WorldWideScience

Sample records for regulatory element located

  1. RESEARCH METHODS OF LOCATIVE ELEMENT

    Directory of Open Access Journals (Sweden)

    SULAYMANOVA N.J.

    2012-01-01

    Full Text Available The article is devoted to the methods of investigation of locative elements. Sentence analysis with locative elements is taken according to the results of component analysis in the system of contradicting – opposition. More over the article is full of examples related to the description of various syntactic units.

  2. HNF-4α regulates expression of human ornithin carbamoyltransferase through interaction with two positive cis-acting regulatory elements located in the proximal promoter.

    Science.gov (United States)

    Lukšan, O; Dvořáková, L; Jirsa, M

    2014-01-01

    OTC encodes ornithine carbamoyltransferase, mitochondrial matrix enzyme involved in the synthesis of urea. The tissue-specific expression of OTC in the liver and intestine is dependent on the interaction of OTC promoter with an upstream enhancer. HNF-4 and C/EBPβ are crucial for this interaction in the rat and mouse. In the present study we focused on characterization of elements involved in the regulation of OTC transcription in human. Using a set of 5'-deleted promoter mutants in a reporter assay we identified two positive cis-acting regulatory elements located at c.-105 and c.-136 within the human OTC promoter. Both are essential for the transcriptional activity of the promoter itself and for the interaction with the enhancer. Protein binding at the corresponding sites was confirmed by DNase I footprinting. Electromobility shift assay with a specific competitor and anti-HNF-4α antibody identified the DNA-protein binding sites as HNF-4α recognition motifs. A third HNF-4α binding site has been found at the position c.-187. All three HNF-4α binding sites are located within 35 bp upstream of the transcription start sites at positions c.-95, c.-119 (major) and c.-169 (minor). A series of C/EBPβ recognition motifs was identified within the enhancer. Involvement of C/EBPβ and HNF-4α in the promoter-enhancer interaction is further supported by a massive DNAprotein interaction observed in the footprinting and EMSA assays. Since the OTC promoter lacks general core promoter elements such as TATA-box or initiators in standard positions, HNF-4α most likely plays an essential role in the initiation of OTC transcription in human.

  3. Prediction of regulatory elements

    DEFF Research Database (Denmark)

    Sandelin, Albin

    2008-01-01

    Finding the regulatory mechanisms responsible for gene expression remains one of the most important challenges for biomedical research. A major focus in cellular biology is to find functional transcription factor binding sites (TFBS) responsible for the regulation of a downstream gene. As wet-lab...

  4. Phylogeny based discovery of regulatory elements

    Directory of Open Access Journals (Sweden)

    Cohen Barak A

    2006-05-01

    Full Text Available Abstract Background Algorithms that locate evolutionarily conserved sequences have become powerful tools for finding functional DNA elements, including transcription factor binding sites; however, most methods do not take advantage of an explicit model for the constrained evolution of functional DNA sequences. Results We developed a probabilistic framework that combines an HKY85 model, which assigns probabilities to different base substitutions between species, and weight matrix models of transcription factor binding sites, which describe the probabilities of observing particular nucleotides at specific positions in the binding site. The method incorporates the phylogenies of the species under consideration and takes into account the position specific variation of transcription factor binding sites. Using our framework we assessed the suitability of alignments of genomic sequences from commonly used species as substrates for comparative genomic approaches to regulatory motif finding. We then applied this technique to Saccharomyces cerevisiae and related species by examining all possible six base pair DNA sequences (hexamers and identifying sequences that are conserved in a significant number of promoters. By combining similar conserved hexamers we reconstructed known cis-regulatory motifs and made predictions of previously unidentified motifs. We tested one prediction experimentally, finding it to be a regulatory element involved in the transcriptional response to glucose. Conclusion The experimental validation of a regulatory element prediction missed by other large-scale motif finding studies demonstrates that our approach is a useful addition to the current suite of tools for finding regulatory motifs.

  5. Blue eye color in humans may be caused by a perfectly associated founder mutation in a regulatory element located within the HERC2 gene inhibiting OCA2 expression

    DEFF Research Database (Denmark)

    Eiberg, Hans; Troelsen, Jesper; Boyd, Mette

    2008-01-01

    The human eye color is a quantitative trait displaying multifactorial inheritance. Several studies have shown that the OCA2 locus is the major contributor to the human eye color variation. By linkage analysis of a large Danish family, we finemapped the blue eye color locus to a 166 Kbp region...... within the HERC2 gene. By association analyses, we identified two SNPs within this region that were perfectly associated with the blue and brown eye colors: rs12913832 and rs1129038. Of these, rs12913832 is located 21.152 bp upstream from the OCA2 promoter in a highly conserved sequence in intron 86...... of HERC2. The brown eye color allele of rs12913832 is highly conserved throughout a number of species. As shown by a Luciferase assays in cell cultures, the element significantly reduces the activity of the OCA2 promoter and electrophoretic mobility shift assays demonstrate that the two alleles bind...

  6. Multivariate Hawkes process models of the occurrence of regulatory elements

    DEFF Research Database (Denmark)

    Carstensen, L; Sandelin, A; Winther, Ole

    2010-01-01

    BACKGROUND: A central question in molecular biology is how transcriptional regulatory elements (TREs) act in combination. Recent high-throughput data provide us with the location of multiple regulatory regions for multiple regulators, and thus with the possibility of analyzing the multivariate di...

  7. A unified architecture of transcriptional regulatory elements

    DEFF Research Database (Denmark)

    Andersson, Robin; Sandelin, Albin Gustav; Danko, Charles G.

    2015-01-01

    Gene expression is precisely controlled in time and space through the integration of signals that act at gene promoters and gene-distal enhancers. Classically, promoters and enhancers are considered separate classes of regulatory elements, often distinguished by histone modifications. However...... and enhancers are considered a single class of functional element, with a unified architecture for transcription initiation. The context of interacting regulatory elements and the surrounding sequences determine local transcriptional output as well as the enhancer and promoter activities of individual elements....

  8. Multivariate Hawkes process models of the occurrence of regulatory elements

    DEFF Research Database (Denmark)

    Carstensen, L; Sandelin, A; Winther, Ole;

    2010-01-01

    BACKGROUND: A central question in molecular biology is how transcriptional regulatory elements (TREs) act in combination. Recent high-throughput data provide us with the location of multiple regulatory regions for multiple regulators, and thus with the possibility of analyzing the multivariate di...... occurrences of multiple TREs along the genome that is capable of providing new insights into dependencies among elements involved in transcriptional regulation. The method is available as an R package from http://www.math.ku.dk/~richard/ppstat/.......BACKGROUND: A central question in molecular biology is how transcriptional regulatory elements (TREs) act in combination. Recent high-throughput data provide us with the location of multiple regulatory regions for multiple regulators, and thus with the possibility of analyzing the multivariate...

  9. Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements).

    Science.gov (United States)

    Giresi, Paul G; Lieb, Jason D

    2009-07-01

    The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also provide protocols for different methods of detecting FAIRE-enriched DNA, including use of PCR, DNA microarrays, and next-generation sequencing. FAIRE works on all eukaryotic chromatin tested to date. To perform FAIRE, chromatin is crosslinked with formaldehyde, sheared by sonication, and phenol-chloroform extracted. Most genomic DNA is crosslinked to nucleosomes and is sequestered to the interphase, whereas DNA recovered in the aqueous phase corresponds to nucleosome-depleted regions of the genome. The isolated regions are largely coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, enhancers, insulators, and active promoters. Given its speed and simplicity, FAIRE has utility in establishing chromatin profiles of diverse cell types in health and disease, isolating DNA regulatory elements en masse for further characterization, and as a screening assay for the effects of small molecules on chromatin organization.

  10. Modular arrangement of regulatory RNA elements

    Science.gov (United States)

    Roßmanith, Johanna; Narberhaus, Franz

    2017-01-01

    ABSTRACT Due to their simple architecture and control mechanism, regulatory RNA modules are attractive building blocks in synthetic biology. This is especially true for riboswitches, which are natural ligand-binding regulators of gene expression. The discovery of various tandem riboswitches inspired the design of combined RNA modules with activities not yet found in nature. Riboswitches were placed in tandem or in combination with a ribozyme or temperature-responsive RNA thermometer resulting in new functionalities. Here, we compare natural examples of tandem riboswitches with recently designed artificial RNA regulators suggesting substantial modularity of regulatory RNA elements. Challenges associated with modular RNA design are discussed. PMID:28010165

  11. Evolutionary conservation of regulatory elements in vertebrate HOX gene clusters

    Energy Technology Data Exchange (ETDEWEB)

    Santini, Simona; Boore, Jeffrey L.; Meyer, Axel

    2003-12-31

    Due to their high degree of conservation, comparisons of DNA sequences among evolutionarily distantly-related genomes permit to identify functional regions in noncoding DNA. Hox genes are optimal candidate sequences for comparative genome analyses, because they are extremely conserved in vertebrates and occur in clusters. We aligned (Pipmaker) the nucleotide sequences of HoxA clusters of tilapia, pufferfish, striped bass, zebrafish, horn shark, human and mouse (over 500 million years of evolutionary distance). We identified several highly conserved intergenic sequences, likely to be important in gene regulation. Only a few of these putative regulatory elements have been previously described as being involved in the regulation of Hox genes, while several others are new elements that might have regulatory functions. The majority of these newly identified putative regulatory elements contain short fragments that are almost completely conserved and are identical to known binding sites for regulatory proteins (Transfac). The conserved intergenic regions located between the most rostrally expressed genes in the developing embryo are longer and better retained through evolution. We document that presumed regulatory sequences are retained differentially in either A or A clusters resulting from a genome duplication in the fish lineage. This observation supports both the hypothesis that the conserved elements are involved in gene regulation and the Duplication-Deletion-Complementation model.

  12. Evolution of anterior Hox regulatory elements among chordates

    Directory of Open Access Journals (Sweden)

    Natale Alfonso

    2011-11-01

    Full Text Available Abstract Background The Hox family of transcription factors has a fundamental role in segmentation pathways and axial patterning of embryonic development and their clustered organization is linked with the regulatory mechanisms governing their coordinated expression along embryonic axes. Among chordates, of particular interest are the Hox paralogous genes in groups 1-4 since their expression is coupled to the control of regional identity in the anterior nervous system, where the highest structural diversity is observed. Results To investigate the degree of conservation in cis-regulatory components that form the basis of Hox expression in the anterior nervous system, we have used assays for transcriptional activity in ascidians and vertebrates to compare and contrast regulatory potential. We identified four regulatory sequences located near the CiHox1, CiHox2 and CiHox4 genes of the ascidian Ciona intestinalis which direct neural specific domains of expression. Using functional assays in Ciona and vertebrate embryos in combination with sequence analyses of enhancer fragments located in similar positions adjacent to Hox paralogy group genes, we compared the activity of these four Ciona cis-elements with a series of neural specific enhancers from the amphioxus Hox1-3 genes and from mouse Hox paralogous groups 1-4. Conclusions This analysis revealed that Kreisler and Krox20 dependent enhancers critical in segmental regulation of the hindbrain appear to be specific for the vertebrate lineage. In contrast, neural enhancers that function as Hox response elements through the action of Hox/Pbx binding motifs have been conserved during chordate evolution. The functional assays reveal that these Hox response cis-elements are recognized by the regulatory components of different and extant species. Together, our results indicate that during chordate evolution, cis-elements dependent upon Hox/Pbx regulatory complexes, are responsible for key aspects of

  13. Isolation of active regulatory elements from eukaryotic chromatin using FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements)

    OpenAIRE

    Giresi, Paul G.; Lieb, Jason D.

    2009-01-01

    The binding of sequence-specific regulatory factors and the recruitment of chromatin remodeling activities cause nucleosomes to be evicted from chromatin in eukaryotic cells. Traditionally, these active sites have been identified experimentally through their sensitivity to nucleases. Here we describe the details of a simple procedure for the genome-wide isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde Assisted Isolation of Regulatory Elements). We also pro...

  14. Identifying Synonymous Regulatory Elements in Vertebrate Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Ovcharenko, I; Nobrega, M A

    2005-02-07

    Synonymous gene regulation, defined as driving shared temporal and/or spatial expression of groups of genes, is likely predicated on genomic elements that contain similar modules of certain transcription factor binding sites (TFBS). We have developed a method to scan vertebrate genomes for evolutionary conserved modules of TFBS in a predefined configuration, and created a tool, named SynoR that identify synonymous regulatory elements (SREs) in vertebrate genomes. SynoR performs de novo identification of SREs utilizing known patterns of TFBS in active regulatory elements (REs) as seeds for genome scans. Layers of multiple-species conservation allow the use of differential phylogenetic sequence conservation filters in the search of SREs and the results are displayed as to provide an extensive annotation of genes containing detected REs. Gene Ontology categories are utilized to further functionally classify the identified genes, and integrated GNF Expression Atlas 2 data allow the cataloging of tissue-specificities of the predicted SREs. We illustrate how this new tool can be used to establish a linkage between human diseases and noncoding genomic content. SynoR is publicly available at http://synor.dcode.org.

  15. RNA regulatory elements and polyadenylation in plants

    Directory of Open Access Journals (Sweden)

    Arthur G. Hunt

    2012-01-01

    Full Text Available Alternative poly(A site choice (also known as alternative polyadenylation, or APA has the potential to affect gene expression in qualitative and quantitative ways. Alternative polyadenylation may affect as many as 82% of all expressed genes in a plant. The consequences of APA include the generation of transcripts with differing 3’-UTRs (and thus differing potential regulatory potential and of transcripts with differing protein-coding potential. Genome-wide studies of possible APA suggest a linkage with pre-mRNA splicing, and indicate a coincidence of and perhaps cooperation between RNA regulatory elements that affect splicing efficiency and the recognition of novel intronic poly(A sites. These studies also raise the possibility of the existence of a novel class of polyadenylation-related cis elements that are distinct from the well-characterized plant polyadenylation signal. Many potential APA events, however, have not been associated with identifiable cis elements. The present state of the field reveals a broad scope of APA, and also numerous opportunities for research into mechanisms that govern both choice and regulation of poly(A sites in plants.

  16. Information capacity of genetic regulatory elements

    Science.gov (United States)

    Tkačik, Gašper; Callan, Curtis G., Jr.; Bialek, William

    2008-07-01

    Changes in a cell’s external or internal conditions are usually reflected in the concentrations of the relevant transcription factors. These proteins in turn modulate the expression levels of the genes under their control and sometimes need to perform nontrivial computations that integrate several inputs and affect multiple genes. At the same time, the activities of the regulated genes would fluctuate even if the inputs were held fixed, as a consequence of the intrinsic noise in the system, and such noise must fundamentally limit the reliability of any genetic computation. Here we use information theory to formalize the notion of information transmission in simple genetic regulatory elements in the presence of physically realistic noise sources. The dependence of this “channel capacity” on noise parameters, cooperativity and cost of making signaling molecules is explored systematically. We find that, in the range of parameters probed by recent in vivo measurements, capacities higher than one bit should be achievable. It is of course generally accepted that gene regulatory elements must, in order to function properly, have a capacity of at least one bit. The central point of our analysis is the demonstration that simple physical models of noisy gene transcription, with realistic parameters, can indeed achieve this capacity: it was not self-evident that this should be so. We also demonstrate that capacities significantly greater than one bit are possible, so that transcriptional regulation need not be limited to simple “on-off” components. The question whether real systems actually exploit this richer possibility is beyond the scope of this investigation.

  17. Discovery of regulatory elements is improved by a discriminatory approach

    DEFF Research Database (Denmark)

    Valen, Eivind; Sandelin, Albin; Winther, Ole;

    2009-01-01

    A major goal in post-genome biology is the complete mapping of the gene regulatory networks for every organism. Identification of regulatory elements is a prerequisite for realizing this ambitious goal. A common problem is finding regulatory patterns in promoters of a group of co-expressed genes...... present a new computational method for identifying transcription factor binding sites in promoters using a discriminatory approach with a large negative set encompassing a significant sample of the promoters from the relevant genome. The sequences are described by a probabilistic model and the most...

  18. Decoding the role of regulatory element polymorphisms in complex disease.

    Science.gov (United States)

    Vockley, Christopher M; Barrera, Alejandro; Reddy, Timothy E

    2017-04-01

    Genetic variation in gene regulatory elements contributes to diverse human diseases, ranging from rare and severe developmental defects to common and complex diseases such as obesity and diabetes. Early examples of regulatory mechanisms of human diseases involve large chromosomal rearrangements that change the regulatory connections within the genome. Single nucleotide variants in regulatory elements can also contribute to disease, potentially via demonstrated associations with changes in transcription factor binding, enhancer activity, post-translational histone modifications, long-range enhancer-promoter interactions, or RNA polymerase recruitment. Establishing causality between non-coding genetic variants, gene regulation, and disease has recently become more feasible with advances in genome-editing and epigenome-editing technologies. As establishing causal regulatory mechanisms of diseases becomes routine, functional annotation of target genes is likely to emerge as a major bottleneck for translation into patient benefits. In this review, we discuss the history and recent advances in understanding the regulatory mechanisms of human disease, and new challenges likely to be encountered once establishing those mechanisms becomes rote. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements.

    Science.gov (United States)

    Schoenfelder, Stefan; Furlan-Magaril, Mayra; Mifsud, Borbala; Tavares-Cadete, Filipe; Sugar, Robert; Javierre, Biola-Maria; Nagano, Takashi; Katsman, Yulia; Sakthidevi, Moorthy; Wingett, Steven W; Dimitrova, Emilia; Dimond, Andrew; Edelman, Lucas B; Elderkin, Sarah; Tabbada, Kristina; Darbo, Elodie; Andrews, Simon; Herman, Bram; Higgs, Andy; LeProust, Emily; Osborne, Cameron S; Mitchell, Jennifer A; Luscombe, Nicholas M; Fraser, Peter

    2015-04-01

    The mammalian genome harbors up to one million regulatory elements often located at great distances from their target genes. Long-range elements control genes through physical contact with promoters and can be recognized by the presence of specific histone modifications and transcription factor binding. Linking regulatory elements to specific promoters genome-wide is currently impeded by the limited resolution of high-throughput chromatin interaction assays. Here we apply a sequence capture approach to enrich Hi-C libraries for >22,000 annotated mouse promoters to identify statistically significant, long-range interactions at restriction fragment resolution, assigning long-range interacting elements to their target genes genome-wide in embryonic stem cells and fetal liver cells. The distal sites contacting active genes are enriched in active histone modifications and transcription factor occupancy, whereas inactive genes contact distal sites with repressive histone marks, demonstrating the regulatory potential of the distal elements identified. Furthermore, we find that coregulated genes cluster nonrandomly in spatial interaction networks correlated with their biological function and expression level. Interestingly, we find the strongest gene clustering in ES cells between transcription factor genes that control key developmental processes in embryogenesis. The results provide the first genome-wide catalog linking gene promoters to their long-range interacting elements and highlight the complex spatial regulatory circuitry controlling mammalian gene expression. © 2015 Schoenfelder et al.; Published by Cold Spring Harbor Laboratory Press.

  20. Identification of germline transcriptional regulatory elements in Aedes aegypti

    Science.gov (United States)

    Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.

    2014-02-01

    The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

  1. Systematic identification and characterization of regulatory elements derived from human endogenous retroviruses.

    Directory of Open Access Journals (Sweden)

    Jumpei Ito

    2017-07-01

    Full Text Available Human endogenous retroviruses (HERVs and other long terminal repeat (LTR-type retrotransposons (HERV/LTRs have regulatory elements that possibly influence the transcription of host genes. We systematically identified and characterized these regulatory elements based on publicly available datasets of ChIP-Seq of 97 transcription factors (TFs provided by ENCODE and Roadmap Epigenomics projects. We determined transcription factor-binding sites (TFBSs using the ChIP-Seq datasets and identified TFBSs observed on HERV/LTR sequences (HERV-TFBSs. Overall, 794,972 HERV-TFBSs were identified. Subsequently, we identified "HERV/LTR-shared regulatory element (HSRE," defined as a TF-binding motif in HERV-TFBSs, shared within a substantial fraction of a HERV/LTR type. HSREs could be an indication that the regulatory elements of HERV/LTRs are present before their insertions. We identified 2,201 HSREs, comprising specific associations of 354 HERV/LTRs and 84 TFs. Clustering analysis showed that HERV/LTRs can be grouped according to the TF binding patterns; HERV/LTR groups bounded to pluripotent TFs (e.g., SOX2, POU5F1, and NANOG, embryonic endoderm/mesendoderm TFs (e.g., GATA4/6, SOX17, and FOXA1/2, hematopoietic TFs (e.g., SPI1 (PU1, GATA1/2, and TAL1, and CTCF were identified. Regulatory elements of HERV/LTRs tended to locate nearby and/or interact three-dimensionally with the genes involved in immune responses, indicating that the regulatory elements play an important role in controlling the immune regulatory network. Further, we demonstrated subgroup-specific TF binding within LTR7, LTR5B, and LTR5_Hs, indicating that gains or losses of the regulatory elements occurred during genomic invasions of the HERV/LTRs. Finally, we constructed dbHERV-REs, an interactive database of HERV/LTR regulatory elements (http://herv-tfbs.com/. This study provides fundamental information in understanding the impact of HERV/LTRs on host transcription, and offers insights into

  2. Close Sequence Comparisons are Sufficient to Identify Humancis-Regulatory Elements

    Energy Technology Data Exchange (ETDEWEB)

    Prabhakar, Shyam; Poulin, Francis; Shoukry, Malak; Afzal, Veena; Rubin, Edward M.; Couronne, Olivier; Pennacchio, Len A.

    2005-12-01

    Cross-species DNA sequence comparison is the primary method used to identify functional noncoding elements in human and other large genomes. However, little is known about the relative merits of evolutionarily close and distant sequence comparisons, due to the lack of a universal metric for sequence conservation, and also the paucity of empirically defined benchmark sets of cis-regulatory elements. To address this problem, we developed a general-purpose algorithm (Gumby) that detects slowly-evolving regions in primate, mammalian and more distant comparisons without requiring adjustment of parameters, and ranks conserved elements by P-value using Karlin-Altschul statistics. We benchmarked Gumby predictions against previously identified cis-regulatory elements at diverse genomic loci, and also tested numerous extremely conserved human-rodent sequences for transcriptional enhancer activity using reporter-gene assays in transgenic mice. Human regulatory elements were identified with acceptable sensitivity and specificity by comparison with 1-5 other eutherian mammals or 6 other simian primates. More distant comparisons (marsupial, avian, amphibian and fish) failed to identify many of the empirically defined functional noncoding elements. We derived an intuitive relationship between ancient and recent noncoding sequence conservation from whole genome comparative analysis, which explains some of these findings. Lastly, we determined that, in addition to strength of conservation, genomic location and/or density of surrounding conserved elements must also be considered in selecting candidate enhancers for testing at embryonic time points.

  3. An evaluation of root ZX and elements diagnostic apex locators.

    Science.gov (United States)

    Tselnik, Marat; Baumgartner, J Craig; Marshall, J Gordon

    2005-07-01

    The purpose of this study was to compare the accuracy of the Root ZX and Elements Diagnostic electronic apex locators under clinical conditions. Thirty-six teeth planned for extraction were used. Each tooth was decoronated, coronally flared with Orifice Shapers, and irrigated with 2.6% sodium hypochlorite. Working lengths were measured with K-files using both electronic apex locators. The files were cemented at the last measured working length and the teeth were extracted. The apical 4-mm of each canal were exposed and photographed under 15x and 30x magnification. Images of each apex were projected and the distance from the file tip to the minor diameter was determined. The mean distances from the file tip to the minor diameter were 0.346 mm for the Elements Diagnostic and 0.410-mm for the Root ZX beyond the minor constriction. In locating the minor constriction the Root ZX was accurate 75% of the time to +/-0.5 mm, 83.3% +/-0.75 mm, and 88.9% to +/-1 mm. The Elements Diagnostic was accurate 75% of the time to +/-0.5 mm, 88.9% to +/-0.75 mm, and 91.7% to +/-1 mm. There was no statistically significant difference between the accuracy of the two electronic apex locators in locating the minor diameter (p < 0.05).

  4. Regulatory element-based prediction identifies new susceptibility regulatory variants for osteoporosis.

    Science.gov (United States)

    Yao, Shi; Guo, Yan; Dong, Shan-Shan; Hao, Ruo-Han; Chen, Xiao-Feng; Chen, Yi-Xiao; Chen, Jia-Bin; Tian, Qing; Deng, Hong-Wen; Yang, Tie-Lin

    2017-08-01

    Despite genome-wide association studies (GWASs) have identified many susceptibility genes for osteoporosis, it still leaves a large part of missing heritability to be discovered. Integrating regulatory information and GWASs could offer new insights into the biological link between the susceptibility SNPs and osteoporosis. We generated five machine learning classifiers with osteoporosis-associated variants and regulatory features data. We gained the optimal classifier and predicted genome-wide SNPs to discover susceptibility regulatory variants. We further utilized Genetic Factors for Osteoporosis Consortium (GEFOS) and three in-house GWASs samples to validate the associations for predicted positive SNPs. The random forest classifier performed best among all machine learning methods with the F1 score of 0.8871. Using the optimized model, we predicted 37,584 candidate SNPs for osteoporosis. According to the meta-analysis results, a list of regulatory variants was significantly associated with osteoporosis after multiple testing corrections and contributed to the expression of known osteoporosis-associated protein-coding genes. In summary, combining GWASs and regulatory elements through machine learning could provide additional information for understanding the mechanism of osteoporosis. The regulatory variants we predicted will provide novel targets for etiology research and treatment of osteoporosis.

  5. BRCA1 Exon 11, a CERES (Composite Regulatory Element of Splicing Element Involved in Splice Regulation

    Directory of Open Access Journals (Sweden)

    Claudia Tammaro

    2014-07-01

    Full Text Available Unclassified variants (UV of BRCA1 can affect normal pre-mRNA splicing. Here, we investigate the UV c.693G>A, a “silent” change in BRCA1 exon 11, which we have found induces aberrant splicing in patient carriers and in vitro. Using a minigene assay, we show that the UV c.693G>A has a strong effect on the splicing isoform ratio of BRCA1. Systematic site-directed mutagenesis of the area surrounding the nucleotide position c.693G>A induced variable changes in the level of exon 11 inclusion/exclusion in the mRNA, pointing to the presence of a complex regulatory element with overlapping enhancer and silencer functions. Accordingly, protein binding analysis in the region detected several splicing regulatory factors involved, including SRSF1, SRSF6 and SRSF9, suggesting that this sequence represents a composite regulatory element of splicing (CERES.

  6. Regulatory elements of the floral homeotic gene AGAMOUS identified by phylogenetic footprinting and shadowing.

    Energy Technology Data Exchange (ETDEWEB)

    Hong, R. L., Hamaguchi, L., Busch, M. A., and Weigel, D.

    2003-06-01

    OAK-B135 In Arabidopsis thaliana, cis-regulatory sequences of the floral homeotic gene AGAMOUS (AG) are located in the second intron. This 3 kb intron contains binding sites for two direct activators of AG, LEAFY (LFY) and WUSCHEL (WUS), along with other putative regulatory elements. We have used phylogenetic footprinting and the related technique of phylogenetic shadowing to identify putative cis-regulatory elements in this intron. Among 29 Brassicaceae, several other motifs, but not the LFY and WUS binding sites previously identified, are largely invariant. Using reporter gene analyses, we tested six of these motifs and found that they are all functionally important for activity of AG regulatory sequences in A. thaliana. Although there is little obvious sequence similarity outside the Brassicaceae, the intron from cucumber AG has at least partial activity in A. thaliana. Our studies underscore the value of the comparative approach as a tool that complements gene-by-gene promoter dissection, but also highlight that sequence-based studies alone are insufficient for a complete identification of cis-regulatory sites.

  7. Discovery and analysis of evolutionarily conserved intronic splicing regulatory elements.

    Directory of Open Access Journals (Sweden)

    Gene W Yeo

    2007-05-01

    Full Text Available Knowledge of the functional cis-regulatory elements that regulate constitutive and alternative pre-mRNA splicing is fundamental for biology and medicine. Here we undertook a genome-wide comparative genomics approach using available mammalian genomes to identify conserved intronic splicing regulatory elements (ISREs. Our approach yielded 314 ISREs, and insertions of ~70 ISREs between competing splice sites demonstrated that 84% of ISREs altered 5' and 94% altered 3' splice site choice in human cells. Consistent with our experiments, comparisons of ISREs to known splicing regulatory elements revealed that 40%-45% of ISREs might have dual roles as exonic splicing silencers. Supporting a role for ISREs in alternative splicing, we found that 30%-50% of ISREs were enriched near alternatively spliced (AS exons, and included almost all known binding sites of tissue-specific alternative splicing factors. Further, we observed that genes harboring ISRE-proximal exons have biases for tissue expression and molecular functions that are ISRE-specific. Finally, we discovered that for Nova1, neuronal PTB, hnRNP C, and FOX1, the most frequently occurring ISRE proximal to an alternative conserved exon in the splicing factor strongly resembled its own known RNA binding site, suggesting a novel application of ISRE density and the propensity for splicing factors to auto-regulate to associate RNA binding sites to splicing factors. Our results demonstrate that ISREs are crucial building blocks in understanding general and tissue-specific AS regulation and the biological pathways and functions regulated by these AS events.

  8. Insulators and Boundaries: Versatile Regulatory Elements in the Eukaryotic Genome

    Science.gov (United States)

    Bell, Adam C.; West, Adam G.; Felsenfeld, Gary

    2001-01-01

    Insulators mark the boundaries of chromatin domains by limiting the range of action of enhancers and silencers. Although the properties of insulators have been well studied, their role in vivo has largely been a subject of speculation. Recent results make it possible to ascribe specific and essential functions to the insulators of Drosophila, yeast, and vertebrates. In some cases, insulator activity can be modulated by nearby regulatory elements, bound cofactors, or covalent modification of the DNA. Not simply passive barriers, insulators are active participants in eukaryotic gene regulation.

  9. 47 CFR 1.1155 - Schedule of regulatory fees and filing locations for cable television services.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Schedule of regulatory fees and filing locations for cable television services. 1.1155 Section 1.1155 Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL PRACTICE AND PROCEDURE Schedule of Statutory Charges and Procedures for Payment § 1.1155 Schedule of regulatory fees and filing...

  10. Idefix insulator activity can be modulated by nearby regulatory elements.

    Science.gov (United States)

    Brasset, E; Bantignies, F; Court, F; Cheresiz, S; Conte, C; Vaury, C

    2007-01-01

    Insulators play important roles in controlling gene activity and maintaining regulatory independence between neighbouring genes. In this article, we show that the enhancer-blocking activity of the insulator present within the LTR retrotransposon Idefix can be abolished if two copies of the region containing the insulator--specifically, the long terminal repeat (LTR)--are fused to the retrotransposon's 5' untranslated region (5' UTR). The presence of this combination of two [LTR-5' UTR] modules is a prerequisite for the loss of enhancer-blocking activity. We further show that the 5' UTR causes flanking genomic sequences to be displaced to the nuclear periphery, which is not observed when two insulators are present by themselves. This study thus provides a functional link between insulators and independent genomic modules, which may cooperate to allow the specific regulation of defined genomic loci via nuclear repositioning. It further illustrates the complexity of genomic regulation within a chromatic environment with multiple functional elements.

  11. Identification of conserved regulatory elements by comparative genome analysis

    Directory of Open Access Journals (Sweden)

    Jareborg Niclas

    2003-05-01

    Full Text Available Abstract Background For genes that have been successfully delineated within the human genome sequence, most regulatory sequences remain to be elucidated. The annotation and interpretation process requires additional data resources and significant improvements in computational methods for the detection of regulatory regions. One approach of growing popularity is based on the preferential conservation of functional sequences over the course of evolution by selective pressure, termed 'phylogenetic footprinting'. Mutations are more likely to be disruptive if they appear in functional sites, resulting in a measurable difference in evolution rates between functional and non-functional genomic segments. Results We have devised a flexible suite of methods for the identification and visualization of conserved transcription-factor-binding sites. The system reports those putative transcription-factor-binding sites that are both situated in conserved regions and located as pairs of sites in equivalent positions in alignments between two orthologous sequences. An underlying collection of metazoan transcription-factor-binding profiles was assembled to facilitate the study. This approach results in a significant improvement in the detection of transcription-factor-binding sites because of an increased signal-to-noise ratio, as demonstrated with two sets of promoter sequences. The method is implemented as a graphical web application, ConSite, which is at the disposal of the scientific community at http://www.phylofoot.org/. Conclusions Phylogenetic footprinting dramatically improves the predictive selectivity of bioinformatic approaches to the analysis of promoter sequences. ConSite delivers unparalleled performance using a novel database of high-quality binding models for metazoan transcription factors. With a dynamic interface, this bioinformatics tool provides broad access to promoter analysis with phylogenetic footprinting.

  12. Rearrangement of Upstream Regulatory Elements Leads to Ectopic Expression of the Drosophila Mulleri Adh-2 Gene

    Science.gov (United States)

    Falb, D.; Fischer, J.; Maniatis, T.

    1992-01-01

    The Adh-2 gene of Drosophila mulleri is expressed in the larval fat body and the adult fat body and hindgut, and a 1500-bp element located 2-3 kb upstream of the Adh-2 promoter is necessary for maximal levels of transcription. Previous work demonstrated that deletion of sequences between this upstream element and the Adh-2 promoter results in Adh-2 gene expression in a novel larval tissue, the middle midgut. In this study we show that the upstream element possesses all of the characteristics of a transcriptional enhancer: its activity is independent of orientation, it acts on a heterologous promoter, and it functions at various positions both 5' and 3' to the Adh-2 gene. Full enhancer function can be localized to a 750-bp element, although other regions possess some redundant activity. The ectopic expression pattern is dependent on the proximity of at least two sequence elements. Thus, tissue-specific transcription can involve complex proximity-dependent interactions among combinations of regulatory elements. PMID:1459428

  13. Maintaining cholesterol homeostasis:Sterol regulatory element-binding proteins

    Institute of Scientific and Technical Information of China (English)

    Lutz W. Weber; Meinrad Boll; Andreas Stampfl

    2004-01-01

    The molecular mechanism of how hepatocytes maintain cholesterol homeostasis has become much more transparent with the discovery of sterol regulatory element binding proteins (SREBPs) in recent years. These membrane proteins are members of the basic helix-loop-helix-leucine zipper (bHLHZip) family of transcription factors. They activate the expression of at least 30 genes involved in the synthesis of cholesterol and lipids. SREBPs are synthesized as precursor proteins in the endoplasmic reticulum (ER), where they form a complex with another protein, SREBP cleavage activating protein (SCAP).The SCAP molecule contains a sterol sensory domain. In the presence of high cellular sterol concentrations SCAP confines SREBP to the ER. With low cellular concentrations, SCAP escorts SREBP to activation in the Golgi. There, SREBP undergoes two proteolytic cleavage steps to release the mature, biologically active transcription factor, nuclear SREBP (nSREBP). nSREBP translocates to the nucleus and binds to sterol response elements (SRE) in the promoter/enhancer regions of target genes. Additional transcription factors are required to activate transcription of these genes. Three different SREBPs are known, SREBPs-1a, -1c and -2. SREBP-1a and -1c are isoforms produced from a single gene by alternate splicing. SREBP-2is encoded by a different gene and does not display any isoforms. It appears that SREBPs alone, in the sequence described above, can exert complete control over cholesterol synthesis, whereas many additional factors (hormones,cytokines, etc.) are required for complete control of lipid metabolism. Medicinal manipulation of the SREBP/SCAP system is expected to prove highly beneficial in the management of cholesterol-related disease.

  14. Human immunodeficiency virus type 2 long terminal repeat: analysis of regulatory elements.

    OpenAIRE

    Arya, S. K.; Gallo, R C

    1988-01-01

    The long terminal repeats (LTRs) of the human immunodeficiency virus type 2 (HIV-2) and a related simian immunodeficiency virus (SIVmac) contain cis-acting positive regulatory elements upstream and the major transactivator gene (tat) response element and a possible negative regulatory element downstream of the transcriptional initiation site. The tat response element of HIV-2 and of SIVmac was more complex than that of HIV-1. Two structurally similar subelements within the HIV-2 tat response ...

  15. Changes in Cis-regulatory Elements during Morphological Evolution

    Directory of Open Access Journals (Sweden)

    Yu-Lee Paul

    2012-10-01

    Full Text Available How have animals evolved new body designs (morphological evolution? This requires explanations both for simple morphological changes, such as differences in pigmentation and hair patterns between different Drosophila populations and species, and also for more complex changes, such as differences in the forelimbs of mice and bats, and the necks of amphibians and reptiles. The genetic changes and pathways involved in these evolutionary steps require identification. Many, though not all, of these events occur by changes in cis-regulatory (enhancer elements within developmental genes. Enhancers are modular, each affecting expression in only one or a few tissues. Therefore it is possible to add, remove or alter an enhancer without producing changes in multiple tissues, and thereby avoid widespread (pleiotropic deleterious effects. Ideally, for a given step in morphological evolution it is necessary to identify (i the change in phenotype, (ii the changes in gene expression, (iii the DNA region, enhancer or otherwise, affected, (iv the mutation involved, (v the nature of the transcription or other factors that bind to this site. In practice these data are incomplete for most of the published studies upon morphological evolution. Here, the investigations are categorized according to how far these analyses have proceeded.

  16. Identification of the Human Zinc Transcriptional Regulatory Element (ZTRE)

    Science.gov (United States)

    Coneyworth, Lisa J.; Jackson, Kelly A.; Tyson, John; Bosomworth, Helen J.; van der Hagen, Eline; Hann, Georgia M.; Ogo, Ogo A.; Swann, Daniel C.; Mathers, John C.; Valentine, Ruth A.; Ford, Dianne

    2012-01-01

    Many genes with crucial roles in zinc homeostasis in mammals respond to fluctuating zinc supply through unknown mechanisms, and uncovering these mechanisms is essential to understanding the process at cellular and systemic levels. We detected zinc-dependent binding of a zinc-induced protein to a specific sequence, the zinc transcriptional regulatory element (ZTRE), in the SLC30A5 (zinc transporter ZnT5) promoter and showed that substitution of the ZTRE abrogated the repression of a reporter gene in response to zinc. We identified the ZTRE in other genes, including (through an unbiased search) the CBWD genes and (through targeted analysis) in multiple members of the SLC30 family, including SLC30A10, which is repressed by zinc. The function of the CBWD genes is currently unknown, but roles for homologs in metal homeostasis are being uncovered in bacteria. We demonstrated that CBWD genes are repressed by zinc and that substitution of the ZTRE in SLC30A10 and CBWD promoter-reporter constructs abrogates this response. Other metals did not affect expression of the transcriptional regulator, binding to the ZTRE or promoter-driven reporter gene expression. These findings provide the basis for elucidating how regulation of a network of genes through this novel mechanism contributes to zinc homeostasis and how the cell orchestrates this response. PMID:22902622

  17. Analysis of long-range interactions in primary human cells identifies cooperative CFTR regulatory elements.

    Science.gov (United States)

    Moisan, Stéphanie; Berlivet, Soizik; Ka, Chandran; Le Gac, Gérald; Dostie, Josée; Férec, Claude

    2016-04-07

    A mechanism by which control DNA elements regulate transcription over large linear genomic distances is by achieving close physical proximity with genes, and looping of the intervening chromatin paths. Alterations of such regulatory 'chromatin looping' systems are likely to play a critical role in human genetic disease at large. Here, we studied the spatial organization of a ≈790 kb locus encompassing the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Dysregulation of CFTR is responsible for cystic fibrosis, which is the most common lethal genetic disorder in Caucasian populations. CFTR is a relatively large gene of 189 kb with a rather complex tissue-specific and temporal expression profile. We used chromatin conformation at the CFTR locus to identify new DNA sequences that regulate its transcription. By comparing 5C chromatin interaction maps of the CFTR locus in expressing and non-expressing human primary cells, we identified several new contact points between the CFTR promoter and its surroundings, in addition to regions featuring previously described regulatory elements. We demonstrate that two of these novel interacting regions cooperatively increase CFTR expression, and suggest that the new enhancer elements located on either side of the gene are brought together through chromatin looping via CTCF.

  18. Regulatory elements of Caenorhabditis elegans ribosomal protein genes

    Directory of Open Access Journals (Sweden)

    Sleumer Monica C

    2012-08-01

    Full Text Available Abstract Background Ribosomal protein genes (RPGs are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from

  19. Regulatory elements and transcriptional control of chicken vasa homologue (CVH) promoter in chicken primordial germ cells.

    Science.gov (United States)

    Jin, So Dam; Lee, Bo Ram; Hwang, Young Sun; Lee, Hong Jo; Rim, Jong Seop; Han, Jae Yong

    2017-01-01

    Primordial germ cells (PGCs), the precursors of functional gametes, have distinct characteristics and exhibit several unique molecular mechanisms to maintain pluripotency and germness in comparison to somatic cells. They express germ cell-specific RNA binding proteins (RBPs) by modulating tissue-specific cis- and trans-regulatory elements. Studies on gene structures of chicken vasa homologue (CVH), a chicken RNA binding protein, involved in temporal and spatial regulation are thus important not only for understanding the molecular mechanisms that regulate germ cell fate, but also for practical applications of primordial germ cells. However, very limited studies are available on regulatory elements that control germ cell-specific expression in chicken. Therefore, we investigated the intricate regulatory mechanism(s) that governs transcriptional control of CVH. We constructed green fluorescence protein (GFP) or luciferase reporter vectors containing the various 5' flanking regions of CVH gene. From the 5' deletion and fragmented assays in chicken PGCs, we have identified a CVH promoter that locates at -316 to +275 base pair fragment with the highest luciferase activity. Additionally, we confirmed for the first time that the 5' untranslated region (UTR) containing intron 1 is required for promoter activity of the CVH gene in chicken PGCs. Furthermore, using a transcription factor binding prediction, transcriptome analysis and siRNA-mediated knockdown, we have identified that a set of transcription factors play a role in the PGC-specific CVH gene expression. These results demonstrate that cis-elements and transcription factors localizing in the 5' flanking region including the 5' UTR and an intron are important for transcriptional regulation of the CVH gene in chicken PGCs. Finally, this information will contribute to research studies in areas of reproductive biology, constructing of germ cell-specific synthetic promoter for tracing primordial germ cells as well as

  20. Genome-wide discovery of drug-dependent human liver regulatory elements.

    Directory of Open Access Journals (Sweden)

    Robin P Smith

    2014-10-01

    Full Text Available Inter-individual variation in gene regulatory elements is hypothesized to play a causative role in adverse drug reactions and reduced drug activity. However, relatively little is known about the location and function of drug-dependent elements. To uncover drug-associated elements in a genome-wide manner, we performed RNA-seq and ChIP-seq using antibodies against the pregnane X receptor (PXR and three active regulatory marks (p300, H3K4me1, H3K27ac on primary human hepatocytes treated with rifampin or vehicle control. Rifampin and PXR were chosen since they are part of the CYP3A4 pathway, which is known to account for the metabolism of more than 50% of all prescribed drugs. We selected 227 proximal promoters for genes with rifampin-dependent expression or nearby PXR/p300 occupancy sites and assayed their ability to induce luciferase in rifampin-treated HepG2 cells, finding only 10 (4.4% that exhibited drug-dependent activity. As this result suggested a role for distal enhancer modules, we searched more broadly to identify 1,297 genomic regions bearing a conditional PXR occupancy as well as all three active regulatory marks. These regions are enriched near genes that function in the metabolism of xenobiotics, specifically members of the cytochrome P450 family. We performed enhancer assays in rifampin-treated HepG2 cells for 42 of these sequences as well as 7 sequences that overlap linkage-disequilibrium blocks defined by lead SNPs from pharmacogenomic GWAS studies, revealing 15/42 and 4/7 to be functional enhancers, respectively. A common African haplotype in one of these enhancers in the GSTA locus was found to exhibit potential rifampin hypersensitivity. Combined, our results further suggest that enhancers are the predominant targets of rifampin-induced PXR activation, provide a genome-wide catalog of PXR targets and serve as a model for the identification of drug-responsive regulatory elements.

  1. From elements to modules: regulatory evolution in Ascomycota fungi

    OpenAIRE

    Wohlbach, Dana J.; Thompson, Dawn Anne; Audrey P Gasch; Regev, Aviv

    2009-01-01

    Regulatory divergence is likely a major driving force in evolution. Comparative transcriptomics provides a new glimpse into the evolution of gene regulation. Ascomycota fungi are uniquely suited among eukaryotes for studies of regulatory evolution, because of broad phylogenetic scope, many sequenced genomes, and facility of genomic analysis. Here we review the substantial divergence in gene expression in Ascomycota and how this is reconciled with the modular organization of transcriptional ne...

  2. Depth locating of elements by the PIXE technique

    Science.gov (United States)

    Lagarde, Gérard; Midy, Pierre; Brissaud, Ivan

    1997-11-01

    We propose here a method to estimate whether two kinds of elements of different atomic numbers are at the same depth in a sample. A PIXE experiment provides the number of X-rays emitted from these elements when hit by a proton beam at two close lying energies. The variation of these numbers versus energy allows one to deduce the desired information on these depths after correcting the effects of atomic numbers. A few examples of applications are presented in order to demonstrate the sensitivity of this procedure.

  3. 47 CFR 1.1153 - Schedule of annual regulatory fees and filing locations for mass media services.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false Schedule of annual regulatory fees and filing locations for mass media services. 1.1153 Section 1.1153 Telecommunication FEDERAL COMMUNICATIONS COMMISSION... of annual regulatory fees and filing locations for mass media services. Radio (47 CFR, Part 73) Fee...

  4. Correlating overrepresented upstream motifs to gene expression a computational approach to regulatory element discovery in eukaryotes

    CERN Document Server

    Caselle, M; Provero, P

    2002-01-01

    Gene regulation in eukaryotes is mainly effected through transcription factors binding to rather short recognition motifs generally located upstream of the coding region. We present a novel computational method to identify regulatory elements in the upstream region of eukaryotic genes. The genes are grouped in sets sharing an overrepresented short motif in their upstream sequence. For each set, the average expression level from a microarray experiment is determined: If this level is significantly higher or lower than the average taken over the whole genome, then the overerpresented motif shared by the genes in the set is likely to play a role in their regulation. The method was tested by applying it to the genome of Saccharomyces cerevisiae, using the publicly available results of a DNA microarray experiment, in which expression levels for virtually all the genes were measured during the diauxic shift from fermentation to respiration. Several known motifs were correctly identified, and a new candidate regulat...

  5. Structural characterization and regulatory element analysis of the heart isoform of cytochrome c oxidase VIa

    Science.gov (United States)

    Wan, B.; Moreadith, R. W.; Blomqvist, C. G. (Principal Investigator)

    1995-01-01

    In order to investigate the mechanism(s) governing the striated muscle-specific expression of cytochrome c oxidase VIaH we have characterized the murine gene and analyzed its transcriptional regulatory elements in skeletal myogenic cell lines. The gene is single copy, spans 689 base pairs (bp), and is comprised of three exons. The 5'-ends of transcripts from the gene are heterogeneous, but the most abundant transcript includes a 5'-untranslated region of 30 nucleotides. When fused to the luciferase reporter gene, the 3.5-kilobase 5'-flanking region of the gene directed the expression of the heterologous protein selectively in differentiated Sol8 cells and transgenic mice, recapitulating the pattern of expression of the endogenous gene. Deletion analysis identified a 300-bp fragment sufficient to direct the myotube-specific expression of luciferase in Sol8 cells. The region lacks an apparent TATA element, and sequence motifs predicted to bind NRF-1, NRF-2, ox-box, or PPAR factors known to regulate other nuclear genes encoding mitochondrial proteins are not evident. Mutational analysis, however, identified two cis-elements necessary for the high level expression of the reporter protein: a MEF2 consensus element at -90 to -81 bp and an E-box element at -147 to -142 bp. Additional E-box motifs at closely located positions were mutated without loss of transcriptional activity. The dependence of transcriptional activation of cytochrome c oxidase VIaH on cis-elements similar to those found in contractile protein genes suggests that the striated muscle-specific expression is coregulated by mechanisms that control the lineage-specific expression of several contractile and cytosolic proteins.

  6. Differential regulation of native estrogen receptor-regulatory elements by estradiol, tamoxifen, and raloxifene.

    Science.gov (United States)

    Levy, Nitzan; Tatomer, Dierdre; Herber, Candice B; Zhao, Xiaoyue; Tang, Hui; Sargeant, Toby; Ball, Lonnele J; Summers, Jonathan; Speed, Terence P; Leitman, Dale C

    2008-02-01

    Estrogen receptors (ERs) regulate gene transcription by interacting with regulatory elements. Most information regarding how ER activates genes has come from studies using a small set of target genes or simple consensus sequences such as estrogen response element, activator protein 1, and Sp1 elements. However, these elements cannot explain the differences in gene regulation patterns and clinical effects observed with estradiol (E(2)) and selective estrogen receptor modulators. To obtain a greater understanding of how E(2) and selective estrogen receptor modulators differentially regulate genes, it is necessary to investigate their action on a more comprehensive set of native regulatory elements derived from ER target genes. Here we used chromatin immunoprecipitation-cloning and sequencing to isolate 173 regulatory elements associated with ERalpha. Most elements were found in the introns (38%) and regions greater than 10 kb upstream of the transcription initiation site (38%); 24% of the elements were found in the proximal promoter region (tamoxifen with ERalpha or ERbeta. Tamoxifen was more effective than raloxifene at activating the elements with ERalpha, whereas raloxifene was superior with ERbeta. Our findings demonstrate that E(2), tamoxifen, and raloxifene differentially regulate native ER-regulatory elements isolated by chromatin immunoprecipitation with ERalpha and ERbeta.

  7. Identification of Regulatory Mutations in SERPINC1 Affecting Vitamin D Response Elements Associated with Antithrombin Deficiency

    Science.gov (United States)

    Toderici, Mara; de la Morena-Barrio, María Eugenia; Padilla, José; Miñano, Antonia; Antón, Ana Isabel; Iniesta, Juan Antonio; Herranz, María Teresa; Fernández, Nuria; Vicente, Vicente; Corral, Javier

    2016-01-01

    Antithrombin is a crucial anticoagulant serpin whose even moderate deficiency significantly increases the risk of thrombosis. Most cases with antithrombin deficiency carried genetic defects affecting exons or flanking regions of SERPINC1.We aimed to identify regulatory mutations inSERPINC1 through sequencing the promoter, intron 1 and 2 of this gene in 23 patients with antithrombin deficiency but without known genetic defects. Three cases with moderate antithrombin deficiency (63–78%) carried potential regulatory mutations. One located 200 bp before the initiation ATG and two in intron 1. These mutations disrupted two out of five potential vitamin D receptor elements (VDRE) identified in SERPINC1 with different software. One genetic defect, c.42-1060_-1057dupTTGA, was a new low prevalent polymorphism (MAF: 0.01) with functional consequences on plasma antithrombin levels. The relevance of the vitamin D pathway on the regulation of SERPINC1 was confirmed in a cell model. Incubation of HepG2 with paricalcitol, a vitamin D analog, increased dose-dependently the levels of SERPINC1transcripts and antithrombin released to the conditioned medium. This study shows further evidence of the transcriptional regulation of SERPINC1 by vitamin D and first describes the functional and pathological relevance of mutations affecting VDRE of this gene. Our study opens new perspectives in the search of new genetic defects involved in antithrombin deficiency and the risk of thrombosis as well as in the design of new antithrombotic treatments. PMID:27003919

  8. MicroRNAs as regulatory elements in psoriasis

    Directory of Open Access Journals (Sweden)

    Liu Yuan

    2016-01-01

    Full Text Available Psoriasis is a chronic, autoimmune, and complex genetic disorder that affects 23% of the European population. The symptoms of Psoriatic skin are inflammation, raised and scaly lesions. microRNA, which is short, nonprotein-coding, regulatory RNAs, plays critical roles in psoriasis. microRNA participates in nearly all biological processes, such as cell differentiation, development and metabolism. Recent researches reveal that multitudinous novel microRNAs have been identified in skin. Some of these substantial novel microRNAs play as a class of posttranscriptional gene regulator in skin disease, such as psoriasis. In order to insight into microRNAs biological functions and verify microRNAs biomarker, we review diverse references about characterization, profiling and subtype of microRNAs. Here we will share our opinions about how and which microRNAs are as regulatory in psoriasis.

  9. Idefix insulator activity can be modulated by nearby regulatory elements

    OpenAIRE

    Brasset, E; Bantignies, F.; Court, F. (Franck); Cheresiz, S.; C. Conte; Vaury, C.

    2007-01-01

    Insulators play important roles in controlling gene activity and maintaining regulatory independence between neighbouring genes. In this article, we show that the enhancer-blocking activity of the insulator present within the LTR retrotransposon Idefix can be abolished if two copies of the region containing the insulator—specifically, the long terminal repeat (LTR)—are fused to the retrotransposon's 5′ untranslated region (5′ UTR). The presence of this combination of two [LTR-5′ UTR] modules ...

  10. Cis-regulatory elements: molecular mechanisms and evolutionary processes underlying divergence.

    Science.gov (United States)

    Wittkopp, Patricia J; Kalay, Gizem

    2011-12-06

    Cis-regulatory sequences, such as enhancers and promoters, control development and physiology by regulating gene expression. Mutations that affect the function of these sequences contribute to phenotypic diversity within and between species. With many case studies implicating divergent cis-regulatory activity in phenotypic evolution, researchers have recently begun to elucidate the genetic and molecular mechanisms that are responsible for cis-regulatory divergence. Approaches include detailed functional analysis of individual cis-regulatory elements and comparing mechanisms of gene regulation among species using the latest genomic tools. Despite the limited number of mechanistic studies published to date, this work shows how cis-regulatory activity can diverge and how studies of cis-regulatory divergence can address long-standing questions about the genetic mechanisms of phenotypic evolution.

  11. FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events.

    Science.gov (United States)

    Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J P; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok

    2015-01-01

    Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain-domain interactions, protein-protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist's mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop 'novel' therapeutic approaches. Database URL: http://ppi.bioinfo.asia.edu.tw/FARE-CAFE.

  12. Comparative analysis of regulatory elements in different germin-like ...

    African Journals Online (AJOL)

    STORAGESEVER

    Earlier, two GLP promoter regions have been amplified, ... was done using web based program PLACE/Signal Scan ... including two promoters from rice reported by our group. (Mahmood et al. .... al., 2004). The TTGAC/TTGACC element, component of .... implicated in His-Asp phosphorelay signal transduction. Plant Cell.

  13. A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.

    Science.gov (United States)

    Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo

    2016-05-01

    Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study.

  14. Dynamic SPR monitoring of yeast nuclear protein binding to a cis-regulatory element.

    Science.gov (United States)

    Mao, Grace; Brody, James P

    2007-11-09

    Gene expression is controlled by protein complexes binding to short specific sequences of DNA, called cis-regulatory elements. Expression of most eukaryotic genes is controlled by dozens of these elements. Comprehensive identification and monitoring of these elements is a major goal of genomics. In pursuit of this goal, we are developing a surface plasmon resonance (SPR) based assay to identify and monitor cis-regulatory elements. To test whether we could reliably monitor protein binding to a regulatory element, we immobilized a 16bp region of Saccharomyces cerevisiae chromosome 5 onto a gold surface. This 16bp region of DNA is known to bind several proteins and thought to control expression of the gene RNR1, which varies through the cell cycle. We synchronized yeast cell cultures, and then sampled these cultures at a regular interval. These samples were processed to purify nuclear lysate, which was then exposed to the sensor. We found that nuclear protein binds this particular element of DNA at a significantly higher rate (as compared to unsynchronized cells) during G1 phase. Other time points show levels of DNA-nuclear protein binding similar to the unsynchronized control. We also measured the apparent association complex of the binding to be 0.014s(-1). We conclude that (1) SPR-based assays can monitor DNA-nuclear protein binding and that (2) for this particular cis-regulatory element, maximum DNA-nuclear protein binding occurs during G1 phase.

  15. Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data

    Directory of Open Access Journals (Sweden)

    Yamaguchi-Shinozaki Kazuko

    2011-02-01

    Full Text Available Abstract Background Phytohormones organize plant development and environmental adaptation through cell-to-cell signal transduction, and their action involves transcriptional activation. Recent international efforts to establish and maintain public databases of Arabidopsis microarray data have enabled the utilization of this data in the analysis of various phytohormone responses, providing genome-wide identification of promoters targeted by phytohormones. Results We utilized such microarray data for prediction of cis-regulatory elements with an octamer-based approach. Our test prediction of a drought-responsive RD29A promoter with the aid of microarray data for response to drought, ABA and overexpression of DREB1A, a key regulator of cold and drought response, provided reasonable results that fit with the experimentally identified regulatory elements. With this succession, we expanded the prediction to various phytohormone responses, including those for abscisic acid, auxin, cytokinin, ethylene, brassinosteroid, jasmonic acid, and salicylic acid, as well as for hydrogen peroxide, drought and DREB1A overexpression. Totally 622 promoters that are activated by phytohormones were subjected to the prediction. In addition, we have assigned putative functions to 53 octamers of the Regulatory Element Group (REG that have been extracted as position-dependent cis-regulatory elements with the aid of their feature of preferential appearance in the promoter region. Conclusions Our prediction of Arabidopsis cis-regulatory elements for phytohormone responses provides guidance for experimental analysis of promoters to reveal the basis of the transcriptional network of phytohormone responses.

  16. Screening in silico predicted remotely acting NF1 gene regulatory elements for mutations in patients with neurofibromatosis type 1.

    Science.gov (United States)

    Hamby, Stephen E; Reviriego, Pablo; Cooper, David N; Upadhyaya, Meena; Chuzhanova, Nadia

    2013-08-15

    Neurofibromatosis type 1 (NF1), a neuroectodermal disorder, is caused by germline mutations in the NF1 gene. NF1 affects approximately 1/3,000 individuals worldwide, with about 50% of cases representing de novo mutations. Although the NF1 gene was identified in 1990, the underlying gene mutations still remain undetected in a small but obdurate minority of NF1 patients. We postulated that in these patients, hitherto undetected pathogenic mutations might occur in regulatory elements far upstream of the NF1 gene. In an attempt to identify such remotely acting regulatory elements, we reasoned that some of them might reside within DNA sequences that (1) have the potential to interact at distance with the NF1 gene and (2) lie within a histone H3K27ac-enriched region, a characteristic of active enhancers. Combining Hi-C data, obtained by means of the chromosome conformation capture technique, with data on the location and level of histone H3K27ac enrichment upstream of the NF1 gene, we predicted in silico the presence of two remotely acting regulatory regions, located, respectively, approximately 600 kb and approximately 42 kb upstream of the NF1 gene. These regions were then sequenced in 47 NF1 patients in whom no mutations had been found in either the NF1 or SPRED1 gene regions. Five patients were found to harbour DNA sequence variants in the distal H3K27ac-enriched region. Although these variants are of uncertain pathological significance and still remain to be functionally characterized, this approach promises to be of general utility for the detection of mutations underlying other inherited disorders that may be caused by mutations in remotely acting regulatory elements.

  17. Quantitative design of regulatory elements based on high-precision strength prediction using artificial neural network.

    Science.gov (United States)

    Meng, Hailin; Wang, Jianfeng; Xiong, Zhiqiang; Xu, Feng; Zhao, Guoping; Wang, Yong

    2013-01-01

    Accurate and controllable regulatory elements such as promoters and ribosome binding sites (RBSs) are indispensable tools to quantitatively regulate gene expression for rational pathway engineering. Therefore, de novo designing regulatory elements is brought back to the forefront of synthetic biology research. Here we developed a quantitative design method for regulatory elements based on strength prediction using artificial neural network (ANN). One hundred mutated Trc promoter & RBS sequences, which were finely characterized with a strength distribution from 0 to 3.559 (relative to the strength of the original sequence which was defined as 1), were used for model training and test. A precise strength prediction model, NET90_19_576, was finally constructed with high regression correlation coefficients of 0.98 for both model training and test. Sixteen artificial elements were in silico designed using this model. All of them were proved to have good consistency between the measured strength and our desired strength. The functional reliability of the designed elements was validated in two different genetic contexts. The designed parts were successfully utilized to improve the expression of BmK1 peptide toxin and fine-tune deoxy-xylulose phosphate pathway in Escherichia coli. Our results demonstrate that the methodology based on ANN model can de novo and quantitatively design regulatory elements with desired strengths, which are of great importance for synthetic biology applications.

  18. Regulatory policy and the location of bio-pharmaceutical foreign direct investment in Europe.

    Science.gov (United States)

    Koenig, Pamina; Macgarvie, Megan

    2011-09-01

    This paper examines the relationship between cross-country differences in drug price regulation and the location of biopharmaceutical Foreign Direct Investment (FDI) in Europe. Simple theory predicts that price regulation in one country might affect total investment, but not the location of that investment, if sales are global. Nevertheless, some manufacturers threaten that the introduction of price regulation in a country will motivate them to move their investments to other countries. Are such threats cheap talk, or is there evidence that firms avoid price-controlling countries when making FDI location choices? We use data on 527 investments initiated in 27 European countries between 2002 and 2009 and find that investors are less likely to choose countries with price controls, after controlling for other determinants of investment. We also observe a relative decline in investment in countries that increased the stringency of regulatory regimes during our sample period. The effect is restricted to non-manufacturing investments and is most robust for those related to administrative functions.

  19. 49 CFR 236.560 - Contact element, mechanical trip type; location with respect to rail.

    Science.gov (United States)

    2010-10-01

    ... SYSTEMS, DEVICES, AND APPLIANCES Automatic Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Locomotives § 236.560 Contact element, mechanical trip type; location with respect to...

  20. Increased Motility of Escherichia coli by Insertion Sequence Element Integration into the Regulatory Region of the flhD Operon

    Science.gov (United States)

    Barker, Clive S.; Prüß, Birgit M.; Matsumura, Philip

    2004-01-01

    The flhD operon is the master operon of the flagellar regulon and a global regulator of metabolism. The genome sequence of the Escherichia coli K-12 strain MG1655 contained an IS1 insertion sequence element in the regulatory region of the flhD promoter. Another stock of MG1655 was obtained from the E. coli Genetic Stock Center. This stock contained isolates which were poorly motile and had no IS1 element upstream of the flhD promoter. From these isolates, motile subpopulations were identified after extended incubation in motility agar. Purified motile derivatives contained an IS5 element insertion upstream of the flhD promoter, and swarm rates were sevenfold higher than that of the original isolate. For a motile derivative, levels of flhD transcript had increased 2.7-fold, leading to a 32-fold increase in fliA transcript and a 65-fold increase in flhB::luxCDABE expression from a promoter probe vector. A collection of commonly used lab strains was screened for IS element insertion and motility. Five strains (RP437, YK410, MC1000, W3110, and W2637) contained IS5 elements upstream of the flhD promoter at either of two locations. This correlated with high swarm rates. Four other strains (W1485, FB8, MM294, and RB791) did not contain IS elements in the flhD regulatory region and were poorly motile. Primer extension determined that the transcriptional start site of flhD was unaltered by the IS element insertions. We suggest that IS element insertion may activate transcription of the flhD operon by reducing transcriptional repression. PMID:15516564

  1. Data mining for regulatory elements in yeast genome.

    Science.gov (United States)

    Brazma, A; Vilo, J; Ukkonen, E; Valtonen, K

    1997-01-01

    We have examined methods and developed a general software tool for finding and analyzing combinations of transcription factor binding sites that occur relatively often in gene upstream regions (putative promoter regions) in the yeast genome. Such frequently occurring combinations may be essential parts of possible promoter classes. The regions upstream to all genes were first isolated from the yeast genome database MIPS using the information in the annotation files of the database. The ones that do not overlap with coding regions were chosen for further studies. Next, all occurrences of the yeast transcription factor binding sites, as given in the IMD database, were located in the genome and in the selected regions in particular. Finally, by using a general purpose data mining software in combination with our own software, which parametrizes the search, we can find the combinations of binding sites that occur in the upstream regions more frequently than would be expected on the basis of the frequency of individual sites. The procedure also finds so-called association rules present in such combinations. The developed tool is available for use through the WWW.

  2. The identification of cis-regulatory elements: A review from a machine learning perspective.

    Science.gov (United States)

    Li, Yifeng; Chen, Chih-Yu; Kaye, Alice M; Wasserman, Wyeth W

    2015-12-01

    The majority of the human genome consists of non-coding regions that have been called junk DNA. However, recent studies have unveiled that these regions contain cis-regulatory elements, such as promoters, enhancers, silencers, insulators, etc. These regulatory elements can play crucial roles in controlling gene expressions in specific cell types, conditions, and developmental stages. Disruption to these regions could contribute to phenotype changes. Precisely identifying regulatory elements is key to deciphering the mechanisms underlying transcriptional regulation. Cis-regulatory events are complex processes that involve chromatin accessibility, transcription factor binding, DNA methylation, histone modifications, and the interactions between them. The development of next-generation sequencing techniques has allowed us to capture these genomic features in depth. Applied analysis of genome sequences for clinical genetics has increased the urgency for detecting these regions. However, the complexity of cis-regulatory events and the deluge of sequencing data require accurate and efficient computational approaches, in particular, machine learning techniques. In this review, we describe machine learning approaches for predicting transcription factor binding sites, enhancers, and promoters, primarily driven by next-generation sequencing data. Data sources are provided in order to facilitate testing of novel methods. The purpose of this review is to attract computational experts and data scientists to advance this field.

  3. A Simple Grammar Defines Activating and Repressing cis-Regulatory Elements in Photoreceptors

    Directory of Open Access Journals (Sweden)

    Michael A. White

    2016-10-01

    Full Text Available Transcription factors often activate and repress different target genes in the same cell. How activation and repression are encoded by different arrangements of transcription factor binding sites in cis-regulatory elements is poorly understood. We investigated how sites for the transcription factor CRX encode both activation and repression in photoreceptors by assaying thousands of genomic and synthetic cis-regulatory elements in wild-type and Crx−/− retinas. We found that sequences with high affinity for CRX repress transcription, whereas sequences with lower affinity activate. This rule is modified by a cooperative interaction between CRX sites and sites for the transcription factor NRL, which overrides the repressive effect of high affinity for CRX. Our results show how simple rearrangements of transcription factor binding sites encode qualitatively different responses to a single transcription factor and explain how CRX plays multiple cis-regulatory roles in the same cell.

  4. A reciprocal space approach for locating symmetry elements in Patterson superposition maps

    Energy Technology Data Exchange (ETDEWEB)

    Hendrixson, T.

    1990-09-21

    A method for determining the location and possible existence of symmetry elements in Patterson superposition maps has been developed. A comparison of the original superposition map and a superposition map operated on by the symmetry element gives possible translations to the location of the symmetry element. A reciprocal space approach using structure factor-like quantities obtained from the Fourier transform of the superposition function is then used to determine the best'' location of the symmetry element. Constraints based upon the space group requirements are also used as a check on the locations. The locations of the symmetry elements are used to modify the Fourier transform coefficients of the superposition function to give an approximation of the structure factors, which are then refined using the EG relation. The analysis of several compounds using this method is presented. Reciprocal space techniques for locating multiple images in the superposition function are also presented, along with methods to remove the effect of multiple images in the Fourier transform coefficients of the superposition map. In addition, crystallographic studies of the extended chain structure of (NHC{sub 5}H{sub 5})SbI{sub 4} and of the twinning method of the orthorhombic form of the high-{Tc} superconductor YBa{sub 2}Cu{sub 3}O{sub 7-x} are presented. 54 refs.

  5. Cis-regulatory elements in the primate brain: from functional specialization to neurodegeneration

    NARCIS (Netherlands)

    Vermunt, Marit W.

    2017-01-01

    Over the last decade, the noncoding part of the genome has been shown to harbour thousands of cis-regulatory elements, such as enhancers, that activate well-defined gene expression programs. Here, we charted active enhancers in a multiplicity of human brain regions to understand the role of

  6. Peak-valley-peak pattern of histone modifications delineates active regulatory elements and their directionality

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Bagger, Frederik Otzen; Lauridsen, Felicia Kathrine Bratt

    2016-01-01

    Formation of nucleosome free region (NFR) accompanied by specific histone modifications at flanking nucleosomes is an important prerequisite for enhancer and promoter activity. Due to this process, active regulatory elements often exhibit a distinct shape of histone signal in the form of a peak...

  7. Single-cell methylomes identify neuronal subtypes and regulatory elements in mammalian cortex.

    Science.gov (United States)

    Luo, Chongyuan; Keown, Christopher L; Kurihara, Laurie; Zhou, Jingtian; He, Yupeng; Li, Junhao; Castanon, Rosa; Lucero, Jacinta; Nery, Joseph R; Sandoval, Justin P; Bui, Brian; Sejnowski, Terrence J; Harkins, Timothy T; Mukamel, Eran A; Behrens, M Margarita; Ecker, Joseph R

    2017-08-11

    The mammalian brain contains diverse neuronal types, yet we lack single-cell epigenomic assays that are able to identify and characterize them. DNA methylation is a stable epigenetic mark that distinguishes cell types and marks regulatory elements. We generated >6000 methylomes from single neuronal nuclei and used them to identify 16 mouse and 21 human neuronal subpopulations in the frontal cortex. CG and non-CG methylation exhibited cell type-specific distributions, and we identified regulatory elements with differential methylation across neuron types. Methylation signatures identified a layer 6 excitatory neuron subtype and a unique human parvalbumin-expressing inhibitory neuron subtype. We observed stronger cross-species conservation of regulatory elements in inhibitory neurons than in excitatory neurons. Single-nucleus methylomes expand the atlas of brain cell types and identify regulatory elements that drive conserved brain cell diversity. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  8. Characterization of an upstream regulatory element of adenovirus L1 poly (A) site.

    Science.gov (United States)

    Liu, Li

    2005-06-20

    The transition from early to late stage infection by adenovirus involves a change in mRNA expression from the adenovirus major late transcription unit (AdMLTU). This early to late switch centers around alternative selection of one of five poly (A) sites (L1-L5) that code for the major structural proteins of Adenovirus. During the early stage of infection, steady state mRNA is primarily derived from the L1 poly (A) site. During the late stage of infection, each of the MLTU poly (A) sites is represented in the steady state mRNA pool (Falck-Pedersen, E., Logan, J., 1989. Regulation of poly(A) site selection in adenovirus. J. Virol. 63 (2), 532-541.). Using transient transfection of a plasmid expressing Chloramphenicol Acetyl Transferase with a tandem poly (A) minigene system (L13) (DeZazzo, J.D., Falck-Pedersen, E., Imperiale, M.J., 1991. Sequences regulating temporal poly(A) site switching in the adenovirus major late transcription unit. Mol. Cell. Biol. 11 (12), 5977-5984; Prescott, J., Falck-Pedersen, E., 1994. Sequence elements upstream of the 3' cleavage site confer substrate strength to the adenovirus L1 and L3 polyadenylation sites. Mol. Cell. Biol. 14 (7), 4682-4693.), it has been demonstrated that the promoter-proximal L1 poly (A) site which is poorly recognized by the 3' end processing machinery, contains an upstream repressor element (URE) that influences steady state levels of mRNA (Prescott, J.C., Liu, L., Falck-Pedersen, E., 1997. Sequence-mediated regulation of adenovirus gene expression by repression of mRNA accumulation. Mol. Cell. Biol. 17 (4), 2207-2216.). In this study, we have further characterized the elements that mediate L1URE function. These studies indicate that the L1 upstream regulatory element (L1 URE) contains a complex RNA architecture that serves to repress gene expression through multiple sub-effectors. The L1URE functions when located upstream of a heterologous poly (A) site, and is able to strongly suppress steady state m

  9. Identification of functional elements and regulatory circuits by Drosophila modENCODE.

    Science.gov (United States)

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L; Landolin, Jane M; Bristow, Christopher A; Ma, Lijia; Lin, Michael F; Washietl, Stefan; Arshinoff, Bradley I; Ay, Ferhat; Meyer, Patrick E; Robine, Nicolas; Washington, Nicole L; Di Stefano, Luisa; Berezikov, Eugene; Brown, Christopher D; Candeias, Rogerio; Carlson, Joseph W; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y; Will, Sebastian; Alekseyenko, Artyom A; Artieri, Carlo; Booth, Benjamin W; Brooks, Angela N; Dai, Qi; Davis, Carrie A; Duff, Michael O; Feng, Xin; Gorchakov, Andrey A; Gu, Tingting; Henikoff, Jorja G; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K; Riddle, Nicole C; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E; Schwartz, Yuri B; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E; Brent, Michael R; Cherbas, Lucy; Elgin, Sarah C R; Gingeras, Thomas R; Grossman, Robert; Hoskins, Roger A; Kaufman, Thomas C; Kent, William; Kuroda, Mitzi I; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J; Celniker, Susan E; Henikoff, Steven; Karpen, Gary H; Lai, Eric C; MacAlpine, David M; Stein, Lincoln D; White, Kevin P; Kellis, Manolis

    2010-12-24

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation.

