WorldWideScience

Sample records for regulates dna methylation

  1. Regulation and function of DNA methylation in plants and animals

    KAUST Repository

    He, Xinjian

    2011-02-15

    DNA methylation is an important epigenetic mark involved in diverse biological processes. In plants, DNA methylation can be established through the RNA-directed DNA methylation pathway, an RNA interference pathway for transcriptional gene silencing (TGS), which requires 24-nt small interfering RNAs. In mammals, de novo DNA methylation occurs primarily at two developmental stages: during early embryogenesis and during gametogenesis. While it is not clear whether establishment of DNA methylation patterns in mammals involves RNA interference in general, de novo DNA methylation and suppression of transposons in germ cells require 24-32-nt piwi-interacting small RNAs. DNA methylation status is dynamically regulated by DNA methylation and demethylation reactions. In plants, active DNA demethylation relies on the repressor of silencing 1 family of bifunctional DNA glycosylases, which remove the 5-methylcytosine base and then cleave the DNA backbone at the abasic site, initiating a base excision repair (BER) pathway. In animals, multiple mechanisms of active DNA demethylation have been proposed, including a deaminase- and DNA glycosylase-initiated BER pathway. New information concerning the effects of various histone modifications on the establishment and maintenance of DNA methylation has broadened our understanding of the regulation of DNA methylation. The function of DNA methylation in plants and animals is also discussed in this review. © 2011 IBCB, SIBS, CAS All rights reserved.

  2. DNA methylation regulates neurophysiological spatial representation in memory formation

    Directory of Open Access Journals (Sweden)

    Eric D. Roth

    2015-04-01

    Full Text Available Epigenetic mechanisms including altered DNA methylation are critical for altered gene transcription subserving synaptic plasticity and the retention of learned behavior. Here, we tested the idea that one role for activity-dependent altered DNA methylation is stabilization of cognition-associated hippocampal place cell firing in response to novel place learning. We observed that a behavioral protocol (spatial exploration of a novel environment known to induce hippocampal place cell remapping resulted in alterations of hippocampal Bdnf DNA methylation. Further studies using neurophysiological in vivo single-unit recordings revealed that pharmacological manipulations of DNA methylation decreased long-term but not short-term place field stability. Together, our data highlight a role for DNA methylation in regulating neurophysiological spatial representation and memory formation.

  3. DNA methylation regulates neurophysiological spatial representation in memory formation.

    Science.gov (United States)

    Roth, Eric D; Roth, Tania L; Money, Kelli M; SenGupta, Sonda; Eason, Dawn E; Sweatt, J David

    2015-04-01

    Epigenetic mechanisms including altered DNA methylation are critical for altered gene transcription subserving synaptic plasticity and the retention of learned behavior. Here we tested the idea that one role for activity-dependent altered DNA methylation is stabilization of cognition-associated hippocampal place cell firing in response to novel place learning. We observed that a behavioral protocol (spatial exploration of a novel environment) known to induce hippocampal place cell remapping resulted in alterations of hippocampal Bdnf DNA methylation. Further studies using neurophysiological in vivo single unit recordings revealed that pharmacological manipulations of DNA methylation decreased long-term but not short-term place field stability. Together our data highlight a role for DNA methylation in regulating neurophysiological spatial representation and memory formation.

  4. Epigenetic regulation during fetal femur development: DNA methylation matters.

    Directory of Open Access Journals (Sweden)

    María C de Andrés

    Full Text Available Epigenetic modifications are heritable changes in gene expression without changes in DNA sequence. DNA methylation has been implicated in the control of several cellular processes including differentiation, gene regulation, development, genomic imprinting and X-chromosome inactivation. Methylated cytosine residues at CpG dinucleotides are commonly associated with gene repression; conversely, strategic loss of methylation during development could lead to activation of lineage-specific genes. Evidence is emerging that bone development and growth are programmed; although, interestingly, bone is constantly remodelled throughout life. Using human embryonic stem cells, human fetal bone cells (HFBCs, adult chondrocytes and STRO-1(+ marrow stromal cells from human bone marrow, we have examined a spectrum of developmental stages of femur development and the role of DNA methylation therein. Using pyrosequencing methodology we analysed the status of methylation of genes implicated in bone biology; furthermore, we correlated these methylation levels with gene expression levels using qRT-PCR and protein distribution during fetal development evaluated using immunohistochemistry. We found that during fetal femur development DNA methylation inversely correlates with expression of genes including iNOS (NOS2 and COL9A1, but not catabolic genes including MMP13 and IL1B. Furthermore, significant demethylation was evident in the osteocalcin promoter between the fetal and adult developmental stages. Increased TET1 expression and decreased expression of DNA (cytosine-5--methyltransferase 1 (DNMT1 in adult chondrocytes compared to HFBCs could contribute to the loss of methylation observed during fetal development. HFBC multipotency confirms these cells to be an ideal developmental system for investigation of DNA methylation regulation. In conclusion, these findings demonstrate the role of epigenetic regulation, specifically DNA methylation, in bone development

  5. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

  6. Hemi-methylated DNA regulates DNA methylation inheritance through allosteric activation of H3 ubiquitylation by UHRF1.

    Science.gov (United States)

    Harrison, Joseph S; Cornett, Evan M; Goldfarb, Dennis; DaRosa, Paul A; Li, Zimeng M; Yan, Feng; Dickson, Bradley M; Guo, Angela H; Cantu, Daniel V; Kaustov, Lilia; Brown, Peter J; Arrowsmith, Cheryl H; Erie, Dorothy A; Major, Michael B; Klevit, Rachel E; Krajewski, Krzysztof; Kuhlman, Brian; Strahl, Brian D; Rothbart, Scott B

    2016-09-06

    The epigenetic inheritance of DNA methylation requires UHRF1, a histone- and DNA-binding RING E3 ubiquitin ligase that recruits DNMT1 to sites of newly replicated DNA through ubiquitylation of histone H3. UHRF1 binds DNA with selectivity towards hemi-methylated CpGs (HeDNA); however, the contribution of HeDNA sensing to UHRF1 function remains elusive. Here, we reveal that the interaction of UHRF1 with HeDNA is required for DNA methylation but is dispensable for chromatin interaction, which is governed by reciprocal positive cooperativity between the UHRF1 histone- and DNA-binding domains. HeDNA recognition activates UHRF1 ubiquitylation towards multiple lysines on the H3 tail adjacent to the UHRF1 histone-binding site. Collectively, our studies are the first demonstrations of a DNA-protein interaction and an epigenetic modification directly regulating E3 ubiquitin ligase activity. They also define an orchestrated epigenetic control mechanism involving modifications both to histones and DNA that facilitate UHRF1 chromatin targeting, H3 ubiquitylation, and DNA methylation inheritance.

  7. DNA Tumor Virus Regulation of Host DNA Methylation and Its Implications for Immune Evasion and Oncogenesis.

    Science.gov (United States)

    Kuss-Duerkop, Sharon K; Westrich, Joseph A; Pyeon, Dohun

    2018-02-13

    Viruses have evolved various mechanisms to evade host immunity and ensure efficient viral replication and persistence. Several DNA tumor viruses modulate host DNA methyltransferases for epigenetic dysregulation of immune-related gene expression in host cells. The host immune responses suppressed by virus-induced aberrant DNA methylation are also frequently involved in antitumor immune responses. Here, we describe viral mechanisms and virus-host interactions by which DNA tumor viruses regulate host DNA methylation to evade antiviral immunity, which may contribute to the generation of an immunosuppressive microenvironment during cancer development. Recent trials of immunotherapies have shown promising results to treat multiple cancers; however, a significant number of non-responders necessitate identifying additional targets for cancer immunotherapies. Thus, understanding immune evasion mechanisms of cancer-causing viruses may provide great insights for reversing immune suppression to prevent and treat associated cancers.

  8. DNA Tumor Virus Regulation of Host DNA Methylation and Its Implications for Immune Evasion and Oncogenesis

    Directory of Open Access Journals (Sweden)

    Sharon K. Kuss-Duerkop

    2018-02-01

    Full Text Available Viruses have evolved various mechanisms to evade host immunity and ensure efficient viral replication and persistence. Several DNA tumor viruses modulate host DNA methyltransferases for epigenetic dysregulation of immune-related gene expression in host cells. The host immune responses suppressed by virus-induced aberrant DNA methylation are also frequently involved in antitumor immune responses. Here, we describe viral mechanisms and virus–host interactions by which DNA tumor viruses regulate host DNA methylation to evade antiviral immunity, which may contribute to the generation of an immunosuppressive microenvironment during cancer development. Recent trials of immunotherapies have shown promising results to treat multiple cancers; however, a significant number of non-responders necessitate identifying additional targets for cancer immunotherapies. Thus, understanding immune evasion mechanisms of cancer-causing viruses may provide great insights for reversing immune suppression to prevent and treat associated cancers.

  9. DNA methylation regulates transcriptional homeostasis of algal endosymbiosis in the coral model Aiptasia

    KAUST Repository

    Li, Yong; Liew, Yi Jin; Cui, Guoxin; Cziesielski, Maha J; Zahran, Noura Ibrahim Omar; Michell, Craig T; Voolstra, Christian R.; Aranda, Manuel

    2017-01-01

    The symbiotic relationship between cnidarians and dinoflagellates is the cornerstone of coral reef ecosystems. Although research is focusing on the molecular mechanisms underlying this symbiosis, the role of epigenetic mechanisms, which have been implicated in transcriptional regulation and acclimation to environmental change, is unknown. To assess the role of DNA methylation in the cnidarian-dinoflagellate symbiosis, we analyzed genome-wide CpG methylation, histone associations, and transcriptomic states of symbiotic and aposymbiotic anemones in the model system Aiptasia. We find methylated genes are marked by histone H3K36me3 and show significant reduction of spurious transcription and transcriptional noise, revealing a role of DNA methylation in the maintenance of transcriptional homeostasis. Changes in DNA methylation and expression show enrichment for symbiosis-related processes such as immunity, apoptosis, phagocytosis recognition and phagosome formation, and unveil intricate interactions between the underlying pathways. Our results demonstrate that DNA methylation provides an epigenetic mechanism of transcriptional homeostasis during symbiosis.

  10. DNA methylation regulates transcriptional homeostasis of algal endosymbiosis in the coral model Aiptasia

    KAUST Repository

    Li, Yong

    2017-11-03

    The symbiotic relationship between cnidarians and dinoflagellates is the cornerstone of coral reef ecosystems. Although research is focusing on the molecular mechanisms underlying this symbiosis, the role of epigenetic mechanisms, which have been implicated in transcriptional regulation and acclimation to environmental change, is unknown. To assess the role of DNA methylation in the cnidarian-dinoflagellate symbiosis, we analyzed genome-wide CpG methylation, histone associations, and transcriptomic states of symbiotic and aposymbiotic anemones in the model system Aiptasia. We find methylated genes are marked by histone H3K36me3 and show significant reduction of spurious transcription and transcriptional noise, revealing a role of DNA methylation in the maintenance of transcriptional homeostasis. Changes in DNA methylation and expression show enrichment for symbiosis-related processes such as immunity, apoptosis, phagocytosis recognition and phagosome formation, and unveil intricate interactions between the underlying pathways. Our results demonstrate that DNA methylation provides an epigenetic mechanism of transcriptional homeostasis during symbiosis.

  11. Global DNA methylation synergistically regulates the nuclear and mitochondrial genomes in glioblastoma cells.

    Science.gov (United States)

    Sun, Xin; Johnson, Jacqueline; St John, Justin C

    2018-05-02

    Replication of mitochondrial DNA is strictly regulated during differentiation and development allowing each cell type to acquire its required mtDNA copy number to meet its specific needs for energy. Undifferentiated cells establish the mtDNA set point, which provides low numbers of mtDNA copy but sufficient template for replication once cells commit to specific lineages. However, cancer cells, such as those from the human glioblastoma multiforme cell line, HSR-GBM1, cannot complete differentiation as they fail to enforce the mtDNA set point and are trapped in a 'pseudo-differentiated' state. Global DNA methylation is likely to be a major contributing factor, as DNA demethylation treatments promote differentiation of HSR-GBM1 cells. To determine the relationship between DNA methylation and mtDNA copy number in cancer cells, we applied whole genome MeDIP-Seq and RNA-Seq to HSR-GBM1 cells and following their treatment with the DNA demethylation agents 5-azacytidine and vitamin C. We identified key methylated regions modulated by the DNA demethylation agents that also induced synchronous changes to mtDNA copy number and nuclear gene expression. Our findings highlight the control exerted by DNA methylation on the expression of key genes, the regulation of mtDNA copy number and establishment of the mtDNA set point, which collectively contribute to tumorigenesis.

  12. Parvovirus b19 DNA CpG dinucleotide methylation and epigenetic regulation of viral expression.

    Directory of Open Access Journals (Sweden)

    Francesca Bonvicini

    Full Text Available CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression.The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections.The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19.

  13. Parvovirus B19 DNA CpG Dinucleotide Methylation and Epigenetic Regulation of Viral Expression

    Science.gov (United States)

    Bonvicini, Francesca; Manaresi, Elisabetta; Di Furio, Francesca; De Falco, Luisa; Gallinella, Giorgio

    2012-01-01

    CpG DNA methylation is one of the main epigenetic modifications playing a role in the control of gene expression. For DNA viruses whose genome has the ability to integrate in the host genome or to maintain as a latent episome, a correlation has been found between the extent of DNA methylation and viral quiescence. No information is available for Parvovirus B19, a human pathogenic virus, which is capable of both lytic and persistent infections. Within Parvovirus B19 genome, the inverted terminal regions display all the characteristic signatures of a genomic CpG island; therefore we hypothesised a role of CpG dinucleotide methylation in the regulation of viral genome expression. The analysis of CpG dinucleotide methylation of Parvovirus B19 DNA was carried out by an aptly designed quantitative real-time PCR assay on bisulfite-modified DNA. The effects of CpG methylation on the regulation of viral genome expression were first investigated by transfection of either unmethylated or in vitro methylated viral DNA in a model cell line, showing that methylation of viral DNA was correlated to lower expression levels of the viral genome. Then, in the course of in vitro infections in different cellular environments, it was observed that absence of viral expression and genome replication were both correlated to increasing levels of CpG methylation of viral DNA. Finally, the presence of CpG methylation was documented in viral DNA present in bioptic samples, indicating the occurrence and a possible role of this epigenetic modification in the course of natural infections. The presence of an epigenetic level of regulation of viral genome expression, possibly correlated to the silencing of the viral genome and contributing to the maintenance of the virus in tissues, can be relevant to the balance and outcome of the different types of infection associated to Parvovirus B19. PMID:22413013

  14. Regulation of DNA Methylation Patterns by CK2-Mediated Phosphorylation of Dnmt3a

    Directory of Open Access Journals (Sweden)

    Rachel Deplus

    2014-08-01

    Full Text Available DNA methylation is a central epigenetic modification that is established by de novo DNA methyltransferases. The mechanisms underlying the generation of genomic methylation patterns are still poorly understood. Using mass spectrometry and a phosphospecific Dnmt3a antibody, we demonstrate that CK2 phosphorylates endogenous Dnmt3a at two key residues located near its PWWP domain, thereby downregulating the ability of Dnmt3a to methylate DNA. Genome-wide DNA methylation analysis shows that CK2 primarily modulates CpG methylation of several repeats, most notably of Alu SINEs. This modulation can be directly attributed to CK2-mediated phosphorylation of Dnmt3a. We also find that CK2-mediated phosphorylation is required for localization of Dnmt3a to heterochromatin. By revealing phosphorylation as a mode of regulation of de novo DNA methyltransferase function and by uncovering a mechanism for the regulation of methylation at repetitive elements, our results shed light on the origin of DNA methylation patterns.

  15. Tcf4 Regulates Synaptic Plasticity, DNA Methylation, and Memory Function

    Directory of Open Access Journals (Sweden)

    Andrew J. Kennedy

    2016-09-01

    Full Text Available Human haploinsufficiency of the transcription factor Tcf4 leads to a rare autism spectrum disorder called Pitt-Hopkins syndrome (PTHS, which is associated with severe language impairment and development delay. Here, we demonstrate that Tcf4 haploinsufficient mice have deficits in social interaction, ultrasonic vocalization, prepulse inhibition, and spatial and associative learning and memory. Despite learning deficits, Tcf4(+/− mice have enhanced long-term potentiation in the CA1 area of the hippocampus. In translationally oriented studies, we found that small-molecule HDAC inhibitors normalized hippocampal LTP and memory recall. A comprehensive set of next-generation sequencing experiments of hippocampal mRNA and methylated DNA isolated from Tcf4-deficient and WT mice before or shortly after experiential learning, with or without administration of vorinostat, identified “memory-associated” genes modulated by HDAC inhibition and dysregulated by Tcf4 haploinsufficiency. Finally, we observed that Hdac2 isoform-selective knockdown was sufficient to rescue memory deficits in Tcf4(+/− mice.

  16. Tcf4 Regulates Synaptic Plasticity, DNA Methylation, and Memory Function.

    Science.gov (United States)

    Kennedy, Andrew J; Rahn, Elizabeth J; Paulukaitis, Brynna S; Savell, Katherine E; Kordasiewicz, Holly B; Wang, Jing; Lewis, John W; Posey, Jessica; Strange, Sarah K; Guzman-Karlsson, Mikael C; Phillips, Scott E; Decker, Kyle; Motley, S Timothy; Swayze, Eric E; Ecker, David J; Michael, Todd P; Day, Jeremy J; Sweatt, J David

    2016-09-06

    Human haploinsufficiency of the transcription factor Tcf4 leads to a rare autism spectrum disorder called Pitt-Hopkins syndrome (PTHS), which is associated with severe language impairment and development delay. Here, we demonstrate that Tcf4 haploinsufficient mice have deficits in social interaction, ultrasonic vocalization, prepulse inhibition, and spatial and associative learning and memory. Despite learning deficits, Tcf4(+/-) mice have enhanced long-term potentiation in the CA1 area of the hippocampus. In translationally oriented studies, we found that small-molecule HDAC inhibitors normalized hippocampal LTP and memory recall. A comprehensive set of next-generation sequencing experiments of hippocampal mRNA and methylated DNA isolated from Tcf4-deficient and WT mice before or shortly after experiential learning, with or without administration of vorinostat, identified "memory-associated" genes modulated by HDAC inhibition and dysregulated by Tcf4 haploinsufficiency. Finally, we observed that Hdac2 isoform-selective knockdown was sufficient to rescue memory deficits in Tcf4(+/-) mice. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  17. Regulation of DNA methylation on EEF1D and RPL8 expression in cattle.

    Science.gov (United States)

    Liu, Xuan; Yang, Jie; Zhang, Qin; Jiang, Li

    2017-10-01

    Dynamic changes to the epigenome play a critical role in a variety of biology processes and complex traits. Many important candidate genes have been identified through our previous genome wide association study (GWAS) on milk production traits in dairy cattle. However, the underlying mechanism of candidate genes have not yet been clearly understood. In this study, we analyzed the methylation variation of the candidate genes, EEF1D and RPL8, which were identified to be strongly associated with milk production traits in dairy cattle in our previous studies, and its effect on protein and mRNA expression. We compared DNA methylation profiles and gene expression levels of EEF1D and RPL8 in five different tissues (heart, liver, mammary gland, ovary and muscle) of three cows. Both genes showed the highest expression level in mammary gland. For RPL8, there was no difference in the DNA methylation pattern in the five tissues, suggesting no effect of DNA methylation on gene expression. For EEF1D, the DNA methylation levels of its first CpG island differed in the five tissues and were negatively correlated with the gene expression levels. To further investigate the function of DNA methylation on the expression of EEF1D, we collected blood samples of three cows at early stage of lactation and in dry period and analyzed its expression and the methylation status of the first CpG island in blood. As a result, the mRNA expression of EEF1D in the dry period was higher than that at the early stage of lactation, while the DNA methylation level in the dry period was lower than that at the early stage of lactation. Our result suggests that the DNA methylation of EEF1D plays an important role in the spatial and temporal regulation of its expression and possibly have an effect on the milk production traits.

  18. Transcription of hepatitis B virus covalently closed circular DNA is regulated by CpG methylation during chronic infection.

    Directory of Open Access Journals (Sweden)

    Yongmei Zhang

    Full Text Available The persistence of hepatitis B virus (HBV infection is maintained by the nuclear viral covalently closed circular DNA (cccDNA, which serves as transcription template for viral mRNAs. Previous studies suggested that cccDNA contains methylation-prone CpG islands, and that the minichromosome structure of cccDNA is epigenetically regulated by DNA methylation. However, the regulatory effect of each CpG island methylation on cccDNA activity remains elusive. In the present study, we analyzed the distribution of CpG methylation within cccDNA in patient samples and investigated the impact of CpG island methylation on cccDNA-driven virus replication. Our study revealed the following observations: 1 Bisulfite sequencing of cccDNA from chronic hepatitis B patients indicated that CpG island I was seldom methylated, 2 CpG island II methylation was correlated to the low level of serum HBV DNA in patients, and in vitro methylation studies confirmed that CpG island II methylation markedly reduced cccDNA transcription and subsequent viral core DNA replication, 3 CpG island III methylation was associated with low serum HBsAg titers, and 4 Furthermore, we found that HBV genotype, HBeAg positivity, and patient age and liver fibrosis stage were also relevant to cccDNA CpG methylation status. Therefore, we clearly demonstrated that the status of cccDNA methylation is connected to the biological behavior of HBV. Taken together, our study provides a complete profile of CpG island methylation within HBV cccDNA and new insights for the function of CpG methylation in regulating HBV cccDNA transcription.

  19. Regulation and function of DNA methylation in plants and animals

    KAUST Repository

    He, Xinjian; Chen, Taiping; Zhu, Jian-Kang

    2011-01-01

    ) pathway. In animals, multiple mechanisms of active DNA demethylation have been proposed, including a deaminase- and DNA glycosylase-initiated BER pathway. New information concerning the effects of various histone modifications on the establishment

  20. Genome-Wide Expression of MicroRNAs Is Regulated by DNA Methylation in Hepatocarcinogenesis

    Directory of Open Access Journals (Sweden)

    Jing Shen

    2015-01-01

    Full Text Available Background. Previous studies, including ours, have examined the regulation of microRNAs (miRNAs by DNA methylation, but whether this regulation occurs at a genome-wide level in hepatocellular carcinoma (HCC is unclear. Subjects/Methods. Using a two-phase study design, we conducted genome-wide screening for DNA methylation and miRNA expression to explore the potential role of methylation alterations in miRNAs regulation. Results. We found that expressions of 25 miRNAs were statistically significantly different between tumor and nontumor tissues and perfectly differentiated HCC tumor from nontumor. Six miRNAs were overexpressed, and 19 were repressed in tumors. Among 133 miRNAs with inverse correlations between methylation and expression, 8 miRNAs (6% showed statistically significant differences in expression between tumor and nontumor tissues. Six miRNAs were validated in 56 additional paired HCC tissues, and significant inverse correlations were observed for miR-125b and miR-199a, which is consistent with the inactive chromatin pattern found in HepG2 cells. Conclusion. These data suggest that the expressions of miR-125b and miR-199a are dramatically regulated by DNA hypermethylation that plays a key role in hepatocarcinogenesis.

  1. Metformin regulates global DNA methylation via mitochondrial one-carbon metabolism.

    Science.gov (United States)

    Cuyàs, E; Fernández-Arroyo, S; Verdura, S; García, R Á-F; Stursa, J; Werner, L; Blanco-González, E; Montes-Bayón, M; Joven, J; Viollet, B; Neuzil, J; Menendez, J A

    2018-02-15

    The anti-diabetic biguanide metformin may exert health-promoting effects via metabolic regulation of the epigenome. Here we show that metformin promotes global DNA methylation in non-cancerous, cancer-prone and metastatic cancer cells by decreasing S-adenosylhomocysteine (SAH), a strong feedback inhibitor of S-adenosylmethionine (SAM)-dependent DNA methyltransferases, while promoting the accumulation of SAM, the universal methyl donor for cellular methylation. Using metformin and a mitochondria/complex I (mCI)-targeted analog of metformin (norMitoMet) in experimental pairs of wild-type and AMP-activated protein kinase (AMPK)-, serine hydroxymethyltransferase 2 (SHMT2)- and mCI-null cells, we provide evidence that metformin increases the SAM:SAH ratio-related methylation capacity by targeting the coupling between serine mitochondrial one-carbon flux and CI activity. By increasing the contribution of one-carbon units to the SAM from folate stores while decreasing SAH in response to AMPK-sensed energetic crisis, metformin can operate as a metabolo-epigenetic regulator capable of reprogramming one of the key conduits linking cellular metabolism to the DNA methylation machinery.

  2. Aberrant regulation of DNA methylation in amyotrophic lateral sclerosis: a new target of disease mechanisms.

    Science.gov (United States)

    Martin, Lee J; Wong, Margaret

    2013-10-01

    Amyotrophic lateral sclerosis (ALS) is the third most common adult-onset neurodegenerative disease. A diagnosis is fatal owing to degeneration of motor neurons in brain and spinal cord that control swallowing, breathing, and movement. ALS can be inherited, but most cases are not associated with a family history of the disease. The mechanisms causing motor neuron death in ALS are still unknown. Given the suspected complex interplay between multiple genes, the environment, metabolism, and lifestyle in the pathogenesis of ALS, we have hypothesized that the mechanisms of disease in ALS involve epigenetic contributions that can drive motor neuron degeneration. DNA methylation is an epigenetic mechanism for gene regulation engaged by DNA methyltransferase (Dnmt)-catalyzed methyl group transfer to carbon-5 in cytosine residues in gene regulatory promoter and nonpromoter regions. Recent genome-wide analyses have found differential gene methylation in human ALS. Neuropathologic assessments have revealed that motor neurons in human ALS show significant abnormalities in Dnmt1, Dnmt3a, and 5-methylcytosine. Similar changes are seen in mice with motor neuron degeneration, and Dnmt3a was found abundantly at synapses and in mitochondria. During apoptosis of cultured motor neuron-like cells, Dnmt1 and Dnmt3a protein levels increase, and 5-methylcytosine accumulates. Enforced expression of Dnmt3a, but not Dnmt1, induces degeneration of cultured neurons. Truncation mutation of the Dnmt3a catalytic domain and Dnmt3a RNAi blocks apoptosis of cultured neurons. Inhibition of Dnmt catalytic activity with small molecules RG108 and procainamide protects motor neurons from excessive DNA methylation and apoptosis in cell culture and in a mouse model of ALS. Thus, motor neurons can engage epigenetic mechanisms to cause their degeneration, involving Dnmts and increased DNA methylation. Aberrant DNA methylation in vulnerable cells is a new direction for discovering mechanisms of ALS

  3. Does DNA methylation regulate metamorphosis? The case of the sea lamprey (Petromyzon marinus) as an example.

    Science.gov (United States)

    Covelo-Soto, Lara; Saura, María; Morán, Paloma

    2015-07-01

    Lampreys represent one of the most ancient vertebrate lineages enclosing a special interest for genetic and epigenetic studies. The sea lamprey (Petromyzon marinus) is an anadromous species that experiences metamorphosis all the way up to the adult stage. Although representing a gradual process, metamorphosis in this species involves dramatic conversions with regard to physiological together with structural body changes preparing individuals for a marine and parasitic life; in consequence, multiple gene expression modifications are expected. The implications of thyroid hormones and HOX gene expression changes have previously been reported in this species and also in other vertebrate species. Nonetheless, information lacks on how these genes are regulated in lampreys. We here report about the existence of methylation pattern differences between the adult and the larvae sea lamprey life cycle stages making use of the Methylation-Sensitive Amplified Polymorphism (MSAP) technique. Differentially methylated fragment sequencing allowed to establish homologous identities with HOX genes involved in morphogenesis, along with genes related to the water balance and to the osmotic homoeostasis, all associated to a marine environment adaptation. These results provide evidences revealing that DNA methylation plays a role in the epigenetic regulation of the P. marinus post-natal development representing a starting point for future studies. To the best of our knowledge, this is the first study which detects DNA methylation changes associated with metamorphosis in lampreys. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Methylation of DNA Ligase 1 by G9a/GLP Recruits UHRF1 to Replicating DNA and Regulates DNA Methylation.

    Science.gov (United States)

    Ferry, Laure; Fournier, Alexandra; Tsusaka, Takeshi; Adelmant, Guillaume; Shimazu, Tadahiro; Matano, Shohei; Kirsh, Olivier; Amouroux, Rachel; Dohmae, Naoshi; Suzuki, Takehiro; Filion, Guillaume J; Deng, Wen; de Dieuleveult, Maud; Fritsch, Lauriane; Kudithipudi, Srikanth; Jeltsch, Albert; Leonhardt, Heinrich; Hajkova, Petra; Marto, Jarrod A; Arita, Kyohei; Shinkai, Yoichi; Defossez, Pierre-Antoine

    2017-08-17

    DNA methylation is an essential epigenetic mark in mammals that has to be re-established after each round of DNA replication. The protein UHRF1 is essential for this process; it has been proposed that the protein targets newly replicated DNA by cooperatively binding hemi-methylated DNA and H3K9me2/3, but this model leaves a number of questions unanswered. Here, we present evidence for a direct recruitment of UHRF1 by the replication machinery via DNA ligase 1 (LIG1). A histone H3K9-like mimic within LIG1 is methylated by G9a and GLP and, compared with H3K9me2/3, more avidly binds UHRF1. Interaction with methylated LIG1 promotes the recruitment of UHRF1 to DNA replication sites and is required for DNA methylation maintenance. These results further elucidate the function of UHRF1, identify a non-histone target of G9a and GLP, and provide an example of a histone mimic that coordinates DNA replication and DNA methylation maintenance. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. CDKL5 is a brain MeCP2 target gene regulated by DNA methylation.

    Science.gov (United States)

    Carouge, Delphine; Host, Lionel; Aunis, Dominique; Zwiller, Jean; Anglard, Patrick

    2010-06-01

    Rett syndrome and its "early-onset seizure" variant are severe neurodevelopmental disorders associated with mutations within the MECP2 and the CDKL5 genes. Antidepressants and drugs of abuse induce the expression of the epigenetic factor MeCP2, thereby influencing chromatin remodeling. We show that increased MeCP2 levels resulted in the repression of Cdkl5 in rat brain structures in response to cocaine, as well as in cells exposed to serotonin, or overexpressing MeCP2. In contrast, Cdkl5 was induced by siRNA-mediated knockdown of Mecp2 and by DNA-methyltransferase inhibitors, demonstrating its regulation by MeCP2 and by DNA methylation. Cdkl5 gene methylation and its methylation-dependent binding to MeCP2 were increased in the striatum of cocaine-treated rats. Our data demonstrate that Cdkl5 is a MeCP2-repressed target gene providing a link between genes the mutation of which generates overlapping symptoms. They highlight DNA methylation changes as a potential mechanism participating in the long-term plasticity triggered by pharmacological agents.

  6. DNA methylation patterns provide insight into epigenetic regulation in the Pacific oyster (Crassostrea gigas

    Directory of Open Access Journals (Sweden)

    Gavery Mackenzie R

    2010-08-01

    Full Text Available Abstract Background DNA methylation is an epigenetic mechanism with important regulatory functions in animals. While the mechanism itself is evolutionarily ancient, the distribution and function of DNA methylation is diverse both within and among phylogenetic groups. Although DNA methylation has been well studied in mammals, there are limited data on invertebrates, particularly molluscs. Here we characterize the distribution and investigate potential functions of DNA methylation in the Pacific oyster (Crassostrea gigas. Results Methylation sensitive PCR and bisulfite sequencing PCR approaches were used to identify CpG methylation in C. gigas genes and demonstrated that this species possesses intragenic methylation. In silico analysis of CpGo/e ratios in publicly available sequence data suggests that DNA methylation is a common feature of the C. gigas genome, and that specific functional categories of genes have significantly different levels of methylation. Conclusions The Pacific oyster genome displays intragenic DNA methylation and contains genes necessary for DNA methylation in animals. Results of this investigation suggest that DNA methylation has regulatory functions in Crassostrea gigas, particularly in gene families that have inducible expression, including those involved in stress and environmental responses.