  10. A Multi-Element Approach to Location Inference of Twitter: A Case for Emergency Response

    Directory of Open Access Journals (Sweden)

    Farhad Laylavi

    2016-04-01

    Full Text Available Since its inception, Twitter has played a major role in real-world events—especially in the aftermath of disasters and catastrophic incidents, and has been increasingly becoming the first point of contact for users wishing to provide or seek information about such situations. The use of Twitter in emergency response and disaster management opens up avenues of research concerning different aspects of Twitter data quality, usefulness and credibility. A real challenge that has attracted substantial attention in the Twitter research community exists in the location inference of twitter data. Considering that less than 2% of tweets are geotagged, finding location inference methods that can go beyond the geotagging capability is undoubtedly the priority research area. This is especially true in terms of emergency response, where spatial aspects of information play an important role. This paper introduces a multi-elemental location inference method that puts the geotagging aside and tries to predict the location of tweets by exploiting the other inherently attached data elements. In this regard, textual content, users’ profile location and place labelling, as the main location-related elements, are taken into account. Location-name classes in three granularity levels are defined and employed to look up the location references from the location-associated elements. The inferred location of the finest granular level is assigned to a tweet, based on a novel location assignment rule. The location assigned by the location inference process is considered to be the inferred location of a tweet, and is compared with the geotagged coordinates as the ground truth of the study. The results show that this method is able to successfully infer the location of 87% of the tweets at the average distance error of 12.2 km and the median distance error of 4.5 km, which is a significant improvement compared with that of the current methods that can predict the location

  11. Computational identification of new structured cis-regulatory elements in the 3'-untranslated region of human protein coding genes.

    Science.gov (United States)

    Chen, Xiaowei Sylvia; Brown, Chris M

    2012-10-01

    Messenger ribonucleic acids (RNAs) contain a large number of cis-regulatory RNA elements that function in many types of post-transcriptional regulation. These cis-regulatory elements are often characterized by conserved structures and/or sequences. Although some classes are well known, given the wide range of RNA-interacting proteins in eukaryotes, it is likely that many new classes of cis-regulatory elements are yet to be discovered. An approach to this is to use computational methods that have the advantage of analysing genomic data, particularly comparative data on a large scale. In this study, a set of structural discovery algorithms was applied followed by support vector machine (SVM) classification. We trained a new classification model (CisRNA-SVM) on a set of known structured cis-regulatory elements from 3'-untranslated regions (UTRs) and successfully distinguished these and groups of cis-regulatory elements not been strained on from control genomic and shuffled sequences. The new method outperformed previous methods in classification of cis-regulatory RNA elements. This model was then used to predict new elements from cross-species conserved regions of human 3'-UTRs. Clustering of these elements identified new classes of potential cis-regulatory elements. The model, training and testing sets and novel human predictions are available at: http://mRNA.otago.ac.nz/CisRNA-SVM.

  12. Analysis of mammalian cis-regulatory DNA elements by homologous recombination.

    Science.gov (United States)

    Fiering, S; Bender, M A; Groudine, M

    1999-01-01

    The use of homologous recombination to modify and thereby functionally analyze cis-regulatory DNA elements in mammalian cells has become an important approach in mammalian gene expression research. We have emphasized the necessity of designing a system that allows the removal of selectable markers used in targeting and facilitates the further modification of the region under study. To perform these tasks, we presently favor making an initial HR-mediated replacement of the entire element under study with an active positive selectable marker in combination with either an inactive second positive selectable marker or an active negative selectable marker. The plug and socket system, in which an inactive selectable marker is complemented by HR, is the most dependable and well-characterized option for making secondary modifications. However, the double-replacement system has certain advantages, and the recently developed RMCE approach, which allows replacement of a negative selectable marker by site-specific recombinase-mediated insertion without using a positive selectable marker, will likely prove very valuable in future experiments. Each of the systems, or combinations thereof, should be considered in light of the specifics of any given experiment to select the most appropriate option. Although the emphasis of this article has been the analysis of cis-acting regulatory elements involved in transcription, these same approaches can be used to analyze other regulatory elements (e.g., origins of replication) and to make multiple subtle mutations in polypeptides.

  13. Evaluation of combinatorial cis-regulatory elements for stable gene expression in chicken cells

    Directory of Open Access Journals (Sweden)

    Seo Hee W

    2010-09-01

    Full Text Available Abstract Background Recent successes in biotechnological application of birds are based on their unique physiological traits such as unlimited manipulability onto developing embryos and simple protein constituents of the eggs. However it is not likely that target protein is produced as kinetically expected because various factors affect target gene expression. Although there have been various attempts to minimize the silencing of transgenes, a generalized study that uses multiple cis-acting elements in chicken has not been made. The aim of the present study was to analyze whether various cis-acting elements can help to sustain transgene expression in chicken fibroblasts. Results We investigated the optimal transcriptional regulatory elements for enhancing stable transgene expression in chicken cells. We generated eight constructs that encode enhanced green fluorescent protein (eGFP driven by either CMV or CAG promoters (including the control, containing three types of key regulatory elements: a chicken lysozyme matrix attachment region (cMAR, 5'-DNase I-hypersensitive sites 4 (cHS4, and the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE. Then we transformed immortalized chicken embryonic fibroblasts with these constructs by electroporation, and after cells were expanded under G418 selection, analyzed mRNA levels and mean fluorescence intensity (MFI by quantitative real-time PCR and flow cytometry, respectively. We found that the copy number of each construct significantly decreased as the size of the construct increased (R2 = 0.701. A significant model effect was found in the expression level among various constructs in both mRNA and protein (P cis-acting elements decreased the level of gene silencing as well as the coefficient of variance of eGFP-expressing cells (P Conclusions Our current data show that an optimal combination of cis-acting elements and promoters/enhancers for sustaining gene expression in chicken cells

  14. [Role of genes and their cis-regulatory elements during animal morphological evolution].

    Science.gov (United States)

    Sun, Boyuan; Tu, Jianbo; Li, Ying; Yang, Mingyao

    2014-06-01

    Cis-regulatory hypothesis is one of the most important theories in evolutionary developmental biology (evo-devo), which claims that evolution of cis-regulatory elements (CREs) plays a key role during evolution of morphology. However, an increasing number of experimental results show that cis-regulatory hypothesis alone is not far enough to explain the complexity of evo-devo processes. Other modifications, including mutations of protein coding, gene and genome duplications, and flexibility of homeodomains and CREs, also cause the morphological changes in animals. In this review, we retrospect the recent results of evolution of CREs and genes associated with CREs and discuss new methods and trends for research in evo-devo.

  15. Novel mutations in the GH gene (GH1) uncover putative splicing regulatory elements.

    Science.gov (United States)

    Babu, Deepak; Mellone, Simona; Fusco, Ileana; Petri, Antonella; Walker, Gillian E; Bellone, Simonetta; Prodam, Flavia; Momigliano-Richiardi, Patricia; Bona, Gianni; Giordano, Mara

    2014-05-01

    Mutations affecting exon 3 splicing are the main cause of autosomal dominant Isolated GH Deficiency II (IGHDII) by increasing the level of exon 3-skipped mRNA encoding the functionally inactive dominant-negative 17.5-kDa isoform. The exons and introns of the gene encoding GH (GH1) were screened for the presence of mutations in 103 sporadic isolated GH deficiency cases. Four different variations within exon 3 were identified in 3 patients. One carried c.261C>T (p.Pro87Pro) and c.272A>T (p.Glu91Val), the second c.255G>A (p.Pro85Pro) and c.261 C>T, and the third c.246G>C (p.Glu82Asp). All the variants were likely generated by gene conversion from an homologous gene in the GH1 cluster. In silico analysis predicted that positions c.255 and c.272 were included within 2 putative novel exon splicing enhancers (ESEs). Their effect on splicing was confirmed in vitro. Constructs bearing these 2 variants induced consistently higher levels both of transcript and protein corresponding to the 17.5-kDa isoform. When c.255 and c.272 were combined in cis with the c.261 variant, as in our patients, their effect was weaker. In conclusion, we identified 2 variations, c.255G>A and c.272A>T, located in 2 novel putative exon splicing enhancers and affecting GH1 splicing in vitro by increasing the production of alternatively spliced isoforms. The amount of aberrant isoforms is further regulated by the presence in cis of the c.261 variant. Thus, our results evidenced novel putative splicing regulatory elements within exon 3, confirming the crucial role of this exon in mRNA processing.

  16. Dissection of cis-regulatory elements in the C. elegans Hox gene egl-5 promoter.

    Science.gov (United States)

    Teng, Yingqi; Girard, Lisa; Ferreira, Henrique B; Sternberg, Paul W; Emmons, Scott W

    2004-12-15

    Hox genes are highly conserved segmental identity genes well known for their complex expression patterns and divergent targets. Here we present an analysis of cis-regulatory elements in the Caenorhabditis elegans Hox gene egl-5, which is expressed in multiple tissues in the posterior region of the nematode. We have utilized phylogenetic footprinting to efficiently identify cis-regulatory elements and have characterized these with gfp reporters and tissue-specific rescue experiments. We have found that the complex expression pattern of egl-5 is the cumulative result of the activities of multiple tissue or local region-specific activator sequences that are conserved both in sequence and near-perfect order in the related nematode Caenorhabditis briggsae. Two conserved regulatory blocks analyzed in detail contain multiple sites for both positively and negatively acting factors. One of these regions may promote activation of egl-5 in certain cells via the Wnt pathway. Positively acting regions are repressed in inappropriate tissues by additional negative pathways acting at other sites within the promoter. Our analysis has allowed us to implicate several new regulatory factors significant to the control of egl-5 expression.

  17. DNA-protein interaction at erythroid important regulatory elements of MEL cells by in vivo footprinting

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Using ligation-mediated PCR method to study the status of DNA-protein interaction at hypersensitive site 2 of locus control Region and β maj promoter of MEL cell line before and after induction, MEL cell has been cultured and induced to differentiation by Hemin and DMSO, then the live cells have been treated with dimethyl sulfate. Ligation mediated PCR has been carried out following the chemical cleavage. The results demonstrate that before and after induction, the status of DNA-protein interaction at both hypersensitive site 2 and β maj promoter change significantly, indicating that distal regulatory elements (locus control region, hypersensitive sites) as well as proximal regulatory elements (promoter, enhancer) of β -globin gene cluster participate in the regulation of developmental specificity.

  18. A step-by-step protocol for formaldehyde-assisted isolation of regulatory elements from Arabidopsis thaliana

    Institute of Scientific and Technical Information of China (English)

    Mohammad Amin Omidbakhshfard; Flavia Vischi Winck; Samuel Arvidsson; Diego M.Riao-Pachn; Bernd Mueller-Roeber

    2014-01-01

    The control of gene expression by transcriptional regulators and other types of functional y relevant DNA transactions such as chromatin remodeling and replication underlie a vast spectrum of biological processes in al organisms. DNA transactions require the control ed interaction of proteins with DNA sequence motifs which are often located in nucleosome-depleted regions (NDRs) of the chromatin. Formaldehyde-assisted isolation of regulatory elements (FAIRE) has been established as an easy-to-implement method for the isolation of NDRs from a number of eukaryotic organisms, and it has been successful y employed for the discovery of new regulatory segments in genomic DNA from, for example, yeast, Drosophila, and humans. Until today, however, FAIRE has only rarely been employed in plant research and currently no detailed FAIRE protocol for plants has been published. Here, we provide a step-by-step FAIRE protocol for NDR discovery in Arabidopsis thaliana. We demonstrate that NDRs isolated from plant chromatin are readily amenable to quantitative polymerase chain reaction and next-generation sequencing. Only minor modification of the FAIRE protocol wil be needed to adapt it to other plants, thus facilitating the global inventory of regulatory regions across species.

  19. Recurrent modification of a conserved cis-regulatory element underlies fruit fly pigmentation diversity.

    Directory of Open Access Journals (Sweden)

    William A Rogers

    2013-08-01

    Full Text Available The development of morphological traits occurs through the collective action of networks of genes connected at the level of gene expression. As any node in a network may be a target of evolutionary change, the recurrent targeting of the same node would indicate that the path of evolution is biased for the relevant trait and network. Although examples of parallel evolution have implicated recurrent modification of the same gene and cis-regulatory element (CRE, little is known about the mutational and molecular paths of parallel CRE evolution. In Drosophila melanogaster fruit flies, the Bric-à-brac (Bab transcription factors control the development of a suite of sexually dimorphic traits on the posterior abdomen. Female-specific Bab expression is regulated by the dimorphic element, a CRE that possesses direct inputs from body plan (ABD-B and sex-determination (DSX transcription factors. Here, we find that the recurrent evolutionary modification of this CRE underlies both intraspecific and interspecific variation in female pigmentation in the melanogaster species group. By reconstructing the sequence and regulatory activity of the ancestral Drosophila melanogaster dimorphic element, we demonstrate that a handful of mutations were sufficient to create independent CRE alleles with differing activities. Moreover, intraspecific and interspecific dimorphic element evolution proceeded with little to no alterations to the known body plan and sex-determination regulatory linkages. Collectively, our findings represent an example where the paths of evolution appear biased to a specific CRE, and drastic changes in function were accompanied by deep conservation of key regulatory linkages.

  20. Downstream Regulatory Element Antagonist Modulator (DREAM), a target for anti-thrombotic agents.

    Science.gov (United States)

    Cho, Jaehyung

    2017-03-01

    Circulating platelets participate in the process of numerous diseases including thrombosis, inflammation, and cancer. Thus, it is of great importance to understand the underlying mechanisms mediating platelet activation under disease conditions. Emerging evidence indicates that despite the lack of a nucleus, platelets possess molecules that are involved in gene transcription in nucleated cells. This review will summarize downstream regulatory element antagonist modulator (DREAM), a transcriptional repressor, and highlight recent findings suggesting its novel non-transcriptional role in hemostasis and thrombosis.

  1. Repressive BMP2 gene regulatory elements near the BMP2 promoter

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Shan [Department of Biochemistry and Molecular Biology, University of Medicine and Dentistry (UMDNJ), New Jersey Medical School (NJMS), Newark, NJ (United States); Chandler, Ronald L. [Department of Molecular Physiology and Biophysics, Center for Human Genetics Research, Vanderbilt University School of Medicine, Nashville, TN (United States); Fritz, David T. [Department of Biochemistry and Molecular Biology, University of Medicine and Dentistry (UMDNJ), New Jersey Medical School (NJMS), Newark, NJ (United States); Mortlock, Douglas P. [Department of Molecular Physiology and Biophysics, Center for Human Genetics Research, Vanderbilt University School of Medicine, Nashville, TN (United States); Rogers, Melissa B., E-mail: rogersmb@umdnj.edu [Department of Biochemistry and Molecular Biology, University of Medicine and Dentistry (UMDNJ), New Jersey Medical School (NJMS), Newark, NJ (United States)

    2010-02-05

    The level of bone morphogenetic protein 2 (BMP2) profoundly influences essential cell behaviors such as proliferation, differentiation, apoptosis, and migration. The spatial and temporal pattern of BMP2 synthesis, particular in diverse embryonic cells, is highly varied and dynamic. We have identified GC-rich sequences within the BMP2 promoter region that strongly repress gene expression. These elements block the activity of a highly conserved, osteoblast enhancer in response to FGF2 treatment. Both positive and negative gene regulatory elements control BMP2 synthesis. Detecting and mapping the repressive motifs is essential because they impede the identification of developmentally regulated enhancers necessary for normal BMP2 patterns and concentration.

  2. Cell-type-specific enrichment of risk-associated regulatory elements at ovarian cancer susceptibility loci.

    Science.gov (United States)

    Coetzee, Simon G; Shen, Howard C; Hazelett, Dennis J; Lawrenson, Kate; Kuchenbaecker, Karoline; Tyrer, Jonathan; Rhie, Suhn K; Levanon, Keren; Karst, Alison; Drapkin, Ronny; Ramus, Susan J; Couch, Fergus J; Offit, Kenneth; Chenevix-Trench, Georgia; Monteiro, Alvaro N A; Antoniou, Antonis; Freedman, Matthew; Coetzee, Gerhard A; Pharoah, Paul D P; Noushmehr, Houtan; Gayther, Simon A

    2015-07-01

    Understanding the regulatory landscape of the human genome is a central question in complex trait genetics. Most single-nucleotide polymorphisms (SNPs) associated with cancer risk lie in non-protein-coding regions, implicating regulatory DNA elements as functional targets of susceptibility variants. Here, we describe genome-wide annotation of regions of open chromatin and histone modification in fallopian tube and ovarian surface epithelial cells (FTSECs, OSECs), the debated cellular origins of high-grade serous ovarian cancers (HGSOCs) and in endometriosis epithelial cells (EECs), the likely precursor of clear cell ovarian carcinomas (CCOCs). The regulatory architecture of these cell types was compared with normal human mammary epithelial cells and LNCaP prostate cancer cells. We observed similar positional patterns of global enhancer signatures across the three different ovarian cancer precursor cell types, and evidence of tissue-specific regulatory signatures compared to non-gynecological cell types. We found significant enrichment for risk-associated SNPs intersecting regulatory biofeatures at 17 known HGSOC susceptibility loci in FTSECs (P = 3.8 × 10(-30)), OSECs (P = 2.4 × 10(-23)) and HMECs (P = 6.7 × 10(-15)) but not for EECs (P = 0.45) or LNCaP cells (P = 0.88). Hierarchical clustering of risk SNPs conditioned on the six different cell types indicates FTSECs and OSECs are highly related (96% of samples using multi-scale bootstrapping) suggesting both cell types may be precursors of HGSOC. These data represent the first description of regulatory catalogues of normal precursor cells for different ovarian cancer subtypes, and provide unique insights into the tissue specific regulatory variation with respect to the likely functional targets of germline genetic susceptibility variants for ovarian cancer.

  3. Detection and characterization of regulatory elements using probabilistic conditional random field and hidden Markov models

    Institute of Scientific and Technical Information of China (English)

    Hongyan Wang; Xiaobo Zhou

    2013-01-01

    By altering the electrostatic charge of histones or providing binding sites to protein recognition molecules,Chromatin marks have been proposed to regulate gene expression,a property that has motivated researchers to link these marks to cis-regulatory elements.With the help of next generation sequencing technologies,we can now correlate one specific chromatin mark with regulatory elements (e.g.enhancers or promoters) and also build tools,such as hidden Markov models,to gain insight into mark combinations.However,hidden Markov models have limitation for their character of generative models and assume that a current observation depends only on a current hidden state in the chain.Here,we employed two graphical probabilistic models,namely the linear conditional random field model and multivariate hidden Markov model,to mark gene regions with different states based on recurrent and spatially coherent character of these eight marks.Both models revealed chromatin states that may correspond to enhancers and promoters,transcribed regions,transcriptional elongation,and low-signal regions.We also found that the linear conditional random field model was more effective than the hidden Markov model in recognizing regulatory elements,such as promoter-,enhancer-,and transcriptional elongation-associated regions,which gives us a better choice.

  4. Quantitative analysis of polycomb response elements (PREs at identical genomic locations distinguishes contributions of PRE sequence and genomic environment

    Directory of Open Access Journals (Sweden)

    Okulski Helena

    2011-03-01

    Full Text Available Abstract Background Polycomb/Trithorax response elements (PREs are cis-regulatory elements essential for the regulation of several hundred developmentally important genes. However, the precise sequence requirements for PRE function are not fully understood, and it is also unclear whether these elements all function in a similar manner. Drosophila PRE reporter assays typically rely on random integration by P-element insertion, but PREs are extremely sensitive to genomic position. Results We adapted the ΦC31 site-specific integration tool to enable systematic quantitative comparison of PREs and sequence variants at identical genomic locations. In this adaptation, a miniwhite (mw reporter in combination with eye-pigment analysis gives a quantitative readout of PRE function. We compared the Hox PRE Frontabdominal-7 (Fab-7 with a PRE from the vestigial (vg gene at four landing sites. The analysis revealed that the Fab-7 and vg PREs have fundamentally different properties, both in terms of their interaction with the genomic environment at each site and their inherent silencing abilities. Furthermore, we used the ΦC31 tool to examine the effect of deletions and mutations in the vg PRE, identifying a 106 bp region containing a previously predicted motif (GTGT that is essential for silencing. Conclusions This analysis showed that different PREs have quantifiably different properties, and that changes in as few as four base pairs have profound effects on PRE function, thus illustrating the power and sensitivity of ΦC31 site-specific integration as a tool for the rapid and quantitative dissection of elements of PRE design.

  5. Evolution of UCP1 Transcriptional Regulatory Elements Across the Mammalian Phylogeny

    Directory of Open Access Journals (Sweden)

    Michael J. Gaudry

    2017-09-01

    Full Text Available Uncoupling protein 1 (UCP1 permits non-shivering thermogenesis (NST when highly expressed in brown adipose tissue (BAT mitochondria. Exclusive to placental mammals, BAT has commonly been regarded to be advantageous for thermoregulation in hibernators, small-bodied species, and the neonates of larger species. While numerous regulatory control motifs associated with UCP1 transcription have been proposed for murid rodents, it remains unclear whether these are conserved across the eutherian mammal phylogeny and hence essential for UCP1 expression. To address this shortcoming, we conducted a broad comparative survey of putative UCP1 transcriptional regulatory elements in 139 mammals (135 eutherians. We find no evidence for presence of a UCP1 enhancer in monotremes and marsupials, supporting the hypothesis that this control region evolved in a stem eutherian ancestor. We additionally reveal that several putative promoter elements (e.g., CRE-4, CCAAT identified in murid rodents are not conserved among BAT-expressing eutherians, and together with the putative regulatory region (PRR and CpG island do not appear to be crucial for UCP1 expression. The specificity and importance of the upTRE, dnTRE, URE1, CRE-2, RARE-2, NBRE, BRE-1, and BRE-2 enhancer elements first described from rats and mice are moreover uncertain as these motifs differ substantially—but generally remain highly conserved—in other BAT-expressing eutherians. Other UCP1 enhancer motifs (CRE-3, PPRE, and RARE-3 as well as the TATA box are also highly conserved in nearly all eutherian lineages with an intact UCP1. While these transcriptional regulatory motifs are generally also maintained in species where this gene is pseudogenized, the loss or degeneration of key basal promoter (e.g., TATA box and enhancer elements in other UCP1-lacking lineages make it unlikely that the enhancer region is pleiotropic (i.e., co-regulates additional genes. Importantly, differential losses of (or mutations

  6. Variable transposition of eight maize activator (ac) elements located on the short arm of chromosome 1.

    Science.gov (United States)

    Sheridan, William F

    2011-09-01

    Eight Activator (Ac) transposable elements mapped to the maize chromosome arm 1S were assessed for Ac transposition rates. For each of the Ac stocks, plants homozygous for the single Ac element and the Ds reporter r1-sc:m3 on chromosome 10 were crossed as females by a homozygous r1-sc:m3 tester color-converted W22 line. The resulting ears produced mostly coarsely spotted kernels and a low frequency of either near-colorless fine-spotted kernels or nonspotted kernels. The relative frequency of these two types of near-colorless kernels differed among the eight Ac stocks. The extent to which increased Ac dosage results in nonspotted kernels may be Ac-specific. Although all of the Ac elements are in near-isogenic inbred W22 lines, they varied to a large extent in their transposition frequency. These differences might possibly result from structural differences among the Ac elements. Because one pair of Ac elements derived from Ac33 on chromosome arm 5S differed about 13-fold in transposition frequency and a second pair of Ac elements derived from Ac12 on chromosome arm 1S differed about 3-fold in transposition frequency, this is not a likely explanation for all eight Ac elements. The data presented here support the notion that the differences in transposition frequency of the eight Ac elements may be a reflection of variability in Ac transcription or accessibility of the transposase to the Ac element, resulting from differences in the chromatin environments wherein the Ac elements are located. This is the first report of variability in transposition rates among different Ac donor lines.

  7. The majority of primate-specific regulatory sequences are derived from transposable elements.

    Directory of Open Access Journals (Sweden)

    Pierre-Étienne Jacques

    2013-05-01

    Full Text Available Although emerging evidence suggests that transposable elements (TEs have contributed novel regulatory elements to the human genome, their global impact on transcriptional networks remains largely uncharacterized. Here we show that TEs have contributed to the human genome nearly half of its active elements. Using DNase I hypersensitivity data sets from ENCODE in normal, embryonic, and cancer cells, we found that 44% of open chromatin regions were in TEs and that this proportion reached 63% for primate-specific regions. We also showed that distinct subfamilies of endogenous retroviruses (ERVs contributed significantly more accessible regions than expected by chance, with up to 80% of their instances in open chromatin. Based on these results, we further characterized 2,150 TE subfamily-transcription factor pairs that were bound in vivo or enriched for specific binding motifs, and observed that TEs contributing to open chromatin had higher levels of sequence conservation. We also showed that thousands of ERV-derived sequences were activated in a cell type-specific manner, especially in embryonic and cancer cells, and we demonstrated that this activity was associated with cell type-specific expression of neighboring genes. Taken together, these results demonstrate that TEs, and in particular ERVs, have contributed hundreds of thousands of novel regulatory elements to the primate lineage and reshaped the human transcriptional landscape.

  8. [Regulatory elements in the skin epithelium of Saccoglossus mereschkowskii (Enteropneusta, Hemichordata): electron microscopic and immunocytochemical study].

    Science.gov (United States)

    Stoliarova, M V; Val'kovich, E I

    2013-01-01

    The aim of this investigation was to demonstrate the regulatory elements in the skin epithelium of Enteropneusta which are supposed to be related to the chordate ancestors. Using electron microscopy, it was found that in the skin epithelium of a representative of enteropneusts Saccoglossus mereschkowskii, the basal parts of some epitheliocytes took part in formation of a nerve layer. These cells were considered as receptor ciliated cells. The granular epithelial cells were shown to release secretion according to both exocrine and endocrine mechanism; these cells were characterized as endocrine-like regulatory cells. Fine granular cells possibly represent special receptor-endocrine-like cell type. The immunocytochemical detection of FMRFamid neuropeptide localization in histological sections confirmed the electron microscopic data on the presence of receptor and endocrine-like cells in the epithelium. It is suggested that the skin epithelium of Enteropneusta contains a peculiar neuro-endocrine regulatory system that is represented by receptor cells, receptor-endocrine-like cells of an open type and nerve elements of the nerve layer.

  9. Identification of novel craniofacial regulatory domains located far upstream of SOX9 and disrupted in Pierre Robin sequence.

    Science.gov (United States)

    Gordon, Christopher T; Attanasio, Catia; Bhatia, Shipra; Benko, Sabina; Ansari, Morad; Tan, Tiong Y; Munnich, Arnold; Pennacchio, Len A; Abadie, Véronique; Temple, I Karen; Goldenberg, Alice; van Heyningen, Veronica; Amiel, Jeanne; FitzPatrick, David; Kleinjan, Dirk A; Visel, Axel; Lyonnet, Stanislas

    2014-08-01

    Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions, and duplications within a ∼2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus for isolated PRS at ∼1.2-1.5 Mb upstream of SOX9 has been previously reported. The craniofacial regulatory potential within this locus, and within the greater genomic domain surrounding SOX9, remains poorly defined. We report two novel deletions upstream of SOX9 in families with PRS, allowing refinement of the regions harboring candidate craniofacial regulatory elements. In parallel, ChIP-Seq for p300 binding sites in mouse craniofacial tissue led to the identification of several novel craniofacial enhancers at the SOX9 locus, which were validated in transgenic reporter mice and zebrafish. Notably, some of the functionally validated elements fall within the PRS deletions. These studies suggest that multiple noncoding elements contribute to the craniofacial regulation of SOX9 expression, and that their disruption results in PRS.

  10. Ancient Transposable Elements Transformed the Uterine Regulatory Landscape and Transcriptome during the Evolution of Mammalian Pregnancy

    Directory of Open Access Journals (Sweden)

    Vincent J. Lynch

    2015-02-01

    Full Text Available A major challenge in biology is determining how evolutionarily novel characters originate; however, mechanistic explanations for the origin of new characters are almost completely unknown. The evolution of pregnancy is an excellent system in which to study the origin of novelties because mammals preserve stages in the transition from egg laying to live birth. To determine the molecular bases of this transition, we characterized the pregnant/gravid uterine transcriptome from tetrapods to trace the evolutionary history of uterine gene expression. We show that thousands of genes evolved endometrial expression during the origins of mammalian pregnancy, including genes that mediate maternal-fetal communication and immunotolerance. Furthermore, thousands of cis-regulatory elements that mediate decidualization and cell-type identity in decidualized stromal cells are derived from ancient mammalian transposable elements (TEs. Our results indicate that one of the defining mammalian novelties evolved from DNA sequences derived from ancient mammalian TEs co-opted into hormone-responsive regulatory elements distributed throughout the genome.

  11. FK506 biosynthesis is regulated by two positive regulatory elements in Streptomyces tsukubaensis

    Directory of Open Access Journals (Sweden)

    Goranovič Dušan

    2012-10-01

    Full Text Available Abstract Background FK506 (Tacrolimus is an important immunosuppressant, produced by industrial biosynthetic processes using various Streptomyces species. Considering the complex structure of FK506, it is reasonable to expect complex regulatory networks controlling its biosynthesis. Regulatory elements, present in gene clusters can have a profound influence on the final yield of target product and can play an important role in development of industrial bioprocesses. Results Three putative regulatory elements, namely fkbR, belonging to the LysR-type family, fkbN, a large ATP-binding regulator of the LuxR family (LAL-type and allN, a homologue of AsnC family regulatory proteins, were identified in the FK506 gene cluster from Streptomyces tsukubaensis NRRL 18488, a progenitor of industrial strains used for production of FK506. Inactivation of fkbN caused a complete disruption of FK506 biosynthesis, while inactivation of fkbR resulted in about 80% reduction of FK506 yield. No functional role in the regulation of the FK506 gene cluster has been observed for the allN gene. Using RT-PCR and a reporter system based on a chalcone synthase rppA, we demonstrated, that in the wild type as well as in fkbN- and fkbR-inactivated strains, fkbR is transcribed in all stages of cultivation, even before the onset of FK506 production, whereas fkbN expression is initiated approximately with the initiation of FK506 production. Surprisingly, inactivation of fkbN (or fkbR does not abolish the transcription of the genes in the FK506 gene cluster in general, but may reduce expression of some of the tested biosynthetic genes. Finally, introduction of a second copy of the fkbR or fkbN genes under the control of the strong ermE* promoter into the wild type strain resulted in 30% and 55% of yield improvement, respectively. Conclusions Our results clearly demonstrate the positive regulatory role of fkbR and fkbN genes in FK506 biosynthesis in S. tsukubaensis NRRL 18488. We

  12. Bounded search for de novo identification of degenerate cis-regulatory elements

    Directory of Open Access Journals (Sweden)

    Khetani Radhika S

    2006-05-01

    Full Text Available Abstract Background The identification of statistically overrepresented sequences in the upstream regions of coregulated genes should theoretically permit the identification of potential cis-regulatory elements. However, in practice many cis-regulatory elements are highly degenerate, precluding the use of an exhaustive word-counting strategy for their identification. While numerous methods exist for inferring base distributions using a position weight matrix, recent studies suggest that the independence assumptions inherent in the model, as well as the inability to reach a global optimum, limit this approach. Results In this paper, we report PRISM, a degenerate motif finder that leverages the relationship between the statistical significance of a set of binding sites and that of the individual binding sites. PRISM first identifies overrepresented, non-degenerate consensus motifs, then iteratively relaxes each one into a high-scoring degenerate motif. This approach requires no tunable parameters, thereby lending itself to unbiased performance comparisons. We therefore compare PRISM's performance against nine popular motif finders on 28 well-characterized S. cerevisiae regulons. PRISM consistently outperforms all other programs. Finally, we use PRISM to predict the binding sites of uncharacterized regulons. Our results support a proposed mechanism of action for the yeast cell-cycle transcription factor Stb1, whose binding site has not been determined experimentally. Conclusion The relationship between statistical measures of the binding sites and the set as a whole leads to a simple means of identifying the diverse range of cis-regulatory elements to which a protein binds. This approach leverages the advantages of word-counting, in that position dependencies are implicitly accounted for and local optima are more easily avoided. While we sacrifice guaranteed optimality to prevent the exponential blowup of exhaustive search, we prove that the error

  13. Trace element fingerprinting of cockle (Cerastoderma edule) shells can reveal harvesting location in adjacent areas.

    Science.gov (United States)

    Ricardo, Fernando; Génio, Luciana; Costa Leal, Miguel; Albuquerque, Rui; Queiroga, Henrique; Rosa, Rui; Calado, Ricardo

    2015-07-07

    Determining seafood geographic origin is critical for controlling its quality and safeguarding the interest of consumers. Here, we use trace element fingerprinting (TEF) of bivalve shells to discriminate the geographic origin of specimens. Barium (Ba), manganese (Mn), magnesium (Mg), strontium (Sr) and lead (Pb) were quantified in cockle shells (Cerastoderma edule) captured with two fishing methods (by hand and by hand-raking) and from five adjacent fishing locations within an estuarine system (Ria de Aveiro, Portugal). Results suggest no differences in TEF of cockle shells captured by hand or by hand-raking, thus confirming that metal rakes do not act as a potential source of metal contamination that could somehow bias TEF results. In contrast, significant differences were recorded among locations for all trace elements analysed. A Canonical Analysis of Principal Coordinates (CAP) revealed that 92% of the samples could be successfully classified according to their fishing location using TEF. We show that TEF can be an accurate, fast and reliable method to determine the geographic origin of bivalves, even among locations separated less than 1 km apart within the same estuarine system. Nonetheless, follow up studies are needed to determine if TEF can reliably discriminate between bivalves originating from different ecosystems.

  14. Human Sterol Regulatory Element-Binding Protein 1a Contributes Significantly to Hepatic Lipogenic Gene Expression

    OpenAIRE

    Andreas Bitter; Nüssler, Andreas K.; Thasler, Wolfgang E.; Kathrin Klein; Zanger, Ulrich M.; Matthias Schwab; Oliver Burk

    2015-01-01

    Background/Aims: Sterol regulatory element-binding protein (SREBP) 1, the master regulator of lipogenesis, was shown to be associated with non-alcoholic fatty liver disease, which is attributed to its major isoform SREBP1c. Based on studies in mice, the minor isoform SREBP1a is regarded as negligible for hepatic lipogenesis. This study aims to elucidate the expression and functional role of SREBP1a in human liver. Methods: mRNA expression of both isoforms was quantified in cohorts of human li...

  15. Investigating the Microscopic Location of Trace Elements in High-Alpine Glacier Ice

    Science.gov (United States)

    Avak, Sven Erik; Birrer, Mario; Laurent, Oscar; Guillong, Marcel; Wälle, Markus; Jenk, Theo Manuel; Bartels-Rausch, Thorsten; Schwikowski, Margit; Eichler, Anja

    2017-04-01

    Past changes in atmospheric pollution can be reconstructed from high-alpine ice core trace element records (Schwikowski et al., 2004). Percolation of meltwater alters the information originally stored in these environmental archives. Eichler et al. (2001) suggested that the preservation of major ions with respect to meltwater percolation depends on their location in the crystal ice lattice, i.e. grain boundaries versus grain interiors. Other studies have also focused on the effect of meltwater on organic pollutant concentrations as well as on stable isotope profiles in ice cores, whereas no information exists about trace elements. Here, we investigate for the first time the effect of the microscopic location of anthropogenic, dust and volcanic related trace elements on the behavior during meltwater percolation by using two different approaches. On the one hand we assess the microscopic location of trace elements indirectly by analyzing trace element concentrations in a high-alpine ice core, which has been shown to be affected by an inflow of meltwater, using discrete inductively coupled plasma mass spectrometry (ICP-MS). Impurities located at grain boundaries are prone to be removed by meltwater and tend to be depleted in the affected section of the record whereas those incorporated into the ice interior are preserved and not disturbed in the record. In the second approach we work towards a direct quantification of differences in concentrations of trace elements between ice grain boundaries and grain interiors in samples both from unaffected and affected sections of this ice core. Therefore we use cryocell laser ablation (LA) ICP-MS, which is the method of choice for the direct in situ chemical analysis of trace elements at a sub-millimeter resolution in glacier ice (Reinhardt et al., 2001, Della Lunga et al., 2014, Sneed et al., 2015). We will present first results of both approaches with regard to the evaluation of the potential of trace elements as environmental

  16. Tissue-Specific Enrichment of Lymphoma Risk Loci in Regulatory Elements.

    Science.gov (United States)

    Hayes, James E; Trynka, Gosia; Vijai, Joseph; Offit, Kenneth; Raychaudhuri, Soumya; Klein, Robert J

    2015-01-01

    Though numerous polymorphisms have been associated with risk of developing lymphoma, how these variants function to promote tumorigenesis is poorly understood. Here, we report that lymphoma risk SNPs, especially in the non-Hodgkin's lymphoma subtype chronic lymphocytic leukemia, are significantly enriched for co-localization with epigenetic marks of active gene regulation. These enrichments were seen in a lymphoid-specific manner for numerous ENCODE datasets, including DNase-hypersensitivity as well as multiple segmentation-defined enhancer regions. Furthermore, we identify putatively functional SNPs that are both in regulatory elements in lymphocytes and are associated with gene expression changes in blood. We developed an algorithm, UES, that uses a Monte Carlo simulation approach to calculate the enrichment of previously identified risk SNPs in various functional elements. This multiscale approach integrating multiple datasets helps disentangle the underlying biology of lymphoma, and more broadly, is generally applicable to GWAS results from other diseases as well.

  17. Evaluation of potential regulatory elements identified as DNase I hypersensitive sites in the CFTR gene

    DEFF Research Database (Denmark)

    Phylactides, M.; Rowntree, R.; Nuthall, H.

    2002-01-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) gene shows a complex pattern of expression, with temporal and spatial regulation that is not accounted for by elements in the promoter. One approach to identifying the regulatory elements for CFTR is the mapping of DNase I...... hypersensitive sites (DHS) within the locus. We previously identified at least 12 clusters of DHS across the CFTR gene and here further evaluate DHS in introns 2,3,10,16,17a, 18, 20 and 21 to assess their functional importance in regulation of CFTR gene expression. Transient transfections of enhancer....../reporter constructs containing the DHS regions showed that those in introns 20 and 21 augmented the activity of the CFTR promoter. Structural analysis of the DNA sequence at the DHS suggested that only the one intron 21 might be caused by inherent DNA structures. Cell specificity of the DHS suggested a role...

  18. Comparative analysis of RNA regulatory elements of amino acid metabolism genes in Actinobacteria

    Directory of Open Access Journals (Sweden)

    Gelfand Mikhail S

    2005-10-01

    Full Text Available Abstract Background Formation of alternative structures in mRNA in response to external stimuli, either direct or mediated by proteins or other RNAs, is a major mechanism of regulation of gene expression in bacteria. This mechanism has been studied in detail using experimental and computational approaches in proteobacteria and Firmicutes, but not in other groups of bacteria. Results Comparative analysis of amino acid biosynthesis operons in Actinobacteria resulted in identification of conserved regions upstream of several operons. Classical attenuators were predicted upstream of trp operons in Corynebacterium spp. and Streptomyces spp., and trpS and leuS genes in some Streptomyces spp. Candidate leader peptides with terminators were observed upstream of ilvB genes in Corynebacterium spp., Mycobacterium spp. and Streptomyces spp. Candidate leader peptides without obvious terminators were found upstream of cys operons in Mycobacterium spp. and several other species. A conserved pseudoknot (named LEU element was identified upstream of leuA operons in most Actinobacteria. Finally, T-boxes likely involved in the regulation of translation initiation were observed upstream of ileS genes from several Actinobacteria. Conclusion The metabolism of tryptophan, cysteine and leucine in Actinobacteria seems to be regulated on the RNA level. In some cases the mechanism is classical attenuation, but in many cases some components of attenuators are missing. The most interesting case seems to be the leuA operon preceded by the LEU element that may fold into a conserved pseudoknot or an alternative structure. A LEU element has been observed in a transposase gene from Bifidobacterium longum, but it is not conserved in genes encoding closely related transposases despite a very high level of protein similarity. One possibility is that the regulatory region of the leuA has been co-opted from some element involved in transposition. Analysis of phylogenetic patterns

  19. A peroxisome proliferator response elements regulatory system in xenopus oocytes and its application

    Institute of Scientific and Technical Information of China (English)

    YAN Jin; FAN Chun-lei; WO Xing-de; GAO Li-ping

    2005-01-01

    Background Peroxisome proliferator-activated receptor-gamma (PPARγ) is a kind of ligand-activated transcription factors binding to peroxisome proliferator response element (PPRE), a specific recognition site. It is thought to play a critical role in glucose and lipid metabolism and in inflammation control. The aim of this study was to establish a new cellular model for the quick screening of lipid-lowering drugs, which may be effective as PPAR-γ ligands on the PPRE-mediated pathway regulatory system. Methods Two plasmids were constructed: pXOE-PPARγ, in which the human PPARγ gene was in the downstream of TFⅢA gene promoter, and pLXRN-PPRE-d2EGFP, in which the enhanced green fluorescent protein (EGFP) gene was subcloned into PPRE. The xenopus oocytes were injected with these two plamids, and consequently treated with prostaglandin E1, pioglitazone, and different kinds of lipid-lowering drugs. After 3 days, the oocytes were observed under a fluorescence microscope. To confirm the drug action,we injected pXOE-PPARγ plasmid into the oocytes, which then treated with prostaglandin E1and Hawthorn flavonoids. The mass of expressed lipoprotein lipase (LPL) in the cells was determined by enzyme labeling linked immunosorbent assay (ELISA).Conclusions It is possible to establish a PPRE regulatory EGFP reporter system in xenopus oocytes to monitor the activity of PPARγ ligand. Hawthorn flavonoids can increase the expression of gene downsteam of PPRE by effect on the PPRE pathway regulatory system.

  20. Syringe filtration methods for examining dissolved and colloidal trace element distributions in remote field locations

    Science.gov (United States)

    Shiller, Alan M.

    2003-01-01

    It is well-established that sampling and sample processing can easily introduce contamination into dissolved trace element samples if precautions are not taken. However, work in remote locations sometimes precludes bringing bulky clean lab equipment into the field and likewise may make timely transport of samples to the lab for processing impossible. Straightforward syringe filtration methods are described here for collecting small quantities (15 mL) of 0.45- and 0.02-microm filtered river water in an uncontaminated manner. These filtration methods take advantage of recent advances in analytical capabilities that require only small amounts of waterfor analysis of a suite of dissolved trace elements. Filter clogging and solute rejection artifacts appear to be minimal, although some adsorption of metals and organics does affect the first approximately 10 mL of water passing through the filters. Overall the methods are clean, easy to use, and provide reproducible representations of the dissolved and colloidal fractions of trace elements in river waters. Furthermore, sample processing materials can be prepared well in advance in a clean lab and transported cleanly and compactly to the field. Application of these methods is illustrated with data from remote locations in the Rocky Mountains and along the Yukon River. Evidence from field flow fractionation suggests that the 0.02-microm filters may provide a practical cutoff to distinguish metals associated with small inorganic and organic complexes from those associated with silicate and oxide colloids.

  1. Engineering Synthetic cis-Regulatory Elements for Simultaneous Recognition of Three Transcriptional Factors in Bacteria.

    Science.gov (United States)

    Amores, Gerardo Ruiz; Guazzaroni, María-Eugenia; Silva-Rocha, Rafael

    2015-12-18

    Recognition of cis-regulatory elements by transcription factors (TF) at target promoters is crucial to gene regulation in bacteria. In this process, binding of TFs to their cognate sequences depends on a set of physical interactions between these proteins and specific nucleotides in the operator region. Previously, we showed that in silico optimization algorithms are able to generate short sequences that are recognized by two different TFs of Escherichia coli, namely, CRP and IHF, thus generating an AND logic gate. Here, we expanded this approach in order to engineer DNA sequences that can be simultaneously recognized by three unrelated TFs (CRP, IHF, and Fis). Using in silico optimization and experimental validation strategies, we were able to obtain a candidate promoter (Plac-CFI1) regulated by only two TFs with an AND logic, thus demonstrating a limitation in the design. Subsequently, we modified the algorithm to allow the optimization of extended sequences, and were able to design two synthetic promoters (PCFI20-1 and PCFI22-5) that were functional in vivo. Expression assays in E. coli mutant strains for each TF revealed that while CRP positively regulates the promoter activities, IHF and Fis are strong repressors of both the promoter variants. Taken together, our results demonstrate the potential of in silico strategies in bacterial synthetic promoter engineering. Furthermore, the study also shows how small modifications in cis-regulatory elements can drastically affect the final logic of the resulting promoter.

  2. Lanosterol metabolism and sterol regulatory element binding protein (SREBP) expression in male germ cell maturation.

    Science.gov (United States)

    Fon Tacer, Klementina; Kalanj-Bognar, Svjetlana; Waterman, Michael R; Rozman, Damjana

    2003-06-01

    Expression of genes involved in cholesterol biosynthesis in male germ cells is insensitive to the negative cholesterol feedback regulation, in contrast to cholesterol level-sensitive/sterol regulatory element binding protein (SREBP)-dependent gene regulation in somatic cells. The role of sterol regulatory element binding proteins in spermatogenic cells was an enigma until recently, when a soluble, 55kDa cholesterol-insensitive form of SREBP2 (SREBP2gc) was discovered [Mol. Cell. Endocrinol. 22 (2002) 8478], being translated from a germ cell-specific SREBP2 mRNA. Our RT-PCR results also show that SREBP2 as well as SREBP1c mRNAs are detectable in prepubertal and postpubertal male germ cells while SREBP1a is not detected. Surprisingly, three SREBP2 immunoreactive proteins (72, 63 and 55kDa), that are not present in mouse liver nuclei, reside in testis nuclei of prepubertal and adult mice. The 55kDa protein is likely SREBP2gc, the other two isoforms are novel. HPLC measurements in liver and testes of fasted prepubertal and postpubertal mice showed no significant difference in cholesterol level. However, FF-MAS and lanosterol/testis-meiosis activating sterol (T-MAS) intermediates that are detectable mainly in testes, increase in fasted postpubertal mice which coincides well with the elevated level of 68kDa SREBP2. Similar to SREBP2gc, the two novel SREBP2 immunoreactive proteins seem to be insensitive to the level of cholesterol.

  3. A biophysical model for identifying splicing regulatory elements and their interactions.

    Directory of Open Access Journals (Sweden)

    Ji Wen

    Full Text Available Alternative splicing (AS of precursor mRNA (pre-mRNA is a crucial step in the expression of most eukaryotic genes. Splicing factors (SFs play an important role in AS regulation by binding to the cis-regulatory elements on the pre-mRNA. Although many splicing factors (SFs and their binding sites have been identified, their combinatorial regulatory effects remain to be elucidated. In this paper, we derive a biophysical model for AS regulation that integrates combinatorial signals of cis-acting splicing regulatory elements (SREs and their interactions. We also develop a systematic framework for model inference. Applying the biophysical model to a human RNA-Seq data set, we demonstrate that our model can explain 49.1%-66.5% variance of the data, which is comparable to the best result achieved by biophysical models for transcription. In total, we identified 119 SRE pairs between different regions of cassette exons that may regulate exon or intron definition in splicing, and 77 SRE pairs from the same region that may arise from a long motif or two different SREs bound by different SFs. Particularly, putative binding sites of polypyrimidine tract-binding protein (PTB, heterogeneous nuclear ribonucleoprotein (hnRNP F/H and E/K are identified as interacting SRE pairs, and have been shown to be consistent with the interaction models proposed in previous experimental results. These results show that our biophysical model and inference method provide a means of quantitative modeling of splicing regulation and is a useful tool for identifying SREs and their interactions. The software package for model inference is available under an open source license.

  4. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition.

    Directory of Open Access Journals (Sweden)

    Arindam Deb

    Full Text Available Combinations of cis-regulatory elements (CREs present at the promoters facilitate the binding of several transcription factors (TFs, thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic

  5. Deciphering Cis-Regulatory Element Mediated Combinatorial Regulation in Rice under Blast Infected Condition.

    Science.gov (United States)

    Deb, Arindam; Kundu, Sudip

    2015-01-01

    Combinations of cis-regulatory elements (CREs) present at the promoters facilitate the binding of several transcription factors (TFs), thereby altering the consequent gene expressions. Due to the eminent complexity of the regulatory mechanism, the combinatorics of CRE-mediated transcriptional regulation has been elusive. In this work, we have developed a new methodology that quantifies the co-occurrence tendencies of CREs present in a set of promoter sequences; these co-occurrence scores are filtered in three consecutive steps to test their statistical significance; and the significantly co-occurring CRE pairs are presented as networks. These networks of co-occurring CREs are further transformed to derive higher order of regulatory combinatorics. We have further applied this methodology on the differentially up-regulated gene-sets of rice tissues under fungal (Magnaporthe) infected conditions to demonstrate how it helps to understand the CRE-mediated combinatorial gene regulation. Our analysis includes a wide spectrum of biologically important results. The CRE pairs having a strong tendency to co-occur often exhibit very similar joint distribution patterns at the promoters of rice. We couple the network approach with experimental results of plant gene regulation and defense mechanisms and find evidences of auto and cross regulation among TF families, cross-talk among multiple hormone signaling pathways, similarities and dissimilarities in regulatory combinatorics between different tissues, etc. Our analyses have pointed a highly distributed nature of the combinatorial gene regulation facilitating an efficient alteration in response to fungal attack. All together, our proposed methodology could be an important approach in understanding the combinatorial gene regulation. It can be further applied to unravel the tissue and/or condition specific combinatorial gene regulation in other eukaryotic systems with the availability of annotated genomic sequences and suitable

  6. Functional Analysis of Multiple Transcription Factor Sites in a Regulatory Element of Human ε-Globin Gene

    Institute of Scientific and Technical Information of China (English)

    Chun-Hui HOU; Jian HUANG; Ruo-Lan QIAN

    2004-01-01

    The developmental control of the human ε-globin gene expression is mediated by transcriptional regulatory elements in the 5' flanking DNA of this gene. A previously identified negative regulatory element (-3028 to -2902 bp, termed ε-NRAII) was analyzed and one putative NF-κB site and two GATA sites locate at -3004 bp, -2975 bp and -2948 bp were characterized. Electrophoresis mobility shift assay (EMSA)showed that the putative NF-κB site was specifically bound by nuclear proteins of K562 cells. Data obtained from transient transfection showed that the expression of reporter gene could be upregulated about 50% or 100% respectively when ε-NRAII was inserted upstream of the SV40 promoter or ε-globin gene proximal promoter (-177 bp to +1 bp), suggesting that ε-NRAII might not be a classic silencer. Mutation in the putative NF-κB site or in the GATA site (at-2975 bp) slightly reduced the expression of reporter gene driven by SV40 promoter or ε-globin gene proximal promoter. However, the mutation of GATA site at -2948 bp remarkably reduced the reporter gene activity driven by SV40 promoter, but not by ε-globin gene proximal promoter. Further mutation analysis showed that the negative effect of mutation in GATA site at -2948 bp on SV40 promoter was not affected by the mutation of the putative NF-κB site, whereas it could be abolished by the mutation of GATA site at -2975 bp. Furthermore, the mutation of both GATA sites could synergistically reduce the reporter gene activity driven by ε-globin gene proximal promoter. Those results suggested that ε-NRAII might function differently on the SV40 promoter and ε-globin gene proximal promoter.

  7. Context and location dependence of adaptive Foxp3+ regulatory T cell formation during immunopathological conditions

    OpenAIRE

    Heiber, Joshua F.; Geiger, Terrence L

    2012-01-01

    Circulating Foxp3+ regulatory T cells (Treg) may arise in the thymus (natural Treg, nTreg) or through the adaptive upregulation of Foxp3 after T cell activation (induced Treg, iTreg). In this brief review, we explore evidence for the formation and function of iTreg during pathologic conditions. Determining the ontogeny and function of Treg populations has relied on the use of manipulated systems in which either iTreg or nTreg are absent, or lineage tracing of T cell clones through repertoire ...

  8. Lattice location of the group V elements As and Sb in ZnO

    CERN Document Server

    Wahl, Ulrich; Decoster, Stefan; Mendonça, Tânia

    2009-01-01

    The lattice locations of the potential p-type dopants arsenic and antimony in single-crystalline ZnO were studied by means of the electron emission channeling method following the implantation of radioactive $^{73}$As and $^{124}$Sb isotopes. The majority of the implanted As and Sb probe atoms was found to occupy substitutional Zn sites, with the possible fraction on substitutional O sites being at maximum a few percent. The obtained results illustrate the difficulty in introducing oversized group V impurities on O sites and thus put further into question whether these elements may act as simple chemical dopants in ZnO.

  9. Lattice location of the group V elements As and Sb in ZnO

    CERN Document Server

    Wahl, U; Decoster, S; Mendonca, T; 10.1016/j.physb.2009.08.174

    2009-01-01

    The lattice locations of the potential p-type dopants arsenic and antimony in single-crystalline ZnO were studied by means of the electron emission channeling method following the implantation of radioactive 73As and 124Sb isotopes. The majority of the implanted As and Sb probe atoms was found to occupy substitutional Zn sites, with the possible fraction on substitutional O sites being at maximum a few percent. The obtained results illustrate the difficulty in introducing oversized group V impurities on O sites and thus put further into question whether these elements may act as simple chemical dopants in ZnO.

  10. INFLUENCE OF BROKEN ROTOR BARS LOCATION IN THE SQUIRREL CAGE INDUCTION MOTOR USING FINITE ELEMENT METHOD

    Directory of Open Access Journals (Sweden)

    N. Halem

    2013-06-01

    Full Text Available It is well known that the number of broken bars and varying load affect on the amplitudes of specific harmonic components in the process analysis of induction motors under broken rotor bars. The location of broken bars is an important factor which affects the diagnosis of the broken bars defect. In this paper the simulation is determinate for different cases for distribution of broken bars under induction motor pole in order to show the impact of broken bars location upon the amplitude of harmonic fault. The simulation results are obtained by using time stepping finite elements (TSFE method. The geometrical characteristics of motor, the effects of slotting and the magnetic saturation of lamination core are included in induction motor model.

  11. INFLUENCE OF BROKEN ROTOR BARS LOCATION IN THE SQUIRREL CAGE INDUCTION MOTOR USING FINITE ELEMENT METHOD

    Directory of Open Access Journals (Sweden)

    N. Halem

    2015-07-01

    Full Text Available It is well known that the number of broken bars and varying load affect on the amplitudes of specific harmonic components  in the process analysis of induction motors under broken rotor bars. The location of broken bars is an important factor which affects the diagnosis of the broken bars defect. In this paper the simulation is determinate for different cases for distribution of broken bars under induction motor pole in order to show the impact of broken bars location upon the amplitude of harmonic fault. The simulation results are obtained by using time stepping finite elements (TSFE method. The geometrical characteristics of motor, the effects of slotting and the magnetic saturation of lamination core are included in induction motor model.

  12. Identification of putative cis-regulatory elements in Cryptosporidium parvum by de novo pattern finding

    Directory of Open Access Journals (Sweden)

    Kissinger Jessica C

    2007-01-01

    Full Text Available Abstract Background Cryptosporidium parvum is a unicellular eukaryote in the phylum Apicomplexa. It is an obligate intracellular parasite that causes diarrhea and is a significant AIDS-related pathogen. Cryptosporidium parvum is not amenable to long-term laboratory cultivation or classical molecular genetic analysis. The parasite exhibits a complex life cycle, a broad host range, and fundamental mechanisms of gene regulation remain unknown. We have used data from the recently sequenced genome of this organism to uncover clues about gene regulation in C. parvum. We have applied two pattern finding algorithms MEME and AlignACE to identify conserved, over-represented motifs in the 5' upstream regions of genes in C. parvum. To support our findings, we have established comparative real-time -PCR expression profiles for the groups of genes examined computationally. Results We find that groups of genes that share a function or belong to a common pathway share upstream motifs. Different motifs are conserved upstream of different groups of genes. Comparative real-time PCR studies show co-expression of genes within each group (in sub-sets during the life cycle of the parasite, suggesting co-regulation of these genes may be driven by the use of conserved upstream motifs. Conclusion This is one of the first attempts to characterize cis-regulatory elements in the absence of any previously characterized elements and with very limited expression data (seven genes only. Using de novo pattern finding algorithms, we have identified specific DNA motifs that are conserved upstream of genes belonging to the same metabolic pathway or gene family. We have demonstrated the co-expression of these genes (often in subsets using comparative real-time-PCR experiments thus establishing evidence for these conserved motifs as putative cis-regulatory elements. Given the lack of prior information concerning expression patterns and organization of promoters in C. parvum we

  13. Putative cis-regulatory elements associated with heat shock genes activated during excystation of Cryptosporidium parvum.

    Directory of Open Access Journals (Sweden)

    Benjamin Cohn

    Full Text Available BACKGROUND: Cryptosporidiosis is a ubiquitous infectious disease, caused by the protozoan parasites Cryptosporidium hominis and C. parvum, leading to acute, persistent and chronic diarrhea worldwide. Although the complications of this disease can be serious, even fatal, in immunocompromised patients of any age, they have also been found to lead to long term effects, including growth inhibition and impaired cognitive development, in infected immunocompetent children. The Cryptosporidium life cycle alternates between a dormant stage, the oocyst, and a highly replicative phase that includes both asexual vegetative stages as well as sexual stages, implying fine genetic regulatory mechanisms. The parasite is extremely difficult to study because it cannot be cultured in vitro and animal models are equally challenging. The recent publication of the genome sequence of C. hominis and C. parvum has, however, significantly advanced our understanding of the biology and pathogenesis of this parasite. METHODOLOGY/PRINCIPAL FINDINGS: Herein, our goal was to identify cis-regulatory elements associated with heat shock response in Cryptosporidium using a combination of in silico and real time RT-PCR strategies. Analysis with Gibbs-Sampling algorithms of upstream non-translated regions of twelve genes annotated as heat shock proteins in the Cryptosporidium genome identified a highly conserved over-represented sequence motif in eleven of them. RT-PCR analyses, described herein and also by others, show that these eleven genes bearing the putative element are induced concurrent with excystation of parasite oocysts via heat shock. CONCLUSIONS/SIGNIFICANCE: Our analyses suggest that occurrences of a motif identified in the upstream regions of the Cryptosporidium heat shock genes represent parts of the transcriptional apparatus and function as stress response elements that activate expression of these genes during excystation, and possibly at other stages in the life

  14. In vivo redundant function of the 3' IgH regulatory element HS3b in the mouse.

    Science.gov (United States)

    Bébin, Anne-Gaëlle; Carrion, Claire; Marquet, Marie; Cogné, Nadine; Lecardeur, Sandrine; Cogné, Michel; Pinaud, Eric

    2010-04-01

    In the mouse, the regulatory region located at the 3' end of the IgH locus includes four transcriptional enhancers: HS3a, HS1-2, HS3b, and HS4; the first three lie in a quasi-palindromic structure. Although the upstream elements HS3a and HS1-2 proved dispensable for Ig expression and class switch recombination (CSR), the joint deletion of HS3b and HS4 led to a consistent decrease in IgH expression in resting B cells and to a major CSR defect. Within this pair of distal enhancers, it was questionable whether HS3b and HS4 could be considered individually as elements critical for IgH expression and/or CSR. Studies in HS4-deficient mice recently revealed the role of HS4 as restricted to Igmicro-chain expression from the pre-B to the mature B cell stage and left HS3b as the last candidate for CSR regulation. Our present study finally invalidates the hypothesis that CSR could mostly rely on HS3b itself. B cells from HS3b-deficient animals undergo normal proliferation, germline transcription, and CSR upon in vitro stimulation with LPS; in vivo Ag-specific responses are not affected. In conclusion, our study highlights a major effect of the global ambiance of the IgH locus; enhancers demonstrated as being strongly synergistic in transgenes turn out to be redundant in their endogenous context.

  15. Genome-wide identification of regulatory elements and reconstruction of gene regulatory networks of the green alga Chlamydomonas reinhardtii under carbon deprivation.

    Directory of Open Access Journals (Sweden)

    Flavia Vischi Winck

    Full Text Available The unicellular green alga Chlamydomonas reinhardtii is a long-established model organism for studies on photosynthesis and carbon metabolism-related physiology. Under conditions of air-level carbon dioxide concentration [CO2], a carbon concentrating mechanism (CCM is induced to facilitate cellular carbon uptake. CCM increases the availability of carbon dioxide at the site of cellular carbon fixation. To improve our understanding of the transcriptional control of the CCM, we employed FAIRE-seq (formaldehyde-assisted Isolation of Regulatory Elements, followed by deep sequencing to determine nucleosome-depleted chromatin regions of algal cells subjected to carbon deprivation. Our FAIRE data recapitulated the positions of known regulatory elements in the promoter of the periplasmic carbonic anhydrase (Cah1 gene, which is upregulated during CCM induction, and revealed new candidate regulatory elements at a genome-wide scale. In addition, time series expression patterns of 130 transcription factor (TF and transcription regulator (TR genes were obtained for cells cultured under photoautotrophic condition and subjected to a shift from high to low [CO2]. Groups of co-expressed genes were identified and a putative directed gene-regulatory network underlying the CCM was reconstructed from the gene expression data using the recently developed IOTA (inner composition alignment method. Among the candidate regulatory genes, two members of the MYB-related TF family, Lcr1 (Low-CO 2 response regulator 1 and Lcr2 (Low-CO2 response regulator 2, may play an important role in down-regulating the expression of a particular set of TF and TR genes in response to low [CO2]. The results obtained provide new insights into the transcriptional control of the CCM and revealed more than 60 new candidate regulatory genes. Deep sequencing of nucleosome-depleted genomic regions indicated the presence of new, previously unknown regulatory elements in the C. reinhardtii genome

  16. Failure location prediction by finite element analysis for an additive manufactured mandible implant.

    Science.gov (United States)

    Huo, Jinxing; Dérand, Per; Rännar, Lars-Erik; Hirsch, Jan-Michaél; Gamstedt, E Kristofer

    2015-09-01

    In order to reconstruct a patient with a bone defect in the mandible, a porous scaffold attached to a plate, both in a titanium alloy, was designed and manufactured using additive manufacturing. Regrettably, the implant fractured in vivo several months after surgery. The aim of this study was to investigate the failure of the implant and show a way of predicting the mechanical properties of the implant before surgery. All computed tomography data of the patient were preprocessed to remove metallic artefacts with metal deletion technique before mandible geometry reconstruction. The three-dimensional geometry of the patient's mandible was also reconstructed, and the implant was fixed to the bone model with screws in Mimics medical imaging software. A finite element model was established from the assembly of the mandible and the implant to study stresses developed during mastication. The stress distribution in the load-bearing plate was computed, and the location of main stress concentration in the plate was determined. Comparison between the fracture region and the location of the stress concentration shows that finite element analysis could serve as a tool for optimizing the design of mandible implants.

  17. cis-regulatory elements involved in ultraviolet light regulation and plant defense.

    Science.gov (United States)

    Wingender, R; Röhrig, H; Höricke, C; Schell, J

    1990-10-01

    An elicitor-regulated transient expression system was established in soybean protoplasts that allowed the identification of cis-regulatory elements involved in plant defense. The 5' region of an ultraviolet (UV) light-inducible and elicitor-inducible chs gene (chs1) of soybean was subjected to deletion analysis with the help of chimeric chs-nptII/gus gene constructs. This analysis delimited the sequences necessary for elicitor inducibility to -175 and -134 of the chs1 promoter. The same soybean sequences were able to direct elicitor inducibility in parsley protoplasts, suggesting a conserved function of cis-acting elements involved in plant defense. In addition, this region of the soybean promoter also promotes UV light inducibility in parsley protoplasts. However, in contrast to the elicitor induction, correct regulation was not observed after UV light induction when sequences downstream of -75 were replaced by a heterologous minimal promoter. This result indicates that at least two cis-acting elements are involved in UV light induction.

  18. Characterization of Putative cis-Regulatory Elements in Genes Preferentially Expressed in Arabidopsis Male Meiocytes

    Directory of Open Access Journals (Sweden)

    Junhua Li

    2014-01-01

    Full Text Available Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes.

  19. Cloning of a regulatory gene from Streptomyces cattleya and study on its cis-acting element.

    Science.gov (United States)

    Shang, G; Wang, Y

    2000-08-01

    Primers were designed from the highly conserved protein regions of luxl, one of the two component regulatory genes in prokaryotic, and an about 180 bp DNA from Streptomyces cattleya was amplified by PCR. Using this fragment as a probe, Southern hybridization was accomplished with chromosome DNA of S. cattleya, leading to the cloning of the foreign DNA into pBluescript (SK-). DNA sequencing and frame analysis showed an intact ORF consisting of 1800 bp; the G+C composition was 69.3%. Upstream from the ORF was a 249 bp AT rich region, downstream of the ORF several complicated secondary structures were found. DNA-binding assay by gel retardation demonstrated the presence of a protein that specifically bound to the 249 bp AT rich region. The region also showed anomalous electrophoretic mobility at low temperature, like that of a bent DNA molecule, indicating that the region contains a cis-acting element.

  20. Cloning of a regulatory gene from Streptomyces cattleya and study on its cis-acting element

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    Primers were designed from the highly conserved protein regions of luxI, one of the two component regulatory genes in prokaryotic, and an about 180 bp DNA from Streptomyces cattleya was amplified by PCR. Using this fragment as a probe, Southern hybridization was accomplished with chromosome DNA of S. cattleya, leading to the cloning of the foreign DNA into pBluescript (SK-). DNA sequencing and frame analysis showed an intact ORF consisting of 1 800 bp; the G+C composition was 69.3%. Upstream from the ORF was a 249 bp AT rich region, downstream of the ORF several complicated secondary structures were found. DNA-binding assay by gel retardation demonstrated the presence of a protein that specifically bound to the 249 bp AT rich region. The region also showed anomalous electrophoretic mobility at low temperature, like that of a bent DNA molecule, indicating that the region contains a cis-acting element.

  1. Lessons from Domestication: Targeting Cis-Regulatory Elements for Crop Improvement.

    Science.gov (United States)

    Swinnen, Gwen; Goossens, Alain; Pauwels, Laurens

    2016-06-01

    Domestication of wild plant species has provided us with crops that serve our human nutritional needs. Advanced DNA sequencing has propelled the unveiling of underlying genetic changes associated with domestication. Interestingly, many changes reside in cis-regulatory elements (CREs) that control the expression of an unmodified coding sequence. Sequence variation in CREs can impact gene expression levels, but also developmental timing and tissue specificity of expression. When genes are involved in multiple pathways or active in several organs and developmental stages CRE modifications are favored in contrast to mutations in coding regions, due to the lack of detrimental pleiotropic effects. Therefore, learning from domestication, we propose that CREs are interesting targets for genome editing to create new alleles for plant breeding.

  2. Crystal Structure of the Lysine Riboswitch Regulatory mRNA Element

    Energy Technology Data Exchange (ETDEWEB)

    Garst, A.; Heroux, A; Rambo, R; Batey, R

    2008-01-01

    Riboswitches are metabolite-sensitive elements found in mRNAs that control gene expression through a regulatory secondary structural switch. Along with regulation of lysine biosynthetic genes, mutations within the lysine-responsive riboswitch (L-box) play a role in the acquisition of resistance to antimicrobial lysine analogs. To understand the structural basis for lysine binding, we have determined the 2.8{angstrom} resolution crystal structure of lysine bound to the Thermotoga maritima asd lysine riboswitch ligand-binding domain. The structure reveals a complex architecture scaffolding a binding pocket completely enveloping lysine. Mutations conferring antimicrobial resistance cluster around this site as well as highly conserved long range interactions, indicating that they disrupt lysine binding or proper folding of the RNA. Comparison of the free and bound forms by x-ray crystallography, small angle x-ray scattering, and chemical probing reveals almost identical structures, indicating that lysine induces only limited and local conformational changes upon binding.

  3. Cloning of a regulatory gene from Streptomyces cattleya and study on its cis-acting element

    Institute of Scientific and Technical Information of China (English)

    尚广东; 王以光

    2000-01-01

    Primers were designed from the highly conserved protein regions of luxl, one of the two component regulatory genes in prokaryotic, and an about 180 bp DNA from Streptomyces cattleya was amplified by PCR. Using this fragment as a probe, Southern hybridization was accomplished with chromosome DNA of S. cattleya, leading to the cloning of the foreign DNA into pBluescript (SK-). DNA sequencing and frame analysis showed an intact ORF consisting of 1 800 bp; the G+C composition was 69.3%. Upstream from the ORF was a 249 bp AT rich region, downstream of the ORF several complicated secondary structures were found. DNA-binding assay by gel retardation demonstrated the presence of a protein that specifically bound to the 249 bp AT rich region. The region also showed anomalous electrophoretic mobility at low temperature, like that of a bent DNA molecule, indicating that the region contains a c/s-acting element.

  4. Genome-wide prediction of transcriptional regulatory elements of human promoters using gene expression and promoter analysis data

    Directory of Open Access Journals (Sweden)

    Kim Seon-Young

    2006-07-01

    Full Text Available Abstract Background A complete understanding of the regulatory mechanisms of gene expression is the next important issue of genomics. Many bioinformaticians have developed methods and algorithms for predicting transcriptional regulatory mechanisms from sequence, gene expression, and binding data. However, most of these studies involved the use of yeast which has much simpler regulatory networks than human and has many genome wide binding data and gene expression data under diverse conditions. Studies of genome wide transcriptional networks of human genomes currently lag behind those of yeast. Results We report herein a new method that combines gene expression data analysis with promoter analysis to infer transcriptional regulatory elements of human genes. The Z scores from the application of gene set analysis with gene sets of transcription factor binding sites (TFBSs were successfully used to represent the activity of TFBSs in a given microarray data set. A significant correlation between the Z scores of gene sets of TFBSs and individual genes across multiple conditions permitted successful identification of many known human transcriptional regulatory elements of genes as well as the prediction of numerous putative TFBSs of many genes which will constitute a good starting point for further experiments. Using Z scores of gene sets of TFBSs produced better predictions than the use of mRNA levels of a transcription factor itself, suggesting that the Z scores of gene sets of TFBSs better represent diverse mechanisms for changing the activity of transcription factors in the cell. In addition, cis-regulatory modules, combinations of co-acting TFBSs, were readily identified by our analysis. Conclusion By a strategic combination of gene set level analysis of gene expression data sets and promoter analysis, we were able to identify and predict many transcriptional regulatory elements of human genes. We conclude that this approach will aid in decoding

  5. HBVRegDB: Annotation, comparison, detection and visualization of regulatory elements in hepatitis B virus sequences

    Directory of Open Access Journals (Sweden)

    Firth Andrew E

    2007-12-01

    Full Text Available Abstract Background The many Hepadnaviridae sequences available have widely varied functional annotation. The genomes are very compact (~3.2 kb but contain multiple layers of functional regulatory elements in addition to coding regions. Key regions are subject to purifying selection, as mutations in these regions will produce non-functional viruses. Results These genomic sequences have been organized into a structured database to facilitate research at the molecular level. HBVRegDB is a comparative genomic analysis tool with an integrated underlying sequence database. The database contains genomic sequence data from representative viruses. In addition to INSDC and RefSeq annotation, HBVRegDB also contains expert and systematically calculated annotations (e.g. promoters and comparative genome analysis results (e.g. blastn, tblastx. It also contains analyses based on curated HBV alignments. Information about conserved regions – including primary conservation (e.g. CDS-Plotcon and RNA secondary structure predictions (e.g. Alidot – is integrated into the database. A large amount of data is graphically presented using the GBrowse (Generic Genome Browser adapted for analysis of viral genomes. Flexible query access is provided based on any annotated genomic feature. Novel regulatory motifs can be found by analysing the annotated sequences. Conclusion HBVRegDB serves as a knowledge database and as a comparative genomic analysis tool for molecular biologists investigating HBV. It is publicly available and complementary to other viral and HBV focused datasets and tools http://hbvregdb.otago.ac.nz. The availability of multiple and highly annotated sequences of viral genomes in one database combined with comparative analysis tools facilitates detection of novel genomic elements.