  7. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations

    Energy Technology Data Exchange (ETDEWEB)

    Fortes, F.P. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Kuasne, H. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Marchi, F.A. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Programa Inter-Institucional em Bioinformtica, Instituto de Matemtica e Estatstica, Universidade So Paulo, So Paulo, SP (Brazil); Miranda, P.M. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Rogatto, S.R. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Achatz, M.I. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Oncogentica, A.C. Camargo Cancer Center, So Paulo, SP (Brazil)

    2015-04-28

    Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.

  8. DNA methylation and histone deacetylation regulating insulin sensitivity due to chronic cold exposure.

    Science.gov (United States)

    Wang, Xiaoqing; Wang, Lai; Sun, Yizheng; Li, Ruiping; Deng, Jinbo; Deng, Jiexin

    2017-02-01

    In this study, we investigated the causal relationship between chronic cold exposure and insulin resistance and the mechanisms of how DNA methylation and histone deacetylation regulate cold-reduced insulin resistance. 46 adult male mice from postnatal day 90-180 were randomly assigned to control group and cold-exposure group. Mice in cold-exposure group were placed at temperature from -1 to 4 °C for 30 days to mimic chronic cold environment. Then, fasting blood glucose, blood insulin level and insulin resistance index were measured with enzymatic methods. Immunofluorescent labeling was carried out to visualize the insulin receptor substrate 2 (IRS2), Obese receptor (Ob-R, a leptin receptor), voltage-dependent anion channel protein 1 (VDAC1), cytochrome C (cytC), 5-methylcytosine (5-mC) positive cells in hippocampal CA1 area. Furthermore, the expressions of some proteins mentioned above were detected with Western blot. The results showed: ① Chronic cold exposure could reduce the insulin resistance index (P cold-exposure group than in control group with both immunohistochemical staining and Western blot (P cold exposure increased DNA methylation and histone deacetylation in the pyramidal cells of CA1 area and led to an increase in the expression of histone deacetylase 1 (HDAC1) and DNA methylation relative enzymes (P cold exposure can improve insulin sensitivity, with the involvement of DNA methylation, histone deacetylation and the regulation of mitochondrial energy metabolism. These epigenetic modifications probably form the basic mechanism of cold-reduced insulin resistance. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Experimental mitochondria-targeted DNA methylation identifies GpC methylation, not CpG methylation, as potential regulator of mitochondrial gene expression

    NARCIS (Netherlands)

    van der Wijst, Monique G. P.; van Tilburg, Amanda Y.; Ruiters, Marcel H. J.; Rots, Marianne G.

    2017-01-01

    Like the nucleus, mitochondria contain their own DNA and recent reports provide accumulating evidence that also the mitochondrial DNA (mtDNA) is subjective to DNA methylation. This evidence includes the demonstration of mitochondria-localised DNA methyltransferases and demethylases, and the

  10. Transcriptional regulation and DNA methylation in plastids during transitional conversion of chloroplasts to chromoplasts.

    Science.gov (United States)

    Kobayashi, H; Ngernprasirtsiri, J; Akazawa, T

    1990-01-01

    During transitional conversion of chloroplasts to chromoplasts in ripening tomato (Lycopersicon esculentum) fruits, transcripts for several plastid genes for photosynthesis decreased to undetectable levels. Run-on transcription of plastids indicated that transcriptional regulation operated as a predominant factor. We found that most of the genes in chloroplasts were actively transcribed in vitro by Escherichia coli and soluble plastid RNA polymerases, but some genes in chromoplasts seemed to be silent when assayed by the in vitro systems. The regulatory step, therefore, was ascribed to DNA templates. The analysis of modified base composition revealed the presence of methylated bases in chromoplast DNA, in which 5-methylcytosine was most abundant. The presence of 5-methylcytosine detected by isoschizomeric endonucleases and Southern hybridization was correlated with the undetectable transcription activity of each gene in the run-on assay and in vitro transcription experiments. It is thus concluded that the suppression of transcription mediated by DNA methylation is one of the mechanisms governing gene expression in plastids converting from chloroplasts to chromoplasts. Images Fig. 1 Fig. 2 Fig. 3. Fig. 4. Fig. 5. PMID:2303026

  11. DNA methylation differentially regulates cytokine secretion in gingival epithelia in response to bacterial challenges.

    Science.gov (United States)

    Drury, Jeanie L; Chung, Whasun Oh

    2015-03-01

    Epigenetic modifications are changes in gene expression without altering DNA sequence. We previously reported that bacteria-specific innate immune responses are regulated by epigenetic modifications. Our hypothesis is that DNA methylation affects gingival cytokine secretion in response to bacterial stimulation. Gingival epithelial cells (GECs) were treated with DNMT-1 inhibitors prior to Porphyromonas gingivalis (Pg) or Fusobacterium nucleatum (Fn) exposure. Protein secretion was assessed using ELISA. Gene expression was quantified using qRT-PCR. The ability of bacteria to invade inhibitor pretreated GECs was assessed utilizing flow cytometry. Changes were compared to unstimulated GECs. GEC upregulation of IL-6 and CXCL1 by Pg or Fn stimulation was significantly diminished by inhibitor pretreatment. Pg stimulated IL-1α secretion and inhibitor pretreatment significantly enhanced this upregulation, while Fn alone or with inhibitor pretreatment had no effect on IL-1α expression. GEC upregulation of human beta-definsin-2 in response to Pg and Fn exposure was enhanced following the inhibitor pretreatment. GEC susceptibility to bacterial invasion was unaltered. These results suggest that DNA methylation differentially affects gingival cytokine secretion in response to Pg or Fn. Our data provide basis for better understanding of how epigenetic modifications, brought on by exposure to oral bacteria, will subsequently affect host susceptibility to oral diseases. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. DNA methylation regulates expression of VEGF-C, and S-adenosylmethionine is effective for VEGF-C methylation and for inhibiting cancer growth

    Energy Technology Data Exchange (ETDEWEB)

    Da, M.X. [Department of Surgical Oncology, Gansu Provincial Hospital, Lanzhou (China); Zhang, Y.B. [Department of Surgery, Ningxia Medical University, Yinchuan (China); Yao, J.B. [Department of Surgical Oncology, Gansu Provincial Hospital, Lanzhou (China); Duan, Y.X. [Department of Surgery, Ningxia Medical University, Yinchuan (China)

    2014-09-30

    DNA hypomethylation may activate oncogene transcription, thus promoting carcinogenesis and tumor development. S-adenosylmethionine (SAM) is a methyl donor in numerous methylation reactions and acts as an inhibitor of intracellular demethylase activity, which results in hypermethylation of DNA. The main objectives of this study were to determine whether DNA hypomethylation correlated with vascular endothelial growth factor-C (VEGF-C) expression, and the effect of SAM on VEGF-C methylation and gastric cancer growth inhibition. VEGF-C expression was assayed by Western blotting and RT-qPCR in gastric cancer cells, and by immunohistochemistry in tumor xenografts. VEGF-C methylation was assayed by bisulfite DNA sequencing. The effect of SAM on cell apoptosis was assayed by flow cytometry analyses and its effect on cancer growth was assessed in nude mice. The VEGF-C promoters of MGC-803, BGC-823, and SGC-7901 gastric cancer cells, which normally express VEGF-C, were nearly unmethylated. After SAM treatment, the VEGF-C promoters in these cells were highly methylated and VEGF-C expression was downregulated. SAM also significantly inhibited tumor growth in vitro and in vivo. DNA methylation regulates expression of VEGF-C. SAM can effectively induce VEGF-C methylation, reduce the expression of VEGF-C, and inhibit tumor growth. SAM has potential as a drug therapy to silence oncogenes and block the progression of gastric cancer.

  13. DNA methylation as a dynamic regulator of development and disease processes: spotlight on the prostate.

    Science.gov (United States)

    Keil, Kimberly P; Vezina, Chad M

    2015-01-01

    Prostate development, benign hyperplasia and cancer involve androgen and growth factor signaling as well as stromal-epithelial interactions. We review how DNA methylation influences these and related processes in other organ systems such as how proliferation is restricted to specific cell populations during defined temporal windows, how androgens elicit their actions and how cells establish, maintain and remodel DNA methylation in a time and cell specific fashion. We also discuss mechanisms by which hormones and endocrine disrupting chemicals reprogram DNA methylation in the prostate and elsewhere and examine evidence for a reawakening of developmental epigenetic pathways as drivers of prostate cancer and benign prostate hyperplasia.

  14. DNA methylation in the human cerebral cortex is dynamically regulated throughout the life span and involves differentiated neurons.

    Directory of Open Access Journals (Sweden)

    Kimberly D Siegmund

    Full Text Available The role of DNA cytosine methylation, an epigenetic regulator of chromatin structure and function, during normal and pathological brain development and aging remains unclear. Here, we examined by MethyLight PCR the DNA methylation status at 50 loci, encompassing primarily 5' CpG islands of genes related to CNS growth and development, in temporal neocortex of 125 subjects ranging in age from 17 weeks of gestation to 104 years old. Two psychiatric disease cohorts--defined by chronic neurodegeneration (Alzheimer's or lack thereof (schizophrenia--were included. A robust and progressive rise in DNA methylation levels across the lifespan was observed for 8/50 loci (GABRA2, GAD1, HOXA1, NEUROD1, NEUROD2, PGR, STK11, SYK typically in conjunction with declining levels of the corresponding mRNAs. Another 16 loci were defined by a sharp rise in DNA methylation levels within the first few months or years after birth. Disease-associated changes were limited to 2/50 loci in the Alzheimer's cohort, which appeared to reflect an acceleration of the age-related change in normal brain. Additionally, methylation studies on sorted nuclei provided evidence for bidirectional methylation events in cortical neurons during the transition from childhood to advanced age, as reflected by significant increases at 3, and a decrease at 1 of 10 loci. Furthermore, the DNMT3a de novo DNA methyl-transferase was expressed across all ages, including a subset of neurons residing in layers III and V of the mature cortex. Therefore, DNA methylation is dynamically regulated in the human cerebral cortex throughout the lifespan, involves differentiated neurons, and affects a substantial portion of genes predominantly by an age-related increase.

  15. Regulation of the DNA Methylation Landscape in Human Somatic Cell Reprogramming by the miR-29 Family

    Directory of Open Access Journals (Sweden)

    Eriona Hysolli

    2016-07-01

    Full Text Available Reprogramming to pluripotency after overexpression of OCT4, SOX2, KLF4, and MYC is accompanied by global genomic and epigenomic changes. Histone modification and DNA methylation states in induced pluripotent stem cells (iPSCs have been shown to be highly similar to embryonic stem cells (ESCs. However, epigenetic differences still exist between iPSCs and ESCs. In particular, aberrant DNA methylation states found in iPSCs are a major concern when using iPSCs in a clinical setting. Thus, it is critical to find factors that regulate DNA methylation states in reprogramming. Here, we found that the miR-29 family is an important epigenetic regulator during human somatic cell reprogramming. Our global DNA methylation and hydroxymethylation analysis shows that DNA demethylation is a major event mediated by miR-29a depletion during early reprogramming, and that iPSCs derived from miR-29a depletion are epigenetically closer to ESCs. Our findings uncover an important miRNA-based approach to generate clinically robust iPSCs.

  16. Amyloid protein-mediated differential DNA methylation status regulates gene expression in Alzheimer’s disease model cell line

    International Nuclear Information System (INIS)

    Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee; Oh, Seikwan; Ahn, Jung-Hyuck

    2011-01-01

    Highlights: ► Genome-wide DNA methylation pattern in Alzheimer’s disease model cell line. ► Integrated analysis of CpG methylation and mRNA expression profiles. ► Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. ► The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer’s disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterations in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2′-deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the −435, −295, and −271 CpG sites of CTIF, and at the −505 to −341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at −432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may contribute to the pathogenesis of AD.

  17. Melatonin-Mediated Development of Ovine Cumulus Cells, Perhaps by Regulation of DNA Methylation

    Directory of Open Access Journals (Sweden)

    Yi Fang

    2018-02-01

    Full Text Available Cumulus cells of pre-pubertal domestic animals are dysfunctional, perhaps due to age-specific epigenetic events. This study was designed to determine effects of melatonin treatment of donors on methylation modification of pre-pubertal cumulus cells. Cumulus cells from germinal vesicle stage cumulus oocyte complexes (COCs were collected from eighteen lambs which were randomly divided into control group (C and melatonin group given an 18 mg melatonin implant subcutaneous (M. Compared to the C group, the M group had higher concentrations of melatonin in plasma and follicular fluid (p < 0.05, greater superovulation, a higher proportion of fully expanded COCs, and a lower proportion of apoptotic cumulus cells (p < 0.05. Real-time PCR results showed that melatonin up-regulated expression of genes MT1, Bcl2, DNMT1, DNMT3a and DNMT3b, but down-regulated expression of genes p53, Caspase 3 and Bax (p < 0.05. Furthermore, melatonin increased FI of FITC (global methylation level on cumulus cells (p < 0.05. To understand the regulation mechanism, the DNMTs promoter methylation sequence were analyzed. Compared to the C group, although there was less methylation at two CpG sites of DNMT1 (p < 0.05 and higher methylation at two CpG sites of DNMT3a (p < 0.05, there were no significant differences in methylation of the detected DNMT1 and DNMT3a promoter regions. However, there were lower methylation levels at five CpG sites of DNMT3b, which decreased methylation of detected DNMT3b promoter region on M group (p < 0.05. In conclusion, alterations of methylation regulated by melatonin may mediate development of cumulus cells in lambs.

  18. DNA methylation in obesity

    Directory of Open Access Journals (Sweden)

    Małgorzata Pokrywka

    2014-11-01

    Full Text Available The number of overweight and obese people is increasing at an alarming rate, especially in the developed and developing countries. Obesity is a major risk factor for diabetes, cardiovascular disease, and cancer, and in consequence for premature death. The development of obesity results from the interplay of both genetic and environmental factors, which include sedentary life style and abnormal eating habits. In the past few years a number of events accompanying obesity, affecting expression of genes which are not directly connected with the DNA base sequence (e.g. epigenetic changes, have been described. Epigenetic processes include DNA methylation, histone modifications such as acetylation, methylation, phosphorylation, ubiquitination, and sumoylation, as well as non-coding micro-RNA (miRNA synthesis. In this review, the known changes in the profile of DNA methylation as a factor affecting obesity and its complications are described.

  19. DNA methylation of specific CpG sites in the promoter region regulates the transcription of the mouse oxytocin receptor.

    Directory of Open Access Journals (Sweden)

    Shimrat Mamrut

    Full Text Available Oxytocin is a peptide hormone, well known for its role in labor and suckling, and most recently for its involvement in mammalian social behavior. All central and peripheral actions of oxytocin are mediated through the oxytocin receptor, which is the product of a single gene. Transcription of the oxytocin receptor is subject to regulation by gonadal steroid hormones, and is profoundly elevated in the uterus and mammary glands during parturition. DNA methylation is a major epigenetic mechanism that regulates gene transcription, and has been linked to reduced expression of the oxytocin receptor in individuals with autism. Here, we hypothesized that transcription of the mouse oxytocin receptor is regulated by DNA methylation of specific sites in its promoter, in a tissue-specific manner. Hypothalamus-derived GT1-7, and mammary-derived 4T1 murine cell lines displayed negative correlations between oxytocin receptor transcription and methylation of the gene promoter, and demethylation caused a significant enhancement of oxytocin receptor transcription in 4T1 cells. Using a reporter gene assay, we showed that methylation of specific sites in the gene promoter, including an estrogen response element, significantly inhibits transcription. Furthermore, methylation of the oxytocin receptor promoter was found to be differentially correlated with oxytocin receptor expression in mammary glands and the uterus of virgin and post-partum mice, suggesting that it plays a distinct role in oxytocin receptor transcription among tissues and under different physiological conditions. Together, these results support the hypothesis that the expression of the mouse oxytocin receptor gene is epigenetically regulated by DNA methylation of its promoter.

  20. Regulation of UGT1A1 and HNF1 transcription factor gene expression by DNA methylation in colon cancer cells

    Directory of Open Access Journals (Sweden)

    Harvey Mario

    2010-01-01

    Full Text Available Abstract Background UDP-glucuronosyltransferase 1A1 (UGT1A1 is a pivotal enzyme involved in metabolism of SN-38, the active metabolite of irinotecan commonly used to treat metastatic colorectal cancer. We previously demonstrated aberrant methylation of specific CpG dinucleotides in UGT1A1-negative cells, and revealed that methylation state of the UGT1A1 5'-flanking sequence is negatively correlated with gene transcription. Interestingly, one of these CpG dinucleotides (CpG -4 is found close to a HNF1 response element (HRE, known to be involved in activation of UGT1A1 gene expression, and within an upstream stimulating factor (USF binding site. Results Gel retardation assays revealed that methylation of CpG-4 directly affect the interaction of USF1/2 with its cognate sequence without altering the binding for HNF1-alpha. Luciferase assays sustained a role for USF1/2 and HNF1-alpha in UGT1A1 regulation in colon cancer cells. Based on the differential expression profiles of HNF1A gene in colon cell lines, we also assessed whether methylation affects its expression. In agreement with the presence of CpG islands in the HNF1A promoter, treatments of UGT1A1-negative HCT116 colon cancer cells with a DNA methyltransferase inhibitor restore HNF1A gene expression, as observed for UGT1A1. Conclusions This study reveals that basal UGT1A1 expression in colon cells is positively regulated by HNF1-alpha and USF, and negatively regulated by DNA methylation. Besides, DNA methylation of HNF1A could also play an important role in regulating additional cellular drug metabolism and transporter pathways. This process may contribute to determine local inactivation of drugs such as the anticancer agent SN-38 by glucuronidation and define tumoral response.

  1. Hepatitis B virus X protein suppresses caveolin-1 expression in hepatocellular carcinoma by regulating DNA methylation

    International Nuclear Information System (INIS)

    Yan, Jun; Lu, Qian; Dong, Jiahong; Li, Xiaowu; Ma, Kuansheng; Cai, Lei

    2012-01-01

    To understand the molecular mechanisms of caveolin-1 downregulation by hepatitis B virus X protein (HBx). The DNA methylation status of the caveolin-1 promoter was examined by nested methylation-specific PCR of 33 hepatitis B virus (HBV)-infected hepatocellular carcinoma (HCC) samples. The SMMC-7721 hepatoma cell line was transfected with a recombinant HBx adenoviral vector, and the effects of HBx protein on caveolin-1 expression and promoter methylation were examined and confirmed by sequencing. A reporter gene containing the caveolin-1 promoter region was constructed, and the effects of HBx on the transcriptional activity of the promoter were also studied. Methylation of the caveolin-1 promoter was detected in 84.8% (28/33) of HBV-infected HCC samples. Expression of caveolin-1 was significantly downregulated (P = 0.022), and multiple CpG sites in the promoter region of caveolin-1 were methylated in SMMC-7721 cells after HBx transfection. Transfected HBx significantly suppressed caveolin-1 promoter activity (P = 0.001). HBx protein induces methylation of the caveolin-1 promoter region and suppresses its expression

  2. Evolution of DNA Methylation across Insects.

    Science.gov (United States)

    Bewick, Adam J; Vogel, Kevin J; Moore, Allen J; Schmitz, Robert J

    2017-03-01

    DNA methylation contributes to gene and transcriptional regulation in eukaryotes, and therefore has been hypothesized to facilitate the evolution of plastic traits such as sociality in insects. However, DNA methylation is sparsely studied in insects. Therefore, we documented patterns of DNA methylation across a wide diversity of insects. We predicted that underlying enzymatic machinery is concordant with patterns of DNA methylation. Finally, given the suggestion that DNA methylation facilitated social evolution in Hymenoptera, we tested the hypothesis that the DNA methylation system will be associated with presence/absence of sociality among other insect orders. We found DNA methylation to be widespread, detected in all orders examined except Diptera (flies). Whole genome bisulfite sequencing showed that orders differed in levels of DNA methylation. Hymenopteran (ants, bees, wasps and sawflies) had some of the lowest levels, including several potential losses. Blattodea (cockroaches and termites) show all possible patterns, including a potential loss of DNA methylation in a eusocial species whereas solitary species had the highest levels. Species with DNA methylation do not always possess the typical enzymatic machinery. We identified a gene duplication event in the maintenance DNA methyltransferase 1 (DNMT1) that is shared by some Hymenoptera, and paralogs have experienced divergent, nonneutral evolution. This diversity and nonneutral evolution of underlying machinery suggests alternative DNA methylation pathways may exist. Phylogenetically corrected comparisons revealed no evidence that supports evolutionary association between sociality and DNA methylation. Future functional studies will be required to advance our understanding of DNA methylation in insects. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Whole genome DNA methylation: beyond genes silencing

    OpenAIRE

    Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati

    2016-01-01

    The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the ...

  4. Epigenetic regulation of somatic angiotensin-converting enzyme by DNA methylation and histone acetylation.

    Science.gov (United States)

    Rivière, Guillaume; Lienhard, Daniel; Andrieu, Thomas; Vieau, Didier; Frey, Brigitte M; Frey, Felix J

    2011-04-01

    Somatic angiotensin-converting enzyme (sACE) is crucial in cardiovascular homeostasis and displays a tissue-specific profile. Epigenetic patterns modulate genes expression and their alterations were implied in pathologies including hypertension. However, the influence of DNA methylation and chromatin condensation state on the expression of sACE is unknown. We examined whether such epigenetic mechanisms could participate in the control of sACE expression in vitro and in vivo. We identified two CpG islands in the human ace-1 gene 3 kb proximal promoter region. Their methylation abolished the luciferase activity of ace-1 promoter/reporter constructs transfected into human liver (HepG2), colon (HT29), microvascular endothelial (HMEC-1) and lung (SUT) cell lines (p sACE mRNA expression cell-type specifically (p sACE mRNA expression in the lungs and liver (p = 0.05), but not in the kidney. In conclusion, the expression level of somatic ACE is modulated by CpG-methylation and histone deacetylases inhibition. The basal methylation pattern of the promoter of the ace-1 gene is cell-type specific and correlates to sACE transcription. DNMT inhibition is associated with altered methylation of the ace-1 promoter and a cell-type and tissue-specific increase of sACE mRNA levels. This study indicates a strong influence of epigenetic mechanisms on sACE expression.

  5. Tet1 Oxidase Regulates Neuronal Gene Transcription, Active DNA Hydroxy-methylation, Object Location Memory, and Threat Recognition Memory.

    Science.gov (United States)

    Kumar, Dinesh; Aggarwal, Milan; Kaas, Garrett A; Lewis, John; Wang, Jing; Ross, Daniel L; Zhong, Chun; Kennedy, Andrew; Song, Hongjun; Sweatt, J David

    2015-10-01

    A dynamic equilibrium between DNA methylation and demethylation of neuronal activity-regulated genes is crucial for memory processes. However, the mechanisms underlying this equilibrium remain elusive. Tet1 oxidase has been shown to play a key role in the active DNA demethylation in the CNS. In this study, we used Tet1 gene knockout (Tet1KO) mice to examine the involvement of Tet1 in memory consolidation and storage in the adult brain. We found that Tet1 ablation leads to: altered expression of numerous neuronal activity-regulated genes, compensatory upregulation of active demethylation pathway genes, and upregulation of various epigenetic modifiers. Moreover, Tet1KO mice showed an enhancement in the consolidation and storage of threat recognition (cued and contextual fear conditioning) and object location memories. We conclude that Tet1 plays a critical role in regulating neuronal transcription and in maintaining the epigenetic state of the brain associated with memory consolidation and storage.

  6. DNA Methylation Modulates Nociceptive Sensitization after Incision.

    Directory of Open Access Journals (Sweden)

    Yuan Sun

    Full Text Available DNA methylation is a key epigenetic mechanism controlling DNA accessibility and gene expression. Blockade of DNA methylation can significantly affect pain behaviors implicated in neuropathic and inflammatory pain. However, the role of DNA methylation with regard to postoperative pain has not yet been explored. In this study we sought to investigate the role of DNA methylation in modulating incisional pain and identify possible targets under DNA methylation and contributing to incisional pain. DNA methyltranferase (DNMT inhibitor 5-Aza-2'-deoxycytidine significantly reduced incision-induced mechanical allodynia and thermal sensitivity. Aza-2'-deoxycytidine also reduced hindpaw swelling after incision, suggesting an anti-inflammatory effect. Global DNA methylation and DNMT3b expression were increased in skin after incision, but none of DNMT1, DNMT3a or DNMT3b was altered in spinal cord or DRG. The expression of proopiomelanocortin Pomc encoding β-endorphin and Oprm1 encoding the mu-opioid receptor were upregulated peripherally after incision; moreover, Oprm1 expression was further increased under DNMT inhibitor treatment. Finally, local peripheral injection of the opioid receptor antagonist naloxone significantly exacerbated incision-induced mechanical hypersensitivity. These results suggest that DNA methylation is functionally relevant to incisional nociceptive sensitization, and that mu-opioid receptor signaling might be one methylation regulated pathway controlling sensitization after incision.

  7. Differential DNA methylation may contribute to temporal and spatial regulation of gene expression and the development of mycelia and conidia in entomopathogenic fungus Metarhizium robertsii.

    Science.gov (United States)

    Li, Wanzhen; Wang, Yulong; Zhu, Jianyu; Wang, Zhangxun; Tang, Guiliang; Huang, Bo

    2017-03-01

    Conidia and mycelia are two important developmental stages in the asexual life cycle of entomopathogenic fungus Metarhizium. Despite the crucial role that DNA methylation plays in many biological processes, its role in regulation of gene expression and development in fungi is not yet fully understood. We performed genome-wide analysis of DNA methylation patterns of an M. robertsii strain with single base pair resolution. Specifically, we examined for changes in methylation patterns between the conidia and mycelia stages. The results showed that approximately 0.38 % of cytosines are methylated in conidia, which is lower than the DNA methylation level (0.42 %) in mycelia. We found that DNA methylation undergoes genome-wide reprogramming during fungal development in M. robertsii. 132 differentially methylated regions (DMRs), which were mostly distributed in gene regions, were identified. KEGG analysis revealed that the DMR-associated genes belong to metabolic pathways. Intriguingly, in contrast to most other eukaryotes, promoter activities in M. robertsii seemed differentially modulated by DNA methylation levels. We found that transcription tended to be enhanced in genes with moderate promoter methylation, while gene expression was decreased in genes with high or low promoter methylation. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  8. DNA methylation and memory formation.

    Science.gov (United States)

    Day, Jeremy J; Sweatt, J David

    2010-11-01

    Memory formation and storage require long-lasting changes in memory-related neuronal circuits. Recent evidence indicates that DNA methylation may serve as a contributing mechanism in memory formation and storage. These emerging findings suggest a role for an epigenetic mechanism in learning and long-term memory maintenance and raise apparent conundrums and questions. For example, it is unclear how DNA methylation might be reversed during the formation of a memory, how changes in DNA methylation alter neuronal function to promote memory formation, and how DNA methylation patterns differ between neuronal structures to enable both consolidation and storage of memories. Here we evaluate the existing evidence supporting a role for DNA methylation in memory, discuss how DNA methylation may affect genetic and neuronal function to contribute to behavior, propose several future directions for the emerging subfield of neuroepigenetics, and begin to address some of the broader implications of this work.

  9. Influence of DNA-methylation on zinc homeostasis in myeloid cells: Regulation of zinc transporters and zinc binding proteins.

    Science.gov (United States)

    Kessels, Jana Elena; Wessels, Inga; Haase, Hajo; Rink, Lothar; Uciechowski, Peter

    2016-09-01

    The distribution of intracellular zinc, predominantly regulated through zinc transporters and zinc binding proteins, is required to support an efficient immune response. Epigenetic mechanisms such as DNA methylation are involved in the expression of these genes. In demethylation experiments using 5-Aza-2'-deoxycytidine (AZA) increased intracellular (after 24 and 48h) and total cellular zinc levels (after 48h) were observed in the myeloid cell line HL-60. To uncover the mechanisms that cause the disturbed zinc homeostasis after DNA demethylation, the expression of human zinc transporters and zinc binding proteins were investigated. Real time PCR analyses of 14 ZIP (solute-linked carrier (SLC) SLC39A; Zrt/IRT-like protein), and 9 ZnT (SLC30A) zinc transporters revealed significantly enhanced mRNA expression of the zinc importer ZIP1 after AZA treatment. Because ZIP1 protein was also enhanced after AZA treatment, ZIP1 up-regulation might be the mediator of enhanced intracellular zinc levels. The mRNA expression of ZIP14 was decreased, whereas zinc exporter ZnT3 mRNA was also significantly increased; which might be a cellular reaction to compensate elevated zinc levels. An enhanced but not significant chromatin accessibility of ZIP1 promoter region I was detected by chromatin accessibility by real-time PCR (CHART) assays after demethylation. Additionally, DNA demethylation resulted in increased mRNA accumulation of zinc binding proteins metallothionein (MT) and S100A8/S100A9 after 48h. MT mRNA was significantly enhanced after 24h of AZA treatment also suggesting a reaction of the cell to restore zinc homeostasis. These data indicate that DNA methylation is an important epigenetic mechanism affecting zinc binding proteins and transporters, and, therefore, regulating zinc homeostasis in myeloid cells. Copyright © 2016 Elsevier GmbH. All rights reserved.

  10. DNA methylation in metabolic disorders

    DEFF Research Database (Denmark)

    Barres, Romain; Zierath, Juleen R

    2011-01-01

    DNA methylation is a major epigenetic modification that controls gene expression in physiologic and pathologic states. Metabolic diseases such as diabetes and obesity are associated with profound alterations in gene expression that are caused by genetic and environmental factors. Recent reports...... have provided evidence that environmental factors at all ages could modify DNA methylation in somatic tissues, which suggests that DNA methylation is a more dynamic process than previously appreciated. Because of the importance of lifestyle factors in metabolic disorders, DNA methylation provides...... a mechanism by which environmental factors, including diet and exercise, can modify genetic predisposition to disease. This article considers the current evidence that defines a role for DNA methylation in metabolic disorders....

  11. Chilling-Mediated DNA Methylation Changes during Dormancy and Its Release Reveal the Importance of Epigenetic Regulation during Winter Dormancy in Apple (Malus x domestica Borkh..

    Directory of Open Access Journals (Sweden)

    Gulshan Kumar

    Full Text Available Winter dormancy is a well known mechanism adopted by temperate plants, to mitigate the chilling temperature of winters. However, acquisition of sufficient chilling during winter dormancy ensures the normal phenological traits in subsequent growing period. Thus, low temperature appears to play crucial roles in growth and development of temperate plants. Apple, being an important temperate fruit crop, also requires sufficient chilling to release winter dormancy and normal phenological traits, which are often associated with yield and quality of fruits. DNA cytosine methylation is one of the important epigenetic modifications which remarkably affect the gene expression during various developmental and adaptive processes. In present study, methylation sensitive amplified polymorphism was employed to assess the changes in cytosine methylation during dormancy, active growth and fruit set in apple, under differential chilling conditions. Under high chill conditions, total methylation was decreased from 27.2% in dormant bud to 21.0% in fruit set stage, while no significant reduction was found under low chill conditions. Moreover, the demethylation was found to be decreased, while methylation increased from dormant bud to fruit set stage under low chill as compared to high chill conditions. In addition, RNA-Seq analysis showed high expression of DNA methyltransferases and histone methyltransferases during dormancy and fruit set, and low expression of DNA glcosylases during active growth under low chill conditions, which was in accordance with changes in methylation patterns. The RNA-Seq data of 47 genes associated with MSAP fragments involved in cellular metabolism, stress response, antioxidant system and transcriptional regulation showed correlation between methylation and their expression. Similarly, bisulfite sequencing and qRT-PCR analysis of selected genes also showed correlation between gene body methylation and gene expression. Moreover

  12. Chilling-Mediated DNA Methylation Changes during Dormancy and Its Release Reveal the Importance of Epigenetic Regulation during Winter Dormancy in Apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Kumar, Gulshan; Rattan, Usha Kumari; Singh, Anil Kumar

    2016-01-01

    Winter dormancy is a well known mechanism adopted by temperate plants, to mitigate the chilling temperature of winters. However, acquisition of sufficient chilling during winter dormancy ensures the normal phenological traits in subsequent growing period. Thus, low temperature appears to play crucial roles in growth and development of temperate plants. Apple, being an important temperate fruit crop, also requires sufficient chilling to release winter dormancy and normal phenological traits, which are often associated with yield and quality of fruits. DNA cytosine methylation is one of the important epigenetic modifications which remarkably affect the gene expression during various developmental and adaptive processes. In present study, methylation sensitive amplified polymorphism was employed to assess the changes in cytosine methylation during dormancy, active growth and fruit set in apple, under differential chilling conditions. Under high chill conditions, total methylation was decreased from 27.2% in dormant bud to 21.0% in fruit set stage, while no significant reduction was found under low chill conditions. Moreover, the demethylation was found to be decreased, while methylation increased from dormant bud to fruit set stage under low chill as compared to high chill conditions. In addition, RNA-Seq analysis showed high expression of DNA methyltransferases and histone methyltransferases during dormancy and fruit set, and low expression of DNA glcosylases during active growth under low chill conditions, which was in accordance with changes in methylation patterns. The RNA-Seq data of 47 genes associated with MSAP fragments involved in cellular metabolism, stress response, antioxidant system and transcriptional regulation showed correlation between methylation and their expression. Similarly, bisulfite sequencing and qRT-PCR analysis of selected genes also showed correlation between gene body methylation and gene expression. Moreover, significant association

  13. DNA Methylation Dynamics Regulate the Formation of a Regenerative Wound Epithelium during Axolotl Limb Regeneration.

    Directory of Open Access Journals (Sweden)

    Cristian Aguilar

    Full Text Available The formation of a blastema during regeneration of an axolotl limb involves important changes in the behavior and function of cells at the site of injury. One of the earliest events is the formation of the wound epithelium and subsequently the apical epidermal cap, which involves in vivo dedifferentiation that is controlled by signaling from the nerve. We have investigated the role of epigenetic modifications to the genome as a possible mechanism for regulating changes in gene expression patterns of keratinocytes of the wound and blastema epithelium that are involved in regeneration. We report a modulation of the expression DNMT3a, a de novo DNA methyltransferase, within the first 72 hours post injury that is dependent on nerve signaling. Treatment of skin wounds on the upper forelimb with decitabine, a DNA methyltransferase inhibitor, induced changes in gene expression and cellular behavior associated with a regenerative response. Furthermore, decitabine-treated wounds were able to participate in regeneration while untreated wounds inhibited a regenerative response. Elucidation of the specific epigenetic modifications that mediate cellular dedifferentiation likely will lead to insights for initiating a regenerative response in organisms that lack this ability.

  14. Redox/methylation mediated abnormal DNA methylation as regulators of ambient fine particulate matter-induced neurodevelopment related impairment in human neuronal cells

    Science.gov (United States)

    Wei, Hongying; Liang, Fan; Meng, Ge; Nie, Zhiqing; Zhou, Ren; Cheng, Wei; Wu, Xiaomeng; Feng, Yan; Wang, Yan

    2016-09-01

    Fine particulate matter (PM2.5) has been implicated as a risk factor for neurodevelopmental disorders including autism in children. However, the underlying biological mechanism remains unclear. DNA methylation is suggested to be a fundamental mechanism for the neuronal responses to environmental cues. We prepared whole particle of PM2.5 (PM2.5), water-soluble extracts (Pw), organic extracts (Po) and carbon core component (Pc) and characterized their chemical constitutes. We found that PM2.5 induced significant redox imbalance, decreased the levels of intercellular methyl donor S-adenosylmethionine and caused global DNA hypomethylation. Furthermore, PM2.5 exposure triggered gene-specific promoter DNA hypo- or hypermethylation and abnormal mRNA expression of autism candidate genes. PM2.5-induced DNA hypermethylation in promoter regions of synapse related genes were associated with the decreases in their mRNA and protein expression. The inhibiting effects of antioxidative reagents, a methylation-supporting agent and a DNA methyltransferase inhibitor demonstrated the involvement of redox/methylation mechanism in PM2.5-induced abnormal DNA methylation patterns and synaptic protein expression. The biological effects above generally followed a sequence of PM2.5 ≥ Pwo > Po > Pw > Pc. Our results implicated a novel epigenetic mechanism for the neurodevelopmental toxicity of particulate air pollution, and that eliminating the chemical components could mitigate the neurotoxicity of PM2.5.

  15. DNA methylation abnormalities in congenital heart disease.

    Science.gov (United States)

    Serra-Juhé, Clara; Cuscó, Ivon; Homs, Aïda; Flores, Raquel; Torán, Núria; Pérez-Jurado, Luis A

    2015-01-01

    Congenital heart defects represent the most common malformation at birth, occurring also in ∼50% of individuals with Down syndrome. Congenital heart defects are thought to have multifactorial etiology, but the main causes are largely unknown. We have explored the global methylation profile of fetal heart DNA in comparison to blood DNA from control subjects: an absolute correlation with the type of tissue was detected. Pathway analysis revealed a significant enrichment of differential methylation at genes related to muscle contraction and cardiomyopathies in the developing heart DNA. We have also searched for abnormal methylation profiles on developing heart-tissue DNA of syndromic and non-syndromic congenital heart defects. On average, 3 regions with aberrant methylation were detected per sample and 18 regions were found differentially methylated between groups. Several epimutations were detected in candidate genes involved in growth regulation, apoptosis and folate pathway. A likely pathogenic hypermethylation of several intragenic sites at the MSX1 gene, involved in outflow tract morphogenesis, was found in a fetus with isolated heart malformation. In addition, hypermethylation of the GATA4 gene was present in fetuses with Down syndrome with or without congenital heart defects, as well as in fetuses with isolated heart malformations. Expression deregulation of the abnormally methylated genes was detected. Our data indicate that epigenetic alterations of relevant genes are present in developing heart DNA in fetuses with both isolated and syndromic heart malformations. These epimutations likely contribute to the pathogenesis of the malformation by cis-acting effects on gene expression.

  16. DNA methylation regulated microRNAs in HPV-16-induced head and neck squamous cell carcinoma (HNSCC).

    Science.gov (United States)

    Sannigrahi, M K; Sharma, Rajni; Singh, Varinder; Panda, Naresh K; Rattan, Vidya; Khullar, Madhu

    2018-02-17

    Epigenetic modifications have been reported to play an important role in regulating gene expression and these modifications become critical when they have a role in controlling another important layer of epigenetic regulation namely microRNAs. In the present study, we have identified the microRNAs that may be regulated by promoter DNA methylation and histone acetylation in Human papilloma virus-positive head and neck squamous cell carcinoma. HPV-negative cell line (UPCI:SCC-116) and HPV-16 +ve cell line (UPCI:SCC-090) were treated with methylation inhibitor (5-aza-2'-deoxycytidine, AZA) and acetylation inhibitor (Trichostatin-A, TSA), followed by micro-array analysis. The differentially expressed miRNAs were validated in control (n = 10), HPV-16 +ve (n = 30), and HPV -ve (n = 30) HNC, TCGA (n = 529) tissue samples, and two HPV -ve (SCC116 and Hacat) and two HPV +ve (SCC090 and SiHa) cell lines. Methylation-specific PCR (MSP) and chromatin immunoprecipitation assay (CHIP) were performed to validate their regulation. In silico and in vitro analyses of identified miRNAs were done to study putative pathways they target and their possible role in carcinogenesis. Among 10 miRNAs specifically up-regulated in microarray analysis of AZA-treated SCC090 cells, we observed significantly decreased expression of hsa-miR-181c-5p, hsa-miR-132-5p, hsa-miR-658 in HPV +ve HNC cohort, TCGA tissue samples, and cell lines as compared to their HPV -ve counterpart, and their promoter region also possesses CpG islands. MSP and analysis of TCGA data (MethHC) revealed increased frequency of methylation at the promoter of hsa-miR-132-5p that is negatively correlated with its expression. In TSA-treated SCC090 cells, out of 7 miRNAs, two namely Hsa-miR-129-2-3p and Hsa-miR-449a were found to be up-regulated as compared to HPV -ve cells. However, the levels of enrichment by anti-acetyl-H3 and anti-acetyl-H4 were significantly low in cell lines compared to respective controls

  17. Whole-genome methylation caller designed for methyl- DNA ...

    African Journals Online (AJOL)

    etchie

    2013-02-20

    Feb 20, 2013 ... Our method uses a single-CpG-resolution, whole-genome methylation ... Key words: Methyl-DNA immunoprecipitation, next-generation sequencing, ...... methylation is prevalent in embryonic stem cells andmaybe mediated.

  18. A preliminary study of endocannabinoid system regulation in psychosis: Distinct alterations of CNR1 promoter DNA methylation in patients with schizophrenia.

    Science.gov (United States)

    D'Addario, Claudio; Micale, Vincenzo; Di Bartolomeo, Martina; Stark, Tibor; Pucci, Mariangela; Sulcova, Alexandra; Palazzo, Mariacarlotta; Babinska, Zuzana; Cremaschi, Laura; Drago, Filippo; Carlo Altamura, A; Maccarrone, Mauro; Dell'Osso, Bernardo

    2017-10-01

    Compelling evidence supports the involvement of the endocannabinoid system (ECS) in psychosis vulnerability. We here evaluated the transcriptional regulation of ECS components in human peripheral blood mononuclear cells (PBMCs) obtained from subjects suffering from bipolar disorder, major depressive disorder and schizophrenia, focusing in particular on the effects of DNA methylation. We observed selective alterations of DNA methylation at the promoter of CNR1, the gene coding for the type-1 cannabinoid receptor, in schizophrenic patients (N=25) with no changes in any other disorder. We confirmed the regulation of CNR1 in a well-validated animal model of schizophrenia, induced by prenatal methylazoxymethanol (MAM) acetate exposure (N=7 per group) where we found, in the prefrontal cortex, a significant increase in CNR1 expression and a consistent reduction in DNA methylation at specific CpG sites of gene promoter. Overall, our findings suggest a selective dysregulation of ECS in psychosis, and highlight the evaluation of CNR1 DNA methylation levels in PBMCs as a potential biomarker for schizophrenia. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. The characterization of DNA methylation-mediated regulation of bovine placental lactogen and bovine prolactin-related protein-1 genes

    Directory of Open Access Journals (Sweden)

    Patel Osman V

    2009-03-01

    Full Text Available Abstract Background Bovine trophoblast binucleate cells (BNC express a plethora of molecules including bovine placental lactogen (bPL, gene name is bCSH1 and bovine prolactin-related protein-1 (bPRP1. BCSH1 and bPRP1 are members of the growth hormone (GH/prolactin (PRL gene family, which are expressed simultaneously in BNC and are central to placentation and the progression of pregnancy in cattle. However, there is a paucity of information on the transcriptional regulatory mechanisms of both the bCSH1 and bPRP1 genes. Recent studies, however, have demonstrated that the expression of a number of genes is controlled by the methylation status of their promoter region. In the present study, we examined the cell-type-specific epigenetic alterations of the 5'-flanking region of the bCSH1 and bPRP1 genes to gain an insight into their regulatory mechanisms. Results Analysis of 5-aza-2'-deoxycytidine treatment demonstrated that bCSH1 expression is moderately induced in fibroblast cultures but enhanced in BT-1 cells. Sodium bisulfite based sequencing revealed that bCSH1 is hypomethylated in the cotyledonary tissue but not in the fetal skin, and this pattern was not altered with the progression of pregnancy. On the other hand, the methylation status of bPRP1 was similar between the cotyledon and fetal skin. The bPRP1 gene was exclusively hypermethylated in a bovine trophoblast cell-derived BT-1 cell-line. While the activity of bCSH1 was similar in both BT-1 and bovine fibroblast cells, that of bPRP1 was specific to BT-1. Treatment with a demethylating agent and luciferase assays provided in vitro evidence of the positive regulation of bCSH1 but not bPRP1. Conclusion This is the first report to identify the differential regulatory mechanisms of the bCSH1 and bPRP1 genes and indicates that bCSH1 might potentially be the only transcript that is subject to DNA methyltransferase regulation. The data indicates the possibility of novel kinetics of induction of

  20. Nano-hydroxyapatite modulates osteoblast lineage commitment by stimulation of DNA methylation and regulation of gene expression

    Science.gov (United States)

    Ha, Shin-Woo; Jang, Hae Lin; Nam, Ki Tae; Beck, George R.

    2015-01-01

    Hydroxyapatite (HA) is the primary structural component of the skeleton and dentition. Under biological conditions, HA does not occur spontaneously and therefore must be actively synthesized by mineralizing cells such as osteoblasts. The mechanism(s) by which HA is actively synthesized by cells and deposited to create a mineralized matrix are not fully understood and the consequences of mineralization on cell function are even less well understood. HA can be chemically synthesized (HAp) and is therefore currently being investigated as a promising therapeutic biomaterial for use as a functional scaffold and implant coating for skeletal repair and dental applications. Here we investigated the biological effects of nano-HAp (10×100 nm) on the lineage commitment and differentiation of bone forming osteoblasts. Exposure of early stage differentiating osteoblasts resulted in dramatic and sustained changes in gene expression, both increased and decreased, whereas later stage osteoblasts were much less responsive. Analysis of the promoter region one of the most responsive genes, alkaline phosphatase, identified the stimulation of DNA methylation following cell exposure to nano-HAp. Collectively, the results reveal the novel epigenetic regulation of cell function by nano-HAp which has significant implication on lineage determination as well as identifying a novel potential therapeutic use of nanomaterials. PMID:26141836

  1. A genome-wide scan reveals important roles of DNA methylation in human longevity by regulating age-related disease genes.

    Directory of Open Access Journals (Sweden)

    Fu-Hui Xiao

    Full Text Available It is recognized that genetic factors contribute to human longevity. Besides the hypothesis of existence of longevity genes, another suggests that a lower frequency of risk alleles decreases the incidence of age-related diseases in the long-lived people. However, the latter finds no support from recent genetic studies. Considering the crucial role of epigenetic modification in gene regulation, we then hypothesize that suppressing disease-related genes in longevity individuals is likely achieved by epigenetic modification, e.g. DNA methylation. To test this hypothesis, we investigated the genome-wide methylation profile in 4 Chinese female centenarians and 4 middle-aged controls using methyl-DNA immunoprecipitation sequencing. 626 differentially methylated regions (DMRs were observed between both groups. Interestingly, genes with these DMRs were enriched in age-related diseases, including type-2 diabetes, cardiovascular disease, stroke and Alzheimer's disease. This pattern remains rather stable after including methylomes of two white individuals. Further analyses suggest that the observed DMRs likely have functional roles in regulating disease-associated gene expressions, with some genes [e.g. caspase 3 (CASP3] being down-regulated whereas the others [i.e. interleukin 1 receptor, type 2 (IL1R2] up-regulated. Therefore, our study suggests that suppressing the disease-related genes via epigenetic modification is an important contributor to human longevity.

  2. MethylMix 2.0: an R package for identifying DNA methylation genes.

    Science.gov (United States)

    Cedoz, Pierre-Louis; Prunello, Marcos; Brennan, Kevin; Gevaert, Olivier

    2018-04-14

    DNA methylation is an important mechanism regulating gene transcription, and its role in carcinogenesis has been extensively studied. Hyper and hypomethylation of genes is a major mechanism of gene expression deregulation in a wide range of diseases. At the same time, high-throughput DNA methylation assays have been developed generating vast amounts of genome wide DNA methylation measurements. We developed MethylMix, an algorithm implemented in R to identify disease specific hyper and hypomethylated genes. Here we present a new version of MethylMix that automates the construction of DNA-methylation and gene expression datasets from The Cancer Genome Atlas (TCGA). More precisely, MethylMix 2.0 incorporates two major updates: the automated downloading of DNA methylation and gene expression datasets from TCGA and the automated preprocessing of such datasets: value imputation, batch correction and CpG sites clustering within each gene. The resulting datasets can subsequently be analyzed with MethylMix to identify transcriptionally predictive methylation states. We show that the Differential Methylation Values created by MethylMix can be used for cancer subtyping. olivier.gevaert@stanford.edu. https://bioconductor.org/packages/release/bioc/manuals/MethylMix/man/MethylMix.pdf. MethylMix 2.0 was implemented as an R package and is available in bioconductor.

  3. Transcriptional regulation and DNA methylation in plastids during transitional conversion of chloroplasts to chromoplasts.

    OpenAIRE

    Kobayashi, H; Ngernprasirtsiri, J; Akazawa, T

    1990-01-01

    During transitional conversion of chloroplasts to chromoplasts in ripening tomato (Lycopersicon esculentum) fruits, transcripts for several plastid genes for photosynthesis decreased to undetectable levels. Run-on transcription of plastids indicated that transcriptional regulation operated as a predominant factor. We found that most of the genes in chloroplasts were actively transcribed in vitro by Escherichia coli and soluble plastid RNA polymerases, but some genes in chromoplasts seemed to ...

  4. Annotating the genome by DNA methylation.

    Science.gov (United States)

    Cedar, Howard; Razin, Aharon

    2017-01-01

    DNA methylation plays a prominent role in setting up and stabilizing the molecular design of gene regulation and by understanding this process one gains profound insight into the underlying biology of mammals. In this article, we trace the discoveries that provided the foundations of this field, starting with the mapping of methyl groups in the genome and the experiments that helped clarify how methylation patterns are maintained through cell division. We then address the basic relationship between methyl groups and gene repression, as well as the molecular rules involved in controlling this process during development in vivo. Finally, we describe ongoing work aimed at defining the role of this modification in disease and deciphering how it may serve as a mechanism for sensing the environment.

  5. Methyl-Analyzer--whole genome DNA methylation profiling.

    Science.gov (United States)

    Xin, Yurong; Ge, Yongchao; Haghighi, Fatemeh G

    2011-08-15

    Methyl-Analyzer is a python package that analyzes genome-wide DNA methylation data produced by the Methyl-MAPS (methylation mapping analysis by paired-end sequencing) method. Methyl-MAPS is an enzymatic-based method that uses both methylation-sensitive and -dependent enzymes covering >80% of CpG dinucleotides within mammalian genomes. It combines enzymatic-based approaches with high-throughput next-generation sequencing technology to provide whole genome DNA methylation profiles. Methyl-Analyzer processes and integrates sequencing reads from methylated and unmethylated compartments and estimates CpG methylation probabilities at single base resolution. Methyl-Analyzer is available at http://github.com/epigenomics/methylmaps. Sample dataset is available for download at http://epigenomicspub.columbia.edu/methylanalyzer_data.html. fgh3@columbia.edu Supplementary data are available at Bioinformatics online.

  6. Salicylic acid and nitric oxide alleviate high temperature induced oxidative damage in Lablab purpureus L plants by regulating bio-physical processes and DNA methylation.

    Science.gov (United States)

    Rai, Krishna Kumar; Rai, Nagendra; Rai, Shashi Pandey

    2018-07-01

    Salicylic acid (SA) and sodium nitroprusside (SNP, NO donor) modulates plant growth and development processes and recent findings have also revealed their involvement in the regulation of epigenetic factors under stress condition. In the present study, some of these factors were comparatively studied in hyacinth bean plants subjected to high temperature (HT) environment (40-42 °C) with and without exogenous application of SA and SNP under field condition. Exogenous application of SA and SNP substantially modulated the growth and biophysical process of hyacinth bean plants under HT environment. Exogenous application of SA and SNP also remarkably regulated the activities of antioxidant enzymes, modulated mRNA level of certain enzymes, improves plant water relation, enhance photosynthesis and thereby increasing plant defence under HT. Coupled restriction enzyme digestion-random amplification (CRED-RA) technique revealed that many methylation changes were "dose dependent" and HT significantly increased DNA damages as evidenced by both increase and decrease in bands profiles, methylation and de-methylation pattern. Thus, the result of the present study clearly shows that exogenous SA and SNP regulates DNA methylation pattern, modulates stress-responsive genes and can impart transient HT tolerance by synchronizing growth and physiological acclimatization of plants, thus narrowing the gaps between physio-biochemical and molecular events in addressing HT tolerance. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  7. ICBP90 Regulation of DNA Methylation, Histone Ubiquitination, and Tumor Suppressor Gene Expression in Breast Cancer Cells

    Science.gov (United States)

    2013-09-01

    accomplishments include creation of relevant plant lines, development of in vitro assays, and profiling of mRNA expression in null mutants. 15. SUBJECT TERMS...DNA methylation, UHRF1, VIM1, ubiquitination, epigenetics, chromatin 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF...Molecular Basis of Human Disease ,” which covered several weeks’ worth of material specifically related to the molecular and epigenetic basis of cancer

  8. miRNAting control of DNA methylation

    Indian Academy of Sciences (India)

    DNA methylation is a type of epigenetic modification where a methyl group is added to the cytosine or adenine residue of a given DNA sequence. It has been observed that DNA methylation is achieved by some collaborative agglomeration of certain proteins and non-coding RNAs. The assembly of IDN2 and its ...

  9. The histone H3K9 methylation and RNAi pathways regulate normalnucleolar and repeated DNA organization by inhibiting formation ofextrachromosomal DNAs

    Energy Technology Data Exchange (ETDEWEB)

    Peng, Jamy C.; Karpen, Gary H.

    2006-06-15

    In order to identify regulators of nuclear organization, Drosophila mutants in the Su(var)3-9 histone H3K9 methyltransferase, RNAi pathway components, and other regulators of heterochromatin-mediated gene silencing were examined for altered nucleoli and positioning of repeated DNAs. Animals lacking components of the H3K9 methylation and RNAi pathways contained disorganized nucleoli, ribosomal DNA (rDNA) and satellite DNAs. The levels of H3K9 dimethylation (H3K9me2) in chromatin associated with repeated DNAs decreased dramatically in Su(var)3-9 and dcr-2 (dicer-2) mutant tissues compared to wild type. We also observed a substantial increase in extrachromosomal repeated DNAs in mutant tissues. The disorganized nucleolus phenotype depends on the presence of Ligase 4 (Lig4), and ecc DNA formation is not induced by removal of cohesin. We conclude that H3K9 methylation of rDNA and satellites, maintained by Su(var)3-9, HP1, and the RNAi pathway, is necessary for the structural stability of repeated DNAs, which is mediated through suppression of non-homologous end joining (NHEJ). These results suggest a mechanism for how local chromatin structure can regulate genome stability, and the organization of chromosomal elements and nuclear organelles.

  10. DNA methylation-dependent regulation of TrkA, TrkB, and TrkC genes in human hepatocellular carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Wook [Laboratory of Molecular Disease and Cell Regulation, Lee Gil Ya Cancer and Diabetes Institute, Gachon University of Medicine and Science, Incheon (Korea, Republic of); Lee, Jong-Joo [Department of Environmental Medical Biology, Institute of Tropical Medicine, Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, 250 Seongsanno, Seodaemun-gu, Seoul 120-752 (Korea, Republic of); Kim, Min Soo [Laboratory of Molecular Disease and Cell Regulation, Lee Gil Ya Cancer and Diabetes Institute, Gachon University of Medicine and Science, Incheon (Korea, Republic of); Son, Byung Ho [Department of Surgery, Kangbuk Samsung Hospital, Sungkyunkwan University, School of Medicine, 108 Pyung-dong, Jongro-gu, Seoul 110-746 (Korea, Republic of); Cho, Yong Kyun, E-mail: choyk2004@hanmail.net [Division of Gastroenterology, Department of Internal Medicine, Kangbuk Samsung Hospital, Sungkyunkwan University, School of Medicine, 108 Pyung-dong, Jongro-gu, Seoul 110-746 (Korea, Republic of); Kim, Hyoung-Pyo, E-mail: kimhp@yuhs.ac [Department of Environmental Medical Biology, Institute of Tropical Medicine, Brain Korea 21 Project for Medical Science, Yonsei University College of Medicine, 250 Seongsanno, Seodaemun-gu, Seoul 120-752 (Korea, Republic of)

    2011-03-04

    Research highlights: {yields} Expression of TrkA, TrkB, and TrkC is significantly elevated in human hepatocellular carcinoma. {yields} Downregulation of Trks is correlated with their promoter hypermethylation. {yields} Inhibiting DNA methylation restored expression of Trks in normal liver cell lines. {yields} Trks promote the proliferation of hepatocellular carcinoma. {yields} Trks induce expression of the metastatic regulator, Twist. -- Abstract: The tropomyosin-related kinase (Trk) family of neurotrophin receptors, TrkA, TrkB and TrkC, has been implicated in the growth and survival of human cancers. Here we report that Trks are frequently overexpressed in hepatocellular carcinoma (HCC) from patients and human liver cancer cell lines. To unravel the underlying molecular mechanism(s) for this phenomenon, DNA methylation patterns of CpG islands in TrkA, TrkB, and TrkC genes were examined in normal and cancer cell lines derived from liver. A good correlation was observed between promoter hypermethylation and lower expression of TrkA, TrkB, and TrkC genes, which was supported by the data that inhibiting DNA methylation with 5-azacytidine restored expression of those genes in normal liver cell lines. Furthermore, Trks promoted the proliferation of HepG2 and induced expression of the metastatic regulator, Twist. These results suggest that Trks may contribute to growth and metastasis of liver cancer.

  11. DNA methylation-dependent regulation of TrkA, TrkB, and TrkC genes in human hepatocellular carcinoma

    International Nuclear Information System (INIS)

    Jin, Wook; Lee, Jong-Joo; Kim, Min Soo; Son, Byung Ho; Cho, Yong Kyun; Kim, Hyoung-Pyo

    2011-01-01

    Research highlights: → Expression of TrkA, TrkB, and TrkC is significantly elevated in human hepatocellular carcinoma. → Downregulation of Trks is correlated with their promoter hypermethylation. → Inhibiting DNA methylation restored expression of Trks in normal liver cell lines. → Trks promote the proliferation of hepatocellular carcinoma. → Trks induce expression of the metastatic regulator, Twist. -- Abstract: The tropomyosin-related kinase (Trk) family of neurotrophin receptors, TrkA, TrkB and TrkC, has been implicated in the growth and survival of human cancers. Here we report that Trks are frequently overexpressed in hepatocellular carcinoma (HCC) from patients and human liver cancer cell lines. To unravel the underlying molecular mechanism(s) for this phenomenon, DNA methylation patterns of CpG islands in TrkA, TrkB, and TrkC genes were examined in normal and cancer cell lines derived from liver. A good correlation was observed between promoter hypermethylation and lower expression of TrkA, TrkB, and TrkC genes, which was supported by the data that inhibiting DNA methylation with 5-azacytidine restored expression of those genes in normal liver cell lines. Furthermore, Trks promoted the proliferation of HepG2 and induced expression of the metastatic regulator, Twist. These results suggest that Trks may contribute to growth and metastasis of liver cancer.

  12. Electronic transport in methylated fragments of DNA

    International Nuclear Information System (INIS)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

    2015-01-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics

  13. Electronic transport in methylated fragments of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  14. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.

    2010-01-01

    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response

  15. Implications of DNA Methylation in Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Ernesto Miranda-Morales

    2017-07-01

    Full Text Available It has been 200 years since Parkinson’s disease (PD was first described, yet many aspects of its etiopathogenesis remain unclear. PD is a progressive and complex neurodegenerative disorder caused by genetic and environmental factors including aging, nutrition, pesticides and exposure to heavy metals. DNA methylation may be altered in response to some of these factors; therefore, it is proposed that epigenetic mechanisms, particularly DNA methylation, can have a fundamental role in gene–environment interactions that are related with PD. Epigenetic changes in PD-associated genes are now widely studied in different populations, to discover the mechanisms that contribute to disease development and identify novel biomarkers for early diagnosis and future pharmacological treatment. While initial studies sought to find associations between promoter DNA methylation and the regulation of associated genes in PD brain tissue, more recent studies have described concordant DNA methylation patterns between blood and brain tissue DNA. These data justify the use of peripheral blood samples instead of brain tissue for epigenetic studies. Here, we summarize the current data about DNA methylation changes in PD and discuss the potential of DNA methylation as a potential biomarker for PD. Additionally, we discuss environmental and nutritional factors that have been implicated in DNA methylation. Although the search for significant DNA methylation changes and gene expression analyses of PD-associated genes have yielded inconsistent and contradictory results, epigenetic modifications remain under investigation for their potential to reveal the link between environmental risk factors and the development of PD.

  16. Whole-genome methylation caller designed for methyl- DNA ...

    African Journals Online (AJOL)

    etchie

    2013-02-20

    Feb 20, 2013 ... Key words: Methyl-DNA immunoprecipitation, next-generation sequencing, Hidden ... its response to environmental cues. .... have a great potential to become the most cost-effective ... hg18 reference genome (set to 0 if not present in retrieved reads). ..... DNA methylation patterns and epigenetic memory.

  17. DNA methylation dynamics in muscle development and disease

    Directory of Open Access Journals (Sweden)

    Elvira eCarrio

    2015-03-01

    Full Text Available DNA methylation is an essential epigenetic modification for mammalian development and is crucial for the establishment and maintenance of cellular identity. Traditionally, DNA methylation has been considered as a permanent repressive epigenetic mark. However, the application of genome-wide approaches has allowed the analysis of DNA methylation in different genomic contexts revealing a more dynamic regulation than originally thought, since active DNA methylation and demethylation occur during cellular differentiation and tissue specification. Satellite cells are the primary stem cells in adult skeletal muscle and are responsible for postnatal muscle growth, hypertrophy, and muscle regeneration. This review outlines the published data regarding DNA methylation changes along the skeletal muscle program, in both physiological and pathological conditions, to better understand the epigenetic mechanisms that control myogenesis

  18. miRNAting control of DNA methylation

    Indian Academy of Sciences (India)

    miRNAting control of DNA methylation. ASHWANI ... function and biological process ... Enrichment analysis of the genes methylated by DRM2 for molecular function and biological ... 39(3), June 2014, 365–380, © Indian Academy of Sciences.

  19. Role for DNA methylation in the regulation of miR-200c and miR-141 expression in normal and cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Vrba, Lukas; Jensen, Taylor J.; Garbe, James C.; Heimark, Ronald L.; Cress, Anne E.; Dickinson, Sally; Stampfer, Martha R.; Futscher, Bernard W.