  6. Regulatory elements controlling pituitary-specific expression of the human prolactin gene.

    Science.gov (United States)

    Peers, B; Voz, M L; Monget, P; Mathy-Hartert, M; Berwaer, M; Belayew, A; Martial, J A

    1990-09-01

    We have performed transfection and DNase I footprinting experiments to investigate pituitary-specific expression of the human prolactin (hPRL) gene. When fused to the chloramphenicol acetyltransferase (CAT) reporter gene, 5,000 base pairs of the 5'-flanking sequences of the hPRL gene were able to drive high cat gene expression in prolactin-expressing GH3B6 cells specifically. Deletion analysis indicated that this pituitary-specific expression was controlled by three main positive regulatory regions. The first was located just upstream from the TATA box between coordinates -40 and -250 (proximal region). We have previously shown that three motifs of this region bind the pituitary-specific Pit-1 factor. The second positive region was located in the vicinity of coordinates -1300 to -1750 (distal region). DNase I footprinting assays revealed that eight DNA motifs of this distal region bound protein Pit-1 and that two other motifs were recognized by ubiquitous factors, one of which seems to belong to the AP-1 (jun) family. The third positive region was located further upstream, between -3500 and -5000 (superdistal region). This region appears to enhance transcription only in the presence of the distal region.

  7. Shaping skeletal growth by modular regulatory elements in the Bmp5 gene.

    Directory of Open Access Journals (Sweden)

    Catherine Guenther

    2008-12-01

    Full Text Available Cartilage and bone are formed into a remarkable range of shapes and sizes that underlie many anatomical adaptations to different lifestyles in vertebrates. Although the morphological blueprints for individual cartilage and bony structures must somehow be encoded in the genome, we currently know little about the detailed genomic mechanisms that direct precise growth patterns for particular bones. We have carried out large-scale enhancer surveys to identify the regulatory architecture controlling developmental expression of the mouse Bmp5 gene, which encodes a secreted signaling molecule required for normal morphology of specific skeletal features. Although Bmp5 is expressed in many skeletal precursors, different enhancers control expression in individual bones. Remarkably, we show here that different enhancers also exist for highly restricted spatial subdomains along the surface of individual skeletal structures, including ribs and nasal cartilages. Transgenic, null, and regulatory mutations confirm that these anatomy-specific sequences are sufficient to trigger local changes in skeletal morphology and are required for establishing normal growth rates on separate bone surfaces. Our findings suggest that individual bones are composite structures whose detailed growth patterns are built from many smaller lineage and gene expression domains. Individual enhancers in BMP genes provide a genomic mechanism for controlling precise growth domains in particular cartilages and bones, making it possible to separately regulate skeletal anatomy at highly specific locations in the body.

  8. Identification of a cis-regulatory element by transient analysis of co-ordinately regulated genes

    Directory of Open Access Journals (Sweden)

    Allan Andrew C

    2008-07-01

    Full Text Available Abstract Background Transcription factors (TFs co-ordinately regulate target genes that are dispersed throughout the genome. This co-ordinate regulation is achieved, in part, through the interaction of transcription factors with conserved cis-regulatory motifs that are in close proximity to the target genes. While much is known about the families of transcription factors that regulate gene expression in plants, there are few well characterised cis-regulatory motifs. In Arabidopsis, over-expression of the MYB transcription factor PAP1 (PRODUCTION OF ANTHOCYANIN PIGMENT 1 leads to transgenic plants with elevated anthocyanin levels due to the co-ordinated up-regulation of genes in the anthocyanin biosynthetic pathway. In addition to the anthocyanin biosynthetic genes, there are a number of un-associated genes that also change in expression level. This may be a direct or indirect consequence of the over-expression of PAP1. Results Oligo array analysis of PAP1 over-expression Arabidopsis plants identified genes co-ordinately up-regulated in response to the elevated expression of this transcription factor. Transient assays on the promoter regions of 33 of these up-regulated genes identified eight promoter fragments that were transactivated by PAP1. Bioinformatic analysis on these promoters revealed a common cis-regulatory motif that we showed is required for PAP1 dependent transactivation. Conclusion Co-ordinated gene regulation by individual transcription factors is a complex collection of both direct and indirect effects. Transient transactivation assays provide a rapid method to identify direct target genes from indirect target genes. Bioinformatic analysis of the promoters of these direct target genes is able to locate motifs that are common to this sub-set of promoters, which is impossible to identify with the larger set of direct and indirect target genes. While this type of analysis does not prove a direct interaction between protein and DNA

  9. Identification of distal cis-regulatory elements at mouse mitoferrin loci using zebrafish transgenesis.

    Science.gov (United States)

    Amigo, Julio D; Yu, Ming; Troadec, Marie-Berengere; Gwynn, Babette; Cooney, Jeffrey D; Lambert, Amy J; Chi, Neil C; Weiss, Mitchell J; Peters, Luanne L; Kaplan, Jerry; Cantor, Alan B; Paw, Barry H

    2011-04-01

    Mitoferrin 1 (Mfrn1; Slc25a37) and mitoferrin 2 (Mfrn2; Slc25a28) function as essential mitochondrial iron importers for heme and Fe/S cluster biogenesis. A genetic deficiency of Mfrn1 results in a profound hypochromic anemia in vertebrate species. To map the cis-regulatory modules (CRMs) that control expression of the Mfrn genes, we utilized genome-wide chromatin immunoprecipitation (ChIP) datasets for the major erythroid transcription factor GATA-1. We identified the CRMs that faithfully drive the expression of Mfrn1 during blood and heart development and Mfrn2 ubiquitously. Through in vivo analyses of the Mfrn-CRMs in zebrafish and mouse, we demonstrate their functional and evolutionary conservation. Using knockdowns with morpholinos and cell sorting analysis in transgenic zebrafish embryos, we show that GATA-1 directly regulates the expression of Mfrn1. Mutagenesis of individual GATA-1 binding cis elements (GBE) demonstrated that at least two of the three GBE within this CRM are functionally required for GATA-mediated transcription of Mfrn1. Furthermore, ChIP assays demonstrate switching from GATA-2 to GATA-1 at these elements during erythroid maturation. Our results provide new insights into the genetic regulation of mitochondrial function and iron homeostasis and, more generally, illustrate the utility of genome-wide ChIP analysis combined with zebrafish transgenesis for identifying long-range transcriptional enhancers that regulate tissue development.

  10. Harvest locations of goose barnacles can be successfully discriminated using trace elemental signatures

    Science.gov (United States)

    Albuquerque, Rui; Queiroga, Henrique; Swearer, Stephen E.; Calado, Ricardo; Leandro, Sérgio M.

    2016-06-01

    European Union regulations state that consumers must be rightfully informed about the provenance of fishery products to prevent fraudulent practices. However, mislabeling of the geographical origin is a common practice. It is therefore paramount to develop forensic methods that allow all players involved in the supply chain to accurately trace the origin of seafood. In this study, trace elemental signatures (TES) of the goose barnacle Pollicipes pollicipes, collected from ten sites along the Portuguese coast, were employed to discriminate individual’s origin. Barium (Ba), boron (B), cadmium (Cd), chromium (Cr), lithium (Li), magnesium (Mg), manganese (Mn), phosphorous (P), lead (Pb), strontium (Sr) and zinc (Zn) - were quantified using Inductively Coupled Plasma‑Mass Spectrometry (ICP-MS). Significant differences were recorded among locations for all elements. A regularized discriminant analysis (RDA) revealed that 83% of all individuals were correctly assigned. This study shows TES can be a reliable tool to confirm the geographic origin of goose barnacles at fine spatial resolution. Although additional studies are required to ascertain the reliability of TES on cooked specimens and the temporal stability of the signature, the approach holds great promise for the management of goose barnacles fisheries, enforcement of conservation policies and assurance in accurate labeling.

  11. Lattice location of the group V elements Sb, As, and P in ZnO

    CERN Document Server

    Wahl, Ulrich; Mendonça, Tânia; Decoster, Stefan

    2010-01-01

    Modifying the properties of ZnO by means of incorporating antimony, arsenic or phosphorus impurities is of interest since these group V elements have been reported in the literature among the few successful p-type dopants in this technologically promising II-VI compound. The lattice location of ion-implanted Sb, As, and P in ZnO single crystals was investigated by means of the electron emission channeling technique using the radioactive isotopes $^{124}$Sb, $^{73}$As and $^{33}$P and it is found that they preferentially occupy substitutional Zn sites while the possible fractions on substitutional O sites are a few percent at maximum. The lattice site preference is understandable from the relatively large ionic size of the heavy mass group V elements. Unfortunately the presented results cannot finally settle the interesting issue whether substitutional Sb, As or P on oxygen sites or Sb$_{Zn}$−2V$_{Zn}$, As$_{Zn}$−2V$_{Zn}$ or P$_{Zn}$−2V$_{Zn}$ complexes (as suggested in the literature) are responsible f...

  12. The contribution of cis-regulatory elements to head-to-head gene pairs’ co-expression pattern

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Transcription regulation is one of the most critical pipelines in biological process,in which cis-elements play the role as gene expression regulators.We attempt to deduce the principles underlying the co-expression of "head-to-head" gene pairs by analyzing activities or behaviors of the shared cis-elements.A network component analysis was performed to estimate the impact of cis-elements on gene promoters and their activities under different conditions.Our discoveries reveal how biological system uses those regulatory elements to control the expression pattern of "head-to-head" gene pairs and the whole transcription regulation system.

  13. Identification of functional elements and regulatory circuits by Drosophila modENCODE

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

    2010-12-22

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

  14. Do pharmacological approaches that prevent opioid tolerance target different elements in the same regulatory machinery?

    Science.gov (United States)

    Garzón, Javier; Rodríguez-Muñoz, María; Sánchez-Blázquez, Pilar

    2008-06-01

    In the nervous system, the interaction of opioids like heroin and morphine with the G protein-coupled Mu-opioid receptor (MOR) provokes the development of tolerance to these opioids, as well as physical dependence. Tolerance implies that higher doses of these drugs must be consumed in order to obtain an equivalent sensation, a situation that contributes notably to the social problems surrounding recreational opioid abuse. The mechanisms that promote opioid tolerance involve a series of adaptive changes in the MOR and in the post-receptor signalling elements. Pharmacological studies have consistently identified a number of signalling proteins relevant to morphine-induced tolerance, including the delta-opioid receptor (DOR), protein kinase C (PKC), protein kinase A (PKA), calcium/calmodulin-dependent kinase II (CaMKII), nitric oxide synthase (NOS), N-methyl-D-aspartate acid glutamate receptors (NMDAR), and regulators of G-signalling (RGS) proteins. Thus, it is feasible that these treatments which diminish morphine tolerance target distinct elements within the same regulatory machinery. In this scheme, the signals originated at the agonist-activated MORs would be recognised by elements such as the NMDARs, which in turn exert a negative feedback on MOR-evoked signalling. This process involves DOR regulation of MORs, MOR-induced activation of NMDARs (probably via the regulation of Src, recruiting PKC and Galpha subunits) and the NMDAR-mediated activation of CaMKII. The active CaMKII promotes the sequestering of morphine-activated Gbetagamma dimers by phosducin-like proteins (PhLP) and of Galpha subunits by RGS proteins and tolerance to opioids like morphine develops. Future efforts to study these phenomena should focus on fitting additional pieces into this puzzle in order to fully define the mechanism underlying the desensitization of MORs in neural cells.

  15. Combining Hi-C data with phylogenetic correlation to predict the target genes of distal regulatory elements in human genome.

    Science.gov (United States)

    Lu, Yulan; Zhou, Yuanpeng; Tian, Weidong

    2013-12-01

    Defining the target genes of distal regulatory elements (DREs), such as enhancer, repressors and insulators, is a challenging task. The recently developed Hi-C technology is designed to capture chromosome conformation structure by high-throughput sequencing, and can be potentially used to determine the target genes of DREs. However, Hi-C data are noisy, making it difficult to directly use Hi-C data to identify DRE-target gene relationships. In this study, we show that DREs-gene pairs that are confirmed by Hi-C data are strongly phylogenetic correlated, and have thus developed a method that combines Hi-C read counts with phylogenetic correlation to predict long-range DRE-target gene relationships. Analysis of predicted DRE-target gene pairs shows that genes regulated by large number of DREs tend to have essential functions, and genes regulated by the same DREs tend to be functionally related and co-expressed. In addition, we show with a couple of examples that the predicted target genes of DREs can help explain the causal roles of disease-associated single-nucleotide polymorphisms located in the DREs. As such, these predictions will be of importance not only for our understanding of the function of DREs but also for elucidating the causal roles of disease-associated noncoding single-nucleotide polymorphisms.

  16. Glutathione S-transferase Ya subunit gene: identification of regulatory elements required for basal level and inducible expression.

    OpenAIRE

    Telakowski-Hopkins, C A; King, R. G.; Pickett, C B

    1988-01-01

    The function of the 5'-flanking region of a rat glutathione S-transferase Ya subunit structural gene has been examined in homologous and heterologous cells. By using the 5'-flanking region of the Ya subunit gene fused to the structural gene encoding chloramphenicol acetyltransferase, we have identified two cis-acting regulatory elements in the upstream region of the Ya gene. One element is required for maximum basal level expression in homologous cells, whereas maximum basal level expression ...

  17. Extensive evolutionary changes in regulatory element activity during human origins are associated with altered gene expression and positive selection.

    Directory of Open Access Journals (Sweden)

    Yoichiro Shibata

    2012-06-01

    Full Text Available Understanding the molecular basis for phenotypic differences between humans and other primates remains an outstanding challenge. Mutations in non-coding regulatory DNA that alter gene expression have been hypothesized as a key driver of these phenotypic differences. This has been supported by differential gene expression analyses in general, but not by the identification of specific regulatory elements responsible for changes in transcription and phenotype. To identify the genetic source of regulatory differences, we mapped DNaseI hypersensitive (DHS sites, which mark all types of active gene regulatory elements, genome-wide in the same cell type isolated from human, chimpanzee, and macaque. Most DHS sites were conserved among all three species, as expected based on their central role in regulating transcription. However, we found evidence that several hundred DHS sites were gained or lost on the lineages leading to modern human and chimpanzee. Species-specific DHS site gains are enriched near differentially expressed genes, are positively correlated with increased transcription, show evidence of branch-specific positive selection, and overlap with active chromatin marks. Species-specific sequence differences in transcription factor motifs found within these DHS sites are linked with species-specific changes in chromatin accessibility. Together, these indicate that the regulatory elements identified here are genetic contributors to transcriptional and phenotypic differences among primate species.

  18. Evaluation of phylogenetic footprint discovery for predicting bacterial cis-regulatory elements and revealing their evolution

    Directory of Open Access Journals (Sweden)

    van Helden Jacques

    2008-01-01

    Full Text Available Abstract Background The detection of conserved motifs in promoters of orthologous genes (phylogenetic footprints has become a common strategy to predict cis-acting regulatory elements. Several software tools are routinely used to raise hypotheses about regulation. However, these tools are generally used as black boxes, with default parameters. A systematic evaluation of optimal parameters for a footprint discovery strategy can bring a sizeable improvement to the predictions. Results We evaluate the performances of a footprint discovery approach based on the detection of over-represented spaced motifs. This method is particularly suitable for (but not restricted to Bacteria, since such motifs are typically bound by factors containing a Helix-Turn-Helix domain. We evaluated footprint discovery in 368 Escherichia coli K12 genes with annotated sites, under 40 different combinations of parameters (taxonomical level, background model, organism-specific filtering, operon inference. Motifs are assessed both at the levels of correctness and significance. We further report a detailed analysis of 181 bacterial orthologs of the LexA repressor. Distinct motifs are detected at various taxonomical levels, including the 7 previously characterized taxon-specific motifs. In addition, we highlight a significantly stronger conservation of half-motifs in Actinobacteria, relative to Firmicutes, suggesting an intermediate state in specificity switching between the two Gram-positive phyla, and thereby revealing the on-going evolution of LexA auto-regulation. Conclusion The footprint discovery method proposed here shows excellent results with E. coli and can readily be extended to predict cis-acting regulatory signals and propose testable hypotheses in bacterial genomes for which nothing is known about regulation.

  19. The Schizosaccharomyces pombe inv1+ regulatory region is unusually large and contains redundant cis-acting elements that function in a SAGA- and Swi/Snf-dependent fashion.

    Science.gov (United States)

    Ahn, Sejin; Spatt, Dan; Winston, Fred

    2012-08-01

    The Schizosaccharomyces pombe inv1(+) gene encodes invertase, the enzyme required for hydrolysis of sucrose and raffinose. Transcription of inv1(+) is regulated by glucose levels, with transcription tightly repressed in high glucose and strongly induced in low glucose. To understand this regulation, we have analyzed the inv1(+) cis-regulatory region and the requirement for the trans-acting coactivators SAGA and Swi/Snf. Surprisingly, deletion of the entire 1-kilobase intergenic region between the inv1(+) TATA element and the upstream open reading frame SPCC191.10 does not significantly alter regulation of inv1(+) transcription. However, a longer deletion that extends through SPCC191.10 abolishes inv1(+) induction in low glucose. Additional analysis demonstrates that there are multiple, redundant regulatory regions spread over 1.5 kb 5' of inv1(+), including within SPCC191.10, that can confer glucose-mediated transcriptional regulation to inv1(+). Furthermore, SPCC191.10 can regulate inv1(+) transcription in an orientation-independent fashion and from a distance as great as 3 kb. With respect to trans-acting factors, both SAGA and Swi/Snf are recruited to SPCC191.10 and to other locations in the large inv1(+) regulatory region in a glucose-dependent fashion, and both are required for inv1(+) derepression. Taken together, these results demonstrate that inv1(+) regulation in S. pombe occurs via the use of multiple regulatory elements and that activation can occur over a great distance, even from elements within other open reading frames.

  20. Separate elements of the TERMINAL FLOWER 1 cis-regulatory region integrate pathways to control flowering time and shoot meristem identity.

    Science.gov (United States)

    Serrano-Mislata, Antonio; Fernández-Nohales, Pedro; Doménech, María J; Hanzawa, Yoshie; Bradley, Desmond; Madueño, Francisco

    2016-09-15

    TERMINAL FLOWER 1 (TFL1) is a key regulator of Arabidopsis plant architecture that responds to developmental and environmental signals to control flowering time and the fate of shoot meristems. TFL1 expression is dynamic, being found in all shoot meristems, but not in floral meristems, with the level and distribution changing throughout development. Using a variety of experimental approaches we have analysed the TFL1 promoter to elucidate its functional structure. TFL1 expression is based on distinct cis-regulatory regions, the most important being located 3' of the coding sequence. Our results indicate that TFL1 expression in the shoot apical versus lateral inflorescence meristems is controlled through distinct cis-regulatory elements, suggesting that different signals control expression in these meristem types. Moreover, we identified a cis-regulatory region necessary for TFL1 expression in the vegetative shoot and required for a wild-type flowering time, supporting that TFL1 expression in the vegetative meristem controls flowering time. Our study provides a model for the functional organisation of TFL1 cis-regulatory regions, contributing to our understanding of how developmental pathways are integrated at the genomic level of a key regulator to control plant architecture. © 2016. Published by The Company of Biologists Ltd.

  1. Computational discovery of soybean promoter cis-regulatory elements for the construction of soybean cyst nematode inducible synthetic promoters

    Science.gov (United States)

    Computational methods offer great hope but limited accuracy in the prediction of functional cis-regulatory elements; improvements are needed to enable synthetic promoter design. We applied an ensemble strategy for de novo soybean cyst nematode (SCN)-inducible motif discovery among promoters of 18 co...

  2. A new method for splice site prediction based on the sequence patterns of splicing signals and regulatory elements

    Institute of Scientific and Technical Information of China (English)

    SUN ZongXiao; SANG LingJie; JU LiNing; ZHU HuaiQiu

    2008-01-01

    It is of significance for splice site prediction to develop novel algorithms that combine the sequence patterns of regulatory elements such as enhancers and silencers with the patterns of splicing signals. In this paper, a statistical model of splicing signals was built based on the entropy density profile (EDP) method, weight array method (WAM) and κ test; moreover, the model of splicing regulatory elements was developed by an unsupervised self-learning method to detect motifs associated with regulatory elements. With two models incorporated, a multi-level support vector machine (SVM) system was de-vised to perform ab initio prediction for splice sites originating from DNA sequence in eukaryotic ge-home. Results of large scale tests on human genomic splice sites show that the new method achieves a comparative high performance in splice site prediction. The method is demonstrated to be with at least the same level of performance and usually better performance than the existing SpliceScan method based on modeling regulatory elements, and shown to have higher accuracies than the traditional methods with modeling splicing signals such as the GeneSplicer. In particular, the method has evident advantage over splice site prediction for the genes with lower GC content.

  3. Prolactin Regulatory Element Binding Protein Is Involved in Hepatitis C Virus Replication by Interaction with NS4B

    Science.gov (United States)

    Kong, Lingbao; Fujimoto, Akira; Nakamura, Mariko; Aoyagi, Haruyo; Matsuda, Mami; Watashi, Koichi; Suzuki, Ryosuke; Arita, Minetaro; Yamagoe, Satoshi; Dohmae, Naoshi; Suzuki, Takehiro; Sakamaki, Yuriko; Ichinose, Shizuko; Suzuki, Tetsuro; Wakita, Takaji

    2016-01-01

    ABSTRACT It has been proposed that the hepatitis C virus (HCV) NS4B protein triggers the membranous HCV replication compartment, but the underlying molecular mechanism is not fully understood. Here, we screened for NS4B-associated membrane proteins by tandem affinity purification and proteome analysis and identified 202 host proteins. Subsequent screening of replicon cells with small interfering RNA identified prolactin regulatory element binding (PREB) to be a novel HCV host cofactor. The interaction between PREB and NS4B was confirmed by immunoprecipitation, immunofluorescence, and proximity ligation assays. PREB colocalized with double-stranded RNA and the newly synthesized HCV RNA labeled with bromouridine triphosphate in HCV replicon cells. Furthermore, PREB shifted to detergent-resistant membranes (DRMs), where HCV replication complexes reside, in the presence of NS4B expression in Huh7 cells. However, a PREB mutant lacking the NS4B-binding region (PREBd3) could not colocalize with double-stranded RNA and did not shift to the DRM in the presence of NS4B. These results indicate that PREB locates at the HCV replication complex by interacting with NS4B. PREB silencing inhibited the formation of the membranous HCV replication compartment and increased the protease and nuclease sensitivity of HCV replicase proteins and RNA in DRMs, respectively. Collectively, these data indicate that PREB promotes HCV RNA replication by participating in the formation of the membranous replication compartment and by maintaining its proper structure by interacting with NS4B. Furthermore, PREB was induced by HCV infection in vitro and in vivo. Our findings provide new insights into HCV host cofactors. IMPORTANCE The hepatitis C virus (HCV) protein NS4B can induce alteration of the endoplasmic reticulum and the formation of a membranous web structure, which provides a platform for the HCV replication complex. The molecular mechanism by which NS4B induces the membranous HCV replication

  4. Properties of non-coding DNA and identification of putative cis-regulatory elements in Theileria parva

    Directory of Open Access Journals (Sweden)

    Guo Xiang

    2008-12-01

    Full Text Available Abstract Background Parasites in the genus Theileria cause lymphoproliferative diseases in cattle, resulting in enormous socio-economic losses. The availability of the genome sequences and annotation for T. parva and T. annulata has facilitated the study of parasite biology and their relationship with host cell transformation and tropism. However, the mechanism of transcriptional regulation in this genus, which may be key to understanding fundamental aspects of its parasitology, remains poorly understood. In this study, we analyze the evolution of non-coding sequences in the Theileria genome and identify conserved sequence elements that may be involved in gene regulation of these parasitic species. Results Intergenic regions and introns in Theileria are short, and their length distributions are considerably right-skewed. Intergenic regions flanked by genes in 5'-5' orientation tend to be longer and slightly more AT-rich than those flanked by two stop codons; intergenic regions flanked by genes in 3'-5' orientation have intermediate values of length and AT composition. Intron position is negatively correlated with intron length, and positively correlated with GC content. Using stringent criteria, we identified a set of high-quality orthologous non-coding sequences between T. parva and T. annulata, and determined the distribution of selective constraints across regions, which are shown to be higher close to translation start sites. A positive correlation between constraint and length in both intergenic regions and introns suggests a tight control over length expansion of non-coding regions. Genome-wide searches for functional elements revealed several conserved motifs in intergenic regions of Theileria genomes. Two such motifs are preferentially located within the first 60 base pairs upstream of transcription start sites in T. parva, are preferentially associated with specific protein functional categories, and have significant similarity to know

  5. DREAM (Downstream Regulatory Element Antagonist Modulator contributes to synaptic depression and contextual fear memory

    Directory of Open Access Journals (Sweden)

    Wu Long-Jun

    2010-01-01

    Full Text Available Abstract The downstream regulatory element antagonist modulator (DREAM, a multifunctional Ca2+-binding protein, binds specifically to DNA and several nucleoproteins regulating gene expression and with proteins outside the nucleus to regulate membrane excitability or calcium homeostasis. DREAM is highly expressed in the central nervous system including the hippocampus and cortex; however, the roles of DREAM in hippocampal synaptic transmission and plasticity have not been investigated. Taking advantage of transgenic mice overexpressing a Ca2+-insensitive DREAM mutant (TgDREAM, we used integrative methods including electrophysiology, biochemistry, immunostaining, and behavior tests to study the function of DREAM in synaptic transmission, long-term plasticity and fear memory in hippocampal CA1 region. We found that NMDA receptor but not AMPA receptor-mediated current was decreased in TgDREAM mice. Moreover, synaptic plasticity, such as long-term depression (LTD but not long-term potentiation (LTP, was impaired in TgDREAM mice. Biochemical experiments found that DREAM interacts with PSD-95 and may inhibit NMDA receptor function through this interaction. Contextual fear memory was significantly impaired in TgDREAM mice. By contrast, sensory responses to noxious stimuli were not affected. Our results demonstrate that DREAM plays a novel role in postsynaptic modulation of the NMDA receptor, and contributes to synaptic plasticity and behavioral memory.

  6. Sterol regulatory element binding transcription factor 1 (SREBF1) polymorphism and milk fatty acid composition.

    Science.gov (United States)

    Nafikov, R A; Schoonmaker, J P; Korn, K T; Noack, K; Garrick, D J; Koehler, K J; Minick-Bormann, J; Reecy, J M; Spurlock, D E; Beitz, D C

    2013-04-01

    Milk is known to contain high concentrations of saturated fatty acids-such as palmitic (16:0), myristic (14:0), and lauric (12:0) acids-that can raise plasma cholesterol in humans, making their presence in milk undesirable. The main objective of our candidate gene study was to develop genetic markers that can be used to improve the healthfulness of bovine milk. The sterol regulatory element binding transcription factor 1 (SREBF1) known to regulate the transcription of lipogenic genes together with SREBF chaperone and insulin induced gene 1 were the candidate genes. The results showed significant association of the overall SREBF1 haplotypes with milk production and variations in lauric (12:0) and myristic (14:0) acid concentrations in milk. Haplotype H1 of SREBF1 was the most desirable to improve milk healthfulness because it was significantly associated with lower lauric (12:0) and myristic (14:0) acid concentrations compared with haplotype H3 of SREBF1, and lower lauric acid (12:0) concentration compared with haplotype H2 of SREBF1. Haplotype H1 of SREBF1, however, was significantly associated with lower milk production compared with haplotype H3 of SREBF1. We did not detect any significant associations between genetic polymorphisms in insulin induced gene 1 (INSIG1) and SREBF chaperone and milk fatty acid composition. In conclusion, genetic polymorphisms in SREBF1 can be used to develop genetic tools for the selection of animals producing milk with healthier fatty acid composition.

  7. Understanding Epistatic Interactions between Genes Targeted by Non-coding Regulatory Elements in Complex Diseases

    Directory of Open Access Journals (Sweden)

    Min Kyung Sung

    2014-12-01

    Full Text Available Genome-wide association studies have proven the highly polygenic architecture of complex diseases or traits; therefore, single-locus-based methods are usually unable to detect all involved loci, especially when individual loci exert small effects. Moreover, the majority of associated single-nucleotide polymorphisms resides in non-coding regions, making it difficult to understand their phenotypic contribution. In this work, we studied epistatic interactions associated with three common diseases using Korea Association Resource (KARE data: type 2 diabetes mellitus (DM, hypertension (HT, and coronary artery disease (CAD. We showed that epistatic single-nucleotide polymorphisms (SNPs were enriched in enhancers, as well as in DNase I footprints (the Encyclopedia of DNA Elements [ENCODE] Project Consortium 2012, which suggested that the disruption of the regulatory regions where transcription factors bind may be involved in the disease mechanism. Accordingly, to identify the genes affected by the SNPs, we employed whole-genome multiple-cell-type enhancer data which discovered using DNase I profiles and Cap Analysis Gene Expression (CAGE. Assigned genes were significantly enriched in known disease associated gene sets, which were explored based on the literature, suggesting that this approach is useful for detecting relevant affected genes. In our knowledge-based epistatic network, the three diseases share many associated genes and are also closely related with each other through many epistatic interactions. These findings elucidate the genetic basis of the close relationship between DM, HT, and CAD.

  8. Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements.

    Science.gov (United States)

    Thakore, Pratiksha I; D'Ippolito, Anthony M; Song, Lingyun; Safi, Alexias; Shivakumar, Nishkala K; Kabadi, Ami M; Reddy, Timothy E; Crawford, Gregory E; Gersbach, Charles A

    2015-12-01

    Epigenome editing with the CRISPR (clustered, regularly interspaced, short palindromic repeats)-Cas9 platform is a promising technology for modulating gene expression to direct cell phenotype and to dissect the causal epigenetic mechanisms of gene regulation. Fusions of nuclease-inactive dCas9 to the Krüppel-associated box (KRAB) repressor (dCas9-KRAB) can silence target gene expression, but the genome-wide specificity and the extent of heterochromatin formation catalyzed by dCas9-KRAB are not known. We targeted dCas9-KRAB to the HS2 enhancer, a distal regulatory element that orchestrates the expression of multiple globin genes, and observed highly specific induction of H3K9 trimethylation (H3K9me3) at the enhancer and decreased chromatin accessibility of both the enhancer and its promoter targets. Targeted epigenetic modification of HS2 silenced the expression of multiple globin genes, with minimal off-target changes in global gene expression. These results demonstrate that repression mediated by dCas9-KRAB is sufficiently specific to disrupt the activity of individual enhancers via local modification of the epigenome.

  9. A novel regulatory element between the human FGA and FGG genes.

    Science.gov (United States)

    Fish, Richard J; Neerman-Arbez, Marguerite

    2012-09-01

    High circulating fibrinogen levels correlate with cardiovascular disease (CVD) risk. Fibrinogen levels vary between people and also change in response to physiological and environmental stimuli. A modest proportion of the variation in fibrinogen levels can be explained by genotype, inferring that variation in genomic sequences that regulate the fibrinogen genes ( FGA , FGB and FGG ) may affect hepatic fibrinogen production and perhaps CVD risk. We previously identified a conserved liver enhancer in the fibrinogen gene cluster (CNC12), between FGB and FGA . Genome-wide Chromatin immunoprecipitation-sequencing (ChIP-seq) demonstrated that transcription factors which bind fibrinogen gene promoters also interact with CNC12, as well as two potential fibrinogen enhancers (PFE), between FGA and FGG . Here we show that one of the PFE sequences has potent hepatocyte enhancer activity. Using a luciferase reporter gene system, we found that PFE2 enhances minimal promoter- and FGA promoter-driven gene expression in hepatoma cells, regardless of its orientation with respect to the promoters. A region within PFE2 bears a short series of conserved nucleotides which maintain enhancer activity without flanking sequence. We also demonstrate that PFE2 is a liver enhancer in vivo, driving enhanced green fluorescent protein expression in transgenic zebrafish larval livers. Our study shows that combining public domain ChIP-seq data with in vitro and in vivo functional tests can identify novel fibrinogen gene cluster regulatory sequences. Variation in such elements could affect fibrinogen production and influence CVD risk.

  10. Drosophila gypsy insulator and yellow enhancers regulate activity of yellow promoter through the same regulatory element.

    Science.gov (United States)

    Melnikova, Larisa; Kostuchenko, Margarita; Silicheva, Margarita; Georgiev, Pavel

    2008-04-01

    There is ample evidence that the enhancers of a promoterless yellow locus in one homologous chromosome can activate the yellow promoter in the other chromosome where the enhancers are inactive or deleted, which is indicative of a high specificity of the enhancer-promoter interaction in yellow. In this paper, we have found that the yellow sequence from -100 to -69 is essential for stimulation of the heterologous eve (TATA-containing) and white (TATA-less) promoters by the yellow enhancers from a distance. However, the presence of this sequence is not required when the yellow enhancers are directly fused to the heterologous promoters or are activated by the yeast GAL4 activator. Unexpectedly, the same promoter proximal region defines previously described promoter-specific, long-distance repression of the yellow promoter by the gypsy insulator on the mod(mdg4) ( u1 ) background. These finding suggest that proteins bound to the -100 to -69 sequence are essential for communication between the yellow promoter and upstream regulatory elements.

  11. Multiple sequence elements facilitate Chp Rho GTPase subcellular location, membrane association, and transforming activity.

    Science.gov (United States)

    Chenette, Emily J; Mitin, Natalia Y; Der, Channing J

    2006-07-01

    Cdc42 homologous protein (Chp) is a member of the Rho family of small GTPases and shares significant sequence and functional similarity with Cdc42. However, unlike classical Rho GTPases, we recently found that Chp depends on palmitoylation, rather than prenylation, for association with cellular membranes. Because palmitoylation alone is typically not sufficient to promote membrane association, we evaluated the possibility that other carboxy-terminal residues facilitate Chp subcellular association with membranes. We found that Chp membrane association and transforming activity was dependent on the integrity of a stretch of basic amino acids in the carboxy terminus of Chp and that the basic amino acids were not simply part of a palmitoyl acyltransferase recognition motif. We also determined that the 11 carboxy-terminal residues alone were sufficient to promote Chp plasma and endomembrane association. Interestingly, stimulation with tumor necrosis factor-alpha activated only endomembrane-associated Chp. Finally, we found that Chp membrane association was not disrupted by Rho guanine nucleotide dissociation inhibitory proteins, which are negative regulators of Cdc42 membrane association and biological activity. In summary, the unique carboxy-terminal sequence elements that promote Chp subcellular location and function expand the complexity of mechanisms by which the cellular functions of Rho GTPases are regulated.

  12. Modelling elemental carbon at regional, urban and traffic locations in The Netherlands

    Science.gov (United States)

    Keuken, M. P.; Zandveld, P.; Jonkers, S.; Moerman, M.; Jedynska, A. D.; Verbeek, R.; Visschedijk, A.; Elshout van den, S.; Panteliadis, P.; Velders, G. J. M.

    2013-07-01

    The annual concentration of elemental carbon (EC) has been derived for The Netherlands in 2011. National emissions contribute 55% to the average EC concentration in the Netherlands. About 65% of the national contribution comes from emissions from road traffic and about 35% from other mobile sources (15%), households (14%), shipping (4%) and other combustion sources (2%). Conversion factors were established to compare different methods of EC measurement such as Black Smoke, Black Carbon and thermal analysis. The measured regional and urban background concentrations and variability were 0.5 ± 0.1 and 0.9 ± 0.1 μg EC per m3, respectively. The ratios between modelled and measured regional and urban background concentrations were 1.6 ± 0.5 and 1.8 ± 0.4, respectively. The modelled values are likely to be overestimated. The modelled and measured traffic contributions to EC concentrations near motorways and in street canyons were in the range 1.1-1.3 μg m-3 with total EC concentrations of 2.0 and 2.2 μg m-3, respectively. Our study showed that EC concentrations near intense traffic are increased with a factor 2-4 as compared to the urban and regional background, respectively. Consequently there is a similar variation in exposure and potential health effects in the population. More measurements of EC are required to improve modelling of EC concentrations in particular at urban background and near traffic locations.

  13. Location of Caspase 3-like Protease in the Development of Sieve Element and Tracheary Element of Stem in Cucurbita moschata

    Institute of Scientific and Technical Information of China (English)

    Xia Hao; Jie Qian; Shan Xu; Xin Song; Jian Zhu

    2008-01-01

    The casepase is considered to regulate the process of programmed cell death in the development of organisms. In this study, caspase 3-like protease was detected by immunohistochemistry and immunoelectron microscopy during the development of sieve element and tracheary element of stem in Cucurbita moschata Duch. Antibody with brown color (under light microscopy) and gold particles (under transmission electron microscopy) for detecting caspase 3-like protease was mainly displayed in inner phloem, extemal phloem and xylem in the region close to procambium. From the results it was considered that caspase 3-like protease did exist in vascular elements and played different roles during the development of sieve and tracheary elements, and different types of programmed cell death might be carried out. The caspase 3-like protease mainly participated in making cytoplasmic streaming cease and in degrading P-protein bodies; however, it rarely participated in the function for signal transferring in the developmental sieve element. However, it might induce calcium accumulation for rupturing the tonoplast in the signal of PCD in the developmental tracheary element.

  14. Location of caspase 3-like protease in the development of sieve element and tracheary element of stem in Cucurbita moschata.

    Science.gov (United States)

    Hao, Xia; Qian, Jie; Xu, Shan; Song, Xin; Zhu, Jian

    2008-12-01

    The casepase is considered to regulate the process of programmed cell death in the development of organisms. In this study, caspase 3-like protease was detected by immunohistochemistry and immunoelectron microscopy during the development of sieve element and tracheary element of stem in Cucurbita moschata Duch. Antibody with brown color (under light microscopy) and gold particles (under transmission electron microscopy) for detecting caspase 3-like protease was mainly displayed in inner phloem, external phloem and xylem in the region close to procambium. From the results it was considered that caspase 3-like protease did exist in vascular elements and played different roles during the development of sieve and tracheary elements, and different types of programmed cell death might be carried out. The caspase 3-like protease mainly participated in making cytoplasmic streaming cease and in degrading P-protein bodies; however, it rarely participated in the function for signal transferring in the developmental sieve element. However, it might induce calcium accumulation for rupturing the tonoplast in the signal of PCD in the developmental tracheary element.

  15. Demystifying the secret mission of enhancers: linking distal regulatory elements to target genes.

    Science.gov (United States)

    Yao, Lijing; Berman, Benjamin P; Farnham, Peggy J

    2015-01-01

    Enhancers are short regulatory sequences bound by sequence-specific transcription factors and play a major role in the spatiotemporal specificity of gene expression patterns in development and disease. While it is now possible to identify enhancer regions genomewide in both cultured cells and primary tissues using epigenomic approaches, it has been more challenging to develop methods to understand the function of individual enhancers because enhancers are located far from the gene(s) that they regulate. However, it is essential to identify target genes of enhancers not only so that we can understand the role of enhancers in disease but also because this information will assist in the development of future therapeutic options. After reviewing models of enhancer function, we discuss recent methods for identifying target genes of enhancers. First, we describe chromatin structure-based approaches for directly mapping interactions between enhancers and promoters. Second, we describe the use of correlation-based approaches to link enhancer state with the activity of nearby promoters and/or gene expression. Third, we describe how to test the function of specific enhancers experimentally by perturbing enhancer-target relationships using high-throughput reporter assays and genome editing. Finally, we conclude by discussing as yet unanswered questions concerning how enhancers function, how target genes can be identified, and how to distinguish direct from indirect changes in gene expression mediated by individual enhancers.

  16. An arthropod cis-regulatory element functioning in sensory organ precursor development dates back to the Cambrian

    Directory of Open Access Journals (Sweden)

    Simpson Pat

    2010-09-01

    Full Text Available Abstract Background An increasing number of publications demonstrate conservation of function of cis-regulatory elements without sequence similarity. In invertebrates such functional conservation has only been shown for closely related species. Here we demonstrate the existence of an ancient arthropod regulatory element that functions during the selection of neural precursors. The activity of genes of the achaete-scute (ac-sc family endows cells with neural potential. An essential, conserved characteristic of proneural genes is their ability to restrict their own activity to single or a small number of progenitor cells from their initially broad domains of expression. This is achieved through a process called lateral inhibition. A regulatory element, the sensory organ precursor enhancer (SOPE, is required for this process. First identified in Drosophila, the SOPE contains discrete binding sites for four regulatory factors. The SOPE of the Drosophila asense gene is situated in the 5' UTR. Results Through a manual comparison of consensus binding site sequences we have been able to identify a SOPE in UTR sequences of asense-like genes in species belonging to all four arthropod groups (Crustacea, Myriapoda, Chelicerata and Insecta. The SOPEs of the spider Cupiennius salei and the insect Tribolium castaneum are shown to be functional in transgenic Drosophila. This would place the origin of this regulatory sequence as far back as the last common ancestor of the Arthropoda, that is, in the Cambrian, 550 million years ago. Conclusions The SOPE is not detectable by inter-specific sequence comparison, raising the possibility that other ancient regulatory modules in invertebrates might have escaped detection.

  17. Nsite, NsiteH and NsiteM Computer Tools for Studying Tran-scription Regulatory Elements

    KAUST Repository

    Shahmuradov, Ilham A.

    2015-07-02

    Summary: Gene transcription is mostly conducted through interactions of various transcription factors and their binding sites on DNA (regulatory elements, REs). Today, we are still far from understanding the real regulatory content of promoter regions. Computer methods for identification of REs remain a widely used tool for studying and understanding transcriptional regulation mechanisms. The Nsite, NsiteH and NsiteM programs perform searches for statistically significant (non-random) motifs of known human, animal and plant one-box and composite REs in a single genomic sequence, in a pair of aligned homologous sequences and in a set of functionally related sequences, respectively.

  18. Prioritizing predicted cis-regulatory elements for co-expressed gene sets based on Lasso regression models.

    Science.gov (United States)

    Hu, Hong; Roqueiro, Damian; Dai, Yang

    2011-01-01

    Computational prediction of cis-regulatory elements for a set of co-expressed genes based on sequence analysis provides an overwhelming volume of potential transcription factor binding sites. It presents a challenge to prioritize transcription factors for regulatory functional studies. A novel approach based on the use of Lasso regression models is proposed to address this problem. We examine the ability of the Lasso model using time-course microarray data obtained from a comprehensive study of gene expression profiles in skin and mucosal wounds in mouse over all stages of wound healing.

  19. Validation of an entirely in vitro approach for rapid prototyping of DNA regulatory elements for synthetic biology

    Science.gov (United States)

    Chappell, James; Jensen, Kirsten; Freemont, Paul S.

    2013-01-01

    A bottleneck in our capacity to rationally and predictably engineer biological systems is the limited number of well-characterized genetic elements from which to build. Current characterization methods are tied to measurements in living systems, the transformation and culturing of which are inherently time-consuming. To address this, we have validated a completely in vitro approach for the characterization of DNA regulatory elements using Escherichia coli extract cell-free systems. Importantly, we demonstrate that characterization in cell-free systems correlates and is reflective of performance in vivo for the most frequently used DNA regulatory elements. Moreover, we devise a rapid and completely in vitro method to generate DNA templates for cell-free systems, bypassing the need for DNA template generation and amplification from living cells. This in vitro approach is significantly quicker than current characterization methods and is amenable to high-throughput techniques, providing a valuable tool for rapidly prototyping libraries of DNA regulatory elements for synthetic biology. PMID:23371936

  20. Variation in the genomic locations and sequence conservation of STAR elements among staphylococcal species provides insight into DNA repeat evolution

    Directory of Open Access Journals (Sweden)

    Purves Joanne

    2012-09-01

    Full Text Available Abstract Background Staphylococcus aureus Repeat (STAR elements are a type of interspersed intergenic direct repeat. In this study the conservation and variation in these elements was explored by bioinformatic analyses of published staphylococcal genome sequences and through sequencing of specific STAR element loci from a large set of S. aureus isolates. Results Using bioinformatic analyses, we found that the STAR elements were located in different genomic loci within each staphylococcal species. There was no correlation between the number of STAR elements in each genome and the evolutionary relatedness of staphylococcal species, however higher levels of repeats were observed in both S. aureus and S. lugdunensis compared to other staphylococcal species. Unexpectedly, sequencing of the internal spacer sequences of individual repeat elements from multiple isolates showed conservation at the sequence level within deep evolutionary lineages of S. aureus. Whilst individual STAR element loci were demonstrated to expand and contract, the sequences associated with each locus were stable and distinct from one another. Conclusions The high degree of lineage and locus-specific conservation of these intergenic repeat regions suggests that STAR elements are maintained due to selective or molecular forces with some of these elements having an important role in cell physiology. The high prevalence in two of the more virulent staphylococcal species is indicative of a potential role for STAR elements in pathogenesis.

  1. Variation in the genomic locations and sequence conservation of STAR elements among staphylococcal species provides insight into DNA repeat evolution.

    Science.gov (United States)

    Purves, Joanne; Blades, Matthew; Arafat, Yasrab; Malik, Salman A; Bayliss, Christopher D; Morrissey, Julie A

    2012-09-28

    Staphylococcus aureus Repeat (STAR) elements are a type of interspersed intergenic direct repeat. In this study the conservation and variation in these elements was explored by bioinformatic analyses of published staphylococcal genome sequences and through sequencing of specific STAR element loci from a large set of S. aureus isolates. Using bioinformatic analyses, we found that the STAR elements were located in different genomic loci within each staphylococcal species. There was no correlation between the number of STAR elements in each genome and the evolutionary relatedness of staphylococcal species, however higher levels of repeats were observed in both S. aureus and S. lugdunensis compared to other staphylococcal species. Unexpectedly, sequencing of the internal spacer sequences of individual repeat elements from multiple isolates showed conservation at the sequence level within deep evolutionary lineages of S. aureus. Whilst individual STAR element loci were demonstrated to expand and contract, the sequences associated with each locus were stable and distinct from one another. The high degree of lineage and locus-specific conservation of these intergenic repeat regions suggests that STAR elements are maintained due to selective or molecular forces with some of these elements having an important role in cell physiology. The high prevalence in two of the more virulent staphylococcal species is indicative of a potential role for STAR elements in pathogenesis.

  2. Activation of Sterol Regulatory Element Binding Factors by Fenofibrate and Gemfibrozil Stimulate Myelination in Zebrafish

    Directory of Open Access Journals (Sweden)

    Yuhei Nishimura

    2016-07-01

    Full Text Available Oligodendrocytes are major myelin-producing cells and play essential roles in the function of a healthy nervous system. However, they are also one of the most vulnerable neural cell types in the central nervous system (CNS, and myelin abnormalities in the CNS are found in a wide variety of neurological disorders, including multiple sclerosis, adrenoleukodystrophy, and schizophrenia. There is an urgent need to identify small molecular weight compounds that can stimulate myelination. In this study, we performed comparative transcriptome analysis to identify pharmacodynamic effects common to miconazole and clobetasol, which have been shown to stimulate myelination by mouse oligodendrocyte progenitor cells (OPCs. Of the genes differentially expressed in both miconazole- and clobetasol-treated mouse OPCs compared with untreated cells, we identified differentially expressed genes (DEGs common to both drug treatments. Gene ontology analysis revealed that these DEGs are significantly associated with the sterol biosynthetic pathway, and further bioinformatics analysis suggested that sterol regulatory element binding factors (SREBFs might be key upstream regulators of the DEGs. In silico screening of a public database for chemicals associated with SREBF activation identified fenofibrate, a peroxisome proliferator-activated receptor α (PPARα agonist, as a drug that increases the expression of known SREBF targets, raising the possibility that fenofibrate may also stimulate myelination. To test this, we performed in vivo imaging of zebrafish expressing a fluorescent reporter protein under the control of the myelin basic protein (mbp promoter. Treatment of zebrafish with fenofibrate significantly increased expression of the fluorescent reporter compared with untreated zebrafish. This increase was attenuated by co-treatment with fatostatin, a specific inhibitor of SREBFs, confirming that the fenofibrate effect was mediated via SREBFs. Furthermore, incubation

  3. Prolactin regulatory element-binding protein is involved in suppression of the adiponectin gene in vivo.

    Science.gov (United States)

    Zhang, X Z; Imachi, H; Lyu, J Y; Fukunaga, K; Sato, S; Ibata, T; Kobayashi, T; Yoshimoto, T; Kikuchi, F; Dong, T; Murao, K

    2017-04-01

    Prolactin regulatory element-binding protein (PREB), a member of the WD-repeat protein family, has been recognized as a transcriptional factor that regulates prolactin promoter activity in the anterior pituitary of rats. PREB is expressed not only in the pituitary but also in various other tissues, including the adipose tissue. Previous studies have shown that PREB acts as a transcriptional regulator and suppresses the expression of the adiponectin gene in cultured 3T3L1 preadipocytes. The aim of this study was to further examine the potential role of PREB in adipose tissue in vivo. Transgenic mice that overexpressing PREB (PREB transgenic mice) were generated. Insulin resistance was evaluated in PREB transgenic mice using glucose and insulin tolerance tests. Adiponectin expression in the adipose tissue was examined by western blot analysis and quantitative polymerase chain reaction (qPCR). The expression levels of stearoyl-CoA desaturase (Scd) and adiponectin receptor 2(ADIPOR2) were quantified by qPCR. Glucose and insulin tolerance tests revealed insulin resistance in PREB transgenic mice. Serum adiponectin and leptin concentrations were decreased. Adiponectin gene expression was decreased in the adipose tissue, which was confirmed by the downregulation of the adiponectin-dependent hepatic Scd gene and upregulation of the ADIPOR2 gene in the liver of PREB transgenic mice. We also found that pioglitazone, an agonist for the peroxisome proliferator-activated receptor-r, improved the insulin resistance in the PREB transgenic mice after a 10-day feeding period. These results demonstrated that PREB might contribute to the regulation of adiponectin gene expression in vivo.

  4. Human Sterol Regulatory Element-Binding Protein 1a Contributes Significantly to Hepatic Lipogenic Gene Expression

    Directory of Open Access Journals (Sweden)

    Andreas Bitter

    2015-01-01

    Full Text Available Background/Aims: Sterol regulatory element-binding protein (SREBP 1, the master regulator of lipogenesis, was shown to be associated with non-alcoholic fatty liver disease, which is attributed to its major isoform SREBP1c. Based on studies in mice, the minor isoform SREBP1a is regarded as negligible for hepatic lipogenesis. This study aims to elucidate the expression and functional role of SREBP1a in human liver. Methods: mRNA expression of both isoforms was quantified in cohorts of human livers and primary human hepatocytes. Hepatocytes were treated with PF-429242 to inhibit the proteolytic activation of SREBP precursor protein. SREBP1a-specifc and pan-SREBP1 knock-down were performed by transfection of respective siRNAs. Lipogenic SREBP-target gene expression was analyzed by real-time RT-PCR. Results: In human liver, SREBP1a accounts for up to half of the total SREBP1 pool. Treatment with PF-429242 indicated SREBP-dependent auto-regulation of SREBP1a, which however was much weaker than of SREBP1c. SREBP1a-specifc knock-down also reduced significantly the expression of SREBP1c and of SREBP-target genes. Regarding most SREBP-target genes, simultaneous knock-down of both isoforms resulted in effects of only similar extent as SREBP1a-specific knock-down. Conclusion: We here showed that SREBP1a is significantly contributing to the human hepatic SREBP1 pool and has a share in human hepatic lipogenic gene expression.

  5. The alr-groEL1 operon in Mycobacterium tuberculosis: an interplay of multiple regulatory elements

    Science.gov (United States)

    Bhat, Aadil H.; Pathak, Deepika; Rao, Alka

    2017-01-01

    Threonylcarbamoyladenosine is a universally conserved essential modification of tRNA that ensures translational fidelity in cellular milieu. TsaD, TsaB and TsaE are identified as tRNA-A37-threonylcarbamoyl (t6A)-transferase enzymes that have been reconstituted in vitro, in few bacteria recently. However, transcriptional organization and regulation of these genes are not known in any of these organisms. This study describes the intricate architecture of a complex multicistronic alr-groEL1 operon, harboring essential genes, namely tsaD, tsaB, tsaE, groES, groEL1, and alr (required for cell wall synthesis), and rimI encoding an N-α- acetyltransferase in Mycobacterium tuberculosis. Using northern blotting, RT-PCR and in vivo fluorescence assays, genes alr to groEL1 were found to constitute an ~6.3 kb heptacistronic operon with multiple internal promoters and an I-shaped intrinsic hairpin-like cis-regulatory element. A strong promoter PtsaD within the coding sequence of rimI gene is identified in M. tuberculosis, in addition. The study further proposes an amendment in the known bicistronic groESL1 operon annotation by providing evidence that groESL1 is co-transcribed as sub-operon of alr-groEL1 operon. The architecture of alr-groEL1 operon, conservation of the genetic context and a mosaic transcriptional profile displayed under various stress conditions convincingly suggest the involvement of this operon in stress adaptation in M. tuberculosis. PMID:28256563

  6. Elements of a regulatory strategy for the consideration of future human actions in safety assessments

    Energy Technology Data Exchange (ETDEWEB)

    Wilmot, R.D.; Wickham, S.M.; Galson, D.A. [Galson Sciences Ltd, Oakham (United Kingdom)

    1999-09-01

    The objective of this report is to discuss issues that should be considered in the development of a regulatory strategy for assessing future human actions in any forthcoming license application for a deep repository for spent fuel in Sweden and for sites of other repositories. The report comprises an outline of key issues concerning the treatment of future human actions in safety assessment, reviews of regulatory developments, recent safety assessments and supporting studies, and international initiatives on the treatment of future human actions in safety assessment, and the principal elements of a regulatory strategy. Performance assessments (PAs) are generally accepted as providing illustrations of system performance under given sets of assumptions. The results of PAs are clearer and easier tounderstand if certain large uncertainties are accounted for by determining performance under several different sets of assumptions or scenarios, each of which defines a possible evolution of the disposal system. A number of assumptions can be made that would restrict the scope of an assessment without reducing the credibility of the corresponding safety case. Reducing speculation about technological development, by assuming that the techniques used in future human activities are similar to those currently in use in the region or at similar sites, will simplify the assessment. A distinction is generally made between inadvertent and intentional intrusion, with intentional activities excluded because society cannot protect future populations from their own actions if they understand the potential consequences. A division of human activities into 'recent and ongoing' and 'future' activities considers not only the timing of the activities but also the degree of control or influence that can be imposed on them. Recent and ongoing human activities are those that affect an area beyond the immediate vicinity of the disposal facility and which neither the proponent

  7. Differential control by IHF and cAMP of two oppositely oriented genes, hpt and gcd, in Escherichia coli: significance of their partially overlapping regulatory elements.

    Science.gov (United States)

    Izu, H; Ito, S; Elias, M D; Yamada, M

    2002-01-01

    The hpt gene, which encodes hypoxanthine phosphoribosyltransferase, is located next to, but transcribed in the opposite direction to, the gcd gene, which codes for a membrane-bound glucose dehydrogenase, at 3.1 min on the Escherichia coli genome. In their promoter-operator region, putative regulatory elements for integration host factor (IHF) and for the complex comprising 3', 5'-cyclic AMP (cAMP) and its receptor protein (CRP) are present, and they overlap the promoters for hpt and gcd, respectively. The involvement of IHF and cAMP-CRP, as well as the corresponding putative cis-acting elements, in the expression of the two genes was investigated by using lacZ operon fusions. In an adenylate cyclase-deficient strain, addition of cAMP increased the expression of hpt and reduced the expression of gcd. In agreement with this observation, the introduction of mutations into the putative binding element for the cAMP-CRP complex enhanced the expression of gcd. In contrast, mutations introduced into the putative IHF-binding elements increased the level of hpt expression. Similar results were obtained with IHF-defective strains. Thus, the expression of the two genes is regulated in a mutually exclusive manner. Additional experiments with mutations at the -10 sequence of the gcd promoter suggest that the binding of RNA polymerase to the hpt promoter interferes with the interaction of RNA polymerase with the gcd promoter, and vice versa.

  8. A novel regulatory element for Shh expression in the lung and gut of mouse embryos.

    Science.gov (United States)

    Tsukiji, Nagaharu; Amano, Takanori; Shiroishi, Toshihiko

    2014-02-01

    Hedgehog (Hh) signaling plays pivotal roles in morphogenesis of several embryonic tissues, including the primitive gut. In the mouse embryo, Sonic hedgehog (Shh) is expressed in endodermal epithelia from the oral cavity to the intestine, and contributes to cell proliferation in the underlying mesenchyme and subsequent differentiation into the gastrointestinal smooth muscle. Three evolutionary conserved non-coding sequences in the region upstream of the Shh coding sequence contain endoderm-specific enhancers for Shh expression. Although Shh expression in the endodermal epithelial lining is mostly attributed to these three enhancers, none of them regulates gene expression in the gastroesophageal epithelium. Here, we found that a 1.7Kb fragment located 100Kb upstream of the Shh coding sequence contains a functional element for Shh expression in endodermal organs, including the esophagus and stomach. Compared with the three known endodermal enhancers, this novel enhancer shows less evolutionary conservation, even among rodents. In mouse embryonic endodermal tissues, the seamless expression of Shh is achieved by a patchwork of multiple enhancers with different rates of evolution.

  9. Multiple Regulatory Elements in the Arabidopsis NIA1 Promoter Act Synergistically to Form a Nitrate Enhancer1[W][OA

    Science.gov (United States)

    Wang, Rongchen; Guan, Peizhu; Chen, Mingsheng; Xing, Xiujuan; Zhang, Yali; Crawford, Nigel M.

    2010-01-01

    To accommodate fluctuating nutrient levels in the soil, plants modulate their metabolism and root development via signaling mechanisms that rapidly reprogram the plant transcriptome. In the case of nitrate, over 1,000 genes are induced or repressed within minutes of nitrate exposure. To identify cis-regulatory elements that mediate these responses, an enhancer screen was performed in transgenic Arabidopsis (Arabidopsis thaliana) plants. A 1.8-kb promoter fragment from the nitrate reductase gene NIA1 was identified that acts as a nitrate enhancer when fused to a 35S minimal promoter. Enhancer activity was localized to a 180-bp fragment, and this activity could be enhanced by the addition of a 131-bp fragment from the nitrite reductase promoter. A promoter construct containing the 180- and 131-bp fragments was also induced by nitrite and repressed by ammonium, indicating that it was responsive to multiple nitrogen signals. To identify specific regulatory elements within the 180-bp NIA1 fragment, a transient expression system using agroinfiltration of Nicotiana benthamiana was developed. Deletion analysis identified three elements corresponding to predicted binding motifs for homeodomain/E-box, Myb, and Alfin1 transcription factors. A fully active promoter showing nitrate and nitrite enhancer activity equivalent to that of the wild-type 180-bp fragment could be built from these three elements if the spacing between the homeodomain/E-box and Myb-Alfin1 sites was equivalent to that of the native promoter. These findings were validated in transgenic Arabidopsis plants and identify a cis-regulatory module containing three elements that comprise a nitrate enhancer in the NIA1 promoter. PMID:20668061

  10. Testosterone physiology in resistance exercise and training: the up-stream regulatory elements.

    Science.gov (United States)

    Vingren, Jakob L; Kraemer, William J; Ratamess, Nicholas A; Anderson, Jeffrey M; Volek, Jeff S; Maresh, Carl M

    2010-12-01

    Testosterone is one of the most potent naturally secreted androgenic-anabolic hormones, and its biological effects include promotion of muscle growth. In muscle, testosterone stimulates protein synthesis (anabolic effect) and inhibits protein degradation (anti-catabolic effect); combined, these effects account for the promotion of muscle hypertrophy by testosterone. These physiological signals from testosterone are modulated through the interaction of testosterone with the intracellular androgen receptor (AR). Testosterone is important for the desired adaptations to resistance exercise and training; in fact, testosterone is considered the major promoter of muscle growth and subsequent increase in muscle strength in response to resistance training in men. The acute endocrine response to a bout of heavy resistance exercise generally includes increased secretion of various catabolic (breakdown-related) and anabolic (growth-related) hormones including testosterone. The response of testosterone and AR to resistance exercise is largely determined by upper regulatory elements including the acute exercise programme variable domains, sex and age. In general, testosterone concentration is elevated directly following heavy resistance exercise in men. Findings on the testosterone response in women are equivocal with both increases and no changes observed in response to a bout of heavy resistance exercise. Age also significantly affects circulating testosterone concentrations. Until puberty, children do not experience an acute increase in testosterone from a bout of resistance exercise; after puberty some acute increases in testosterone from resistance exercise can be found in boys but not in girls. Aging beyond 35-40 years is associated with a 1-3% decline per year in circulating testosterone concentration in men; this decline eventually results in the condition known as andropause. Similarly, aging results in a reduced acute testosterone response to resistance exercise in men

  11. Two essential regulatory elements in the human interferon gamma promoter confer activation specific expression in T cells.

    Science.gov (United States)

    Penix, L; Weaver, W M; Pang, Y; Young, H A; Wilson, C B

    1993-11-01

    Like interleukin 2 (IL-2), interferon gamma (IFN-gamma) is an early response gene in T cells and both are prototypical T helper cell type 1 (Th-1) lymphokines. Yet IL-2 and IFN-gamma production are independently regulated, as demonstrated by their differential expression in certain T cell subsets, suggesting that the regulatory elements in these two genes must differ. To explore this possibility, the 5' flank of the human IFN-gamma gene was analyzed. Expression of IFN-gamma promoter-driven beta-galactosidase reporter constructs containing 538 bp of 5' flank was similar to that by constructs driven by the IL-2 promoter in activated Jurkat T cells; expression nearly as great was observed with the construct containing only 108 bp of IFN-gamma 5' flank. These IFN-gamma promoter constructs faithfully mirrored expression of the endogenous gene, in that expression required activation both with ionomycin and PMA, was inhibited by cyclosporin A, and was not observed in U937 or THP-1 cells. The region between -108 and -40 bp in the IFN-gamma promoter was required for promoter function and contained two elements that are conserved across species. Deletion of 10 bp within either element reduced promoter function by 70%, whereas deletions in nonconserved portions of this region had little effect on promoter function. The distal conserved element (-96 to -80 bp) contained a consensus GATA motif and a potential regulatory motif found in the promoter regions of the GM-CSF and macrophage inflammatory protein (MIP) genes. Factors binding to this element, including GATA-3, were found in Jurkat nuclear extracts by electromobility shift assays and two of the three complexes observed were altered in response to activation. One or both of these motifs are present in the 5' flank of multiple, other lymphokine genes, including IL-3, IL-4, IL-5, and GM-CSF, but neither is present in the promoter of the IL-2 gene. The proximal conserved element (-73 to -48 bp) shares homology with the NFIL-2

  12. Characterization of a putative cis-regulatory element that controls transcriptional activity of the pig uroplakin II gene promoter.

    Science.gov (United States)

    Kwon, Deug-Nam; Park, Mi-Ryung; Park, Jong-Yi; Cho, Ssang-Goo; Park, Chankyu; Oh, Jae-Wook; Song, Hyuk; Kim, Jae-Hwan; Kim, Jin-Hoi

    2011-07-01

    Uroplakin II (UPII) is a one of the integral membrane proteins synthesized as a major differentiation product of mammalian urothelium. UPII gene expression is bladder specific and differentiation dependent, but little is known about its transcription response elements and molecular mechanism. To identify the cis-regulatory elements in the pig UPII (pUPII) gene promoter region, we constructed pUPII 5' upstream region deletion mutants and demonstrated that each of the deletion mutants participates in controlling the expression of the pUPII gene in human bladder carcinoma RT4 cells. We also identified a new core promoter region and putative negative cis-regulatory element within a minimal promoter region. In addition, we showed that hepatocyte nuclear factor 4 (HNF4) can directly bind in the pUPII core promoter (5F-1) region, which plays a critical role in controlling promoter activity. Transient cotransfection experiments showed that HNF4 positively regulates pUPII gene promoter activity. Thus, the binding element and its binding protein, HNF4 transcription factor, may be involved in the mechanism that specifically regulates pUPII gene transcription.

  13. Increasing the dynamic control space of mammalian transcription devices by combinatorial assembly of homologous regulatory elements from different bacterial species.

    Science.gov (United States)

    Bacchus, William; Weber, Wilfried; Fussenegger, Martin

    2013-01-01

    Prokaryotic transcriptional regulatory elements are widely utilized building blocks for constructing regulatory genetic circuits adapted for mammalian cells and have found their way into a broad range of biotechnological applications. Prokaryotic transcriptional repressors, fused to eukaryotic transactivation or repression domains, compose the transcription factor, which binds and adjusts transcription from chimeric promoters containing the repressor-specific operator sequence. Escherichia coli and Chlamydia trachomatis share common features in the regulatory mechanism of the biosynthesis of l-tryptophan. The repressor protein TrpR of C. trachomatis regulates the trpRBA operon and the TrpR of E. coli regulates the trpEDCBA operon, both requiring l-tryptophan as a co-repressor. Fusion of these bacterial repressors to the VP16 transactivation domain of Herpes simplex virus creates synthetic transactivators that could bind and activate chimeric promoters, assembled by placing repressor-specific operator modules adjacent to a minimal promoter, in an l-tryptophan-adjustable manner. Combinations of different transactivator and promoter variants from the same or different bacterial species resulted in a multitude of regulatory systems where l-tryptophan regulation properties, background noise, and maximal gene expression levels were significantly diverse. Different l-tryptophan analogues showed diverse regulatory capacity depending on the promoter/transactivator combination. We believe the systems approach to rationally choose promoters, transactivators and inducer molecules, to obtain desired and predefined genetic expression dynamics and control profiles, will significantly advance the design of new regulatory circuits as well as improving already existing ones. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

    Science.gov (United States)

    Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

    2015-08-15

    Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan.

  15. Trace Element Concentrations in Bearded Seals (Erignathus barbatus Near Red Dog Mine Compared to Other Locations in Alaska

    Directory of Open Access Journals (Sweden)

    Lori Quakenbush

    2009-01-01

    Full Text Available To determine if bearded seals (Erignathus barbatus harvested near a zinc and lead mine (Red Dog, Alaska , USA by subsistence hunters from Kivalina, Alaska, were as safe to eat as bearded seals from other locations in Alaska, we compared 19 trace element concentrations in liver tissue. Liver concentrations from nine bearded seals harvested near the Red Dog Mine (RDM port site were compared with 15 bearded seals from two reference sites (Hooper Bay and Little Diomede, Alaska, USA. Concentrations did not differ by gender, but we found statistically significant trends in concentrations of cadmium, mercury, manganese, selenium, and vanadium with age. Arsenic and copper were the only elements found to be more concentrated in the liver of bearded seals harvested near RDM than in the other locations. The predominant form of arsenic in marine mammals is known to be a nontoxic organic form, not the toxic inorganic form, and copper is an essential element. Although elevated near RDM, neither element was found at concentrations that presented health risks. We found no evidence that bearded seals harvested near RDM were less safe to eat or that trace element concentrations were greater than those found in bearded seals harvested elsewhere in Alaska or Canada.

  16. Statistically Significant Strings are Related to Regulatory Elements in the Promoter Regions of Saccharomyces cerevisiae

    CERN Document Server

    Hu, R; Hu, Rui; Wang, Bin

    2000-01-01

    Finding out statistically significant words in DNA and protein sequences forms the basis for many genetic studies. By applying the maximal entropy principle, we give one systematic way to study the nonrandom occurrence of words in DNA or protein sequences. Through comparison with experimental results, it was shown that patterns of regulatory binding sites in Saccharomyces cerevisiae(yeast) genomes tend to occur significantly in the promoter regions. We studied two correlated gene family of yeast. The method successfully extracts the binding sites varified by experiments in each family. Many putative regulatory sites in the upstream regions are proposed. The study also suggested that some regulatory sites are a ctive in both directions, while others show directional preference.

  17. Comparative analysis of the ATRX promoter and 5' regulatory region reveals conserved regulatory elements which are linked to roles in neurodevelopment, alpha-globin regulation and testicular function

    Directory of Open Access Journals (Sweden)

    Argentaro Anthony

    2011-06-01

    Full Text Available Abstract Background ATRX is a tightly-regulated multifunctional protein with crucial roles in mammalian development. Mutations in the ATRX gene cause ATR-X syndrome, an X-linked recessive developmental disorder resulting in severe mental retardation and mild alpha-thalassemia with facial, skeletal and genital abnormalities. Although ubiquitously expressed the clinical features of the syndrome indicate that ATRX is not likely to be a global regulator of gene expression but involved in regulating specific target genes. The regulation of ATRX expression is not well understood and this is reflected by the current lack of identified upstream regulators. The availability of genomic data from a range of species and the very highly conserved 5' regulatory regions of the ATRX gene has allowed us to investigate putative transcription factor binding sites (TFBSs in evolutionarily conserved regions of the mammalian ATRX promoter. Results We identified 12 highly conserved TFBSs of key gene regulators involved in biologically relevant processes such as neural and testis development and alpha-globin regulation. Conclusions Our results reveal potentially important regulatory elements in the ATRX gene which may lead to the identification of upstream regulators of ATRX and aid in the understanding of the molecular mechanisms that underlie ATR-X syndrome.

  18. Importance of location and exterior of city hotels as elements of guest satisfaction

    Directory of Open Access Journals (Sweden)

    Tepavčević Jelena

    2016-01-01

    Full Text Available Business practices and attitudes of tourists show that hospitality represents the primary factor in the development of urban tourism. It is considered that, besides the exclusive appearance, there is no business success for hotel properties without a proper location. It is known that a typical tourist would like to be close enough to tourist attractions, to be able to reach them on foot. This paper deals with the importance of location and exterior of urban hotels on guests decision on the selection and overall satisfaction with hotel products. The survey was conducted in the hotels two largest urban centers in Serbia (Belgrade and Novi Sad. The aim of the research is an insight into the real impact of location and exterior when assessing the guest satisfaction. Descriptive statistical analysis, t-test and regression analysis were used for statistical data processing.

  19. metagene Profiles Analyses Reveal Regulatory Element's Factor-Specific Recruitment Patterns.

    Science.gov (United States)

    Joly Beauparlant, Charles; Lamaze, Fabien C; Deschênes, Astrid; Samb, Rawane; Lemaçon, Audrey; Belleau, Pascal; Bilodeau, Steve; Droit, Arnaud

    2016-08-01

    ChIP-Sequencing (ChIP-Seq) provides a vast amount of information regarding the localization of proteins across the genome. The aggregation of ChIP-Seq enrichment signal in a metagene plot is an approach commonly used to summarize data complexity and to obtain a high level visual representation of the general occupancy pattern of a protein. Here we present the R package metagene, the graphical interface Imetagene and the companion package similaRpeak. Together, they provide a framework to integrate, summarize and compare the ChIP-Seq enrichment signal from complex experimental designs. Those packages identify and quantify similarities or dissimilarities in patterns between large numbers of ChIP-Seq profiles. We used metagene to investigate the differential occupancy of regulatory factors at noncoding regulatory regions (promoters and enhancers) in relation to transcriptional activity in GM12878 B-lymphocytes. The relationships between occupancy patterns and transcriptional activity suggest two different mechanisms of action for transcriptional control: i) a "gradient effect" where the regulatory factor occupancy levels follow transcription and ii) a "threshold effect" where the regulatory factor occupancy levels max out prior to reaching maximal transcription. metagene, Imetagene and similaRpeak are implemented in R under the Artistic license 2.0 and are available on Bioconductor.

  20. Creation of cis-regulatory elements during sea urchin evolution by co-option and optimization of a repetitive sequence adjacent to the spec2a gene.