    2009-12-23

    BACKGROUND: The microRNA-200 family participates in the maintenance of an epithelial phenotype and loss of its expression can result in epithelial to mesenchymal transition (EMT). Furthermore, the loss of expression of miR-200 family members is linked to an aggressive cancer phenotype. Regulation of the miR-200 family expression in normal and cancer cells is not fully understood. METHODOLOGY/ PRINCIPAL FINDINGS: Epigenetic mechanisms participate in the control of miR-200c and miR-141 expression in both normal and cancer cells. A CpG island near the predicted mir-200c/mir-141 transcription start site shows a striking correlation between miR-200c and miR-141 expression and DNA methylation in both normal and cancer cells, as determined by MassARRAY technology. The CpG island is unmethylated in human miR-200/miR-141 expressing epithelial cells and in miR-200c/miR-141 positive tumor cells. The CpG island is heavily methylated in human miR-200c/miR-141 negative fibroblasts and miR-200c/miR-141 negative tumor cells. Mouse cells show a similar inverse correlation between DNA methylation and miR-200c expression. Enrichment of permissive histone modifications, H3 acetylation and H3K4 trimethylation, is seen in normal miR-200c/miR-141-positive epithelial cells, as determined by chromatin immunoprecipitation coupled to real-time PCR. In contrast, repressive H3K9 dimethylation marks are present in normal miR-200c/miR-141-negative fibroblasts and miR-200c/miR-141 negative cancer cells and the permissive histone modifications are absent. The epigenetic modifier drug, 5-aza-2'-deoxycytidine, reactivates miR-200c/miR-141 expression showing that epigenetic mechanisms play a functional role in their transcriptional control. CONCLUSIONS/ SIGNIFICANCE: We report that DNA methylation plays a role in the normal cell type-specific expression of miR-200c and miR-141 and this role appears evolutionarily conserved, since similar results were obtained in mouse. Aberrant DNA methylation

  20. Evidence Suggesting Absence of Mitochondrial DNA Methylation

    DEFF Research Database (Denmark)

    Mechta, Mie; Ingerslev, Lars R; Fabre, Odile

    2017-01-01

    , 16S, ND5 and CYTB, suggesting that mtDNA supercoiled structure blocks the access to bisulfite conversion. Here, we identified an artifact of mtDNA bisulfite sequencing that can lead to an overestimation of mtDNA methylation levels. Our study supports that cytosine methylation is virtually absent...

  1. MicroRNA-219-2-3p functions as a tumor suppressor in gastric cancer and is regulated by DNA methylation.

    Directory of Open Access Journals (Sweden)

    Huizi Lei

    Full Text Available BACKGROUND AIMS: Gastric cancer is the most frequent gastrointestinal tumor in adults and is the most lethal form of human cancer. Despite of the improvements in treatments, the underlying mechanism of gastric carcinogenesis is not well known. To define novel modulators that regulate susceptibility to tumorgenesis, we focused on miR-219-2-3p. METHODS: Quantitative RT-PCR was employed to investigate the level of miR-219-2-3p in gastric cancer (GC tissues (n = 113 and their matched adjacent normal tissues (n = 113. In vitro cell proliferation, apoptosis assays, cell migration, and invasion assays were performed to elucidate biological effects of miR-219-2-3p. Since silencing of miRNA by promoter CpG island methylation may be an important mechanism in tumorgenesis, GC cells were treated with 5-aza-2'-deoxycytidine and trichostatin A, and expression changes of miR-219-2-3p were subsequently examined by quantitative RT-PCR. Finally, the methylation status of CpG island upstream of miR-219-2-3p was analyzed by methylation-specific PCR in GC tissues (n = 22. RESULTS: miR-219-2-3p was down-regulated in GC and cell lines. In addition, the experiments documented the lower expression of miR-219-2-3p in GC specimens with higher grade and later stage tumors. Meanwhile, miR-219-2-3p exerted antiproliferative, proapoptotic, and antimetastatic roles and reduced levels of p-ERK1/2 in GC cells. Furthermore, 5-aza-2'-deoxycytidine and trichostatin A increased the expression (~2 fold of miR-219-2-3p in GC cells. By methylation-specific PCR, DNA methylation in the upstream region of miR-219-2-3p was detected in both adjacent normal tissues and cancer tissues. As expected, the methylation level was considerably higher in the miR-219-2-3p down-regulated group than up-regulated group. CONCLUSIONS: miR-219-2-3p is potentially involved in gastric cancer progression and metastasis by regulating ERK1/2-related signal pathways, which may provide a novel therapeutic strategy

  2. What do unicellular organisms teach us about DNA methylation?

    Science.gov (United States)

    Harony, Hala; Ankri, Serge

    2008-05-01

    DNA methylation is an epigenetic hallmark that has been studied intensively in mammals and plants. However, knowledge of this phenomenon in unicellular organisms is scanty. Examining epigenetic regulation, and more specifically DNA methylation, in these organisms represents a unique opportunity to better understand their biology. The determination of their methylation status is often complicated by the presence of several differentiation stages in their life cycle. This article focuses on some recent advances that have revealed the unexpected nature of the epigenetic determinants present in protozoa. The role of the enigmatic DNA methyltransferase Dnmt2 in unicellular organisms is discussed.

  3. DNA methylation-based variation between human populations.

    Science.gov (United States)

    Kader, Farzeen; Ghai, Meenu

    2017-02-01

    Several studies have proved that DNA methylation affects regulation of gene expression and development. Epigenome-wide studies have reported variation in methylation patterns between populations, including Caucasians, non-Caucasians (Blacks), Hispanics, Arabs, and numerous populations of the African continent. Not only has DNA methylation differences shown to impact externally visible characteristics, but is also a potential biomarker for underlying racial health disparities between human populations. Ethnicity-related methylation differences set their mark during early embryonic development. Genetic variations, such as single-nucleotide polymorphisms and environmental factors, such as age, dietary folate, socioeconomic status, and smoking, impacts DNA methylation levels, which reciprocally impacts expression of phenotypes. Studies show that it is necessary to address these external influences when attempting to differentiate between populations since the relative impacts of these factors on the human methylome remain uncertain. The present review summarises several reported attempts to establish the contribution of differential DNA methylation to natural human variation, and shows that DNA methylation could represent new opportunities for risk stratification and prevention of several diseases amongst populations world-wide. Variation of methylation patterns between human populations is an exciting prospect which inspires further valuable research to apply the concept in routine medical and forensic casework. However, trans-generational inheritance needs to be quantified to decipher the proportion of variation contributed by DNA methylation. The future holds thorough evaluation of the epigenome to understand quantification, heritability, and the effect of DNA methylation on phenotypes. In addition, methylation profiling of the same ethnic groups across geographical locations will shed light on conserved methylation differences in populations.

  4. miRNA-148a regulates the expression of the estrogen receptor through DNMT1-mediated DNA methylation in breast cancer cells

    Science.gov (United States)

    Xu, Yurui; Chao, Lin; Wang, Jianyu; Sun, Yonghong

    2017-01-01

    Breast cancer remains the most prevalent cancer among women worldwide. The expression of estrogen receptor-α (ER-α) is an important marker for prognosis. ER-α status may be positive or negative in breast cancer cells, although the cause of negative or positive status is not yet fully characterized. In the present study, the expression of ER-α and miRNA-148a was assessed in two breast cancer cell lines, HCC1937 and MCF7. An association between ER-α and miRNA-148a expression was identified. It was then demonstrated that DNA methyltransferase 1 (DNMT1) is a target of miRNA-148a, which may suppress the expression of ER-α via DNA methylation. Finally, an miRNA-148a mimic or inhibitor was transfected into MCF7 cells; the miRNA-148a mimic increased ER-α expression whereas the miRNA-148a inhibitor decreased ER-α expression. In conclusion, it was identified that miRNA-148a regulates ER-α expression through DNMT1-mediated DNA methylation in breast cancer cells. This may represent a potential miRNA-based strategy to modulate the expression of ER-α and provide a novel perspective for investigating the role of miRNAs in treating breast cancer. PMID:29085474

  5. Whole-genome transcription and DNA methylation analysis of peripheral blood mononuclear cells identified aberrant gene regulation pathways in systemic lupus erythematosus.

    Science.gov (United States)

    Zhu, Honglin; Mi, Wentao; Luo, Hui; Chen, Tao; Liu, Shengxi; Raman, Indu; Zuo, Xiaoxia; Li, Quan-Zhen

    2016-07-13

    Recent achievement in genetics and epigenetics has led to the exploration of the pathogenesis of systemic lupus erythematosus (SLE). Identification of differentially expressed genes and their regulatory mechanism(s) at whole-genome level will provide a comprehensive understanding of the development of SLE and its devastating complications, lupus nephritis (LN). We performed whole-genome transcription and DNA methylation analysis in PBMC of 30 SLE patients, including 15 with LN (SLE LN(+)) and 15 without LN (SLE LN(-)), and 25 normal controls (NC) using HumanHT-12 Beadchips and Illumina Human Methy450 chips. The serum proinflammatory cytokines were quantified using Bio-plex Human Cytokine 27-plex assay. Differentially expressed genes and differentially methylated CpG were analyzed with GenomeStudio, R, and SAM software. The association between DNA methylation and gene expression were tested. Gene interaction pathways of the differentially expressed genes were analyzed by IPA software. We identified 552 upregulated genes and 550 downregulated genes in PBMC of SLE. Integration of DNA methylation and gene expression profiling showed that 334 upregulated genes were hypomethylated, and 479 downregulated genes were hypermethylated. Pathway analysis on the differential genes in SLE revealed significant enrichment in interferon (IFN) signaling and toll-like receptor (TLR) signaling pathways. Nine IFN- and seven TLR-related genes were identified and displayed step-wise increase in SLE LN(-) and SLE LN(+). Hypomethylated CpG sites were detected on these genes. The gene expressions for MX1, GPR84, and E2F2 were increased in SLE LN(+) as compared to SLE LN(-) patients. The serum levels of inflammatory cytokines, including IL17A, IP-10, bFGF, TNF-α, IL-6, IL-15, GM-CSF, IL-1RA, IL-5, and IL-12p70, were significantly elevated in SLE compared with NC. The levels of IL-15 and IL1RA correlated with their mRNA expression. The upregulation of IL-15 may be regulated by hypomethylated

  6. Oxidative Stress and DNA Methylation in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Krishna Vanaja Donkena

    2010-01-01

    Full Text Available The protective effects of fruits, vegetables, and other foods on prostate cancer may be due to their antioxidant properties. An imbalance in the oxidative stress/antioxidant status is observed in prostate cancer patients. Genome oxidative damage in prostate cancer patients is associated with higher lipid peroxidation and lower antioxidant levels. Oxygen radicals are associated with different steps of carcinogenesis, including structural DNA damage, epigenetic changes, and protein and lipid alterations. Epigenetics affects genetic regulation, cellular differentiation, embryology, aging, cancer, and other diseases. DNA methylation is perhaps the most extensively studied epigenetic modification, which plays an important role in the regulation of gene expression and chromatin architecture, in association with histone modification and other chromatin-associated proteins. This review will provide a broad overview of the interplay of oxidative stress and DNA methylation, DNA methylation changes in regulation of gene expression, lifestyle changes for prostate cancer prevention, DNA methylation as biomarkers for prostate cancer, methods for detection of methylation, and clinical application of DNA methylation inhibitors for epigenetic therapy.

  7. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo

    2007-07-01

    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  8. Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication.

    Science.gov (United States)

    Haruta, Mayumi; Shimada, Midori; Nishiyama, Atsuya; Johmura, Yoshikazu; Le Tallec, Benoît; Debatisse, Michelle; Nakanishi, Makoto

    2016-01-22

    The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. DNMT1-interacting RNAs block gene specific DNA methylation

    Science.gov (United States)

    Di Ruscio, Annalisa; Ebralidze, Alexander K.; Benoukraf, Touati; Amabile, Giovanni; Goff, Loyal A.; Terragni, Joylon; Figueroa, Maria Eugenia; De Figureido Pontes, Lorena Lobo; Alberich-Jorda, Meritxell; Zhang, Pu; Wu, Mengchu; D’Alò, Francesco; Melnick, Ari; Leone, Giuseppe; Ebralidze, Konstantin K.; Pradhan, Sriharsa; Rinn, John L.; Tenen, Daniel G.

    2013-01-01

    Summary DNA methylation was described almost a century ago. However, the rules governing its establishment and maintenance remain elusive. Here, we present data demonstrating that active transcription regulates levels of genomic methylation. We identified a novel RNA arising from the CEBPA gene locus critical in regulating the local DNA methylation profile. This RNA binds to DNMT1 and prevents CEBPA gene locus methylation. Deep sequencing of transcripts associated with DNMT1 combined with genome-scale methylation and expression profiling extended the generality of this finding to numerous gene loci. Collectively, these results delineate the nature of DNMT1-RNA interactions and suggest strategies for gene selective demethylation of therapeutic targets in disease. PMID:24107992

  10. DNA methylation profiling of embryonic stem cell differentiation into the three germ layers.

    Science.gov (United States)

    Isagawa, Takayuki; Nagae, Genta; Shiraki, Nobuaki; Fujita, Takanori; Sato, Noriko; Ishikawa, Shumpei; Kume, Shoen; Aburatani, Hiroyuki

    2011-01-01

    Embryogenesis is tightly regulated by multiple levels of epigenetic regulation such as DNA methylation, histone modification, and chromatin remodeling. DNA methylation patterns are erased in primordial germ cells and in the interval immediately following fertilization. Subsequent developmental reprogramming occurs by de novo methylation and demethylation. Variance in DNA methylation patterns between different cell types is not well understood. Here, using methylated DNA immunoprecipitation and tiling array technology, we have comprehensively analyzed DNA methylation patterns at proximal promoter regions in mouse embryonic stem (ES) cells, ES cell-derived early germ layers (ectoderm, endoderm and mesoderm) and four adult tissues (brain, liver, skeletal muscle and sperm). Most of the methylated regions are methylated across all three germ layers and in the three adult somatic tissues. This commonly methylated gene set is enriched in germ cell-associated genes that are generally transcriptionally inactive in somatic cells. We also compared DNA methylation patterns by global mapping of histone H3 lysine 4/27 trimethylation, and found that gain of DNA methylation correlates with loss of histone H3 lysine 4 trimethylation. Our combined findings indicate that differentiation of ES cells into the three germ layers is accompanied by an increased number of commonly methylated DNA regions and that these tissue-specific alterations in methylation occur for only a small number of genes. DNA methylation at the proximal promoter regions of commonly methylated genes thus appears to be an irreversible mark which functions to fix somatic lineage by repressing the transcription of germ cell-specific genes.

  11. Radiation effects on DNA methylation in mice

    International Nuclear Information System (INIS)

    Komura, J.; Kurishita, A.; Miyamura, Y.; Ono, T.; Tawa, R.; Sakurai, H.

    1992-01-01

    Effects of ionizing radiation on DNA methylation in liver, brain and spleen were examined by high performance liquid chromatography (HPLC). The total methylated cytosine level in the genome was reduced within 8 hours after 3.8 Gy of irradiation in liver of adult mice. But no appreciable effect was observed in brain and spleen. When mice were irradiated at newborn, liver DNA revealed no change in methylated cytosine level. Even though slight effects of radiation were detected in he methylation of the c-myc and c-fos genes, they were only temporary and no long-term effects were observed. These data suggest that the effect of radiation on DNA methylation in vivo is not prevailing a DNA damage, but rather influenced much through biological parameters. (author)

  12. Maternal intake of methyl-group donors affects DNA methylation of metabolic genes in infants.

    Science.gov (United States)

    Pauwels, Sara; Ghosh, Manosij; Duca, Radu Corneliu; Bekaert, Bram; Freson, Kathleen; Huybrechts, Inge; Langie, Sabine A S; Koppen, Gudrun; Devlieger, Roland; Godderis, Lode

    2017-01-01

    during lactation and buccal infant DNA methylation. This study suggests that maternal dietary and supplemental intake of methyl-group donors, especially in the periconception period, can influence infant's buccal DNA methylation in genes related to metabolism, growth, appetite regulation, and maintenance of DNA methylation reactions.

  13. De novo DNA methylation during monkey pre-implantation embryogenesis.

    Science.gov (United States)

    Gao, Fei; Niu, Yuyu; Sun, Yi Eve; Lu, Hanlin; Chen, Yongchang; Li, Siguang; Kang, Yu; Luo, Yuping; Si, Chenyang; Yu, Juehua; Li, Chang; Sun, Nianqin; Si, Wei; Wang, Hong; Ji, Weizhi; Tan, Tao

    2017-04-01

    Critical epigenetic regulation of primate embryogenesis entails DNA methylome changes. Here we report genome-wide composition, patterning, and stage-specific dynamics of DNA methylation in pre-implantation rhesus monkey embryos as well as male and female gametes studied using an optimized tagmentation-based whole-genome bisulfite sequencing method. We show that upon fertilization, both paternal and maternal genomes undergo active DNA demethylation, and genome-wide de novo DNA methylation is also initiated in the same period. By the 8-cell stage, remethylation becomes more pronounced than demethylation, resulting in an increase in global DNA methylation. Promoters of genes associated with oxidative phosphorylation are preferentially remethylated at the 8-cell stage, suggesting that this mode of energy metabolism may not be favored. Unlike in rodents, X chromosome inactivation is not observed during monkey pre-implantation development. Our study provides the first comprehensive illustration of the 'wax and wane' phases of DNA methylation dynamics. Most importantly, our DNA methyltransferase loss-of-function analysis indicates that DNA methylation influences early monkey embryogenesis.

  14. Drugging the methylome: DNA methylation and memory.

    Science.gov (United States)

    Kennedy, Andrew J; Sweatt, J David

    2016-01-01

    Over the past decade, since epigenetic mechanisms were first implicated in memory formation and synaptic plasticity, dynamic DNA methylation reactions have been identified as integral to long-term memory formation, maintenance, and recall. This review incorporates various new findings that DNA methylation mechanisms are important regulators of non-Hebbian plasticity mechanisms, suggesting that these epigenetic mechanisms are a fundamental link between synaptic plasticity and metaplasticity. Because the field of neuroepigenetics is so young and the biochemical tools necessary to probe gene-specific questions are just now being developed and used, this review also speculates about the direction and potential of therapeutics that target epigenetic mechanisms in the central nervous system and the unique pharmacokinetic and pharmacodynamic properties that epigenetic therapies may possess. Mapping the dynamics of the epigenome in response to experiential learning, even a single epigenetic mark in isolation, remains a significant technical and bioinformatic hurdle facing the field, but will be necessary to identify changes to the methylome that govern memory-associated gene expression and effectively drug the epigenome.

  15. DNA Methylation Biomarkers: Cancer and Beyond

    Directory of Open Access Journals (Sweden)

    Thomas Mikeska

    2014-09-01

    Full Text Available Biomarkers are naturally-occurring characteristics by which a particular pathological process or disease can be identified or monitored. They can reflect past environmental exposures, predict disease onset or course, or determine a patient’s response to therapy. Epigenetic changes are such characteristics, with most epigenetic biomarkers discovered to date based on the epigenetic mark of DNA methylation. Many tissue types are suitable for the discovery of DNA methylation biomarkers including cell-based samples such as blood and tumor material and cell-free DNA samples such as plasma. DNA methylation biomarkers with diagnostic, prognostic and predictive power are already in clinical trials or in a clinical setting for cancer. Outside cancer, strong evidence that complex disease originates in early life is opening up exciting new avenues for the detection of DNA methylation biomarkers for adverse early life environment and for estimation of future disease risk. However, there are a number of limitations to overcome before such biomarkers reach the clinic. Nevertheless, DNA methylation biomarkers have great potential to contribute to personalized medicine throughout life. We review the current state of play for DNA methylation biomarkers, discuss the barriers that must be crossed on the way to implementation in a clinical setting, and predict their future use for human disease.

  16. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status. © 2013 Elsevier Inc. All rights reserved.

  17. DNA methylation in states of cell physiology and pathology.

    Directory of Open Access Journals (Sweden)

    Lech Chyczewski

    2007-10-01

    Full Text Available DNA methylation is one of epigenetic mechanisms regulating gene expression. The methylation pattern is determined during embryogenesis and passed over to differentiating cells and tissues. In a normal cell, a significant degree of methylation is characteristic for extragenic DNA (cytosine within the CG dinucleotide while CpG islands located in gene promoters are unmethylated, except for inactive genes of the X chromosome and the genes subjected to genomic imprinting. The changes in the methylation pattern, which may appear as the organism age and in early stages of cancerogenesis, may lead to the silencing of over ninety endogenic genes. It has been found, that these disorders consist not only of the methylation of CpG islands, which are normally unmethylated, but also of the methylation of other dinucleotides, e.g. CpA. Such methylation has been observed in non-small cell lung cancer, in three regions of the exon 5 of the p53 gene (so-called "non-CpG" methylation. The knowledge of a normal methylation process and its aberrations appeared to be useful while searching for new markers enabling an early detection of cancer. With the application of the Real-Time PCR technique (using primers for methylated and unmethylated sequences five new genes which are potential biomarkers of lung cancer have been presented.

  18. Identification of Novel Gene Targets and Putative Regulators of Arsenic-Associated DNA Methylation in Human Urothelial Cells and Bladder Cancer

    Science.gov (United States)

    Rager, Julia E.; Miller, Sloane; Tulenko, Samantha E.; Smeester, Lisa; Ray, Paul D.; Yosim, Andrew; Currier, Jenna M.; Ishida, María C.; González-Horta, Maria del Carmen; Sánchez-Ramírez, Blanca; Ballinas-Casarrubias, Lourdes; Gutiérrez-Torres, Daniela S.; Drobná, Zuzana; Del Razo, Luz M.; García-Vargas, Gonzalo G.; Kim, William Y.; Zhou, Yi-Hui; Wright, Fred A.; Stýblo, Miroslav; Fry, Rebecca C.

    2016-01-01

    There is strong epidemiologic evidence linking chronic exposure to inorganic arsenic (iAs) to a myriad of adverse health effects, including cancer of the bladder. The present study set out to identify DNA methylation patterns associated with iAs and its metabolites in exfoliated urothelial cells (EUCs) that originate primarily from the urinary bladder, one of the targets of arsenic (As)-induced carcinogenesis. Genome-wide, gene-specific promoter DNA methylation levels were assessed in EUCs from 46 residents of Chihuahua, Mexico, and the relationship was examined between promoter methylation profiles and the intracellular concentrations of total As (tAs) and As species. A set of 49 differentially methylated genes was identified with increased promoter methylation associated with EUC tAs, iAs, and/or monomethylated As (MMAs) enriched for their roles in metabolic disease and cancer. Notably, no genes had differential methylation associated with EUC dimethylated As (DMAs), suggesting that DMAs may influence DNA methylation-mediated urothelial cell responses to a lesser extent than iAs or MMAs. Further analysis showed that 22 of the 49 As-associated genes (45%) are also differentially methylated in bladder cancer tissue identified using The Cancer Genome Atlas repository. Both the As- and cancer-associated genes are enriched for the binding sites of common transcription factors known to play roles in carcinogenesis, demonstrating a novel potential mechanistic link between iAs exposure and bladder cancer. PMID:26039340

  19. Genetic and DNA methylation changes in cotton (Gossypium genotypes and tissues.

    Directory of Open Access Journals (Sweden)

    Kenji Osabe

    Full Text Available In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP assays including a methylation insensitive enzyme (BsiSI, and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC. DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.

  20. Genetic and DNA methylation changes in cotton (Gossypium) genotypes and tissues.

    Science.gov (United States)

    Osabe, Kenji; Clement, Jenny D; Bedon, Frank; Pettolino, Filomena A; Ziolkowski, Lisa; Llewellyn, Danny J; Finnegan, E Jean; Wilson, Iain W

    2014-01-01

    In plants, epigenetic regulation is important in normal development and in modulating some agronomic traits. The potential contribution of DNA methylation mediated gene regulation to phenotypic diversity and development in cotton was investigated between cotton genotypes and various tissues. DNA methylation diversity, genetic diversity, and changes in methylation context were investigated using methylation-sensitive amplified polymorphism (MSAP) assays including a methylation insensitive enzyme (BsiSI), and the total DNA methylation level was measured by high-performance liquid chromatography (HPLC). DNA methylation diversity was greater than the genetic diversity in the selected cotton genotypes and significantly different levels of DNA methylation were identified between tissues, including fibre. The higher DNA methylation diversity (CHG methylation being more diverse than CG methylation) in cotton genotypes suggest epigenetic regulation may be important for cotton, and the change in DNA methylation between fibre and other tissues hints that some genes may be epigenetically regulated for fibre development. The novel approach using BsiSI allowed direct comparison between genetic and epigenetic diversity, and also measured CC methylation level that cannot be detected by conventional MSAP.

  1. Effect of different light quality on DNA methylation variation for brown ...

    African Journals Online (AJOL)

    DNA methylation plays an important role in regulating gene expression during plant development. We studied the effects of different light quality on DNA methylation patterns of brown cotton (Gossypium hirstum) by using the methylation sensitive amplified polymorphism (MSAP). We selected 66 pairs of MSAP selective ...

  2. Quantification of 5-methyl-2'-deoxycytidine in the DNA.

    Science.gov (United States)

    Giel-Pietraszuk, Małgorzata; Insińska-Rak, Małgorzata; Golczak, Anna; Sikorski, Marek; Barciszewska, Mirosława; Barciszewski, Jan

    2015-01-01

    Methylation at position 5 of cytosine (Cyt) at the CpG sequences leading to formation of 5-methyl-cytosine (m(5)Cyt) is an important element of epigenetic regulation of gene expression. Modification of the normal methylation pattern, unique to each organism, leads to the development of pathological processes and diseases, including cancer. Therefore, quantification of the DNA methylation and analysis of changes in the methylation pattern is very important from a practical point of view and can be used for diagnostic purposes, as well as monitoring of the treatment progress. In this paper we present a new method for quantification of 5-methyl-2'deoxycytidine (m(5)C) in the DNA. The technique is based on conversion of m(5)C into fluorescent 3,N(4)-etheno-5-methyl-2'deoxycytidine (εm(5)C) and its identification by reversed-phase high-performance liquid chromatography (RP-HPLC). The assay was used to evaluate m(5)C concentration in DNA of calf thymus and peripheral blood of cows bred under different conditions. This approach can be applied for measuring of 5-methylcytosine in cellular DNA from different cells and tissues.

  3. DNA Methylation Influences Chlorogenic Acid Biosynthesis in Lonicera japonica by Mediating LjbZIP8 to Regulate Phenylalanine Ammonia-Lyase 2 Expression

    Directory of Open Access Journals (Sweden)

    Liangping Zha

    2017-07-01

    Full Text Available The content of active compounds differ in buds and flowers of Lonicera japonica (FLJ and L. japonica var. chinensis (rFLJ. Chlorogenic acid (CGAs were major active compounds of L. japonica and regarded as measurements for quality evaluation. However, little is known concerning the formation of active compounds at the molecular level. We quantified the major CGAs in FLJ and rFLJ, and found the concentrations of CGAs were higher in the buds of rFLJ than those of FLJ. Further analysis of CpG methylation of CGAs biosynthesis genes showed differences between FLJ and rFLJ in the 5′-UTR of phenylalanine ammonia-lyase 2 (PAL2. We identified 11 LjbZIP proteins and 24 rLjbZIP proteins with conserved basic leucine zipper domains, subcellular localization, and electrophoretic mobility shift assay showed that the transcription factor LjbZIP8 is a nuclear-localized protein that specifically binds to the G-box element of the LjPAL2 5′-UTR. Additionally, a transactivation assay and LjbZIP8 overexpression in transgenic tobacco indicated that LjbZIP8 could function as a repressor of transcription. Finally, treatment with 5-azacytidine decreased the transcription level of LjPAL2 and CGAs content in FLJ leaves. These results raise the possibility that DNA methylation might influence the recruitment of LjbZIP8, regulating PAL2 expression level and CGAs content in L. japonica.

  4. Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication

    Energy Technology Data Exchange (ETDEWEB)

    Haruta, Mayumi [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Shimada, Midori, E-mail: midorism@med.nagoya-cu.ac.jp [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Nishiyama, Atsuya; Johmura, Yoshikazu [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Le Tallec, Benoît; Debatisse, Michelle [Institut Curie, Centre de Recherche, 26 rue d’Ulm, CNRS UMR 3244, 75248 ParisCedex 05 (France); Nakanishi, Makoto, E-mail: mkt-naka@med.nagoya-cu.ac.jp [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan)

    2016-01-22

    The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. - Highlights: • DNMT1 depletion results in an abnormal DNA replication program. • Aberrant DNA replication is independent of the DNA damage checkpoint in DNMT1cKO. • DNMT1 catalytic activity and RFT domain are required for proper DNA replication. • DNMT1 catalytic activity and RFT domain are required for cell proliferation.

  5. Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication

    International Nuclear Information System (INIS)

    Haruta, Mayumi; Shimada, Midori; Nishiyama, Atsuya; Johmura, Yoshikazu; Le Tallec, Benoît; Debatisse, Michelle; Nakanishi, Makoto

    2016-01-01

    The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. - Highlights: • DNMT1 depletion results in an abnormal DNA replication program. • Aberrant DNA replication is independent of the DNA damage checkpoint in DNMT1cKO. • DNMT1 catalytic activity and RFT domain are required for proper DNA replication. • DNMT1 catalytic activity and RFT domain are required for cell proliferation.

  6. Modeling spatiotemporal dynamics of DNA methylation

    DEFF Research Database (Denmark)

    Lövkvist, Cecilia Elisabet

    into how epigenetic marks are distributed in the human genome. In the first part of the thesis, we investigate DNA methylation and maintenance of methylation patterns throughout cell division. We argue that collaborative models, those where the methylation of CpG sites depends on the methylation status...... into the game more explicitly in another type of model that speaks out the duality of the two aspects. Using statistical analysis of experimental data, this thesis further explores a link between DNA methylation and nucleosome occupancy. By comparing the patterns on promoters to regions with similar Cp...... division. The patterns of epigentic marks depend on enzymes that ensure their maintenance and introduction. Using theoretical models, this thesis proposes new mechanisms for how enzymes operate to maintain patterns of epigenetic marks. Through analysis of experimental data this work gives new insight...

  7. DNA Methylation Landscapes of Human Fetal Development

    NARCIS (Netherlands)

    Slieker, Roderick C.; Roost, Matthias S.; van Iperen, Liesbeth; Suchiman, H. Eka D; Tobi, Elmar W.; Carlotti, Françoise; de Koning, Eelco J P; Slagboom, P. Eline; Heijmans, Bastiaan T.; Chuva de Sousa Lopes, Susana M.

    2015-01-01

    Remodelling the methylome is a hallmark of mammalian development and cell differentiation. However, current knowledge of DNA methylation dynamics in human tissue specification and organ development largely stems from the extrapolation of studies in vitro and animal models. Here, we report on the DNA

  8. DNA methyltransferase 1 mutations and mitochondrial pathology: is mtDNA methylated?

    Directory of Open Access Journals (Sweden)

    Alessandra eMaresca

    2015-03-01

    Full Text Available Autosomal dominant cerebellar ataxia, deafness and narcolepsy (ADCA-DN and Hereditary sensory neuropathy with dementia and hearing loss (HSN1E are two rare, overlapping neurodegenerative syndromes that have been recently linked to allelic dominant pathogenic mutations in the DNMT1 gene, coding for DNA (cytosine-5-methyltransferase 1. DNMT1 is the enzyme responsible for maintaining the nuclear genome methylation patterns during the DNA replication and repair, thus regulating gene expression. The mutations responsible for ADCA-DN and HSN1E affect the replication foci targeting sequence domain, which regulates DNMT1 binding to chromatin. DNMT1 dysfunction is anticipated to lead to a global alteration of the DNA methylation pattern with predictable downstream consequences on gene expression. Interestingly, ADCA-DN and HSN1E phenotypes share some clinical features typical of mitochondrial diseases, such as optic atrophy, peripheral neuropathy and deafness, and some biochemical evidence of mitochondrial dysfunction. The recent discovery of a mitochondrial isoform of DNMT1 and its proposed role in methylating mitochondrial DNA (mtDNA suggests that DNMT1 mutations may directly affect mtDNA and mitochondrial physiology. On the basis of this latter finding the link between DNMT1 abnormal activity and mitochondrial dysfunction in ADCA-DN and HSN1E appears intuitive, however mtDNA methylation remains highly debated. In the last years several groups demonstrated the presence of 5-methylcytosine in mtDNA by different approaches, but, on the other end, the opposite evidence that mtDNA is not methylated has also been published. Since over 1500 mitochondrial proteins are encoded by the nuclear genome, the altered methylation of these genes may well have a critical role in leading to the mitochondrial impairment observed in ADCA-DN and HSN1E. Thus, many open questions still remain unanswered, such as why mtDNA should be methylated, and how this process is

  9. Analysis of DNA methylation in various swine tissues.

    Directory of Open Access Journals (Sweden)

    Chun Yang

    Full Text Available DNA methylation is known to play an important role in regulating gene expression during biological development and tissue differentiation in eukaryotes. In this study, we used the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP method to assess the extent and pattern of cytosine methylation in muscle, heart, liver, spleen, lung, kidney and stomach from the swine strain Laiwu, and we also examined specific methylation patterns in the seven tissues. In total, 96,371 fragments, each representing a recognition site cleaved by either or both EcoRI + HpaII and EcoRI + MspI, the HpaII and MspI are isoschizomeric enzymes, were amplified using 16 pairs of selective primers. A total of 50,094 sites were found to be methylated at cytosines in seven tissues. The incidence of DNA methylation was approximately 53.99% in muscle, 51.24% in the heart, 50.18% in the liver, 53.31% in the spleen, 51.97% in the lung, 51.15% in the kidney and 53.39% in the stomach, as revealed by the incidence of differential digestion. Additionally, differences in DNA methylation levels imply that such variations may be related to specific gene expression during tissue differentiation, growth and development. Three types of bands were generated in the F-MSAP profile, the total numbers of these three types of bands in the seven tissues were 46,277, 24,801 and 25,293, respectively.In addition, different methylation patterns were observed in seven tissues from pig, and almost all of the methylation patterns detected by F-MSAP could be confirmed by Southern analysis using the isolated amplified fragments as probes. The results clearly demonstrated that the F-MSAP technique can be adapted for use in large-scale DNA methylation detection in the pig genome.