    Science.gov (United States)

    Dayal, Sandeep; Kiyama, Takae; Villinski, Jeffrey T; Zhang, Ning; Liang, Shuguang; Klein, William H

    2004-09-15

    The creation, preservation, and degeneration of cis-regulatory elements controlling developmental gene expression are fundamental genome-level evolutionary processes about which little is known. Here, we identify critical differences in cis-regulatory elements controlling the expression of the sea urchin aboral ectoderm-specific spec genes. We found multiple copies of a repetitive sequence element termed RSR in genomes of species within the Strongylocentrotidae family, but RSRs were not detected in genomes of species outside Strongylocentrotidae. spec genes in Strongylocentrotus purpuratus are invariably associated with RSRs, and the spec2a RSR functioned as a transcriptional enhancer and displayed greater activity than did spec1 or spec2c RSRs. Single-base pair differences at two cis-regulatory elements within the spec2a RSR increased the binding affinities of four transcription factors, SpCCAAT-binding factor at one element and SpOtx, SpGoosecoid, and SpGATA-E at another. The cis-regulatory elements to which these four factors bound were recent evolutionary acquisitions that acted to either activate or repress transcription, depending on the cell type. These elements were found in the spec2a RSR ortholog in Strongylocentrotus pallidus but not in RSR orthologs of Strongylocentrotus droebachiensis or Hemicentrotus pulcherrimus. Our results indicated that a dynamic pattern of cis-regulatory element evolution exists for spec genes despite their conserved aboral ectoderm expression.

  1. Cytotype regulation by telomeric P elements in Drosophila melanogaster: variation in regulatory strength and maternal effects.

    Science.gov (United States)

    Thorp, Michael W; Chapman, Eric J; Simmons, Michael J

    2009-10-01

    Strains carrying the X-linked telomeric P elements TP5 or TP6 varied in their ability to repress hybrid dysgenesis. The rank ordering of these strains was consistent across different genetic assays and was not related to the type of telomeric P element (TP5 or TP6) present. Strong repression of dysgenesis was associated with weak expression of mRNA from the telomeric P element and also with a reduced amount of mRNA from a transposase-producing P element contained within a transgene inserted on an autosome. A strictly maternal component of repression, transmitted independently of the telomeric P element, was detected in the daughters but not the sons of females from the strongest repressing strains. However, this effect was seen only when dysgenesis was induced by crossing these females to males from a P strain, not when it was induced by crossing them to males homozygous for a single transposase-producing P element contained within a transgene. These findings are consistent with the hypothesis that the P cytotype, the condition that regulates P elements, involves an RNA interference mechanism mediated by piRNAs produced by telomeric P elements such as TP5 and TP6 and amplified by RNAs produced by other P elements.

  2. Regulatory elements associated with paternally-expressed genes in the imprinted murine Angelman/Prader-Willi syndrome domain.

    Directory of Open Access Journals (Sweden)

    Sara Rodriguez-Jato

    Full Text Available The Angelman/Prader-Willi syndrome (AS/PWS domain contains at least 8 imprinted genes regulated by a bipartite imprinting center (IC associated with the SNRPN gene. One component of the IC, the PWS-IC, governs the paternal epigenotype and expression of paternal genes. The mechanisms by which imprinting and expression of paternal genes within the AS/PWS domain - such as MKRN3 and NDN - are regulated by the PWS-IC are unclear. The syntenic region in the mouse is organized and imprinted similarly to the human domain with the murine PWS-IC defined by a 6 kb interval within the Snrpn locus that includes the promoter. To identify regulatory elements that may mediate PWS-IC function, we mapped the location and allele-specificity of DNase I hypersensitive (DH sites within the PWS-IC in brain cells, then identified transcription factor binding sites within a subset of these DH sites. Six major paternal-specific DH sites were detected in the Snrpn gene, five of which map within the 6 kb PWS-IC. We postulate these five DH sites represent functional components of the murine PWS-IC. Analysis of transcription factor binding within multiple DH sites detected nuclear respiratory factors (NRF's and YY1 specifically on the paternal allele. NRF's and YY1 were also detected in the paternal promoter region of the murine Mrkn3 and Ndn genes. These results suggest that NRF's and YY1 may facilitate PWS-IC function and coordinately regulate expression of paternal genes. The presence of NRF's also suggests a link between transcriptional regulation within the AS/PWS domain and regulation of respiration. 3C analyses indicated Mkrn3 lies in close proximity to the PWS-IC on the paternal chromosome, evidence that the PWS-IC functions by allele-specific interaction with its distal target genes. This could occur by allele-specific co-localization of the PWS-IC and its target genes to transcription factories containing NRF's and YY1.

  3. Integrated Nondestructive Evaluation and Finite Element Analysis Predicts Crack Location and Shape

    Science.gov (United States)

    Abdul-Azia, Ali; Baaklini, George Y.; Trudell, Jeffrey J.

    2002-01-01

    This study describes the finite-element analyses and the NDE modality undertaken on two flywheel rotors that were spun to burst speed. Computed tomography and dimensional measurements were used to nondestructively evaluate the rotors before and/or after they were spun to the first crack detection. Computed tomography data findings of two- and three-dimensional crack formation were used to conduct finite-element (FEA) and fracture mechanics analyses. A procedure to extend these analyses to estimate the life of these components is also outlined. NDE-FEA results for one of the rotors are presented in the figures. The stress results, which represent the radial stresses in the rim, clearly indicate that the maximum stress region is within the section defined by the computed tomography scan. Furthermore, the NDE data correlate well with the FEA results. In addition, the measurements reported show that the NDE and FEA data are in parallel.

  4. Efficient inversions and duplications of mammalian regulatory DNA elements and gene clusters by CRISPR/Cas9

    Science.gov (United States)

    Li, Jinhuan; Shou, Jia; Guo, Ya; Tang, Yuanxiao; Wu, Yonghu; Jia, Zhilian; Zhai, Yanan; Chen, Zhifeng; Xu, Quan; Wu, Qiang

    2015-01-01

    The human genome contains millions of DNA regulatory elements and a large number of gene clusters, most of which have not been tested experimentally. The clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated nuclease 9 (Cas9) programed with a synthetic single-guide RNA (sgRNA) emerges as a method for genome editing in virtually any organisms. Here we report that targeted DNA fragment inversions and duplications could easily be achieved in human and mouse genomes by CRISPR with two sgRNAs. Specifically, we found that, in cultured human cells and mice, efficient precise inversions of DNA fragments ranging in size from a few tens of bp to hundreds of kb could be generated. In addition, DNA fragment duplications and deletions could also be generated by CRISPR through trans-allelic recombination between the Cas9-induced double-strand breaks (DSBs) on two homologous chromosomes (chromatids). Moreover, junctions of combinatorial inversions and duplications of the protocadherin (Pcdh) gene clusters induced by Cas9 with four sgRNAs could be detected. In mice, we obtained founders with alleles of precise inversions, duplications, and deletions of DNA fragments of variable sizes by CRISPR. Interestingly, we found that very efficient inversions were mediated by microhomology-mediated end joining (MMEJ) through short inverted repeats. We showed for the first time that DNA fragment inversions could be transmitted through germlines in mice. Finally, we applied this CRISPR method to a regulatory element of the Pcdhα cluster and found a new role in the regulation of members of the Pcdhγ cluster. This simple and efficient method should be useful in manipulating mammalian genomes to study millions of regulatory DNA elements as well as vast numbers of gene clusters. PMID:25757625

  5. Sterol Regulatory Element Binding Protein 1a Regulates Hepatic Fatty Acid Partitioning by Activating Acetyl Coenzyme A Carboxylase 2

    OpenAIRE

    Im, Seung-Soon; Hammond, Linda E.; Yousef, Leyla; Nugas-Selby, Cherryl; Shin, Dong-Ju; Seo, Young-Kyo; Fong, Loren G.; Young, Stephen G.; Osborne, Timothy F.

    2009-01-01

    We generated a line of mice in which sterol regulatory element binding protein 1a (SREBP-1a) was specifically inactivated by insertional mutagenesis. Homozygous mutant mice were completely viable despite expressing SREBP-1a mRNA below 5% of normal, and there were minimal effects on expression of either SREBP-1c or -2. Microarray expression studies in liver, where SREBP-1a mRNA is 1/10 the level of the highly similar SREBP-1c, demonstrated that only a few genes were affected. The only downregu...

  6. Characterization of "cis"-regulatory elements ("c"RE) associated with mammary gland function

    Science.gov (United States)

    The Bos taurus genome assembly has propelled dairy science into a new era; still, most of the information encoded in the genome has not yet been decoded. The human Encyclopedia of DNA Elements (ENCODE) project has spearheaded the identification and annotation of functional genomic elements in the hu...

  7. Optical signal processing of video surveillance for recognizing and measurement location railway infrastructure elements

    Science.gov (United States)

    Diyazitdinov, Rinat R.; Vasin, Nikolay N.

    2016-03-01

    Processing of optical signals, which are received from CCD sensors of video cameras, allows to extend the functionality of video surveillance systems. Traditional video surveillance systems are used for saving, transmitting and preprocessing of the video content from the controlled objects. Video signal processing by analytics systems allows to get more information about object's location and movement, the flow of technological processes and to measure other parameters. For example, the signal processing of video surveillance systems, installed on carriage-laboratories, are used for getting information about certain parameters of the railways. Two algorithms for video processing, allowing recognition of pedestrian crossings of the railways, as well as location measurement of the so-called "Anchor Marks" used to control the mechanical stresses of continuous welded rail track are described in this article. The algorithms are based on the principle of determining the region of interest (ROI), and then the analysis of the fragments inside this ROI.

  8. Quasi-optimal locations of piezo-elements on a rectangular plate

    Science.gov (United States)

    Koszewnik, Andrzej; Gosiewski, Zdzisław

    2016-07-01

    The optimal location of piezo-actuators and piezo-sensors for the vibration control of a rectangular plate with SFSF (Simply Supported - Free - Simply Supported - Free) boundary conditions is presented in the paper. Based on bending moments, Mx(x,y) and My(x,y), the modal control forces generated by the piezo-stripes are calculated for the first five mode shapes. Calculations are carried out for different locations of two piezo-strips directed along the X and Y axes. The obtained results are used to define performance indexes of modal control forces for the two considered directions of vibration. In a similar way the modal unit elongations of the piezo-sensors are calculated for two different orientations of the piezos on the plate. Based on these results the objective cost functions J_{ɛ - odd} and J_{ɛ - even} are defined separately for odd and even modes. The quasi-optimal locations of the piezo-actuators and piezo-sensors are determined by maximizing the proposed cost functions. After analytical and numerical investigations the process of the full model identification is carried out at the laboratory stand. A chirp signal is applied in the identification process. The rectangular plate is excited with the chirp force while output signals are measured by the piezo-sensors oriented in the perpendicular directions X and Y. In such a way two mathematical models are obtained to control the vibration of the plate separately for odd and even natural modes.-1

  9. Elemental analysis and radiation hazards parameters of bauxite located in Saudi Arabia

    Science.gov (United States)

    Alashrah, S.; E Taher, A.

    2017-04-01

    Since Bauxite has been widely used in industry and in scientific investigations for producing Aluminum, it is important to measure the radionuclides concentrations to determine the health effect. The Bauxite mine is located in Az Zabirah city in Saudi Arabia. The concentrations of the radionuclides in the bauxite samples were measured using γ-ray spectrometer NaI (Tl). The average and range values of the concentrations of 226Ra, 232Th and 40K were 102.2 (141.1-62.7), 156.3 (202.8-102.8) and 116.8 (191.7- 48.9) Bq/kg respectively. These results were compared with the reported ranges in the literature from other locations around the world. The radiation hazard parameters; radium equivalent activity, annual dose, external hazard were also calculated and compared with the recommended levels by International Commission on Radiological Protection (ICRP-60) and united nations scientific committee on the effects of atomic radiation UNSCEAR reports. There are no studies for the natural radioactivity in the bauxite mine in Az Zabirah city, so these results are a start to establishing a database in this location.

  10. Auto and cross regulatory elements control Onecut expression in the ascidian nervous system.

    Science.gov (United States)

    Pezzotti, Maria Rosa; Locascio, Annamaria; Racioppi, Claudia; Fucci, Laura; Branno, Margherita

    2014-06-15

    The expression pattern of Onecut genes in the central and peripheral nervous systems is highly conserved in invertebrates and vertebrates but the regulatory networks in which they are involved are still largely unknown. The presence of three gene copies in vertebrates has revealed the functional roles of the Onecut genes in liver, pancreas and some populations of motor neurons. Urochordates have only one Onecut gene and are the closest living relatives of vertebrates and thus represent a good model system to understand its regulatory network and involvement in nervous system formation. In order to define the Onecut genetic cascade, we extensively characterized the Onecut upstream cis-regulatory DNA in the ascidian Ciona intestinalis. Electroporation experiments using a 2.5kb genomic fragment and of a series of deletion constructs identified a small region of 262bp able to reproduce most of the Onecut expression profile during embryonic development. Further analyses, both bioinformatic and in vivo using transient transgenes, permitted the identification of transcription factors responsible for Onecut endogenous expression. We provide evidence that Neurogenin is a direct activator of Onecut and that an autoregulatory loop is responsible for the maintenance of its expression. Furthermore, for the first time we propose the existence of a direct connection among Neurogenin, Onecut and Rx transcription factors in photoreceptor cell formation.

  11. The Role of Crowding Forces in Juxtaposing β-Globin Gene Domain Remote Regulatory Elements in Mouse Erythroid Cells.

    Directory of Open Access Journals (Sweden)

    Arkadiy K Golov

    Full Text Available The extremely high concentration of macromolecules in a eukaryotic cell nucleus indicates that the nucleoplasm is a crowded macromolecular solution in which large objects tend to gather together due to crowding forces. It has been shown experimentally that crowding forces support the integrity of various nuclear compartments. However, little is known about their role in control of chromatin dynamics in vivo. Here, we experimentally addressed the possible role of crowding forces in spatial organization of the eukaryotic genome. Using the mouse β-globin domain as a model, we demonstrated that spatial juxtaposition of the remote regulatory elements of this domain in globin-expressing cells may be lost and restored by manipulation of the level of macromolecular crowding. In addition to proving the role of crowding forces in shaping interphase chromatin, our results suggest that the folding of the chromatin fiber is a major determinant in juxtaposing remote genomic elements.

  12. An adaptive transposable element insertion in the regulatory region of the EO gene in the domesticated silkworm, Bombyx mori.

    Science.gov (United States)

    Sun, Wei; Shen, Yi-Hong; Han, Min-Jin; Cao, Yun-Feng; Zhang, Ze

    2014-12-01

    Although there are many studies to show a key role of transposable elements (TEs) in adaptive evolution of higher organisms, little is known about the molecular mechanisms. In this study, we found that a partial TE (Taguchi) inserted in the cis-regulatory region of the silkworm ecdysone oxidase (EO) gene, which encodes a crucial enzyme to reduce the titer of molting hormone (20-hydroxyecdysone, 20E). The TE insertion occurred during domestication of silkworm and the frequency of the TE insertion in the domesticated silkworm (Bombyx mori) is high, 54.24%. The linkage disequilibrium in the TE inserted strains of the domesticated silkworm was elevated. Molecular population genetics analyses suggest that this TE insertion is adaptive for the domesticated silkworm. Luminescent reporter assay shows that the TE inserted in the cis-regulatory region of the EO gene functions as a 20E-induced enhancer of the gene expression. Further, phenotypic bioassay indicates that the silkworm with the TE insertion exhibited more stable developmental phenotype than the silkworm without the TE insertion when suffering from food shortage. Thus, the inserted TE in the cis-regulatory region of the EO gene increased developmental uniformity of silkworm individuals through regulating 20E metabolism, partially explaining transformation of a domestication developmental trait in the domesticated silkworm. Our results emphasize the exceptional role of gene expression regulation in developmental transition of domesticated animals.

  13. Kinetics of transcription initiation directed by multiple cis-regulatory elements on the glnAp2 promoter.

    Science.gov (United States)

    Wang, Yaolai; Liu, Feng; Wang, Wei

    2016-12-15

    Transcription initiation is orchestrated by dynamic molecular interactions, with kinetic steps difficult to detect. Utilizing a hybrid method, we aim to unravel essential kinetic steps of transcriptional regulation on the glnAp2 promoter, whose regulatory region includes two enhancers (sites I and II) and three low-affinity sequences (sites III-V), to which the transcriptional activator NtrC binds. By structure reconstruction, we analyze all possible organization architectures of the transcription apparatus (TA). The main regulatory mode involves two NtrC hexamers: one at enhancer II transiently associates with site V such that the other at enhancer I can rapidly approach and catalyze the σ(54)-RNA polymerase holoenzyme. We build a kinetic model characterizing essential steps of the TA operation; with the known kinetics of the holoenzyme interacting with DNA, this model enables the kinetics beyond technical detection to be determined by fitting the input-output function of the wild-type promoter. The model further quantitatively reproduces transcriptional activities of various mutated promoters. These results reveal different roles played by two enhancers and interpret why the low-affinity elements conditionally enhance or repress transcription. This work presents an integrated dynamic picture of regulated transcription initiation and suggests an evolutionarily conserved characteristic guaranteeing reliable transcriptional response to regulatory signals. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. SINGLE-SHELL TANKS LEAK INTEGRITY ELEMENTS/SX FARM LEAK CAUSES AND LOCATIONS - 12127

    Energy Technology Data Exchange (ETDEWEB)

    VENETZ TJ; WASHENFELDER D; JOHNSON J; GIRARDOT C

    2012-01-25

    Washington River Protection Solutions, LLC (WRPS) developed an enhanced single-shell tank (SST) integrity project in 2009. An expert panel on SST integrity was created to provide recommendations supporting the development of the project. One primary recommendation was to expand the leak assessment reports (substitute report or LD-1) to include leak causes and locations. The recommendation has been included in the M-045-9IF Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) as one of four targets relating to SST leak integrity. The 241-SX Farm (SX Farm) tanks with leak losses were addressed on an individual tank basis as part of LD-1. Currently, 8 out of 23 SSTs that have been reported to having a liner leak are located in SX Farm. This percentage was the highest compared to other tank farms which is why SX Farm was analyzed first. The SX Farm is comprised of fifteen SSTs built 1953-1954. The tanks are arranged in rows of three tanks each, forming a cascade. Each of the SX Farm tanks has a nominal I-million-gal storage capacity. Of the fifteen tanks in SX Farm, an assessment reported leak losses for the following tanks: 241-SX-107, 241-SX-108, 241-SX-109, 241-SX-111, 241-SX-112, 241-SX-113, 241-SX-114 and 241-SX-115. The method used to identify leak location consisted of reviewing in-tank and ex-tank leak detection information. This provided the basic data identifying where and when the first leaks were detected. In-tank leak detection consisted of liquid level measurement that can be augmented with photographs which can provide an indication of the vertical leak location on the sidewall. Ex-tank leak detection for the leaking tanks consisted of soil radiation data from laterals and drywells near the tank. The in-tank and ex-tank leak detection can provide an indication of the possible leak location radially around and under the tank. Potential leak causes were determined using in-tank and ex-tank information that is not directly related to

  15. Relation between the location of elements in the periodic table and various organ-uptake rates.

    Science.gov (United States)

    Ando, A; Ando, I; Hiraki, T; Hisada, K

    1989-01-01

    Fifty four elements and 65 radioactive compounds were examined to determine the organ uptake rates for rats 3, 24 and 48 h after i.v. injection of these compounds. They were prepared as carrier free nuclides, or containing a small amount of stable nuclide. Generally speaking, behaviors of K, Rb, Cs and Tl in all the organs were very similar to one another, but they differed from that of Na. Bivalent hard acids were avidly taken up into bone; therefore, uptake rates in soft tissues were very small. Hard acids of tri-, quadri- and pentavalence which were taken up into the soft tissue organs decreased more slowly from these organs than other ions. Soft acids such as Hg2+ were bound very firmly to the component in the kidney. Anions (with few exceptions), GeCl4 and SbCl3 were rapidly excreted in urine, so that the uptake rates in organs were low.

  16. A comparative analysis of the evolution, expression, and cis-regulatory element of polygalacturonase genes in grasses and dicots.

    Science.gov (United States)

    Liang, Ying; Yu, Youjian; Cui, Jinlong; Lyu, Meiling; Xu, Liai; Cao, Jiashu

    2016-11-01

    Cell walls are a distinguishing characteristic of plants essential to their survival. The pectin content of primary cell walls in grasses and dicots is distinctly different. Polygalacturonases (PGs) can degrade pectins and participate in multiple developmental processes of plants. This study comprehensively compared the evolution, expression, and cis-regulatory element of PGs in grasses and dicots. A total of 577 PGs identified from five grasses and five dicots fell into seven clades. Evolutionary analysis demonstrated the distinct differences between grasses and dicots in patterns of gene duplication and loss, and evolutionary rates. Grasses generally contained much fewer clade C and F members than dicots. We found that this disparity was the result of less duplication and more gene losses in grasses. More duplications occurred in clades D and E, and expression analysis showed that most of clade E members were expressed ubiquitously at a high overall level and clade D members were closely related to male reproduction in both grasses and dicots, suggesting their biological functions were highly conserved across species. In addition to the general role in reproductive development, PGs of clades C and F specifically played roles in root development in dicots, shedding light on organ differentiation between the two groups of plants. A regulatory element analysis of clade C and F members implied that possible functions of PGs in specific biological responses contributed to their expansion and preservation. This work can improve the knowledge of PGs in plants generally and in grasses specifically and is beneficial to functional studies.

  17. Curcumin up-regulates LDL receptor expression via the sterol regulatory element pathway in HepG2 cells.

    Science.gov (United States)

    Dou, Xiaobing; Fan, Chunlei; Wo, Like; Yan, Jin; Qian, Ying; Wo, Xingde

    2008-09-01

    Plasma low-density lipoprotein-cholesterol (LDL-C) is mainly taken up and cleared by the hepatocellular LDL receptor (LDL-R). LDL-R gene expression is regulated by the sterol regulatory element binding proteins (SREBPs). Previous studies have shown that curcumin reduces plasma LDL-C and has hypolipidemic and anti-atherosclerotic effects. Herein, we investigated the effect of curcumin on LDL-R expression and its molecular mechanism in HepG2 cells. Curcumin increased LDL-R expression (mRNA and protein) and the resultant uptake of DiI-LDL in a dose- and time-dependent manner. Using a GFP reporter system in a transfected HepG2/SRE-GFP cell line, we found that curcumin activated the sterol regulatory element of the LDL-R promoter. In HepG2/Insig2 cells, curcumin reversed the inhibition of LDL-R expression induced by Insig2 overexpression. These data demonstrate that curcumin increases LDL-R protein expression and uptake activity via the SREBPs pathway. These findings contribute to our further understanding of the cholesterol-lowering and anti-atherosclerotic effects of curcumin.

  18. An unexpected location of the arginine catabolic mobile element (ACME) in a USA300-related MRSA strain

    DEFF Research Database (Denmark)

    Bartels, Mette Damkjær; Hansen, Lars Hestbjerg; Boye, Kit

    2011-01-01

    In methicillin resistant Staphylococcus aureus (MRSA), the arginine catabolic mobile element (ACME) was initially described in USA300 (t008-ST8) where it is located downstream of the staphylococcal cassette chromosome mec (SCCmec). A common health-care associated MRSA in Copenhagen, Denmark (t024......-ST8) is clonally related to USA300 and is frequently PCR positive for the ACME specific arcA-gene. This study is the first to describe an ACME element upstream of the SCCmec in MRSA. By traditional SCCmec typing schemes, the SCCmec of t024-ST8 strain M1 carries SCCmec IVa, but full sequencing...... of SCCmec, M1 had two new DR between the orfX gene and the J3 region of the SCCmec. The region between the orfX DR (DR1) and DR2 contained the ccrAB4 genes. An ACME II-like element was located between DR2 and DR3. The entire 26,468 bp sequence between DR1 and DR3 was highly similar to parts of the ACME...

  19. An Unexpected Location of the Arginine Catabolic Mobile Element (ACME) in a USA300-Related MRSA Strain

    DEFF Research Database (Denmark)

    Damkjær Bartels, Mette; Hansen, Lars H.; Boye, Kit;

    2011-01-01

    In methicillin resistant Staphylococcus aureus (MRSA), the arginine catabolic mobile element (ACME) was initially described in USA300 (t008-ST8) where it is located downstream of the staphylococcal cassette chromosome mec (SCCmec). A common health-care associated MRSA in Copenhagen, Denmark (t024......-ST8) is clonally related to USA300 and is frequently PCR positive for the ACME specific arcA-gene. This study is the first to describe an ACME element upstream of the SCCmec in MRSA. By traditional SCCmec typing schemes, the SCCmec of t024-ST8 strain M1 carries SCCmec IVa, but full sequencing...... of SCCmec, M1 had two new DR between the orfX gene and the J3 region of the SCCmec. The region between the orfX DR (DR1) and DR2 contained the ccrAB4 genes. An ACME II-like element was located between DR2 and DR3. The entire 26,468 bp sequence between DR1 and DR3 was highly similar to parts of the ACME...

  20. Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.

    Directory of Open Access Journals (Sweden)

    Daniel Meier

    Full Text Available The Fanconi anemia (FA gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS. In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs, and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.

  1. The Function of the Conserved Regulatory Element within the Second Intron of the Mammalian Csf1r Locus

    Science.gov (United States)

    O’Neal, Julie; Sester, David P.; Tagoh, Hiromi; Ingram, Richard M.; Pridans, Clare; Bonifer, Constanze; Hume, David A.

    2013-01-01

    The gene encoding the receptor for macrophage colony-stimulating factor (CSF-1R) is expressed exclusively in cells of the myeloid lineages as well as trophoblasts. A conserved element in the second intron, Fms-Intronic Regulatory Element (FIRE), is essential for macrophage-specific transcription of the gene. However, the molecular details of how FIRE activity is regulated and how it impacts the Csf1r promoter have not been characterised. Here we show that agents that down-modulate Csf1r mRNA transcription regulated promoter activity altered the occupancy of key FIRE cis-acting elements including RUNX1, AP1, and Sp1 binding sites. We demonstrate that FIRE acts as an anti-sense promoter in macrophages and reversal of FIRE orientation within its native context greatly reduced enhancer activity in macrophages. Mutation of transcription initiation sites within FIRE also reduced transcription. These results demonstrate that FIRE is an orientation-specific transcribed enhancer element. PMID:23383005

  2. The function of the conserved regulatory element within the second intron of the mammalian Csf1r locus.

    Directory of Open Access Journals (Sweden)

    Kristin A Sauter

    Full Text Available The gene encoding the receptor for macrophage colony-stimulating factor (CSF-1R is expressed exclusively in cells of the myeloid lineages as well as trophoblasts. A conserved element in the second intron, Fms-Intronic Regulatory Element (FIRE, is essential for macrophage-specific transcription of the gene. However, the molecular details of how FIRE activity is regulated and how it impacts the Csf1r promoter have not been characterised. Here we show that agents that down-modulate Csf1r mRNA transcription regulated promoter activity altered the occupancy of key FIRE cis-acting elements including RUNX1, AP1, and Sp1 binding sites. We demonstrate that FIRE acts as an anti-sense promoter in macrophages and reversal of FIRE orientation within its native context greatly reduced enhancer activity in macrophages. Mutation of transcription initiation sites within FIRE also reduced transcription. These results demonstrate that FIRE is an orientation-specific transcribed enhancer element.

  3. Identification of Distal cis-Regulatory Elements at Mouse Mitoferrin Loci Using Zebrafish Transgenesis▿

    OpenAIRE

    Amigo, J. D.; Yu, M.; Troadec, M.-B.; Gwynn, B; Cooney, J. D.; Lambert, A.J.; Chi, N. C.; Weiss, M J; Peters, L. L.; Kaplan, J; Cantor, Alan B.; Paw, Barry Htin

    2011-01-01

    Mitoferrin 1 (Mfrn1; Slc25a37) and mitoferrin 2 (Mfrn2; Slc25a28) function as essential mitochondrial iron importers for heme and Fe/S cluster biogenesis. A genetic deficiency of Mfrn1 results in a profound hypochromic anemia in vertebrate species. To map the cis-regulatory modules (CRMs) that control expression of the Mfrn genes, we utilized genome-wide chromatin immunoprecipitation (ChIP) datasets for the major erythroid transcription factor GATA-1. We identified the CRMs that faithfully dr...

  4. Transposable element insertion location bias and the dynamics of gene drive in mosquito populations.

    Science.gov (United States)

    Rasgon, J L; Gould, F

    2005-10-01

    Some vector-borne disease control strategies using transgenic mosquitoes require transgene spread to high frequency in populations. Transposable elements (TEs) are DNA sequences that replicate and transpose within the genomes of other organisms and may therefore be represented in the next generation in higher frequencies than predicted by Mendelian segregation. This over-representation has allowed some TEs to spread through natural populations. Transgenes incorporated within a TE sequence are expected to be driven into populations as long as there is a positive balance between fitness costs and over-representation. Models have been used to examine parameters that affect this balance but did not take into account biased insertion of TEs to linked sites in the genome. A simulation model was created to examine the impact of insertion bias on TE spread in mosquito populations. TEs that induce no fitness costs are predicted to increase in frequency over a wide range of parameter values but spread is slower for lower levels of transposition and non-local movement. If TEs are costly, high proportions of local movement can slow or halt spread. To function as a robust transgene drive mechanism a TE should replicate and transpose > 10%/insert/generation, induce < 1% fitness cost/insert, and move preferentially to unlinked sites in the genome.

  5. Prediction of coronary plaque location on arteries having myocardial bridge, using finite element models.

    Science.gov (United States)

    Nikolić, Dalibor; Radović, Miloš; Aleksandrić, Srđan; Tomašević, Miloje; Filipović, Nenad

    2014-11-01

    This study was performed to evaluate the influences of the myocardial bridges on the plaque initializations and progression in the coronary arteries. The wall structure is changed due to the plaque presence, which could be the reason for multiple heart malfunctions. Using simplified parametric finite element model (FE model) of the coronary artery having myocardial bridge and analyzing different mechanical parameters from blood circulation through the artery (wall shear stress, oscillatory shear index, residence time), we investigated the prediction of "the best" position for plaque progression. We chose six patients from the angiography records and used data from DICOM images to generate FE models with our software tools for FE preprocessing, solving and post-processing. We found a good correlation between real positions of the plaque and the ones that we predicted to develop at the proximal part of the myocardial bridges with wall shear stress, oscillatory shear index and residence time. This computer model could be additional predictive tool for everyday clinical examination of the patient with myocardial bridge.

  6. Relation between the location of elements in the periodic table and tumor-uptake rate.

    Science.gov (United States)

    Ando, A; Ando, I; Hiraki, T; Hisada, K

    1985-01-01

    The bipositive ions and anions, with few exceptions, indicated a low tumor uptake rate. On the other hand, compounds of Hg, Au and Bi, which have a strong binding power to protein, showed a high tumor uptake rate. As Hg2+, Au+ and Bi3+ are soft acids according to the classification of Lewis acids, it was thought that these ions would bind strongly to soft bases (R-SH, R-S-) present in tumor tissue. For many hard acids such as 85Sr2+, 67Ga3+, 181Hf4+, and 95Nb5+, tumor uptake rates are shown as a function of ionic potentials (valency/ionic radii) of the metal ions. Considering the present data and previously reported results, it was presumed that hard acids of trivalence, quadrivalence and pentavalence would replace calcium in the calcium salts of hard bases (calcium salts of acid mucopolysaccharides, etc.). Ionic potentials of alkaline metals and Tl were small, but the tumor-uptake rate of these elements indicated various values. As Ge and Sb are bound by covalent bonds to chloride, GeCl4 and SbCl3 behaved differently from many metallic compounds in tumor tissue.

  7. [Relations between location of elements in periodic table and affinity for the kidneys (author's transl)].

    Science.gov (United States)

    Ando, A; Hisada, K; Ando, I

    1977-10-01

    The distribution of many inorganic compounds in rats was investigated in order to evaluate kidney affinity of inorganic compounds. In these experiments, 30%, 10-20% and 4-10% of administered dose was localized in the kidneys in 203Hg-acetate and 203 Bi-acetate, in H198AuCl4, 103PdCl2, 201TlCl, 210Pd(NO3)2 and H2(127M)TeO3, and in Na2(51)CrO4, 54MnCl2, (114m)InCl3 and 7BeCl2, respectively. Some bipositive ions and anions was hardly taken up into the kidneys. And in many hard acids according to classification of Lewis acids, the uptake rate into the kidneys was usually small. On the other hand, Hg, Au and Bi, which have strong binding power to the protein, showed high uptake rate in the kidneys. As Hg++, Au+ and Bi+++ was soft acids according to classification of Lewis acids, it was thought that these elements would bind strongly to soft base (RSH, RS-) present in the kidney.

  8. [Relation between location of elements in periodic table and affinity for the malignant tumor (author's transl)].

    Science.gov (United States)

    Ando, A; Hisada, K; Ando, I

    1977-10-01

    Affinity of many inorganic compounds for the malignant tumor was examined, using the rats which were subcutaneously transplanted with Yoshida sarcoma. And the relations between the uptake rate into the malignant tumor and in vitro binding power to the protein were investigated in these compounds. In these experiments, the bipositive ions and anions had not affinity for the tumor tissue with a few exceptions. On the other hand, Hg, Au and Bi, which have strong binding power to the protein, showed high uptake rate into the malignant tumor. As Hg++, Au+ and Bi+++ are soft acids according to classification of Lewis acids, it was thought that these elements would bind strongly to soft base (R-SH, R-S-) present in the tumor tissue. In many hard acids (according to classification of Lewis acids), the uptake rate into the tumor was shown as a function of ionic potentials (valency/ionic radii) of the metal ions. It is presumed that the chemical bond of these hard acids in the tumor tissue is ionic bond to hard base (R-COO-, R-PO3(2-), R-SO3-, R-NH2).

  9. Expression of human transferrin can be regulated effectively by rabbit transferrin regulatory elements in transgenic mice.

    Science.gov (United States)

    Yan, Jingbin; Gong, Xiuli; Pan, Shubiao; Guo, Xinbing; Ren, Zhaorui; Zeng, Yitao

    2014-06-01

    Human transferrin (hTF) belongs to the iron-binding glycoprotein family. It plays an important role in iron transport throughout the body. Transgenic mice are a good model to study how to produce functional hTF on a large-scale. We have improved the expression of hTF and investigated its regulatory mechanism in transgenic mice. Three expression constructs were prepared in which hTF expression was controlled by different regulatory cassettes of rabbit transferrin (rTF). hTF was secreted into serum of transgenic mice when its expression was controlled by the rTF promoter and enhancer, whereas the rTF enhancer in tandem with the rTF promoter repressed hTF secretion into milk. A significant inverse relationship between methylation of the rTF promoter and hTF expression was observed in liver, heart, mammary gland, and muscle of transgenic mice. The highest concentration of hTF was 700 μg/ml in milk.

  10. TRACE ELEMENT CONTENTS IN TOPSOIL LOCATED NEAR STEEL PLANT IN KRAKOW-NOWA HUTA

    Directory of Open Access Journals (Sweden)

    Paweł Mundała

    2014-10-01

    Full Text Available The paper presents the results of cadmium, lead and zinc contents in topsoils of arable land located in vicinity Steel Plant in Krakow-Nowa Huta. Soil samples were collected in autumn 2007 from the 0-20 cm layer placed in a west-east trnsect of 7,5 km length. It started approximately 5km east form the border of the steel plant. .Sampled area is characterized by high level of agriculture, where the dominant crops have been vegetables, mainly cabbage and cauliflower. It was found, the soil was not contaminated with heavy metals. All samples met the requirements of the Polish Minister of the Environment. Also the assessment according to Institute of Soil Science and Plant Cultivation method showed only incerased content 60% in case of zinc and only 13% for Cd. Any levels of pollution were not observed. There also decreasing trend of accumulation were stated as a function of growing distance from the steel plant.

  11. Isotopes and trace elements as geo-location markers for biosecurity: determining the origin of exotic pests.

    Science.gov (United States)

    Holder, Peter W.; Armstrong, Karen; Clough, Tim; Frew, Russell; van Hale, Robert; Baker, Joel A.; Millet, Marc-Alban

    2010-05-01

    Background. The benefits of accurate point of origin discrimination in biosecurity include achieving appropriate operational responses in exotic pest eradication and post-border incursion campaigns, and identifying risk pathways. Reading natural abundance biogeochemical markers via mass spectrometry methods is a powerful tool for tracing ecological pathways and provenance determination of agricultural products and items of forensic interest. However, the application of these methods to trace insects - man's most damaging competitors - has been underutilised to date and our understanding in this field is still in a phase of basic development. Stable isotope ratio analyses using δ2H, δ13C have given spatial resolution in the monarch butterfly, single host system in eastern North America. Subsequently, the same method was employed in an attempt to determine the origin of important biosecurity pests in New Zealand. However, the results were contentious as the accuracy and limitations of the method in a biosecurity application were unknown. Further investigation has shown the value of existing invertebrate stable isotope geo-location methodology (i.e., using only two light elements) is tenuous in the biosecurity context, where the sample sizes are usually only one or two insects, and the specimens are generally polyphagous and accidentally introduced, and so from an unknown and unpredictable place, point in time and host: The spatial distribution of 2H in New Zealand may not be reliable over insect life-span time-scales; and fractional variables are un-quantified and potentially overwhelm any New Zealand signal. Further, the geo-location value of 13C is uncertain, especially for polyphagous insects. Research aims. The internationally distributed Helicoverpa armigera [Noctuidae] is being used to examine the processes fundamental to the location-to-plant-to-insect biogeochemical profile imprinting in phytophagous insects, including the turn over of elements in adult

  12. An unexpected location of the arginine catabolic mobile element (ACME in a USA300-related MRSA strain.

    Directory of Open Access Journals (Sweden)

    Mette Damkjær Bartels

    Full Text Available In methicillin resistant Staphylococcus aureus (MRSA, the arginine catabolic mobile element (ACME was initially described in USA300 (t008-ST8 where it is located downstream of the staphylococcal cassette chromosome mec (SCCmec. A common health-care associated MRSA in Copenhagen, Denmark (t024-ST8 is clonally related to USA300 and is frequently PCR positive for the ACME specific arcA-gene. This study is the first to describe an ACME element upstream of the SCCmec in MRSA. By traditional SCCmec typing schemes, the SCCmec of t024-ST8 strain M1 carries SCCmec IVa, but full sequencing of the cassette revealed that the entire J3 region had no homology to published SCCmec IVa. Within the J3 region of M1 was a 1705 bp sequence only similar to a sequence in S. haemolyticus strain JCSC1435 and 2941 bps with no homology found in GenBank. In addition to the usual direct repeats (DR at each extremity of SCCmec, M1 had two new DR between the orfX gene and the J3 region of the SCCmec. The region between the orfX DR (DR1 and DR2 contained the ccrAB4 genes. An ACME II-like element was located between DR2 and DR3. The entire 26,468 bp sequence between DR1 and DR3 was highly similar to parts of the ACME composite island of S. epidermidis strain ATCC12228. Sequencing of an ACME negative t024-ST8 strain (M299 showed that DR1 and the sequence between DR1 and DR3 was missing. The finding of a mobile ACME II-like element inserted downstream of orfX and upstream of SCCmec indicates a novel recombination between staphylococcal species.

  13. Identification of novel craniofacial regulatory domains located far upstream ofSOX9and disrupted in Pierre Robin sequence

    OpenAIRE

    2014-01-01

    Mutations in the coding sequence of SOX9 cause campomelic dysplasia (CD), a disorder of skeletal development associated with 46,XY disorders of sex development (DSDs). Translocations, deletions and duplications within a ~2 Mb region upstream of SOX9 can recapitulate the CD-DSD phenotype fully or partially, suggesting the existence of an unusually large cis-regulatory control region. Pierre Robin sequence (PRS) is a craniofacial disorder that is frequently an endophenotype of CD and a locus fo...

  14. Location, location, location

    NARCIS (Netherlands)

    Anderson, S.P.; Goeree, J.K.; Ramer, R.

    1997-01-01

    We analyze the canonical location-then-price duopoly game with general log- concave consumer densities. A unique pure-strategy equilibrium to the two-stage game exists if the density is not "too asymmetric" and not "too concave." These criteria are satisfied by many commonly used densities. Equilibr

  15. Unusual 5'-regulatory structure and regulation of the murine Mlc1 gene: Lack of promoter-specific functional elements

    Directory of Open Access Journals (Sweden)

    Darja Henseler

    2011-10-01

    Full Text Available Normal 0 21 false false false MicrosoftInternetExplorer4 The MLC1 gene is involved in an autosomal recessive neurological disorder, megalencephalic leucoencephalopathy with subcortical cysts (MLC, which is characterized by macrocephaly during the first year of life and swollen white matter (leucoencephaly. Variants of MLC1 have also been associated with psychiatric disorders such as schizophrenia, major depression and bipolar disorder. Currently, little is known about the encoded protein (MLC1. Judging from its similarity to other known proteins, it may serve as a trans-membrane transporter. However, the function of the encoded protein and its gene regulation has not been investigated successfully so far. We investigated the 5’ region of the murine Mlc1 with respect to regulatory elements for gene expression. A promoter search and an in silico analysis were conducted. Luciferase reporter gene constructs with potential promoter regions were created to study promoter activity in vitro. We found two alternative first exons for the murine Mlc1 but were not able to detect any promoter activity for the investigated reporter gene constructs in different cell lines, thus pointing to the presence of essential cis-acting elements far outside of the region. In silico analysis indicated an uncommon promoter structure for Mlc1, with CCAAT-boxes representing the only noticeable elements.

  16. Levels and spatial distribution of airborne chemical elements in a heavy industrial area located in the north of Spain.

    Science.gov (United States)

    Lage, J; Almeida, S M; Reis, M A; Chaves, P C; Ribeiro, T; Garcia, S; Faria, J P; Fernández, B G; Wolterbeek, H T

    2014-01-01

    The adverse health effects of airborne particles have been subjected to intense investigation in recent years; however, more studies on the chemical characterization of particles from pollution emissions are needed to (1) identify emission sources, (2) better understand the relative toxicity of particles, and (3) pinpoint more targeted emission control strategies and regulations. The main objective of this study was to assess the levels and spatial distribution of airborne chemical elements in a heavy industrial area located in the north of Spain. Instrumental and biomonitoring techniques were integrated and analytical methods for k0 instrumental neutron activation analysis and particle-induced x-ray emission were used to determine element content in aerosol filters and lichens. Results indicated that in general local industry contributed to the emissions of As, Sb, Cu, V, and Ni, which are associated with combustion processes. In addition, the steelwork emitted significant quantities of Fe and Mn and the cement factory was associated with Ca emissions. The spatial distribution of Zn and Al also indicated an important contribution of two industries located outside the studied area.

  17. A novel processing system of sterol regulatory element-binding protein-1c regulated by polyunsaturated fatty acid.

    Science.gov (United States)

    Nakakuki, Masanori; Kawano, Hiroyuki; Notsu, Tatsuto; Imada, Kazunori; Mizuguchi, Kiyoshi; Shimano, Hitoshi

    2014-05-01

    The proteolytic cascade is the key step in transactivation of sterol regulatory element-binding proteins (SREBPs), a transcriptional factor of lipid synthesis. Proteolysis of SREBP-2 is strictly regulated by sterols, but that of SREBP-1c was not strongly sterol-regulated, but inhibited by polyunsaturated fatty acids (PUFAs). In this study, the proteolytic processing of SREBP-1 and -2 was examined by transfection studies of cDNA-encoding mutants in which all the known cleavage sites were disrupted. In cultured cells, sterol-regulated SREBP-2 processing was completely eliminated by mutation of cleavage sites. In contrast, the corresponding SREBP-1c mutants as well as wild type exhibited large amounts of cleaved products in the nuclear extracts from culture cells and murine liver in vivo. The nuclear form of the mutant SREBP-1c was induced by delipidated condition and suppressed by eicosapentaenoic acid, an n-3 PUFA, but not by sterols. This novel processing mechanism was affected by neither SREBP cleavage-activating protein (SCAP) nor insulin-induced gene (Insig)-1, unlike SREBP-2, but abolished by a serine protease inhibitor. Through analysis of deletion mutant, a site-2 protease recognition sequence (DRSR) was identified to be involved in this novel processing. These findings suggest that SREBP-1c cleavage could be subjected to a novel PUFA-regulated cleavage system in addition to the sterol-regulatory SCAP/Insig system.

  18. Computational Identification of Tissue-Specific Splicing Regulatory Elements in Human Genes from RNA-Seq Data

    Science.gov (United States)

    Badr, Eman; ElHefnawi, Mahmoud; Heath, Lenwood S.

    2016-01-01

    Alternative splicing is a vital process for regulating gene expression and promoting proteomic diversity. It plays a key role in tissue-specific expressed genes. This specificity is mainly regulated by splicing factors that bind to specific sequences called splicing regulatory elements (SREs). Here, we report a genome-wide analysis to study alternative splicing on multiple tissues, including brain, heart, liver, and muscle. We propose a pipeline to identify differential exons across tissues and hence tissue-specific SREs. In our pipeline, we utilize the DEXSeq package along with our previously reported algorithms. Utilizing the publicly available RNA-Seq data set from the Human BodyMap project, we identified 28,100 differentially used exons across the four tissues. We identified tissue-specific exonic splicing enhancers that overlap with various previously published experimental and computational databases. A complicated exonic enhancer regulatory network was revealed, where multiple exonic enhancers were found across multiple tissues while some were found only in specific tissues. Putative combinatorial exonic enhancers and silencers were discovered as well, which may be responsible for exon inclusion or exclusion across tissues. Some of the exonic enhancers are found to be co-occurring with multiple exonic silencers and vice versa, which demonstrates a complicated relationship between tissue-specific exonic enhancers and silencers. PMID:27861625

  19. Sterol Regulatory Element Binding Protein (Srb1) Is Required for Hypoxic Adaptation and Virulence in the Dimorphic Fungus Histoplasma capsulatum

    Science.gov (United States)

    DuBois, Juwen C.; Smulian, A. George

    2016-01-01

    The Histoplasma capsulatum sterol regulatory element binding protein (SREBP), Srb1 is a member of the basic helix-loop-helix (bHLH), leucine zipper DNA binding protein family of transcription factors that possess a unique tyrosine (Y) residue instead of an arginine (R) residue in the bHLH region. We have determined that Srb1 message levels increase in a time dependent manner during growth under oxygen deprivation (hypoxia). To further understand the role of Srb1 during infection and hypoxia, we silenced the gene encoding Srb1 using RNA interference (RNAi); characterized the resulting phenotype, determined its response to hypoxia, and its ability to cause disease within an infected host. Silencing of Srb1 resulted in a strain of H. capsulatum that is incapable of surviving in vitro hypoxia. We found that without complete Srb1 expression, H. capsulatum is killed by murine macrophages and avirulent in mice given a lethal dose of yeasts. Additionally, silencing Srb1 inhibited the hypoxic upregulation of other known H. capsulatum hypoxia-responsive genes (HRG), and genes that encode ergosterol biosynthetic enzymes. Consistent with these regulatory functions, Srb1 silenced H. capsulatum cells were hypersensitive to the antifungal azole drug itraconazole. These data support the theory that the H. capsulatum SREBP is critical for hypoxic adaptation and is required for H. capsulatum virulence. PMID:27711233

  20. Inferring regulatory element landscapes and transcription factor networks from cancer methylomes.

    Science.gov (United States)

    Yao, Lijing; Shen, Hui; Laird, Peter W; Farnham, Peggy J; Berman, Benjamin P

    2015-05-21

    Recent studies indicate that DNA methylation can be used to identify transcriptional enhancers, but no systematic approach has been developed for genome-wide identification and analysis of enhancers based on DNA methylation. We describe ELMER (Enhancer Linking by Methylation/Expression Relationships), an R-based tool that uses DNA methylation to identify enhancers and correlates enhancer state with expression of nearby genes to identify transcriptional targets. Transcription factor motif analysis of enhancers is coupled with expression analysis of transcription factors to infer upstream regulators. Using ELMER, we investigated more than 2,000 tumor samples from The Cancer Genome Atlas. We identified networks regulated by known cancer drivers such as GATA3 and FOXA1 (breast cancer), SOX17 and FOXA2 (endometrial cancer), and NFE2L2, SOX2, and TP63 (squamous cell lung cancer). We also identified novel networks with prognostic associations, including RUNX1 in kidney cancer. We propose ELMER as a powerful new paradigm for understanding the cis-regulatory interface between cancer-associated transcription factors and their functional target genes.

  1. Distinct functional constraints partition sequence conservation in a cis-regulatory element.

    Directory of Open Access Journals (Sweden)

    Antoine Barrière

    2011-06-01

    Full Text Available Different functional constraints contribute to different evolutionary rates across genomes. To understand why some sequences evolve faster than others in a single cis-regulatory locus, we investigated function and evolutionary dynamics of the promoter of the Caenorhabditis elegans unc-47 gene. We found that this promoter consists of two distinct domains. The proximal promoter is conserved and is largely sufficient to direct appropriate spatial expression. The distal promoter displays little if any conservation between several closely related nematodes. Despite this divergence, sequences from all species confer robustness of expression, arguing that this function does not require substantial sequence conservation. We showed that even unrelated sequences have the ability to promote robust expression. A prominent feature shared by all of these robustness-promoting sequences is an AT-enriched nucleotide composition consistent with nucleosome depletion. Because general sequence composition can be maintained despite sequence turnover, our results explain how different functional constraints can lead to vastly disparate rates of sequence divergence within a promoter.

  2. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes

    Science.gov (United States)

    Mahmood, Khalid; Mathiassen, Solvejg K.; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management. PMID:27547209

  3. Multiple Herbicide Resistance in Lolium multiflorum and Identification of Conserved Regulatory Elements of Herbicide Resistance Genes.

    Science.gov (United States)

    Mahmood, Khalid; Mathiassen, Solvejg K; Kristensen, Michael; Kudsk, Per

    2016-01-01

    Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of Lolium multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR) genes were also observed after herbicides exposure in the gene expression databases, indicating them as reliable markers. In order to get an overview of herbicidal resistance status of L. multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS) inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase) inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively, and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O. sativa and A. thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif is known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward toward a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management.

  4. Multiple herbicide resistance in Lolium multiflorum and identification of conserved regulatory elements of herbicide resistance genes

    Directory of Open Access Journals (Sweden)

    Khalid Mahmood

    2016-08-01

    Full Text Available Herbicide resistance is a ubiquitous challenge to herbicide sustainability and a looming threat to control weeds in crops. Recently four genes were found constituently over-expressed in herbicide resistant individuals of Lolium rigidum, a close relative of L. multiflorum. These include two cytochrome P450s, one nitronate monooxygenase and one glycosyl-transferase. Higher expressions of these four herbicide metabolism related (HMR genes were also observed after herbicides exposure in the gene expression databases, indicating them a reliable marker. In order to get an overview of herbicidal resistance status of Lolium multiflorum L, 19 field populations were collected. Among these populations, four populations were found to be resistant to acetolactate synthase (ALS inhibitors while three exhibited resistance to acetyl-CoA carboxylase (ACCase inhibitors in our initial screening and dose response study. The genotyping showed the presence of mutations Trp-574-Leu and Ile-2041-Asn in ALS and ACCase, respectively and qPCR experiments revealed the enhanced expression of HMR genes in individuals of certain resistant populations. Moreover, co-expression networks and promoter analyses of HMR genes in O.sativa and A.thaliana resulted in the identification of a cis-regulatory motif and zinc finger transcription factors. The identified transcription factors were highly expressed similar to HMR genes in response to xenobiotics whereas the identified motif known to play a vital role in coping with environmental stresses and maintaining genome stability. Overall, our findings provide an important step forward towards a better understanding of metabolism-based herbicide resistance that can be utilized to devise novel strategies of weed management.

  5. An "in-out" strategy using gene targeting and FLP recombinase for the functional dissection of complex DNA regulatory elements: analysis of the beta-globin locus control region.

    OpenAIRE

    Fiering, S; Kim, C. G.; Epner, E M; Groudine, M

    1993-01-01

    The human beta-globin locus control region (LCR) is a complex DNA regulatory element that controls the expression of the cis-linked beta-like globin genes located in the 55 kilobases 3' of the LCR. We have initiated the functional analysis of the LCR by homologous recombination in murine erythroleukemia cell somatic hybrids that carry a single copy of human chromosome 11 on which the beta-globin locus is situated. High-level expression of the human beta-globin gene normally occurs when these ...

  6. Piperine Induces Hepatic Low-Density Lipoprotein Receptor Expression through Proteolytic Activation of Sterol Regulatory Element-Binding Proteins.

    Directory of Open Access Journals (Sweden)

    Ayasa Ochiai

    Full Text Available Elevated plasma low-density lipoprotein (LDL cholesterol is considered as a risk factor for atherosclerosis. Because the hepatic LDL receptor (LDLR uptakes plasma lipoproteins and lowers plasma LDL cholesterol, the activation of LDLR is a promising drug target for atherosclerosis. In the present study, we identified the naturally occurring alkaloid piperine, as an inducer of LDLR gene expression by screening the effectors of human LDLR promoter. The treatment of HepG2 cells with piperine increased LDLR expression at mRNA and protein levels and stimulated LDL uptake. Subsequent luciferase reporter gene assays revealed that the mutation of sterol regulatory element-binding protein (SREBP-binding element abolished the piperine-mediated induction of LDLR promoter activity. Further, piperine treatments increased mRNA levels of several SREBP targets and mature forms of SREBPs. However, the piperine-mediated induction of the mature forms of SREBPs was not observed in SRD-15 cells, which lack insulin-induced gene-1 (Insig-1 and Insig-2. Finally, the knockdown of SREBPs completely abolished the piperine-meditated induction of LDLR gene expression in HepG2 cells, indicating that piperine stimulates the proteolytic activation of SREBP and subsequent induction of LDLR expression and activity.

  7. Piperine Induces Hepatic Low-Density Lipoprotein Receptor Expression through Proteolytic Activation of Sterol Regulatory Element-Binding Proteins.

    Science.gov (United States)

    Ochiai, Ayasa; Miyata, Shingo; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2015-01-01

    Elevated plasma low-density lipoprotein (LDL) cholesterol is considered as a risk factor for atherosclerosis. Because the hepatic LDL receptor (LDLR) uptakes plasma lipoproteins and lowers plasma LDL cholesterol, the activation of LDLR is a promising drug target for atherosclerosis. In the present study, we identified the naturally occurring alkaloid piperine, as an inducer of LDLR gene expression by screening the effectors of human LDLR promoter. The treatment of HepG2 cells with piperine increased LDLR expression at mRNA and protein levels and stimulated LDL uptake. Subsequent luciferase reporter gene assays revealed that the mutation of sterol regulatory element-binding protein (SREBP)-binding element abolished the piperine-mediated induction of LDLR promoter activity. Further, piperine treatments increased mRNA levels of several SREBP targets and mature forms of SREBPs. However, the piperine-mediated induction of the mature forms of SREBPs was not observed in SRD-15 cells, which lack insulin-induced gene-1 (Insig-1) and Insig-2. Finally, the knockdown of SREBPs completely abolished the piperine-meditated induction of LDLR gene expression in HepG2 cells, indicating that piperine stimulates the proteolytic activation of SREBP and subsequent induction of LDLR expression and activity.

  8. An ensemble of regulatory elements controls Runx3 spatiotemporal expression in subsets of dorsal root ganglia proprioceptive neurons.

    Science.gov (United States)

    Appel, Elena; Weissmann, Sarit; Salzberg, Yehuda; Orlovsky, Kira; Negreanu, Varda; Tsoory, Michael; Raanan, Calanit; Feldmesser, Ester; Bernstein, Yael; Wolstein, Orit; Levanon, Ditsa; Groner, Yoram

    2016-12-01

    The Runx3 transcription factor is essential for development and diversification of the dorsal root ganglia (DRGs) TrkC sensory neurons. In Runx3-deficient mice, developing TrkC neurons fail to extend central and peripheral afferents, leading to cell death and disruption of the stretch reflex circuit, resulting in severe limb ataxia. Despite its central role, the mechanisms underlying the spatiotemporal expression specificities of Runx3 in TrkC neurons were largely unknown. Here we first defined the genomic transcription unit encompassing regulatory elements (REs) that mediate the tissue-specific expression of Runx3. Using transgenic mice expressing BAC reporters spanning the Runx3 locus, we discovered three REs-dubbed R1, R2, and R3-that cross-talk with promoter-2 (P2) to drive TrkC neuron-specific Runx3 transcription. Deletion of single or multiple elements either in the BAC transgenics or by CRISPR/Cas9-mediated endogenous ablation established the REs' ability to promote and/or repress Runx3 expression in developing sensory neurons. Our analysis reveals that an intricate combinatorial interplay among the three REs governs Runx3 expression in distinct subtypes of TrkC neurons while concomitantly extinguishing its expression in non-TrkC neurons. These findings provide insights into the mechanism regulating cell type-specific expression and subtype diversification of TrkC neurons in developing DRGs. © 2016 Appel et al.; Published by Cold Spring Harbor Laboratory Press.

  9. Distinct cis regulatory elements govern the expression of TAG1 in embryonic sensory ganglia and spinal cord.

    Science.gov (United States)

    Hadas, Yoav; Nitzan, Noa; Furley, Andrew J W; Kozlov, Serguei V; Klar, Avihu

    2013-01-01

    Cell fate commitment of spinal progenitor neurons is initiated by long-range, midline-derived, morphogens that regulate an array of transcription factors that, in turn, act sequentially or in parallel to control neuronal differentiation. Included among these are transcription factors that regulate the expression of receptors for guidance cues, thereby determining axonal trajectories. The Ig/FNIII superfamily molecules TAG1/Axonin1/CNTN2 (TAG1) and Neurofascin (Nfasc) are co-expressed in numerous neuronal cell types in the CNS and PNS - for example motor, DRG and interneurons - both promote neurite outgrowth and both are required for the architecture and function of nodes of Ranvier. The genes encoding TAG1 and Nfasc are adjacent in the genome, an arrangement which is evolutionarily conserved. To study the transcriptional network that governs TAG1 and Nfasc expression in spinal motor and commissural neurons, we set out to identify cis elements that regulate their expression. Two evolutionarily conserved DNA modules, one located between the Nfasc and TAG1 genes and the second directly 5' to the first exon and encompassing the first intron of TAG1, were identified that direct complementary expression to the CNS and PNS, respectively, of the embryonic hindbrain and spinal cord. Sequential deletions and point mutations of the CNS enhancer element revealed a 130bp element containing three conserved E-boxes required for motor neuron expression. In combination, these two elements appear to recapitulate a major part of the pattern of TAG1 expression in the embryonic nervous system.

  10. Origins of Cdx1 regulatory elements suggest roles in vertebrate evolution.

    Science.gov (United States)

    Gaunt, Stephen J; Paul, Yu-Lee

    2011-01-01

    Cdx1, an upstream regulator of Hox genes, is best characterized for its homeotic effects upon the developing axial skeleton, particularly in the neck. It responds to retinoic acid (RA) in both mouse embryos and embryonal carcinoma (EC) cells. By use of beta-galactosidase chemiluminescence, we show that a mouse Cdx1/lacZ reporter expressed in P19 EC cells responds to RA by the combined activities of an intron retinoic acid response element (RARE) and an upstream RARE. In contrast, a chicken Cdx1/lacZ reporter responds only by activity of the intron RARE. Database analyses upon Cdx1 from twenty three vertebrate species reveal that the intron RARE is structurally conserved in amniotes (eutherian mammals, marsupials, birds and Anole lizard), but not in Xenopus or fish. The upstream RARE is structurally conserved only in eutherian mammals. We conclude that the intron RARE originated at around the amphibian/amniote division, and the upstream RARE appeared around the marsupial/eutherian mammal division. In view of the site of action of Cdx1, we propose that acquisition of the intron RARE may have facilitated the substantial changes that occurred in the neck and anterior thorax at the advent of the amniotes. We present evidence that Cdx1 is also a developmental regulator of the female urogenital system, and we suggest that acquisition of the upstream RARE may have contributed to morphological divergence of marsupial and eutherian mammals.

  11. Functional evolution of the p53 regulatory network through its target response elements

    Science.gov (United States)

    Jegga, Anil G.; Inga, Alberto; Menendez, Daniel; Aronow, Bruce J.; Resnick, Michael A.

    2008-01-01

    Transcriptional network evolution is central to the development of complex biological systems. Networks can evolve through variation of master regulators and/or by changes in regulation of genes within networks. To gain insight into meaningful evolutionary differences in large networks, it is essential to address the functional consequences of sequence differences in response elements (REs) targeted by transcription factors. Using a combination of custom bioinformatics and multispecies alignment of promoter regions, we investigated the functional evolution of REs in terms of responsiveness to the sequence-specific transcription factor p53, a tumor suppressor and master regulator of stress responses. We identified REs orthologous to known p53 targets in human and rodent cells or alternatively REs related to the established p53 consensus. The orthologous REs were assigned p53 transactivation capabilities based on rules determined from model systems, and a functional heat map was developed to visually summarize conservation of sequence and relative level of responsiveness to p53 for 47 REs in 14 species. Individual REs exhibited marked differences in transactivation potentials and widespread evolutionary turnover. Functional differences were often not predicted from consensus sequence evaluations. Of the established human p53 REs analyzed, 91% had sequence conservation in at least one nonprimate species compared with 67.5% for functional conservation. Surprisingly, there was almost no conservation of functional REs for genes involved in DNA metabolism or repair between humans and rodents, suggesting important differences in p53 stress responses and cancer development. PMID:18187580

  12. Shared Enhancer Activity in the Limbs and Phallus and Functional Divergence of a Limb-Genital cis-Regulatory Element in Snakes.

    Science.gov (United States)

    Infante, Carlos R; Mihala, Alexandra G; Park, Sungdae; Wang, Jialiang S; Johnson, Kenji K; Lauderdale, James D; Menke, Douglas B

    2015-10-12

    The amniote phallus and limbs differ dramatically in their morphologies but share patterns of signaling and gene expression in early development. Thus far, the extent to which genital and limb transcriptional networks also share cis-regulatory elements has remained unexplored. We show that many limb enhancers are retained in snake genomes, suggesting that these elements may function in non-limb tissues. Consistent with this, our analysis of cis-regulatory activity in mice and Anolis lizards reveals that patterns of enhancer activity in embryonic limbs and genitalia overlap heavily. In mice, deletion of HLEB, an enhancer of Tbx4, produces defects in hindlimbs and genitalia, establishing the importance of this limb-genital enhancer for development of these different appendages. Further analyses demonstrate that the HLEB of snakes has lost hindlimb enhancer function while retaining genital activity. Our findings identify roles for Tbx4 in genital development and highlight deep similarities in cis-regulatory activity between limbs and genitalia.

  13. Transcriptome Analysis of an Insecticide Resistant Housefly Strain: Insights about SNPs and Regulatory Elements in Cytochrome P450 Genes.

    Directory of Open Access Journals (Sweden)

    Khalid Mahmood

    Full Text Available Insecticide resistance in the housefly, Musca domestica, has been investigated for more than 60 years. It will enter a new era after the recent publication of the housefly genome and the development of multiple next generation sequencing technologies. The genetic background of the xenobiotic response can now be investigated in greater detail. Here, we investigate the 454-pyrosequencing transcriptome of the spinosad-resistant 791spin strain in relation to the housefly genome with focus on P450 genes.The de novo assembly of clean reads gave 35,834 contigs consisting of 21,780 sequences of the spinosad resistant strain. The 3,648 sequences were annotated with an enzyme code EC number and were mapped to 124 KEGG pathways with metabolic processes as most highly represented pathway. One hundred and twenty contigs were annotated as P450s covering 44 different P450 genes of housefly. Eight differentially expressed P450s genes were identified and investigated for SNPs, CpG islands and common regulatory motifs in promoter and coding regions. Functional annotation clustering of metabolic related genes and motif analysis of P450s revealed their association with epigenetic, transcription and gene expression related functions. The sequence variation analysis resulted in 12 SNPs and eight of them found in cyp6d1. There is variation in location, size and frequency of CpG islands and specific motifs were also identified in these P450s. Moreover, identified motifs were associated to GO terms and transcription factors using bioinformatic tools.Transcriptome data of a spinosad resistant strain provide together with genome data fundamental support for future research to understand evolution of resistance in houseflies. Here, we report for the first time the SNPs, CpG islands and common regulatory motifs in differentially expressed P450s. Taken together our findings will serve as a stepping stone to advance understanding of the mechanism and role of P450s in

  14. Formaldehyde-Assisted Isolation of Regulatory Elements (FAIRE analysis uncovers broad changes in chromatin structure resulting from hexavalent chromium exposure.

    Directory of Open Access Journals (Sweden)

    Jerald L Ovesen

    Full Text Available The ability of chromatin to switch back and forth from open euchromatin to closed heterochromatin is vital for transcriptional regulation and genomic stability, but its dynamic structure is subject to disruption by exposure to environmental agents such as hexavalent chromium. Cr(VI exposure disrupts chromatin remodeling mechanisms and causes chromosomal damage through formation of free radicals, Cr-DNA adducts, and DNA-Cr-protein cross-links. In addition, acute, high-concentration, and chronic, low-concentration exposures to Cr(VI lead to significantly different transcriptional and genomic stability outcomes. We used mouse hepatoma Hepa-1c1c7 cells to investigate how transcriptional responses to chromium treatment might correlate with structural chromatin changes. We used Formaldehyde-Assisted Isolation of Regulatory Elements (FAIRE analysis coupled with deep sequencing to identify regions of the genome that may switch between open and closed chromatin in response to exposure to varying Cr(VI concentrations. At either Cr(VI concentration, chromatin domains surrounding binding sites for AP-1 transcription factors become significantly open, whereas BACH2 and CTCF binding sites are open solely at the low and high concentrations, respectively. Parallel gene expression profiling using RNA-seq indicates that the structural chromatin changes caused by Cr(VI affect gene expression levels in the target areas that vary depending on Cr(VI concentration, but show no correlation between global changes in the overall transcriptional response and Cr(VI concentration. Our results suggest that FAIRE may be a useful technique to map chromatin elements targeted by DNA damaging agents for which there is no prior knowledge of their specificity, and to identify subsequent transcriptomic changes induced by those agents.

  15. Sterol regulatory element-binding proteins are regulators of the rat thyroid peroxidase gene in thyroid cells.

    Directory of Open Access Journals (Sweden)

    Christine Rauer

    Full Text Available Sterol regulatory element-binding proteins (SREBPs-1c and -2, which were initially discovered as master transcriptional regulators of lipid biosynthesis and uptake, were recently identified as novel transcriptional regulators of the sodium-iodide symporter gene in the thyroid, which is essential for thyroid hormone synthesis. Based on this observation that SREBPs play a role for thyroid hormone synthesis, we hypothesized that another gene involved in thyroid hormone synthesis, the thyroid peroxidase (TPO gene, is also a target of SREBP-1c and -2. Thyroid epithelial cells treated with 25-hydroxycholesterol, which is known to inhibit SREBP activation, had about 50% decreased mRNA levels of TPO. Similarly, the mRNA level of TPO was reduced by about 50% in response to siRNA mediated knockdown of both, SREBP-1 and SREBP-2. Reporter gene assays revealed that overexpression of active SREBP-1c and -2 causes a strong transcriptional activation of the rat TPO gene, which was localized to an approximately 80 bp region in the intron 1 of the rat TPO gene. In vitro- and in vivo-binding of both, SREBP-1c and SREBP-2, to this region in the rat TPO gene could be demonstrated using gel-shift assays and chromatin immunoprecipitation. Mutation analysis of the 80 bp region of rat TPO intron 1 revealed two isolated and two overlapping SREBP-binding elements from which one, the overlapping SRE+609/InvSRE+614, was shown to be functional in reporter gene assays. In connection with recent findings that the rat NIS gene is also a SREBP target gene in the thyroid, the present findings suggest that SREBPs may be possible novel targets for pharmacological modulation of thyroid hormone synthesis.

  16. The flavone apigenin blocks nuclear translocation of sterol regulatory element-binding protein-2 in the hepatic cells WRL-68.

    Science.gov (United States)

    Wong, Tsz Yan; Lin, Shu-Mei; Leung, Lai K

    2015-06-28

    Sterol regulatory element-binding protein-2 (SREBP-2) is a pivotal transcriptional factor in cholesterol metabolism. Factors interfering with the proper functioning of SREBP-2 potentially alter plasma lipid concentrations. Consuming fruits and vegetables is associated with beneficial plasma lipid profile. The mechanism by which plant foods induce desirable lipid changes remains unclear. Apigenin, a common plant food flavonoid, was shown to modulate the nuclear translocation of SREBP-2 in the hepatic cells WRL-68 in the present study. The processing of SREBP-2 protein occurred after translation, and apigenin blocked this activation route. Further examination indicated that AMP-activated protein kinase (AMPK) was activated by the flavone, and co-administrating the AMPK-specific inhibitor compound C could release the blockage. Reporter gene assay revealed that the transactivation of sterol responsive element (SRE)-containing 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) promoter was suppressed by the flavone. Similarly, electromobility shift assay result also demonstrated a reduced DNA-binding activity on the SRE domain under the same treatment. The reduced transactivity and DNA-binding activity could be attributed to a decreased amount of SREBP-2 translocating from cytosol to nucleus as depicted by confocal microscopy. Quantitative RT-PCR assay demonstrated that the transcription of HMGCR followed the same pattern of SREBP-2 translocation. In summary, the present study showed that apigenin prevented SREBP-2 translocation and reduced the downstream gene HMGCR transcription. The minimum effective dosage should be achievable in the form of functional food consumption or dietary supplementation.

  17. A Meiotic Drive Element in the Maize Pathogen Fusarium verticillioides Is Located Within a 102 kb Region of Chromosome V.

    Science.gov (United States)

    Pyle, Jay; Patel, Tejas; Merrill, Brianna; Nsokoshi, Chabu; McCall, Morgan; Proctor, Robert H; Brown, Daren W; Hammond, Thomas M

    2016-08-09

    Fusarium verticillioides is an agriculturally important fungus because of its association with maize and its propensity to contaminate grain with toxic compounds. Some isolates of the fungus harbor a meiotic drive element known as Spore killer (Sk(K)) that causes nearly all surviving meiotic progeny from an Sk(K) × Spore killer-susceptible (Sk(S)) cross to inherit the Sk(K) allele. Sk(K) has been mapped to chromosome V but the genetic element responsible for meiotic drive has yet to be identified. In this study, we used cleaved amplified polymorphic sequence markers to genotype individual progeny from an Sk(K) × Sk(S) mapping population. We also sequenced the genomes of three progeny from the mapping population to determine their single nucleotide polymorphisms. These techniques allowed us to refine the location of Sk(K) to a contiguous 102 kb interval of chromosome V, herein referred to as the Sk region. Relative to Sk(S) genotypes, Sk(K) genotypes have one extra gene within this region for a total of 42 genes. The additional gene in Sk(K) genotypes, herein named SKC1 for Spore Killer Candidate 1, is the most highly expressed gene from the Sk region during early stages of sexual development. The Sk region also has three hyper-variable regions, the longest of which includes SKC1 The possibility that SKC1, or another gene from the Sk region, is an essential component of meiotic drive and spore killing is discussed.

  18. Distinct cis regulatory elements govern the expression of TAG1 in embryonic sensory ganglia and spinal cord.

    Directory of Open Access Journals (Sweden)

    Yoav Hadas

    Full Text Available Cell fate commitment of spinal progenitor neurons is initiated by long-range, midline-derived, morphogens that regulate an array of transcription factors that, in turn, act sequentially or in parallel to control neuronal differentiation. Included among these are transcription factors that regulate the expression of receptors for guidance cues, thereby determining axonal trajectories. The Ig/FNIII superfamily molecules TAG1/Axonin1/CNTN2 (TAG1 and Neurofascin (Nfasc are co-expressed in numerous neuronal cell types in the CNS and PNS - for example motor, DRG and interneurons - both promote neurite outgrowth and both are required for the architecture and function of nodes of Ranvier. The genes encoding TAG1 and Nfasc are adjacent in the genome, an arrangement which is evolutionarily conserved. To study the transcriptional network that governs TAG1 and Nfasc expression in spinal motor and commissural neurons, we set out to identify cis elements that regulate their expression. Two evolutionarily conserved DNA modules, one located between the Nfasc and TAG1 genes and the second directly 5' to the first exon and encompassing the first intron of TAG1, were identified that direct complementary expression to the CNS and PNS, respectively, of the embryonic hindbrain and spinal cord. Sequential deletions and point mutations of the CNS enhancer element revealed a 130bp element containing three conserved E-boxes required for motor neuron expression. In combination, these two elements appear to recapitulate a major part of the pattern of TAG1 expression in the embryonic nervous system.