  10. Bisulfite sequencing reveals that Aspergillus flavus holds a hollow in DNA methylation.

    Directory of Open Access Journals (Sweden)

    Si-Yang Liu

    Full Text Available Aspergillus flavus first gained scientific attention for its production of aflatoxin. The underlying regulation of aflatoxin biosynthesis has been serving as a theoretical model for biosynthesis of other microbial secondary metabolites. Nevertheless, for several decades, the DNA methylation status, one of the important epigenomic modifications involved in gene regulation, in A. flavus remains to be controversial. Here, we applied bisulfite sequencing in conjunction with a biological replicate strategy to investigate the DNA methylation profiling of A. flavus genome. Both the bisulfite sequencing data and the methylome comparisons with other fungi confirm that the DNA methylation level of this fungus is negligible. Further investigation into the DNA methyltransferase of Aspergillus uncovers its close relationship with RID-like enzymes as well as its divergence with the methyltransferase of species with validated DNA methylation. The lack of repeat contents of the A. flavus' genome and the high RIP-index of the small amount of remanent repeat potentially support our speculation that DNA methylation may be absent in A. flavus or that it may possess de novo DNA methylation which occurs very transiently during the obscure sexual stage of this fungal species. This work contributes to our understanding on the DNA methylation status of A. flavus, as well as reinforces our views on the DNA methylation in fungal species. In addition, our strategy of applying bisulfite sequencing to DNA methylation detection in species with low DNA methylation may serve as a reference for later scientific investigations in other hypomethylated species.

  11. Linkage of DNA Methylation Quantitative Trait Loci to Human Cancer Risk

    Directory of Open Access Journals (Sweden)

    Holger Heyn

    2014-04-01

    Full Text Available Epigenetic regulation and, in particular, DNA methylation have been linked to the underlying genetic sequence. DNA methylation quantitative trait loci (meQTL have been identified through significant associations between the genetic and epigenetic codes in physiological and pathological contexts. We propose that interrogating the interplay between polymorphic alleles and DNA methylation is a powerful method for improving our interpretation of risk alleles identified in genome-wide association studies that otherwise lack mechanistic explanation. We integrated patient cancer risk genotype data and genome-scale DNA methylation profiles of 3,649 primary human tumors, representing 13 solid cancer types. We provide a comprehensive meQTL catalog containing DNA methylation associations for 21% of interrogated cancer risk polymorphisms. Differentially methylated loci harbor previously reported and as-yet-unidentified cancer genes. We suggest that such regulation at the DNA level can provide a considerable amount of new information about the biology of cancer-risk alleles.

  12. Prognostic DNA Methylation Markers for Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Siri H. Strand

    2014-09-01

    Full Text Available Prostate cancer (PC is the most commonly diagnosed neoplasm and the third most common cause of cancer-related death amongst men in the Western world. PC is a clinically highly heterogeneous disease, and distinction between aggressive and indolent disease is a major challenge for the management of PC. Currently, no biomarkers or prognostic tools are able to accurately predict tumor progression at the time of diagnosis. Thus, improved biomarkers for PC prognosis are urgently needed. This review focuses on the prognostic potential of DNA methylation biomarkers for PC. Epigenetic changes are hallmarks of PC and associated with malignant initiation as well as tumor progression. Moreover, DNA methylation is the most frequently studied epigenetic alteration in PC, and the prognostic potential of DNA methylation markers for PC has been demonstrated in multiple studies. The most promising methylation marker candidates identified so far include PITX2, C1orf114 (CCDC181 and the GABRE~miR-452~miR-224 locus, in addition to the three-gene signature AOX1/C1orf114/HAPLN3. Several other biomarker candidates have also been investigated, but with less stringent clinical validation and/or conflicting evidence regarding their possible prognostic value available at this time. Here, we review the current evidence for the prognostic potential of DNA methylation markers in PC.

  13. DNA methylation regulates gabrb2 mRNA expression: developmental variations and disruptions in l-methionine-induced zebrafish with schizophrenia-like symptoms.

    Science.gov (United States)

    Wang, L; Jiang, W; Lin, Q; Zhang, Y; Zhao, C

    2016-11-01

    Single nucleotide polymorphisms (SNPs) in the human type A gamma-aminobutyric acid (GABA) receptor β 2 subunit gene (GABRB2) have been associated with schizophrenia and quantitatively correlated with mRNA expression in the postmortem brain tissue of patients with schizophrenia. l-Methionine (MET) administration has been reported to cause a recrudescence of psychotic symptoms in patients with schizophrenia, and similar symptoms have been generated in MET-induced mice. In this study, a zebrafish animal model was used to evaluate the relationship between the gabrb2 mRNA expression and its promoter DNA methylation in developmental and MET-induced schizophrenia-like zebrafish. The results indicated developmental increases in global DNA methylation and decreases in gabrb2 promoter methylation in zebrafish. A significant increase in gabrb2 mRNA levels was observed after GABA was synthesized. Additionally, the MET-triggered schizophrenia-like symptoms in adult zebrafish, involving social withdrawal and cognitive dysfunction analyzed with social interaction and T-maze behavioral tests, were accompanied by significantly increased DNA methylation levels in the global genome and the gabrb2 promoter. Furthermore, the significant correlation between gabrb2 mRNA expression and gabrb2 promoter methylation observed in the developmental stages became non-significant in MET-triggered adult zebrafish. These findings demonstrate that gabrb2 mRNA expression is associated with DNA methylation varies by developmental stage and show that these epigenetic association mechanisms are disrupted in MET-triggered adult zebrafish with schizophrenia-like symptoms. In conclusion, these results provide plausible epigenetic evidence of the GABA A receptor β 2 subunit involvement in the schizophrenia-like behaviors and demonstrate the potential use of zebrafish models in neuropsychiatric research. © 2016 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  14. Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate-Vertebrate Boundary.

    Science.gov (United States)

    Keller, Thomas E; Han, Priscilla; Yi, Soojin V

    2016-04-01

    Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf

  15. DNA methylation and healthy human aging.

    Science.gov (United States)

    Jones, Meaghan J; Goodman, Sarah J; Kobor, Michael S

    2015-12-01

    The process of aging results in a host of changes at the cellular and molecular levels, which include senescence, telomere shortening, and changes in gene expression. Epigenetic patterns also change over the lifespan, suggesting that epigenetic changes may constitute an important component of the aging process. The epigenetic mark that has been most highly studied is DNA methylation, the presence of methyl groups at CpG dinucleotides. These dinucleotides are often located near gene promoters and associate with gene expression levels. Early studies indicated that global levels of DNA methylation increase over the first few years of life and then decrease beginning in late adulthood. Recently, with the advent of microarray and next-generation sequencing technologies, increases in variability of DNA methylation with age have been observed, and a number of site-specific patterns have been identified. It has also been shown that certain CpG sites are highly associated with age, to the extent that prediction models using a small number of these sites can accurately predict the chronological age of the donor. Together, these observations point to the existence of two phenomena that both contribute to age-related DNA methylation changes: epigenetic drift and the epigenetic clock. In this review, we focus on healthy human aging throughout the lifetime and discuss the dynamics of DNA methylation as well as how interactions between the genome, environment, and the epigenome influence aging rates. We also discuss the impact of determining 'epigenetic age' for human health and outline some important caveats to existing and future studies. © 2015 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  16. Genetic variants of methyl metabolizing enzymes and epigenetic regulators: Associations with promoter CpG island hypermethylation in colorectal cancer

    NARCIS (Netherlands)

    Vogel, S. de; Wouters, K.A.D.; Gottschalk, R.W.H.; Schooten, F.J. van; Goeij, A.F.P.M. de; Bruïne, A.P. de; Goldbohm, R.A.; Brandt, P.A. van den; Weijenberg, M.P.; Engeland, M. van

    2009-01-01

    Aberrant DNA methylation affects carcinogenesis of colorectal cancer. Folate metabolizing enzymes may influence the bioavailability of methyl groups, whereas DNA and histone methyltransferases are involved in epigenetic regulation of gene expression. We studied associations of genetic variants of

  17. [Research Progress on the Detection Method of DNA Methylation and Its Application in Forensic Science].

    Science.gov (United States)

    Nie, Y C; Yu, L J; Guan, H; Zhao, Y; Rong, H B; Jiang, B W; Zhang, T

    2017-06-01

    As an important part of epigenetic marker, DNA methylation involves in the gene regulation and attracts a wide spread attention in biological auxology, geratology and oncology fields. In forensic science, because of the relative stable, heritable, abundant, and age-related characteristics, DNA methylation is considered to be a useful complement to the classic genetic markers for age-prediction, tissue-identification, and monozygotic twins' discrimination. Various methods for DNA methylation detection have been validated based on methylation sensitive restriction endonuclease, bisulfite modification and methylation-CpG binding protein. In recent years, it is reported that the third generation sequencing method can be used to detect DNA methylation. This paper aims to make a review on the detection method of DNA methylation and its applications in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine.

  18. Hepatic deficiency of the pioneer transcription factor FoxA restricts hepatitis B virus biosynthesis by the developmental regulation of viral DNA methylation.

    Directory of Open Access Journals (Sweden)

    Vanessa C McFadden

    2017-02-01

    Full Text Available The FoxA family of pioneer transcription factors regulates hepatitis B virus (HBV transcription, and hence viral replication. Hepatocyte-specific FoxA-deficiency in the HBV transgenic mouse model of chronic infection prevents the transcription of the viral DNA genome as a result of the failure of the developmentally controlled conversion of 5-methylcytosine residues to cytosine during postnatal hepatic maturation. These observations suggest that pioneer transcription factors such as FoxA, which mark genes for expression at subsequent developmental steps in the cellular differentiation program, mediate their effects by reversing the DNA methylation status of their target genes to permit their ensuing expression when the appropriate tissue-specific transcription factor combinations arise during development. Furthermore, as the FoxA-deficient HBV transgenic mice are viable, the specific developmental timing, abundance and isoform type of pioneer factor expression must permit all essential liver gene expression to occur at a level sufficient to support adequate liver function. This implies that pioneer transcription factors can recognize and mark their target genes in distinct developmental manners dependent upon, at least in part, the concentration and affinity of FoxA for its binding sites within enhancer and promoter regulatory sequence elements. This selective marking of cellular genes for expression by the FoxA pioneer factor compared to HBV may offer the opportunity for the specific silencing of HBV gene expression and hence the resolution of chronic HBV infections which are responsible for approximately one million deaths worldwide annually due to liver cirrhosis and hepatocellular carcinoma.

  19. Transcription factor ZBED6 mediates IGF2 gene expression by regulating promoter activity and DNA methylation in myoblasts

    Science.gov (United States)

    Zinc finger, BED-type containing 6 (ZBED6) is an important transcription factor in placental mammals, affecting development, cell proliferation and growth. In this study, we found that the expression of the ZBED6 and IGF2 were up regulated during C2C12 differentiation. The IGF2 expression levels wer...

  20. Global DNA methylation of ischemic stroke subtypes.

    Directory of Open Access Journals (Sweden)

    Carolina Soriano-Tárraga

    Full Text Available Ischemic stroke (IS, a heterogeneous multifactorial disorder, is among the leading causes of mortality and long-term disability in the western world. Epidemiological data provides evidence for a genetic component to the disease, but its epigenetic involvement is still largely unknown. Epigenetic mechanisms, such as DNA methylation, change over time and may be associated with aging processes and with modulation of the risk of various pathologies, such as cardiovascular disease and stroke. We analyzed 2 independent cohorts of IS patients. Global DNA methylation was measured by luminometric methylation assay (LUMA of DNA blood samples. Univariate and multivariate regression analyses were used to assess the methylation differences between the 3 most common IS subtypes, large-artery atherosclerosis (LAA, small-artery disease (SAD, and cardio-aortic embolism (CE. A total of 485 IS patients from 2 independent hospital cohorts (n = 281 and n = 204 were included, distributed across 3 IS subtypes: LAA (78/281, 59/204, SAD (97/281, 53/204, and CE (106/281, 89/204. In univariate analyses, no statistical differences in LUMA levels were observed between the 3 etiologies in either cohort. Multivariate analysis, adjusted by age, sex, hyperlipidemia, and smoking habit, confirmed the lack of differences in methylation levels between the analyzed IS subtypes in both cohorts. Despite differences in pathogenesis, our results showed no global methylation differences between LAA, SAD, and CE subtypes of IS. Further work is required to establish whether the epigenetic mechanism of methylation might play a role in this complex disease.

  1. Variation in DNA Methylation Patterns is More Common among Maize Inbreds than among Tissues

    Directory of Open Access Journals (Sweden)

    Steven R. Eichten

    2013-07-01

    Full Text Available Chromatin modifications, such as DNA methylation, can provide heritable, epigenetic regulation of gene expression in the absence of genetic changes. A role for DNA methylation in meiotically stable marking of repetitive elements and other sequences has been demonstrated in plants. Methylation of DNA is also proposed to play a role in development through providing a mitotic memory of gene expression states established during cellular differentiation. We sought to clarify the relative levels of DNA methylation variation among different genotypes and tissues in maize ( L.. We have assessed genomewide DNA methylation patterns in leaf, immature tassel, embryo, and endosperm tissues of two inbred maize lines: B73 and Mo17. There are hundreds of regions of differential methylation present between the two genotypes. In general, the same regions exhibit differential methylation between B73 and Mo17 in each of the tissues that were surveyed. In contrast, there are few examples of tissue-specific DNA methylation variation. Only a subset of regions with tissue-specific variation in DNA methylation show similar patterns in both genotypes of maize and even fewer are associated with altered gene expression levels among the tissues. Our data indicates a limited impact of DNA methylation on developmental gene regulation within maize.

  2. Defining Driver DNA Methylation Changes in Human Cancer

    Directory of Open Access Journals (Sweden)

    Gerd P. Pfeifer

    2018-04-01

    Full Text Available Human malignant tumors are characterized by pervasive changes in the patterns of DNA methylation. These changes include a globally hypomethylated tumor cell genome and the focal hypermethylation of numerous 5′-cytosine-phosphate-guanine-3′ (CpG islands, many of them associated with gene promoters. It has been challenging to link specific DNA methylation changes with tumorigenesis in a cause-and-effect relationship. Some evidence suggests that cancer-associated DNA hypomethylation may increase genomic instability. Promoter hypermethylation events can lead to silencing of genes functioning in pathways reflecting hallmarks of cancer, including DNA repair, cell cycle regulation, promotion of apoptosis or control of key tumor-relevant signaling networks. A convincing argument for a tumor-driving role of DNA methylation can be made when the same genes are also frequently mutated in cancer. Many of the most commonly hypermethylated genes encode developmental transcription factors, the methylation of which may lead to permanent gene silencing. Inactivation of such genes will deprive the cells in which the tumor may initiate from the option of undergoing or maintaining lineage differentiation and will lock them into a perpetuated stem cell-like state thus providing an additional window for cell transformation.

  3. Information Thermodynamics of Cytosine DNA Methylation.

    Directory of Open Access Journals (Sweden)

    Robersy Sanchez

    Full Text Available Cytosine DNA methylation (CDM is a stable epigenetic modification to the genome and a widespread regulatory process in living organisms that involves multicomponent molecular machines. Genome-wide cytosine methylation patterning participates in the epigenetic reprogramming of a cell, suggesting that the biological information contained within methylation positions may be amenable to decoding. Adaptation to a new cellular or organismal environment also implies the potential for genome-wide redistribution of CDM changes that will ensure the stability of DNA molecules. This raises the question of whether or not we would be able to sort out the regulatory methylation signals from the CDM background ("noise" induced by thermal fluctuations. Here, we propose a novel statistical and information thermodynamic description of the CDM changes to address the last question. The physical basis of our statistical mechanical model was evaluated in two respects: 1 the adherence to Landauer's principle, according to which molecular machines must dissipate a minimum energy ε = kBT ln2 at each logic operation, where kB is the Boltzmann constant, and T is the absolute temperature and 2 whether or not the binary stretch of methylation marks on the DNA molecule comprise a language of sorts, properly constrained by thermodynamic principles. The study was performed for genome-wide methylation data from 152 ecotypes and 40 trans-generational variations of Arabidopsis thaliana and 93 human tissues. The DNA persistence length, a basic mechanical property altered by CDM, was estimated with values from 39 to 66.9 nm. Classical methylome analysis can be retrieved by applying information thermodynamic modelling, which is able to discriminate signal from noise. Our finding suggests that the CDM signal comprises a language scheme properly constrained by molecular thermodynamic principles, which is part of an epigenomic communication system that obeys the same thermodynamic

  4. DNA methylation in human fibroblasts following DNA damage and repair

    International Nuclear Information System (INIS)

    Kastan, M.B.

    1984-01-01

    Methylation of deoxycytidine (dCyd) incorporated by DNA excision repair synthesis in human diploid fibroblasts following damage with ultraviolet radiation (UV), N-methyl-N-nitrosourea, or N-acetoxy-2-acetylaminofluorene was studied utilizing [6- 3 H]dCyd to label repaired DNA specifically and high performance liquid chromatographic analysis to quantify the percentage of deoxycytidine converted to 5-methyldeoxycytidine (m 5 dCyd). In confluent, nondividing cells, methylation in repair patches induced by all three agents is slow and incomplete. Whereas after DNA replication a level of 3.4% m 5 dCyd is reached in less than 2 hours, following UV-stimulated repair synthesis in confluent cells it takes about 3 days to reach a level of approx.2.0% m 5 dCyd in the repair patch. This undermethylation of repair patches occurs throughout the genome. In cells from cultures in logarithmic-phase growth, m 5 dCyd formation in UV-induced repair patches occurs faster and to a greater extent, reaching a level of approx.2.7% in 10-20 hours. Pre-existing hypomethylated repair patches in confluent cells are methylated further when the cells are stimulated to divide; however, the repair patch may still not be fully methylated before cell division occurs. Thus DNA damage and repair may lead to heritable loss of methylation at some sites. The distribution within chromatin of m 5 dCyd in repair patches was also investigated. Over a wide range of extents of digestion by staphylococcal nuclease or deoxyribonuclease I, the level of hypomethylation in repaired DNA in nuclease sensitive and resistant regions of chromatin was constant relative to the genomic level of methylation in these regions. Similar conclusions were reached in experiments with isolated mononucleosomes

  5. Differential DNA methylation patterns define status epilepticus and epileptic tolerance.

    Science.gov (United States)

    Miller-Delaney, Suzanne F C; Das, Sudipto; Sano, Takanori; Jimenez-Mateos, Eva M; Bryan, Kenneth; Buckley, Patrick G; Stallings, Raymond L; Henshall, David C

    2012-02-01

    Prolonged seizures (status epilepticus) produce pathophysiological changes in the hippocampus that are associated with large-scale, wide-ranging changes in gene expression. Epileptic tolerance is an endogenous program of cell protection that can be activated in the brain by previous exposure to a non-harmful seizure episode before status epilepticus. A major transcriptional feature of tolerance is gene downregulation. Here, through methylation analysis of 34,143 discrete loci representing all annotated CpG islands and promoter regions in the mouse genome, we report the genome-wide DNA methylation changes in the hippocampus after status epilepticus and epileptic tolerance in adult mice. A total of 321 genes showed altered DNA methylation after status epilepticus alone or status epilepticus that followed seizure preconditioning, with >90% of the promoters of these genes undergoing hypomethylation. These profiles included genes not previously associated with epilepsy, such as the polycomb gene Phc2. Differential methylation events generally occurred throughout the genome without bias for a particular chromosomal region, with the exception of a small region of chromosome 4, which was significantly overrepresented with genes hypomethylated after status epilepticus. Surprisingly, only few genes displayed differential hypermethylation in epileptic tolerance. Nevertheless, gene ontology analysis emphasized the majority of differential methylation events between the groups occurred in genes associated with nuclear functions, such as DNA binding and transcriptional regulation. The present study reports select, genome-wide DNA methylation changes after status epilepticus and in epileptic tolerance, which may contribute to regulating the gene expression environment of the seizure-damaged hippocampus.

  6. Androgen receptor function links human sexual dimorphism to DNA methylation.

    Directory of Open Access Journals (Sweden)

    Ole Ammerpohl

    Full Text Available Sex differences are well known to be determinants of development, health and disease. Epigenetic mechanisms are also known to differ between men and women through X-inactivation in females. We hypothesized that epigenetic sex differences may also result from sex hormone functions, in particular from long-lasting androgen programming. We aimed at investigating whether inactivation of the androgen receptor, the key regulator of normal male sex development, is associated with differences of the patterns of DNA methylation marks in genital tissues. To this end, we performed large scale array-based analysis of gene methylation profiles on genomic DNA from labioscrotal skin fibroblasts of 8 males and 26 individuals with androgen insensitivity syndrome (AIS due to inactivating androgen receptor gene mutations. By this approach we identified differential methylation of 167 CpG loci representing 162 unique human genes. These were significantly enriched for androgen target genes and low CpG content promoter genes. Additional 75 genes showed a significant increase of heterogeneity of methylation in AIS compared to a high homogeneity in normal male controls. Our data show that normal and aberrant androgen receptor function is associated with distinct patterns of DNA-methylation marks in genital tissues. These findings support the concept that transcription factor binding to the DNA has an impact on the shape of the DNA methylome. These data which derived from a rare human model suggest that androgen programming of methylation marks contributes to sexual dimorphism in the human which might have considerable impact on the manifestation of sex-associated phenotypes and diseases.

  7. DNA methylation modifications associated with chronic fatigue syndrome.

    Directory of Open Access Journals (Sweden)

    Wilfred C de Vega

    Full Text Available Chronic Fatigue Syndrome (CFS, also known as myalgic encephalomyelitis, is a complex multifactorial disease that is characterized by the persistent presence of fatigue and other particular symptoms for a minimum of 6 months. Symptoms fail to dissipate after sufficient rest and have major effects on the daily functioning of CFS sufferers. CFS is a multi-system disease with a heterogeneous patient population showing a wide variety of functional disabilities and its biological basis remains poorly understood. Stable alterations in gene function in the immune system have been reported in several studies of CFS. Epigenetic modifications have been implicated in long-term effects on gene function, however, to our knowledge, genome-wide epigenetic modifications associated with CFS have not been explored. We examined the DNA methylome in peripheral blood mononuclear cells isolated from CFS patients and healthy controls using the Illumina HumanMethylation450 BeadChip array, controlling for invariant probes and probes overlapping polymorphic sequences. Gene ontology (GO and network analysis of differentially methylated genes was performed to determine potential biological pathways showing changes in DNA methylation in CFS. We found an increased abundance of differentially methylated genes related to the immune response, cellular metabolism, and kinase activity. Genes associated with immune cell regulation, the largest coordinated enrichment of differentially methylated pathways, showed hypomethylation within promoters and other gene regulatory elements in CFS. These data are consistent with evidence of multisystem dysregulation in CFS and implicate the involvement of DNA modifications in CFS pathology.

  8. Inferring a role for methylation of intergenic DNA in the regulation of genes aberrantly expressed in precursor B-cell acute lymphoblastic leukemia.

    Science.gov (United States)

    Almamun, Md; Kholod, Olha; Stuckel, Alexei J; Levinson, Benjamin T; Johnson, Nathan T; Arthur, Gerald L; Davis, J Wade; Taylor, Kristen H

    2017-09-01

    A complete understanding of the mechanisms involved in the development of pre-B ALL is lacking. In this study, we integrated DNA methylation data and gene expression data to elucidate the impact of aberrant intergenic DNA methylation on gene expression in pre-B ALL. We found a subset of differentially methylated intergenic loci that were associated with altered gene expression in pre-B ALL patients. Notably, 84% of these regions were also bound by transcription factors (TF) known to play roles in differentiation and B-cell development in a lymphoblastoid cell line. Further, an overall downregulation of eRNA transcripts was observed in pre-B ALL patients and these transcripts were associated with the downregulation of putative target genes involved in B-cell migration, proliferation, and apoptosis. The identification of novel putative regulatory regions highlights the significance of intergenic DNA sequences and may contribute to the identification of new therapeutic targets for the treatment of pre-B ALL.

  9. Genome-wide DNA methylation patterns and transcription analysis in sheep muscle.

    Directory of Open Access Journals (Sweden)

    Christine Couldrey

    Full Text Available DNA methylation plays a central role in regulating many aspects of growth and development in mammals through regulating gene expression. The development of next generation sequencing technologies have paved the way for genome-wide, high resolution analysis of DNA methylation landscapes using methodology known as reduced representation bisulfite sequencing (RRBS. While RRBS has proven to be effective in understanding DNA methylation landscapes in humans, mice, and rats, to date, few studies have utilised this powerful method for investigating DNA methylation in agricultural animals. Here we describe the utilisation of RRBS to investigate DNA methylation in sheep Longissimus dorsi muscles. RRBS analysis of ∼1% of the genome from Longissimus dorsi muscles provided data of suitably high precision and accuracy for DNA methylation analysis, at all levels of resolution from genome-wide to individual nucleotides. Combining RRBS data with mRNAseq data allowed the sheep Longissimus dorsi muscle methylome to be compared with methylomes from other species. While some species differences were identified, many similarities were observed between DNA methylation patterns in sheep and other more commonly studied species. The RRBS data presented here highlights the complexity of epigenetic regulation of genes. However, the similarities observed across species are promising, in that knowledge gained from epigenetic studies in human and mice may be applied, with caution, to agricultural species. The ability to accurately measure DNA methylation in agricultural animals will contribute an additional layer of information to the genetic analyses currently being used to maximise production gains in these species.

  10. DNA methylation patterns in cord blood DNA and body size in childhood.

    Directory of Open Access Journals (Sweden)

    Caroline L Relton

    Full Text Available Epigenetic markings acquired in early life may have phenotypic consequences later in development through their role in transcriptional regulation with relevance to the developmental origins of diseases including obesity. The goal of this study was to investigate whether DNA methylation levels at birth are associated with body size later in childhood.A study design involving two birth cohorts was used to conduct transcription profiling followed by DNA methylation analysis in peripheral blood. Gene expression analysis was undertaken in 24 individuals whose biological samples and clinical data were collected at a mean ± standard deviation (SD age of 12.35 (0.95 years, the upper and lower tertiles of body mass index (BMI were compared with a mean (SD BMI difference of 9.86 (2.37 kg/m(2. This generated a panel of differentially expressed genes for DNA methylation analysis which was then undertaken in cord blood DNA in 178 individuals with body composition data prospectively collected at a mean (SD age of 9.83 (0.23 years. Twenty-nine differentially expressed genes (>1.2-fold and p<10(-4 were analysed to determine DNA methylation levels at 1-3 sites per gene. Five genes were unmethylated and DNA methylation in the remaining 24 genes was analysed using linear regression with bootstrapping. Methylation in 9 of the 24 (37.5% genes studied was associated with at least one index of body composition (BMI, fat mass, lean mass, height at age 9 years, although only one of these associations remained after correction for multiple testing (ALPL with height, p(Corrected = 0.017.DNA methylation patterns in cord blood show some association with altered gene expression, body size and composition in childhood. The observed relationship is correlative and despite suggestion of a mechanistic epigenetic link between in utero life and later phenotype, further investigation is required to establish causality.

  11. Ancestry dependent DNA methylation and influence of maternal nutrition.

    Directory of Open Access Journals (Sweden)

    Khyobeni Mozhui

    Full Text Available There is extensive variation in DNA methylation between individuals and ethnic groups. These differences arise from a combination of genetic and non-genetic influences and potential modifiers include nutritional cues, early life experience, and social and physical environments. Here we compare genome-wide DNA methylation in neonatal cord blood from African American (AA; N = 112 and European American (EA; N = 91 participants of the CANDLE Study (Conditions Affecting Neurocognitive Development and Learning in Early Childhood. Our goal is to determine if there are replicable ancestry-specific methylation patterns that may implicate risk factors for diseases that have differential prevalence between populations. To identify the most robust ancestry-specific CpG sites, we replicate our results in lymphoblastoid cell lines from Yoruba African and CEPH European panels of HapMap. We also evaluate the influence of maternal nutrition--specifically, plasma levels of vitamin D and folate during pregnancy--on methylation in newborns. We define stable ancestry-dependent methylation of genes that include tumor suppressors and cell cycle regulators (e.g., APC, BRCA1, MCC. Overall, there is lower global methylation in African ancestral groups. Plasma levels of 25-hydroxy vitamin D are also considerably lower among AA mothers and about 60% of AA and 40% of EA mothers have concentrations below 20 ng/ml. Using a weighted correlation analysis, we define a network of CpG sites that is jointly modulated by ancestry and maternal vitamin D. Our results show that differences in DNA methylation patterns are remarkably stable and maternal micronutrients can exert an influence on the child epigenome.

  12. DNA Methylation as a Biomarker for Preeclampsia

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Cindy M.; Ralph, Jody L.; Wright, Michelle L.; Linggi, Bryan E.; Ohm, Joyce E.

    2014-10-01

    Background: Preeclampsia contributes significantly to pregnancy-associated morbidity and mortality as well as future risk of cardiovascular disease in mother and offspring, and preeclampsia in offspring. The lack of reliable methods for early detection limits the opportunities for prevention, diagnosis, and timely treatment. Purpose: The purpose of this study was to explore distinct DNA methylation patterns associated with preeclampsia in both maternal cells and fetal-derived tissue that represent potential biomarkers to predict future preeclampsia and inheritance in children. Method: A convenience sample of nulliparous women (N = 55) in the first trimester of pregnancy was recruited for this prospective study. Genome-wide DNA methylation was quantified in first-trimester maternal peripheral white blood cells and placental chorionic tissue from normotensive women and those with preeclampsia (n = 6/group). Results: Late-onset preeclampsia developed in 12.7% of women. Significant differences in DNA methylation were identified in 207 individual linked cytosine and guanine (CpG) sites in maternal white blood cells collected in the first trimester (132 sites with gain and 75 sites with loss of methylation), which were common to approximately 75% of the differentially methylated CpG sites identified in chorionic tissue of fetal origin. Conclusion: This study is the first to identify maternal epigenetic targets and common targets in fetal-derived tissue that represent putative biomarkers for early detection and heritable risk of preeclampsia. Findings may pave the way for diagnosis of preeclampsia prior to its clinical presentation and acute damaging effects, and the potential for prevention of the detrimental long-term sequelae.

  13. Transcription factors as readers and effectors of DNA methylation.

    Science.gov (United States)

    Zhu, Heng; Wang, Guohua; Qian, Jiang

    2016-08-01

    Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease.

  14. RNA-directed DNA methylation: Mechanisms and functions

    KAUST Repository

    Mahfouz, Magdy M.

    2010-07-01

    Epigenetic RNA based gene silencing mechanisms play a major role in genome stability and control of gene expression. Transcriptional gene silencing via RNA-directed DNA methylation (RdDM) guides the epigenetic regulation of the genome in response to disease states, growth, developmental and stress signals. RdDM machinery is composed of proteins that produce and modify 24-nt- long siRNAs, recruit the RdDM complex to genomic targets, methylate DNA and remodel chromatin. The final DNA methylation pattern is determined by either DNA methyltransferase alone or by the combined action of DNA methyltransferases and demethylases. The dynamic interaction between RdDM and demethylases may render the plant epigenome plastic to growth, developmental, and environmental cues. The epigenome plasticity may allow the plant genome to assume many epigenomes and to have the right epigenome at the right time in response to intracellular or extracellular stimuli. This review discusses recent advances in RdDM research and considers future perspectives.

  15. Allele-Specific DNA Methylation Detection by Pyrosequencing®

    DEFF Research Database (Denmark)

    Kristensen, Lasse Sommer; Johansen, Jens Vilstrup; Grønbæk, Kirsten

    2015-01-01

    DNA methylation is an epigenetic modification that plays important roles in healthy as well as diseased cells, by influencing the transcription of genes. In spite the fact that human somatic cells are diploid, most of the currently available methods for the study of DNA methylation do not provide......-effective protocol for allele-specific DNA methylation detection based on Pyrosequencing(®) of methylation-specific PCR (MSP) products including a single nucleotide polymorphism (SNP) within the amplicon....

  16. Global DNA Methylation in the Chestnut Blight Fungus Cryphonectria parasitica and Genome-Wide Changes in DNA Methylation Accompanied with Sectorization

    Directory of Open Access Journals (Sweden)

    Kum-Kang So

    2018-02-01

    Full Text Available Mutation in CpBck1, an ortholog of the cell wall integrity mitogen-activated protein kinase kinase kinase (MAPKKK of Saccharomyces cerevisiae, in the chestnut blight fungus Cryphonectria parasitica resulted in a sporadic sectorization as culture proceeded. The progeny from the sectored area maintained the characteristics of the sector, showing a massive morphogenetic change, including robust mycelial growth without differentiation. Epigenetic changes were investigated as the genetic mechanism underlying this sectorization. Quantification of DNA methylation and whole-genome bisulfite sequencing revealed genome-wide DNA methylation of the wild-type at each nucleotide level and changes in DNA methylation of the sectored progeny. Compared to the wild-type, the sectored progeny exhibited marked genome-wide DNA hypomethylation but increased methylation sites. Expression analysis of two DNA methyltransferases, including two representative types of DNA methyltransferase (DNMTase, demonstrated that both were significantly down-regulated in the sectored progeny. However, functional analysis using mutant phenotypes of corresponding DNMTases demonstrated that a mutant of CpDmt1, an ortholog of RID of Neurospora crassa, resulted in the sectored phenotype but the CpDmt2 mutant did not, suggesting that the genetic basis of fungal sectorization is more complex. The present study revealed that a mutation in a signaling pathway component resulted in sectorization accompanied with changes in genome-wide DNA methylation, which suggests that this signal transduction pathway is important for epigenetic control of sectorization via regulation of genes involved in DNA methylation.

  17. Histone modification alteration coordinated with acquisition of promoter DNA methylation during Epstein-Barr virus infection.

    Science.gov (United States)

    Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi

    2017-08-15

    Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were "DNA methylation-sensitive" genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A . The other half were "DNA methylation-resistant" genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site.

  18. Genome-wide DNA methylation alterations of Alternanthera philoxeroides in natural and manipulated habitats: implications for epigenetic regulation of rapid responses to environmental fluctuation and phenotypic variation.

    Science.gov (United States)

    Gao, Lexuan; Geng, Yupeng; Li, Bo; Chen, Jiakuan; Yang, Ji

    2010-11-01

    Alternanthera philoxeroides (alligator weed) is an invasive weed that can colonize both aquatic and terrestrial habitats. Individuals growing in different habitats exhibit extensive phenotypic variation but little genetic differentiation in its introduced range. The mechanisms underpinning the wide range of phenotypic variation and rapid adaptation to novel and changing environments remain uncharacterized. In this study, we examined the epigenetic variation and its correlation with phenotypic variation in plants exposed to natural and manipulated environmental variability. Genome-wide methylation profiling using methylation-sensitive amplified fragment length polymorphism (MSAP) revealed considerable DNA methylation polymorphisms within and between natural populations. Plants of different source populations not only underwent significant morphological changes in common garden environments, but also underwent a genome-wide epigenetic reprogramming in response to different treatments. Methylation alterations associated with response to different water availability were detected in 78.2% (169/216) of common garden induced polymorphic sites, demonstrating the environmental sensitivity and flexibility of the epigenetic regulatory system. These data provide evidence of the correlation between epigenetic reprogramming and the reversible phenotypic response of alligator weed to particular environmental factors. © 2010 Blackwell Publishing Ltd.

  19. Exploring the roles of DNA methylation in the metal-reducing bacterium Shewanella oneidensis MR-1

    Energy Technology Data Exchange (ETDEWEB)

    Bendall, Matthew L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Luong, Khai [Pacific Biosciences, Menlo Park, CA (United States); Wetmore, Kelly M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Blow, Matthew [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Korlach, Jonas [Pacific Biosciences, Menlo Park, CA (United States); Deutschbauer, Adam [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Malmstrom, Rex [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2013-08-30

    We performed whole genome analyses of DNA methylation in Shewanella 17 oneidensis MR-1 to examine its possible role in regulating gene expression and 18 other cellular processes. Single-Molecule Real Time (SMRT) sequencing 19 revealed extensive methylation of adenine (N6mA) throughout the 20 genome. These methylated bases were located in five sequence motifs, 21 including three novel targets for Type I restriction/modification enzymes. The 22 sequence motifs targeted by putative methyltranferases were determined via 23 SMRT sequencing of gene knockout mutants. In addition, we found S. 24 oneidensis MR-1 cultures grown under various culture conditions displayed 25 different DNA methylation patterns. However, the small number of differentially 26 methylated sites could not be directly linked to the much larger number of 27 differentially expressed genes in these conditions, suggesting DNA methylation is 28 not a major regulator of gene expression in S. oneidensis MR-1. The enrichment 29 of methylated GATC motifs in the origin of replication indicate DNA methylation 30 may regulate genome replication in a manner similar to that seen in Escherichia 31 coli. Furthermore, comparative analyses suggest that many 32 Gammaproteobacteria, including all members of the Shewanellaceae family, may 33 also utilize DNA methylation to regulate genome replication.

  20. Genome-Wide Prediction of DNA Methylation Using DNA Composition and Sequence Complexity in Human.

    Science.gov (United States)

    Wu, Chengchao; Yao, Shixin; Li, Xinghao; Chen, Chujia; Hu, Xuehai

    2017-02-16

    DNA methylation plays a significant role in transcriptional regulation by repressing activity. Change of the DNA methylation level is an important factor affecting the expression of target genes and downstream phenotypes. Because current experimental technologies can only assay a small proportion of CpG sites in the human genome, it is urgent to develop reliable computational models for predicting genome-wide DNA methylation. Here, we proposed a novel algorithm that accurately extracted sequence complexity features (seven features) and developed a support-vector-machine-based prediction model with integration of the reported DNA composition features (trinucleotide frequency and GC content, 65 features) by utilizing the methylation profiles of embryonic stem cells in human. The prediction results from 22 human chromosomes with size-varied windows showed that the 600-bp window achieved the best average accuracy of 94.7%. Moreover, comparisons with two existing methods further showed the superiority of our model, and cross-species predictions on mouse data also demonstrated that our model has certain generalization ability. Finally, a statistical test of the experimental data and the predicted data on functional regions annotated by ChromHMM found that six out of 10 regions were consistent, which implies reliable prediction of unassayed CpG sites. Accordingly, we believe that our novel model will be useful and reliable in predicting DNA methylation.

  1. Reduced DNA methylation of FKBP5 in Cushing's syndrome.

    Science.gov (United States)

    Resmini, Eugenia; Santos, Alicia; Aulinas, Anna; Webb, Susan M; Vives-Gilabert, Yolanda; Cox, Olivia; Wand, Gary; Lee, Richard S

    2016-12-01

    FKBP5 encodes a co-chaperone of HSP90 protein that regulates intracellular glucocorticoid receptor sensitivity. When it is bound to the glucocorticoid receptor complex, cortisol binds with lower affinity to glucocorticoid receptor. Cushing's syndrome is associated with memory deficits, smaller hippocampal volumes, and wide range of cognitive impairments. We aimed at evaluating blood DNA methylation of FKBP5 and its relationship with memory and hippocampal volumes in Cushing's syndrome patients. Polymorphism rs1360780 in FKBP5 has also been assessed to determine whether genetic variations can also govern CpG methylation. Thirty-two Cushing's syndrome patients and 32 matched controls underwent memory tests, 3-Tesla MRI of the brain, and DNA extraction from total leukocytes. DNA samples were bisulfite treated, PCR amplified, and pyrosequenced to assess a total of 41CpG-dinucleotides in the introns 1, 2, 5, and 7 of FKBP5. Significantly lower intronic FKBP5 DNA methylation in CS patients compared to controls was observed in ten CpG-dinucleotides. DNA methylation at these CpGs correlated with left and right HV (Intron-2-Region-2-CpG-3: LHV, r = 0.73, p = 0.02; RHV, r = 0.58, p = 0.03). Cured and active CS patients showed both lower methylation of intron 2 (92.37, 91.8, and 93.34 %, respectively, p = 0.03 for both) and of intron 7 (77.08, 73.74, and 79.71 %, respectively, p = 0.02 and p < 0.01) than controls. Twenty-two subjects had the CC genotype, 34 had the TC genotype, and eight had the TT genotype. Lower average DNA methylation in intron 7 was observed in the TT subjects compared to CC (72.5vs. 79.5 %, p = 0.02) and to TC (72.5 vs. 79.0 %, p = 0.03). Our data demonstrate, for the first time, a reduction of intronic DNA methylation of FKBP5 in CS patients.

  2. Shotgun Bisulfite Sequencing of the Betula platyphylla Genome Reveals the Tree’s DNA Methylation Patterning

    Directory of Open Access Journals (Sweden)

    Chang Su

    2014-12-01

    Full Text Available DNA methylation plays a critical role in the regulation of gene expression. Most studies of DNA methylation have been performed in herbaceous plants, and little is known about the methylation patterns in tree genomes. In the present study, we generated a map of methylated cytosines at single base pair resolution for Betula platyphylla (white birch by bisulfite sequencing combined with transcriptomics to analyze DNA methylation and its effects on gene expression. We obtained a detailed view of the function of DNA methylation sequence composition and distribution in the genome of B. platyphylla. There are 34,460 genes in the whole genome of birch, and 31,297 genes are methylated. Conservatively, we estimated that 14.29% of genomic cytosines are methylcytosines in birch. Among the methylation sites, the CHH context accounts for 48.86%, and is the largest proportion. Combined transcriptome and methylation analysis showed that the genes with moderate methylation levels had higher expression levels than genes with high and low methylation. In addition, methylated genes are highly enriched for the GO subcategories of binding activities, catalytic activities, cellular processes, response to stimulus and cell death, suggesting that methylation mediates these pathways in birch trees.

  3. DNA methylation of amino acid transporter genes in the human placenta.

    Science.gov (United States)

    Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K

    2017-12-01

    Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.

  4. Environmental Influences on the Epigenome: Exposure- Associated DNA Methylation in Human Populations.

    Science.gov (United States)

    Martin, Elizabeth M; Fry, Rebecca C

    2018-04-01

    DNA methylation is the most well studied of the epigenetic regulators in relation to environmental exposures. To date, numerous studies have detailed the manner by which DNA methylation is influenced by the environment, resulting in altered global and gene-specific DNA methylation. These studies have focused on prenatal, early-life, and adult exposure scenarios. The present review summarizes currently available literature that demonstrates a relationship between DNA methylation and environmental exposures. It includes studies on aflatoxin B 1 , air pollution, arsenic, bisphenol A, cadmium, chromium, lead, mercury, polycyclic aromatic hydrocarbons, persistent organic pollutants, tobacco smoke, and nutritional factors. It also addresses gaps in the literature and future directions for research. These gaps include studies of mixtures, sexual dimorphisms with respect to environmentally associated methylation changes, tissue specificity, and temporal stability of the methylation marks.

  5. Altered DNA methylation: a secondary mechanism involved in carcinogenesis.

    Science.gov (United States)

    Goodman, Jay I; Watson, Rebecca E

    2002-01-01

    This review focuses on the role that DNA methylation plays in the regulation of normal and aberrant gene expression and on how, in a hypothesis-driven fashion, altered DNA methylation may be viewed as a secondary mechanism involved in carcinogenesis. Research aimed at discerning the mechanisms by which chemicals can transform normal cells into frank carcinomas has both theoretical and practical implications. Through an increased understanding of the mechanisms by which chemicals affect the carcinogenic process, we learn more about basic biology while, at the same time, providing the type of information required to make more rational safety assessment decisions concerning their actual potential to cause cancer under particular conditions of exposure. One key question is: does the mechanism of action of the chemical in question involve a secondary mechanism and, if so, what dose may be below its threshold?

  6. TET1 and hydroxymethylcytosine in transcription and DNA methylation fidelity

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Pedersen, Marianne Terndrup

    2011-01-01

    a role in transcriptional repression. TET1 binds a significant proportion of Polycomb group target genes. Furthermore, TET1 associates and colocalizes with the SIN3A co-repressor complex. We propose that TET1 fine-tunes transcription, opposes aberrant DNA methylation at CpG-rich sequences and thereby...... throughout the genome of embryonic stem cells, with the majority of binding sites located at transcription start sites (TSSs) of CpG-rich promoters and within genes. The hmC modification is found in gene bodies and in contrast to mC is also enriched at CpG-rich TSSs. We provide evidence further that TET1 has...... contributes to the regulation of DNA methylation fidelity....

  7. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

    International Nuclear Information System (INIS)

    Prior, Sara; Miousse, Isabelle R.; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R.; Allen, Antiño R.; Raber, Jacob; Tackett, Alan J.; Hauer-Jensen, Martin; Nelson, Gregory A.

    2016-01-01

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

  8. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

    Energy Technology Data Exchange (ETDEWEB)

    Prior, Sara; Miousse, Isabelle R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nzabarushimana, Etienne [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Department of Bioinformatics, School of Informatics and Computing, Indiana University, Bloomington, IN 47405 (United States); Pathak, Rupak [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Skinner, Charles; Kutanzi, Kristy R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Allen, Antiño R. [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Raber, Jacob [Departments of Behavioral Neuroscience, Neurology, and Radiation Medicine, Division of Neuroscience, ONPRC, Oregon Health & Science University, Portland, OR 97239 (United States); Tackett, Alan J. [Department of Biochemistry, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Hauer-Jensen, Martin [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nelson, Gregory A. [Department of Basic Sciences, Division of Radiation Research, Loma Linda University, Loma Linda, CA 92350 (United States); and others

    2016-10-15

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

  9. IBM1, a JmjC domain-containing histone demethylase, is involved in the regulation of RNA-directed DNA methylation through the epigenetic control of RDR2 and DCL3 expression in Arabidopsis

    Science.gov (United States)

    Fan, Di; Dai, Yan; Wang, Xuncheng; Wang, Zhenjie; He, Hang; Yang, Hongchun; Cao, Ying; Deng, Xing Wang; Ma, Ligeng

    2012-01-01

    Small RNA-directed DNA methylation (RdDM) is an important epigenetic pathway in Arabidopsis that controls the expression of multiple genes and several developmental processes. RNA-DEPENDENT RNA POLYMERASE 2 (RDR2) and DICER-LIKE 3 (DCL3) are necessary factors in 24-nt small interfering RNA (siRNA) biogenesis, which is part of the RdDM pathway. Here, we found that Increase in BONSAI Methylation 1 (IBM1), a conserved JmjC family histone demethylase, is directly associated with RDR2 and DCL3 chromatin. The mutation of IBM1 induced the hypermethylation of H3K9 and DNA non-CG sites within RDR2 and DCL3, which repressed their expression. A genome-wide analysis suggested that the reduction in RDR2 and DCL3 expression affected siRNA biogenesis in a locus-specific manner and disrupted RdDM-directed gene repression. Together, our results suggest that IBM1 regulates gene expression through two distinct pathways: direct association to protect genes from silencing by preventing the coupling of histone and DNA methylation, and indirect silencing of gene expression through RdDM-directed repression. PMID:22772985

  10. Recognition of methylated DNA through methyl-CpG binding domain proteins

    DEFF Research Database (Denmark)

    Zou, Xueqing; Ma, Wen; Solov'yov, Ilia

    2012-01-01

    DNA methylation is a key regulatory control route in epigenetics, involving gene silencing and chromosome inactivation. It has been recognized that methyl-CpG binding domain (MBD) proteins play an important role in interpreting the genetic information encoded by methylated DNA (mDNA). Although...... the function of MBD proteins has attracted considerable attention and is well characterized, the mechanism underlying mDNA recognition by MBD proteins is still poorly understood. In this article, we demonstrate that the methyl-CpG dinucleotides are recognized at the MBD-mDNA interface by two MBD arginines...

  11. Detection of DNA methylation changes in micropropagated banana plants using methylation-sensitive amplification polymorphism (MSAP).

    Science.gov (United States)

    Peraza-Echeverria, S; Herrera-Valencia, V A.; Kay, A -J.

    2001-07-01

    The extent of DNA methylation polymorphisms was evaluated in micropropagated banana (Musa AAA cv. 'Grand Naine') derived from either the vegetative apex of the sucker or the floral apex of the male inflorescence using the methylation-sensitive amplification polymorphism (MSAP) technique. In all, 465 fragments, each representing a recognition site cleaved by either or both of the isoschizomers were amplified using eight combinations of primers. A total of 107 sites (23%) were found to be methylated at cytosine in the genome of micropropagated banana plants. In plants micropropagated from the male inflorescence explant 14 (3%) DNA methylation events were polymorphic, while plants micropropagated from the sucker explant produced 8 (1.7%) polymorphisms. No DNA methylation polymorphisms were detected in conventionally propagated banana plants. These results demonstrated the usefulness of MSAP to detect DNA methylation events in micropropagated banana plants and indicate that DNA methylation polymorphisms are associated with micropropagation.

  12. Methylated DNA Immunoprecipitation Analysis of Mammalian Endogenous Retroviruses.

    Science.gov (United States)

    Rebollo, Rita; Mager, Dixie L

    2016-01-01

    Endogenous retroviruses are repetitive sequences found abundantly in mammalian genomes which are capable of modulating host gene expression. Nevertheless, most endogenous retrovirus copies are under tight epigenetic control via histone-repressive modifications and DNA methylation. Here we describe a common method used in our laboratory to detect, quantify, and compare mammalian endogenous retrovirus DNA methylation. More specifically we describe methylated DNA immunoprecipitation (MeDIP) followed by quantitative PCR.

  13. Forensic DNA methylation profiling from evidence material for investigative leads

    Science.gov (United States)

    Lee, Hwan Young; Lee, Soong Deok; Shin, Kyoung-Jin

    2016-01-01

    DNA methylation is emerging as an attractive marker providing investigative leads to solve crimes in forensic genetics. The identification of body fluids that utilizes tissue-specific DNA methylation can contribute to solving crimes by predicting activity related to the evidence material. The age estimation based on DNA methylation is expected to reduce the number of potential suspects, when the DNA profile from the evidence does not match with any known person, including those stored in the forensic database. Moreover, the variation in DNA implicates environmental exposure, such as cigarette smoking and alcohol consumption, thereby suggesting the possibility to be used as a marker for predicting the lifestyle of potential suspect. In this review, we describe recent advances in our understanding of DNA methylation variations and the utility of DNA methylation as a forensic marker for advanced investigative leads from evidence materials. [BMB Reports 2016; 49(7): 359-369] PMID:27099236

  14. DNA methylation signatures of educational attainment

    Science.gov (United States)

    van Dongen, Jenny; Bonder, Marc Jan; Dekkers, Koen F.; Nivard, Michel G.; van Iterson, Maarten; Willemsen, Gonneke; Beekman, Marian; van der Spek, Ashley; van Meurs, Joyce B. J.; Franke, Lude; Heijmans, Bastiaan T.; van Duijn, Cornelia M.; Slagboom, P. Eline; Boomsma, Dorret I.; BIOS consortium

    2018-03-01

    Educational attainment is a key behavioural measure in studies of cognitive and physical health, and socioeconomic status. We measured DNA methylation at 410,746 CpGs (N = 4152) and identified 58 CpGs associated with educational attainment at loci characterized by pleiotropic functions shared with neuronal, immune and developmental processes. Associations overlapped with those for smoking behaviour, but remained after accounting for smoking at many CpGs: Effect sizes were on average 28% smaller and genome-wide significant at 11 CpGs after adjusting for smoking and were 62% smaller in never smokers. We examined sources and biological implications of education-related methylation differences, demonstrating correlations with maternal prenatal folate, smoking and air pollution signatures, and associations with gene expression in cis, dynamic methylation in foetal brain, and correlations between blood and brain. Our findings show that the methylome of lower-educated people resembles that of smokers beyond effects of their own smoking behaviour and shows traces of various other exposures.

  15. Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).

    Science.gov (United States)

    Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J

    2014-01-01

    DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic

  16. A Novel Computational Method for Detecting DNA Methylation Sites with DNA Sequence Information and Physicochemical Properties.

    Science.gov (United States)

    Pan, Gaofeng; Jiang, Limin; Tang, Jijun; Guo, Fei

    2018-02-08

    DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods-especially machine learning methods-have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k -gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria-area under the receiver operating characteristic curve (AUC), Matthew's correlation coefficient (MCC), accuracy (ACC), sensitivity (SN), and specificity-are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from: https://figshare.com/s/0697b692d802861282d3.

  17. A Novel Computational Method for Detecting DNA Methylation Sites with DNA Sequence Information and Physicochemical Properties

    Directory of Open Access Journals (Sweden)

    Gaofeng Pan

    2018-02-01

    Full Text Available DNA methylation is an important biochemical process, and it has a close connection with many types of cancer. Research about DNA methylation can help us to understand the regulation mechanism and epigenetic reprogramming. Therefore, it becomes very important to recognize the methylation sites in the DNA sequence. In the past several decades, many computational methods—especially machine learning methods—have been developed since the high-throughout sequencing technology became widely used in research and industry. In order to accurately identify whether or not a nucleotide residue is methylated under the specific DNA sequence context, we propose a novel method that overcomes the shortcomings of previous methods for predicting methylation sites. We use k-gram, multivariate mutual information, discrete wavelet transform, and pseudo amino acid composition to extract features, and train a sparse Bayesian learning model to do DNA methylation prediction. Five criteria—area under the receiver operating characteristic curve (AUC, Matthew’s correlation coefficient (MCC, accuracy (ACC, sensitivity (SN, and specificity—are used to evaluate the prediction results of our method. On the benchmark dataset, we could reach 0.8632 on AUC, 0.8017 on ACC, 0.5558 on MCC, and 0.7268 on SN. Additionally, the best results on two scBS-seq profiled mouse embryonic stem cells datasets were 0.8896 and 0.9511 by AUC, respectively. When compared with other outstanding methods, our method surpassed them on the accuracy of prediction. The improvement of AUC by our method compared to other methods was at least 0.0399 . For the convenience of other researchers, our code has been uploaded to a file hosting service, and can be downloaded from: https://figshare.com/s/0697b692d802861282d3.

  18. Understanding the connection between epigenetic DNA methylation and nucleosome positioning from computer simulations.

    Directory of Open Access Journals (Sweden)

    Guillem Portella

    Full Text Available Cytosine methylation is one of the most important epigenetic marks that regulate the process of gene expression. Here, we have examined the effect of epigenetic DNA methylation on nucleosomal stability using molecular dynamics simulations and elastic deformation models. We found that methylation of CpG steps destabilizes nucleosomes, especially when these are placed in sites where the DNA minor groove faces the histone core. The larger stiffness of methylated CpG steps is a crucial factor behind the decrease in nucleosome stability. Methylation changes the positioning and phasing of the nucleosomal DNA, altering the accessibility of DNA to regulatory proteins, and accordingly gene functionality. Our theoretical calculations highlight a simple physical-based explanation on the foundations of epigenetic signaling.

  19. Analysis of DNA Methylation of Gracilariopsis lemaneiformis Under Temperature Stress Using the Methylation Sensitive Amplification Polymorphism (MSAP) Technique

    Science.gov (United States)

    Peng, Chong; Sui, Zhenghong; Zhou, Wei; Hu, Yiyi; Mi, Ping; Jiang, Minjie; Li, Xiaodong; Ruan, Xudong

    2018-06-01

    Gracilariopsis lemaneiformis is an economically important agarophyte, which contains high quality gel and shows a high growth rate. Wild population of G. lemaneiformis displayed resident divergence, though with a low genetic diversity as was revealed by amplified fragment length polymorphism (AFLP) and simple sequence repeat (SSR) analyses. In addition, different strains of G. lemaneiformis are diverse in morphology. The highly inconsistence between genetic background and physiological characteristics recommends strongly to the regulation at epigenetic level. In this study, the DNA methylation change in G. lemaneiformis among different generation branches and under different temperature stresses was assessed using methylation sensitive amplified polymorphism (MSAP) technique. It was shown that DNA methylation level among different generation branches was diverse. The full and total methylated DNA level was the lowest in the second generation branch and the highest in the third generation. The total methylation level was 61.11%, 60.88% and 64.12% at 15°C, 22°C and 26°C, respectively. Compared with the control group (22°C), the fully methylated and totally methylated ratios were increased in both experiment groups (15°C and 26°C). All of the cytosine methylation/demethylation transform (CMDT) was further analyzed. High temperature treatment could induce more CMDT than low temperature treatment did.

  20. Current trends in electrochemical sensing and biosensing of DNA methylation.

    Science.gov (United States)

    Krejcova, Ludmila; Richtera, Lukas; Hynek, David; Labuda, Jan; Adam, Vojtech

    2017-11-15

    DNA methylation plays an important role in physiological and pathological processes. Several genetic diseases and most malignancies tend to be associated with aberrant DNA methylation. Among other analytical methods, electrochemical approaches have been successfully employed for characterisation of DNA methylation patterns that are essential for the diagnosis and treatment of particular diseases. This article discusses current trends in the electrochemical sensing and biosensing of DNA methylation. Particularly, it provides an overview of applied electrode materials, electrode modifications and biorecognition elements applications with an emphasis on strategies that form the core DNA methylation detection approaches. The three main strategies as (i) bisulfite treatment, (ii) cleavage by restriction endonucleases, and (iii) immuno/affinity reaction were described in greater detail. Additionally, the availability of the reviewed platforms for early cancer diagnosis and the approval of methylation inhibitors for anticancer therapy were discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Regulation Mechanism of HBV cccDNA

    Directory of Open Access Journals (Sweden)

    Cheng Jun

    2012-06-01

    Full Text Available Covalently closed circular (ccc DNA of hepatitis B virus (HBV existed in the nuclei of HBV infected hepatocytes with a half-life time of 14.3 years in a mathematic model. Viral protein feedback regulation in HBV life cycle to maintain vital viral replication is an important mechanism. Interleukin-6, epithelial growth factor, heme oxygenase-1, histones, and hepatocyte nuclear factors are demonstrated as the key regulators for HBV life cycle. CpG island structure and methylation status are involved in the regulation of HBV DNA replication. Nucleos(tide analogues are widely used in the clinical practice for the treatment of chronic hepatitis B patients, although no evidence indicating a direct inhibiton of HBV cccDNA. In the future, along with the study of HBV life cycle, new drugs including RNA interference technique, will pave the way to eliminate the HBV cccDNA from infected hepatocytes resulting final cure of chronic hepatitis B.

  2. Lysine methyltransferase G9a is not required for DNMT3A/3B anchoring to methylated nucleosomes and maintenance of DNA methylation in somatic cells

    Directory of Open Access Journals (Sweden)

    Sharma Shikhar

    2012-01-01

    Full Text Available Abstract Background DNA methylation, histone modifications and nucleosome occupancy act in concert for regulation of gene expression patterns in mammalian cells. Recently, G9a, a H3K9 methyltransferase, has been shown to play a role in establishment of DNA methylation at embryonic gene targets in ES cells through recruitment of de novo DNMT3A/3B enzymes. However, whether G9a plays a similar role in maintenance of DNA methylation in somatic cells is still unclear. Results Here we show that G9a is not essential for maintenance of DNA methylation in somatic cells. Knockdown of G9a has no measurable effect on DNA methylation levels at G9a-target loci. DNMT3A/3B remain stably anchored to nucleosomes containing methylated DNA even in the absence of G9a, ensuring faithful propagation of methylated states in cooperation with DNMT1 through somatic divisions. Moreover, G9a also associates with nucleosomes in a DNMT3A/3B and DNA methylation-independent manner. However, G9a knockdown synergizes with pharmacologic inhibition of DNMTs resulting in increased hypomethylation and inhibition of cell proliferation. Conclusions Taken together, these data suggest that G9a is not involved in maintenance of DNA methylation in somatic cells but might play a role in re-initiation of de novo methylation after treatment with hypomethylating drugs, thus serving as a potential target for combinatorial treatments strategies involving DNMTs inhibitors.

  3. Correlating Gene-specific DNA Methylation Changes with Expression and Transcriptional Activity of Astrocytic KCNJ10 (Kir4.1).

    Science.gov (United States)

    Nwaobi, Sinifunanya E; Olsen, Michelle L

    2015-09-26

    DNA methylation serves to regulate gene expression through the covalent attachment of a methyl group onto the C5 position of a cytosine in a cytosine-guanine dinucleotide. While DNA methylation provides long-lasting and stable changes in gene expression, patterns and levels of DNA methylation are also subject to change based on a variety of signals and stimuli. As such, DNA methylation functions as a powerful and dynamic regulator of gene expression. The study of neuroepigenetics has revealed a variety of physiological and pathological states that are associated with both global and gene-specific changes in DNA methylation. Specifically, striking correlations between changes in gene expression and DNA methylation exist in neuropsychiatric and neurodegenerative disorders, during synaptic plasticity, and following CNS injury. However, as the field of neuroepigenetics continues to expand its understanding of the role of DNA methylation in CNS physiology, delineating causal relationships in regards to changes in gene expression and DNA methylation are essential. Moreover, in regards to the larger field of neuroscience, the presence of vast region and cell-specific differences requires techniques that address these variances when studying the transcriptome, proteome, and epigenome. Here we describe FACS sorting of cortical astrocytes that allows for subsequent examination of a both RNA transcription and DNA methylation. Furthermore, we detail a technique to examine DNA methylation, methylation sensitive high resolution melt analysis (MS-HRMA) as well as a luciferase promoter assay. Through the use of these combined techniques one is able to not only explore correlative changes between DNA methylation and gene expression, but also directly assess if changes in the DNA methylation status of a given gene region are sufficient to affect transcriptional activity.

  4. Osteoponin Promoter Controlled by DNA Methylation: Aberrant Methylation in Cloned Porcine Genome

    Directory of Open Access Journals (Sweden)

    Chih-Jie Shen

    2014-01-01

    Full Text Available Cloned animals usually exhibited many defects in physical characteristics or aberrant epigenetic reprogramming, especially in some important organ development. Osteoponin (OPN is an extracellular-matrix protein involved in heart and bone development and diseases. In this study, we investigated the correlation between OPN mRNA and its promoter methylation changes by the 5-aza-dc treatment in fibroblast cell and promoter assay. Aberrant methylation of porcine OPN was frequently found in different tissues of somatic nuclear transferred cloning pigs, and bisulfite sequence data suggested that the OPN promoter region −2615 to −2239 nucleotides (nt may be a crucial regulation DNA element. In pig ear fibroblast cell culture study, the demethylation of OPN promoter was found in dose-dependent response of 5-aza-dc treatment and followed the OPN mRNA reexpression. In cloned pig study, discrepant expression pattern was identified in several cloned pig tissues, especially in brain, heart, and ear. Promoter assay data revealed that four methylated CpG sites presenting in the −2615 to −2239 nt region cause significant downregulation of OPN promoter activity. These data suggested that methylation in the OPN promoter plays a crucial role in the regulation of OPN expression that we found in cloned pigs genome.