  19. Regulation of steroid 5-{alpha} reductase type 2 (Srd5a2) by sterol regulatory element binding proteins and statin

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Young-Kyo [Department of Molecular Biology and Biochemistry, 3244 McGaugh Hall, University of California, UC Irvine, Irvine, CA 92697-3900 (United States); Zhu, Bing [Department of Pathology, University of Texas Medical Branch, Galveston, TX 77555-0144 (United States); Jeon, Tae-Il [Department of Molecular Biology and Biochemistry, 3244 McGaugh Hall, University of California, UC Irvine, Irvine, CA 92697-3900 (United States); Osborne, Timothy F., E-mail: tfosborn@uci.edu [Department of Molecular Biology and Biochemistry, 3244 McGaugh Hall, University of California, UC Irvine, Irvine, CA 92697-3900 (United States)

    2009-11-01

    In this study, we show that sterol regulatory element binding proteins (SREBPs) regulate expression of Srd5a2, an enzyme that catalyzes the irreversible conversion of testosterone to dihydroxytestosterone in the male reproductive tract and is highly expressed in androgen-sensitive tissues such as the prostate and skin. We show that Srd5a2 is induced in livers and prostate from mice fed a chow diet supplemented with lovastatin plus ezitimibe (L/E), which increases the activity of nuclear SREBP-2. The three fold increase in Srd5a2 mRNA mediated by L/E treatment was accompanied by the induction of SREBP-2 binding to the Srd5a2 promoter detected by a ChIP-chip assay in liver. We identified a SREBP-2 responsive region within the first 300 upstream bases of the mouse Srd5a2 promoter by co-transfection assays which contain a site that bound SREBP-2 in vitro by an EMSA. Srd5a2 protein was also induced in cells over-expressing SREBP-2 in culture. The induction of Srd5a2 through SREBP-2 provides a mechanistic explanation for why even though statin therapy is effective in reducing cholesterol levels in treating hypercholesterolemia it does not compromise androgen production in clinical studies.

  20. Xanthohumol Improves Diet-induced Obesity and Fatty Liver by Suppressing Sterol Regulatory Element-binding Protein (SREBP) Activation.

    Science.gov (United States)

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro

    2015-08-14

    Sterol regulatory element-binding proteins (SREBPs) are key transcription factors that stimulate the expression of genes involved in fatty acid and cholesterol biosynthesis. Here, we demonstrate that a prenylated flavonoid in hops, xanthohumol (XN), is a novel SREBP inactivator that reduces the de novo synthesis of fatty acid and cholesterol. XN independently suppressed the maturation of SREBPs of insulin-induced genes in a manner different from sterols. Our results suggest that XN impairs the endoplasmic reticulum-to-Golgi translocation of the SREBP cleavage-activating protein (SCAP)-SREBP complex by binding to Sec23/24 and blocking SCAP/SREBP incorporation into common coated protein II vesicles. Furthermore, in diet-induced obese mice, dietary XN suppressed SREBP-1 target gene expression in the liver accompanied by a reduction of the mature form of hepatic SREBP-1, and it inhibited the development of obesity and hepatic steatosis. Altogether, our data suggest that XN attenuates the function of SREBP-1 by repressing its maturation and that it has the potential of becoming a nutraceutical food or pharmacological agent for improving metabolic syndrome.

  1. Xanthohumol Improves Diet-induced Obesity and Fatty Liver by Suppressing Sterol Regulatory Element-binding Protein (SREBP) Activation*

    Science.gov (United States)

    Miyata, Shingo; Inoue, Jun; Shimizu, Makoto; Sato, Ryuichiro

    2015-01-01

    Sterol regulatory element-binding proteins (SREBPs) are key transcription factors that stimulate the expression of genes involved in fatty acid and cholesterol biosynthesis. Here, we demonstrate that a prenylated flavonoid in hops, xanthohumol (XN), is a novel SREBP inactivator that reduces the de novo synthesis of fatty acid and cholesterol. XN independently suppressed the maturation of SREBPs of insulin-induced genes in a manner different from sterols. Our results suggest that XN impairs the endoplasmic reticulum-to-Golgi translocation of the SREBP cleavage-activating protein (SCAP)-SREBP complex by binding to Sec23/24 and blocking SCAP/SREBP incorporation into common coated protein II vesicles. Furthermore, in diet-induced obese mice, dietary XN suppressed SREBP-1 target gene expression in the liver accompanied by a reduction of the mature form of hepatic SREBP-1, and it inhibited the development of obesity and hepatic steatosis. Altogether, our data suggest that XN attenuates the function of SREBP-1 by repressing its maturation and that it has the potential of becoming a nutraceutical food or pharmacological agent for improving metabolic syndrome. PMID:26140926

  2. Regulatory mechanisms that prevent re-initiation of DNA replication can be locally modulated at origins by nearby sequence elements.

    Directory of Open Access Journals (Sweden)

    Christopher D Richardson

    2014-06-01

    Full Text Available Eukaryotic cells must inhibit re-initiation of DNA replication at each of the thousands of origins in their genome because re-initiation can generate genomic alterations with extraordinary frequency. To minimize the probability of re-initiation from so many origins, cells use a battery of regulatory mechanisms that reduce the activity of replication initiation proteins. Given the global nature of these mechanisms, it has been presumed that all origins are inhibited identically. However, origins re-initiate with diverse efficiencies when these mechanisms are disabled, and this diversity cannot be explained by differences in the efficiency or timing of origin initiation during normal S phase replication. This observation raises the possibility of an additional layer of replication control that can differentially regulate re-initiation at distinct origins. We have identified novel genetic elements that are necessary for preferential re-initiation of two origins and sufficient to confer preferential re-initiation on heterologous origins when the control of re-initiation is partially deregulated. The elements do not enhance the S phase timing or efficiency of adjacent origins and thus are specifically acting as re-initiation promoters (RIPs. We have mapped the two RIPs to ∼ 60 bp AT rich sequences that act in a distance- and sequence-dependent manner. During the induction of re-replication, Mcm2-7 reassociates both with origins that preferentially re-initiate and origins that do not, suggesting that the RIP elements can overcome a block to re-initiation imposed after Mcm2-7 associates with origins. Our findings identify a local level of control in the block to re-initiation. This local control creates a complex genomic landscape of re-replication potential that is revealed when global mechanisms preventing re-replication are compromised. Hence, if re-replication does contribute to genomic alterations, as has been speculated for cancer cells, some

  3. Identification of gene co-regulatory modules and associated cis-elements involved in degenerative heart disease

    Directory of Open Access Journals (Sweden)

    Danko Charles G

    2009-05-01

    Full Text Available Abstract Background Cardiomyopathies, degenerative diseases of cardiac muscle, are among the leading causes of death in the developed world. Microarray studies of cardiomyopathies have identified up to several hundred genes that significantly alter their expression patterns as the disease progresses. However, the regulatory mechanisms driving these changes, in particular the networks of transcription factors involved, remain poorly understood. Our goals are (A to identify modules of co-regulated genes that undergo similar changes in expression in various types of cardiomyopathies, and (B to reveal the specific pattern of transcription factor binding sites, cis-elements, in the proximal promoter region of genes comprising such modules. Methods We analyzed 149 microarray samples from human hypertrophic and dilated cardiomyopathies of various etiologies. Hierarchical clustering and Gene Ontology annotations were applied to identify modules enriched in genes with highly correlated expression and a similar physiological function. To discover motifs that may underly changes in expression, we used the promoter regions for genes in three of the most interesting modules as input to motif discovery algorithms. The resulting motifs were used to construct a probabilistic model predictive of changes in expression across different cardiomyopathies. Results We found that three modules with the highest degree of functional enrichment contain genes involved in myocardial contraction (n = 9, energy generation (n = 20, or protein translation (n = 20. Using motif discovery tools revealed that genes in the contractile module were found to contain a TATA-box followed by a CACC-box, and are depleted in other GC-rich motifs; whereas genes in the translation module contain a pyrimidine-rich initiator, Elk-1, SP-1, and a novel motif with a GCGC core. Using a naïve Bayes classifier revealed that patterns of motifs are statistically predictive of expression patterns, with

  4. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    Directory of Open Access Journals (Sweden)

    Dozmorov Igor

    2007-05-01

    Full Text Available Abstract Background Tachykinins (TK, such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs. Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2. In the absence of

  5. Identification of Rbd2 as a candidate protease for sterol regulatory element binding protein (SREBP) cleavage in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jinsil; Ha, Hye-Jeong [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-gu, Daejeon 34141 (Korea, Republic of); Kim, Sujin [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-gu, Daejeon 34141 (Korea, Republic of); Department of Functional Genomics, University of Science and Technology (UST), 217 Gajeong-ro, Yuseong-gu, Daejeon 34113 (Korea, Republic of); Choi, Ah-Reum [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-gu, Daejeon 34141 (Korea, Republic of); Lee, Sook-Jeong [Department of New Drug Discovery and Development, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon 34134 (Korea, Republic of); Hoe, Kwang-Lae, E-mail: kwanghoe@cnu.ac.kr [Department of New Drug Discovery and Development, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon 34134 (Korea, Republic of); Kim, Dong-Uk, E-mail: kimdongu@kribb.re.kr [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-gu, Daejeon 34141 (Korea, Republic of)

    2015-12-25

    Lipid homeostasis in mammalian cells is regulated by sterol regulatory element-binding protein (SREBP) transcription factors that are activated through sequential cleavage by Golgi Site-1 and Site-2 proteases. Fission yeast SREBP, Sre1, engages a different mechanism involving the Golgi Dsc E3 ligase complex, but it is not clearly understood exactly how Sre1 is proteolytically cleaved and activated. In this study, we screened the Schizosaccharomyces pombe non-essential haploid deletion collection to identify missing components of the Sre1 cleavage machinery. Our screen identified an additional component of the SREBP pathway required for Sre1 proteolysis named rhomboid protein 2 (Rbd2). We show that an rbd2 deletion mutant fails to grow under hypoxic and hypoxia-mimetic conditions due to lack of Sre1 activity and that this growth phenotype is rescued by Sre1N, a cleaved active form of Sre1. We found that the growth inhibition phenotype under low oxygen conditions is specific to the strain with deletion of rbd2, not any other fission yeast rhomboid-encoding genes. Our study also identified conserved residues of Rbd2 that are required for Sre1 proteolytic cleavage. All together, our results suggest that Rbd2 is a functional SREBP protease with conserved residues required for Sre1 cleavage and provide an important piece of the puzzle to understand the mechanisms for Sre1 activation and the regulation of various biological and pathological processes involving SREBPs. - Highlights: • An rbd2-deleted yeast strain shows defects in growth in response to low oxygen levels. • rbd2-deficient cells fail to generate cleaved Sre1 (Sre1N) under hypoxic conditions. • Expression of Sre1N rescues the rbd2 deletion mutant growth phenotype. • Rbd2 contains conserved residues potentially critical for catalytic activity. • Mutation of the conserved Rbd2 catalytic residues leads to defects in Sre1 cleavage.

  6. Regulation of the CDP-choline pathway by sterol regulatory element binding proteins involves transcriptional and post-transcriptional mechanisms.

    Science.gov (United States)

    Ridgway, Neale D; Lagace, Thomas A

    2003-06-15

    The synthesis of phosphatidylcholine (PtdCho) by the CDP-choline pathway is under the control of the rate-limiting enzyme CTP:phosphocholine cytidylyltransferase (CCT). Sterol regulatory element binding proteins (SREBPs) have been proposed to regulate CCT at the transcriptional level, or via the synthesis of lipid activators or substrates of the CDP-choline pathway. To assess the contributions of these two mechanisms, we examined CCTalpha expression and PtdCho synthesis by the CDP-choline pathway in cholesterol and fatty acid auxotrophic CHO M19 cells inducibly expressing constitutively active nuclear forms of SREBP1a or SREBP2. Induction of either SREBP resulted in increased expression of mRNAs for sterol-regulated genes, elevated fatty acid and cholesterol synthesis (>10-50-fold) and increased PtdCho synthesis (2-fold). CCTalpha mRNA was increased 2-fold by enforced expression of SREBP1a or SREBP2. The resultant increase in CCTalpha protein and activity (2-fold) was restricted primarily to the soluble fraction of cells, and increased CCTalpha activity in vivo was not detected. Inhibition of the synthesis of fatty acids or their CoA esters by cerulenin or triacsin C respectively following SREBP induction effectively blocked the accompanying elevation in PtdCho synthesis. Thus PtdCho synthesis was driven by increased synthesis of fatty acids or a product thereof. These data show that transcriptional activation of CCTalpha is modest relative to that of other SREBP-regulated genes, and that stimulation of PtdCho synthesis by SREBPs in CHO cells is due primarily to increased fatty acid synthesis.

  7. Nutritional control of gene expression in Drosophila larvae via TOR, Myc and a novel cis-regulatory element

    Directory of Open Access Journals (Sweden)

    Grewal Savraj S

    2010-01-01

    Full Text Available Abstract Background Nutrient availability is a key determinant of eukaryotic cell growth. In unicellular organisms many signaling and transcriptional networks link nutrient availability to the expression of metabolic genes required for growth. However, less is known about the corresponding mechanisms that operate in metazoans. We used gene expression profiling to explore this issue in developing Drosophila larvae. Results We found that starvation for dietary amino acids (AA's leads to dynamic changes in transcript levels of many metabolic genes. The conserved insulin/PI3K and TOR signaling pathways mediate nutrition-dependent growth in Drosophila and other animals. We found that many AA starvation-responsive transcripts were also altered in TOR mutants. In contrast, although PI3K overexpression induced robust changes in the expression of many metabolic genes, these changes showed limited overlap with the AA starvation expression profile. We did however identify a strong overlap between genes regulated by the transcription factor, Myc, and AA starvation-responsive genes, particularly those involved in ribosome biogenesis, protein synthesis and mitochondrial function. The consensus Myc DNA binding site is enriched in promoters of these AA starvation genes, and we found that Myc overexpression could bypass dietary AA to induce expression of these genes. We also identified another sequence motif (Motif 1 enriched in the promoters of AA starvation-responsive genes. We showed that Motif 1 was both necessary and sufficient to mediate transcriptional responses to dietary AA in larvae. Conclusions Our data suggest that many of the transcriptional effects of amino acids are mediated via signaling through the TOR pathway in Drosophila larvae. We also find that these transcriptional effects are mediated through at least two mechanisms: via the transcription factor Myc, and via the Motif 1 cis-regulatory element. These studies begin to elucidate a nutrient

  8. Identification of minute damage in composite bridge structures equipped with fiber optic sensors using the location of neutral axis and finite element analysis

    Science.gov (United States)

    Li, Xi; Glisic, Branko

    2016-04-01

    By definition, the neutral axis of a loaded composite beam structure is the curve along which the section experiences zero bending strain. When no axial loading is present, the location of the neutral axis passes through the centroid of stiffness of the beam cross-section. In the presence of damage, the centroid of stiffness, as well as the neutral axis, shift from the healthy position. The concept of neutral axis can be widely applied to all beam-like structures. According to literature, a change in location of the neutral axis can be associated with damage in the corresponding cross-section. In this paper, the movement of neutral axis near locations of minute damage in a composite bridge structure was studied using finite element analysis and experimental results. The finite element model was developed based on a physical scale model of a composite simply-supported structure with controlled minute damage in the reinforced concrete deck. The structure was equipped with long-gauge fiber optic strain and temperature sensors at a healthy reference location as well as two locations of damage. A total of 12 strain sensors were installed during construction and used to monitor the structure during various loading events. This paper aims to explain previous experimental results which showed that the observed positions of neutral axis near damage locations were higher than the predicted healthy locations in some loading events. Analysis has shown that finite element analysis has potential to simulate and explain the physical behavior of the test structure.

  9. Analysis of organic and elemental carbon in heating and non-heating periods in four locations of Beijing.

    Science.gov (United States)

    Sun, Fengbin; Lun, Xiaoxiu; Liu, Xuhui; Mo, Li; Li, Renna; Zhang, Hongxia; Chen, Jungang; Cao, Yingying; Shi, Fangtian; Yu, Xinxiao

    2016-01-01

    The concentrations of elemental carbon (EC) and organic carbon (OC) in PM2.5 atmospheric aerosol were measured at four different sites in Beijing: Beijing Olympic Forest Park (OF), Jiufeng National Forest Park (JF), Beijing Forestry University campus lawn (G), and roads near the Beijing Forestry University (S). The winter heating period concentrations were 30-45% higher than the spring non-heating period. Possible reasons for this could be the severe convective weather in spring due to the temperate monsoon, deposition of PM2.5 to plants in spring, stable atmospheric conditions in winter, and/or a greater number of sources of carbonaceous aerosols in winter. The proportion of total carbon (i.e. EC + OC) in PM2.5 in Beijing is high. The OC/EC value was 2.45 (OF) and 2.39 (JF) in winter and 1.6 (OF) and 1.43 (JF) in spring. These ratios and the high correlation of OC with EC in the winter samples indicate a strong primary source of OC. Eight carbon fractions from the four different sampling locations were analysed, and the OC1-4 values were found to vary considerably. In winter, the OC1 values from all four sites were higher than the spring values. Although there were differences at each site, the percentages of OC2, OC3, EC1-OP, and EC2 were the largest. Secondary organic carbon (SOC) formed during long-range transport from the emission sources to the monitoring sites, and the increase of OC2 and OC3 concentrations could be associated with SOC.

  10. Driving midgut-specific expression and secretion of a foreign protein in transgenic mosquitoes with AgAper1 regulatory elements.

    Science.gov (United States)

    Abraham, E G; Donnelly-Doman, M; Fujioka, H; Ghosh, A; Moreira, L; Jacobs-Lorena, M

    2005-06-01

    The Anopheles gambiae adult peritrophic matrix protein 1 (AgAper1) regulatory elements were used to drive the expression of phospholipase A2 (PLA2), a protein known to disrupt malaria parasite development in mosquitoes. These AgAper1 regulatory elements were sufficient to promote the accumulation of PLA2 in midgut epithelial cells before a blood meal and its release into the lumen upon blood ingestion. Plasmodium berghei oocyst formation was reduced by approximately 80% (74-91% range) in transgenic mosquitoes. Blood-seeking behaviour and survival of AgAper1-PLA2 transgenic mosquitoes were comparable to sibling wild-type mosquitoes, while fertility was substantially lower. Ultrastructural studies suggest that decreased fitness is a consequence of internal damage to midgut epithelial cells.

  11. Effects of retinoic acid and hydrogen peroxide on sterol regulatory element-binding protein-1a activation during adipogenic differentiation of 3T3-L1 cells

    OpenAIRE

    Eldaim, Mabrouk A. Abd; Okamatsu-Ogura, Yuko; Terao, Akira; Kimura, Kazuhiro

    2010-01-01

    Both retinoic acid (RA) and oxidative stress (H2O2) increased transcription and cleavage of membrane-bound sterol regulatory element-binding protein (SREBP)-1, leading to enhanced transcription of fatty acid synthase (FAS) in hepatoma cells. On the other hand, RA and H2O2 decreased and increased lipogenesis in adipocytes, respectively, although roles of SREBP-1 activation in these effects remain to be elucidated. To elucidate its involvement, we examined the activation of SREBP...

  12. Investigation of deformation of elements of three-dimensional reinforced concrete structures located in the soil, interacting with each other through rubber gaskets

    Science.gov (United States)

    Berezhnoi, D. V.; Balafendieva, I. S.; Sachenkov, A. A.; Sekaeva, L. R.

    2017-06-01

    In work the technique of calculation of elements of three-dimensional reinforced concrete substructures located in a soil, interacting with each other through rubber linings is realized. To describe the interaction of deformable structures with the ground, special “semi-infinite” finite elements are used. A technique has been implemented that allows one to describe the contact interaction of three-dimensional structures by means of a special contact finite element with specific properties. The obtained numerical results are compared with the experimental data, their good agreement is noted.

  13. Brain region-specific expression of MeCP2 isoforms correlates with DNA methylation within Mecp2 regulatory elements.

    Directory of Open Access Journals (Sweden)

    Carl O Olson

    Full Text Available MeCP2 is a critical epigenetic regulator in brain and its abnormal expression or compromised function leads to a spectrum of neurological disorders including Rett Syndrome and autism. Altered expression of the two MeCP2 isoforms, MeCP2E1 and MeCP2E2 has been implicated in neurological complications. However, expression, regulation and functions of the two isoforms are largely uncharacterized. Previously, we showed the role of MeCP2E1 in neuronal maturation and reported MeCP2E1 as the major protein isoform in the adult mouse brain, embryonic neurons and astrocytes. Recently, we showed that DNA methylation at the regulatory elements (REs within the Mecp2 promoter and intron 1 impact the expression of Mecp2 isoforms in differentiating neural stem cells. This current study is aimed for a comparative analysis of temporal, regional and cell type-specific expression of MeCP2 isoforms in the developing and adult mouse brain. MeCP2E2 displayed a later expression onset than MeCP2E1 during mouse brain development. In the adult female and male brain hippocampus, both MeCP2 isoforms were detected in neurons, astrocytes and oligodendrocytes. Furthermore, MeCP2E1 expression was relatively uniform in different brain regions (olfactory bulb, striatum, cortex, hippocampus, thalamus, brainstem and cerebellum, whereas MeCP2E2 showed differential enrichment in these brain regions. Both MeCP2 isoforms showed relatively similar distribution in these brain regions, except for cerebellum. Lastly, a preferential correlation was observed between DNA methylation at specific CpG dinucleotides within the REs and Mecp2 isoform-specific expression in these brain regions. Taken together, we show that MeCP2 isoforms display differential expression patterns during brain development and in adult mouse brain regions. DNA methylation patterns at the Mecp2 REs may impact this differential expression of Mecp2/MeCP2 isoforms in brain regions. Our results significantly contribute

  14. Delineating the core regulatory elements crucial for directed cell migration by examining folic-acid-mediated responses.

    Science.gov (United States)

    Srinivasan, Kamalakkannan; Wright, Gus A; Hames, Nicole; Housman, Max; Roberts, Alayna; Aufderheide, Karl J; Janetopoulos, Chris

    2013-01-01

    Dictyostelium discoideum shows chemotaxis towards folic acid (FA) throughout vegetative growth, and towards cAMP during development. We determined the spatiotemporal localization of cytoskeletal and signaling molecules and investigated the FA-mediated responses in a number of signaling mutants to further our understanding of the core regulatory elements that are crucial for cell migration. Proteins enriched in the pseudopods during chemotaxis also relocalize transiently to the plasma membrane during uniform FA stimulation. In contrast, proteins that are absent from the pseudopods during migration redistribute transiently from the PM to the cytosol when cells are globally stimulated with FA. These chemotactic responses to FA were also examined in cells lacking the GTPases Ras C and G. Although Ras and phosphoinositide 3-kinase activity were significantly decreased in Ras G and Ras C/G nulls, these mutants still migrated towards FA, indicating that other pathways must support FA-mediated chemotaxis. We also examined the spatial movements of PTEN in response to uniform FA and cAMP stimulation in phospholipase C (PLC) null cells. The lack of PLC strongly influences the localization of PTEN in response to FA, but not cAMP. In addition, we compared the gradient-sensing behavior of polarized cells migrating towards cAMP to that of unpolarized cells migrating towards FA. The majority of polarized cells make U-turns when the cAMP gradient is switched from the front of the cell to the rear. Conversely, unpolarized cells immediately extend pseudopods towards the new FA source. We also observed that plasma membrane phosphatidylinositol 3,4,5-trisphosphate [PtdIns(3,4,5)P3] levels oscillate in unpolarized cells treated with Latrunculin-A, whereas polarized cells had stable plasma membrane PtdIns(3,4,5)P3 responses toward the chemoattractant gradient source. Results were similar for cells that were starved for 4 hours, with a mixture of polarized and unpolarized cells responding

  15. Activation of sterol regulatory element binding protein and NLRP3 inflammasome in atherosclerotic lesion development in diabetic pigs.

    Directory of Open Access Journals (Sweden)

    Yu Li

    Full Text Available BACKGROUND: Aberrantly elevated sterol regulatory element binding protein (SREBP, the lipogenic transcription factor, contributes to the development of fatty liver and insulin resistance in animals. Our recent studies have discovered that AMP-activated protein kinase (AMPK phosphorylates SREBP at Ser-327 and inhibits its activity, represses SREBP-dependent lipogenesis, and thereby ameliorates hepatic steatosis and atherosclerosis in insulin-resistant LDLR(-/- mice. Chronic inflammation and activation of NLRP3 inflammasome have been implicated in atherosclerosis and fatty liver disease. However, whether SREBP is involved in vascular lipid accumulation and inflammation in atherosclerosis remains largely unknown. PRINCIPAL FINDINGS: The preclinical study with aortic pouch biopsy specimens from humans with atherosclerosis and diabetes shows intense immunostaining for SREBP-1 and the inflammatory marker VCAM-1 in atherosclerotic plaques. The cleavage processing of SREBP-1 and -2 and expression of their target genes are increased in the well-established porcine model of diabetes and atherosclerosis, which develops human-like, complex atherosclerotic plaques. Immunostaining analysis indicates an elevation in SREBP-1 that is primarily localized in endothelial cells and in infiltrated macrophages within fatty streaks, fibrous caps with necrotic cores, and cholesterol crystals in advanced lesions. Moreover, concomitant suppression of NAD-dependent deacetylase SIRT1 and AMPK is observed in atherosclerotic pigs, which leads to the proteolytic activation of SREBP-1 by diminishing the deacetylation and Ser-372 phosphorylation of SREBP-1. Aberrantly elevated NLRP3 inflammasome markers are evidenced by increased expression of inflammasome components including NLPR3, ASC, and IL-1β. The increase in SREBP-1 activity and IL-1β production in lesions is associated with vascular inflammation and endothelial dysfunction in atherosclerotic pig aorta, as demonstrated

  16. PlantPAN: Plant promoter analysis navigator, for identifying combinatorial cis-regulatory elements with distance constraint in plant gene groups

    Directory of Open Access Journals (Sweden)

    Huang Hsien-Da

    2008-11-01

    Full Text Available Abstract Background The elucidation of transcriptional regulation in plant genes is important area of research for plant scientists, following the mapping of various plant genomes, such as A. thaliana, O. sativa and Z. mays. A variety of bioinformatic servers or databases of plant promoters have been established, although most have been focused only on annotating transcription factor binding sites in a single gene and have neglected some important regulatory elements (tandem repeats and CpG/CpNpG islands in promoter regions. Additionally, the combinatorial interaction of transcription factors (TFs is important in regulating the gene group that is associated with the same expression pattern. Therefore, a tool for detecting the co-regulation of transcription factors in a group of gene promoters is required. Results This study develops a database-assisted system, PlantPAN (Plant Promoter Analysis Navigator, for recognizing combinatorial cis-regulatory elements with a distance constraint in sets of plant genes. The system collects the plant transcription factor binding profiles from PLACE, TRANSFAC (public release 7.0, AGRIS, and JASPER databases and allows users to input a group of gene IDs or promoter sequences, enabling the co-occurrence of combinatorial transcription factor binding sites (TFBSs within a defined distance (20 bp to 200 bp to be identified. Furthermore, the new resource enables other regulatory features in a plant promoter, such as CpG/CpNpG islands and tandem repeats, to be displayed. The regulatory elements in the conserved regions of the promoters across homologous genes are detected and presented. Conclusion In addition to providing a user-friendly input/output interface, PlantPAN has numerous advantages in the analysis of a plant promoter. Several case studies have established the effectiveness of PlantPAN. This novel analytical resource is now freely available at http://PlantPAN.mbc.nctu.edu.tw.

  17. Positive- and negative-acting regulatory elements contribute to the tissue-specific expression of INNER NO OUTER, a YABBY-type transcription factor gene in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Simon Marissa K

    2012-11-01

    Full Text Available Abstract Background The INNER NO OUTER (INO gene, which encodes a YABBY-type transcription factor, specifies and promotes the growth of the outer integument of the ovule in Arabidopsis. INO expression is limited to the abaxial cell layer of the developing outer integument of the ovule and is regulated by multiple regions of the INO promoter, including POS9, a positive element that when present in quadruplicate can produce low-level expression in the normal INO pattern. Results Significant redundancy in activity between different regions of the INO promoter is demonstrated. For specific regulatory elements, multimerization or the addition of the cauliflower mosaic virus 35S general enhancer was able to activate expression of reporter gene constructs that were otherwise incapable of expression on their own. A new promoter element, POS6, is defined and is shown to include sufficient positive regulatory information to reproduce the endogenous pattern of expression in ovules, but other promoter regions are necessary to fully suppress expression outside of ovules. The full-length INO promoter, but not any of the INO promoter deletions tested, is able to act as an enhancer-blocking insulator to prevent the ectopic activation of expression by the 35S enhancer. Sequence conservation between the promoter regions of Arabidopsis thaliana, Brassica oleracea and Brassica rapa aligns closely with the functional definition of the POS6 and POS9 regions, and with a defined INO minimal promoter. The B. oleracea INO promoter is sufficient to promote a similar pattern and level of reporter gene expression in Arabidopsis to that observed for the Arabidopsis promoter. Conclusions At least two independent regions of the INO promoter contain sufficient regulatory information to direct the specific pattern but not the level of INO gene expression. These regulatory regions act in a partially redundant manner to promote the expression in a specific pattern in the ovule and

  18. Functional analysis of a large set of BRCA2 exon 7 variants highlights the predictive value of hexamer scores in detecting alterations of exonic splicing regulatory elements.

    Science.gov (United States)

    Di Giacomo, Daniela; Gaildrat, Pascaline; Abuli, Anna; Abdat, Julie; Frébourg, Thierry; Tosi, Mario; Martins, Alexandra

    2013-11-01

    Exonic variants can alter pre-mRNA splicing either by changing splice sites or by modifying splicing regulatory elements. Often these effects are difficult to predict and are only detected by performing RNA analyses. Here, we analyzed, in a minigene assay, 26 variants identified in the exon 7 of BRCA2, a cancer predisposition gene. Our results revealed eight new exon skipping mutations in this exon: one directly altering the 5' splice site and seven affecting potential regulatory elements. This brings the number of splicing regulatory mutations detected in BRCA2 exon 7 to a total of 11, a remarkably high number considering the total number of variants reported in this exon (n = 36), all tested in our minigene assay. We then exploited this large set of splicing data to test the predictive value of splicing regulator hexamers' scores recently established by Ke et al. (). Comparisons of hexamer-based predictions with our experimental data revealed high sensitivity in detecting variants that increased exon skipping, an important feature for prescreening variants before RNA analysis. In conclusion, hexamer scores represent a promising tool for predicting the biological consequences of exonic variants and may have important applications for the interpretation of variants detected by high-throughput sequencing.

  19. Mutations that alter a repeated ACCA element located at the 5' end of the Potato virus X genome affect RNA accumulation.

    Science.gov (United States)

    Park, Mi-Ri; Kwon, Sun-Jung; Choi, Hong-Soo; Hemenway, Cynthia L; Kim, Kook-Hyung

    2008-08-15

    The repeated ACCA or AC-rich sequence and structural (SL1) elements in the 5' non-translated region (NTR) of the Potato virus X (PVX) RNA play vital roles in the PVX life cycle by controlling translation, RNA replication, movement, and assembly. It has already been shown that the repeated ACCA or AC-rich sequence affect both gRNA and sgRNA accumulation, while not affecting minus-strand RNA accumulation, and are also required for host protein binding. The functional significance of the repeated ACCA sequence elements in the 5' NTR region was investigated by analyzing the effects of deletion and site-directed mutations on PVX replication in Nicotiana benthamiana plants and NT1 protoplasts. Substitution (ACCA into AAAA or UUUU) mutations introduced in the first (nt 10-13) element in the 5' NTR of the PVX RNA significantly affected viral replication, while mutations introduced in the second (nt 17-20) and third (nt 20-23) elements did not. The fourth (nt 29-32) ACCA element weakly affected virus replication, whereas mutations in the fifth (nt 38-41) significantly reduced virus replication due to the structure disruption of SL1 by AAAA and/or UUUU substitutions. Further characterization of the first ACCA element indicated that duplication of ACCA at nt 10-13 (nt 10-17, ACCAACCA) caused severe symptom development as compared to that of wild type, while deletion of the single element (nt 10-13), DeltaACCA) or tripling of this element caused reduced symptom development. Single- and double-nucleotide substitutions introduced into the first ACCA element revealed the importance of CC located at nt positions 11 and 12. Altogether, these results indicate that the first ACCA element is important for PVX replication.

  20. MAP kinases Erk1/2 phosphorylate sterol regulatory element-binding protein (SREBP)-1a at serine 117 in vitro.

    Science.gov (United States)

    Roth, G; Kotzka, J; Kremer, L; Lehr, S; Lohaus, C; Meyer, H E; Krone, W; Müller-Wieland, D

    2000-10-27

    Sterol regulatory element-binding protein (SREBP)-1a is a transcription factor sensing cellular cholesterol levels and integrating gene regulatory signals mediated by MAP kinase cascades. Here we report the identification of serine 117 in SREBP-1a as the major phosphorylation site of the MAP kinases Erk1/2. This site was identified by nanoelectrospray mass spectrometry and peptide sequencing of recombinant fusion proteins phosphorylated by Erk1/2 in vitro. Serine 117 was verified as the major phosphorylation site by in vitro mutagenesis. Mutation of serine 117 to alanine abolished Erk2-mediated phosphorylation in vitro and the MAP kinase-related transcriptional activation of SREBP-1a by insulin and platelet-derived growth factor in vivo. Our data indicate that the MAP kinase-mediated effects on SREBP-1a-regulated target genes are linked to this phosphorylation site.

  1. Identifying elements of the plumbing system beneath Kilauea Volcano, Hawaii, from the source locations of very-long-period signals

    Science.gov (United States)

    Almendros, J.; Chouet, B.; Dawson, P.; Bond, T.

    2002-01-01

    We analyzed 16 seismic events recorded by the Hawaiian broad-band seismic network at Kilauca Volcano during the period September 9-26, 1999. Two distinct types of event are identified based on their spectral content, very-long-period (VLP) waveform, amplitude decay pattern and particle motion. We locate the VLP signals with a method based on analyses of semblance and particle motion. Different source regions are identified for the two event types. One source region is located at depths of ~1 km beneath the northeast edge of the Halemaumau pit crater. A second region is located at depths of ~8 km below the northwest quadrant of Kilauea caldera. Our study represents the first time that such deep sources have been identified in VLP data at Kilauea. This discovery opens the possibility of obtaining a detailed image of the location and geometry of the magma plumbing system beneath this volcano based on source locations and moment tensor inversions of VLP signals recorded by a permanent, large-aperture broad-band network.

  2. Prediction of Cis-Regulatory Elements Controlling Genes Differentially Expressed by Retinal and Choroidal Vascular Endothelial Cells.

    Science.gov (United States)

    Choi, Dongseok; Appukuttan, Binoy; Binek, Sierra J; Planck, Stephen R; Stout, J Timothy; Rosenbaum, James T; Smith, Justine R

    2008-01-01

    Cultured endothelial cells of the human retina and choroid demonstrate distinct patterns of gene expression. We hypothesized that differential gene expression reflected differences in the interactions of transcription factors and respective cis-regulatory motifs(s) in these two emdothelial cell subpopulations, recognizing that motifs often exist as modules. We tested this hypothesis in silico by using TRANSFAC Professional and CisModule to identify cis-regulatory motifs and modules in genes that were differentially expressed by human retinal versus choroidal endothelial cells, as identified by analysis of a microarray data set. Motifs corresponding to eight transcription factors were significantly (p < 0.05) differentially abundant in genes that were relatively highly expressed in retinal (i.e., GCCR, HMGIY, HSF1, p53, VDR) or choroidal (i.e., E2F, YY1, ZF5) endothelial cells. Predicted cis-regulatory modules were quite different for these two groups of genes. Our findings raise the possibility of exploiting specific cis-regulatory motifs to target therapy at the ocular endothelial cells subtypes responsible for neovascular age-related macular degeneration or proliferative diabetic retinopathy.

  3. Identification of novel regulatory NFAT and TFII-I binding elements in the calbindin-D28k promoter in response to serum deprivation*

    Science.gov (United States)

    Guo, Jianfei; Öz, Orhan K.

    2015-01-01

    Calbindin-D28k, a key regulator of calcium homeostasis plays a cytoprotective role in various tissues. We used serum free (SFM) and charcoal stripped serum (csFBS) culture media as models of cellular stress to modulate calbindin D28k expression and identify regulatory cis-elements and trans-acting factors in kidney and beta cells. The murine calbindin-D28k promoter activity was significantly upregulated under SFM or csFBS condition. Promoter analysis revealed evolutionary conserved regulatory cis-elements and deletion of 23nt from +117/+139 as critical for basal transcription. Bioinformatics analysis of the promoter revealed conserved NFAT and TFII regulators elements. Forced expression of NFAT stimulated promoter activity. Inhibition of NFAT transcriptional activity by FK506 attenuated calbindin-D28k expression. TFII-I was shown to be necessary for basal promoter activity and to act cooperatively with NFAT. Using chromatin immunoprecipitation (ChIP) assays, NFAT was shown to bind to both proximal and distal promoter regions. ChIP assays also revealed recruitment of TFII to the −36/+139 region. Knockdown of TFII-I decreased promoter activity. In summary, calbindin-D28k expression during serum deprivation is partly regulated by NFAT and TF-II. This regulation may be important in vivo during ischemia and growth factor withdrawal to regulate cellular function and maintenance. PMID:26260319

  4. A Regulatory MDM4 Genetic Variant Locating in the Binding Sequence of Multiple MicroRNAs Contributes to Susceptibility of Small Cell Lung Cancer.

    Directory of Open Access Journals (Sweden)

    Feng Gao

    Full Text Available A functional rs4245739 A>C single nucleotide polymorphism (SNP locating in the MDM43'-untranslated (3'-UTR region creates a miR-191-5p or miR-887-3p targeting sites. This change results in decreased expression of oncogene MDM4. Therefore, we examined the association between this SNP and small cell lung cancer (SCLC risk as well as its regulatory function in SCLC cells. Genotypes were determined in two independent case-control sets consisted of 520SCLC cases and 1040 controls from two regions of China. Odds ratios (ORs and 95% confidence intervals (CIs were estimated by logistic regression. The impact of the rs4245739 SNP on miR-191-5p/miR-887-3p mediated MDM4 expression regulation was investigated using luciferase reporter gene assays. We found that the MDM4 rs4245739AC and CC genotypes were significantly associated with decreased SCLC susceptibility compared with the AA genotype in both case-control sets (Shandong set: OR = 0.53, 95% CI = 0.32-0.89, P = 0.014; Jiangsu set: OR = 0.47, 95% CI = 0.26-0.879, P = 0.017. Stratified analyses indicated that there was a significantly multiplicative interaction between rs4245739 and smoking (Pinteractioin = 0.048. After co-tranfection of miRNAs and different allelic-MDM4 reporter constructs into SCLC cells, we found that the both miR-191-5p and miR-887-3p can lead to significantly decreased MDM4 expression activities in the construct with C-allelic 3'-UTR but not A-allelic 3'-UTR, suggesting a consistent genotype-phenotype correlation. Our data illuminate that the MDM4rs4245739SNP contributes to SCLC risk and support the notion that gene 3'-UTR genetic variants, impacting miRNA-binding, might modify SCLC susceptibility.

  5. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner

    2014-01-01

    , supported by histone marks and ChIP-seq data, that specifically have features of an enhancer and a promoter, respectively. We also identified a putative long non-coding RNA from the characteristically long first intron of the Cd247 gene. The long non-coding RNA annotation is supported by manual annotations...... from the GENCODE project in human and our expression quantification analysis performed in NOD and B6 mice using qRT-PCR. Furthermore, 17 of the 23 SNPs already known to be implicated with T1D were observed within the long non-coding RNA region in mouse. The spatially conserved regulatory elements...

  6. Preventing Phosphorylation of Sterol Regulatory Element-Binding Protein 1a by MAP-Kinases Protects Mice from Fatty Liver and Visceral Obesity

    OpenAIRE

    Jorg Kotzka; Birgit Knebel; Jutta Haas; Lorena Kremer; Sylvia Jacob; Sonja Hartwig; Ulrike Nitzgen; Dirk Muller-Wieland

    2012-01-01

    The transcription factor sterol regulatory element binding protein (SREBP)-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK). Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK) or p38 stress acti...

  7. Mutational analysis of structural elements in a class-I cyclic di-GMP riboswitch to elucidate its regulatory mechanism.

    Science.gov (United States)

    Inuzuka, Saki; Nishimura, Kei-Ichiro; Kakizawa, Hitoshi; Fujita, Yuki; Furuta, Hiroyuki; Matsumura, Shigeyoshi; Ikawa, Yoshiya

    2016-09-01

    The Vc2 riboswitch possesses an aptamer domain belonging to the class-I c-di-GMP riboswitch family. This domain has been analysed and the molecular mechanism by which it recognizes the c-di-GMP ligand has been elucidated. On the other hand, the regulatory mechanism of the full-length Vc2 riboswitch to control its downstream open reading frame (ORF) remains largely unknown. In this study, we performed in vivo reporter assays and in vitro biochemical analyses of the full-length riboswitch and its aptamer domain. We evaluated the results of in vivo and in vitro analyses to elucidate the regulatory mechanism of the Vc2 riboswitch. The present results suggest that recognition of c-di-GMP ligand by the Vc2 riboswitch aptamer domain downregulates expression of its downstream ORF primarily at the translational level.

  8. In silico identification and experimental characterization of regulatory elements controlling the expression of the Salmonella csrB and csrC genes.

    Science.gov (United States)

    Martínez, Luary C; Martínez-Flores, Irma; Salgado, Heladia; Fernández-Mora, Marcos; Medina-Rivera, Alejandra; Puente, José L; Collado-Vides, Julio; Bustamante, Víctor H

    2014-01-01

    The small RNAs CsrB and CsrC of Salmonella indirectly control the expression of numerous genes encoding widespread cellular functions, including virulence. The expression of csrB and csrC genes, which are located in different chromosomal regions, is coordinated by positive transcriptional control mediated by the two-component regulatory system BarA/SirA. Here, we identified by computational analysis an 18-bp inverted repeat (IR) sequence located far upstream from the promoter of Salmonella enterica serovar Typhimurium csrB and csrC genes. Deletion analysis and site-directed mutagenesis of the csrB and csrC regulatory regions revealed that this IR sequence is required for transcriptional activation of both genes. Protein-DNA and protein-protein interaction assays showed that the response regulator SirA specifically binds to the IR sequence and provide evidence that SirA acts as a dimer. Interestingly, whereas the IR sequence was essential for the SirA-mediated expression of csrB, our results revealed that SirA controls the expression of csrC not only by binding to the IR sequence but also by an indirect mode involving the Csr system. Additional computational, biochemical, and genetic analyses demonstrated that the integration host factor (IHF) global regulator positively controls the expression of csrB, but not of csrC, by interacting with a sequence located between the promoter and the SirA-binding site. These findings contribute to the better understanding of the regulatory mechanism controlling the expression of CsrB and CsrC.

  9. FT I,a novel positive myeloid—lineage—specific transcription regulatory element within the mouse myeloperoxidase gene enhancer,En 1

    Institute of Scientific and Technical Information of China (English)

    ZHUJINGDE

    1995-01-01

    FT I (AAAAGGGGAAGCAGAG),a poly purine element within the myeloid-lineage specific enhancer(En 1) of the mouse myeloperoxidase gene[1,2] has been further characterised.1,FT I functions as a myeloid-lineage specific transcription regulatory element;2,WEHI 3BD+ cells have higher binding activity to FT I and express the proteins which could form the unique DNA-protein complex(es) of FT I;.3,The essential sequence for the specific DNA-protein interactions of FT I is AAAAGGGGAAGC;4,South-western analysis in conjunction with the competition assay of the proteins binding to FT I,has revealed a 28 kd protein in WEHI 3BD+ cells that displays the properties of the putative transcription factor which acts through FT I.These new findings have demonstrated both the functional myeloid-lineage specificity and the novelty of FT I.

  10. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    Acyl-CoA-binding protein (ACBP) is an ubiquitously expressed 10-kDa protein which is present in high amounts in cells involved in solute transport or secretion. Rat ACBP is encoded by a gene containing the typical hallmarks of a housekeeping gene. Analysis of the promoter region of the rat ACBP...... gene by electrophoretic mobility shift assay (EMSA) revealed specific binding of proteins from rat liver nuclear extracts to potential recognition sequences of NF-1/CTF, Sp1, AP-1, C/EBP and HNF-3. In addition, specific binding to a DR-1 type element was observed. By using in vitro translated...... for the ACBP DR-1 element. Addition of peroxisome proliferators (PP) to H4IIEC3 rat hepatoma cells led to an increase in the ACBP mRNA level, indicating that the DR-1 element could be a functional peroxisome proliferator responsive element (PPRE). Analysis of the ACBP promoter by transient transfection showed...

  11. Comparative study of trace element levels in some local vegetable varieties and irrigation waters from different locations in Ilorin, Nigeria

    Directory of Open Access Journals (Sweden)

    O.O. Dosumu

    2003-06-01

    Full Text Available The level of heavy metals in two varieties of vegetables harvested during the dry and wet seasons from seven different locations in Ilorin, Nigeria, were determined. The correlation between the level of metals in the vegetables and the irrigation water was also studied. Vegetables harvested during the dry season were found to contain higher level of toxic metals. Low water quality, accumulation of particulate after rainless period and nearness of some vegetable gardens to major and well travelled roads appeared to be the major contributory factors. Amaranthus hybridus seemed to have higher metal accumulation capacity compared to Corchorus olitorius mannii.

  12. Examining cooperative binding of Sox2 on DC5 regulatory element upon complex formation with Pax6 through excess electron transfer assay.

    Science.gov (United States)

    Saha, Abhijit; Kizaki, Seiichiro; De, Debojyoti; Endo, Masayuki; Kim, Kyeong Kyu; Sugiyama, Hiroshi

    2016-08-19

    Functional cooperativity among transcription factors on regulatory genetic elements is pivotal for milestone decision-making in various cellular processes including mammalian development. However, their molecular interaction during the cooperative binding cannot be precisely understood due to lack of efficient tools for the analyses of protein-DNA interaction in the transcription complex. Here, we demonstrate that photoinduced excess electron transfer assay can be used for analysing cooperativity of proteins in transcription complex using cooperative binding of Pax6 to Sox2 on the regulatory DNA element (DC5 enhancer) as an example. In this assay, (Br)U-labelled DC5 was introduced for the efficient detection of transferred electrons from Sox2 and Pax6 to the DNA, and guanine base in the complementary strand was replaced with hypoxanthine (I) to block intra-strand electron transfer at the Sox2-binding site. By examining DNA cleavage occurred as a result of the electron transfer process, from tryptophan residues of Sox2 and Pax6 to DNA after irradiation at 280 nm, we not only confirmed their binding to DNA but also observed their increased occupancy on DC5 with respect to that of Sox2 and Pax6 alone as a result of their cooperative interaction. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Epithelial Expression of Human ABO Blood Group Genes Is Dependent upon a Downstream Regulatory Element Functioning through an Epithelial Cell-specific Transcription Factor, Elf5.

    Science.gov (United States)

    Sano, Rie; Nakajima, Tamiko; Takahashi, Yoichiro; Kubo, Rieko; Kobayashi, Momoko; Takahashi, Keiko; Takeshita, Haruo; Ogasawara, Kenichi; Kominato, Yoshihiko

    2016-10-21

    The human ABO blood group system is of great importance in blood transfusion and organ transplantation. The ABO system is composed of complex carbohydrate structures that are biosynthesized by A- and B-transferases encoded by the ABO gene. However, the mechanisms regulating ABO gene expression in epithelial cells remain obscure. On the basis of DNase I-hypersensitive sites in and around ABO in epithelial cells, we prepared reporter plasmid constructs including these sites. Subsequent luciferase assays and histone modifications indicated a novel positive regulatory element, designated the +22.6-kb site, downstream from ABO, and this was shown to enhance ABO promoter activity in an epithelial cell-specific manner. Expression of ABO and B-antigen was reduced in gastric cancer KATOIII cells by biallelic deletion of the +22.6-kb site using the CRISPR/Cas9 system. Electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrated that the site bound to an epithelial cell-specific transcription factor, Elf5. Mutation of the Ets binding motifs to abrogate binding of this factor reduced the regulatory activity of the +22.6-kb site. Furthermore, ELF5 knockdown with shRNA reduced both endogenous transcription from ABO and B-antigen expression in KATOIII cells. Thus, Elf5 appeared to be involved in the enhancer potential of the +22.6-kb site. These results support the contention that ABO expression is dependent upon a downstream positive regulatory element functioning through a tissue-restricted transcription factor, Elf5, in epithelial cells.

  14. An "in-out" strategy using gene targeting and FLP recombinase for the functional dissection of complex DNA regulatory elements: analysis of the beta-globin locus control region.

    Science.gov (United States)

    Fiering, S; Kim, C G; Epner, E M; Groudine, M

    1993-01-01

    The human beta-globin locus control region (LCR) is a complex DNA regulatory element that controls the expression of the cis-linked beta-like globin genes located in the 55 kilobases 3' of the LCR. We have initiated the functional analysis of the LCR by homologous recombination in murine erythroleukemia cell somatic hybrids that carry a single copy of human chromosome 11 on which the beta-globin locus is situated. High-level expression of the human beta-globin gene normally occurs when these hybrid cells are induced to differentiate. We have reported that the insertion of an expressed selectable marker gene (driven by the Friend virus enhancer/promoter) into the LCR disrupts the LCR-mediated regulation of globin transcription. In these cells, beta-globin is no longer expressed when the cells differentiate; instead, expression of the selectable marker gene increases significantly after differentiation. Since present techniques for homologous recombination require the insertion of a selectable marker, further progress in using homologous recombination to analyze the LCR depends on deletion of the selectable marker and demonstration that the locus functions normally after the insertion, expression, and deletion of the selectable marker. Here we show that after precise deletion of the selectable marker by using the FLP recombinase/FRT (FLP recombinase target) system, the locus functions as it did before the homologous recombination event. These studies demonstrate the feasibility of using homologous recombination to analyze the LCR in particular, and other complex cis-regulatory DNA elements in general, in their normal chromosomal context. Images Fig. 2 Fig. 3 Fig. 4 PMID:8378321

  15. Yeast sterol regulatory element-binding protein (SREBP) cleavage requires Cdc48 and Dsc5, a ubiquitin regulatory X domain-containing subunit of the Golgi Dsc E3 ligase.

    Science.gov (United States)

    Stewart, Emerson V; Lloyd, S Julie-Ann; Burg, John S; Nwosu, Christine C; Lintner, Robert E; Daza, Riza; Russ, Carsten; Ponchner, Karen; Nusbaum, Chad; Espenshade, Peter J

    2012-01-01

    Schizosaccharomyces pombe Sre1 is a membrane-bound transcription factor that controls adaptation to hypoxia. Like its mammalian homolog, sterol regulatory element-binding protein (SREBP), Sre1 activation requires release from the membrane. However, in fission yeast, this release occurs through a strikingly different mechanism that requires the Golgi Dsc E3 ubiquitin ligase complex and the proteasome. The mechanistic details of Sre1 cleavage, including the link between the Dsc E3 ligase complex and proteasome, are not well understood. Here, we present results of a genetic selection designed to identify additional components required for Sre1 cleavage. From the selection, we identified two new components of the fission yeast SREBP pathway: Dsc5 and Cdc48. The AAA (ATPase associated with diverse cellular activities) ATPase Cdc48 and Dsc5, a ubiquitin regulatory X domain-containing protein, interact with known Dsc complex components and are required for SREBP cleavage. These findings provide a mechanistic link between the Dsc E3 ligase complex and the proteasome in SREBP cleavage and add to a growing list of similarities between the Dsc E3 ligase and membrane E3 ligases involved in endoplasmic reticulum-associated degradation.

  16. Three-dimensional analysis using finite element method of anterior teeth inclination and center of resistance location.

    Science.gov (United States)

    Geramy, Allahyar; Sodagar, Ahmad; Hassanpour, Mehdi

    2014-01-01

    To locate the centre of resistance of consolidated units of four and six anterior teeth during retraction. Twelve three-dimensional (3D) models were designed in SolidWorks of the anterior segment with four and six teeth and their supporting structure. A proper force system was applied in each model to retract the teeth bodily. The exact location of the centre of resistances (CRes) was determined. It was found that the path of CRes change in four-tooth and six-tooth units according to the anterior teeth torque. A posterior shift of the CRes by increasing the inclination of teeth was shown. However, vertical position has a fluctuant behaviour. First it moves apically, then it moves incisally. Furthermore, results suggest that in en masse retraction, translation can be achieved with a smaller amount of moment-to-force ratio than in four-incisor retraction. In other words, for bodily retraction of anterior incisor segments, we should apply force in a more apical position. Different anterior torques between 7 and 35 degrees, cannot affect the CRes position dramatically. The area of CRes shifting is 0.92 mm (anterioposteriorly) x 0.74 mm (superior-inferiorly) in the six-tooth unit in the teeth model and 0.85 mm (anterioposteriorly) x 0.82 mm (superior-inferiorly) in the teeth and bone model. In the four-tooth model, the area of CRes shifting is 0.97 mm (anterioposteriorly) x 0.93 mm (superior-inferiorly) in tooth model and 0.77 mm (anterioposteriorly) x 0.87 mm (superior-inferiorly) in the teeth and bone model.

  17. Cis-regulatory element-based genome-wide identification of DREB1/CBF targets in Arabidopsis

    Institute of Scientific and Technical Information of China (English)

    Huan Zhao; Weizhong Liu; Yong Hu; Xianglin Liu; Yikun He

    2008-01-01

    Microarray analysis is used to identify transcriptional targets.However,the direct targets of transcription factors cannot be distin guished from indirect ones;further,genes with low-expression levels cannot be identified by this method.In the present study,we exploi the cis-element dehydration-responsive element(DRE)that is known to be responsible for the transcription of DRE binding factor](DREB1)targets in the promoter region of all Arabidopsis genes.Putative targets whose promoters contain the elements were verified by both microarray and reverse transcription-polymerase chain reaction(RT-PCR)analysis.Five new DREB 1/CBF direct targets were identified.Compared with traditional microarray analysis,our method is convenient and cost-effective for identifying the downstream targets of transcription factors.

  18. Intercomparison of thermal and optical measurement methods for elemental carbon and black carbon at an urban location.

    Science.gov (United States)

    Hitzenberger, R; Petzold, A; Bauer, H; Ctyroky, P; Pouresmaeil, P; Laskus, L; Puxbaum, H

    2006-10-15

    Despite intensive efforts during the past 20 years, no generally accepted standard method exists to measure black carbon (BC) or elemental carbon (EC). Data on BC and EC concentrations are method specific and can differ widely (e.g. Schmid et al., 2001, ten Brink et al., 2004). In this study, a comprehensive set of methods (both optical and thermal) is compared. Measurements were performed under urban background conditions in Vienna, Austria, a city heavily impacted by diesel emissions. Filter and impactor samples were taken during 3 weeks in summer 2002 and analyzed for EC with thermal methods: a modified Cachier method (Cachier et al., 1989), a thermal-optical method (Schmid et al., 2001), and the VDI method (VDI, 1996); for BC with optical methods: a filter transmission method and the integrating sphere method (Hitzenberger et al., 1996); and for total carbon (TC) with a combustion method (Puxbaum and Rendl, 1983). The online methods aethalometer (Hansen et al., 1984) and the multiangle absorption photometer MAAP (Petzold et al., 2002) to measure BC were also used. The average values of BC and EC obtained with the methods agreed within their standard deviations. A conversion table was set up to allow comparisons between data measured elsewhere under urban background conditions (with similar source characteristics) with different instruments. An approach to estimate the absorption coefficient from attenuation data is derived so that existing records of aethalometer data in urban environments may be used to obtain also the absorption coefficients.

  19. Wall thickness measurement using resonant phenomena of circumferential Lamb waves generated by plural transducer elements located evenly on girth

    Science.gov (United States)

    Nishino, Hideo; Iwata, Kodai; Ishikawa, Masashi

    2016-07-01

    We present a novel method of measuring the pipe wall thickness using the resonance of the circumferential (C-) Lamb wave generated by a piezoelectric ring-shaped sensor (PS). The PS is a special device for an axially propagating torsional wave; however, the C-Lamb waves are generated simultaneously as spurious signals owing to the structure of the PS. Particularly under resonant conditions, the C-Lamb waves are dominantly generated, distorting the axially propagating wave. In this method, these troublesome spurious signals are used effectively for the measurement of the wall thickness under the PS location that is a dead zone of the PS itself. The method can compensate for its drawback, namely, the dead zone problem, without using additional instruments. In this study, the mechanisms of the generation and resonance of the C-Lamb waves were first explained. Secondly, the principle of the wall thickness estimation utilizing the resonance of the C-Lamb waves was proposed. Finally, experimental verifications were carried out. The estimated wall thicknesses agreed very well (maximum 1.5% error) with those measured by a micrometer caliper under suitable resonant conditions.

  20. The extended regulatory networks of SXT/R391 integrative and conjugative elements and IncA/C conjugative plasmids.

    Science.gov (United States)

    Poulin-Laprade, Dominic; Carraro, Nicolas; Burrus, Vincent

    2015-01-01

    Nowadays, healthcare systems are challenged by a major worldwide drug resistance crisis caused by the massive and rapid dissemination of antibiotic resistance genes and associated emergence of multidrug resistant pathogenic bacteria, in both clinical and environmental settings. Conjugation is the main driving force of gene transfer among microorganisms. This mechanism of horizontal gene transfer mediates the translocation of large DNA fragments between two bacterial cells in direct contact. Integrative and conjugative elements (ICEs) of the SXT/R391 family (SRIs) and IncA/C conjugative plasmids (ACPs) are responsible for the dissemination of a broad spectrum of antibiotic resistance genes among diverse species of Enterobacteriaceae and Vibrionaceae. The biology, diversity, prevalence and distribution of these two families of conjugative elements have been the subject of extensive studies for the past 15 years. Recently, the transcriptional regulators that govern their dissemination through the expression of ICE- or plasmid-encoded transfer genes have been described. Unrelated repressors control the activation of conjugation by preventing the expression of two related master activator complexes in both types of elements, i.e., SetCD in SXT/R391 ICEs and AcaCD in IncA/C plasmids. Finally, in addition to activating ICE- or plasmid-borne genes, these master activators have been shown to specifically activate phylogenetically unrelated mobilizable genomic islands (MGIs) that also disseminate antibiotic resistance genes and other adaptive traits among a plethora of pathogens such as Vibrio cholerae and Salmonella enterica.

  1. HRP-2, the Caenorhabditis elegans homolog of mammalian heterogeneous nuclear ribonucleoproteins Q and R, is an alternative splicing factor that binds to UCUAUC splicing regulatory elements.

    Science.gov (United States)

    Kabat, Jennifer L; Barberan-Soler, Sergio; Zahler, Alan M

    2009-10-16

    Alternative splicing is regulated by cis sequences in the pre-mRNA that serve as binding sites for trans-acting alternative splicing factors. In a previous study, we used bioinformatics and molecular biology to identify and confirm that the intronic hexamer sequence UCUAUC is a nematode alternative splicing regulatory element. In this study, we used RNA affinity chromatography to identify trans factors that bind to this sequence. HRP-2, the Caenorhabditis elegans homolog of human heterogeneous nuclear ribonucleoproteins Q and R, binds to UCUAUC in the context of unc-52 intronic regulatory sequences as well as to RNAs containing tandem repeats of this sequence. The three Us in the hexamer are the most important determinants of this binding specificity. We demonstrate, using RNA interference, that HRP-2 regulates the alternative splicing of two genes, unc-52 and lin-10, both of which have cassette exons flanked by an intronic UCUAUC motif. We propose that HRP-2 is a protein responsible for regulating alternative splicing through binding interactions with the UCUAUC sequence.

  2. Splicing Regulatory Elements and mRNA-abundance of dlg1 and capt, Genetically Interacting with dFMRP in Drosophila Brain

    Directory of Open Access Journals (Sweden)

    Maria Petrova

    2014-09-01

    Full Text Available To further understand the molecular and cellular mechanisms underlying the disease, we used the Drososphila FraX model and investigated a not well studied role of Drosophila Fragile X Mental Retardation Protein (dFMRP in alternative splicing of neuronal mRNAs to which it binds via a G-quartet sequence. By means of qRT-PCR we established the relative abundance of some isoforms of the gene dlg1, resulting from alternative exon skipping nearby a G-quartet and an exonic ESE-sequence, both acting as exonic splicing enhancers. We also investigated the relative mRNA-abundance of all capt-isoforms and the pre-mRNAs of both genes. We proposed a possible involvement of dFMRP in alternative splicing of genes, interacting with dfmr1. In the absence of dFMRP in larval and pupal brains, we found a change in the mRNA-level of one of the studied isoforms of dlg1 and of its pre-mRNA.We also established previously reported splicing regulatory elements and predicted computationally novel hexamere sequences in the exonic/intronic ends of both genes with p upative regulatory roles in alternative splicing.

  3. Unraveling the regulatory network of IncA/C plasmid mobilization: When genomic islands hijack conjugative elements.

    Science.gov (United States)

    Carraro, Nicolas; Matteau, Dominick; Burrus, Vincent; Rodrigue, Sébastien

    2015-01-01

    Conjugative plasmids of the A/C incompatibility group (IncA/C) have become substantial players in the dissemination of multidrug resistance. These large conjugative plasmids are characterized by their broad host-range, extended spectrum of antimicrobials resistance, and prevalence in enteric bacteria recovered from both environmental and clinical settings. Until recently, relatively little was known about the basic biology of IncA/C plasmids, mostly because of the hindrance of multidrug resistance for molecular biology experiments. To circumvent this issue, we previously developed pVCR94ΔX, a convenient prototype that codes for a reduced set of antibiotic resistances. Using pVCR94ΔX, we then characterized the regulatory pathway governing IncA/C plasmid dissemination. We found that the expression of roughly 2 thirds of the genes encoded by this plasmid, including large operons involved in the conjugation process, depends on an FlhCD-like master activator called AcaCD. Beyond the mobility of IncA/C plasmids, AcaCD was also shown to play a key role in the mobilization of different classes of genomic islands (GIs) identified in various pathogenic bacteria. By doing so, IncA/C plasmids can have a considerable impact on bacterial genomes plasticity and evolution.

  4. Regulation of Calcium-Independent Phospholipase A2 Expression by Adrenoceptors and Sterol Regulatory Element Binding Protein-Potential Crosstalk Between Sterol and Glycerophospholipid Mediators.

    Science.gov (United States)

    Chew, Wee-Siong; Ong, Wei-Yi

    2016-01-01

    Calcium-independent phospholipase A2 (iPLA2) is an 85-kDa enzyme that releases docosahexaenoic acid (DHA) from glycerophospholipids. DHA can be metabolized to resolvins and neuroprotectins that have anti-inflammatory properties and effects on neural plasticity. Recent studies show an important role of prefrontal cortical iPLA2 in hippocampo-prefrontal cortical LTP and antidepressant-like effect of the norepinephrine reuptake inhibitor (NRI) antidepressant, maprotiline. In this study, we elucidated the cellular mechanisms through which stimulation of adrenergic receptors could lead to increased iPLA2 expression. Treatment of SH-SY5Y neuroblastoma cells with maprotiline, another tricyclic antidepressant with noradrenaline reuptake inhibiting properties, nortriptyline, and the adrenergic receptor agonist, phenylephrine, resulted in increased iPLA2β mRNA expression. This increase was blocked by inhibitors to alpha-1 adrenergic receptor, mitogen-activated protein (MAP) kinase or extracellular signal-regulated kinase (ERK) 1/2, and sterol regulatory element-binding protein (SREBP). Maprotiline and phenylephrine induced binding of SREBP-2 to sterol regulatory element (SRE) region on the iPLA2 promoter, as determined by electrophoretic mobility shift assay (EMSA). Together, results indicate that stimulation of adrenoreceptors causes increased iPLA2 expression via MAP kinase/ERK 1/2 and SREBP, and suggest a possible mechanism for effect of CNS noradrenaline on neural plasticity and crosstalk between sterol and glycerophospholipid mediators, that may play a role in physiological or pathophysiological processes in the brain and other organs.

  5. Identification of new TSGA10 transcript variants in human testis with conserved regulatory RNA elements in 5'untranslated region and distinct expression in breast cancer.

    Science.gov (United States)

    Salehipour, Pouya; Nematzadeh, Mahsa; Mobasheri, Maryam Beigom; Afsharpad, Mandana; Mansouri, Kamran; Modarressi, Mohammad Hossein

    2017-09-01

    Testis specific gene antigen 10 (TSGA10) is a cancer testis antigen involved in the process of spermatogenesis. TSGA10 could also play an important role in the inhibition of angiogenesis by preventing nuclear localization of HIF-1α. Although it has been shown that TSGA10 messenger RNA (mRNA) is mainly expressed in testis and some tumors, the transcription pattern and regulatory mechanisms of this gene remain largely unknown. Here, we report that human TSGA10 comprises at least 22 exons and generates four different transcript variants. It was identified that using two distinct promoters and splicing of exons 4 and 7 produced these transcript variants, which have the same coding sequence, but the sequence of 5'untanslated region (5'UTR) is different between them. This is significant because conserved regulatory RNA elements like upstream open reading frame (uORF) and putative internal ribosome entry site (IRES) were found in this region which have different combinations in each transcript variant and it may influence translational efficiency of them in normal or unusual environmental conditions like hypoxia. To indicate the transcription pattern of TSGA10 in breast cancer, expression of identified transcript variants was analyzed in 62 breast cancer samples. We found that TSGA10 tends to express variants with shorter 5'UTR and fewer uORF elements in breast cancer tissues. Our study demonstrates for the first time the expression of different TSGA10 transcript variants in testis and breast cancer tissues and provides a first clue to a role of TSGA10 5'UTR in regulation of translation in unusual environmental conditions like hypoxia. Copyright © 2017. Published by Elsevier B.V.

  6. To feed or not to feed: plant factors located in the epidermis, mesophyll, and sieve elements influence pea aphid's ability to feed on legume species.

    Directory of Open Access Journals (Sweden)

    Alexander Schwarzkopf

    Full Text Available The pea aphid (Acyrthosiphon pisum Harris, a legume specialist, encompasses at least 11 genetically distinct sympatric host races. Each host race shows a preference for a certain legume species. Six pea aphid clones from three host races were used to localize plant factors influencing aphid probing and feeding behavior on four legume species. Aphid performance was tested by measuring survival and growth. The location of plant factors influencing aphid probing and feeding was determined using the electrical penetration graph (EPG technique. Every aphid clone performed best on the plant species from which it was originally collected, as well as on Vicia faba. On other plant species, clones showed intermediate or poor performance. The most important plant factors influencing aphid probing and feeding behavior were localized in the epidermis and sieve elements. Repetitive puncturing of sieve elements might be relevant for establishing phloem feeding, since feeding periods appear nearly exclusively after these repetitive sieve element punctures. A combination of plant factors influences the behavior of pea aphid host races on different legume species and likely contributes to the maintenance of these races.

  7. The organization structure and regulatory elements of Chlamydomonas histone genes reveal features linking plant and animal genes.

    Science.gov (United States)

    Fabry, S; Müller, K; Lindauer, A; Park, P B; Cornelius, T; Schmitt, R

    1995-09-01

    The genome of the green alga Chlamydomonas reinhardtii contains approximately 15 gene clusters of the nucleosomal (or core) histone H2A, H2B, H3 and H4 genes and at least one histone H1 gene. Seven non-allelic histone gene loci were isolated from a genomic library, physically mapped, and the nucleotide sequences of three isotypes of each core histone gene species and one linked H1 gene determined. The core histone genes are organized in clusters of H2A-H2B and H3-H4 pairs, in which each gene pair shows outwardly divergent transcription from a short (< 300 bp) intercistronic region. These intercistronic regions contain typically conserved promoter elements, namely a TATA-box and the three motifs TGGCCAG-G(G/C)-CGAG, CGTTGACC and CGGTTG. Different from the genes of higher plants, but like those of animals and the related alga Volvox, the 3' untranslated regions contain no poly A signal, but a palindromic sequence (3' palindrome) essential for mRNA processing is present. One single H1 gene was found in close linkage to a H2A-H2B pair. The H1 upstream region contains the octameric promoter element GGTTGACC (also found upstream of the core histone genes) and two specific sequence motifs that are shared only with the Volvox H1 promoters. This suggests differential transcription of the H1 and the core histone genes. The H1 gene is interrupted by two introns. Unlike Volvox H3 genes, the three sequenced H3 isoforms are intron-free. Primer-directed PCR of genomic DNA demonstrated, however, that at least 8 of the about 15 H3 genes do contain one intron at a conserved position. In synchronized C. reinhardtii cells, H4 mRNA levels (representative of all core histone mRNAs) peak during cell division, suggesting strict replication-dependent gene control. The derived peptide sequences place C. reinhardtii core histones closer to plants than to animals, except that the H2A histones are more animal-like. The peptide sequence of histone H1 is closely related to the V. carteri VH1-II

  8. Principal Locations of Major-Ion, Trace-Element, Nitrate, and Escherichia coli Loading to Emigration Creek, Salt Lake County, Utah, October 2005

    Science.gov (United States)

    Kimball, Briant A.; Runkel, Robert L.; Walton-Day, Katherine

    2008-01-01

    Housing development and recreational activity in Emigration Canyon have increased substantially since 1980, perhaps causing an observed decrease in water quality of this northern Utah stream located near Salt Lake City. To identify reaches of the stream that contribute to water-quality degradation, a tracer-injection and synoptic-sampling study was done to quantify mass loading of major ions, trace elements, nitrate, and Escherichia coli (E. coli) to the stream. The resulting mass-loading profiles for major ions and trace elements indicate both geologic and anthropogenic inputs to the stream, principally from tributary and spring inflows to the stream at Brigham Fork, Burr Fork, Wagner Spring, Emigration Tunnel Spring, Blacksmith Hollow, and Killyon Canyon. The pattern of nitrate loading does not correspond to the major-ion and trace-element loading patterns. Nitrate levels in the stream did not exceed water-quality standards at the time of synoptic sampling. The majority of nitrate mass loading can be considered related to anthropogenic input, based on the field settings and trends in stable isotope ratios of nitrogen. The pattern of E. coli loading does not correspond to the major-ion, trace-element, or nitrate loading patterns. The majority of E. coli loading was related to anthropogenic sources based on field setting, but a considerable part of the loading also comes from possible animal sources in Killyon Canyon, in Perkins Flat, and in Rotary Park. In this late summer sampling, E. coli concentrations only exceeded water-quality standards in limited sections of the study reach. The mass-loading approach used in this study provides a means to design future studies and to evaluate the loading on a catchment scale.

  9. Preaxial polydactyly/triphalangeal thumb is associated with changed transcription factor-binding affinity in a family with a novel point mutation in the long-range cis-regulatory element ZRS

    DEFF Research Database (Denmark)

    Farooq, Muhammad; Troelsen, Jesper T; Boyd, Mette

    2010-01-01

    have been reported in ZRS, the underlying regulatory mechanism is still unknown. In this study, we analyzed the effect on transcription factor binding of a novel ZRS point mutation (463T>G) in a Pakistani family with preaxial polydactyly and triphalangeal thumb. Electrophoretical mobility shift assay......A cis-regulatory sequence also known as zone of polarizing activity (ZPA) regulatory sequence (ZRS) located in intron 5 of LMBR1 is essential for expression of sonic hedgehog (SHH) in the developing posterior limb bud mesenchyme. Even though many point mutations causing preaxial duplication defects...

  10. Broad-Host-Range Expression Reveals Native and Host Regulatory Elements That Influence Heterologous Antibiotic Production in Gram-Negative Bacteria.

    Science.gov (United States)

    Zhang, Jia Jia; Tang, Xiaoyu; Zhang, Michelle; Nguyen, Darlene; Moore, Bradley S

    2017-09-05

    in Gram-negative proteobacterial expression hosts, and we leverage this platform to uncover regulatory elements that influence violacein expression from Pseudoalteromonas Although it is often assumed that BGCs will be more successfully expressed in more closely related hosts, our work suggests that this may not be a general rule of thumb, as heterologous production of natural products can be influenced by specific host regulatory and/or biosynthetic elements, and the identity and effectiveness of those elements are difficult to predict. We argue for the use of a diverse set of heterologous hosts, which may also provide insights into the BGC biosynthetic mechanism and the biological function of BGCs. Copyright © 2017 Zhang et al.