  5. The role of DNA methylation on Octopus vulgaris development and their perspectives

    Directory of Open Access Journals (Sweden)

    Eva eDíaz-Freije

    2014-02-01

    Full Text Available DNA methylation is a common regulator of gene expression and development in mammalian and other vertebrate genomes. DNA methylation has been studied so far in a few bivalve mollusk species, finding a wide spectrum of levels. We focused our study in the common octopus, Octopus vulgaris, an important organism for neuroscience, physiology and ethology research as well as for human consumption. We aim to confirm the existence of DNA methylation in O. vulgaris and ultimately, if methylation plays a role in gene regulation during octopus development. We used a genome-wide approach, methylation-sensitive amplified polymorphism (MSAP, firstly in four different tissues from the same specimens from adult benthonic individuals to test whether gene expression is regulated by methylation. Secondly, we tested the hypothesis that methylation underlies development by assessing MSAP patters from paralarvae to adult developmental stages. Our data indicate that octopus genome is widely methylated since clear differences can be observed, and the methylation pattern change with the development. The statistical analyses showed significant differences in methylation pattern between paralarvae, where higher internal cytosine methylation is observed, and the three other post-hatching stages. This suggests an important role of cytosine methylation during the first step of development, when major morphological changes take place. However, methylation seems to have little effect on gene expression during the benthonic phase, since any significant effect was revealed in the AMOVA performed. Our observations highlight the importance of epigenetic mechanism in the first developmental steps of the common octopus and open new perspectives to overcome high mortality rate during paralarvae growth. Thus, better understanding the molecular regulation patterns could lead to new approaches that increase the efficiency of husbandry of this emergent species for aquaculture.

  6. Analysis of DNA methylation of perennial ryegrass under drought using the methylation-sensitive amplification polymorphism (MSAP) technique.

    Science.gov (United States)

    Tang, Xiao-Mei; Tao, Xiang; Wang, Yan; Ma, Dong-Wei; Li, Dan; Yang, Hong; Ma, Xin-Rong

    2014-12-01

    Perennial ryegrass (Lolium perenne), an excellent grass for forage and turf, is widespread in temperate regions. Drought is an important factor that limits its growth, distribution, and yield. DNA methylation affects gene expression and plays an important role in adaptation to adverse environments. In this study, the DNA methylation changes in perennial ryegrass under drought stress were assessed using methylation-sensitive amplified polymorphism (MSAP). After 15 days of drought stress treatment, the plant height was less than half of the control, and the leaves were smaller and darker. Genome-wide, a total of 652 CCGG sites were detected by MSAP. The total methylation level was 57.67 and 47.39 % in the control and drought treatment, respectively, indicating a decrease of 10.28 % due to drought exposure. Fifteen differentially displayed DNA fragments in MSAP profiles were cloned for sequencing analysis. The results showed that most of the genes involved in stress responses. The relative expression levels revealed that three demethylated fragments were up-regulated. The expression of a predicted retrotransposon increased significantly, changing from hypermethylation to non-methylation. Although the extent of methylation in two other genes decreased, the sites of methylation remained, and the expression increased only slightly. All of these results suggested that drought stress decreased the total DNA methylation level in perennial ryegrass and demethylation up-regulated related gene expressions and that the extent of methylation was negatively correlated with expression. Overall, the induced epigenetic changes in genome probably are an important regulatory mechanism for acclimating perennial ryegrass to drought and possibly other environmental stresses.

  7. An integrative analysis of DNA methylation and RNA-Seq data for human heart, kidney and liver

    Directory of Open Access Journals (Sweden)

    Xie Linglin

    2011-12-01

    Full Text Available Abstract Background Many groups, including our own, have proposed the use of DNA methylation profiles as biomarkers for various disease states. While much research has been done identifying DNA methylation signatures in cancer vs. normal etc., we still lack sufficient knowledge of the role that differential methylation plays during normal cellular differentiation and tissue specification. We also need thorough, genome level studies to determine the meaning of methylation of individual CpG dinucleotides in terms of gene expression. Results In this study, we have used (insert statistical method here to compile unique DNA methylation signatures from normal human heart, lung, and kidney using the Illumina Infinium 27 K methylation arraysand compared those to gene expression by RNA sequencing. We have identified unique signatures of global DNA methylation for human heart, kidney and liver, and showed that DNA methylation data can be used to correctly classify various tissues. It indicates that DNA methylation reflects tissue specificity and may play an important role in tissue differentiation. The integrative analysis of methylation and RNA-Seq data showed that gene methylation and its transcriptional levels were comprehensively correlated. The location of methylation markers in terms of distance to transcription start site and CpG island showed no effects on the regulation of gene expression by DNA methylation in normal tissues. Conclusions This study showed that an integrative analysis of methylation array and RNA-Seq data can be utilized to discover the global regulation of gene expression by DNA methylation and suggests that DNA methylation plays an important role in normal tissue differentiation via modulation of gene expression.

  8. Patterns of DNA Methylation in Development, Division of Labor and Hybridization in an Ant with Genetic Caste Determination

    OpenAIRE

    Smith, Chris R.; Mutti, Navdeep S.; Jasper, W. Cameron; Naidu, Agni; Smith, Christopher D.; Gadau, Jürgen

    2012-01-01

    BACKGROUND: DNA methylation is a common regulator of gene expression, including acting as a regulator of developmental events and behavioral changes in adults. Using the unique system of genetic caste determination in Pogonomyrmex barbatus, we were able to document changes in DNA methylation during development, and also across both ancient and contemporary hybridization events. METHODOLOGY/PRINCIPAL FINDINGS: Sodium bisulfite sequencing demonstrated in vivo methylation of symmetric CG dinucle...

  9. Neuronal DNA Methylation Profiling of Blast-Related Traumatic Brain Injury.

    Science.gov (United States)

    Haghighi, Fatemeh; Ge, Yongchao; Chen, Sean; Xin, Yurong; Umali, Michelle U; De Gasperi, Rita; Gama Sosa, Miguel A; Ahlers, Stephen T; Elder, Gregory A

    2015-08-15

    Long-term molecular changes in the brain resulting from blast exposure may be mediated by epigenetic changes, such as deoxyribonucleic acid (DNA) methylation, that regulate gene expression. Aberrant regulation of gene expression is associated with behavioral abnormalities, where DNA methylation bridges environmental signals to sustained changes in gene expression. We assessed DNA methylation changes in the brains of rats exposed to three 74.5 kPa blast overpressure events, conditions that have been associated with long-term anxiogenic manifestations weeks or months following the initial exposures. Rat frontal cortex eight months post-exposure was used for cell sorting of whole brain tissue into neurons and glia. We interrogated DNA methylation profiles in these cells using Expanded Reduced Representation Bisulfite Sequencing. We obtained data for millions of cytosines, showing distinct methylation profiles for neurons and glia and an increase in global methylation in neuronal versus glial cells (pDNA methylation perturbations in blast overpressure-exposed animals, compared with sham blast controls, within 458 and 379 genes in neurons and glia, respectively. Differentially methylated neuronal genes showed enrichment in cell death and survival and nervous system development and function, including genes involved in transforming growth factor β and nitric oxide signaling. Functional validation via gene expression analysis of 30 differentially methylated neuronal and glial genes showed a 1.2 fold change in gene expression of the serotonin N-acetyltransferase gene (Aanat) in blast animals (pDNA methylation induced in response to multiple blast overpressure exposures. In particular, increased methylation and decreased gene expression were observed in the Aanat gene, which is involved in converting serotonin to the circadian hormone melatonin and is implicated in sleep disturbance and depression associated with traumatic brain injury.

  10. MTHFR methylation moderates the impact of smoking on DNA methylation at AHRR for African American young adults.

    Science.gov (United States)

    Beach, Steven R H; Lei, Man Kit; Ong, Mei Ling; Brody, Gene H; Dogan, Meeshanthini V; Philibert, Robert A

    2017-09-01

    Smoking has been shown to have a large, reliable, and rapid effect on demethylation of AHRR, particularly at cg05575921, suggesting that methylation may be used as an index of cigarette consumption. Because the availability of methyl donors may also influence the degree of demethylation in response to smoking, factors that affect the activity of methylene tetrahydrofolate reductase (MTHFR), a key regulator of methyl group availability, may be of interest. In the current investigation, we examined the extent to which individual differences in methylation of MTHFR moderated the association between smoking and demethylation at cg05575921 as well as at other loci on AHRR associated with a main effect of smoking. Using a discovery sample (AIM, N = 293), and a confirmatory sample (SHAPE, N = 368) of young adult African Americans, degree of methylation of loci in the first exon of MTHFR was associated with amplification of the association between smoking and AHRR demethylation at cg05575921. However, genetic variation at a commonly studied MTHFR variant, C677T, did not influence cg05575921 methylation. The significant interaction between MTHFR methylation and the smoking-induced response at cg05575921 suggests a role for individual differences in methyl cycle regulation in understanding the effects of cigarette consumption on genome wide DNA methylation. © 2017 Wiley Periodicals, Inc.

  11. Folate, colorectal cancer and the involvement of DNA methylation.

    Science.gov (United States)

    Williams, Elizabeth A

    2012-11-01

    Diet is a major factor in the aetiology of colorectal cancer (CRC). Epidemiological evidence suggests that folate confers a modest protection against CRC risk. However, the relationship is complex, and evidence from human intervention trials and animal studies suggests that a high-dose of folic acid supplementation may enhance the risk of colorectal carcinogenesis in certain circumstances. The molecular mechanisms underlying the apparent dual modulatory effect of folate on colorectal carcinogenesis are not fully understood. Folate is central to C1 metabolism and is needed for both DNA synthesis and DNA methylation, providing plausible biological mechanisms through which folate could modulate cancer risk. Aberrant DNA methylation is an early event in colorectal carcinogenesis and is typically associated with the transcriptional silencing of tumour suppressor genes. Folate is required for the production of S-adenosyl methionine, which serves as a methyl donor for DNA methylation events; thereby folate availability is proposed to modulate DNA methylation status. The evidence for an effect of folate on DNA methylation in the human colon is limited, but a modulation of DNA methylation in response to folate has been demonstrated. More research is required to clarify the optimum intake of folate for CRC prevention and to elucidate the effect of folate availability on DNA methylation and the associated impact on CRC biology.

  12. Phosphate-methylated DNA aimed at HIV-1 RNA loops and integrated DNA inhibits viral infectivity

    NARCIS (Netherlands)

    Buck, H. M.; Koole, L. H.; van Genderen, M. H.; Smit, L.; Geelen, J. L.; Jurriaans, S.; Goudsmit, J.

    1990-01-01

    Phosphate-methylated DNA hybridizes strongly and specifically to natural DNA and RNA. Hybridization to single-stranded and double-stranded DNA leads to site-selective blocking of replication and transcription. Phosphate-methylated DNA was used to interrupt the life cycle of the human

  13. Comprehensive analysis of genome-wide DNA methylation across human polycystic ovary syndrome ovary granulosa cell.

    Science.gov (United States)

    Xu, Jiawei; Bao, Xiao; Peng, Zhaofeng; Wang, Linlin; Du, Linqing; Niu, Wenbin; Sun, Yingpu

    2016-05-10

    Polycystic ovary syndrome (PCOS) affects approximately 7% of the reproductive-age women. A growing body of evidence indicated that epigenetic mechanisms contributed to the development of PCOS. The role of DNA modification in human PCOS ovary granulosa cell is still unknown in PCOS progression. Global DNA methylation and hydroxymethylation were detected between PCOS' and controls' granulosa cell. Genome-wide DNA methylation was profiled to investigate the putative function of DNA methylaiton. Selected genes expressions were analyzed between PCOS' and controls' granulosa cell. Our results showed that the granulosa cell global DNA methylation of PCOS patients was significant higher than the controls'. The global DNA hydroxymethylation showed low level and no statistical difference between PCOS and control. 6936 differentially methylated CpG sites were identified between control and PCOS-obesity. 12245 differential methylated CpG sites were detected between control and PCOS-nonobesity group. 5202 methylated CpG sites were significantly differential between PCOS-obesity and PCOS-nonobesity group. Our results showed that DNA methylation not hydroxymethylation altered genome-wide in PCOS granulosa cell. The different methylation genes were enriched in development protein, transcription factor activity, alternative splicing, sequence-specific DNA binding and embryonic morphogenesis. YWHAQ, NCF2, DHRS9 and SCNA were up-regulation in PCOS-obesity patients with no significance different between control and PCOS-nonobesity patients, which may be activated by lower DNA methylaiton. Global and genome-wide DNA methylation alteration may contribute to different genes expression and PCOS clinical pathology.

  14. Quantitative DNA methylation analysis of candidate genes in cervical cancer.

    Directory of Open Access Journals (Sweden)

    Erin M Siegel

    Full Text Available Aberrant DNA methylation has been observed in cervical cancer; however, most studies have used non-quantitative approaches to measure DNA methylation. The objective of this study was to quantify methylation within a select panel of genes previously identified as targets for epigenetic silencing in cervical cancer and to identify genes with elevated methylation that can distinguish cancer from normal cervical tissues. We identified 49 women with invasive squamous cell cancer of the cervix and 22 women with normal cytology specimens. Bisulfite-modified genomic DNA was amplified and quantitative pyrosequencing completed for 10 genes (APC, CCNA, CDH1, CDH13, WIF1, TIMP3, DAPK1, RARB, FHIT, and SLIT2. A Methylation Index was calculated as the mean percent methylation across all CpG sites analyzed per gene (~4-9 CpG site per sequence. A binary cut-point was defined at >15% methylation. Sensitivity, specificity and area under ROC curve (AUC of methylation in individual genes or a panel was examined. The median methylation index was significantly higher in cases compared to controls in 8 genes, whereas there was no difference in median methylation for 2 genes. Compared to HPV and age, the combination of DNA methylation level of DAPK1, SLIT2, WIF1 and RARB with HPV and age significantly improved the AUC from 0.79 to 0.99 (95% CI: 0.97-1.00, p-value = 0.003. Pyrosequencing analysis confirmed that several genes are common targets for aberrant methylation in cervical cancer and DNA methylation level of four genes appears to increase specificity to identify cancer compared to HPV detection alone. Alterations in DNA methylation of specific genes in cervical cancers, such as DAPK1, RARB, WIF1, and SLIT2, may also occur early in cervical carcinogenesis and should be evaluated.

  15. DNA methylation analysis from saliva samples for epidemiological studies.

    Science.gov (United States)

    Nishitani, Shota; Parets, Sasha E; Haas, Brian W; Smith, Alicia K

    2018-06-18

    Saliva is a non-invasive, easily accessible tissue, which is regularly collected in large epidemiological studies to examine genetic questions. Recently, it is becoming more common to use saliva to assess DNA methylation. However, DNA extracted from saliva is a mixture of both bacterial and human DNA derived from epithelial and immune cells in the mouth. Thus, there are unique challenges to using salivary DNA in methylation studies that can influence data quality. This study assesses: (1) quantification of human DNA after extraction; (2) delineation of human and bacterial DNA; (3) bisulfite conversion (BSC); (4) quantification of BSC DNA; (5) PCR amplification of BSC DNA from saliva and; (6) quantitation of DNA methylation with a targeted assay. The framework proposed will allow saliva samples to be more widely used in targeted epigenetic studies.

  16. DNA Methylation and Methylation Polymorphism in Genetically Stable In vitro Regenerates of Jatropha curcas L. Using Methylation-Sensitive AFLP Markers.

    Science.gov (United States)

    Rathore, Mangal S; Jha, Bhavanath

    2016-03-01

    The present investigation aimed to evaluate the degree and pattern of DNA methylation using methylation-sensitive AFLP (MS-AFLP) markers in genetically stable in vitro regenerates of Jatropha curcas L.. The genetically stable in vitro regenerates were raised through direct organogenesis via enhanced axillary shoot bud proliferation (Protocol-1) and in vitro-derived leaf regeneration (Protocol-2). Ten selective combinations of MS-AFLP primers produced 462 and 477 MS-AFLP bands in Protocol-1 (P-1) and Protocol-2 (P-2) regenerates, respectively. In P-1 regenerates, 15.8-31.17 % DNA was found methylated with an average of 25.24 %. In P-2 regenerates, 15.93-32.7 % DNA was found methylated with an average of 24.11 %. Using MS-AFLP in P-1 and P-2 regenerates, 11.52-25.53 % and 13.33-25.47 % polymorphism in methylated DNA was reported, respectively. Compared to the mother plant, P-1 regenerates showed hyper-methylation while P-2 showed hypo-methylation. The results clearly indicated alternation in degree and pattern of DNA methylation; hence, epigenetic instability in the genetically stable in vitro regenerates of J. curcas, developed so far using two different regeneration systems and explants of two different origins. The homologous nucleotide fragments in genomes of P-1 and P-2 regenerates showing methylation re-patterning might be involved in immediate adaptive responses and developmental processes through differential regulation of transcriptome under in vitro conditions.

  17. DNA methylation levels analysis in four tissues of sea cucumber Apostichopus japonicus based on fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) during aestivation.

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng

    2015-03-01

    DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Epigenetic changes in neurology: DNA methylation in multiple sclerosis.

    Science.gov (United States)

    Iridoy Zulet, M; Pulido Fontes, L; Ayuso Blanco, T; Lacruz Bescos, F; Mendioroz Iriarte, M

    2017-09-01

    Epigenetics is defined as the study of the mechanisms that regulate gene expression without altering the underlying DNA sequence. The best known is DNA methylation. Multiple Sclerosis (MS) is a disease with no entirely known etiology, in which it is stated that the involvement of environmental factors on people with a genetic predisposition, may be key to the development of the disease. It is at this intersection between genetic predisposition and environmental factors where DNA methylation may play a pathogenic role. A literature review of the effects of environmental risk factors for the development of MS can have on the different epigenetic mechanisms as well as the implication that such changes have on the development of the disease. Knowledge of epigenetic modifications involved in the pathogenesis of MS, opens a new avenue of research for identification of potential biomarkers, as well as finding new therapeutic targets. Copyright © 2015 Sociedad Española de Neurología. Publicado por Elsevier España, S.L.U. All rights reserved.

  19. Comprehensive analyses of DNA methylation profile, regulation on flowering, and seed mineral accumulation in Arabidopsis thaliana in response to zinc deficiency

    OpenAIRE

    Chen Xiaochao

    2016-01-01

    Zinc (Zn) is an essential micronutrient for plant growth and development, which plays important roles in DNA binding, metabolic, catalytic and transcriptional regulator activities. However, Zn deficiency is a worldwide problem due to its limited bioavailability in soils in many agricultural areas, often as a result of high CaCO3 content and high pH. In addition, phytic acid is able to strongly chelate cations, such as Zn2+, Fe2+, Ca2+ and Mg2+ to form the phytate salts. Phytate cannot be dige...

  20. Epigenetics in Alzheimer's Disease: Perspective of DNA Methylation.

    Science.gov (United States)

    Qazi, Talal Jamil; Quan, Zhenzhen; Mir, Asif; Qing, Hong

    2018-02-01

    Research over the years has shown that causes of Alzheimer's disease are not well understood, but over the past years, the involvement of epigenetic mechanisms in the developing memory formation either under pathological or physiological conditions has become clear. The term epigenetics represents the heredity of changes in phenotype that are independent of altered DNA sequences. Different studies validated that cytosine methylation of genomic DNA decreases with age in different tissues of mammals, and therefore, the role of epigenetic factors in developing neurological disorders in aging has been under focus. In this review, we summarized and reviewed the involvement of different epigenetic mechanisms especially the DNA methylation in Alzheimer's disease (AD), late-onset Alzheimer's disease (LOAD), familial Alzheimer's disease (FAD), and autosomal dominant Alzheimer's disease (ADAD). Down to the minutest of details, we tried to discuss the methylation patterns like mitochondrial DNA methylation and ribosomal DNA (rDNA) methylation. Additionally, we mentioned some therapeutic approaches related to epigenetics, which could provide a potential cure for AD. Moreover, we reviewed some recent studies that validate DNA methylation as a potential biomarker and its role in AD. We hope that this review will provide new insights into the understanding of AD pathogenesis from the epigenetic perspective especially from the perspective of DNA methylation.

  1. Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.

    Science.gov (United States)

    Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M

    2011-07-01

    Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.

  2. DNA methylation dynamics in the rat EGF gene promoter after partial hepatectomy

    Directory of Open Access Journals (Sweden)

    Deming Li

    2014-06-01

    Full Text Available Epidermal growth factor (EGF, a multifunctional growth factor, is a regulator in a wide variety of physiological processes. EGF plays an important role in the regulation of liver regeneration. This study was aimed at investigating the methylation level of EGF gene throughout liver regeneration. DNA of liver tissue from control rats and partial hepatectomy (PH rats at 10 time points was extracted and a 354 bp fragment including 10 CpG sites from the transcription start was amplified after DNA was modified by sodium bisulfate. The result of sequencing suggested that methylation ratio of four CpG sites was found to be significantly changed when PH group was compared to control group, in particular two of them were extremely striking. mRNA expression of EGF was down-regulated in total during liver regeneration. We think that the rat EGF promoter region is regulated by variation in DNA methylation during liver regeneration.

  3. Extensive genetic and DNA methylation variation contribute to heterosis in triploid loquat hybrids.

    Science.gov (United States)

    Liu, Chao; Wang, Mingbo; Wang, Lingli; Guo, Qigao; Liang, Guolu

    2018-04-24

    We aim to overcome the unclear origin of the loquat and elucidate the heterosis mechanism of the triploid loquat. Here we investigated the genetic and epigenetic variations between the triploid plant and its parental lines using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplified fragment length polymorphism (MSAP) analyses. We show that in addition to genetic variations, extensive DNA methylation variation occurred during the formation process of triploid loquat, with the triploid hybrid having increased DNA methylation compared to the parents. Furthermore, a correlation existed between genetic variation and DNA methylation remodeling, suggesting that genome instability may lead to DNA methylation variation or vice versa. Sequence analysis of the MSAP bands revealed that over 53% of them overlap with protein-coding genes, which may indicate a functional role of the differential DNA methylation in gene regulation and hence heterosis phenotypes. Consistent with this, the genetic and epigenetic alterations were associated closely to the heterosis phenotypes of triploid loquat, and this association varied for different traits. Our results suggested that the formation of triploid is accompanied by extensive genetic and DNA methylation variation, and these changes contribute to the heterosis phenotypes of the triploid loquats from the two cross lines.

  4. Aberrant DNA methylation associated with Alzheimer's disease in the superior temporal gyrus.

    Science.gov (United States)

    Gao, Zhan; Fu, Hong-Juan; Zhao, Li-Bo; Sun, Zhuo-Yan; Yang, Yu-Fei; Zhu, Hong-Yan

    2018-01-01

    Abnormal DNA methylation patterns have been demonstrated to be associated with the pathogenesis of Alzheimer's disease (AD). The present study aimed to identify differential methylation in the superior temporal gyrus (STG) of patients with late-onset AD based on epigenome-wide DNA methylation data by bioinformatics analysis. The genome-wide DNA methylation data in the STG region of 34 patients with late-onset AD and 34 controls without dementia were recruited from the Gene Expression Omnibus database. Through systemic quality control, differentially methylated CpG sites were determined by the Student's t-test and mean methylation value differences between the two conditions. Hierarchical clustering analysis was applied to assess the classification performance of differentially methylated CpGs. Functional analysis was performed to investigate the biological functions of the genes associated with differentially methylated CpGs. A total of 17,895 differentially methylated CpG sites were initially identified, including 11,822 hypermethylated CpGs and 6,073 hypomethylated CpGs. Further analysis examined 2,211 differentially methylated CpGs (covering 1,991 genes). AD subjects demonstrated distinctive DNA methylation patterns when compared with the controls, with a classification accuracy value of 1. Hypermethylation was mainly detected for genes regulating the cell cycle progression, whereas hypomethylation was observed in genes involved in transcription factor binding. The present study demonstrated widespread and distinctive DNA methylation alterations in late-onset AD. Identification of AD-associated epigenetic biomarkers may allow for the development of novel diagnostic and therapeutic targets.

  5. Exposure of E. coli to DNA-methylating agents impairs biofilm formation and invasion of eukaryotic cells via down regulation of the N-acetylneuraminate lyase NanA

    Directory of Open Access Journals (Sweden)

    Pamela eDi Pasquale

    2016-02-01

    Full Text Available DNA methylation damage can be induced by endogenous and exogenous chemical agents, which has led every living organism to develop suitable response strategies. We investigated protein expression profiles of Escherichia coli upon exposure to the alkylating agent methyl-methane sulfonate (MMS by differential proteomics. Quantitative proteomic data showed a massive downregulation of enzymes belonging to the glycolytic pathway and fatty acids degradation, strongly suggesting a decrease of energy production. A strong reduction in the expression of the N-acetylneuraminate lyases (NanA involved in the sialic acid metabolism was also observed. Using a null NanA mutant and DANA, a substrate analogue acting as competitive inhibitor, we demonstrated that down regulation of NanA affects biofilm formation and adhesion properties of E. coli MV1161. Exposure to alkylating agents also decreased biofilm formation and bacterial adhesion to Caco-2 eukaryotic cell line by the adherent invasive E. coli (AIEC strain LF82. Our data showed that methylation stress impairs E. coli adhesion properties and suggest a possible role of NanA in biofilm formation and bacteria host interactions.

  6. SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation

    Science.gov (United States)

    Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.

    2015-01-01

    Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578

  7. Detecting differential DNA methylation from sequencing of bisulfite converted DNA of diverse species.

    Science.gov (United States)

    Huh, Iksoo; Wu, Xin; Park, Taesung; Yi, Soojin V

    2017-07-21

    DNA methylation is one of the most extensively studied epigenetic modifications of genomic DNA. In recent years, sequencing of bisulfite-converted DNA, particularly via next-generation sequencing technologies, has become a widely popular method to study DNA methylation. This method can be readily applied to a variety of species, dramatically expanding the scope of DNA methylation studies beyond the traditionally studied human and mouse systems. In parallel to the increasing wealth of genomic methylation profiles, many statistical tools have been developed to detect differentially methylated loci (DMLs) or differentially methylated regions (DMRs) between biological conditions. We discuss and summarize several key properties of currently available tools to detect DMLs and DMRs from sequencing of bisulfite-converted DNA. However, the majority of the statistical tools developed for DML/DMR analyses have been validated using only mammalian data sets, and less priority has been placed on the analyses of invertebrate or plant DNA methylation data. We demonstrate that genomic methylation profiles of non-mammalian species are often highly distinct from those of mammalian species using examples of honey bees and humans. We then discuss how such differences in data properties may affect statistical analyses. Based on these differences, we provide three specific recommendations to improve the power and accuracy of DML and DMR analyses of invertebrate data when using currently available statistical tools. These considerations should facilitate systematic and robust analyses of DNA methylation from diverse species, thus advancing our understanding of DNA methylation. © The Author 2017. Published by Oxford University Press.

  8. Patterns of DNA methylation in development, division of labor and hybridization in an ant with genetic caste determination.

    Directory of Open Access Journals (Sweden)

    Chris R Smith

    Full Text Available BACKGROUND: DNA methylation is a common regulator of gene expression, including acting as a regulator of developmental events and behavioral changes in adults. Using the unique system of genetic caste determination in Pogonomyrmex barbatus, we were able to document changes in DNA methylation during development, and also across both ancient and contemporary hybridization events. METHODOLOGY/PRINCIPAL FINDINGS: Sodium bisulfite sequencing demonstrated in vivo methylation of symmetric CG dinucleotides in P. barbatus. We also found methylation of non-CpG sequences. This validated two bioinformatics methods for predicting gene methylation, the bias in observed to expected ratio of CpG dinucleotides and the density of CpG/TpG single nucleotide polymorphisms (SNP. Frequencies of genomic DNA methylation were determined for different developmental stages and castes using ms-AFLP assays. The genetic caste determination system (GCD is probably the product of an ancestral hybridization event between P. barbatus and P. rugosus. Two lineages obligately co-occur within a GCD population, and queens are derived from intra-lineage matings whereas workers are produced from inter-lineage matings. Relative DNA methylation levels of queens and workers from GCD lineages (contemporary hybrids were not significantly different until adulthood. Virgin queens had significantly higher relative levels of DNA methylation compared to workers. Worker DNA methylation did not vary among developmental stages within each lineage, but was significantly different between the currently hybridizing lineages. Finally, workers of the two genetic caste determination lineages had half as many methylated cytosines as workers from the putative parental species, which have environmental caste determination. CONCLUSIONS/SIGNIFICANCE: These results suggest that DNA methylation may be a conserved regulatory mechanism moderating division of labor in both bees and ants. Current and historic

  9. DNA methylation mediated control of gene expression is critical for development of crown gall tumors.

    Directory of Open Access Journals (Sweden)

    Jochen Gohlke

    Full Text Available Crown gall tumors develop after integration of the T-DNA of virulent Agrobacterium tumefaciens strains into the plant genome. Expression of the T-DNA-encoded oncogenes triggers proliferation and differentiation of transformed plant cells. Crown gall development is known to be accompanied by global changes in transcription, metabolite levels, and physiological processes. High levels of abscisic acid (ABA in crown galls regulate expression of drought stress responsive genes and mediate drought stress acclimation, which is essential for wild-type-like tumor growth. An impact of epigenetic processes such as DNA methylation on crown gall development has been suggested; however, it has not yet been investigated comprehensively. In this study, the methylation pattern of Arabidopsis thaliana crown galls was analyzed on a genome-wide scale as well as at the single gene level. Bisulfite sequencing analysis revealed that the oncogenes Ipt, IaaH, and IaaM were unmethylated in crown galls. Nevertheless, the oncogenes were susceptible to siRNA-mediated methylation, which inhibited their expression and subsequently crown gall growth. Genome arrays, hybridized with methylated DNA obtained by immunoprecipitation, revealed a globally hypermethylated crown gall genome, while promoters were rather hypomethylated. Mutants with reduced non-CG methylation developed larger tumors than the wild-type controls, indicating that hypermethylation inhibits plant tumor growth. The differential methylation pattern of crown galls and the stem tissue from which they originate correlated with transcriptional changes. Genes known to be transcriptionally inhibited by ABA and methylated in crown galls became promoter methylated upon treatment of A. thaliana with ABA. This suggests that the high ABA levels in crown galls may mediate DNA methylation and regulate expression of genes involved in drought stress protection. In summary, our studies provide evidence that epigenetic processes

  10. Differential DNA Methylation Patterns Are Related to Phellogen Origin and Quality of Quercus suber Cork.

    Science.gov (United States)

    Inácio, Vera; Barros, Pedro M; Costa, Augusta; Roussado, Cristóvão; Gonçalves, Elsa; Costa, Rita; Graça, José; Oliveira, M Margarida; Morais-Cecílio, Leonor

    2017-01-01

    DNA methylation is thought to influence Quercus suber cork quality, which is the main constraint for its economic valorisation. However, a deep knowledge of the cytosine methylation patterns disclosing the epigenetic variability of trees with different cork quality types is totally missing. This study investigates the hypothesis that variations in DNA methylation contribute to differences in cork cellular characteristics directly related to original or traumatic phellogen activity. We used MSAPs (Methylation Sensitive Amplified Polymorphism) to assess DNA methylation patterns of cork and leaf tissues of Q. suber adult trees growing in three cork oak stands. The relationship between the detected polymorphisms and the diversity of cork quality traits was explored by a marker-trait analysis focusing on the most relevant quality characteristics. Populations differed widely in cork quality, but only slightly in degree of epigenetic differentiation. Four MSAP markers (1.3% of the total) were significantly associated with the most noteworthy quality traits: wood inclusions (nails) and porosity. This evidence supports the potential role of cytosine methylation in the modulation of differential phellogen activity either involved in localized cell death or in pore production, resulting in different cork qualities. Although, the underlying basis of the methylation polymorphism of loci affecting cork quality traits remain unclear, the disclosure of markers statistically associated with cork quality strengthens the potential role of DNA methylation in the regulation of these traits, namely at the phellogen level.