  11. Size distributions of elemental carbon and its contribution to light extinction in urban and rural locations in the pearl river delta region, China

    Directory of Open Access Journals (Sweden)

    H. Yu

    2010-06-01

    Full Text Available Elemental carbon (EC in size-segregated aerosol samples were determined at five urban, one suburban, and one rural locations in the Pearl River Delta region in South China during 2006–2008 period. The size modal characteristics of EC were different at the urban and suburban/rural locations. The urban EC had a dominant condensation mode with a mass median aerodynamic diameter (MMAD in the 0.36–0.43 μm range and a slightly less abundant mode in the droplet mode size (MMAD: 0.8–1.1 μm, while the suburban/rural EC had a prominent mode in the droplet mode size (MMAD: 0.7–1.1 μm and a minor condensation mode (MMAD: 0.22–0.33 μm. Calculations using Mie theory and the measured size distributions of EC, organic carbon, and major inorganic ions indicate that EC-containing particles contributed 76±20% of the observed light extinction at the urban sites. Among the EC-containing particles, EC mass alone contributed 21±11% of the observed light extinction while non-EC materials on the EC particles (i.e., organic matter, ammonium sulfate, and water contributed 55±15%. At the suburban/rural locations, EC-containing particles contributed 37–48% of the measured light extinction, with EC mass contributing 4–10% and non-EC coating materials contributing the remaining light extinction. Our results suggest that EC-containing particles were important to the overall light extinction in the urban atmospheres due to their more abundant presence from vehicular emissions. The EC-containing particles in the suburban/rural locations had a reduced but still significant contribution to light extinction budget.

  12. Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space.

    Science.gov (United States)

    Karnik, Rahul; Beer, Michael A

    2015-01-01

    The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix) rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs.

  13. Identification of Predictive Cis-Regulatory Elements Using a Discriminative Objective Function and a Dynamic Search Space.

    Directory of Open Access Journals (Sweden)

    Rahul Karnik

    Full Text Available The generation of genomic binding or accessibility data from massively parallel sequencing technologies such as ChIP-seq and DNase-seq continues to accelerate. Yet state-of-the-art computational approaches for the identification of DNA binding motifs often yield motifs of weak predictive power. Here we present a novel computational algorithm called MotifSpec, designed to find predictive motifs, in contrast to over-represented sequence elements. The key distinguishing feature of this algorithm is that it uses a dynamic search space and a learned threshold to find discriminative motifs in combination with the modeling of motifs using a full PWM (position weight matrix rather than k-mer words or regular expressions. We demonstrate that our approach finds motifs corresponding to known binding specificities in several mammalian ChIP-seq datasets, and that our PWMs classify the ChIP-seq signals with accuracy comparable to, or marginally better than motifs from the best existing algorithms. In other datasets, our algorithm identifies novel motifs where other methods fail. Finally, we apply this algorithm to detect motifs from expression datasets in C. elegans using a dynamic expression similarity metric rather than fixed expression clusters, and find novel predictive motifs.

  14. Overlapping protein-binding sites within a negative regulatory element modulate the brain-preferential expression of the human HPRT gene

    Energy Technology Data Exchange (ETDEWEB)

    Rincon-Limas, D.E.; Amaya-Manzanares, E.; Nino-Rosales, M.L. [Baylor College of Medicine, Houston, TX (United States)] [and others

    1994-09-01

    The hypoxanthine phosphoribosyltransferase (HPRT) gene, whose deficiency in humans causes the Lesch-Nyhan syndrome, is constitutively expressed at low levels in all tissues but at higher levels in the brain, the significance and mechanism of which is unknown. Towards dissecting this molecular mechanism, we have previously identified a 182 bp element (hHPRT-NE) within the 5{prime}-flanking region of the human HPRT gene which is involved not only in conferring neuronal specificity but also in repressing gene expression in non-neuronal tissues. Here we report that this element interacts with different nuclear proteins, some of which are present specifically in neuronal cells (complex I) and others of which are present in cells showing constitutive expression of the gene (complex II). In addition, we found that complex I factors are expressed in human NT2/D1 cells following induction of neuronal differentiation by retinoic acid. This finding correlates with an increase of HPRT gene transcription following neuronal differentiation, as demonstrated by RT-PCR and RNAase protection assays. We also mapped the binding sites for both complexes to a 60 bp region which, when tested by transient transfections in cultured fibroblasts, functioned as a repressor element. Methylation interference footprinting revealed a minimal unique DNA motif as the binding site for nuclear proteins from both neuronal and non-neuronal sources. Moreover, UV-crosslinking experiments showed that both complexes are formed by the association of several distinct proteins. Strikingly, site-directed mutagenesis of the footprinted region indicated that different nucleotides are essential for the association of these two complexes. These data suggest that differential formation of DNA-protein complexes at this regulatory domain could be a major determinant in the brain-preferential expression of the human HPRT gene.

  15. Confined housing system increased abdominal and subcutaneous fat deposition and gene expressions of carbohydrate response element-binding protein and sterol regulatory element-binding protein 1 in chicken.

    Science.gov (United States)

    Li, Q; Zhao, X L; Gilbert, E R; Liu, Y P; Wang, Y; Qiu, M H; Zhu, Q

    2015-02-06

    Free-range production system is increasingly being used in poultry breeding and feed production in many countries. The objective of the current experiment was to evaluate the effects of different raising systems on fat-related traits and mRNA levels of liver lipogenesis genes in Erlang Mountainous chicken. Each of 10 birds (91 day old) from caged, indoor-floor housed, and free-range housing systems was slaughtered, and fat-related traits, live body weight (BW), subcutaneous fat thickness (SFT), abdominal fat weight (AFW), abdominal fat percentage (AFP), and intramuscular fat content were determined. The mRNA levels of liver X receptor α, carbohydrate response element-binding protein (ChREBP), sterol regulatory element-binding protein-1 (SREBP1), and fatty acid synthase were detected. The caged chicken exhibited significantly higher BW, SFT, and AFW than those of free-ranged chicken (P caged chicken, while the lowest level was found in free-ranged chicken. Association analysis indicated that there were significant (P caged chicken was probably induced by increased gene expression of ChREBP and SREBP1 in the liver.

  16. Preventing phosphorylation of sterol regulatory element-binding protein 1a by MAP-kinases protects mice from fatty liver and visceral obesity.

    Science.gov (United States)

    Kotzka, Jorg; Knebel, Birgit; Haas, Jutta; Kremer, Lorena; Jacob, Sylvia; Hartwig, Sonja; Nitzgen, Ulrike; Muller-Wieland, Dirk

    2012-01-01

    The transcription factor sterol regulatory element binding protein (SREBP)-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK). Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK) or p38 stress activated MAP kinases. Serine 117 is also the major phosphorylation site in SREBP-1a for JNK. In contrast to that the major phosphorylation sites of p38 MAPK family are serine 63 and threonine 426. Functional analyses reveal that phosphorylation of SREBP-1a does not alter protein/DNA interaction. The identified phosphorylation sites are specific for both kinase families also in cellular context. To provide direct evidence that phosphorylation of SREBP-1a is a regulatory principle of biological and clinical relevance, we generated transgenic mice expressing mature transcriptionally active N-terminal domain of human SREBP-1a variant lacking all identified phosphorylaton sites designed as alb-SREBP-1aΔP and wild type SREBP-1a designed as alb-SREBP-1a liver specific under control of the albumin promoter and a liver specific enhancer. In contrast to alb-SREBP-1a mice the phosphorylation-deficient mice develop no enlarged fatty livers under normocaloric conditions. Phenotypical examination reveales a massive accumulation of adipose tissue in alb-SREBP-1a but not in the phosphorylation deficient alb-SREBP-1aΔP mice. Moreover, preventing phosphorylation of SREBP-1a protects mice also from dyslipidemia. In conclusion, phosphorylation of SREBP-1a by ERK, JNK and p38 MAPK-families resembles a biological principle and plays a significant role, in vivo.

  17. Preventing phosphorylation of sterol regulatory element-binding protein 1a by MAP-kinases protects mice from fatty liver and visceral obesity.

    Directory of Open Access Journals (Sweden)

    Jorg Kotzka

    Full Text Available The transcription factor sterol regulatory element binding protein (SREBP-1a plays a pivotal role in lipid metabolism. Using the SREBP-1a expressing human hepatoma cell line HepG2 we have shown previously that human SREBP-1a is phosphorylated at serine 117 by ERK-mitogen-activated protein kinases (MAPK. Using a combination of cell biology and protein chemistry approach we show that SREBP-1a is also target of other MAPK-families, i.e. c-JUN N-terminal protein kinases (JNK or p38 stress activated MAP kinases. Serine 117 is also the major phosphorylation site in SREBP-1a for JNK. In contrast to that the major phosphorylation sites of p38 MAPK family are serine 63 and threonine 426. Functional analyses reveal that phosphorylation of SREBP-1a does not alter protein/DNA interaction. The identified phosphorylation sites are specific for both kinase families also in cellular context. To provide direct evidence that phosphorylation of SREBP-1a is a regulatory principle of biological and clinical relevance, we generated transgenic mice expressing mature transcriptionally active N-terminal domain of human SREBP-1a variant lacking all identified phosphorylaton sites designed as alb-SREBP-1aΔP and wild type SREBP-1a designed as alb-SREBP-1a liver specific under control of the albumin promoter and a liver specific enhancer. In contrast to alb-SREBP-1a mice the phosphorylation-deficient mice develop no enlarged fatty livers under normocaloric conditions. Phenotypical examination reveales a massive accumulation of adipose tissue in alb-SREBP-1a but not in the phosphorylation deficient alb-SREBP-1aΔP mice. Moreover, preventing phosphorylation of SREBP-1a protects mice also from dyslipidemia. In conclusion, phosphorylation of SREBP-1a by ERK, JNK and p38 MAPK-families resembles a biological principle and plays a significant role, in vivo.

  18. Elements located upstream and downstream of the major splice donor site influence the ability of HIV-2 leader RNA to dimerize in vitro.

    Science.gov (United States)

    Lanchy, Jean-Marc; Rentz, Casey A; Ivanovitch, John D; Lodmell, J Stephen

    2003-03-11

    An essential step in the replication cycle of all retroviruses is the dimerization of genomic RNA prior to or during budding and maturation of the viral particle. In HIV-1, a 5' leader region site termed stem-loop 1 (SL1) promotes RNA dimerization in vitro and influences dimerization in vivo. In HIV-2, two sequences promote dimerization of RNA fragments in vitro: the 5'-end of the primer-binding site (PBS) and a stem-loop region homologous to the HIV-1 SL1 sequence. Because HIV-2 RNA constructs of different lengths use these two dimerization signals disproportionately, we hypothesized that other sequences could modulate their relative utilization. Here, we characterized the influence of sequences upstream and downstream of the major splice donor site on the formation of HIV-2 RNA dimers in vitro using a variety of RNA constructs and dimerization and electrophoresis protocols. We first assayed the formation of loose or tight dimers for 1-444 and 1-561 model RNAs. Although both RNAs could form PBS-dependent loose dimers, the 1-561 RNA was unable to make SL1-dependent tight dimers. Using RNAs truncated at their 5'- and/or 3'-ends and by making compensatory base substitutions, we found that two elements interfere with the formation of SL1-dependent tight dimers. The cores of these elements are located at nucleotides 189-196 and 543-550. Our results suggest that base pairing between these sequences prevents the formation of SL1-dependent tight dimers, probably by sequestering SL1 in a stable intramolecular arrangement. Moreover, we found that nucleotides downstream of SL1 decreased the rate of tight dimerization. Interestingly, dimerization at 37 degrees C in the presence of nucleocapsid protein increased the yield of SL1-mediated tight dimerization in vitro, even in the presence of the two interfering elements, suggesting a relationship between the nucleocapsid protein and activation of the SL1 dimerization signal in vivo.

  19. Effects of heater location and heater size on the natural convection heat transfer in a square cavity using finite element method

    Energy Technology Data Exchange (ETDEWEB)

    Ngo, Ich Long; Byon, Chan [Yeungnam University, Gyeongsan (Korea, Republic of)

    2015-07-15

    Finite element method was used to investigate the effects of heater location and heater size on the natural convection heat transfer in a 2D square cavity heated partially or fully from below and cooled from above. Rayleigh number (5 X 10{sup 2} ≤ Ra ≤ 5X10{sup 5}), heater size (0.1 ≤ D/L ≤ 1.0), and heater location (0.1 ≤ x{sub h}/L ≤ 0.5) were considered. Numerical results indicated that the average Nusselt number (Nu{sub m}) increases as the heater size decreases. In addition, when x{sub h}/L is less than 0.4, Nu{sub m} increases as x{sub h}/L increases, and Num decreases again for a larger value of x{sub h}/L. However, this trend changes when Ra is less than 10{sup 4}, suggesting that Nu{sub m} attains its maximum value at the region close to the bottom surface center. This study aims to gain insight into the behaviors of natural convection in order to potentially improve internal natural convection heat transfer.

  20. A universal algorithm for genome-wide in silicio identification of biologically significant gene promoter putative cis-regulatory-elements; identification of new elements for reactive oxygen species and sucrose signaling in Arabidopsis.

    Science.gov (United States)

    Geisler, Matt; Kleczkowski, Leszek A; Karpinski, Stanislaw

    2006-02-01

    Short motifs of many cis-regulatory elements (CREs) can be found in the promoters of most Arabidopsis genes, and this raises the question of how their presence can confer specific regulation. We developed a universal algorithm to test the biological significance of CREs by first identifying every Arabidopsis gene with a CRE and then statistically correlating the presence or absence of the element with the gene expression profile on multiple DNA microarrays. This algorithm was successfully verified for previously characterized abscisic acid, ethylene, sucrose and drought responsive CREs in Arabidopsis, showing that the presence of these elements indeed correlates with treatment-specific gene induction. Later, we used standard motif sampling methods to identify 128 putative motifs induced by excess light, reactive oxygen species and sucrose. Our algorithm was able to filter 20 out of 128 novel CREs which significantly correlated with gene induction by either heat, reactive oxygen species and/or sucrose. The position, orientation and sequence specificity of CREs was tested in silicio by analyzing the expression of genes with naturally occurring sequence variations. In three novel CREs the forward orientation correlated with sucrose induction and the reverse orientation with sucrose suppression. The functionality of the predicted novel CREs was experimentally confirmed using Arabidopsis cell-suspension cultures transformed with short promoter fragments or artificial promoters fused with the GUS reporter gene. Our genome-wide analysis opens up new possibilities for in silicio verification of the biological significance of newly discovered CREs, and allows for subsequent selection of such CREs for experimental studies.

  1. Integrative modeling of eQTLs and cis-regulatory elements suggests mechanisms underlying cell type specificity of eQTLs.

    Directory of Open Access Journals (Sweden)

    Christopher D Brown

    Full Text Available Genetic variants in cis-regulatory elements or trans-acting regulators frequently influence the quantity and spatiotemporal distribution of gene transcription. Recent interest in expression quantitative trait locus (eQTL mapping has paralleled the adoption of genome-wide association studies (GWAS for the analysis of complex traits and disease in humans. Under the hypothesis that many GWAS associations tag non-coding SNPs with small effects, and that these SNPs exert phenotypic control by modifying gene expression, it has become common to interpret GWAS associations using eQTL data. To fully exploit the mechanistic interpretability of eQTL-GWAS comparisons, an improved understanding of the genetic architecture and causal mechanisms of cell type specificity of eQTLs is required. We address this need by performing an eQTL analysis in three parts: first we identified eQTLs from eleven studies on seven cell types; then we integrated eQTL data with cis-regulatory element (CRE data from the ENCODE project; finally we built a set of classifiers to predict the cell type specificity of eQTLs. The cell type specificity of eQTLs is associated with eQTL SNP overlap with hundreds of cell type specific CRE classes, including enhancer, promoter, and repressive chromatin marks, regions of open chromatin, and many classes of DNA binding proteins. These associations provide insight into the molecular mechanisms generating the cell type specificity of eQTLs and the mode of regulation of corresponding eQTLs. Using a random forest classifier with cell specific CRE-SNP overlap as features, we demonstrate the feasibility of predicting the cell type specificity of eQTLs. We then demonstrate that CREs from a trait-associated cell type can be used to annotate GWAS associations in the absence of eQTL data for that cell type. We anticipate that such integrative, predictive modeling of cell specificity will improve our ability to understand the mechanistic basis of human

  2. 数字教材关键要素的定位与实现%Locating and Implementing Vital Elements of Digital Textbook

    Institute of Scientific and Technical Information of China (English)

    孙众; 骆力明

    2013-01-01

      在数字化学习的时代背景下,数字教材已成为支持课堂及课外学习的新型学习形态。然而,数字教材中的关键要素该如何定位并加以实现,才能满足学习者群智学习和个性学习的需要?回顾数字教材的发展历程及国内外已有研究,结合数字教材的阶段特点及主要问题,本文提出实现下一代数字教材设计与开发的“三层次五要素冶。其中,三层次是指内容层、交流层和生成层;五要素是指与学习目标聚焦度高且可智能推送的学习资源,符合学科特色且实现离线使用、在线更新的学科工具,与资源实现多对多关联的学习活动,支持人际交往的社会认知网络,实现按需生成的个性化教材。%Digital textbooks are resources to support in-class and off-class learning in digital learning era. Yet, less attention has been paid to locate and implement vital elements in digital textbooks. This study aims to meet the need of group-intelligent learning and personalized learning by exploring this issue. After reviewing the history of digital text-book in the past decades, the authors divide digital textbooks into three generations, discuss major shorting for each one, and then shed light on five vital elements for the next generation of intelligent digital textbooks according to the analysis of literature review and practical investigation. The result indicates that learning materials, learning tools, learning activities, personal learning network, and customized learning are five pivotal elements for intelligent digital textbooks. This paper takes elementary English learning as an example and systematically introduces the applications of the five pivotal elements in designing and implementing digital English textbooks. It provides reference for research-ers and designers to develop future digital textbooks.

  3. Sterol regulatory element binding transcription factor 1 expression and genetic polymorphism significantly affect intramuscular fat deposition in the longissimus muscle of Erhualian and Sutai pigs.

    Science.gov (United States)

    Chen, J; Yang, X J; Xia, D; Chen, J; Wegner, J; Jiang, Z; Zhao, R Q

    2008-01-01

    Two experiments were performed to elucidate the role of sterol regulatory element binding transcription factor 1 (SREBF1) in i.m. fat (IMF) deposition in pigs. In Exp. 1, LM samples were removed from 4 male and 4 female Erhualian piglets at 3, 20, and 45 d of age, and SREBF1 mRNA expression level and IMF content were measured. Intramuscular fat content and expression of SREBF1 mRNA was greater (P Single-strand conformation polymorphism (SSCP) analysis of the reverse transcription PCR products of the SREBF1 gene revealed 3 genotypes in Sutai pigs with frequencies of 50% for AA, 36% for AB, and 14% for BB, respectively. Both SREBF1 mRNA level and IMF content in muscle were greater (P < 0.05) in AB and BB animals than in AA animals, whereas no difference in backfat thickness was observed among the 3 genotypes. Sequencing analysis identified 2 SNP at T1006C and C1033T within the open reading frame of the SREBF1 gene (NM_214157). Although both are silent mutations, they affected the secondary structure of SREBF1 mRNA. These results suggest that SREBF1 might play an important role in regulation of muscle fat deposition during postnatal growth of pigs. The SNP identified in the SREBF1 gene suggest that it could be used as a genetic marker to improve IMF content in pigs.

  4. Sterol regulatory element-binding protein-1 determines plasma remnant lipoproteins and accelerates atherosclerosis in low-density lipoprotein receptor-deficient mice.

    Science.gov (United States)

    Karasawa, Tadayoshi; Takahashi, Akimitsu; Saito, Ryo; Sekiya, Motohiro; Igarashi, Masaki; Iwasaki, Hitoshi; Miyahara, Shoko; Koyasu, Saori; Nakagawa, Yoshimi; Ishii, Kiyoaki; Matsuzaka, Takashi; Kobayashi, Kazuto; Yahagi, Naoya; Takekoshi, Kazuhiro; Sone, Hirohito; Yatoh, Shigeru; Suzuki, Hiroaki; Yamada, Nobuhiro; Shimano, Hitoshi

    2011-08-01

    Sterol regulatory element-binding protein-1 (SREBP-1) is nutritionally regulated and is known to be a key transcription factor regulating lipogenic enzymes. The goal of this study was to evaluate the roles of SREBP-1 in dyslipidemia and atherosclerosis. Transgenic mice that overexpress SREBP-1c in the liver and SREBP-1-deficient mice were crossed with low-density lipoprotein receptor (LDLR)-deficient mice, and the plasma lipids and atherosclerosis were analyzed. Hepatic SREBP-1c overexpression in LDLR-deficient mice caused postprandial hypertriglyceridemia, increased very-low-density lipoprotein (VLDL) cholesterol, and decreased high-density lipoprotein cholesterol in plasma, which resulted in accelerated aortic atheroma formation. Conversely, absence of SREBP-1 suppressed Western diet-induced hyperlipidemia in LDLR-deficient mice and ameliorated atherosclerosis. In contrast, bone marrow-specific SREBP-1 deficiency did not alter the development of atherosclerosis. The size of nascent VLDL particles secreted from the liver was increased in SREBP-1c transgenic mice and reduced in SREBP-1-deficient mice, accompanied by upregulation and downregulation of phospholipid transfer protein expression, respectively. Hepatic SREBP-1c determines plasma triglycerides and remnant cholesterol and contributes to atherosclerosis in hyperlipidemic states. Hepatic SREBP-1c also regulates the size of nascent VLDL particles.

  5. Lipid extract of Nostoc commune var. sphaeroides Kutzing, a blue-green alga, inhibits the activation of sterol regulatory element binding proteins in HepG2 cells.

    Science.gov (United States)

    Rasmussen, Heather E; Blobaum, Kara R; Park, Young-Ki; Ehlers, Sarah J; Lu, Fan; Lee, Ji-Young

    2008-03-01

    Nostoc commune var. sphaeroides Kützing (N. commune), a blue-green alga, has been used as both a food ingredient and in medicine for centuries. To determine the effect of N. commune on cholesterol metabolism, N. commune lipid extract was incubated at increasing concentrations (25-100 mg/L) with HepG2 cells, a human hepatoma cell line. The addition of N. commune lipid extract markedly reduced mRNA abundance of 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR) and LDL receptor (LDLR) (P commune lipid extract confirmed the inhibitory role of N. commune in cholesterol synthesis (P commune lipid extract, expression of sterol regulatory element binding protein 2 (SREBP-2) was assessed. Whereas mRNA for SREBP-2 remained unchanged, SREBP-2 mature protein was reduced by N. commune (P commune lipid extract also decreased SREBP-1 mature protein by approximately 30% (P commune lipid extract inhibits the maturation process of both SREBP-1 and -2, resulting in a decrease in expression of genes involved in cholesterol and fatty acid metabolism.

  6. β-Hydroxybutyrate Facilitates Fatty Acids Synthesis Mediated by Sterol Regulatory Element-Binding Protein1 in Bovine Mammary Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Min Zhang

    2015-11-01

    Full Text Available Background/Aims: In dairy cows, β-hydroxybutyrate (BHBA is utilized as precursors of de novo synthesized fatty acids in mammary gland. Ketotic cows are characterized by excessive negative energy balance (NEB, which can further increase the blood BHBA concentration. Sterol regulatory element-binding protein1 (SREBP1 and cell death-inducing DNA fragmentation factor-alpha-like effector α (Cidea play crucial roles in lipid synthesis. Therefore, we hypothesized that BHBA could stimulate SREBP1/Cidea pathway to increase milk fat synthesis in bovine mammary epithelial cells. Methods: Bovine mammary epithelial cells were treated with different concentrations of BHBA and transfected with adenovirus to silence SREBP1 expression. The effects of BHBA on the lipid synthesis in bovine mammary epithelial cells were investigated. Results: The results showed that BHBA could significantly increase the expression of SREBP1, fatty acid synthase (FAS, acetyl-CoA carboxylase α (ACC-α, Cidea and diacylglycerol transferase-1 (DGAT-1, as well as the triglycerides (TG content in bovine mammary epithelial cells. BHBA treatment also increased the transfer of mature SREBP1 to nucleus compared with control group. However, SREBP1 silencing could significantly down-regulate the overexpression of FAS, ACC-α, Cidea and DGAT-1, as well as TG content induced by BHBA. Conclusion: The present data indicate that BHBA can significantly increase TG secretion mediated by SREBP1 in bovine mammary epithelial cells.

  7. Transgenes of the mouse immunoglobulin heavy chain locus, lacking distal elements in the 3' regulatory region, are impaired for class switch recombination.

    Directory of Open Access Journals (Sweden)

    Wesley A Dunnick

    Full Text Available The immunoglobulin heavy (H chain class switch is mediated by a deletional recombination event between µ and γ, α, or ε constant region genes. This recombination event is upregulated during immune responses by a regulatory region that lies 3' of the constant region genes. We study switch recombination using a transgene of the entire murine H chain constant region locus. We isolated two lines of mice in which the H chain transgenes were truncated at their 3' ends. The truncation in both transgenic lines results in deletion of the 3'-most enhancer (HS4 and a region with insulator-like structure and activities. Even though both truncated transgenes express the µ H chain gene well, they undergo very low or undetectable switch recombination to transgenic γ and α constant region genes. For both transgenic lines, germline transcription of some H chain constant regions genes is severely impaired. However, the germline transcription of the γ1 and γ2a genes is at wild type levels for the transgenic line with the larger truncation, but at reduced levels for the transgenic line with the smaller truncation. The dramatic reduction in class switch recombination for all H chain genes and the varied reduction in germline transcription for some H chain genes could be caused by (i insertion site effects or (ii deletion of enhancer elements for class switch recombination and transcription, or (iii a combination of both effects.

  8. Heat Shock Protein 90 Modulates Lipid Homeostasis by Regulating the Stability and Function of Sterol Regulatory Element-binding Protein (SREBP) and SREBP Cleavage-activating Protein.

    Science.gov (United States)

    Kuan, Yen-Chou; Hashidume, Tsutomu; Shibata, Takahiro; Uchida, Koji; Shimizu, Makoto; Inoue, Jun; Sato, Ryuichiro

    2017-02-17

    Sterol regulatory element-binding proteins (SREBPs) are the key transcription factors that modulate lipid biosynthesis. SREBPs are synthesized as endoplasmic reticulum-bound precursors that require proteolytic activation in the Golgi apparatus. The stability and maturation of precursor SREBPs depend on their binding to SREBP cleavage-activating protein (SCAP), which escorts the SCAP-SREBP complex to the Golgi apparatus. In this study, we identified heat shock protein (HSP) 90 as a novel SREBP regulator that binds to and stabilizes SCAP-SREBP. In HepG2 cells, HSP90 inhibition led to proteasome-dependent degradation of SCAP-SREBP, which resulted in the down-regulation of SREBP target genes and the reduction in intracellular triglyceride and cholesterol levels. We also demonstrated in vivo that HSP90 inhibition decreased SCAP-SREBP protein, down-regulated SREBP target genes, and reduced lipids levels in mouse livers. We propose that HSP90 plays an indispensable role in SREBP regulation by stabilizing the SCAP-SREBP complex, facilitating the activation of SREBP to maintain lipids homeostasis.

  9. The influence of contact ratio and its location on the primary stability of cementless total hip arthroplasty: A finite element analysis.

    Science.gov (United States)

    Reimeringer, M; Nuño, N

    2016-05-03

    Cementless hip stems are fixed to the surrounding bone by means of press-fit. To ensure a good press-fit, current surgical technique specifies an under-reaming of the bone cavity using successively larger broaches. Nevertheless, this surgical technique is inaccurate. Several studies show that the contact ratio (percentage of stem interface in contact with bone) achieved after surgery can vary between 20% and 95%. Therefore, this study aimed to investigate the influence of the contact ratio and its location on the primary stability of a cementless total hip arthroplasty using finite element analysis. A straight tapered femoral stem implanted in a composite bone was subjected to stair climbing. Micromotion of 7600 nodes at the stem-bone interface was computed for different configurations of contact ratios between 2% and 98%) along the hip stem. Considering the 15 configurations evaluated, the average micromotion ranges between 27μm and 54μm. The percentage of the porous interface of the stem having micromotion below 40μm that allows bone ingrowth range between 25-57%. The present numerical study shows that full contact (100%) between stem and bone is not necessary to obtain a good primary stability. The stem primary stability is influenced by both the contact ratio and its location. Several configurations with contact ratio lower than 100% and involving either the proximal or the cortical contact provide better primary stability than the full contact configuration. However, with contact ratio lower than 40%, the stem should be in contact with cortical bone to ensure a good primary stability.

  10. The disruption of a novel limb cis-regulatory element of SHH is associated with autosomal dominant preaxial polydactyly-hypertrichosis.

    Science.gov (United States)

    Petit, Florence; Jourdain, Anne-Sophie; Holder-Espinasse, Muriel; Keren, Boris; Andrieux, Joris; Duterque-Coquillaud, Martine; Porchet, Nicole; Manouvrier-Hanu, Sylvie; Escande, Fabienne

    2016-01-01

    The expression gradient of the morphogen Sonic Hedgehog (SHH) is crucial in establishing the number and the identity of the digits during anteroposterior patterning of the limb. Its anterior ectopic expression is responsible for preaxial polydactyly (PPD). Most of these malformations are due to the gain-of-function of the Zone of Polarizing Activity Regulatory Sequence, the only limb-specific enhancer of SHH known to date. We report a family affected with a novel condition associating PPD and hypertrichosis of the upper back, following an autosomal dominant mode of inheritance. This phenotype is consistent with deregulation of SHH expression during limb and follicle development. In affected members, we identified a 2 kb deletion located ~240 kb upstream from the SHH promoter. The deleted sequence is capable of repressing the transcriptional activity of the SHH promoter in vitro, consistent with a silencer activity. We hypothesize that the deletion of this silencer could be responsible for SHH deregulation during development, leading to a PPD-hypertrichosis phenotype.

  11. Close linkage of the mouse and human CD3. gamma. - and delta-chain genes suggests that their transcription is controlled by common regulatory elements

    Energy Technology Data Exchange (ETDEWEB)

    Saito, H.; Koyama, T.; Georgopoulos, K.; Clevers, H.; Haser, W.G.; LeBien, T.; Tonegawa, S.; Terhorst, C.

    1987-12-01

    Antigen receptors on the T-cell surface are noncovalently associated with at least four invariant polypeptide chains, CD3-..gamma.., -delta, -epsilon, and -zeta. The mouse CD3-..gamma.. gene, consisting of seven exons, was found to be highly homologous to the CD3-..gamma.. described earlier. Both the high level of sequence homology and the exon/intron organization indicate that the CD3-..gamma.. and -delta genes arose by gene duplication. Surprisingly, murine and human genomic DNA clones could be isolated that contained elements of both the CD3-..gamma.. and CD3-delta genes. In fact, the putative transcription start site of the mouse CD3-..gamma.. gene is less than 1.4 kilobases from the transcription initiation site of the mouse CD3-delta gene. Common elements that regulate the divergent transcription of the two genes are therefore proposed to be located in the intervening 1.4-kilobase DNA segment. This might contribute to the coordinate expression of the CD3-..gamma.. and -delta genes during intrathymic maturation of T lymphocytes.

  12. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    Directory of Open Access Journals (Sweden)

    Garcia Sònia

    2012-06-01

    Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.

  13. Tlr4-mutant mice are resistant to acute alcohol-induced sterol-regulatory element binding protein activation and hepatic lipid accumulation

    Science.gov (United States)

    Zhang, Zhi-Hui; Liu, Xiao-Qian; Zhang, Cheng; He, Wei; Wang, Hua; Chen, Yuan-Hua; Liu, Xiao-Jing; Chen, Xi; Xu, De-Xiang

    2016-01-01

    Previous studies demonstrated that acute alcohol intoxication caused hepatic lipid accumulation. The present study showed that acute alcohol intoxication caused hepatic lipid accumulation in Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic sterol-regulatory element binding protein (SREBP)-1, a transcription factor regulating fatty acid and triglyceride (TG) synthesis, was activated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic Fas, Acc, Scd-1 and Dgat-2, the key genes for fatty acid and TG synthesis, were up-regulated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Additional experiment showed that hepatic MyD88 was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic NF-κB was activated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Moreover, hepatic GSH content was reduced and hepatic MDA level was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic CYP2E1 was elevated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Hepatic p67phox and gp91phox, two NADPH oxidase subunits, were up-regulated in alcohol-treated Tlr4-wild-type mice but not in Tlr4-mutant mice. Alpha-phenyl-N-t-butylnitrone (PBN), a free radical spin-trapping agent, protected against alcohol-induced hepatic SREBP-1 activation and hepatic lipid accumulation. In conclusion, Tlr4-mutant mice are resistant to acute alcohol-induced hepatic SREBP-1 activation and hepatic lipid accumulation. PMID:27627966

  14. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    Energy Technology Data Exchange (ETDEWEB)

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan [Vaccine and Infectious Disease Organization, University of Saskatchewan, Saskatoon, Saskatchewan, Canada S7N 5E3 (Canada); Babiuk, Lorne A. [University of Alberta, Edmonton, Alberta (Canada); Liu, Qiang, E-mail: qiang.liu@usask.ca [Vaccine and Infectious Disease Organization, University of Saskatchewan, Saskatoon, Saskatchewan, Canada S7N 5E3 (Canada)

    2010-11-19

    Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  15. Global Analysis of DNA Methylation Variation in Adipose Tissue from Twins Reveals Links to Disease-Associated Variants in Distal Regulatory Elements

    Science.gov (United States)

    Grundberg, Elin; Meduri, Eshwar; Sandling, Johanna K.; Hedman, Åsa K.; Keildson, Sarah; Buil, Alfonso; Busche, Stephan; Yuan, Wei; Nisbet, James; Sekowska, Magdalena; Wilk, Alicja; Barrett, Amy; Small, Kerrin S.; Ge, Bing; Caron, Maxime; Shin, So-Youn; Ahmadi, Kourosh R.; Ainali, Chrysanthi; Barrett, Amy; Bataille, Veronique; Bell, Jordana T.; Buil, Alfonso; Deloukas, Panos; Dermitzakis, Emmanouil T.; Dimas, Antigone S.; Durbin, Richard; Glass, Daniel; Grundberg, Elin; Hassanali, Neelam; Hedman, Åsa K.; Ingle, Catherine; Knowles, David; Krestyaninova, Maria; Lindgren, Cecilia M.; Lowe, Christopher E.; McCarthy, Mark I.; Meduri, Eshwar; di Meglio, Paola; Min, Josine L.; Montgomery, Stephen B.; Nestle, Frank O.; Nica, Alexandra C.; Nisbet, James; O’Rahilly, Stephen; Parts, Leopold; Potter, Simon; Sandling, Johanna; Sekowska, Magdalena; Shin, So-Youn; Small, Kerrin S.; Soranzo, Nicole; Spector, Tim D.; Surdulescu, Gabriela; Travers, Mary E.; Tsaprouni, Loukia; Tsoka, Sophia; Wilk, Alicja; Yang, Tsun-Po; Zondervan, Krina T.; Lathrop, Mark; Dermitzakis, Emmanouil T.; McCarthy, Mark I.; Spector, Timothy D.; Bell, Jordana T.; Deloukas, Panos

    2013-01-01

    Epigenetic modifications such as DNA methylation play a key role in gene regulation and disease susceptibility. However, little is known about the genome-wide frequency, localization, and function of methylation variation and how it is regulated by genetic and environmental factors. We utilized the Multiple Tissue Human Expression Resource (MuTHER) and generated Illumina 450K adipose methylome data from 648 twins. We found that individual CpGs had low variance and that variability was suppressed in promoters. We noted that DNA methylation variation was highly heritable (h2median = 0.34) and that shared environmental effects correlated with metabolic phenotype-associated CpGs. Analysis of methylation quantitative-trait loci (metQTL) revealed that 28% of CpGs were associated with nearby SNPs, and when overlapping them with adipose expression quantitative-trait loci (eQTL) from the same individuals, we found that 6% of the loci played a role in regulating both gene expression and DNA methylation. These associations were bidirectional, but there were pronounced negative associations for promoter CpGs. Integration of metQTL with adipose reference epigenomes and disease associations revealed significant enrichment of metQTL overlapping metabolic-trait or disease loci in enhancers (the strongest effects were for high-density lipoprotein cholesterol and body mass index [BMI]). We followed up with the BMI SNP rs713586, a cg01884057 metQTL that overlaps an enhancer upstream of ADCY3, and used bisulphite sequencing to refine this region. Our results showed widespread population invariability yet sequence dependence on adipose DNA methylation but that incorporating maps of regulatory elements aid in linking CpG variation to gene regulation and disease risk in a tissue-dependent manner. PMID:24183450

  16. Subunit architecture of the Golgi Dsc E3 ligase required for sterol regulatory element-binding protein (SREBP) cleavage in fission yeast.

    Science.gov (United States)

    Lloyd, S Julie-Ann; Raychaudhuri, Sumana; Espenshade, Peter J

    2013-07-19

    The membrane-bound sterol regulatory element-binding protein (SREBP) transcription factors regulate lipogenesis in mammalian cells and are activated through sequential cleavage by the Golgi-localized Site-1 and Site-2 proteases. The mechanism of fission yeast SREBP cleavage is less well defined and, in contrast, requires the Golgi-localized Dsc E3 ligase complex. The Dsc E3 ligase consists of five integral membrane subunits, Dsc1 through Dsc5, and resembles membrane E3 ligases that function in endoplasmic reticulum-associated degradation. Using immunoprecipitation assays and blue native electrophoresis, we determined the subunit architecture for the complex of Dsc1 through Dsc5, showing that the Dsc proteins form subcomplexes and display defined connectivity. Dsc2 is a rhomboid pseudoprotease family member homologous to mammalian UBAC2 and a central component of the Dsc E3 ligase. We identified conservation in the architecture of the Dsc E3 ligase and the multisubunit E3 ligase gp78 in mammals. Specifically, Dsc1-Dsc2-Dsc5 forms a complex resembling gp78-UBAC2-UBXD8. Further characterization of Dsc2 revealed that its C-terminal UBA domain can bind to ubiquitin chains but that the Dsc2 UBA domain is not essential for yeast SREBP cleavage. Based on the ability of rhomboid superfamily members to bind transmembrane proteins, we speculate that Dsc2 functions in SREBP recognition and binding. Homologs of Dsc1 through Dsc4 are required for SREBP cleavage and virulence in the human opportunistic pathogen Aspergillus fumigatus. Thus, these studies advance our organizational understanding of multisubunit E3 ligases involved in endoplasmic reticulum-associated degradation and fungal pathogenesis.

  17. Progesterone stimulates adipocyte determination and differentiation 1/sterol regulatory element-binding protein 1c gene expression. potential mechanism for the lipogenic effect of progesterone in adipose tissue.

    Science.gov (United States)

    Lacasa, D; Le Liepvre, X; Ferre, P; Dugail, I

    2001-04-13

    Fatty acid synthase (FAS), a nutritionally regulated lipogenic enzyme, is transcriptionally controlled by ADD1/SREBP1c (adipocyte determination and differentiation 1/sterol regulatory element-binding protein 1c), through insulin-mediated stimulation of ADD1/SREBP1c expression. Progesterone exerts lipogenic effects on adipocytes, and FAS is highly induced in breast tumor cell lines upon progesterone treatment. We show here that progesterone up-regulates ADD1/SREBP1c expression in the MCF7 breast cancer cell line and the primary cultured preadipocyte from rat parametrial adipose tissue. In MCF7, progesterone induced ADD1/SREBP1c and Metallothionein II (a well known progesterone-regulated gene) mRNAs, with comparable potency. In preadipocytes, progesterone increased ADD1/SREBP1c mRNA dose-dependently, but not SREBP1a or SREBP2. Run-on experiments demonstrated that progesterone action on ADD1/SREBP1c was primarily at the transcriptional level. The membrane-bound and mature nuclear forms of ADD1/SREBP1 protein accumulated in preadipocytes cultured with progesterone, and FAS induction could be abolished by adenovirus-mediated overexpression of a dominant negative form of ADD1/SREBP1 in these cells. Finally, in the presence of insulin, progesterone was unable to up-regulate ADD1/SREBP1c mRNA in preadipocytes, whereas its effect was restored after 24 h of insulin deprivation. Together these results demonstrate that ADD1/SREBP1c is controlled by progesterone, which, like insulin, acts by increasing ADD1/SREBP1c gene transcription. This provides a potential mechanism for the lipogenic actions of progesterone on adipose tissue.

  18. The zinc finger protein ZNF658 regulates the transcription of genes involved in zinc homeostasis and affects ribosome biogenesis through the zinc transcriptional regulatory element.

    Science.gov (United States)

    Ogo, Ogo A; Tyson, John; Cockell, Simon J; Howard, Alison; Valentine, Ruth A; Ford, Dianne

    2015-03-01

    We previously identified the ZTRE (zinc transcriptional regulatory element) in genes involved in zinc homeostasis and showed that it mediates transcriptional repression in response to zinc. We now report that ZNF658 acts at the ZTRE. ZNF658 was identified by matrix-assisted laser desorption ionization-time of flight mass spectrometry of a band excised after electrophoretic mobility shift assay using a ZTRE probe. The protein contains a KRAB domain and 21 zinc fingers. It has similarity with ZAP1 from Saccharomyces cerevisiae, which regulates the response to zinc restriction, including a conserved DNA binding region we show to be functional also in ZNF658. Small interfering RNA (siRNA) targeted to ZNF658 abrogated the zinc-induced, ZTRE-dependent reduction in SLC30A5 (ZnT5 gene), SLC30A10 (ZnT10 gene), and CBWD transcripts in human Caco-2 cells and the ability of zinc to repress reporter gene expression from corresponding promoter-reporter constructs. Microarray analysis of the effect of reducing ZNF658 expression by siRNA uncovered a large decrease in rRNA. We find that ZTREs are clustered within the 45S rRNA precursor. We also saw effects on expression of multiple ribosomal proteins. ZNF658 thus links zinc homeostasis with ribosome biogenesis, the most active transcriptional, and hence zinc-demanding, process in the cell. ZNF658 is thus a novel transcriptional regulator that plays a fundamental role in the orchestrated cellular response to zinc availability.

  19. Effective carbon partitioning driven by exotic phloem-specific regulatory elements fused to the Arabidopsis thaliana AtSUC2 sucrose-proton symporter gene

    Directory of Open Access Journals (Sweden)

    Ismail Ihab O

    2009-01-01

    Full Text Available Abstract Background AtSUC2 (At1g22710 from Arabidopsis thaliana encodes a phloem-localized sucrose/proton symporter required for efficient photoassimilate transport from source tissues to sink tissues. AtSUC2 plays a key role in coordinating the demands of sink tissues with the output capacity of source leaves, and in maintaining phloem hydrostatic pressure during changes in plant-water balance. Expression and activity are regulated, both positively and negatively, by developmental (sink to source transition and environmental cues, including light, diurnal changes, photoassimilate levels, turgor pressure, drought and osmotic stress, and hormones. Results To assess the importance of this regulation to whole-plant growth and carbon partitioning, AtSUC2 cDNA was expressed from two exotic, phloem-specific promoters in a mutant background debilitated for AtSUC2 function. The first was a promoter element from Commelina Yellow Mottle Virus (CoYMV, and the second was the rolC promoter from Agrobacterium rhizogenes. CoYMVp::AtSUC2 cDNA restored growth and carbon partitioning to near wild-type levels, whereas plants harboring rolCp::AtSUC2 cDNA showed only partial complementation. Conclusion Expressing AtSUC2 cDNA from exotic, phloem-specific promoters argues that strong, phloem-localized expression is sufficient for efficient transport. Expressing AtSUC2 from promoters that foster efficient phloem transport but are subject to regulatory cascades different from the endogenous sucrose/proton symporter genes has implications for biotechnology.

  20. Preliminary identification and analysis of point mutations corre-lated with response to interferon-α in hepatitis B virus post-transcriptional regulatory elements

    Institute of Scientific and Technical Information of China (English)

    XING Tong-jing; LUO Kang-xian; HOU Jin-lin

    2005-01-01

    Background It is still unclear whether viral genetic variability influences response to interferon(IFN)-α treatment. Recent reports suggest that IFN-α effects may be associated with hepatitis B virus(HBV) post-transcriptional regulation. This study was designed to explore the heterogeneity of HBV post-transcriptional regulatory elements (HPRE) and the relationship between the diversity of HPRE and the response to IFN-α treatment. Methods The HPRE sequences from 31 Chinese patients infected with HBV were determined by directly sequencing of polymerase chain reaction (PCR) product, and comparing them to those from Caucasian patients. Subsequently, eukaryotic expression vectors containing HPRE at various points were constructed and transfected into HepG2 cells, which were then exposed to recombinant human cytokines. Results The T to C point mutation at nt 1504 and the C to T (G) at nt 1508 in HPRE were found in 21 and 19 patients with chronic hepatitis B, respectively; the C to T point mutation at nt 1509 was found in 17 patients. These point mutations did not exist in the HPRE of the Caucasian patients. The activity of the CAT gene obviously increased in the case of T to C point mutation at nt 1504, but did not change in the case of the C to T (G) mutations at nt 1508 and 1509. The activity of the CAT gene at these point mutations of HPRE could be inhibited by IFN-α/γ and tumor necrosis factor (TNF)-α except for the point mutations at nt 1508 of HPRE which may escape the suppression role of IFN-α on HPRE. Conclusions There are point mutations between the HPRE of Chinese and Caucasian HBV patients, which might be correlated with response to IFN-α. The variation of HPRE might affect the function of HPRE and influence the regulative function of IFN-α other than that of IFN-γ or TNF-α on HPRE.

  1. Central leptin regulates total ceramide content and sterol regulatory element binding protein-1C proteolytic maturation in rat white adipose tissue.

    Science.gov (United States)

    Bonzón-Kulichenko, Elena; Schwudke, Dominik; Gallardo, Nilda; Moltó, Eduardo; Fernández-Agulló, Teresa; Shevchenko, Andrej; Andrés, Antonio

    2009-01-01

    Obesity and type 2 diabetes are associated with insulin and leptin resistance, and increased ceramide contents in target tissues. Because the adipose tissue has become a central focus in these diseases, and leptin-induced increases in insulin sensitivity may be related to effects of leptin on lipid metabolism, we investigated herein whether central leptin was able to regulate total ceramide levels and the expression of enzymes involved in ceramide metabolism in rat white adipose tissue (WAT). After 7 d central leptin treatment, the total content of ceramides was analyzed by quantitative shotgun lipidomics mass spectrometry. The effects of leptin on the expression of several enzymes of the sphingolipid metabolism, sterol regulatory element binding protein (SREBP)-1c, and insulin-induced gene 1 (INSIG-1) in this tissue were studied. Total ceramide levels were also determined after surgical WAT denervation. Central leptin infusion significantly decreased both total ceramide content and the long-chain fatty acid ceramide species in WAT. Concomitant with these results, leptin decreased the mRNA levels of enzymes involved in de novo ceramide synthesis (SPT-1, LASS2, LASS4) and ceramide production from sphingomyelin (SMPD-1/2). The mRNA levels of enzymes of ceramide degradation (Asah1/2) and utilization (sphingomyelin synthase, ceramide kinase, glycosyl-ceramide synthase, GM3 synthase) were also down-regulated. Ceramide-lowering effects of central leptin were prevented by local autonomic nervous system denervation of WAT. Finally, central leptin treatment markedly increased INSIG-1 mRNA expression and impaired SREBP-1c activation in epididymal WAT. These observations indicate that in vivo central leptin, acting through the autonomic nervous system, regulates total ceramide levels and SREBP-1c proteolytic maturation in WAT, probably contributing to improve the overall insulin sensitivity.

  2. The Hepatitis C Virus-induced NLRP3 Inflammasome Activates the Sterol Regulatory Element-binding Protein (SREBP) and Regulates Lipid Metabolism.

    Science.gov (United States)

    McRae, Steven; Iqbal, Jawed; Sarkar-Dutta, Mehuli; Lane, Samantha; Nagaraj, Abhiram; Ali, Naushad; Waris, Gulam

    2016-02-12

    Hepatitis C virus (HCV) relies on host lipids and lipid droplets for replication and morphogenesis. The accumulation of lipid droplets in infected hepatocytes manifests as hepatosteatosis, a common pathology observed in chronic hepatitis C patients. One way by which HCV promotes the accumulation of intracellular lipids is through enhancing de novo lipogenesis by activating the sterol regulatory element-binding proteins (SREBPs). In general, activation of SREBPs occurs during cholesterol depletion. Interestingly, during HCV infection, the activation of SREBPs occurs under normal cholesterol levels, but the underlying mechanisms are still elusive. Our previous study has demonstrated the activation of the inflammasome complex in HCV-infected human hepatoma cells. In this study, we elucidate the potential link between chronic hepatitis C-associated inflammation and alteration of lipid homeostasis in infected cells. Our results reveal that the HCV-activated NLRP3 inflammasome is required for the up-regulation of lipogenic genes such as 3-hydroxy-3-methylglutaryl-coenzyme A synthase, fatty acid synthase, and stearoyl-CoA desaturase. Using pharmacological inhibitors and siRNA against the inflammasome components (NLRP3, apoptosis-associated speck-like protein containing a CARD, and caspase-1), we further show that the activation of the NLRP3 inflammasome plays a critical role in lipid droplet formation. NLRP3 inflammasome activation in HCV-infected cells enables caspase-1-mediated degradation of insulin-induced gene proteins. This subsequently leads to the transport of the SREBP cleavage-activating protein·SREBP complex from the endoplasmic reticulum to the Golgi, followed by proteolytic activation of SREBPs by S1P and S2P in the Golgi. Typically, inflammasome activation leads to viral clearance. Paradoxically, here we demonstrate how HCV exploits the NLRP3 inflammasome to activate SREBPs and host lipid metabolism, leading to liver disease pathogenesis associated with

  3. Sterol Regulatory Element-Binding Protein-1c Regulates Inflammasome Activation in Gingival Fibroblasts Infected with High-Glucose-Treated Porphyromonas gingivalis

    Science.gov (United States)

    Kuo, Hsing-Chun; Chang, Li-Ching; Chen, Te-Chuan; Lee, Ko-Chao; Lee, Kam-Fai; Chen, Cheng-Nan; Yu, Hong-Ren

    2016-01-01

    Background: Porphyromonas gingivalis is a major bacterial species implicated in the progression of periodontal disease, which is recognized as a common complication of diabetes. The interleukin (IL)-1β, processed by the NLR family pyrin domain containing 3 (NLRP3) inflammasome, has been identified as a target for pathogenic infection of the inflammatory response. However, the effect of P. gingivalis in a high-glucose situation in the modulation of inflammasome activation in human gingival fibroblasts (HGFs) is not well-understood. Methods: P. gingivalis strain CCUG25226 was used to study the mechanisms underlying the regulation of HGF NLRP3 expression by the infection of high-glucose-treated P. gingivalis (HGPg). Results: HGF infection with HGPg increases the expression of IL-1β and NLRP3. We further demonstrated that the upregulation of sterol regulatory element-binding protein (SREBP)-1c by activation of the Akt and p70S6K pathways is critical for HGPg-induced NLRP3 expression. We showed that the inhibition of Janus kinase 2 (JAK2) blocks the Akt- and p70S6K-mediated SREBP-1c, NLRP3, and IL-1β expression. The effect of HGPg on HGF signaling and NLRP3 expression is mediated by β1 integrin. In addition, gingival tissues from diabetic patients with periodontal disease exhibited higher NLRP3 and SREBP-1c expression. Conclusions: Our findings identify the molecular pathways underlying HGPg-dependent NLRP3 inflammasome expression in HGFs, providing insight into the effect of P. gingivalis invasion in HGFs. PMID:28083517

  4. An in silico approach reveals associations between genetic and epigenetic factors within regulatory elements in B cells from primary Sjögren’s syndrome patients

    Directory of Open Access Journals (Sweden)

    Orsia D. Konsta

    2015-08-01

    Full Text Available Recent advances in genetics have highlighted several regions and candidate genes associated with primary Sjögren's syndrome (SS, a systemic autoimmune epithelitis that combines exocrine gland dysfunctions, and focal lymphocytic infiltrations. In addition to genetic factors, it is now clear that epigenetic deregulations are present during SS and restricted to specific cell type subsets such as lymphocytes and salivary gland epithelial cells. In this study, 72 single nucleotide polymorphisms (SNPs associated with 43 SS gene risk factors were selected from publicly available and peer reviewed literature for further in silico analysis. SS risk variant location was tested revealing a broad distribution in coding sequences (5.6%, intronic sequences (55.6%, upstream/downstream genic regions (30.5%, and intergenic regions (8.3%. Moreover, a significant enrichment of regulatory motifs (promoter, enhancer, insulator, DNAse peak and eQTL characterizes SS risk variants (94.4%. Next, screening SNPs in high linkage disequilibrium (r2 ≥ 0.8 in Caucasians revealed 645 new variants including 5 SNPs with missense mutations, and indicated an enrichment of transcriptionally active motifs according to the cell type (B cells > monocytes > T cells >> A549. Finally, we looked at SS risk variants for histone markers in B cells (GM12878, monocytes (CD14+ and epithelial cells (A548. Active histone markers were associated with SS risk variants at both promoters and enhancers in B cells, and within enhancers in monocytes. In conclusion and based on the obtained in silico results, that need further confirmation, associations were observed between SS genetic risk factors and epigenetic factors and these associations predominate in B cells such as those observed at the FAM167A-BLK locus.

  5. Homologous elements hs3a and hs3b in the 3' regulatory region of the murine immunoglobulin heavy chain (Igh) locus are both dispensable for class-switch recombination.

    Science.gov (United States)

    Yan, Yi; Pieretti, Joyce; Ju, Zhongliang; Wei, Shiniu; Christin, John R; Bah, Fatmata; Birshtein, Barbara K; Eckhardt, Laurel A

    2011-08-01

    Immunoglobulin heavy chain (IgH) genes are formed, tested, and modified to yield diverse, specific, and high affinity antibody responses to antigen. The processes involved must be regulated, however, to avoid unintended damage to chromosomes. The 3' regulatory region of the Igh locus plays a major role in regulating class-switch recombination (CSR), the process by which antibody effector functions are modified during an immune response. Loss of all known enhancer-like elements in this region dramatically impairs CSR, but individual element deletions have no effect on this process. In the present study, we explored the hypothesis that an underlying functional redundancy in the homologous elements hs3a and hs3b was masking the importance of either element to CSR. Several transgenic mouse lines were generated, each carrying a bacterial artificial chromosome transgene that mimicked Igh locus structure but in which hs3a was missing and hs3b was flanked by loxP sites. Matings to Cyclization Recombination Enzyme-expressing mice established "pairs" of lines that differed only in the presence or absence of hs3b. Remarkably, CSR remained robust in the absence of both hs3a and hs3b, suggesting that the remaining two elements of the 3' regulatory region, hs1.2 and hs4, although individually dispensable for CSR, are, together, sufficient to support CSR.

  6. Cis-regulatory mutations in human disease.

    Science.gov (United States)

    Epstein, Douglas J

    2009-07-01

    Cis-acting regulatory sequences are required for the proper temporal and spatial control of gene expression. Variation in gene expression is highly heritable and a significant determinant of human disease susceptibility. The diversity of human genetic diseases attributed, in whole or in part, to mutations in non-coding regulatory sequences is on the rise. Improvements in genome-wide methods of associating genetic variation with human disease and predicting DNA with cis-regulatory potential are two of the major reasons for these recent advances. This review will highlight select examples from the literature that have successfully integrated genetic and genomic approaches to uncover the molecular basis by which cis-regulatory mutations alter gene expression and contribute to human disease. The fine mapping of disease-causing variants has led to the discovery of novel cis-acting regulatory elements that, in some instances, are located as far away as 1.5 Mb from the target gene. In other cases, the prior knowledge of the regulatory landscape surrounding the gene of interest aided in the selection of enhancers for mutation screening. The success of these studies should provide a framework for following up on the large number of genome-wide association studies that have identified common variants in non-coding regions of the genome that associate with increased risk of human diseases including, diabetes, autism, Crohn's, colorectal cancer, and asthma, to name a few.

  7. Deletion hotspots in AMACR promoter CpG island are cis-regulatory elements controlling the gene expression in the colon.

    Directory of Open Access Journals (Sweden)

    Xiang Zhang

    2009-01-01

    Full Text Available Alpha-methylacyl-coenzyme A racemase (AMACR regulates peroxisomal beta-oxidation of phytol-derived, branched-chain fatty acids from red meat and dairy products -- suspected risk factors for colon carcinoma (CCa. AMACR was first found overexpressed in prostate cancer but not in benign glands and is now an established diagnostic marker for prostate cancer. Aberrant expression of AMACR was recently reported in Cca; however, little is known about how this gene is abnormally activated in cancer. By using a panel of immunostained-laser-capture-microdissected clinical samples comprising the entire colon adenoma-carcinoma sequence, we show that deregulation of AMACR during colon carcinogenesis involves two nonrandom events, resulting in the mutually exclusive existence of double-deletion at CG3 and CG10 and deletion of CG12-16 in a newly identified CpG island within the core promoter of AMACR. The double-deletion at CG3 and CG10 was found to be a somatic lesion. It existed in histologically normal colonic glands and tubular adenomas with low AMACR expression and was absent in villous adenomas and all CCas expressing variable levels of AMACR. In contrast, deletion of CG12-16 was shown to be a constitutional allele with a frequency of 43% in a general population. Its prevalence reached 89% in moderately differentiated CCas strongly expressing AMACR but only existed at 14% in poorly differentiated CCas expressing little or no AMACR. The DNA sequences housing these deletions were found to be putative cis-regulatory elements for Sp1 at CG3 and CG10, and ZNF202 at CG12-16. Chromatin immunoprecipitation, siRNA knockdown, gel shift assay, ectopic expression, and promoter analyses supported the regulation by Sp1 and ZNF202 of AMACR gene expression in an opposite manner. Our findings identified key in vivo events and novel transcription factors responsible for AMACR regulation in CCas and suggested these AMACR deletions may have diagnostic/prognostic value for

  8. Sterol regulatory element binding protein (SREBP)-1 expression in brain is affected by age but not by hormones or metabolic changes.

    Science.gov (United States)

    Okamoto, Kenjirou; Kakuma, Tetsuya; Fukuchi, Satoshi; Masaki, Takayuki; Sakata, Toshiie; Yoshimatsu, Hironobu

    2006-04-07

    Sterol regulatory element binding protein (SREBP)-1 is a membrane-bound transcription factor that regulates the expression of several genes involved in cellular fatty acid synthesis in the peripheral tissues, including liver. Although SREBP-1 is expressed in brain, little is known about its function. The aim of the present study was to clarify the characteristics of SREBP-1 mRNA expression in rat brain under various nutritional and hormonal conditions. In genetically obese (fa/fa) Zucker rats, expression of SREBP-1 mRNA was greater in liver than in hypothalamus or cerebrum compared to the lean littermates of these rats. Fasting for 45 h and refeeding for 3 h did not affect expression in brains of Wistar rats of SREBP-1 mRNA or the mRNAs of lipogenic enzymes that are targets of SREBP-1, i.e., fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC). Infusion of 2.0 mIU insulin or 3.0 microg leptin into the third cerebroventricle did not affect SREBP-1 mRNA expression in either hypothalamus or cerebrum. SREBP-1 mRNA expression in brains of transgenic mice that overexpressed leptin did not differ from that of wild-type mice. However, we observed a unique age-related alteration in SREBP-1 mRNA expression in brains of Sprague-Dawley rats. Specifically, SREBP-1 mRNA expression increased between 1 and 20 months of age, while there was no such change in the expression of FAS or ACC. This raises the possibility that increased SREBP-1 expression secondary to aging-related decline of polyunsaturated fatty acid (PUFA) might compensate for the reduction of FAS expression in brain. These findings suggest that the expression of SREBP-1 and downstream lipogenic enzymes in brain is probably not regulated by peripheral nutritional conditions or humoral factors. Aging-related changes in SREBP-1 mRNA expression may be involved in developmental changes in brain lipid metabolism.

  9. Regulatory agencies and regulatory risk

    OpenAIRE

    Knieps, Günter; Weiß, Hans-Jörg

    2007-01-01

    The aim of this paper is to show that regulatory risk is due to the discretionary behaviour of regulatory agencies, caused by a too extensive regulatory mandate provided by the legislator. The normative point of reference and a behavioural model of regulatory agencies based on the positive theory of regulation are presented. Regulatory risk with regard to the future behaviour of regulatory agencies is modelled as the consequence of the ex ante uncertainty about the relative influence of inter...

  10. Matrix metalloproteinase-2 mediates a mechanism of metabolic cardioprotection consisting of negative regulation of the sterol regulatory element-binding protein-2/3-hydroxy-3-methylglutaryl-CoA reductase pathway in the heart.

    Science.gov (United States)

    Wang, Xiang; Berry, Evan; Hernandez-Anzaldo, Samuel; Takawale, Abhijit; Kassiri, Zamaneh; Fernandez-Patron, Carlos

    2015-04-01

    Previously, we reported that cardiac matrix metalloproteinase (MMP)-2 is upregulated in hypertensive mice. How MMP-2 affects the development of cardiac disease is unclear. Here, we report that MMP-2 protects from hypertensive cardiac disease. In mice infused with angiotensin II, the lack of MMP-2 (Mmp2(-/-)) did not affect the severity of the hypertension but caused cardiac hypertrophy to develop earlier and to a greater extent versus wild-type (Mmp2(+/+)) mice, as measured by heart weight:body weight ratio and upregulation of hypertrophy and fibrosis markers. We further found numerous metabolic and inflammatory gene expression abnormalities in the left ventricle of Mmp2(-/-) mice. Interestingly, Mmp2(-/-) mice expressed greater amounts of sterol regulatory element-binding protein-2 and 3-hydroxy-3-methylglutaryl-coenzyme A reductase (a target of sterol regulatory element-binding protein-2-mediated transcription and rate limiting enzyme in cholesterol and isoprenoids biosynthesis) in addition to markers of inflammation including chemokines of the C-C motif ligand family. We focused on the functionally related genes for sterol regulatory binding protein-2 and 3-hydroxy-3-methylglutaryl-coenzyme A reductase. The 3-hydroxy-3-methylglutaryl-coenzyme A reductase inhibitor, lovastatin, attenuated angiotensin II-induced cardiac hypertrophy and fibrosis in Mmp2(-/-) and wild-type (Mmp2(+/+)) mice, with Mmp2(-/-) mice showing resistance to cardioprotection by lovastatin. MMP-2 deficiency predisposes to cardiac dysfunction as well as metabolic and inflammatory gene expression dysregulation. This complex phenotype is, at least in part, because of the cardiac sterol regulatory element-binding protein-2/3-hydroxy-3-methylglutaryl-coenzyme A reductase pathway being upregulated in MMP-2 deficiency.

  11. csrT Represents a New Class of csrA-Like Regulatory Genes Associated with Integrative Conjugative Elements of Legionella pneumophila

    OpenAIRE

    Abbott, Zachary D.; Flynn, Kaitlin J.; Byrne, Brenda G.; Mukherjee, Sampriti; Kearns, Daniel B.; Swanson, Michele S

    2016-01-01

    Bacterial evolution is accelerated by mobile genetic elements. To spread horizontally and to benefit the recipient bacteria, genes encoded on these elements must be properly regulated. Among the legionellae are multiple integrative conjugative elements (ICEs) that each encode a paralog of the broadly conserved regulator csrA. Using bioinformatic analyses, we deduced that specific csrA paralogs are coinherited with particular lineages of the type IV secretion system that mediates horizontal sp...

  12. Structural and regulatory elements of HCV NS5B polymerase--β-loop and C-terminal tail--are required for activity of allosteric thumb site II inhibitors.

    Directory of Open Access Journals (Sweden)

    Sarah E Boyce

    Full Text Available Elucidation of the mechanism of action of the HCV NS5B polymerase thumb site II inhibitors has presented a challenge. Current opinion holds that these allosteric inhibitors stabilize the closed, inactive enzyme conformation, but how this inhibition is accomplished mechanistically is not well understood. Here, using a panel of NS5B proteins with mutations in key regulatory motifs of NS5B--the C-terminal tail and β-loop--in conjunction with a diverse set of NS5B allosteric inhibitors, we show that thumb site II inhibitors possess a distinct mechanism of action. A combination of enzyme activity studies and direct binding assays reveals that these inhibitors require both regulatory elements to maintain the polymerase inhibitory activity. Removal of either element has little impact on the binding affinity of thumb site II inhibitors, but significantly reduces their potency. NS5B in complex with a thumb site II inhibitor displays a characteristic melting profile that suggests stabilization not only of the thumb domain but also the whole polymerase. Successive truncations of the C-terminal tail and/or removal of the β-loop lead to progressive destabilization of the protein. Furthermore, the thermal unfolding transitions characteristic for thumb site II inhibitor-NS5B complex are absent in the inhibitor-bound constructs in which interactions between C-terminal tail and β-loop are abolished, pointing to the pivotal role of both regulatory elements in communication between domains. Taken together, a comprehensive picture of inhibition by compounds binding to thumb site II emerges: inhibitor binding provides stabilization of the entire polymerase in an inactive, closed conformation, propagated via coupled interactions between the C-terminal tail and β-loop.

  13. Migration of trace elements from basalt substrate to co-located vegetation (lichens and mosses) at the Wudalianchi volcanos, Northeast China

    Science.gov (United States)

    Bao, Yuan; Ju, Yiwen; Li, Boping; Sun, Yimin

    2016-03-01

    Vegetation (e.g., lichens and mosses) living on the basalt substrate have potential to accumulate trace elements in their tissues. Here, we analyze the trace elements in basalt (collected from major volcanic center to jet plate places, representing four different eruption phases) and adjacent lichens and mosses to assess their elemental source-receptor relation. The results indicate that As, Sr, Mo, Cd, and Ba are enriched in basalt, and depleted in lichens and mosses. However, Zn, Hg, and Pb are enriched in lichens and mosses and depleted in basalt. Moreover, with the increase of basalt age, Cr, Mn, Fe, Ni, and Cu are gradually enriched in lichen and moss, but gradually depleted in basalt. Compared with transition metals, large ion lithophiles, the platinum group, and rare earth elements, Cr, Co, Cu, Zn, and Os are more easily absorbed by No. 1 lichen. Specifically, S is highly assimilated in vegetation, with a highest value of 166, followed by I, C, Pb, Zn, and Hg. In addition, the hydrogen and oxygen isotopic compositions of water samples suggest that the surface water in the Wenbo area came from meteoric waters in summer with a high humidity, while the underground water in the Beiyaoquan area came from meteoric waters in winter with a low humidity.

  14. Identification of novel regulatory GRE-binding elements in the porcine IP3R1 gene promoter and their transcriptional activation under glucocorticoid stimulation.

    Science.gov (United States)

    Chai, Jin; Xiong, Qi; Wang, Dan; Wan, Xuebing; Niu, Hongdan; Xiang, Hong; Li, Huanan; Wang, Hongshuai; Zheng, Rong; Peng, Jian; Jiang, Siwen

    2017-08-01

    Inositol 1,4,5-trisphosphate receptor 1 (IP3R1) is a type of ligand-gated calcium channel that is expressed predominantly in mammalian skeletal muscle, where it acts as a key regulator of calcium homeostasis. In meat, calcium disequilibrium is accompanied by the deterioration of meat quality. Here we show that serum cortisol concentration was higher and the IP3R1 gene expression level increased markedly in pigs exposed to high stress. In porcine primary muscle cells, dexamethasone (DEX, a synthetic glucocorticoid) increased the protein levels of porcine IP3R1 and GRα, and cell apoptosis, and the specific GRα inhibitor RU486 attenuated these effects. DEX also increased the expression of IP3R1 at both the gene and protein levels, and this expression was attenuated by RU486, siRNA against GRα, and the transcriptional inhibitor actinomycin D. DEX significantly reduced cell viability and increased the intracellular calcium concentration, and these effects were attenuated by siRNA against GRα. Bioinformatics analyses predicted a potential glucocorticoid response element (GRE) located in the region -326 to -309 upstream of the IP3R1 promoter and highly conserved in pigs and other mammalian species. Promoter analysis showed that this region containing the GRE was critical for transcriptional activity of porcine IP3R1 under DEX stimulation. This was confirmed by deletion and site-mutation methods. EMSA and ChIP assays showed that this potential GRE bound specifically to GRα and this complex activated the transcription of the IP3R1 gene. Taken together, these data suggest that DEX-mediated induction of IP3R1 influences porcine muscle cells through the transcriptional activation of a mechanism involving interactions between GRα and a GRE present in the proximal IP3R1 promoter. This process can lead to an imbalance in intracellular calcium concentration, which may subsequently activate the apoptosis signal and decrease cell activity, and cause deterioration of meat

  15. Analysis of connection element classes and locations and of some structural requirements for the mounting of different superstructure types on transport vehicles

    Directory of Open Access Journals (Sweden)

    Zoran Đ. Majkić

    2011-04-01

    Full Text Available The paper presents the basic requirements for transport vehicles. A special request regarding the adaptation of transport vehicles for the transport of various types of cargo was taken into consideration. Superstructures and the situation arising after mounting superstructures on wheeled transport vehicles were analyzed and the following was described: console coupling, stirrups, simplex elastic coupling, two-way elastic and rigid connection elements. Vehicle torsional elasticity is provided by a proper choice of the type of connection between the superstructure and the vehicle chassis. Applying the instructions of vehicle manufacturers for using appropriate connections between the truck superstructure and the vehicle chassis provides positive torsional elasticity of the vehicle. The paper gives the general recommendations of the Volvo, Mercedes and Renault transport vehicle producers for the use of particular connection types of locations as well as structural requirements for the mounting of concrete mixers, tippers and truck tanks on their vehicles. Introduction Achieving a high level of transport effectiveness depends on a number of factors. One of the most important ones is the possibility to increase the payload share in the gross vehicle weight. This share depends on the net vehicle weight, a method of coupling the truck superstructure with the chassis frame as well as on the truck superstructure construction. Realization of this requirement is of significant importance, particularly for large business systems since it results in the reduction of number of necessary vehicles, more economic fleet maintenance and the fleet capacity increase. It is also relatively easy to adapt the vehicle for the transportation of other loads, depending on user's current needs. The adaptation is correctly performed if manufacturer's recommendations are followed during the mounting of the superstructure on the chassis. This paper gives the analysis of the

  16. Noise Source Location Optimization

    Directory of Open Access Journals (Sweden)

    Ed O’Keefe

    1994-01-01

    Full Text Available This article describes a method to determine locations of noise sources that minimize modal coupling in complex acoustic volumes. Using the acoustic source scattering capabilities of the boundary element method, predictions are made of mode shape and pressure levels due to various source locations. Combining knowledge of the pressure field with a multivariable function minimization technique, the source location generating minimum pressure levels can be determined. The analysis also allows for an objective comparison of “best/worst” locations. The technique was implemented on a personal computer for the U.S. Space Station, predicting 5–10 dB noise reduction using optimum source locations.

  17. Identification of a NF-kB site in the negative regulatory element (εNRAII) of human ε-globin gene and its binding protein NF-κB p50 in the nuclei of K562 cells

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The developmental control of the human ε-globin gene expression is mediated by transcription regulatory elements in the 5' flanking DNA of this gene. Sequence analysis has revealed a DNA motif (GGGGAATTTGCT) similar to NF-κB consensus sequence resides in the negative regulatory element (-3028bp ~ -2902bp, termed ε-NRAII) 5' to the cap site of this gene. NRF DNA fragment (-3010bp ~-2986bp) containing the NF-κB motif similar sequence was synthesized and used in electrophoresis mobility shift assay (EMSA) and competitive analysis. Data showed that a protein factor from nuclear extracts of K562 cells specifically interacted with NRF DNA fragment. The synthetic NF DNA fragment (containing NF-κB consensus sequence) could competed for the protein binding, but MNF DNA fragment (mutated NF-κB motif) could not, suggesting that the binding protein is a member of NF-κB/Rel family. Western blot assay demonstrated that the molecular weight of NF-κB protein in the nuclei of K562 cells is 50ku. We suggested that NF-κB p50 may play an important role in the regulation of human ε-globin gene expression.

  18. Regulatory guidance document

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-05-01

    The Office of Civilian Radioactive Waste Management (OCRWM) Program Management System Manual requires preparation of the OCRWM Regulatory Guidance Document (RGD) that addresses licensing, environmental compliance, and safety and health compliance. The document provides: regulatory compliance policy; guidance to OCRWM organizational elements to ensure a consistent approach when complying with regulatory requirements; strategies to achieve policy objectives; organizational responsibilities for regulatory compliance; guidance with regard to Program compliance oversight; and guidance on the contents of a project-level Regulatory Compliance Plan. The scope of the RGD includes site suitability evaluation, licensing, environmental compliance, and safety and health compliance, in accordance with the direction provided by Section 4.6.3 of the PMS Manual. Site suitability evaluation and regulatory compliance during site characterization are significant activities, particularly with regard to the YW MSA. OCRWM`s evaluation of whether the Yucca Mountain site is suitable for repository development must precede its submittal of a license application to the Nuclear Regulatory Commission (NRC). Accordingly, site suitability evaluation is discussed in Chapter 4, and the general statements of policy regarding site suitability evaluation are discussed in Section 2.1. Although much of the data and analyses may initially be similar, the licensing process is discussed separately in Chapter 5. Environmental compliance is discussed in Chapter 6. Safety and Health compliance is discussed in Chapter 7.

  19. Location Privacy

    Science.gov (United States)

    Meng, Xiaofeng; Chen, Jidong

    With rapid development of sensor and wireless mobile devices, it is easy to access mobile users' location information anytime and anywhere. On one hand, LBS is becoming more and more valuable and important. On the other hand, location privacy issues raised by such applications have also gained more attention. However, due to the specificity of location information, traditional privacy-preserving techniques in data publishing cannot be used. In this chapter, we will introduce location privacy, and analyze the challenges of location privacy-preserving, and give a survey of existing work including the system architecture, location anonymity and query processing.

  20. A CYCLIC-AMP RESPONSE ELEMENT IS INVOLVED IN RETINOIC ACID-DEPENDENT RAR-BETA-2 PROMOTER ACTIVATION

    NARCIS (Netherlands)

    KRUYT, FAE; FOLKERS, G; VANDENBRINK, CE; VANDERSAAG, PT; Kruyt, Frank

    1992-01-01

    Activation of the retinoic acid receptor (RAR) beta2 promoter is known to be mediated by a RA response element located in the proximity of the TATA-box. By deletion studies in P19 embryonal carcinoma cells we have analyzed the RARbeta2 promoter for the presence of additional regulatory elements. We

  1. 78 FR 30384 - Federal Regulatory Enforcement Fairness Hearing; Region X Regulatory Fairness Board

    Science.gov (United States)

    2013-05-22

    ... ADMINISTRATION Federal Regulatory Enforcement Fairness Hearing; Region X Regulatory Fairness Board AGENCY: U.S... Business Regulatory Fairness Board. SUMMARY: The (SBA) Office of the National Ombudsman is issuing this notice to announce the location, date and time of the Regional Small Business Regulatory Fairness hearing...

  2. 78 FR 36011 - Region VII Regulatory Fairness Board; Federal Regulatory Enforcement Fairness Hearing

    Science.gov (United States)

    2013-06-14

    ... ADMINISTRATION Region VII Regulatory Fairness Board; Federal Regulatory Enforcement Fairness Hearing AGENCY: U.S... Business Regulatory Fairness Board. SUMMARY: The (SBA) Office of the National Ombudsman is issuing this notice to announce the location, date and time of the Regional Small Business Regulatory Fairness hearing...

  3. Executive function training with game elements for obese children: A novel treatment to enhance self-regulatory abilities for weight-control

    NARCIS (Netherlands)

    Verbeken, S.; Braet, C.; Goossens, L.; van der Oord, S.

    2013-01-01

    For obese children behavioral treatment results in only small changes in relative weight and frequent relapse. The current study investigated the effects of an Executive Functioning (EF) training with game-elements on weight loss maintenance in obese children, over and above the care as usual in an

  4. Library Locations

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — Carnegie Library of Pittsburgh locations including address, coordinates, phone number, square footage, and standard operating hours.

  5. The gene encoding acyl-CoA-binding protein is subject to metabolic regulation by both sterol regulatory element-binding protein and peroxisome proliferator-activated receptor alpha in hepatocytes

    DEFF Research Database (Denmark)

    Sandberg, Maria B; Bloksgaard, Maria; Duran-Sandoval, Daniel

    2005-01-01

    gene in hepatocytes. Members of the SREBP family activate the rat ACBP gene through binding sites for SREBP and the auxiliary factors Sp1 and nuclear factor Y in the proximal promoter. In addition, we show that ACBP is a peroxisome proliferator-activated receptor (PPAR) alpha target gene in cultured...... observation that ACBP expression in rodent liver is down-regulated by fasting, and we show that insulin but not glucose is the inducer of ACBP expression in primary rat hepatocytes. In keeping with the regulation by insulin, we show that ACBP is a sterol regulatory element-binding protein 1c (SREBP-1c) target...... hepatocytes and is induced in the liver by fibrates in a PPARalpha-dependent manner. Thus, ACBP is a dual PPARalpha and SREBP-1c target gene in hepatocytes. Fasting leads to reduced activity of SREBP but increased activity of PPARalpha in hepatocytes, and in keeping with ACBP being a dual target gene, we show...

  6. CNS-specific regulatory elements in brain-derived HIV-1 strains affect responses to latency-reversing agents with implications for cure strategies

    Science.gov (United States)

    Gray, L R; Cowley, D; Welsh, C; Lu, H K; Brew, B J; Lewin, S R; Wesselingh, S L; Gorry, P R; Churchill, M J

    2016-01-01

    Latency-reversing agents (LRAs), including histone deacetylase inhibitors (HDACi), are being investigated as a strategy to eliminate latency in HIV-infected patients on suppressive antiretroviral therapy. The effectiveness of LRAs in activating latent infection in HIV strains derived from the central nervous system (CNS) is unknown. Here we show that CNS-derived HIV-1 strains possess polymorphisms within and surrounding the Sp transcription factor motifs in the long terminal repeat (LTR). These polymorphisms result in decreased ability of the transcription factor specificity protein 1 to bind CNS-derived LTRs, reducing the transcriptional activity of CNS-derived viruses. These mutations result in CNS-derived viruses being less responsive to activation by the HDACi panobinostat and romidepsin compared with lymphoid-derived viruses from the same subjects. Our findings suggest that HIV-1 strains residing in the CNS have unique transcriptional regulatory mechanisms, which impact the regulation of latency, the consideration of which is essential for the development of HIV-1 eradication strategies. PMID:26303660

  7. Combining computational prediction of cis-regulatory elements with a new enhancer assay to efficiently label neuronal structures in the medaka fish.

    Directory of Open Access Journals (Sweden)

    Emmanuel Mongin

    Full Text Available The developing vertebrate nervous system contains a remarkable array of neural cells organized into complex, evolutionarily conserved structures. The labeling of living cells in these structures is key for the understanding of brain development and function, yet the generation of stable lines expressing reporter genes in specific spatio-temporal patterns remains a limiting step. In this study we present a fast and reliable pipeline to efficiently generate a set of stable lines expressing a reporter gene in multiple neuronal structures in the developing nervous system in medaka. The pipeline combines both the accurate computational genome-wide prediction of neuronal specific cis-regulatory modules (CRMs and a newly developed experimental setup to rapidly obtain transgenic lines in a cost-effective and highly reproducible manner. 95% of the CRMs tested in our experimental setup show enhancer activity in various and numerous neuronal structures belonging to all major brain subdivisions. This pipeline represents a significant step towards the dissection of embryonic neuronal development in vertebrates.

  8. Binding of estrogen receptors to switch sites and regulatory elements in the immunoglobulin heavy chain locus of activated B cells suggests a direct influence of estrogen on antibody expression.

    Science.gov (United States)

    Jones, Bart G; Penkert, Rhiannon R; Xu, Beisi; Fan, Yiping; Neale, Geoff; Gearhart, Patricia J; Hurwitz, Julia L

    2016-09-01

    Females and males differ in antibody isotype expression patterns and in immune responses to foreign- and self-antigens. For example, systemic lupus erythematosus is a condition that associates with the production of isotype-skewed anti-self antibodies, and exhibits a 9:1 female:male disease ratio. To explain differences between B cell responses in males and females, we sought to identify direct interactions of the estrogen receptor (ER) with the immunoglobulin heavy chain locus. This effort was encouraged by our previous identification of estrogen response elements (ERE) in heavy chain switch (S) regions. We conducted a full-genome chromatin immunoprecipitation analysis (ChIP-seq) using DNA from LPS-activated B cells and an ERα-specific antibody. Results revealed ER binding to a wide region of DNA, spanning sequences from the JH cluster to Cδ, with peaks in Eμ and Sμ sites. Additional peaks of ERα binding were coincident with hs1,2 and hs4 sites in the 3' regulatory region (3'RR) of the heavy chain locus. This first demonstration of direct binding of ER to key regulatory elements in the immunoglobulin locus supports our hypothesis that estrogen and other nuclear hormone receptors and ligands may directly influence antibody expression and class switch recombination (CSR). Our hypothesis encourages the conduct of new experiments to evaluate the consequences of ER binding. A better understanding of ER:DNA interactions in the immunoglobulin heavy chain locus, and respective mechanisms, may ultimately translate to better control of antibody expression, better protection against pathogens, and prevention of pathologies caused by auto-immune disease.

  9. Consciousness as recursive, spatiotemporal self-location.

    Science.gov (United States)

    Peters, Frederic

    2010-07-01

    At the phenomenal level, consciousness arises in a consistently coherent fashion as a singular, unified field of recursive self-awareness (subjectivity) with explicitly orientational characteristics--that of a subject located both spatially and temporally in an egocentrically-extended domain. Understanding these twin elements of consciousness begins with the recognition that ultimately (and most primitively), cognitive systems serve the biological self-regulatory regime in which they subsist. The psychological structures supporting self-located subjectivity involve an evolutionary elaboration of the two basic elements necessary for extending self-regulation into behavioral interaction with the environment: an orientative reference frame which consistently structures ongoing interaction in terms of controllable spatiotemporal parameters, and processing architecture that relates behavior to homeostatic needs via feedback. Over time, constant evolutionary pressures for energy efficiency have encouraged the emergence of anticipative feedforward processing mechanisms, and the elaboration, at the apex of the sensorimotor processing hierarchy, of self-activating, highly attenuated recursively-feedforward circuitry processing the basic orientational schema independent of external action output. As the primary reference frame of active waking cognition, this recursive self-locational schema processing generates a zone of subjective self-awareness in terms of which it feels like something to be oneself here and now. This is consciousness-as-subjectivity.

  10. Progress on Cis-acting Regulatory Elements in Nonsense-mediated mRNA Decay%NMD作用的顺式调控元件

    Institute of Scientific and Technical Information of China (English)

    黄峙; 周天鸿; 郭宝江

    2004-01-01

    真核生物利用无义介导的mRNA降解(nonsense-mediated mRNA decay,NMD),对含有提前终止密码子(premature termination codons,PTC)的异常转录产物进行快速清除,防止毒害性截短蛋白(truncated proteins)的产生,是真核生物重要的mRNA监视机制.NMD作用的启动与多种顺式调控元件有关,它们包括:提前终止密码子的标识;PTC下游特定位置的序列元件,在酵母细胞称为DSE(downstream sequence element,DSE),在哺乳动物细胞主要为内含子剪接依赖性序列元件(exon-exon junction,EEJ);稳定作用元件(stabilizer elements,STE)对NMD作用的阻抑调节;以及其他与NMD作用相关的序列,如poly(A)延长、5'-UTR的uORF(upstream open reading frame,uORF)和程序化核糖体移码(programmed -1 ribosomal frameshift,-1 PRF)信号序列等.NMD途径中的这些顺式调控元件可能是分子遗传调控的关键靶点.

  11. Isolation of a solventogenic Clostridium sp. strain: fermentation of glycerol to n-butanol, analysis of the bcs operon region and its potential regulatory elements.

    Science.gov (United States)

    Panitz, J C; Zverlov, V V; Pham, V T T; Stürzl, S; Schieder, D; Schwarz, W H

    2014-02-01

    A new solventogenic bacterium, strain GT6, was isolated from standing water sediment. 16S-rRNA gene analysis revealed that GT6 belongs to the heterogeneous Clostridium tetanomorphum group of bacteria exhibiting 99% sequence identity with C. tetanomorphum 4474(T). GT6 can utilize a wide range of carbohydrate substrates including glucose, fructose, maltose, xylose and glycerol to produce mainly n-butanol without any acetone. Additional products of GT6 metabolism were ethanol, butyric acid, acetic acid, and trace amounts of 1,3-propanediol. Medium and substrate composition, and culture conditions such as pH and temperature influenced product formation. The major fermentation product from glycerol was n-butanol with a final concentration of up to 11.5 g/L. 3% (v/v) glycerol lead to a total solvent concentration of 14 g/L within 72 h. Growth was not inhibited by glycerol concentrations as high as 15% (v/v). The solventogenesis genes crt, bcd, etfA/B and hbd composing the bcs (butyryl-CoA synthesis) operon of C. tetanomorphum GT6 were sequenced. They occur in a genomic arrangement identical to those in other solventogenic clostridia. Furthermore, the sequence of a potential regulator gene highly similar to that of the NADH-sensing Rex family of regulatory genes was found upstream of the bcs operon. Potential binding sites for Rex have been identified in the promoter region of the bcs operon of solvent producing clostridia as well as upstream of other genes involved in NADH oxidation. This indicates a fundamental role of Rex in the regulation of fermentation products in anaerobic, and especially in solventogenic bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

  12. MicroRNAs are part of the regulatory network that controls EGF induced apoptosis, including elements of the JAK/STAT pathway, in A431 cells.

    Directory of Open Access Journals (Sweden)

    Ibrahim Alanazi

    Full Text Available MiRNAs are known to regulate gene expression and in the context of cancer have been shown to regulate metastasis, cell proliferation and cell death. In this report we describe potential miRNA regulatory roles with respect to induction of cell death by pharmacologic dose of Epidermal Growth Factor (EGF. Our previous work suggested that multiple pathways are involved in the induction of apoptosis, including interferon induced genes, cytokines, cytoskeleton and cell adhesion and TP53 regulated genes. Using miRNA time course expression profiling of EGF treated A431 cells and coupling this to our previous gene expression and proteomic data, we have been able to implicate a number of additional miRNAs in the regulation of apoptosis. Specifically we have linked miR-134, miR-145, miR-146b-5p, miR-432 and miR-494 to the regulation of both apoptotic and anti-apoptotic genes expressed as a function of EGF treatment. Whilst additional miRNAs were differentially expressed, these had the largest number of apoptotic and anti-apoptotic targets. We found 5 miRNAs previously implicated in the regulation of apoptosis and our results indicate that an additional 20 miRNAs are likely to be involved based on their correlated expression with targets. Certain targets were linked to multiple miRNAs, including PEG10, BTG1, ID1, IL32 and NCF2. Some miRNAs that target the interferon pathway were found to be down regulated, consistent with a novel layer of regulation of interferon pathway components downstream of JAK/STAT. We have significantly expanded the repertoire of miRNAs that may regulate apoptosis in cancer cells as a result of this work.

  13. The T box regulatory element controlling expression of the class I lysyl-tRNA synthetase of Bacillus cereus strain 14579 is functional and can be partially induced by reduced charging of asparaginyl-tRNAAsn

    LENUS (Irish Health Repository)

    Foy, Niall

    2010-07-22

    Abstract Background Lysyl-tRNA synthetase (LysRS) is unique within the aminoacyl-tRNA synthetase family in that both class I (LysRS1) and class II (LysRS2) enzymes exist. LysRS1 enzymes are found in Archaebacteria and some eubacteria while all other organisms have LysRS2 enzymes. All sequenced strains of Bacillus cereus (except AH820) and Bacillus thuringiensis however encode both a class I and a class II LysRS. The lysK gene (encoding LysRS1) of B. cereus strain 14579 has an associated T box element, the first reported instance of potential T box control of LysRS expression. Results A global study of 891 completely sequenced bacterial genomes identified T box elements associated with control of LysRS expression in only four bacterial species: B. cereus, B. thuringiensis, Symbiobacterium thermophilum and Clostridium beijerinckii. Here we investigate the T box element found in the regulatory region of the lysK gene in B. cereus strain 14579. We show that this T box element is functional, responding in a canonical manner to an increased level of uncharged tRNALys but, unusually, also responding to an increased level of uncharged tRNAAsn. We also show that B. subtilis strains with T box regulated expression of the endogenous lysS or the heterologous lysK genes are viable. Conclusions The T box element controlling lysK (encoding LysRS1) expression in B. cereus strain 14579 is functional, but unusually responds to depletion of charged tRNALys and tRNAAsn. This may have the advantage of making LysRS1 expression responsive to a wider range of nutritional stresses. The viability of B. subtilis strains with a single LysRS1 or LysRS2, whose expression is controlled by this T box element, makes the rarity of the occurrence of such control of LysRS expression puzzling.

  14. The T box regulatory element controlling expression of the class I lysyl-tRNA synthetase of Bacillus cereus strain 14579 is functional and can be partially induced by reduced charging of asparaginyl-tRNAAsn

    Directory of Open Access Journals (Sweden)

    Conant Gavin C

    2010-07-01

    Full Text Available Abstract Background Lysyl-tRNA synthetase (LysRS is unique within the aminoacyl-tRNA synthetase family in that both class I (LysRS1 and class II (LysRS2 enzymes exist. LysRS1 enzymes are found in Archaebacteria and some eubacteria while all other organisms have LysRS2 enzymes. All sequenced strains of Bacillus cereus (except AH820 and Bacillus thuringiensis however encode both a class I and a class II LysRS. The lysK gene (encoding LysRS1 of B. cereus strain 14579 has an associated T box element, the first reported instance of potential T box control of LysRS expression. Results A global study of 891 completely sequenced bacterial genomes identified T box elements associated with control of LysRS expression in only four bacterial species: B. cereus, B. thuringiensis, Symbiobacterium thermophilum and Clostridium beijerinckii. Here we investigate the T box element found in the regulatory region of the lysK gene in B. cereus strain 14579. We show that this T box element is functional, responding in a canonical manner to an increased level of uncharged tRNALys but, unusually, also responding to an increased level of uncharged tRNAAsn. We also show that B. subtilis strains with T box regulated expression of the endogenous lysS or the heterologous lysK genes are viable. Conclusions The T box element controlling lysK (encoding LysRS1 expression in B. cereus strain 14579 is functional, but unusually responds to depletion of charged tRNALys and tRNAAsn. This may have the advantage of making LysRS1 expression responsive to a wider range of nutritional stresses. The viability of B. subtilis strains with a single LysRS1 or LysRS2, whose expression is controlled by this T box element, makes the rarity of the occurrence of such control of LysRS expression puzzling.

  15. Oleanolic Acid Diminishes Liquid Fructose-Induced Fatty Liver in Rats: Role of Modulation of Hepatic Sterol Regulatory Element-Binding Protein-1c-Mediated Expression of Genes Responsible for De Novo Fatty Acid Synthesis

    Directory of Open Access Journals (Sweden)

    Changjin Liu

    2013-01-01

    Full Text Available Oleanolic acid (OA, contained in more than 1620 plants and as an aglycone precursor for naturally occurred and synthesized triterpenoid saponins, is used in China for liver disorders in humans. However, the underlying liver-protecting mechanisms remain largely unknown. Here, we found that treatment of rats with OA (25 mg/kg/day, gavage, once daily over 10 weeks diminished liquid fructose-induced excess hepatic triglyceride accumulation without effect on total energy intake. Attenuation of the increased vacuolization and Oil Red O staining area was evident on histological examination of liver in OA-treated rats. Hepatic gene expression profile demonstrated that OA suppressed fructose-stimulated overexpression of sterol regulatory element-binding protein-(SREBP- 1/1c mRNA and nuclear protein. In accord, overexpression of SREBP-1c-responsive genes responsible for fatty acid synthesis was also downregulated. In contrast, overexpressed nuclear protein of carbohydrate response element-binding protein and its target genes liver pyruvate kinase and microsomal triglyceride transfer protein were not altered. Additionally, OA did not affect expression of peroxisome proliferator-activated receptor-gamma- and -alpha and their target genes. It is concluded that modulation of hepatic SREBP-1c-mediated expression of the genes responsible for de novo fatty acid synthesis plays a pivotal role in OA-elicited diminishment of fructose-induced fatty liver in rats.

  16. The dark matter of the cancer genome: aberrations in regulatory elements, untranslated regions, splice sites, non-coding RNA and synonymous mutations.

    Science.gov (United States)

    Diederichs, Sven; Bartsch, Lorenz; Berkmann, Julia C; Fröse, Karin; Heitmann, Jana; Hoppe, Caroline; Iggena, Deetje; Jazmati, Danny; Karschnia, Philipp; Linsenmeier, Miriam; Maulhardt, Thomas; Möhrmann, Lino; Morstein, Johannes; Paffenholz, Stella V; Röpenack, Paula; Rückert, Timo; Sandig, Ludger; Schell, Maximilian; Steinmann, Anna; Voss, Gjendine; Wasmuth, Jacqueline; Weinberger, Maria E; Wullenkord, Ramona

    2016-01-01

    Cancer is a disease of the genome caused by oncogene activation and tumor suppressor gene inhibition. Deep sequencing studies including large consortia such as TCGA and ICGC identified numerous tumor-specific mutations not only in protein-coding sequences but also in non-coding sequences. Although 98% of the genome is not translated into proteins, most studies have neglected the information hidden in this "dark matter" of the genome. Malignancy-driving mutations can occur in all genetic elements outside the coding region, namely in enhancer, silencer, insulator, and promoter as well as in 5'-UTR and 3'-UTR Intron or splice site mutations can alter the splicing pattern. Moreover, cancer genomes contain mutations within non-coding RNA, such as microRNA, lncRNA, and lincRNA A synonymous mutation changes the coding region in the DNA and RNA but not the protein sequence. Importantly, oncogenes such as TERT or miR-21 as well as tumor suppressor genes such as TP53/p53, APC, BRCA1, or RB1 can be affected by these alterations. In summary, coding-independent mutations can affect gene regulation from transcription, splicing, mRNA stability to translation, and hence, this largely neglected area needs functional studies to elucidate the mechanisms underlying tumorigenesis. This review will focus on the important role and novel mechanisms of these non-coding or allegedly silent mutations in tumorigenesis.

  17. Executive function training with game elements for obese children: a novel treatment to enhance self-regulatory abilities for weight-control.

    Science.gov (United States)

    Verbeken, Sandra; Braet, Caroline; Goossens, Lien; van der Oord, Saskia

    2013-06-01

    For obese children behavioral treatment results in only small changes in relative weight and frequent relapse. The current study investigated the effects of an Executive Functioning (EF) training with game-elements on weight loss maintenance in obese children, over and above the care as usual in an inpatient treatment program. Forty-four children (aged 8-14 years) who were in the final months of a 10-months inpatient treatment program in a medical paediatric centre were randomized to either the 6 week EF-training condition or to a care as usual only control group. The EF-training consisted of a 25-session training of inhibition and working memory. Treatment outcomes were child performances on cognitive tasks of inhibition and working memory and childcare worker ratings on EF-symptoms as well as weight loss maintenance after leaving the clinic. Children in the EF-training condition showed significantly more improvement than the children in the care as usual only group on the working memory task as well as on the childcare worker reports of working memory and meta-cognition. They were also more capable to maintain their weight loss until 8 weeks post-training. This study shows promising evidence for the efficacy of an EF-training as weight stabilization intervention in obese children.

  18. Scanning sequences after Gibbs sampling to find multiple occurrences of functional elements

    Directory of Open Access Journals (Sweden)

    Landsman David

    2006-09-01

    Full Text Available Abstract Background Many DNA regulatory elements occur as multiple instances within a target promoter. Gibbs sampling programs for finding DNA regulatory elements de novo can be prohibitively slow in locating all instances of such an element in a sequence set. Results We describe an improvement to the A-GLAM computer program, which predicts regulatory elements within DNA sequences with Gibbs sampling. The improvement adds an optional "scanning step" after Gibbs sampling. Gibbs sampling produces a position specific scoring matrix (PSSM. The new scanning step resembles an iterative PSI-BLAST search based on the PSSM. First, it assigns an "individual score" to each subsequence of appropriate length within the input sequences using the initial PSSM. Second, it computes an E-value from each individual score, to assess the agreement between the corresponding subsequence and the PSSM. Third, it permits subsequences with E-values falling below a threshold to contribute to the underlying PSSM, which is then updated using the Bayesian calculus. A-GLAM iterates its scanning step to convergence, at which point no new subsequences contribute to the PSSM. After convergence, A-GLAM reports predicted regulatory elements within each sequence in order of increasing E-values, so users have a statistical evaluation of the predicted elements in a convenient presentation. Thus, although the Gibbs sampling step in A-GLAM finds at most one regulatory element per input sequence, the scanning step can now rapidly locate further instances of the element in each sequence. Conclusion Datasets from experiments determining the binding sites of transcription factors were used to evaluate the improvement to A-GLAM. Typically, the datasets included several sequences containing multiple instances of a regulatory motif. The improvements to A-GLAM permitted it to predict the multiple instances.

  19. Deletion of a conserved regulatory element required for Hmx1 expression in craniofacial mesenchyme in the dumbo rat: a newly identified cause of congenital ear malformation

    Directory of Open Access Journals (Sweden)

    Lely A. Quina

    2012-11-01

    Hmx1 is a homeodomain transcription factor expressed in the developing eye, peripheral ganglia, and branchial arches of avian and mammalian embryos. Recent studies have identified a loss-of-function allele at the HMX1 locus as the causative mutation in the oculo-auricular syndrome (OAS in humans, characterized by ear and eye malformations. The mouse dumbo (dmbo mutation, with similar effects on ear and eye development, also results from a loss-of-function mutation in the Hmx1 gene. A recessive dmbo mutation causing ear malformation in rats has been mapped to the chromosomal region containing the Hmx1 gene, but the nature of the causative allele is unknown. Here we show that dumbo rats and mice exhibit similar neonatal ear and eye phenotypes. In midgestation embryos, dumbo rats show a specific loss of Hmx1 expression in neural-crest-derived craniofacial mesenchyme (CM, whereas Hmx1 is expressed normally in retinal progenitors, sensory ganglia and in CM, which is derived from mesoderm. High-throughput resequencing of 1 Mb of rat chromosome 14 from dmbo/dmbo rats, encompassing the Hmx1 locus, reveals numerous divergences from the rat genomic reference sequence, but no coding changes in Hmx1. Fine genetic mapping narrows the dmbo critical region to an interval of ∼410 kb immediately downstream of the Hmx1 transcription unit. Further sequence analysis of this region reveals a 5777-bp deletion located ∼80 kb downstream in dmbo/dmbo rats that is not apparent in 137 other rat strains. The dmbo deletion region contains a highly conserved domain of ∼500 bp, which is a candidate distal enhancer and which exhibits a similar relationship to Hmx genes in all vertebrate species for which data are available. We conclude that the rat dumbo phenotype is likely to result from loss of function of an ultraconserved enhancer specifically regulating Hmx1 expression in neural-crest-derived CM. Dysregulation of Hmx1 expression is thus a candidate mechanism for congenital ear

  20. Regulatory Anatomy

    DEFF Research Database (Denmark)

    Hoeyer, Klaus

    2015-01-01

    This article proposes the term “safety logics” to understand attempts within the European Union (EU) to harmonize member state legislation to ensure a safe and stable supply of human biological material for transplants and transfusions. With safety logics, I refer to assemblages of discourses, le...... they arise. In short, I expose the regulatory anatomy of the policy landscape....

  1. Expression of the human granulocyte-macrophage colony stimulating factor (hGM-CSF) gene under control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a MAR element in transgenic mice.

    Science.gov (United States)

    Burkov, I A; Serova, I A; Battulin, N R; Smirnov, A V; Babkin, I V; Andreeva, L E; Dvoryanchikov, G A; Serov, O L

    2013-10-01

    Expression of the human granulocyte-macrophage colony-stimulating factor (hGM-CSF) gene under the control of the 5'-regulatory sequence of the goat alpha-S1-casein gene with and without a matrix attachment region (MAR) element from the Drosophila histone 1 gene was studied in four and eight transgenic mouse lines, respectively. Of the four transgenic lines carrying the transgene without MAR, three had correct tissues-specific expression of the hGM-CSF gene in the mammary gland only and no signs of cell mosaicism. The concentration of hGM-CSF in the milk of transgenic females varied from 1.9 to 14 μg/ml. One line presented hGM-CSF in the blood serum, indicating ectopic expression. The values of secretion of hGM-CSF in milk of 6 transgenic lines carrying the transgene with MAR varied from 0.05 to 0.7 μg/ml, and two of these did not express hGM-CSF. Three of the four examined animals from lines of this group showed ectopic expression of the hGM-CSF gene, as determined by RT-PCR and immunofluorescence analyses, as well as the presence of hGM-CSF in the blood serum. Mosaic expression of the hGM-CSF gene in mammary epithelial cells was specific to all examined transgenic mice carrying the transgene with MAR but was never observed in the transgenic mice without MAR. The mosaic expression was not dependent on transgene copy number. Thus, the expected "protective or enhancer effect" from the MAR element on the hGM-CSF gene expression was not observed.

  2. Regulatory facility guide for Ohio

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, S.S.; Bock, R.E.; Francis, M.W.; Gove, R.M.; Johnson, P.E.; Kovac, F.M.; Mynatt, J.O. [Oak Ridge National Lab., TN (United States); Rymer, A.C. [Transportation Consulting Services, Knoxville, TN (United States)

    1994-02-28

    The Regulatory Facility Guide (RFG) has been developed for the DOE and contractor facilities located in the state of Ohio. It provides detailed compilations of international, federal, and state transportation-related regulations applicable to shipments originating at destined to Ohio facilities. This RFG was developed as an additional resource tool for use both by traffic managers who must ensure that transportation operations are in full compliance with all applicable regulatory requirements and by oversight personnel who must verify compliance activities.

  3. A replication-time-controlling sequence element in Schizosaccharomyces pombe.

    Science.gov (United States)

    Tripathi, Vishnu P; Dubey, Dharani D

    2017-08-01

    Eukaryotic replication origins are highly variable in their activity and replication timing. The nature and role of cis-acting regulatory sequences that control chromosomal replication timing is not well defined. In the fission yeast, Schizosaccharomyces pombe, a 200-bp late-replication-enforcing element (LRE), has been shown to enforce late replication of ARS elements in plasmids. Here, we show that a short (133-bp) fragment of the LRE (shLRE) is required for causing late replication of adjoining origins in its native as well as in an ectopic early-replicating chromosomal location. Active from both sides of an early-replicating origin, the shLRE is a bona fide cis-acting regulatory element that imposes late replication timing in the chromosome.

  4. Dietary fiber prevents obesity-related liver lipotoxicity by modulating sterol-regulatory element binding protein pathway in C57BL/6J mice fed a high-fat/cholesterol diet.

    Science.gov (United States)

    Han, Shufen; Jiao, Jun; Zhang, Wei; Xu, Jiaying; Wan, Zhongxiao; Zhang, Weiguo; Gao, Xiaoran; Qin, Liqiang

    2015-10-29

    Adequate intake of dietary fibers has proven metabolic and cardiovascular benefits, molecular mechanisms remain still limited. This study was aimed to investigate the effects of cereal dietary fiber on obesity-related liver lipotoxicity in C57BL/6J mice fed a high-fat/cholesterol (HFC) diet and underlying mechanism. Forty-eight adult male C57BL/6J mice were randomly given a reference chow diet, or a high fat/cholesterol (HFC) diet supplemented with or without oat fiber or wheat bran fiber for 24 weeks. Our results showed mice fed oat or wheat bran fiber exhibited lower weight gain, lipid profiles and insulin resistance, compared with HFC diet. The two cereal dietary fibers potently decreased protein expressions of sterol regulatory element binding protein-1 and key factors involved in lipogenesis, including fatty acid synthase and acetyl-CoA carboxylase in target tissues. At molecular level, the two cereal dietary fibers augmented protein expressions of peroxisome proliferator-activated receptor alpha and gamma, liver X receptor alpha, and ATP-binding cassette transporter A1 in target tissues. Our findings indicated that cereal dietary fiber supplementation abrogated obesity-related liver lipotoxicity and dyslipidemia in C57BL/6J mice fed a HFC diet. In addition, the efficacy of oat fiber is greater than wheat bran fiber in normalizing these metabolic disorders and pathological profiles.

  5. Association of variants in the sterol regulatory element-binding factor 1 gene (SREBF1) with type 2 diabetes, glycemia, and insulin resistance - A study of 15,734 Danish subjects

    DEFF Research Database (Denmark)

    Grarup, Niels; Stender-Petersen, Kirstine L; Andersson, Ehm A

    2008-01-01

    Objective: We evaluated association of variants in the sterol regulatory element-binding factor 1 gene (SREBF1) with type 2 diabetes. Due to the previous inconclusive quantitative trait associations, we also did studies of intermediate quantitative phenotypes. Research design and methods: We...... genotyped four variants in SREBF1 in the population-based Inter99 cohort (n=6,070), the Danish ADDITION study (n=8,662) and in additional type 2 diabetic patients (n=1,002). The case-control studies involved 2,980 type 2 diabetic patients and 4,522 glucose-tolerant subjects. Results: The minor alleles...... of the rs2297508, rs11868035 and rs1889018 (linkage disequilibrium R(2)=0.6-0.8) associated with a modestly increased risk of type 2 diabetes (rs2297508: OR 1.17 [95% CI 1.05-1.30], P=0.003) which was confirmed in meta-analyses of all published studies (rs2297508 G-allele: OR 1.08 [1.03-1.14] per allele, P...

  6. Effects of Stearoyl-CoA Desaturase 1 and Sterol Regulatory Element Binding Protein Gene Polymorphisms on Milk Production, Composition and Coagulation Properties of Individual Milk of Brown Swiss Cows

    Directory of Open Access Journals (Sweden)

    Alice Maurmayr

    2011-10-01

    Full Text Available Associations between stearoyl-CoA desaturase (SCD and sterol regulatory element binding protein (SREBP-1 gene polymorphisms and milk production, composition (fat, protein, and casein content, acidity (pH and titratable acidity and coagulation properties (MCP, namely rennet coagulation time (RCT, min and curd firmness (a30, mm were investigated on individual Brown Swiss milk. A total of 294 cows from 16 herds and progeny of 15 sires were milk-sampled once. Th e additive effects of SCD and SREBP-1 genotypes on the aforementioned traits were analyzed through Bayesian linear models. The SCD gene was associated with protein content, casein content and a30. Lower protein, casein and a30 was observed for milk yielded by SCD V than A cows, whereas for other traits the effect was trivial. Animals carrying the L allele of SREBP-1 showed higher fat content than animals carrying the S allele. These results suggest a possible use of these loci in gene-assisted selection programs for the improvement of milk quality traits and MCP in Brown Swiss cattle, although large scale studies in different breeds are required.

  7. Effects of Stearoyl-CoA Desaturase 1 and Sterol Regulatory Element Binding Protein Gene Polymorphisms on Milk Production, Composition and Coagulation Properties of Individual Milk of Brown Swiss Cows

    Directory of Open Access Journals (Sweden)

    Alice Maurmayr

    2011-09-01

    Full Text Available Associations between stearoyl-CoA desaturase (SCD and sterol regulatory element binding protein (SREBP-1 gene polymorphisms and milk production, composition (fat, protein, and casein content, acidity (pH and titratable acidity and coagulation properties (MCP, namely rennet coagulation time (RCT, min and curd firmness (a30, mm were investigated on individual Brown Swiss milk. A total of 294 cows from 16 herds and progeny of 15 sires were milk-sampled once. Th e additive effects of SCD and SREBP-1 genotypes on the aforementioned traits were analyzed through Bayesian linear models. The SCD gene was associated with protein content, casein content and a30. Lower protein, casein and a30 was observed for milk yielded by SCD V than A cows, whereas for other traits the effect was trivial. Animals carrying the L allele of SREBP-1 showed higher fat content than animals carrying the S allele. These results suggest a possible use of these loci in gene-assisted selection programs for the improvement of milk quality traits and MCP in Brown Swiss cattle, although large scale studies in different breeds are required.

  8. Dsc E3 ligase localization to the Golgi requires the ATPase Cdc48 and cofactor Ufd1 for activation of Sterol Regulatory Element-binding Protein in fission yeast.

    Science.gov (United States)

    Burr, Risa; Ribbens, Diedre; Raychaudhuri, Sumana; Stewart, Emerson V; Ho, Jason; Espenshade, Peter J

    2017-08-18

    Sterol regulatory element-binding proteins (SREBPs) in the fission yeast Schizosaccharomyces pombe regulate lipid homeostasis and the hypoxic response under conditions of low sterol or oxygen availability. SREBPs are cleaved in the Golgi through the combined action of the Dsc E3 ligase complex, the rhomboid protease Rbd2, and the essential ATPases Associated with diverse cellular Activities (AAA+) ATPase Cdc48. The soluble SREBP N-terminal transcription factor domain is then released in the cytosol to enter the nucleus and regulate gene expression. Previously, we reported that Cdc48 binding to Rbd2 is required for Rbd2-mediated SREBP cleavage. Here, using affinity chromatography and mass spectrometry experiments, we identified Cdc48-binding proteins in S. pombe, generating a list of many previously unknown potential Cdc48 binding partners. We show that the established Cdc48 cofactor Ufd1 is required for SREBP cleavage but does not interact with the Cdc48-Rbd2 complex. Cdc48-Ufd1 is instead required at a step prior to Rbd2 function, during Golgi localization of the Dsc E3 ligase complex. Together, these findings demonstrate that two distinct Cdc48 complexes - Cdc48-Ufd1 and Cdc48-Rbd2 - are required for SREBP activation and low-oxygen adaptation in S. pombe. Copyright © 2017, The American Society for Biochemistry and Molecular Biology.

  9. Location - Managed Facility - St. Paul District (MVP)

    Data.gov (United States)

    Army Corps of Engineers, Department of the Army, Department of Defense — St. Paul District - US Army Corps of Engineers Managed Facility locations. District headquarters, Natural Resource, Recreation, Lock and Dam, and Regulatory offices...

  10. Effects of a low severity prescribed fire on water-soluble elements in ash from a cork oak (Quercus suber) forest located in the northeast of the Iberian Peninsula

    Science.gov (United States)

    Pereira, P.; beda, X.; Martin, D.; Mataix-Solera, J.; Guerrero, C.

    2011-01-01

    Wildfire is the major disturbance in Mediterranean forests. Prescribed fire can be an alternative to reduce the amount of fuel and hence decrease the wildfire risk. However the effects of prescribed fire must be studied, especially on ash properties, because ash is an important nutrient source for ecosystem recovery. The aim of this study is to determine the effects of a low severity prescribed fire on water-soluble elements in ash including pH, electrical conductivity (EC), calcium (Ca), magnesium (Mg), sodium (Na), potassium (K), aluminum (Al), manganese (Mn), iron (Fe), zinc (Zn), silica (SiO2) and total sulphur (TS). A prescribed fire was conducted in a cork oak (Quercus suber) (Q.S) forest located in the northeast part of the Iberian Peninsula. Samples were collected from a flat plot of 40??70m mainly composed of Q.S and Quercus robur (Q.R) trees. In order to understand the effects of the prescribed fire on the soluble elements in ash, we conducted our data analysis on three data groups: all samples, only Q.S samples and only Q.R samples. All three sample groups exhibited a significant increase in pH, EC (pwater-soluble Ca, Mg, Na, SiO2 and TS and a decrease in water-soluble Mn, Fe and Zn. Differences were identified between oak species for water-soluble K, Al and Fe. In Q.S samples we registered a significant increase in the first two elements pwater-soluble K and Al and a significant decrease in water-soluble Fe (psamples, that at some points burned with higher severity. The increase of pH, EC, Ca, Mg, Na and K will improve soil fertility, mainly in the study area where soils are acidic. The application of this low severity prescribed fire will improve soil nutrient status without causing soil degradation and thus is considered to be a good management strategy. ?? 2010 Elsevier Inc.

  11. Research and Application of Fuzzy Matter Element Method in Distribution Center Location%基于模糊物元法的配送中心选址研究与应用

    Institute of Scientific and Technical Information of China (English)

    魏波; 陈进军

    2016-01-01

    配送中心是物流系统中的一个重要环节,配送中心的功能决定了其地址选择决策对整个物流系统的运作效率、经营成本以及服务水平产生重大影响。文中将模糊物元法应用于配送中心选址决策中,从物流环境、交通便利程度、响应时间、运输成本、建设成本、配送线路数量等方面进行选址决策,最后通过实例进行计算。%Distribution center is an important part of logistics system,and its function determines that its address selection decision have a significant impact on operational efficiency,operating costs and service level of the whole logistic system.This pa-per employs fuzzy matter-element method to locate logistics centers in the fields of logistics environment,transportation conven-ience,response time,transportation costs,construction costs,the number of distribution lines and so on,and finally ends with cal-culating examples.

  12. The C/ebp-Atf response element (CARE) location reveals two distinct Atf4-dependent, elongation-mediated mechanisms for transcriptional induction of aminoacyl-tRNA synthetase genes in response to amino acid limitation.

    Science.gov (United States)

    Shan, Jixiu; Zhang, Fan; Sharkey, Jason; Tang, Tiffany A; Örd, Tönis; Kilberg, Michael S

    2016-11-16

    The response to amino acid (AA) limitation of the entire aminoacyl-tRNA synthetase (ARS) gene family revealed that 16/20 of the genes encoding cytoplasmic-localized enzymes are transcriptionally induced by activating transcription factor 4 (Atf4) via C/ebp-Atf-Response-Element (CARE) enhancers. In contrast, only 4/19 of the genes encoding mitochondrial-localized ARSs were weakly induced. Most of the activated genes have a functional CARE near the transcription start site (TSS), but for others the CARE is downstream. Regardless of the location of CARE enhancer, for all ARS genes there was constitutive association of RNA polymerase II (Pol II) and the general transcription machinery near the TSS. However, for those genes with a downstream CARE, Atf4, C/ebp-homology protein (Chop), Pol II and TATA-binding protein exhibited enhanced recruitment to the CARE during AA limitation. Increased Atf4 binding regulated the association of elongation factors at both the promoter and the enhancer regions, and inhibition of cyclin-dependent kinase 9 (CDK9), that regulates these elongation factors, blocked induction of the AA-responsive ARS genes. Protein pull-down assays indicated that Atf4 directly interacts with CDK9 and its associated protein cyclin T1. The results demonstrate that AA availability modulates the ARS gene family through modulation of transcription elongation. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. [Bacteriophage λ: electrostatic properties of the genome and its elements].

    Science.gov (United States)

    Krutinina, G G; Krutinin, E A; Kamzolova, S G; Osypov, A A

    2015-01-01

    Bacteriophage λ is a classical model object in molecular biology, but little is still known on the physical properties of its DNA and regulatory elements. A study was made of the electrostatic properties of phage λ DNA and regulatory elements. A global electrostatic potential distribution along the phage genome was found to be nonuniform with main regulatory elements being located in a limited region with a high potential. The RNA polymerase binding frequency on the linearized phage chromosome directly correlates with its local potential. Strong promoters of the phage and its host Escherichia coli have distinct electrostatic upstream elements, which differ in nucleotide sequence. Attachment and recombination sites of phage λ and its host have a higher potential, which possibly facilitates their recognition by integrase. Phage λ and host Rho-independent terminators have a symmetrical M-shaped potential profile, which only slightly depends on the annotated terminator palindrome length, and occur in a region with a substantially higher potential, which may cause polymerase retention, facilitating the formation of a terminator hairpin in RNA. It was concluded that virtually all elements of phage λ genome have potential distribution specifics, which are related to their structural properties and may play a role in their biological function. The global potential distribution along the phage genome reflects the architecture of the regulation of its transcription and integration in the host genome.

  14. Caloric restriction-associated remodeling of rat white adipose tissue: effects on the growth hormone/insulin-like growth factor-1 axis, sterol regulatory element binding protein-1, and macrophage infiltration.

    Science.gov (United States)

    Chujo, Yoshikazu; Fujii, Namiki; Okita, Naoyuki; Konishi, Tomokazu; Narita, Takumi; Yamada, Atsushi; Haruyama, Yushi; Tashiro, Kosuke; Chiba, Takuya; Shimokawa, Isao; Higami, Yoshikazu

    2013-08-01

    The role of the growth hormone (GH)-insulin-like growth factor (IGF)-1 axis in the lifelong caloric restriction (CR)-associated remodeling of white adipose tissue (WAT), adipocyte size, and gene expression profiles was explored in this study. We analyzed the WAT morphology of 6-7-month-old wild-type Wistar rats fed ad libitum (WdAL) or subjected to CR (WdCR), and of heterozygous transgenic dwarf rats bearing an anti-sense GH transgene fed ad libitum (TgAL) or subjected to CR (TgCR). Although less effective in TgAL, the adipocyte size was significantly reduced in WdCR compared with WdAL. This CR effect was blunted in Tg rats. We also used high-density oligonucleotide microarrays to examine the gene expression profile of WAT of WdAL, WdCR, and TgAL rats. The gene expression profile of WdCR, but not TgAL, differed greatly from that of WdAL. The gene clusters with the largest changes induced by CR but not by Tg were genes involved in lipid biosynthesis and inflammation, particularly sterol regulatory element binding proteins (SREBPs)-regulated and macrophage-related genes, respectively. Real-time reverse-transcription polymerase chain reaction analysis confirmed that the expression of SREBP-1 and its downstream targets was upregulated, whereas the macrophage-related genes were downregulated in WdCR, but not in TgAL. In addition, CR affected the gene expression profile of Tg rats similarly to wild-type rats. Our findings suggest that CR-associated remodeling of WAT, which involves SREBP-1-mediated transcriptional activation and suppression of macrophage infiltration, is regulated in a GH-IGF-1-independent manner.

  15. A novel sterol regulatory element-binding protein gene (sreA identified in penicillium digitatum is required for prochloraz resistance, full virulence and erg11 (cyp51 regulation.

    Directory of Open Access Journals (Sweden)

    Jing Liu

    Full Text Available Penicillium digitatum is the most destructive postharvest pathogen of citrus fruits, causing fruit decay and economic loss. Additionally, control of the disease is further complicated by the emergence of drug-resistant strains due to the extensive use of triazole antifungal drugs. In this work, an orthologus gene encoding a putative sterol regulatory element-binding protein (SREBP was identified in the genome of P. digitatum and named sreA. The putative SreA protein contains a conserved domain of unknown function (DUF2014 at its carboxyl terminus and a helix-loop-helix (HLH leucine zipper DNA binding domain at its amino terminus, domains that are functionally associated with SREBP transcription factors. The deletion of sreA (ΔsreA in a prochloraz-resistant strain (PdHS-F6 by Agrobacterium tumefaciens-mediated transformation led to increased susceptibility to prochloraz and a significantly lower EC50 value compared with the HS-F6 wild-type or complementation strain (COsreA. A virulence assay showed that the ΔsreA strain was defective in virulence towards citrus fruits, while the complementation of sreA could restore the virulence to a large extent. Further analysis by quantitative real-time PCR demonstrated that prochloraz-induced expression of cyp51A and cyp51B in PdHS-F6 was completely abolished in the ΔsreA strain. These results demonstrate that sreA is a critical transcription factor gene required for prochloraz resistance and full virulence in P. digitatum and is involved in the regulation of cyp51 expression.

  16. A novel sterol regulatory element-binding protein gene (sreA) identified in penicillium digitatum is required for prochloraz resistance, full virulence and erg11 (cyp51) regulation.

    Science.gov (United States)

    Liu, Jing; Yuan, Yongze; Wu, Zhi; Li, Na; Chen, Yuanlei; Qin, Tingting; Geng, Hui; Xiong, Li; Liu, Deli

    2015-01-01

    Penicillium digitatum is the most destructive postharvest pathogen of citrus fruits, causing fruit decay and economic loss. Additionally, control of the disease is further complicated by the emergence of drug-resistant strains due to the extensive use of triazole antifungal drugs. In this work, an orthologus gene encoding a putative sterol regulatory element-binding protein (SREBP) was identified in the genome of P. digitatum and named sreA. The putative SreA protein contains a conserved domain of unknown function (DUF2014) at its carboxyl terminus and a helix-loop-helix (HLH) leucine zipper DNA binding domain at its amino terminus, domains that are functionally associated with SREBP transcription factors. The deletion of sreA (ΔsreA) in a prochloraz-resistant strain (PdHS-F6) by Agrobacterium tumefaciens-mediated transformation led to increased susceptibility to prochloraz and a significantly lower EC50 value compared with the HS-F6 wild-type or complementation strain (COsreA). A virulence assay showed that the ΔsreA strain was defective in virulence towards citrus fruits, while the complementation of sreA could restore the virulence to a large extent. Further analysis by quantitative real-time PCR demonstrated that prochloraz-induced expression of cyp51A and cyp51B in PdHS-F6 was completely abolished in the ΔsreA strain. These results demonstrate that sreA is a critical transcription factor gene required for prochloraz resistance and full virulence in P. digitatum and is involved in the regulation of cyp51 expression.

  17. Direct inhibition of the ubiquitin-proteasome pathway by ester bond-containing green tea polyphenols is associated with increased expression of sterol regulatory element-binding protein 2 and LDL receptor.

    Science.gov (United States)

    Kuhn, Deborah J; Burns, Audrey C; Kazi, Aslamuzzaman; Dou, Q Ping

    2004-06-01

    Green tea has been shown to lower plasma cholesterol, associated with up-regulation of the low-density lipoprotein receptor (LDLR) although the responsible molecular mechanism is unknown. Previously, we reported that ester bond-containing green tea polyphenols (GTPs), such as (-)-epigallocatechin-3-gallate [(-)-EGCG], potently inhibit the tumor cellular proteasome activity, which may contribute to the cancer-preventative effect of green tea. In the current study, we hypothesize that the proteasome is a heart disease-associated molecular target of GTPs. We have shown that ester bond-containing GTPs, including (-)-EGCG, potently inhibit the proteasomal activity in intact hepatocellular carcinoma HepG2 and cervical carcinoma HeLa cells, as evident by accumulation of ubiquitinated proteins and three natural proteasome targets (p27, IkappaB-alpha and Bax). (-)-EGCG selectively inhibits the chymotrypsin-like, but not trypsin-like, activity of the proteasome. Associated with proteasome inhibition by ester bond-containing GTPs, there was a significant, time- and concentration-dependent increase in levels of the cleaved, activated, but not the precursor, form of sterol regulatory element-binding protein 2 (SREBP-2), an essential factor for LDLR transcription. Subsequently, LDL receptor expression was increased dramatically in HepG2 and HeLa cells treated with (-)-EGCG. Our results suggest that ester bond-containing GTPs inhibit ubiquitin/proteasome-mediated degradation of the active SREBP-2, resulting in up-regulation of LDLR. This identified molecular mechanism may be related to the previously reported cholesterol-lowering and heart disease-preventative effects of green tea.

  18. Genetic flexibility of regulatory networks.

    Science.gov (United States)

    Hunziker, Alexander; Tuboly, Csaba; Horváth, Péter; Krishna, Sandeep; Semsey, Szabolcs

    2010-07-20

    Gene regulatory networks are based on simple building blocks such as promoters, transcription factors (TFs) and their binding sites on DNA. But how diverse are the functions that can be obtained by different arrangements of promoters and TF binding sites? In this work we constructed synthetic regulatory regions using promoter elements and binding sites of two noninteracting TFs, each sensing a single environmental input signal. We show that simply by combining these three kinds of elements, we can obtain 11 of the 16 Boolean logic gates that integrate two environmental signals in vivo. Further, we demonstrate how combination of logic gates can result in new logic functions. Our results suggest that simple elements of transcription regulation form a highly flexible toolbox that can generate diverse functions under natural selection.

  19. Using hexamers to predict cis-regulatory motifs in Drosophila

    Directory of Open Access Journals (Sweden)

    Kibler Dennis

    2005-10-01

    Full Text Available Abstract Background Cis-regulatory modules (CRMs are short stretches of DNA that help regulate gene expression in higher eukaryotes. They have been found up to 1 megabase away from the genes they regulate and can be located upstream, downstream, and even within their target genes. Due to the difficulty of finding CRMs using biological and computational techniques, even well-studied regulatory systems may contain CRMs that have not yet been discovered. Results We present a simple, efficient method (HexDiff based only on hexamer frequencies of known CRMs and non-CRM sequence to predict novel CRMs in regulatory systems. On a data set of 16 gap and pair-rule genes containing 52 known CRMs, predictions made by HexDiff had a higher correlation with the known CRMs than several existing CRM prediction algorithms: Ahab, Cluster Buster, MSCAN, MCAST, and LWF. After combining the results of the different algorithms, 10 putative CRMs were identified and are strong candidates for future study. The hexamers used by HexDiff to distinguish between CRMs and non-CRM sequence were also analyzed and were shown to be enriched in regulatory elements. Conclusion HexDiff provides an efficient and effective means for finding new CRMs based on known CRMs, rather than known binding sites.

  20. Identification of a Positive Cis-Element Upstream of Human NKX3.1 Gene

    Institute of Scientific and Technical Information of China (English)

    An-Li JIANG; Peng-Ju ZHANG; Xiao-Yan HU; Wei-Wen CHEN; Feng KONG; Zhi-Fang LIU; Hui-Qing YUAN; Jian-Ye ZHANG

    2005-01-01

    NKX3.1 is a prostate-specific homeobox gene related to prostate development and prostate cancer. In this work, we aimed to identify precisely the functional cis-element in the 197 bp region (from -1032 to -836 bp) of the NKX3.1 promoter (from -1032 to +8 bp), which was previously identified to present positive regulatory activity on NKX3.1 expression, by deletion mutagenesis analysis and electrophoretic mobility shift assay (EMSA). A 16 bp positive cis-element located between -920 and -905 bp upstream of the NKX3.1 gene was identified by deletion mutation analysis and proved to be a functional positive cis-element by EMSA. It will be important to further study the functions and regulatory mechanisms of this positive cis-element in NKX3.1 gene expression.

  1. Molecular structural and functional characterization of STAT1 gene regulatory region in teleost Channa argus.

    Science.gov (United States)

    Jia, Weizhang; Zhou, Xiuxia

    2010-05-15

    The transcription factor STAT1 is involved in signal transduction of type I and II interferons (IFNs). However, the molecular characteristics of the STAT1 regulatory region still remain to be elucidated in teleosts. In the present study, the complete cDNA and the regulatory region of the STAT1 gene were isolated from snakehead (Channa argus). More than 2.4kb 5'-flanking region of STAT1 shares the regulatory elements of IFN-stimulated response element (ISRE) and IFN-gamma activation site (GAS). Consensus ISRE and GAS were located from -373 to -361 and -716 to -724 in the promoter region, respectively. Moreover, it is noticeable that the crucial elements of ISRE (+698 to +710) and GAS (+294 and +301) are present in the first intron of snakehead STAT1. Comparisons of six vertebrate STAT1 5'-flanking regions all present the common sequence characteristics of IFN-induced gene promoter, which include ISRE, GAS and Sp1 sites. In order to further characterize the snakehead STAT1 regulatory region, six reporter constructs of snakehead STAT1 promoter and first intron were generated to examine the specificity to human interferon-gamma (hIFN-gamma). Only those constructs containing the ISRE element showed notable reporter activity after stimulation of Hela cells with hIFN-gamma. However, sequential deletions of putative transcription factor binding sites indicated that GAS elements have little effect on the promoter and intronic activity in response to hIFN-gamma. Taken together, these results suggest that the regulatory mechanisms of IFN-signalling appear to be mediated in a similar manner in fish and mammals.

  2. Regulatory RNAs in prokaryotes: here, there and everywhere.

    Science.gov (United States)

    Narberhaus, Franz; Vogel, Jörg

    2009-10-01

    A recent meeting on 'Regulatory RNAs in prokaryotes' reflected the growing interest in this research topic. Almost 200 scientists met to discuss the identification, structure, function and mechanistic details of regulatory RNAs in bacteria and archaea. The topics included small regulatory RNAs, riboswitches, RNA thermosensors and CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) elements.

  3. Expression of sterol regulatory element-binding transcription factor (SREBF 2 and SREBF cleavage-activating protein (SCAP in human atheroma and the association of their allelic variants with sudden cardiac death

    Directory of Open Access Journals (Sweden)

    Kytömäki Leena

    2008-12-01

    Full Text Available Abstract Background Disturbed cellular cholesterol homeostasis may lead to accumulation of cholesterol in human atheroma plaques. Cellular cholesterol homeostasis is controlled by the sterol regulatory element-binding transcription factor 2 (SREBF-2 and the SREBF cleavage-activating protein (SCAP. We investigated whole genome expression in a series of human atherosclerotic samples from different vascular territories and studied whether the non-synonymous coding variants in the interacting domains of two genes, SREBF-2 1784G>C (rs2228314 and SCAP 2386A>G, are related to the progression of coronary atherosclerosis and the risk of pre-hospital sudden cardiac death (SCD. Methods Whole genome expression profiling was completed in twenty vascular samples from carotid, aortic and femoral atherosclerotic plaques and six control samples from internal mammary arteries. Three hundred sudden pre-hospital deaths of middle-aged (33–69 years Caucasian Finnish men were subjected to detailed autopsy in the Helsinki Sudden Death Study. Coronary narrowing and areas of coronary wall covered with fatty streaks or fibrotic, calcified or complicated lesions were measured and related to the SREBF-2 and SCAP genotypes. Results Whole genome expression profiling showed a significant (p = 0.02 down-regulation of SREBF-2 in atherosclerotic carotid plaques (types IV-V, but not in the aorta or femoral arteries (p = NS for both, as compared with the histologically confirmed non-atherosclerotic tissues. In logistic regression analysis, a significant interaction between the SREBF-2 1784G>C and the SCAP 2386A>G genotype was observed on the risk of SCD (p = 0.046. Men with the SREBF-2 C allele and the SCAP G allele had a significantly increased risk of SCD (OR 2.68, 95% CI 1.07–6.71, compared to SCAP AA homologous subjects carrying the SREBF-2 C allele. Furthermore, similar trends for having complicated lesions and for the occurrence of thrombosis were found, although the

  4. Association of sterol regulatory element binding protein 2 and insulin-like growth factor binding protein 3 genetic polymorphisms with avascular necrosis of the femoral head in the Chinese population

    Institute of Scientific and Technical Information of China (English)

    SONG Yang; DU Zhen-wu; LI Qiu-ju; ZHANG Gui-zhen; WANG Ling-ling; WU Ning; WANG Jin-cheng; GAO Zhong-li

    2012-01-01

    Background Sterol regulatory element binding protein(SREBP)-2 plays a key role in lipid homeostasis by stimulating gene expression of cholesterol biosynthetic pathways.The insulin-like growth factor binding protein(IGFBP)family regulates growth and metabolism,especially bone cell metabolism,and correlates with osteonecrosis.However,association of their gene polymorphisms with risk of avascular necrosis of the femoral head(ANFH)has rarely been reported.We determined whether SREBP-2 and IGFBP-3 gene polymorphisms were associated with increased ANFH risk in the Chinese population.Methods Two single nucleotide polymorphisms of SREBP2 gene,rs2267439 and rs2267443,and one of IGFBP-3 gene,rs2453839,were selected and genotyped in 49 ANFH patients and 42 control individuals by direct sequencing assay.Results The frequencies of rs2267439 TT and rs2267443 GA of SREBP2 and rs2453839 TT and CT of IGFBP-3 in the ANFH group showed increased and decreased tendencies(against normal control group),respectively.Interaction analysis of genes revealed that the frequency of carrying rs2267439 TT and rs2267443 GA genctypes of SREBF-2 in ANFH patients was significantly higher than in the control group(P<0.05).Association analysis between polymorphisms and clinical phenotype demonstrated that the disease course in ANFH patients with the rs2453839 TT genotype of IGFBP-3 was significantly shorter than that of CT+CC carriers(P<0.01).CT+CC genotype frequency in patients with stage Ⅲ/Ⅳ?bilateral hip lesions was significantly higher than in those with stage Ⅲ/Ⅳ?unilateral lesions and stage Ⅱ/Ⅲ?bilateral lesions(P<0.05-0.02).Conclusions Our results suggested that interaction of SREBP-2 gene polymorphisms and the relationship between the polymorphisms and clinical phenotype of IGFBP-3 were closely related to increased ANFH risk in the Chinese population.The most significant finding was that the CT+CC genotype carriers of IGFBP-3 rs2453839 were highly associated with the

  5. Functional interaction of hepatic nuclear factor-4 and peroxisome proliferator-activated receptor-gamma coactivator 1alpha in CYP7A1 regulation is inhibited by a key lipogenic activator, sterol regulatory element-binding protein-1c.

    Science.gov (United States)

    Ponugoti, Bhaskar; Fang, Sungsoon; Kemper, Jongsook Kim

    2007-11-01

    Insulin inhibits transcription of cholesterol 7alpha-hydroxylase (Cyp7a1), a key gene in bile acid synthesis, and the hepatic nuclear factor-4 (HNF-4) site in the promoter was identified as a negative insulin response sequence. Using a fasting/feeding protocol in mice and insulin treatment in HepG2 cells, we explored the inhibition mechanisms. Expression of sterol regulatory element-binding protein-1c (SREBP-1c), an insulin-induced lipogenic factor, inversely correlated with Cyp7a1 expression in mouse liver. Interaction of HNF-4 with its coactivator, peroxisome proliferator-activated receptor-gamma coactivator 1alpha (PGC-1alpha), was observed in livers of fasted mice and was reduced after feeding. Conversely, HNF-4 interaction with SREBP-1c was increased after feeding. In vitro studies suggested that SREBP-1c competed with PGC-1alpha for direct interaction with the AF2 domain of HNF-4. Reporter assays showed that SREBP-1c, but not of a SREBP-1c mutant lacking the HNF-4 interacting domain, inhibited HNF-4/PGC-1alpha transactivation of Cyp7a1. SREBP-1c also inhibited PGC-1alpha-coactivation of estrogen receptor, constitutive androstane receptor, pregnane X receptor, and farnesoid X receptor, implying inhibition of HNF-4 by SREBP-1c could extend to other nuclear receptors. In chromatin immunoprecipitation studies, HNF-4 binding to the promoter was not altered, but PGC-1alpha was dissociated, SREBP-1c and histone deacetylase-2 (HDAC2) were recruited, and acetylation of histone H3 was decreased upon feeding. Adenovirus-mediated expression of a SREBP-1c dominant-negative mutant, which blocks the interaction of SREBP-1c and HNF-4, partially but significantly reversed the inhibition of Cyp7a1 after feeding. Our data show that SREBP-1c functions as a non-DNA-binding inhibitor and mediates, in part, suppression of Cyp7a1 by blocking functional interaction of HNF-4 and PGC-1alpha. This mechanism may be relevant to known repression of many other HNF-4 target genes upon

  6. The IgH locus 3' regulatory region: pulling the strings from behind.

    Science.gov (United States)

    Pinaud, Eric; Marquet, Marie; Fiancette, Rémi; Péron, Sophie; Vincent-Fabert, Christelle; Denizot, Yves; Cogné, Michel

    2011-01-01

    Antigen receptor gene loci are among the most complex in mammals. The IgH locus, encoding the immunoglobulin heavy chain (IgH) in B-lineage cells, undergoes major transcription-dependent DNA remodeling events, namely V(D)J recombination, Ig class-switch recombination (CSR), and somatic hypermutation (SHM). Various cis-regulatory elements (encompassing promoters, enhancers, and chromatin insulators) recruit multiple nuclear factors in order to ensure IgH locus regulation by tightly orchestrated physical and/or functional interactions. Among major IgH cis-acting regions, the large 3' regulatory region (3'RR) located at the 3' boundary of the locus includes several enhancers and harbors an intriguing quasi-palindromic structure. In this review, we report progress insights made over the past decade in order to describe in more details the structure and functions of IgH 3'RRs in mouse and human. Generation of multiple cellular, transgenic and knock-out models helped out to decipher the function of the IgH 3' regulatory elements in the context of normal and pathologic B cells. Beside its interest in physiology, the challenge of elucidating the locus-wide cross talk between distant cis-regulatory elements might provide useful insights into the mechanisms that mediate oncogene deregulation after chromosomal translocations onto the IgH locus.

  7. Functional validation of a constitutive autonomous silencer element.

    Directory of Open Access Journals (Sweden)

    Heyuan Qi

    Full Text Available Sequences of the genome that are capable of silencing gene expression are thought to play a key role in gene regulation. However, very few silencer elements capable of functioning in mammalian cells have been described, and only a fraction of these have been tested for the ability to function in an autonomous fashion. We report here the characterization and functional validation of a constitutive autonomous silencer element from the human genome called T39, and the comparison of T39 to three other putative silencer elements previously described by others. Functional analysis included one assay for enhancer-blocking insulator activity and two independent assays for silencer activity, all based on stable transfection and comparison to a neutral spacer control. In erythroid K562 cells, T39 exhibited potent silencer activity, the previously described element PRE2-S5 exhibited modest silencer activity, and the two other previously described elements exhibited no silencer activity. T39 was further found to be capable of silencing three disparate promoters, of silencing gene expression in three disparate cell lines, and of functioning as a single copy in a topology-independent manner. Of the four elements analyzed, only T39 exhibits a constitutive pattern of DNase hypersensitivity and binding by CTCF. In its native location the T39 element also exhibits a unique interaction profile with a subset of distal putative regulatory elements. Taken together, these studies validate T39 as a constitutive autonomous silencer, identify T39 as a defined control for future studies of other regulatory elements such as insulators, and provide a basic chromatin profile for one highly potent silencer element.

  8. The core regulatory network in human cells.

    Science.gov (United States)

    Kim, Man-Sun; Kim, Dongsan; Kang, Nam Sook; Kim, Jeong-Rae

    2017-03-04

    In order to discover the common characteristics of various cell types in the human body, many researches have been conducted to find the set of genes commonly expressed in various cell types and tissues. However, the functional characteristics of a cell is determined by the complex regulatory relationships among the genes rather than by expressed genes themselves. Therefore, it is more important to identify and analyze a core regulatory network where all regulatory relationship between genes are active across all cell types to uncover the common features of various cell types. Here, based on hundreds of tissue-specific gene regulatory networks constructed by recent genome-wide experimental data, we constructed the core regulatory network. Interestingly, we found that the core regulatory network is organized by simple cascade and has few complex regulations such as feedback or feed-forward loops. Moreover, we discovered that the regulatory links from genes in the core regulatory network to genes in the peripheral regulatory network are much more abundant than the reverse direction links. These results suggest that the core regulatory network locates at the top of regulatory network and plays a role as a 'hub' in terms of information flow, and the information that is common to all cells can be modified to achieve the tissue-specific characteristics through various types of feedback and feed-forward loops in the peripheral regulatory networks. We also found that the genes in the core regulatory network are evolutionary conserved, essential and non-disease, non-druggable genes compared to the peripheral genes. Overall, our study provides an insight into how all human cells share a common function and generate tissue-specific functional traits by transmitting and processing information through regulatory network.

  9. Conservation and implications of eukaryote transcriptional regulatory regions across multiple species

    Directory of Open Access Journals (Sweden)

    Deng Minghua

    2008-12-01

    Full Text Available Abstract Background Increasing evidence shows that whole genomes of eukaryotes are almost entirely transcribed into both protein coding genes and an enormous number of non-protein-coding RNAs (ncRNAs. Therefore, revealing the underlying regulatory mechanisms of transcripts becomes imperative. However, for a complete understanding of transcriptional regulatory mechanisms, we need to identify the regions in which they are found. We will call these transcriptional regulation regions, or TRRs, which can be considered functional regions containing a cluster of regulatory elements that cooperatively recruit transcriptional factors for binding and then regulating the expression of transcripts. Results We constructed a hierarchical stochastic language (HSL model for the identification of core TRRs in yeast based on regulatory cooperation among TRR elements. The HSL model trained based on yeast achieved comparable accuracy in predicting TRRs in other species, e.g., fruit fly, human, and rice, thus demonstrating the conservation of TRRs across species. The HSL model was also used to identify the TRRs of genes, such as p53 or OsALYL1, as well as microRNAs. In addition, the ENCODE regions were examined by HSL, and TRRs were found to pervasively locate in the genomes. Conclusion Our findings indicate that 1 the HSL model can be used to accurately predict core TRRs of transcripts across species and 2 identified core TRRs by HSL are proper candidates for the further scrutiny of specific regulatory elements and mechanisms. Meanwhile, the regulatory activity taking place in the abundant numbers of ncRNAs might account for the ubiquitous presence of TRRs across the genome. In addition, we also found that the TRRs of protein coding genes and ncRNAs are similar in structure, with the latter being more conserved than the former.

  10. Regulatory Expectations for Safety Culture

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Su Jin; Oh, Jang Jin; Choi, Young Sung [Korea Institute of Nuclear Safety, Daejeon (Korea, Republic of)

    2014-05-15

    The oversight of licensee's safety culture becomes an important issue that attracts great public and political concerns recently in Korea. Beginning from the intended violation of rules, a series of corruptions, documents forgery and disclosure of wrong-doings made the public think that the whole mindset of nuclear workers has been inadequate. Thus, they are demanding that safety culture shall be improved and that regulatory body shall play more roles and responsibilities for the improvements and oversight for them. This paper introduces, as an effort of regulatory side, recent changes in the role of regulators in safety culture, regulatory expectations on the desired status of licensee's safety culture, the pilot inspection program for safety culture and research activity for the development of oversight system. After the Fukushima accident in Japan 2011, many critics has searched for cultural factors that caused the unacceptable negligence pervaded in Japan nuclear society and the renewed emphasis has been placed on rebuilding safety culture by operators, regulators, and relevant institutions globally. Significant progress has been made in how to approach safety culture and led to a new perspective different from the existing normative assessment method both in operators and regulatory side. Regulatory expectations and oversight of them are based on such a new holistic concept for human, organizational and cultural elements to maintain and strengthen the integrity of defense in depth and consequently nuclear safety.

  11. GREAM: A Web Server to Short-List Potentially Important Genomic Repeat Elements Based on Over-/Under-Representation in Specific Chromosomal Locations, Such as the Gene Neighborhoods, within or across 17 Mammalian Species.

    Directory of Open Access Journals (Sweden)

    Darshan Shimoga Chandrashekar

    Full Text Available Genome-wide repeat sequences, such as LINEs, SINEs and LTRs share a considerable part of the mammalian nuclear genomes. These repeat elements seem to be important for multiple functions including the regulation of transcription initiation, alternative splicing and DNA methylation. But it is not possible to study all repeats and, hence, it would help to short-list before exploring their potential functional significance via experimental studies and/or detailed in silico analyses.We developed the 'Genomic Repeat Element Analyzer for Mammals' (GREAM for analysis, screening and selection of potentially important mammalian genomic repeats. This web-server offers many novel utilities. For example, this is the only tool that can reveal a categorized list of specific types of transposons, retro-transposons and other genome-wide repetitive elements that are statistically over-/under-represented in regions around a set of genes, such as those expressed differentially in a disease condition. The output displays the position and frequency of identified elements within the specified regions. In addition, GREAM offers two other types of analyses of genomic repeat sequences: a enrichment within chromosomal region(s of interest, and b comparative distribution across the neighborhood of orthologous genes. GREAM successfully short-listed a repeat element (MER20 known to contain functional motifs. In other case studies, we could use GREAM to short-list repetitive elements in the azoospermia factor a (AZFa region of the human Y chromosome and those around the genes associated with rat liver injury. GREAM could also identify five over-represented repeats around some of the human and mouse transcription factor coding genes that had conserved expression patterns across the two species.GREAM has been developed to provide an impetus to research on the role of repetitive sequences in mammalian genomes by offering easy selection of more interesting repeats in various

  12. The Ibibio Locative Copular Constructions

    Directory of Open Access Journals (Sweden)

    Ogbonna Anyanwu

    2010-10-01

    Full Text Available The Ibibio language, a member of the Lower Cross group of languages is predominantly spoken in Akwa Ibom State, Nigeria. Ibibio has two types of copular construction. One is locative while the other is predicative. Using a purely descriptive approach/method, this paper provides a descriptive account of the copular locative constructions in Ibibio. This study is based on a database collected from adult speakers of Ibibio by the author using an elicitation list. The database includes both actual and potential words/sentences, which standard Ibibio speakers found to be in consistent with their language rules.The paper has observed that Ibibio copular locatives make use of locative copular verbs which have semantic content, but are however, with indeterminate locative precision except when they co- occur with an appropriate locative complement. It has further observed that in Ibibio, the location of a subject entity can be marked with locative elements in two ways. In the first instance, a locative copular verb which can be dórò, ‘be on’ síne ‘be in’ bà ‘be at’ obligatorily co-occurs with a deitic locative complement or a locative prepositional phrase (PP complement headed by a multipurpose preposition (P, ké. The P is semantically, interpreted as either on, in, at or under depending on the particular locative copular verb that it co-occurs with. In the second instance, in addition to the locative copular verb and the locative PP complement headed by the P ké, there is also within the PP complement (headed by the P ké , a locative relational noun modifier which, modifies the head noun, a complement to the locative P ké. Based on Ameka andOgbonna Anyanwu71Levinson’s (2007 cross-linguistic classification of positional and locative verbs, the paper concludes that Ibibio belongs to the multi-verb type of languages with inherently locative copular verbs which are used to express the spatial locative orientation of subject

  13. An information transmission model for transcription factor binding at regulatory DNA sites.

    Science.gov (United States)

    Tan, Mingfeng; Yu, Dong; Jin, Yuan; Dou, Lei; Li, Beiping; Wang, Yuelan; Yue, Junjie; Liang, Long

    2012-06-06

    Computational identification of transcription factor binding sites (TFBSs) is a rapid, cost-efficient way to locate unknown regulatory elements. With increased potential for high-throughput genome sequencing, the availability of accurate computational methods for TFBS prediction has never been as important as it currently is. To date, identifying TFBSs with high sensitivity and specificity is still an open challenge, necessitating the development of novel models for predicting transcription factor-binding regulatory DNA elements. Based on the information theory, we propose a model for transcription factor binding of regulatory DNA sites. Our model incorporates position interdependencies in effective ways. The model computes the information transferred (TI) between the transcription factor and the TFBS during the binding process and uses TI as the criterion to determine whether the sequence motif is a possible TFBS. Based on this model, we developed a computational method to identify TFBSs. By theoretically proving and testing our model using both real and artificial data, we found that our model provides highly accurate predictive results. In this study, we present a novel model for transcription factor binding regulatory DNA sites. The model can provide an increased ability to detect TFBSs.

  14. Pressure Transducer Locations

    Data.gov (United States)

    National Aeronautics and Space Administration — Files are located here, defining the locations of the pressure transducers on the HIRENASD model. These locations also correspond to the locations that analysts...

  15. ChIP-Seq-Annotated Heliconius erato Genome Highlights Patterns of cis-Regulatory Evolution in Lepidoptera.

    Science.gov (United States)

    Lewis, James J; van der Burg, Karin R L; Mazo-Vargas, Anyi; Reed, Robert D

    2016-09-13

    Uncovering phylogenetic patterns of cis-regulatory evolution remains a fundamental goal for evolutionary and developmental biology. Here, we characterize the evolution of regulatory loci in butterflies and moths using chromatin immunoprecipitation sequencing (ChIP-seq) annotation of regulatory elements across three stages of head development. In the process we provide a high-quality, functionally annotated genome assembly for the butterfly, Heliconius erato. Comparing cis-regulatory element conservation across six lepidopteran genomes, we find that regulatory sequences evolve at a pace similar to that of protein-coding regions. We also observe that elements active at multiple developmental stages are markedly more conserved than elements with stage-specific activity. Surprisingly, we also find that stage-specific proximal and distal regulatory elements evolve at nearly identical rates. Our study provides a benchmark for genome-wide patterns of regulatory element evolution in insects, and it shows that developmental timing of activity strongly predicts patterns of regulatory sequence evolution.

  16. The location of protein S8 and surrounding elements of 16S rRNA in the 70S ribosome from combined use of directed hydroxyl radical probing and X-ray crystallography.

    Science.gov (United States)

    Lancaster, L; Culver, G M; Yusupova, G Z; Cate, J H; Yusupov, M M; Noller, H F

    2000-05-01

    Ribosomal protein S8, which is essential for the assembly of the central domain of 16S rRNA, is one of the most thoroughly studied RNA-binding proteins. To map its surrounding RNA in the ribosome, we carried out directed hydroxyl radical probing of 16S rRNA using Fe(II) tethered to nine different positions on the surface of protein S8 in 70S ribosomes. Hydroxyl radical-induced cleavage was observed near the classical S8-binding site in the 620 stem, and flanking the other S8-footprinted regions of the central domain at the three-helix junction near position 650 and the 825 and 860 stems. In addition, cleavage near the 5' terminus of 16S rRNA, in the 300 region of its 5' domain, and in the 1070 region of its 3'-major domain provide information about the proximity to S8 of RNA elements not directly involved in its binding. These data, along with previous footprinting and crosslinking results, allowed positioning of protein S8 and its surrounding RNA elements in a 7.8-A map of the Thermus thermophilus 70S ribosome. The resulting model is in close agreement with the extensive body of data from previous studies using protein-protein and protein-RNA crosslinking, chemical and enzymatic footprinting, and genetics.

  17. Regulatory principles governing Salmonella and Yersinia virulence

    Science.gov (United States)

    Erhardt, Marc; Dersch, Petra

    2015-01-01

    Enteric pathogens such as Salmonella and Yersinia evolved numerous strategies to survive and proliferate in different environmental reservoirs and mammalian hosts. Deciphering common and pathogen-specific principles for how these bacteria adjust and coordinate spatiotemporal expression of virulence determinants, stress adaptation, and metabolic functions is fundamental to understand microbial pathogenesis. In order to manage sudden environmental changes, attacks by the host immune systems and microbial competition, the pathogens employ a plethora of transcriptional and post-transcriptional control elements, including transcription factors, sensory and regulatory RNAs, RNAses, and proteases, to fine-tune and control complex gene regulatory networks. Many of the contributing global regulators and the molecular mechanisms of regulation are frequently conserved between Yersinia and Salmonella. However, the interplay, arrangement, and composition of the control elements vary between these closely related enteric pathogens, which generate phenotypic differences leading to distinct pathogenic properties. In this overview we present common and different regulatory networks used by Salmonella and Yersinia to coordinate the expression of crucial motility, cell adhesion and invasion determinants, immune defense strategies, and metabolic adaptation processes. We highlight evolutionary changes of the gene regulatory circuits that result in different properties of the regulatory elements and how this influences the overall outcome of the infection process. PMID:26441883

  18. A Location Privacy Aware Friend Locator

    DEFF Research Database (Denmark)

    Siksnys, Laurynas; Thomsen, Jeppe Rishede; Saltenis, Simonas

    2009-01-01

    to trade their location privacy for quality of service, limiting the attractiveness of the services. The challenge is to develop a communication-efficient solution such that (i) it detects proximity between a user and the user’s friends, (ii) any other party is not allowed to infer the location of the user...

  19. Genome-wide identification of enhancer elements.

    Science.gov (United States)

    Tulin, Sarah; Barsi, Julius C; Bocconcelli, Carlo; Smith, Joel

    2016-01-01

    We present a prospective genome-wide regulatory element database for the sea urchin embryo and the modified chromosome capture-related methodology used to create it. The method we developed is termed GRIP-seq for genome-wide regulatory element immunoprecipitation and combines features of chromosome conformation capture, chromatin immunoprecipitation, and paired-end next-generation sequencing with molecular steps that enrich for active cis-regulatory elements associated with basal transcriptional machinery. The first GRIP-seq database, available to the community, comes from S. purpuratus 24 hpf embryos and takes advantage of the extremely well-characterized cis-regulatory elements in this system for validation. In addition, using the GRIP-seq database, we identify and experimentally validate a novel, intronic cis-regulatory element at the onecut locus. We find GRIP-seq signal sensitively identifies active cis-regulatory elements with a high signal-to-noise ratio for both distal and intronic elements. This promising GRIP-seq protocol has the potential to address a rate-limiting step in resolving comprehensive, predictive network models in all systems.

  20. Escherichia coli transcriptional regulatory network

    Directory of Open Access Journals (Sweden)

    Agustino Martinez-Antonio

    2011-06-01

    Full Text Available Escherichia coli is the most well-know bacterial model about the function of its molecular components. In this review are presented several structural and functional aspects of their transcriptional regulatory network constituted by transcription factors and target genes. The network discussed here represent to 1531 genes and 3421 regulatory interactions. This network shows a power-law distribution with a few global regulators and most of genes poorly connected. 176 of genes in the network correspond to transcription factors, which form a sub-network of seven hierarchical layers where global regulators tend to be set in superior layers while local regulators are located in the lower ones. There is a small set of proteins know as nucleoid-associated proteins, which are in a high cellular concentrations and reshape the nucleoid structure to influence the running of global transcriptional programs, to this mode of regulation is named analog regulation. Specific signal effectors assist the activity of most of transcription factors in E. coli. These effectors switch and tune the activity of transcription factors. To this type of regulation, depending of environmental signals is named the digital-precise-regulation. The integration of regulatory programs have place in the promoter region of transcription units where it is common to observe co-regulation among global and local TFs as well as of TFs sensing exogenous and endogenous conditions. The mechanistic logic to understand the harmonious operation of regulatory programs in the network should consider the globalism of TFs, their signal perceived, coregulation, genome position, and cellular concentration. Finally, duplicated TFs and their horizontal transfer influence the evolvability of members of the network. The most duplicated and transferred TFs are located in the network periphery.

  1. Elements to evaluate the intention in the non-compliance s or violations to the regulatory framework in the national nuclear facilities; Elementos para evaluar la intencionalidad en los incumplimientos o violaciones al marco regulador en las instalaciones nucleares nacionales

    Energy Technology Data Exchange (ETDEWEB)

    Espinosa V, J. M.; Gonzalez V, J. A., E-mail: jmespinosa@cnsns.gob.mx [Comision Nacional de Seguridad Nuclear y Salvaguardias, Dr. Jose Ma. Barragan No. 779, Col. Narvarte, 03020 Mexico D. F. (Mexico)

    2013-10-15

    Inside the impact evaluation process to the safety of non-compliance s or violations, developed and implanted by the Comision Nacional de Seguridad Nuclear y Salvaguardias (CNSNS), the Guide for the Impact Evaluation to the Safety in the National Nuclear Facilities by Non-compliance s or Violations to the Regulatory Framework was developed, which indicates that in the determination of the severity (graveness level) of a non-compliance or violation, four factors are evaluated: real and potential consequences to the safety, the impact to the regulator process and the intention. The non-compliance s or intentional violations are of particular interest, since the development of the regulatory activities of the CNSNS considers that the personnel of the licensees, as well as their contractors, will act and will communicate with integrity and honesty. The CNSNS cannot tolerate intentional non-compliance s, for what this violations type can be considered of a level of more graveness that the subjacent non-compliance. To determine the severity of a violation that involves intention, the CNSNS also took in consideration factors as the position and the personnel's responsibilities involved in the violation, the graveness level of the non-compliance in itself, the offender's intention and the possible gain that would produce the non-compliance, if exists, either economic or of another nature. The CNSNS hopes the licensees take significant corrective actions in response to non-compliance s or intentional violations, these corrective actions should correspond to the violation graveness with the purpose of generating a dissuasive effect in the organizations of the licensees. The present article involves the legal framework that confers the CNSNS the attributions to impose administrative sanctions to its licensees, establishes the definition of the CNSNS about what constitutes a non-compliance or intentional violation and finally indicates the intention types (deliberate

  2. The lung enriched transcription factor TTF-1 and the ubiquitously expressed proteins Sp1 and Sp3 interact with elements located in the minimal promoter of the rat Clara cell secretory protein gene.

    Science.gov (United States)

    Toonen, R F; Gowan, S; Bingle, C D

    1996-01-01

    The mechanisms that direct expression of the Clara cell secretory protein (CCSP) gene to the bronchiolar epithelial cells of the lung remain to be elucidated. Previous studies have identified a number of proteins which bind to a functionally important region (Region 1) located -132 to -76 bp from the transcription start site in the rat CCSP gene. Subsequently we have shown that while Region 1 is an important positive regulator of CCSP gene expression, sequences 3' of this region (-75 to +38) are sufficient to confer tissue-specific expression of a reporter gene. In the present study we have used transient transfections with a deletion series of CCSP-CAT reporter plasmids (where CAT is chloramphenicol acetyltransferase) and gel mobility shift assays with a series of overlapping oligonucleotides covering the whole minimal promoter region to study protein-DNA interactions within this region. These studies have identified a conserved functional binding site for the lung and thyroid enriched homeodomain transcription factor TTF-1, located between positions -51 and -42 from the transcription start site. CCSP-CAT chimaeric reporters containing this region are specifically activated by TTF-1 in co-transfection assays, and nuclear extracts from cells which express TTF-1 bind to this region, as does in vitro translated rat TTF-1. Three additional conserved regions were identified, and in further gel mobility shift studies with an oligonucleotide spanning the conserved region immediately 5' to the TTF-1 site we identified a binding site for the ubiquitously expressed zinc-finger-containing proteins Sp1 and Sp3. These studies suggest that cell-type-restricted and ubiquitous nuclear proteins may play a combined role in the regulation of the CCSP gene within the bronchiolar epithelium by interacting with the minimal promoter region. PMID:8687389

  3. 水稻籽实主要元素分布位置及含量表征方法%Characterization methods of the location and content of the distribution of the main elements in rice

    Institute of Scientific and Technical Information of China (English)

    索丽敏; 王元冬; 孙先达; 张冬梅

    2016-01-01

    Heavy metal elements as non?essential elements of a biological metabolism in organisms even absorb a small amount can be toxic or even lethal effect. Human intake of heavy metals in the accumulation of different organs in the body, causing a series of medical problems, leading to serious illness and even death. Previous studies the distribution of heavy metals in plants are generally using an atomic absorption spectrometer, in the digestion and extraction process is likely to cause the loss of the measurement result is low. Mature rice grain materials, electron probe microanalysis method, determination of heavy metals in different parts of the rice grain.%随机抽取若干成熟水稻籽粒为检测素材,采用电子探针二次电子成像和元素面分布检测的方法,检测了水稻籽粒各个重要部位元素的含量,用电子探针元素面分布的方法表征水稻籽实主要元素的富集位置.结果表明:胚根是水稻籽粒元素种类最富集的结构部位,同时它也是有害元素聚集最广泛的一个部位.胚根中是否存在有害元素也直接决定了下一代籽粒的食品安全质量.S元素主要存在于籽粒的中心层、近糊粉层和培根部位,其含量在胚根外层最多;Al元素主要存在于籽粒的胚根,其含量也在胚根中最多;Cr元素主要存在于胚根和糊粉外层,其含量在糊粉外层最多.

  4. Locative Inversion in Cantonese.

    Science.gov (United States)

    Mok, Sui-Sang

    This study investigates the phenomenon of "Locative Inversion" in Cantonese. The term "Locative Inversion" indicates that the locative phrase (LP) syntactic process in Cantonese and the appears at the sentence-initial position and its logical subject occurs postverbally. It is demonstrated that this Locative Inversion is a…

  5. A Cis-Regulatory Map of the Drosophila Genome

    Science.gov (United States)

    Nègre, Nicolas; Brown, Christopher D.; Ma, Lijia; Bristow, Christopher Aaron; Miller, Steven W.; Wagner, Ulrich; Kheradpour, Pouya; Eaton, Matthew L.; Loriaux, Paul; Sealfon, Rachel; Li, Zirong; Ishii, Haruhiko; Spokony, Rebecca F.; Chen, Jia; Hwang, Lindsay; Cheng, Chao; Auburn, Richard P.; Davis, Melissa B.; Domanus, Marc; Shah, Parantu K.; Morrison, Carolyn A.; Zieba, Jennifer; Suchy, Sarah; Senderowicz, Lionel; Victorsen, Alec; Bild, Nicholas A.; Grundstad, A. Jason; Hanley, David; MacAlpine, David M.; Mannervik, Mattias; Venken, Koen; Bellen, Hugo; White, Robert; Russell, Steven; Grossman, Robert L.; Ren, Bing; Gerstein, Mark; Posakony, James W.; Kellis, Manolis; White, Kevin P.

    2011-01-01

    Systematic annotation of gene regulatory elements is a major challenge in genome science. Direct mapping of chromatin modification marks and transcriptional factor binding sites genome-wide 1,2 has successfully identified specific subtypes of regulatory elements 3. In Drosophila several pioneering studies have provided genome-wide identification of Polycomb-Response Elements 4, chromatin states 5, transcription factor binding sites (TFBS) 6–9, PolII regulation 8, and insulator elements 10; however, comprehensive annotation of the regulatory genome remains a significant challenge. Here we describe results from the modENCODE cis-regulatory annotation project. We produced a map of the Drosophila melanogaster regulatory genome based on more than 300 chromatin immuno-precipitation (ChIP) datasets for eight chromatin features, five histone deacetylases (HDACs) and thirty-eight site-specific transcription factors (TFs) at different stages of development. Using these data we inferred more than 20,000 candidate regulatory elements and we validated a subset of predictions for promoters, enhancers, and insulators in vivo. We also identified nearly 2,000 genomic regions of dense TF binding associated with chromatin activity and accessibility. We discovered hundreds of new TF co-binding relationships and defined a TF network with over 800 potential regulatory relationships. PMID:21430782

  6. Toxic Elements

    DEFF Research Database (Denmark)

    Hajeb, Parvaneh; Shakibazadeh, Shahram; Sloth, Jens Jørgen

    2016-01-01

    Food is considered the main source of toxic element (arsenic, cadmium, lead, and mercury) exposure to humans, and they can cause major public health effects. In this chapter, we discuss the most important sources for toxic element in food and the foodstuffs which are significant contributors...... to human exposure. The occurrence of each element in food classes from different regions is presented. Some of the current toxicological risk assessments on toxic elements, the human health effect of each toxic element, and their contents in the food legislations are presented. An overview of analytical...... techniques and challenges for determination of toxic elements in food is also given....

  7. Human CHAC1 Protein Degrades Glutathione, and mRNA Induction Is Regulated by the Transcription Factors ATF4 and ATF3 and a Bipartite ATF/CRE Regulatory Element*

    Science.gov (United States)

    Crawford, Rebecca R.; Prescott, Eugenia T.; Sylvester, Charity F.; Higdon, Ashlee N.; Shan, Jixiu; Kilberg, Michael S.; Mungrue, Imran N.

    2015-01-01

    Using an unbiased systems genetics approach, we previously predicted a role for CHAC1 in the endoplasmic reticulum stress pathway, linked functionally to activating transcription factor 4 (ATF4) following treatment with oxidized phospholipids, a model for atherosclerosis. Mouse and yeast CHAC1 homologs have been shown to degrade glutathione in yeast and a cell-free system. In this report, we further defined the ATF4-CHAC1 interaction by cloning the human CHAC1 promoter upstream of a luciferase reporter system for in vitro assays in HEK293 and U2OS cells. Mutation and deletion analyses defined two major cis DNA elements necessary and sufficient for CHAC1 promoter-driven luciferase transcription under conditions of ER stress or ATF4 coexpression: the −267 ATF/cAMP response element (CRE) site and a novel −248 ATF/CRE modifier (ACM) element. We also examined the ability of the CHAC1 ATF/CRE and ACM sequences to bind ATF4 and ATF3 using immunoblot-EMSA and confirmed ATF4, ATF3, and CCAAT/enhancer-binding protein β binding at the human CHAC1 promoter in the proximity of the ATF/CRE and ACM using ChIP. To further validate the function of CHAC1 in a human cell model, we measured glutathione levels in HEK293 cells with enhanced CHAC1 expression. Overexpression of CHAC1 led to a robust depletion of glutathione, which was alleviated in a CHAC1 catalytic mutant. These results suggest an important role for CHAC1 in oxidative stress and apoptosis with implications for human health and disease. PMID:25931127

  8. Human CHAC1 Protein Degrades Glutathione, and mRNA Induction Is Regulated by the Transcription Factors ATF4 and ATF3 and a Bipartite ATF/CRE Regulatory Element.

    Science.gov (United States)

    Crawford, Rebecca R; Prescott, Eugenia T; Sylvester, Charity F; Higdon, Ashlee N; Shan, Jixiu; Kilberg, Michael S; Mungrue, Imran N

    2015-06-19

    Using an unbiased systems genetics approach, we previously predicted a role for CHAC1 in the endoplasmic reticulum stress pathway, linked functionally to activating transcription factor 4 (ATF4) following treatment with oxidized phospholipids, a model for atherosclerosis. Mouse and yeast CHAC1 homologs have been shown to degrade glutathione in yeast and a cell-free system. In this report, we further defined the ATF4-CHAC1 interaction by cloning the human CHAC1 promoter upstream of a luciferase reporter system for in vitro assays in HEK293 and U2OS cells. Mutation and deletion analyses defined two major cis DNA elements necessary and sufficient for CHAC1 promoter-driven luciferase transcription under conditions of ER stress or ATF4 coexpression: the -267 ATF/cAMP response element (CRE) site and a novel -248 ATF/CRE modifier (ACM) element. We also examined the ability of the CHAC1 ATF/CRE and ACM sequences to bind ATF4 and ATF3 using immunoblot-EMSA and confirmed ATF4, ATF3, and CCAAT/enhancer-binding protein β binding at the human CHAC1 promoter in the proximity of the ATF/CRE and ACM using ChIP. To further validate the function of CHAC1 in a human cell model, we measured glutathione levels in HEK293 cells with enhanced CHAC1 expression. Overexpression of CHAC1 led to a robust depletion of glutathione, which was alleviated in a CHAC1 catalytic mutant. These results suggest an important role for CHAC1 in oxidative stress and apoptosis with implications for human health and disease. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Safeguards inventory and process monitoring regulatory comparison

    Energy Technology Data Exchange (ETDEWEB)

    Cavaluzzi, Jack M. [Texas A & M Univ., College Station, TX (United States); Gibbs, Philip W. [Brookhaven National Lab. (BNL), Upton, NY (United States)

    2013-06-27

    Detecting the theft or diversion of the relatively small amount of fissile material needed to make a nuclear weapon given the normal operating capacity of many of today’s running nuclear production facilities is a difficult task. As throughput increases, the ability of the Material Control and Accountability (MC&A) Program to detect the material loss decreases because the statistical measurement uncertainty also increases. The challenge faced is the ability of current accounting, measurement, and material control programs to detect small yet significant losses under some regulatory approaches can decrease to the point where it is extremely low if not practically non-existent at normal operating capacities. Adding concern to this topic is that there are variations among regulatory bodies as far as what is considered a Significant Quantity (SQ). Some research suggests that thresholds should be lower than those found in any current regulation which if adopted would make meeting detection goals even more difficult. This paper reviews and compares the current regulatory requirements for the MA elements related to physical inventory, uncertainty of the Inventory Difference (ID), and Process Monitoring (PM) in the United States Department of Energy (DOE) and Nuclear Regulatory Commission (NRC), Rosatom of the Russian Federation and the Chinese Atomic Energy Agency (CAEA) of China. The comparison looks at how the regulatory requirements for the implementation of various MA elements perform across a range of operating capacities in example facilities.

  10. Law Enforcement Locations

    Data.gov (United States)

    Kansas Data Access and Support Center — Law Enforcement Locations in Kansas Any location where sworn officers of a law enforcement agency are regularly based or stationed. Law enforcement agencies "are...

  11. An element

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, K.; Iidzima, K.

    1983-03-30

    An anode of a light metal is used in the element, along with an electrolyte which consists of an ether solvent and an ionogenic additive in the form of a salt of dithiocarbamic acid. The element has good discharge characteristics.

  12. Onderzoek location based marketing: Mobile = location = effect

    NARCIS (Netherlands)

    Gisbergen, M.S. van; Huhn, A.E.; Khan, V.J.; Ketelaar, P.E.

    2011-01-01

    Onderzoekers van de NHTV (Internationaa Hoger Onderwijs Breda, Radboud Universiteit, DVJ Insights en Popai Benelux lieten consumenten in een virtuele supermarkt advertenties via de smartphone ontvangen wanneer men langs het geadverteerde product liep. De uitkomsten laten zien dat 'location based adv

  13. Onderzoek location based marketing: Mobile = location = effect

    OpenAIRE

    Gisbergen, M.S. van; Huhn, A.E.; Khan, V.J.; Ketelaar, P.E.

    2011-01-01

    Onderzoekers van de NHTV (Internationaa Hoger Onderwijs Breda, Radboud Universiteit, DVJ Insights en Popai Benelux lieten consumenten in een virtuele supermarkt advertenties via de smartphone ontvangen wanneer men langs het geadverteerde product liep. De uitkomsten laten zien dat 'location based advertising' effectief is.

  14. Locatives in Kpelle.

    Science.gov (United States)

    Kuha, Mai

    This paper examines the differences between locative expressions in Kpelle and English, based on the dialect of one native speaker of Kpelle. It discusses the crucial role of the reference object in defining the meaning of locatives in Kpelle, in contrast to English, where the characteristics of the object to be located are less important. An…

  15. Smartphones as locative media

    CERN Document Server

    Frith, Jordan

    2015-01-01

    Smartphone adoption has surpassed 50% of the population in more than 15 countries, and there are now more than one million mobile applications people can download to their phones. Many of these applications take advantage of smartphones as locative media, which is what allows smartphones to be located in physical space. Applications that take advantage of people's location are called location-based services, and they are the focus of this book. Smartphones as locative media raise important questions about how we understand the complicated relationship between the Internet and physical space

  16. A Regulatory Element Near the 3′ End of the Adeno-Associated Virus rep Gene Inhibits Adenovirus Replication in cis by Means of p40 Promoter-Associated Short Transcripts

    Science.gov (United States)

    Hammer, Eva; Gonsior, Melanie; Stutika, Catrin; Heilbronn, Regine

    2016-01-01

    ABSTRACT Adeno-associated virus (AAV) has long been known to inhibit helper adenovirus (Ad) replication independently of AAV Rep protein expression. More recently, replication of Ad serotype 5 (Ad5)/AAV serotype 2 (AAV-2) hybrid vectors was shown to be inhibited in cis by a sequence near the 3′ end of AAV rep, termed the Rep inhibition sequence for adenoviral replication (RIS-Ad). RIS-Ad functions independently of Rep protein expression. Here we demonstrate that inhibition of adenoviral replication by RIS-Ad requires an active AAV p40 promoter and the 5′ half of the intron. In addition, Ad inhibition is critically dependent on the integrity of the p40 transcription start site (TSS) leading to short p40-associated transcripts. These do not give rise to effector molecules capable of inhibiting adenoviral replication in trans, like small polypeptides or microRNAs. Our data point to an inhibitory mechanism in which RNA polymerase II (Pol II) pauses directly downstream of the p40 promoter, leading to interference of the stalled Pol II transcription complex with the adenoviral replication machinery. Whereas inhibition by RIS-Ad is mediated exclusively in cis, it can be overcome by providing a replication-competent adenoviral genome in trans. Moreover, the inhibitory effect of RIS-Ad is not limited to AAV-2 but could also be shown for the corresponding regions of other AAV serotypes, including AAV-5. These findings have important implications for the future generation of Ad5/AAV hybrid vectors. IMPORTANCE Insertion of sequences from the 3′ part of the rep gene of adeno-associated virus (AAV) into the genome of its helper adenovirus strongly reduces adenoviral genome replication. We could show that this inhibition is mediated exclusively in cis without the involvement of trans-acting regulatory RNAs or polypeptides but nevertheless requires an active AAV-2 p40 promoter and p40-associated short transcripts. Our results suggest a novel inhibitory mechanism that has so

  17. PuF, an antimetastatic and developmental signaling protein, interacts with the Alzheimer’s amyloid-β precursor protein via a tissue-specific proximal regulatory element (PRE

    Directory of Open Access Journals (Sweden)

    Lahiri Debomoy K

    2013-01-01

    Full Text Available Abstract Background Alzheimer’s disease (AD is intimately tied to amyloid-β (Aβ peptide. Extraneuronal brain plaques consisting primarily of Aβ aggregates are a hallmark of AD. Intraneuronal Aβ subunits are strongly implicated in disease progression. Protein sequence mutations of the Aβ precursor protein (APP account for a small proportion of AD cases, suggesting that regulation of the associated gene (APP may play a more important role in AD etiology. The APP promoter possesses a novel 30 nucleotide sequence, or “proximal regulatory element” (PRE, at −76/−47, from the +1 transcription start site that confers cell type specificity. This PRE contains sequences that make it vulnerable to epigenetic modification and may present a viable target for drug studies. We examined PRE-nuclear protein interaction by gel electrophoretic mobility shift assay (EMSA and PRE mutant EMSA. This was followed by functional studies of PRE mutant/reporter gene fusion clones. Results EMSA probed with the PRE showed DNA-protein interaction in multiple nuclear extracts and in human brain tissue nuclear extract in a tissue-type specific manner. We identified transcription factors that are likely to bind the PRE, using competition gel shift and gel supershift: Activator protein 2 (AP2, nm23 nucleoside diphosphate kinase/metastatic inhibitory protein (PuF, and specificity protein 1 (SP1. These sites crossed a known single nucleotide polymorphism (SNP. EMSA with PRE mutants and promoter/reporter clone transfection analysis further implicated PuF in cells and extracts. Functional assays of mutant/reporter clone transfections were evaluated by ELISA of reporter protein levels. EMSA and ELISA results correlated by meta-analysis. Conclusions We propose that PuF may regulate the APP gene promoter and that AD risk may be increased by interference with PuF regulation at the PRE. PuF is targeted by calcium/calmodulin-dependent protein kinase II inhibitor 1, which also

  18. Conserved stem-loop structures in the HIV-1 RNA region containing the A3 3' splice site and its cis-regulatory element: possible involvement in RNA splicing.

    Science.gov (United States)

    Jacquenet, S; Ropers, D; Bilodeau, P S; Damier, L; Mougin, A; Stoltzfus, C M; Branlant, C

    2001-01-15

    The HIV-1 transcript is alternatively spliced to over 30 different mRNAs. Whether RNA secondary structure can influence HIV-1 RNA alternative splicing has not previously been examined. Here we have determined the secondary structure of the HIV-1/BRU RNA segment, containing the alternative A3, A4a, A4b, A4c and A5 3' splice sites. Site A3, required for tat mRNA production, is contained in the terminal loop of a stem-loop structure (SLS2), which is highly conserved in HIV-1 and related SIVcpz strains. The exon splicing silencer (ESS2) acting on site A3 is located in a long irregular stem-loop structure (SLS3). Two SLS3 domains were protected by nuclear components under splicing condition assays. One contains the A4c branch points and a putative SR protein binding site. The other one is adjacent to ESS2. Unexpectedly, only the 3' A residue of ESS2 was protected. The suboptimal A3 polypyrimidine tract (PPT) is base paired. Using site-directed mutagenesis and transfection of a mini-HIV-1 cDNA into HeLa cells, we found that, in a wild-type PPT context, a mutation of the A3 downstream sequence that reinforced SLS2 stability decreased site A3 utilization. This was not the case with an optimized PPT. Hence, sequence and secondary structure of the PPT may cooperate in limiting site A3 utilization.

  19. Generic Network Location Service

    Directory of Open Access Journals (Sweden)

    Laban Mwansa

    2010-11-01

    Full Text Available This work presents the Generic Network Location Service based on the Chord implementation utilizing data structures called distributed hash tables (DHT or structured overlay networks, which are used to build scalable self-managing distributed systems. The provided algorithms guarantee resilience in the presence of dynamism: they guarantee consistent lookup results in the presence of nodes failing and leaving. Generic Network Location Service provides a Location Service system based on DHT technology, which is storing device location records in nodes within a Chord DHT. Location records are consisting of network device identification keys as attributes, which are used to create replicas of additional location records through established Chord hashing mechanisms. Storing device location records, in places address-able (using the DHT lookup by individual location record keys provides a simple way of implementing transla¬tion functions similar to well¬ known network services (e.g. ARP, DNS, ENUM. The generic network location ser¬vice presented in the paper is not supposed to be a substitu¬tion of the existing translation techniques (e.g. ARP, DNS, ENUM, but it is considered as an overlay service that uses data available in existing systems and provides some translations currently unavailable.

  20. Smart Location Database - Download

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Smart Location Database (SLD) summarizes over 80 demographic, built environment, transit service, and destination accessibility attributes for every census block...

  1. Smart Location Database - Service

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Smart Location Database (SLD) summarizes over 80 demographic, built environment, transit service, and destination accessibility attributes for every census block...

  2. Global mapping of transposon location.

    Directory of Open Access Journals (Sweden)

    Abram Gabriel

    2006-12-01

    Full Text Available Transposable genetic elements are ubiquitous, yet their presence or absence at any given position within a genome can vary between individual cells, tissues, or strains. Transposable elements have profound impacts on host genomes by altering gene expression, assisting in genomic rearrangements, causing insertional mutations, and serving as sources of phenotypic variation. Characterizing a genome's full complement of transposons requires whole genome sequencing, precluding simple studies of the impact of transposition on interindividual variation. Here, we describe a global mapping approach for identifying transposon locations in any genome, using a combination of transposon-specific DNA extraction and microarray-based comparative hybridization analysis. We use this approach to map the repertoire of endogenous transposons in different laboratory strains of Saccharomyces cerevisiae and demonstrate that transposons are a source of extensive genomic variation. We also apply this method to mapping bacterial transposon insertion sites in a yeast genomic library. This unique whole genome view of transposon location will facilitate our exploration of transposon dynamics, as well as defining bases for individual differences and adaptive potential.

  3. Regulatory T cell memory

    Science.gov (United States)

    Rosenblum, Michael D.; Way, Sing Sing; Abbas, Abul K.

    2016-01-01

    Memory for antigen is a defining feature of adaptive immunity. Antigen-specific lymphocyte populations show an increase in number and function after antigen encounter and more rapidly re-expand upon subsequent antigen exposure. Studies of immune memory have primarily focused on effector B cells and T cells with microbial specificity, using prime challenge models of infection. However, recent work has also identified persistently expanded populations of antigen-specific regulatory T cells that protect against aberrant immune responses. In this Review, we consider the parallels between memory effector T cells and memory regulatory T cells, along with the functional implications of regulatory memory in autoimmunity, antimicrobial host defence and maternal fetal tolerance. In addition, we discuss emerging evidence for regulatory T cell memory in humans and key unanswered questions in this rapidly evolving field. PMID:26688349

  4. NRC regulatory initiatives

    Energy Technology Data Exchange (ETDEWEB)

    Johnson, T.C. [Nuclear Regulatory Commission (United States)

    1989-11-01

    The US Nuclear Regulatory Commission (NRC) is addressing several low-level waste disposal issues that will be important to waste generators and to States and Compacts developing new disposal capacity. These issues include Greater-Than-Class C (GTCC) waste, mixed waste, below regulatory concern (BRC) waste, and the low-level waste data base. This paper discusses these issues and their current status.

  5. LOCATORS OPTIMIZATION FOR MEASURING FIXTURE DESIGN

    Institute of Scientific and Technical Information of China (English)

    Wang Jian; Zhou Jiangqi; Lin Zhongqin

    2004-01-01

    "N-2-1" principle is widely recognized in the fixture design for deformable sheet metal workpieces, where N, the locators on primary datum, is the key to sheet metal fixture design. However, little research is done on how to determine the positions and the number of N locators. In practice, the N locators are frequently designed from experience, which is often unsatisfactory for achieving the precision requirement in fixture design. A new method to lay out the N locators for measuring fixture of deformable sheet metal workpiece is presented, given the fixed number of N. Finite-element method is used to model and analysis the deformation of different locator layouts. A knowledge based genetic algorithm (KBGA) is applied to identify the optimum locator layout for measuring fixture design. An example of a door outer is used to verify the optimization approach.

  6. Industrial location and competitiveness

    NARCIS (Netherlands)

    S. Brakman (Steven); J.H. Garretsen (Harry); J.G.M. van Marrewijk (Charles)

    2006-01-01

    textabstractThe interaction between the extent of location advantages and the intensity of firm competition relative to the size of the market jointly determines the location of industrial activity. Technology, factor endowments, geography, and scale economies are influential for determining locatio

  7. Appraising manufacturing location

    NARCIS (Netherlands)

    Steenhuis, Harm-Jan; Bruijn, de Erik J.

    2002-01-01

    International location of manufacturing activities is an issue for managers of manufacturing companies as well as public policy makers. For managers, the issue is relevant because international locations offer opportunities for lowering costs due to productivity improvements. For governments the iss

  8. Assessing manufacturing location

    NARCIS (Netherlands)

    Steenhuis, Harm-Jan; Bruijn, de Erik J.

    2004-01-01

    International location of manufacturing activities is an issue for managers of manufacturing companies as well as public policy-makers. For managers, the issue is relevant because international locations offer opportunities for lowering costs due to productivity improvements. For governments the iss

  9. Secure Location Provenance for Mobile Devices

    Science.gov (United States)

    2015-07-01

    SECURE LOCATION PROVENANCE FOR MOBILE DEVICES UNIVERSITY OF ALABAMA AT BIRMINGHAM JULY 2015 FINAL TECHNICAL REPORT...PROVENANCE FOR MOBILE DEVICES 5a. CONTRACT NUMBER FA8750-12-2-0254 5b. GRANT NUMBER N/A 5c. PROGRAM ELEMENT NUMBER 69220K 6. AUTHOR(S) Ragib Hasan...based services allow mobile device users to access various services based on the users’ current physical location information. Path-critical applications

  10. [Advanced therapy: from European regulatory framework to national regulatory framework].

    Science.gov (United States)

    Lucas-Samuel, S

    2013-05-01

    The European regulation n(o) 1394/2007/CE published on the 13th of November 2007 defined and harmonized the European regulatory framework for advanced therapy medicinal products. It creates a specialized committee located at the European Medicine Agency, in charge of the assessment of these medicinal products. The consequences of this regulation are introduced in the French regulation by the law n(o) 2011-302 published on the 22nd of March 2011. It detailed notably the possibility for public establishments (except health establishments) and nonprofit organisms to create pharmaceutical establishments. This law defined also a specific category of advanced therapy medicinal products, which fall under the "hospital exemption" framework. The rules regarding the authorizations of the establishments able to prepare these types of medicinal products and the authorization of the products are defined by the n(o) 2012-1236 decree published on the 6th of November 2012.

  11. Functional characterization of variations on regulatory motifs.

    Directory of Open Access Journals (Sweden)

    Michal Lapidot

    2008-03-01

    Full Text Available Transcription factors (TFs regulate gene expression through specific interactions with short promoter elements. The same regulatory protein may recognize a variety of related sequences. Moreover, once they are detected it is hard to predict whether highly similar sequence motifs will be recognized by the same TF and regulate similar gene expression patterns, or serve as binding sites for distinct regulatory factors. We developed computational measures to assess the functional implications of variations on regulatory motifs and to compare the functions of related sites. We have developed computational means for estimating the functional outcome of substituting a single position within a binding site and applied them to a collection of putative regulatory motifs. We predict the effects of nucleotide variations within motifs on gene expression patterns. In cases where such predictions could be compared to suitable published experimental evidence, we found very good agreement. We further accumulated statistics from multiple substitutions across various binding sites in an attempt to deduce general properties that characterize nucleotide substitutions that are more likely to alter expression. We found that substitutions involving Adenine are more likely to retain the expression pattern and that substitutions involving Guanine are more likely to alter expression compared to the rest of the substitutions. Our results should facilitate the prediction of the expression outcomes of binding site variations. One typical important implication is expected to be the ability to predict the phenotypic effect of variation in regulatory motifs in promoters.

  12. Identification of four novel alleles of the BoLA-DRB3 upstream regulatory region in Chinese yellow cattle.

    Science.gov (United States)

    Wang, K; Sun, D-X; Li, K-Y; Wang, X-Q; Zhang, F

    2012-07-01

    The sequence of upstream regulatory region (URR) of BoLA-DRB3 gene was amplified with polymerase chain reaction followed by DNA sequencing from six animals of Chinese yellow cattle. A total of five alleles including four newly identified ones, named BoLA-DRB3*R-03-U2, BoLA-DRB3*R-06-U2, BoLA-DRB3*R-07-U and BoLA-DRB3*R-12-U for the BoLA-DRB3 URR were found. Result of sequence analysis showed that the regulatory elements W, X, Y, CCAAT and TATA-like boxes existed in such URRs and 16 polymorphic sites (11 transitions, 3 transversions, 1 deletion and 1 insertion) located in the spacers between the conserved consensus boxes and 1 insertion within X box, while no new polymorphic site within the consensus boxes.

  13. The role of cis regulatory evolution in maize domestication.

    Science.gov (United States)

    Lemmon, Zachary H; Bukowski, Robert; Sun, Qi; Doebley, John F

    2014-11-01

    Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem). Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes) show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues.

  14. The Role of cis Regulatory Evolution in Maize Domestication

    Science.gov (United States)

    Lemmon, Zachary H.; Bukowski, Robert; Sun, Qi; Doebley, John F.

    2014-01-01

    Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem). Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes) show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues. PMID:25375861

  15. The role of cis regulatory evolution in maize domestication.

    Directory of Open Access Journals (Sweden)

    Zachary H Lemmon

    2014-11-01

    Full Text Available Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem. Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues.

  16. The role of cis regulatory evolution in maize domestication.

    Directory of Open Access Journals (Sweden)

    Zachary H Lemmon

    2014-11-01

    Full Text Available Gene expression differences between divergent lineages caused by modification of cis regulatory elements are thought to be important in evolution. We assayed genome-wide cis and trans regulatory differences between maize and its wild progenitor, teosinte, using deep RNA sequencing in F1 hybrid and parent inbred lines for three tissue types (ear, leaf and stem. Pervasive regulatory variation was observed with approximately 70% of ∼17,000 genes showing evidence of regulatory divergence between maize and teosinte. However, many fewer genes (1,079 genes show consistent cis differences with all sampled maize and teosinte lines. For ∼70% of these 1,079 genes, the cis differences are specific to a single tissue. The number of genes with cis regulatory differences is greatest for ear tissue, which underwent a drastic transformation in form during domestication. As expected from the domestication bottleneck, maize possesses less cis regulatory variation than teosinte with this deficit greatest for genes showing maize-teosinte cis regulatory divergence, suggesting selection on cis regulatory differences during domestication. Consistent with selection on cis regulatory elements, genes with cis effects correlated strongly with genes under positive selection during maize domestication and improvement, while genes with trans regulatory effects did not. We observed a directional bias such that genes with cis differences showed higher expression of the maize allele more often than the teosinte allele, suggesting domestication favored up-regulation of gene expression. Finally, this work documents the cis and trans regulatory changes between maize and teosinte in over 17,000 genes for three tissues.

  17. Smart Location Mapping

    Science.gov (United States)

    The Smart Location Database, Access to Jobs and Workers via Transit, and National Walkability Index tools can help assess indicators related to the built environment, transit accessibility, and walkability.

  18. Waste Recovery Locations

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — Locations where City residents are encouraged to drop off and dispose or recycle of unwanted materials. Information provided is subject to change. Please call ahead...

  19. Electronic apex locators.

    Science.gov (United States)

    Gordon, M P J; Chandler, N P

    2004-07-01

    Prior to root canal treatment at least one undistorted radiograph is required to assess canal morphology. The apical extent of instrumentation and the final root filling have a role in treatment success, and are primarily determined radiographically. Electronic apex locators reduce the number of radiographs required and assist where radiographic methods create difficulty. They may also indicate cases where the apical foramen is some distance from the radiographic apex. Other roles include the detection of root canal perforation. A review of the literature focussed first on the subject of electronic apex location. A second review used the names of apex location devices. From the combined searches, 113 pertinent articles in English were found. This paper reviews the development, action, use and types of electronic apex locators.

  20. Allegheny County Dam Locations

    Data.gov (United States)

    Allegheny County / City of Pittsburgh / Western PA Regional Data Center — This dataset shows the point locations of dams in Allegheny County. If viewing this description on the Western Pennsylvania Regional Data Center’s open data portal...

  1. VT Hospital Site Locations

    Data.gov (United States)

    Vermont Center for Geographic Information — (Link to Metadata) This data layer contains point locations of all major community, regional, comprehensive health, and healthcare provider hospitals in the state of...

  2. IHS Facility Locator

    Data.gov (United States)

    U.S. Department of Health & Human Services — This map can be used to find an Indian Health Service, Tribal or Urban Indian Health Program facility. This map can be used to: Zoom in to a general location to...

  3. USAID Activity Locations

    Data.gov (United States)

    US Agency for International Development — The USAID Activities dataset is a snapshot of activities supported by USAID including their geographical locations within countries at the time of the snapshot. The...

  4. Eldercare Locator Database

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Eldercare Locator is a searchable database that allows a user to search via zip code or city/ state for agencies at the State and local levels that provide...

  5. Uranium Location Database

    Data.gov (United States)

    U.S. Environmental Protection Agency — A GIS compiled locational database in Microsoft Access of ~15,000 mines with uranium occurrence or production, primarily in the western United States. The metadata...

  6. Global Volcano Locations Database

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NGDC maintains a database of over 1,500 volcano locations obtained from the Smithsonian Institution Global Volcanism Program, Volcanoes of the World publication. The...

  7. Location and logistics

    OpenAIRE

    Alumura, Sibel A.; Karab, Bahar Y.; Melo, M. Teresa

    2013-01-01

    Facility location decisions play a critical role in designing logistics networks. This article provides some guidelines on how location decisions and logistics functions can be integrated into a single mathematical model to optimize the configuration of a logistics network. This will be illustrated by two generic models, one supporting the design of a forward logistics network and the other addressing the specific requirements of a reverse logistics network. Several special cases and extensio...

  8. Location and logistics

    OpenAIRE

    Alumura, Sibel A.; Karab, Bahar Y.; Melo, M. Teresa

    2013-01-01

    Facility location decisions play a critical role in designing logistics networks. This article provides some guidelines on how location decisions and logistics functions can be integrated into a single mathematical model to optimize the configuration of a logistics network. This will be illustrated by two generic models, one supporting the design of a forward logistics network and the other addressing the specific requirements of a reverse logistics network. Several special cases and extensio...

  9. Conserved cis-regulatory modules in promoters of genes encoding wheat high-molecular-weight glutenin subunits.

    Science.gov (United States)

    Ravel, Catherine; Fiquet, Samuel; Boudet, Julie; Dardevet, Mireille; Vincent, Jonathan; Merlino, Marielle; Michard, Robin; Martre, Pierre

    2014-01-01

    The concentration and composition of the gliadin and glutenin seed storage proteins (SSPs) in wheat flour are the most important determinants of its end-use value. In cereals, the synthesis of SSPs is predominantly regulated at the transcriptional level by a complex network involving at least five cis-elements in gene promoters. The high-molecular-weight glutenin subunits (HMW-GS) are encoded by two tightly linked genes located on the long arms of group 1 chromosomes. Here, we sequenced and annotated the HMW-GS gene promoters of 22 electrophoretic wheat alleles to identify putative cis-regulatory motifs. We focused on 24 motifs known to be involved in SSP gene regulation. Most of them were identified in at least one HMW-GS gene promoter sequence. A common regulatory framework was observed in all the HMW-GS gene promoters, as they shared conserved cis-regulatory modules (CCRMs) including all the five motifs known to regulate the transcription of SSP genes. This common regulatory framework comprises a composite box made of the GATA motifs and GCN4-like Motifs (GLMs) and was shown to be functional as the GLMs are able to bind a bZIP transcriptional factor SPA (Storage Protein Activator). In addition to this regulatory framework, each HMW-GS gene promoter had additional motifs organized differently. The promoters of most highly expressed x-type HMW-GS genes contain an additional box predicted to bind R2R3-MYB transcriptional factors. However, the differences in annotation between promoter alleles could not be related to their level of expression. In summary, we identified a common modular organization of HMW-GS gene promoters but the lack of correlation between the cis-motifs of each HMW-GS gene promoter and their level of expression suggests that other cis-elements or other mechanisms regulate HMW-GS gene expression.

  10. 2012 Global Summit on Regulatory Science (GSRS-2012)--modernizing toxicology.

    Science.gov (United States)

    Miller, Margaret A; Tong, Weida; Fan, Xiaohui; Slikker, William

    2013-01-01

    Regulatory science encompasses the tools, models, techniques, and studies needed to assess and evaluate product safety, efficacy, quality, and performance. Several recent publications have emphasized the role of regulatory science in improving global health, supporting economic development and fostering innovation. As for other scientific disciplines, research in regulatory science is the critical element underpinning the development and advancement of regulatory science as a modern scientific discipline. As a regulatory agency in the 21st century, the Food and Drug Administration (FDA) has an international component that underpins its domestic mission; foods, drugs, and devices are developed and imported to the United States from across the world. The Global Summit on Regulatory Science, an international conference for discussing innovative technologies, approaches, and partnerships that enhance the translation of basic science into regulatory applications, is providing leadership for the advancement of regulatory sciences within the global context. Held annually, this international conference provides a platform where regulators, policy makers, and bench scientists from various countries can exchange views on how to develop, apply, and implement innovative methodologies into regulatory assessments in their respective countries, as well as developing a harmonized strategy to improve global public health through global collaboration.

  11. 三种植物甾醇调控SRE元件和3T3-L1细胞脂肪化活性的作用%Effects of Three Plant Sterols on Activity of Sterol Regulatory Element and Adipogenesis of 3T3L-1

    Institute of Scientific and Technical Information of China (English)

    陈彦光; 张弦; 刘健

    2013-01-01

    [目的]为了研究植物甾醇对脂质代谢的调控作用.[方法]利用所构建的SRE荧光素酶活性测定系统,体外考察了豆甾醇、β-谷甾醇和菜油甾醇3种常见的植物甾醇对SRE元件的调控活性.[结果]植物甾醇能够增强SRE元件活性.植物甾醇也可以增加3T3-L1细胞的脂肪化作用.[结论]植物甾醇可能正调控脂质的合成.%[Objective] The research aimed to study the regulating effect of plant sterol on lipid metabolism.[Method] Luciferase reporter vector pGL3-basic that contained one or three sterol regulatory element (SRE) was transfected into HepG2,and luciferase activity of three plant sterols (stigmasterol,β-sitosterol and campesterol) was analyzed.[Result] The plant sterols had positive regulator of SRE.And plant sterols could increase adipogenesis of 3T3L-1.[Conclusion] Plant sterols could increase adipogenesis by increasing SRE activity.

  12. Locating protein-coding sequences under selection for additional, overlapping functions in 29 mammalian genomes

    DEFF Research Database (Denmark)

    Lin, Michael F; Kheradpour, Pouya; Washietl, Stefan

    2011-01-01

    synonymous constraint in these regions reflects selection on overlapping functional elements including splicing regulatory elements, dual-coding genes, RNA secondary structures, microRNA target sites, and developmental enhancers. Our results show that overlapping functional elements are common in mammalian...

  13. RNA-Binding Proteins in Trichomonas vaginalis: Atypical Multifunctional Proteins Involved in a Posttranscriptional Iron Regulatory Mechanism

    Science.gov (United States)

    Figueroa-Angulo, Elisa E.; Calla-Choque, Jaeson S.; Mancilla-Olea, Maria Inocente; Arroyo, Rossana

    2015-01-01

    Iron homeostasis is highly regulated in vertebrates through a regulatory system mediated by RNA-protein interactions between the iron regulatory proteins (IRPs) that interact with an iron responsive element (IRE) located in certain mRNAs, dubbed the IRE-IRP regulatory system. Trichomonas vaginalis, the causal agent of trichomoniasis, presents high iron dependency to regulate its growth, metabolism, and virulence properties. Although T. vaginalis lacks IRPs or proteins with aconitase activity, possesses gene expression mechanisms of iron regulation at the transcriptional and posttranscriptional levels. However, only one gene with iron regulation at the transcriptional level has been described. Recently, our research group described an iron posttranscriptional regulatory mechanism in the T. vaginalis tvcp4 and tvcp12 cysteine proteinase mRNAs. The tvcp4 and tvcp12 mRNAs have a stem-loop structure in the 5'-coding region or in the 3'-UTR, respectively that interacts with T. vaginalis multifunctional proteins HSP70, α-Actinin, and Actin under iron starvation condition, causing translation inhibition or mRNA stabilization similar to the previously characterized IRE-IRP system in eukaryotes. Herein, we summarize recent progress and shed some light on atypical RNA-binding proteins that may participate in the iron posttranscriptional regulation in T. vaginalis. PMID:26703754

  14. Rationales for regulatory activity

    Energy Technology Data Exchange (ETDEWEB)

    Perhac, R.M. [Univ. of Tennessee, Knoxville, TN (United States)

    1997-02-01

    The author provides an outline which touches on the types of concerns about risk evaluation which are addressed in the process of establishing regulatory guides. Broadly he says regulatory activity serves three broad constituents: (1) Paternalism (private risk); (2) Promotion of social welfare (public risks); (3) Protection of individual rights (public risks). He then discusses some of the major issues encountered in reaching a decision on what is an acceptable level of risk within each of these areas, and how one establishes such a level.

  15. XcisClique: analysis of regulatory bicliques

    Directory of Open Access Journals (Sweden)

    Grene Ruth

    2006-04-01

    Full Text Available Abstract Background Modeling of cis-elements or regulatory motifs in promoter (upstream regions of genes is a challenging computational problem. In this work, set of regulatory motifs simultaneously present in the promoters of a set of genes is modeled as a biclique in a suitably defined bipartite graph. A biologically meaningful co-occurrence of multiple cis-elements in a gene promoter is assessed by the combined analysis of genomic and gene expression data. Greater statistical significance is associated with a set of genes that shares a common set of regulatory motifs, while simultaneously exhibiting highly correlated gene expression under given experimental conditions. Methods XcisClique, the system developed in this work, is a comprehensive infrastructure that associates annotated genome and gene expression data, models known cis-elements as regular expressions, identifies maximal bicliques in a bipartite gene-motif graph; and ranks bicliques based on their computed statistical significance. Significance is a function of the probability of occurrence of those motifs in a biclique (a hypergeometric distribution, and on the new sum of absolute values statistic (SAV that uses Spearman correlations of gene expression vectors. SAV is a statistic well-suited for this purpose as described in the discussion. Results XcisClique identifies new motif and gene combinations that might indicate as yet unidentified involvement of sets of genes in biological functions and processes. It currently supports Arabidopsis thaliana and can be adapted to other organisms, assuming the existence of annotated genomic sequences, suitable gene expression data, and identified regulatory motifs. A subset of Xcis Clique functionalities, including the motif visualization component MotifSee, source code, and supplementary material are available at https://bioinformatics.cs.vt.edu/xcisclique/.

  16. Phased array ultrasonic inspection of feeder welds - regulatory perspective

    Energy Technology Data Exchange (ETDEWEB)

    Carroll, B.; Kirkhope, K.; Colligan, L.; Valpy, B.; Stevenson, J. [Canadian Nuclear Safety Commission, Ottawa, Ontario (Canada)

    2011-07-01

    The Canadian Nuclear Safety Commission has accepted the application of Phased Array Ultrasonic Testing (PAUT) in lieu of Radiographic Testing for feeder piping replacement at the Point Lepreau and Bruce A Units 1 and 2 refurbishment projects. Background information regarding the principles and elements of the CNSC regulatory approach for the acceptance of PAUT for feeder installation will be discussed, addressing quality management and regulatory oversight activities focused on inspection reliability and dose reduction. CNSC staff's views for future direction on the application of PAUT in lieu of RT in regulatory framework and codes and standards are also discussed. (author)

  17. A SINE in the genome of the cephalochordate amphioxus is an Alu element

    Science.gov (United States)

    Holland, Linda Z.

    2006-01-01

    Transposable elements of about 300 bp, termed “short interspersed nucleotide elements or SINEs are common in eukaryotes. However, Alu elements, SINEs containing restriction sites for the AluI enzyme, have been known only from primates. Here I report the first SINE found in the genome of the cephalochordate, amphioxus. It is an Alu element of 375 bp that does not share substantial identity with any genomic sequences in vertebrates. It was identified because it was located in the FoxD regulatory region in a cosmid derived from one individual, but absent from the two FoxD alleles of BACs from a second individual. However, searches of sequences of BACs and genomic traces from this second individual gave an estimate of 50-100 copies in the amphioxus genome. The finding of an Alu element in amphioxus raises the question of whether Alu elements in amphioxus and primates arose by convergent evolution or by inheritance from a common ancestor. Genome-wide analyses of transposable elements in amphioxus and other chordates such as tunicates, agnathans and cartilaginous fishes could well provide the answer. PMID:16733535

  18. Geostar - Navigation location system

    Science.gov (United States)

    Keyser, Donald A.

    The author describes the Radiodetermination Satellite Service (RDSS). The initial phase of the RDSS provides for a unique service enabling central offices and headquarters to obtain position-location information and receive short digital messages from mobile user terminals throughout the contiguous United States, southern Canada, and northern Mexico. The system employs a spread-spectrum, CDMA modulation technique allowing multiple customers to use the system simultaneously, without preassigned coordination with fellow users. Position location is currently determined by employing an existing radio determination receiver, such as Loran-C, GPS, or Transit, in the mobile user terminal. In the early 1990s position location will be determined at a central earth station by time-differential ranging of the user terminals via two or more geostationary satellites. A brief overview of the RDSS system architecture is presented with emphasis on the user terminal and its diverse applications.

  19. Lost in Location

    DEFF Research Database (Denmark)

    Hansen, Lone Koefoed

    2009-01-01

    The article investigates how users of personal satellite navigation devices (often referred to as sat-nav) are sometimes lost and led astray and argues that the satnav's aim to remove every insecurity about the correct route seems to remove the individual's conscious perception of the space...... performance, the article examines how the growing locative media industry can learn from the location-aware performative strategies employed by artists who create situated and urban performances for the curious participant. The academic frames employed in the analysis draw on psychogeography, site...

  20. Conservation-based prediction of the transcription regulatory region of the SCN1A gene

    Institute of Scientific and Technical Information of China (English)

    Yue-Sheng Long; Yi-Wu Shi; Wei-Ping Liao

    2009-01-01

    A challenge in identifying the transcription regulatory region is that the locations of eukaryotic transcriptional elements are often diverse among different genes.SCN1A,a disease-related sodium channel gene,has a complex 5'-untranslated region and diverse mRNA transcripts,which might be driven by different promoters.By cross-species sequence comparison and bioinformatics analysis,human 5'-untranslated exons were found to be conserved within the region of 200 kb upstream of the 5' flanking regions of SCN1A in higher mammals,but not in lower mammals and non-mammals.The core promoter elements (INR,DPE,and TATA) were found in the regions flanking different 5'-untranslated exons,suggesting that these sequences (from-45 to+35) might be targeted as core promoters.The nucleotide identity rate of these core promoter sequences are different,and the conservation level of the upstream region of each core promoter varies distinctly,implicating different regulatory mechanisms of the four promoters which exist in the nervous system.

  1. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  2. Artificial ants deposit pheromone to search for regulatory DNA elements

    Directory of Open Access Journals (Sweden)

    Liu Yunlong

    2006-08-01

    Full Text Available Abstract Background Identification of transcription-factor binding motifs (DNA sequences can be formulated as a combinatorial problem, where an efficient algorithm is indispensable to predict the role of multiple binding motifs. An ant algorithm is a biology-inspired computational technique, through which a combinatorial problem is solved by mimicking the behavior of social insects such as ants. We developed a unique version of ant algorithms to select a set of binding motifs by considering a potential contribution of each of all random DNA sequences of 4- to 7-bp in length. Results Human chondrogenesis was used as a model system. The results revealed that the ant algorithm was able to identify biologically known binding motifs in chondrogenesis such as AP-1, NFκB, and sox9. Some of the predicted motifs were identical to those previously derived with the genetic algorithm. Unlike the genetic algorithm, however, the ant algorithm was able to evaluate a contribution of individual binding motifs as a spectrum of distributed information and predict core consensus motifs from a wider DNA pool. Conclusion The ant algorithm offers an efficient, reproducible procedure to predict a role of individual transcription-factor binding motifs using a unique definition of artificial ants.

  3. SOS regulatory elements are essential for UPEC pathogenesis.

    Science.gov (United States)

    Li, Birong; Smith, Peter; Horvath, Dennis J; Romesberg, Floyd E; Justice, Sheryl S

    2010-08-01

    Epithelial cells are highly regarded as the first line of defense against microorganisms, but the mechanisms used to control bacterial diseases are poorly understood. A component of the DNA damage repair regulon, SulA, is essential for UPEC virulence in a mouse model for human urinary tract infection, suggesting that DNA damage is a key mediator in the primary control of pathogens within the epithelium. In this study, we examine the role of DNA damage repair regulators in the intracellular lifestyle of UPEC within superficial bladder epithelial cells. LexA and RecA coordinate various operons for repair of DNA damage due to exogenous and endogenous agents and are known regulators of sulA. UPEC strains defective in regulation of the SOS response mediated by RecA and LexA display attenuated virulence in immunocompetent mice within the first 6 h post infection. RecA and LexA regulation of the SOS regulon is dispensable in immunocompromised mice. These data suggest that epithelial cells produce sufficient levels of DNA damaging agents, such that the bacterial DNA damage repair response is essential, as a means to control invading bacteria. Since many pathogens interact with the epithelium before exposure to professional phagocytes, it is likely that adaptation to oxidative radicals during intracellular growth provides additional protection from killing by innate immune phagocytes.

  4. Epigenetic modifications as regulatory elements of autophagy in cancer.

    Science.gov (United States)

    Sui, Xinbing; Zhu, Jing; Zhou, Jichun; Wang, Xian; Li, Da; Han, Weidong; Fang, Yong; Pan, Hongming

    2015-05-01

    Epigenetic modifications have been considered as hallmarks of cancer and play an important role in tumor initiation and development. Epigenetic mechanisms, including DNA methylation, histone modifications, and microRNAs, may regulate cell cycle and apoptosis, as well as macroautophagy (hereafter referred to as autophagy). Autophagy, as a crucial cellular homeostatic mechanism, performs a dual role, having pro-survival or pro-death properties. A variety of signaling pathways including epigenetic control have been implicated in the upregulation or downregulation of autophagy. However, the role of epigenetic regulation in autophagy is still less well acknowledged. Recent studies have linked epigenetic control to the autophagic process. Some epigenetic modifiers are also involved in the regulation of autophagy and potentiate the efficacy of traditional therapeutics. Thus, understanding the novel functions of epigenetic control in autophagy may allow us to develop potential therapeutic approaches for cancer treatment.

  5. Location-routing problems

    Energy Technology Data Exchange (ETDEWEB)

    Laporte, G.

    1987-01-01

    Location-routing problems involve simultaneously locating a number of facilities among candidate sites and establishing delivery routes to a set of users in such a way that the total system cost is minimized. This paper presents a survey of such problems. It includes some applications and examples of location-routing problems, a description of the main heuristics that have been developed for such problems, and reviews of various formulations and algorithms used in solving these problems. A more detailed review is given of exact algorithms for the vehicle routing problem, three-index vehicle flow formulations, and two-index vehicle flow formulations and algorithms for symmetrical and non-symmetrical problems. It is concluded that location-routing problem research is a fast-growing area, with most developments occurring over the past few years; however, research is relatively fragmented, often addresses problems which are too specific and contains several voids which have yet to be filled. A number of promising research areas are identified. 137 refs., 3 figs.

  6. The Czech Locative Chameleon

    Directory of Open Access Journals (Sweden)

    Tarald Taraldsen

    2007-12-01

    Full Text Available We show that under certain circumstances, the Czech locative prepositions (LOC show up as directional prepositions (DIR and vice versa, (under different circumstances the Czech DIR PPs show up as LOC. We argue that such a chameleon life of the PPs is structurally dependent.

  7. The Czech Locative Chameleon

    OpenAIRE

    Tarald Taraldsen; Lucie Medová

    2007-01-01

    We show that under certain circumstances, the Czech locative prepositions (LOC) show up as directional prepositions (DIR) and vice versa, (under different circumstances) the Czech DIR PPs show up as LOC. We argue that such a chameleon life of the PPs is structurally dependent.

  8. Locative Inversion in English

    NARCIS (Netherlands)

    Broekhuis, H.

    2005-01-01

    This article aims at reformulating in more current terms Hoekstra and Mulder’s (1990) analysis of the Locative Inversion (LI) construction. The new proposal is crucially based on the assumption that Small Clause (SC) predicates agree with their external argument in phi-features, which may be morphol

  9. Location-based games

    DEFF Research Database (Denmark)

    Ejsing-Duun, Stine

    In this dissertation, it is explored which prerequisites are necessary in location-based games (LBGs) to make meaningful the meeting between players and spatiality with an emphasis on physical locations. Throughout the dissertation, it has been shown that LBGs affect players’ perception of and be......In this dissertation, it is explored which prerequisites are necessary in location-based games (LBGs) to make meaningful the meeting between players and spatiality with an emphasis on physical locations. Throughout the dissertation, it has been shown that LBGs affect players’ perception...... of and behavior in everyday spaces, as the games reside on the boundaries between the continuums of play and ordinary, authentic and fictional, and as they merge physical and digital media. These are termed the six dimensions of LBGs. LBGs let the player explore the boundaries between these dimensions...... experiences of being in the world and the creation of meaning. The theory on motivation defines what motivation consists of and how it relates to our actions. This theory has been combined with theories concerning play and play culture, digital media, (digital) games, (optimal) experiences, landscape...

  10. RFID Location Algorithm

    Directory of Open Access Journals (Sweden)

    Wang Zi Min

    2016-01-01

    Full Text Available With the development of social services, people’s living standards improve further requirements, there is an urgent need for a way to adapt to the complex situation of the new positioning technology. In recent years, RFID technology have a wide range of applications in all aspects of life and production, such as logistics tracking, car alarm, security and other items. The use of RFID technology to locate, it is a new direction in the eyes of the various research institutions and scholars. RFID positioning technology system stability, the error is small and low-cost advantages of its location algorithm is the focus of this study.This article analyzes the layers of RFID technology targeting methods and algorithms. First, RFID common several basic methods are introduced; Secondly, higher accuracy to political network location method; Finally, LANDMARC algorithm will be described. Through this it can be seen that advanced and efficient algorithms play an important role in increasing RFID positioning accuracy aspects.Finally, the algorithm of RFID location technology are summarized, pointing out the deficiencies in the algorithm, and put forward a follow-up study of the requirements, the vision of a better future RFID positioning technology.

  11. Crime Location Choice

    NARCIS (Netherlands)

    Bernasco, Wim; Ruiter, Stijn

    2014-01-01

    Most behavior of interest to social scientists is choice behavior: actions people commit while they could also have done something else. In geographical and environmental criminology, a new framework has emerged for analyzing individual crime location choice. It is based on the principle of random u

  12. RSAT 2015: Regulatory Sequence Analysis Tools.

    Science.gov (United States)

    Medina-Rivera, Alejandra; Defrance, Matthieu; Sand, Olivier; Herrmann, Carl; Castro-Mondragon, Jaime A; Delerce, Jeremy; Jaeger, Sébastien; Blanchet, Christophe; Vincens, Pierre; Caron, Christophe; Staines, Daniel M; Contreras-Moreira, Bruno; Artufel, Marie; Charbonnier-Khamvongsa, Lucie; Hernandez, Céline; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques

    2015-07-01

    RSAT (Regulatory Sequence Analysis Tools) is a modular software suite for the analysis of cis-regulatory elements in genome sequences. Its main applications are (i) motif discovery, appropriate to genome-wide data sets like ChIP-seq, (ii) transcription factor binding motif analysis (quality assessment, comparisons and clustering), (iii) comparative genomics and (iv) analysis of regulatory variations. Nine new programs have been added to the 43 described in the 2011 NAR Web Software Issue, including a tool to extract sequences from a list of coordinates (fetch-sequences from UCSC), novel programs dedicated to the analysis of regulatory variants from GWAS or population genomics (retrieve-variation-seq and variation-scan), a program to cluster motifs and visualize the similarities as trees (matrix-clustering). To deal with the drastic increase of sequenced genomes, RSAT public sites have been reorganized into taxon-specific servers. The suite is well-documented with tutorials and published protocols. The software suite is available through Web sites, SOAP/WSDL Web services, virtual machines and stand-alone programs at http://www.rsat.eu/.

  13. Regulatory Challenges for Cartilage Repair Technologies.

    Science.gov (United States)

    McGowan, Kevin B; Stiegman, Glenn

    2013-01-01

    In the United States, few Food and Drug Administration (FDA)-approved options exist for the treatment of focal cartilage and osteochondral lesions. Developers of products for cartilage repair face many challenges to obtain marketing approval from the FDA. The objective of this review is to discuss the necessary steps for FDA application and approval for a new cartilage repair product. FDA Guidance Documents, FDA Panel Meetings, scientific organization recommendations, and clinicaltrials.gov were reviewed to demonstrate the current thinking of FDA and the scientific community on the regulatory process for cartilage repair therapies. Cartilage repair therapies can receive market approval from FDA as medical devices, drugs, or biologics, and the specific classification of product can affect the nonclinical, clinical, and regulatory strategy to bring the product to market. Recent FDA guidance gives an outline of the required elements to bring a cartilage repair product to market, although these standards are often very general. As a result, companies have to carefully craft their study patient population, comparator group, and clinical endpoint to best showcase their product's attributes. In addition, regulatory strategy and manufacturing process validation need to be considered early in the clinical study process to allow for timely product approval following the completion of clinical study. Although the path to regulatory approval for a cartilage repair therapy is challenging and time-consuming, proper clinical trial planning and attention to the details can eventually save companies time and money by bringing a product to the market in the most expeditious process possible.

  14. Element Research.

    Science.gov (United States)

    Herald, Christine

    2001-01-01

    Describes a research assignment for 8th grade students on the elements of the periodic table. Students use web-based resources and a chemistry handbook to gather information, construct concept maps, and present the findings to the full class using the mode of their choice: a humorous story, a slideshow or gameboard, a brochure, a song, or skit.…

  15. Electric current locator

    Science.gov (United States)

    King, Paul E [Corvallis, OR; Woodside, Charles Rigel [Corvallis, OR

    2012-02-07

    The disclosure herein provides an apparatus for location of a quantity of current vectors in an electrical device, where the current vector has a known direction and a known relative magnitude to an input current supplied to the electrical device. Mathematical constants used in Biot-Savart superposition equations are determined for the electrical device, the orientation of the apparatus, and relative magnitude of the current vector and the input current, and the apparatus utilizes magnetic field sensors oriented to a sensing plane to provide current vector location based on the solution of the Biot-Savart superposition equations. Description of required orientations between the apparatus and the electrical device are disclosed and various methods of determining the mathematical constants are presented.

  16. Main: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 S000319 7-Sep-2000 (last modified) seki Element 1 found in the promo...ter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Locate...Element 2 share a common motif; See S000320; nodule; leghaemoglobin; lbc3; root; Soybean (Glycine max) GATATATTAATATTTTATTTTATA ...

  17. Superheavy elements: existence, classification and experiment

    OpenAIRE

    Kostyghin, V. A.; Vaschenko, V. M.; Loza, Ye. A.

    2012-01-01

    This paper proposes spatial periodic table developed based on classic electron shell structure model. The periodic table determines location and chemical properties of superheavy elements. 14 new long-living superheavy elements found by Proton-21 laboratory and one long-living superheavy element found by A.Marinov were identified.

  18. Nuclear Regulatory Commission information digest

    Energy Technology Data Exchange (ETDEWEB)

    None,

    1990-03-01

    The Nuclear Regulatory Commission information digest provides summary information regarding the US Nuclear Regulatory Commission, its regulatory responsibilities, and areas licensed by the commission. This is an annual publication for the general use of the NRC Staff and is available to the public. The digest is divided into two parts: the first presents an overview of the US Nuclear Regulatory Commission and the second provides data on NRC commercial nuclear reactor licensees and commercial nuclear power reactors worldwide.

  19. A Retroviral Promoter and a Cellular Enhancer Define a Bipartite Element Which Controls env ERVWE1 Placental Expression

    Science.gov (United States)

    Prudhomme, Sarah; Oriol, Guy; Mallet, François

    2004-01-01

    T