  11. DNA Methylation in Skeletal Muscle Stem Cell Specification, Proliferation, and Differentiation

    Directory of Open Access Journals (Sweden)

    Rhianna C. Laker

    2016-01-01

    Full Text Available An unresolved and critically important question in skeletal muscle biology is how muscle stem cells initiate and regulate the genetic program during muscle development. Epigenetic dynamics are essential for cellular development and organogenesis in early life and it is becoming increasingly clear that epigenetic remodeling may also be responsible for the cellular adaptations that occur in later life. DNA methylation of cytosine bases within CpG dinucleotide pairs is an important epigenetic modification that reduces gene expression when located within a promoter or enhancer region. Recent advances in the field suggest that epigenetic regulation is essential for skeletal muscle stem cell identity and subsequent cell development. This review summarizes what is currently known about how skeletal muscle stem cells regulate the myogenic program through DNA methylation, discusses a novel role for metabolism in this process, and addresses DNA methylation dynamics in adult skeletal muscle in response to physical activity.

  12. DNA Methylation: A Frontier in Tooth Organogenesis and Developmental Dental Defects.

    Science.gov (United States)

    Wan, Mian; Li, Hongyu; Zhou, Yachuan; Du, Wei; Xu, Xin; Ye, Ling; Zhou, Xuedong; Zheng, Liwei

    2018-01-01

    Tooth development relies on interactions between epithelial and mesenchymal tissues, which are controlled by sophisticated networks of conserved signaling. The signaling networks regulating odontogenesis have been well characterized, but the epigenetic mechanisms underlying remain to be elucidated. In this review, we describe current researches regarding the control of various genes expression by DNA methylation during odontogenesis, summarize genomic mapping of DNA methylation in various stages of tooth formation and diverse dental tissues by high-throughput approaches, and highlight the roles of DNA methylation in odontogenesis. Researches on mammals have revealed that the genomic methylation, which occurs on cytosine residues, regulates certain genes transcription. Consequently, DNA methylation plays a crucial role in spatiotemporal organization of signaling pathways, and is essential for organogenesis. Recently, mounting evidence proves that methylation of genomes contributes to the spatiotemporal gene dynamics during odontogenesis. With emerging new technologies of mapping cytosine modifications in global genome, investigators are seeking an overall view of DNA methylome dynamics that characterize genetic information to manifest across incredibly varied tooth development stages, dental tissues, and developmental dental defects. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  13. Social Crowding during Development Causes Changes in GnRH1 DNA Methylation.

    Science.gov (United States)

    Alvarado, Sebastian G; Lenkov, Kapa; Williams, Blake; Fernald, Russell D

    2015-01-01

    Gestational and developmental cues have important consequences for long-term health, behavior and adaptation to the environment. In addition, social stressors cause plastic molecular changes in the brain that underlie unique behavioral phenotypes that also modulate fitness. In the adult African cichlid, Astatotilapia burtoni, growth and social status of males are both directly regulated by social interactions in a dynamic social environment, which causes a suite of plastic changes in circuits, cells and gene transcription in the brain. We hypothesized that a possible mechanism underlying some molecular changes might be DNA methylation, a reversible modification made to cytosine nucleotides that is known to regulate gene function. Here we asked whether changes in DNA methylation of the GnRH1 gene, the central regulator of the reproductive axis, were altered during development of A. burtoni. We measured changes in methylation state of the GnRH1 gene during normal development and following the gestational and developmental stress of social crowding. We found differential DNA methylation within developing juveniles between 14-, 28- and 42-day-old. Following gestational crowding of mouth brooding mothers, we saw differential methylation and transcription of GnRH1 in their offspring. Taken together, our data provides evidence for social control of GnRH1 developmental responses to gestational cues through DNA methylation.

  14. The application of methylation specific electrophoresis (MSE to DNA methylation analysis of the 5' CpG island of mucin in cancer cells

    Directory of Open Access Journals (Sweden)

    Yokoyama Seiya

    2012-02-01

    Full Text Available Abstract Background Methylation of CpG sites in genomic DNA plays an important role in gene regulation and especially in gene silencing. We have reported mechanisms of epigenetic regulation for expression of mucins, which are markers of malignancy potential and early detection of human neoplasms. Epigenetic changes in promoter regions appear to be the first step in expression of mucins. Thus, detection of promoter methylation status is important for early diagnosis of cancer, monitoring of tumor behavior, and evaluating the response of tumors to targeted therapy. However, conventional analytical methods for DNA methylation require a large amount of DNA and have low sensitivity. Methods Here, we report a modified version of the bisulfite-DGGE (denaturing gradient gel electrophoresis using a nested PCR approach. We designated this method as methylation specific electrophoresis (MSE. The MSE method is comprised of the following steps: (a bisulfite treatment of genomic DNA, (b amplification of the target DNA by a nested PCR approach and (c applying to DGGE. To examine whether the MSE method is able to analyze DNA methylation of mucin genes in various samples, we apply it to DNA obtained from state cell lines, ethanol-fixed colonic crypts and human pancreatic juices. Result The MSE method greatly decreases the amount of input DNA. The lower detection limit for distinguishing different methylation status is Conclusions The MSE method can provide a qualitative information of methylated sequence profile. The MSE method allows sensitive and specific analysis of the DNA methylation pattern of almost any block of multiple CpG sites. The MSE method can be applied to analysis of DNA methylation status in many different clinical samples, and this may facilitate identification of new risk markers.

  15. DNA methylation analysis reveals distinct methylation signatures in pediatric germ cell tumors

    International Nuclear Information System (INIS)

    Amatruda, James F; Frazier, A Lindsay; Poynter, Jenny N; Ross, Julie A; Christensen, Brock; Fustino, Nicholas J; Chen, Kenneth S; Hooten, Anthony J; Nelson, Heather; Kuriger, Jacquelyn K; Rakheja, Dinesh

    2013-01-01

    Aberrant DNA methylation is a prominent feature of many cancers, and may be especially relevant in germ cell tumors (GCTs) due to the extensive epigenetic reprogramming that occurs in the germ line during normal development. We used the Illumina GoldenGate Cancer Methylation Panel to compare DNA methylation in the three main histologic subtypes of pediatric GCTs (germinoma, teratoma and yolk sac tumor (YST); N = 51) and used recursively partitioned mixture models (RPMM) to test associations between methylation pattern and tumor and demographic characteristics. We identified genes and pathways that were differentially methylated using generalized linear models and Ingenuity Pathway Analysis. We also measured global DNA methylation at LINE1 elements and evaluated methylation at selected imprinted loci using pyrosequencing. Methylation patterns differed by tumor histology, with 18/19 YSTs forming a distinct methylation class. Four pathways showed significant enrichment for YSTs, including a human embryonic stem cell pluripotency pathway. We identified 190 CpG loci with significant methylation differences in mature and immature teratomas (q < 0.05), including a number of CpGs in stem cell and pluripotency-related pathways. Both YST and germinoma showed significantly lower methylation at LINE1 elements compared with normal adjacent tissue while there was no difference between teratoma (mature and immature) and normal tissue. DNA methylation at imprinted loci differed significantly by tumor histology and location. Understanding methylation patterns may identify the developmental stage at which the GCT arose and the at-risk period when environmental exposures could be most harmful. Further, identification of relevant genetic pathways could lead to the development of new targets for therapy

  16. To What Extent Does DNA Methylation Affect Phenotypic Variation in Cattle?

    Directory of Open Access Journals (Sweden)

    Stephanie McKAY

    2015-07-01

    Full Text Available DNA methylation is an environmentally influenced epigenetic modification that regulates gene transcription and has the potential to influence variation in economically important phenotypes in agricultural species. We have utilized a novel approach to evaluate the relationship between genetic and epigenetic variation and downstream phenotypes. To begin with, we have integrated RNA-Seq and methyl binding domain sequencing (MBD-Seq data in order to determine the extent to which DNA methylation affects phenotypic variation in economically important traits of cattle. MBD-Seq is a technique that involves the sample enrichment of methylated genomic regions followed by their next-generation sequencing. This study utilized Illumina next generation sequencing technology to perform both RNA-Seq and MBD-Seq. NextGENe software (SoftGenetics, State College, PA was employed for quality trimming and aligning the sequence reads to the UMD3.1 bovine reference genome, generating counts of matched reads and methylated peak identification. Subsequently, we identified and quantified genome-wide methylated regions and characterized the extent of differential methylation and differential expression between two groups of animals with extreme phenotypes. The program edgeR from the R software package (version 3.0.1 was employed for identifying differentially methylated regions and regions of differential expression. Finally, Partial Correlation with Information Theory (PCIT was performed to identify transcripts and methylation events that exhibit differential hubbing. A differential hub is defined as a gene network hub that is more highly connected in one treatment group than the other. This analysis produced every possible pair-wise interaction that subsequently enabled us to look at network interactions of how methylation affects expression. (co-expression, co-methylation, methylation x expression. Genomic regions of interest derived from this analysis were then aligned

  17. Decoding the regulatory landscape of medulloblastoma using DNA methylation sequencing

    NARCIS (Netherlands)

    Hovestadt, Volker; Jones, David T. W.; Picelli, Simone; Wang, Wei; Kool, Marcel; Northcott, Paul A.; Sultan, Marc; Stachurski, Katharina; Ryzhova, Marina; Warnatz, Hans-Jörg; Ralser, Meryem; Brun, Sonja; Bunt, Jens; Jäger, Natalie; Kleinheinz, Kortine; Erkek, Serap; Weber, Ursula D.; Bartholomae, Cynthia C.; von Kalle, Christof; Lawerenz, Chris; Eils, Jürgen; Koster, Jan; Versteeg, Rogier; Milde, Till; Witt, Olaf; Schmidt, Sabine; Wolf, Stephan; Pietsch, Torsten; Rutkowski, Stefan; Scheurlen, Wolfram; Taylor, Michael D.; Brors, Benedikt; Felsberg, Jörg; Reifenberger, Guido; Borkhardt, Arndt; Lehrach, Hans; Wechsler-Reya, Robert J.; Eils, Roland; Yaspo, Marie-Laure; Landgraf, Pablo; Korshunov, Andrey; Zapatka, Marc; Radlwimmer, Bernhard; Pfister, Stefan M.; Lichter, Peter

    2014-01-01

    Epigenetic alterations, that is, disruption of DNA methylation and chromatin architecture, are now acknowledged as a universal feature of tumorigenesis. Medulloblastoma, a clinically challenging, malignant childhood brain tumour, is no exception. Despite much progress from recent genomics studies,

  18. DNA Methylation: An Epigenetic Risk Factor in Preterm Birth

    Science.gov (United States)

    Menon, Ramkumar; Conneely, Karen N.; Smith, Alicia K.

    2012-01-01

    Spontaneous preterm birth (PTB; birth prior to 37 weeks of gestation) is a complex phenotype with multiple risk factors that complicate our understanding of its etiology. A number of recent studies have supported the hypothesis that epigenetic modifications such as DNA methylation induced by pregnancy-related risk factors may influence the risk of PTB or result in changes that predispose a neonate to adult-onset diseases. The critical role of timing of gene expression in the etiology of PTB makes it a highly relevant disorder in which to examine the potential role of epigenetic changes. Because changes in DNA methylation patterns can result in long-term consequences, it is of critical interest to identify the epigenetic patterns associated with adverse pregnancy outcomes. This review examines the potential role of DNA methylation as a risk factor for PTB and discusses several issues and limitations that should be considered when planning DNA methylation studies. PMID:22228737

  19. Parental epigenetic difference in DNA methylation-level may play ...

    African Journals Online (AJOL)

    Jane

    2011-08-22

    Aug 22, 2011 ... We found that a specific type of DNA methylation-level difference, that is, relative CHG (H ... eukaryotes and is particularly abundant in higher plants, ..... characterization of a set of disease resistance-gene analogs (RGAs).

  20. Advancements in the Underlying Pathogenesis of Schizophrenia: Implications of DNA Methylation in Glial Cells.

    Science.gov (United States)

    Chen, Xing-Shu; Huang, Nanxin; Michael, Namaka; Xiao, Lan

    2015-01-01

    Schizophrenia (SZ) is a chronic and severe mental illness for which currently there is no cure. At present, the exact molecular mechanism involved in the underlying pathogenesis of SZ is unknown. The disease is thought to be caused by a combination of genetic, biological, psychological, and environmental factors. Recent studies have shown that epigenetic regulation is involved in SZ pathology. Specifically, DNA methylation, one of the earliest found epigenetic modifications, has been extensively linked to modulation of neuronal function, leading to psychiatric disorders such as SZ. However, increasing evidence indicates that glial cells, especially dysfunctional oligodendrocytes undergo DNA methylation changes that contribute to the pathogenesis of SZ. This review primarily focuses on DNA methylation involved in glial dysfunctions in SZ. Clarifying this mechanism may lead to the development of new therapeutic interventional strategies for the treatment of SZ and other illnesses by correcting abnormal methylation in glial cells.

  1. Advancements in the Underlying Pathogenesis of Schizophrenia: Implications of DNA Methylation in Glial Cells

    Directory of Open Access Journals (Sweden)

    Xin-Shu eChen

    2015-12-01

    Full Text Available Schizophrenia (SZ)is a chronic and severe mental illness for which currently there is no cure. At present, the exact molecular mechanism involved in the underlying pathogenesis of SZ is unknown. The disease is thought to be caused by a combination of genetic, biological, psychological, and environmental factors. Recent studies have shown that epigenetic regulation is involved in SZ pathology. Specifically, DNA methylation, one of the earliest found epigenetic modifications, has been extensively linked to modulation of neuronal function, leading to psychiatric disorders such as SZ. However, increasing evidence indicates that glial cells, especially dysfunctional oligodendrocytes undergo DNA methylation changes that contribute to the pathogenesis of SZ. This review primarily focuses on DNA methylation involved in glial dysfunctions in SZ. Clarifying this mechanism may lead to the development of new therapeutic interventional strategies for the treatment of SZ and other illnesses by correcting abnormal methylation in glial cells.

  2. DNA methylation and genetic diversity analysis of genus Cycas in ...

    African Journals Online (AJOL)

    10 Cycas species as well as one subspecies localized in Thailand were studied using the methylation sensitive amplification polymorphism (MSAP) technique. 11 MSAP primer combinations were used and 720 MSAP bands were generated. The percentages of DNA methylation estimated from MSAP fingerprints were in ...

  3. DNA sequence explains seemingly disordered methylation levels in partially methylated domains of Mammalian genomes.

    Directory of Open Access Journals (Sweden)

    Dimos Gaidatzis

    2014-02-01

    Full Text Available For the most part metazoan genomes are highly methylated and harbor only small regions with low or absent methylation. In contrast, partially methylated domains (PMDs, recently discovered in a variety of cell lines and tissues, do not fit this paradigm as they show partial methylation for large portions (20%-40% of the genome. While in PMDs methylation levels are reduced on average, we found that at single CpG resolution, they show extensive variability along the genome outside of CpG islands and DNase I hypersensitive sites (DHS. Methylation levels range from 0% to 100% in a roughly uniform fashion with only little similarity between neighboring CpGs. A comparison of various PMD-containing methylomes showed that these seemingly disordered states of methylation are strongly conserved across cell types for virtually every PMD. Comparative sequence analysis suggests that DNA sequence is a major determinant of these methylation states. This is further substantiated by a purely sequence based model which can predict 31% (R(2 of the variation in methylation. The model revealed CpG density as the main driving feature promoting methylation, opposite to what has been shown for CpG islands, followed by various dinucleotides immediately flanking the CpG and a minor contribution from sequence preferences reflecting nucleosome positioning. Taken together we provide a reinterpretation for the nucleotide-specific methylation levels observed in PMDs, demonstrate their conservation across tissues and suggest that they are mainly determined by specific DNA sequence features.

  4. High-resolution analysis of cytosine methylation in ancient DNA.

    Directory of Open Access Journals (Sweden)

    Bastien Llamas

    Full Text Available Epigenetic changes to gene expression can result in heritable phenotypic characteristics that are not encoded in the DNA itself, but rather by biochemical modifications to the DNA or associated chromatin proteins. Interposed between genes and environment, these epigenetic modifications can be influenced by environmental factors to affect phenotype for multiple generations. This raises the possibility that epigenetic states provide a substrate for natural selection, with the potential to participate in the rapid adaptation of species to changes in environment. Any direct test of this hypothesis would require the ability to measure epigenetic states over evolutionary timescales. Here we describe the first single-base resolution of cytosine methylation patterns in an ancient mammalian genome, by bisulphite allelic sequencing of loci from late Pleistocene Bison priscus remains. Retrotransposons and the differentially methylated regions of imprinted loci displayed methylation patterns identical to those derived from fresh bovine tissue, indicating that methylation patterns are preserved in the ancient DNA. Our findings establish the biochemical stability of methylated cytosines over extensive time frames, and provide the first direct evidence that cytosine methylation patterns are retained in DNA from ancient specimens. The ability to resolve cytosine methylation in ancient DNA provides a powerful means to study the role of epigenetics in evolution.

  5. The impact of endurance exercise on global and AMPK gene-specific DNA methylation

    Energy Technology Data Exchange (ETDEWEB)

    King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Resch, Eduard [Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Peil, Johannes [Sports Clinic, Bad Nauheim, MCI GmbH, In der Aue 30-32, 61231, Bad Nauheim (Germany); Geisslinger, Gerd [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Niederberger, Ellen, E-mail: e.niederberger@em.uni-frankfurt.de [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany)

    2016-05-27

    Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.

  6. The impact of endurance exercise on global and AMPK gene-specific DNA methylation

    International Nuclear Information System (INIS)

    King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia; Resch, Eduard; Peil, Johannes; Geisslinger, Gerd; Niederberger, Ellen

    2016-01-01

    Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.

  7. Chronic consumption of a western diet modifies the DNA methylation profile in the frontal cortex of mice.

    Science.gov (United States)

    Yokoyama, Amy S; Dunaway, Keith; Rutkowsky, Jennifer; Rutledge, John C; Milenkovic, Dragan

    2018-02-21

    In our previous work in mice, we have shown that chronic consumption of a Western diet (WD; 42% kcal fat, 0.2% total cholesterol and 34% sucrose) is correlated with impaired cognitive function. Cognitive decline has also been associated with alterations in DNA methylation. Additionally, although there have been many studies analyzing the effect of maternal consumption of a WD on DNA methylation in the offspring, few studies have analyzed how an individual's consumption of a WD can impact his/her DNA methylation. Since the frontal cortex is involved in the regulation of cognitive function and is often affected in cases of cognitive decline, this study aimed to examine how chronic consumption of a WD affects DNA methylation in the frontal cortex of mice. Eight-week-old male mice were fed either a control diet (CD) or a WD for 12 weeks, after which time alterations in DNA methylation were analyzed. Assessment of global DNA methylation in the frontal cortex using dot blot analysis revealed that there was a decrease in global DNA methylation in the WD-fed mice compared with the CD-fed mice. Bioinformatic analysis identified several networks and pathways containing genes displaying differential methylation, particularly those involved in metabolism, cell adhesion and cytoskeleton integrity, inflammation and neurological function. In conclusion, the results from this study suggest that consumption of a WD alters DNA methylation in the frontal cortex of mice and could provide one of the mechanisms by which consumption of a WD impairs cognitive function.

  8. Evaluating genome-wide DNA methylation changes in mice by Methylation Specific Digital Karyotyping

    Directory of Open Access Journals (Sweden)

    Maruoka Shuichiro

    2008-12-01

    Full Text Available Abstract Background The study of genome-wide DNA methylation changes has become more accessible with the development of various array-based technologies though when studying species other than human the choice of applications are limited and not always within reach. In this study, we adapted and tested the applicability of Methylation Specific Digital Karyotyping (MSDK, a non-array based method, for the prospective analysis of epigenetic changes after perinatal nutritional modifications in a mouse model of allergic airway disease. MSDK is a sequenced based method that allows a comprehensive and unbiased methylation profiling. The method generates 21 base pairs long sequence tags derived from specific locations in the genome. The resulting tag frequencies determine in a quantitative manner the methylation level of the corresponding loci. Results Genomic DNA from whole lung was isolated and subjected to MSDK analysis using the methylation-sensitive enzyme Not I as the mapping enzyme and Nla III as the fragmenting enzyme. In a pair wise comparison of the generated mouse MSDK libraries we identified 158 loci that are significantly differentially methylated (P-value = 0.05 after perinatal dietary changes in our mouse model. Quantitative methylation specific PCR and sequence analysis of bisulfate modified genomic DNA confirmed changes in methylation at specific loci. Differences in genomic MSDK tag counts for a selected set of genes, correlated well with changes in transcription levels as measured by real-time PCR. Furthermore serial analysis of gene expression profiling demonstrated a dramatic difference in expressed transcripts in mice exposed to perinatal nutritional changes. Conclusion The genome-wide methylation survey applied in this study allowed for an unbiased methylation profiling revealing subtle changes in DNA methylation in mice maternally exposed to dietary changes in methyl-donor content. The MSDK method is applicable for mouse models

  9. DNA methylation polymorphism in flue-cured tobacco and candidate markers for tobacco mosaic virus resistance*

    Science.gov (United States)

    Zhao, Jie-hong; Zhang, Ji-shun; Wang, Yi; Wang, Ren-gang; Wu, Chun; Fan, Long-jiang; Ren, Xue-liang

    2011-01-01

    DNA methylation plays an important role in the epigenetic regulation of gene expression during plant growth, development, and polyploidization. However, there is still no distinct evidence in tobacco regarding the distribution of the methylation pattern and whether it contributes to qualitative characteristics. We studied the levels and patterns of methylation polymorphism at CCGG sites in 48 accessions of allotetraploid flue-cured tobacco, Nicotiana tabacum, using a methylation-sensitive amplified polymorphism (MSAP) technique. The results showed that methylation existed at a high level among tobacco accessions, among which 49.3% sites were methylated and 69.9% allelic sites were polymorphic. A cluster analysis revealed distinct patterns of geography-specific groups. In addition, three polymorphic sites significantly related to tobacco mosaic virus (TMV) resistance were explored. This suggests that tobacco breeders should pay more attention to epigenetic traits. PMID:22042659

  10. DNA methylation polymorphism in flue-cured tobacco and candidate markers for tobacco mosaic virus resistance.

    Science.gov (United States)

    Zhao, Jie-hong; Zhang, Ji-shun; Wang, Yi; Wang, Ren-gang; Wu, Chun; Fan, Long-jiang; Ren, Xue-liang

    2011-11-01

    DNA methylation plays an important role in the epigenetic regulation of gene expression during plant growth, development, and polyploidization. However, there is still no distinct evidence in tobacco regarding the distribution of the methylation pattern and whether it contributes to qualitative characteristics. We studied the levels and patterns of methylation polymorphism at CCGG sites in 48 accessions of allotetraploid flue-cured tobacco, Nicotiana tabacum, using a methylation-sensitive amplified polymorphism (MSAP) technique. The results showed that methylation existed at a high level among tobacco accessions, among which 49.3% sites were methylated and 69.9% allelic sites were polymorphic. A cluster analysis revealed distinct patterns of geography-specific groups. In addition, three polymorphic sites significantly related to tobacco mosaic virus (TMV) resistance were explored. This suggests that tobacco breeders should pay more attention to epigenetic traits.

  11. Microarray-based DNA methylation study of Ewing's sarcoma of the bone.

    Science.gov (United States)

    Park, Hye-Rim; Jung, Woon-Won; Kim, Hyun-Sook; Park, Yong-Koo

    2014-10-01

    Alterations in DNA methylation patterns are a hallmark of malignancy. However, the majority of epigenetic studies of Ewing's sarcoma have focused on the analysis of only a few candidate genes. Comprehensive studies are thus lacking and are required. The aim of the present study was to identify novel methylation markers in Ewing's sarcoma using microarray analysis. The current study reports the microarray-based DNA methylation study of 1,505 CpG sites of 807 cancer-related genes from 69 Ewing's sarcoma samples. The Illumina GoldenGate Methylation Cancer Panel I microarray was used, and with the appropriate controls (n=14), a total of 92 hypermethylated genes were identified in the Ewing's sarcoma samples. The majority of the hypermethylated genes were associated with cell adhesion, cell regulation, development and signal transduction. The overall methylation mean values were compared between patients who survived and those that did not. The overall methylation mean was significantly higher in the patients who did not survive (0.25±0.03) than in those who did (0.22±0.05) (P=0.0322). However, the overall methylation mean was not found to significantly correlate with age, gender or tumor location. GDF10 , OSM , APC and HOXA11 were the most significant differentially-methylated genes, however, their methylation levels were not found to significantly correlate with the survival rate. The DNA methylation profile of Ewing's sarcoma was characterized and 92 genes that were significantly hypermethylated were detected. A trend towards a more aggressive behavior was identified in the methylated group. The results of this study indicated that methylation may be significant in the development of Ewing's sarcoma.

  12. [Novel Approaches in DNA Methylation Studies - MS-HRM Analysis and Electrochemistry].

    Science.gov (United States)

    Bartošík, M; Ondroušková, E

    Cytosine methylation in DNA is an epigenetic mechanism regulating gene expression and plays a vital role in cell differentiation or proliferation. Tumor cells often exhibit aberrant DNA methylation, e.g. hypermethylation of tumor suppressor gene promoters. New methods, capable of determining methylation status of specific DNA sequences, are thus being developed. Among them, MS-HRM (methylation-specific high resolution melting) and electrochemistry offer relatively inexpensive instrumentation, fast assay times and possibility of screening multiple samples/DNA regions simultaneously. MS-HRM is due to its sensitivity and simplicity an interesting alternative to already established techniques, including methylation-specific PCR or bisulfite sequencing. Electrochemistry, when combined with suitable electroactive labels and electrode surfaces, has been applied in several unique strategies for discrimination of cytosines and methylcytosines. Both techniques were successfully tested in analysis of DNA methylation within promoters of important tumor suppressor genes and could thus help in achieving more precise diagnostics and prognostics of cancer. Aberrant methylation of promoters has already been described in hundreds of genes associated with tumorigenesis and could serve as important biomarker if new methods applicable into clinical practice are sufficiently advanced.Key words: DNA methylation - 5-methylcytosine - HRM analysis - melting temperature - DNA duplex - electrochemistry - nucleic acid hybridizationThis work was supported by MEYS - NPS I - LO1413.The authors declare they have no potential conflicts of interest concerning drugs, products, or services used in the study.The Editorial Board declares that the manuscript met the ICMJE recommendation for biomedical papers.Submitted: 6. 5. 2016Accepted: 16. 5. 2016.

  13. DNA methylation in inflammatory genes among children with obstructive sleep apnea.

    Science.gov (United States)

    Kim, Jinkwan; Bhattacharjee, Rakesh; Khalyfa, Abdelnaby; Kheirandish-Gozal, Leila; Capdevila, Oscar Sans; Wang, Yang; Gozal, David

    2012-02-01

    Pediatric obstructive sleep apnea (OSA) leads to multiple end-organ morbidities that are mediated by the cumulative burden of oxidative stress and inflammation. Because not all children with OSA exhibit increased systemic inflammation, genetic and environmental factors may be affecting patterns of DNA methylation in genes subserving inflammatory functions. DNA from matched children with OSA with and without high levels of high-sensitivity C-reactive protein (hsCRP) were assessed for DNA methylation levels of 24 inflammatory-related genes. Primer-based polymerase chain reaction assays in a case-control setting involving 47 OSA cases and 31 control subjects were conducted to confirm the findings; hsCRP and myeloid-related protein (MRP) 8/14 levels were also assayed. Forkhead box P3 (FOXP3) and interferon regulatory factor 1 (IRF1) showed higher methylation in six children with OSA and high hsCRP levels compared with matched children with OSA and low hsCRP levels (P DNA methylation levels compared with children with OSA and low CRP levels and control subjects. IRF1 did not exhibit significant differences. FOXP3 DNA methylation levels correlated with hsCRP and MRP 8/14 levels and with apnea-hypopnea index (AHI), BMI z score, and apolipoprotein B levels. A stepwise multiple regression model showed that AHI was independently associated with FOXP3 DNA methylation levels (P gene, which regulates expression of T regulatory lymphocytes, is more likely to display increased methylation among children with OSA who exhibit increased systemic inflammatory responses. Thus, epigenetic modifications may constitute an important determinant of inflammatory phenotype in OSA, and FOXP3 DNA methylation levels may provide a potential biomarker for end-organ vulnerability.

  14. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation.

    Science.gov (United States)

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-03-22

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

  15. DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA.

    Science.gov (United States)

    Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam

    2017-10-01

    In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Dynamic heterogeneity and DNA methylation in embryonic stem cells.

    KAUST Repository

    Singer, Zakary S

    2014-07-01

    Cell populations can be strikingly heterogeneous, composed of multiple cellular states, each exhibiting stochastic noise in its gene expression. A major challenge is to disentangle these two types of variability and to understand the dynamic processes and mechanisms that control them. Embryonic stem cells (ESCs) provide an ideal model system to address this issue because they exhibit heterogeneous and dynamic expression of functionally important regulatory factors. We analyzed gene expression in individual ESCs using single-molecule RNA-FISH and quantitative time-lapse movies. These data discriminated stochastic switching between two coherent (correlated) gene expression states and burst-like transcriptional noise. We further showed that the "2i" signaling pathway inhibitors modulate both types of variation. Finally, we found that DNA methylation plays a key role in maintaining these metastable states. Together, these results show how ESC gene expression states and dynamics arise from a combination of intrinsic noise, coherent cellular states, and epigenetic regulation.

  17. Heterogeneity of DNA methylation in multifocal prostate cancer.

    Science.gov (United States)

    Serenaite, Inga; Daniunaite, Kristina; Jankevicius, Feliksas; Laurinavicius, Arvydas; Petroska, Donatas; Lazutka, Juozas R; Jarmalaite, Sonata

    2015-01-01

    Most prostate cancer (PCa) cases are multifocal, and separate foci display histological and molecular heterogeneity. DNA hypermethylation is a frequent alteration in PCa, but interfocal heterogeneity of these changes has not been extensively investigated. Ten pairs of foci from multifocal PCa and 15 benign prostatic hyperplasia (BPH) samples were obtained from prostatectomy specimens, resulting altogether in 35 samples. Methylation-specific PCR (MSP) was used to evaluate methylation status of nine tumor suppressor genes (TSGs), and a set of selected TSGs was quantitatively analyzed for methylation intensity by pyrosequencing. Promoter sequences of the RASSF1 and ESR1 genes were methylated in all paired PCa foci, and frequent (≥75 %) DNA methylation was detected in RARB, GSTP1, and ABCB1 genes. MSP revealed different methylation status of at least one gene in separate foci in 8 out of 10 multifocal tumors. The mean methylation level of ESR1, GSTP1, RASSF1, and RARB differed between the paired foci of all PCa cases. The intensity of DNA methylation in these TSGs was significantly higher in PCa cases than in BPH (p epigenetic profile of recurrent tumors can be inferred from our data.

  18. A methionine-free diet associated with nitrosourea treatment down-regulates methylguanine-DNA methyl transferase activity in patients with metastatic cancer.

    Science.gov (United States)

    Thivat, Emilie; Durando, Xavier; Demidem, Aïcha; Farges, Marie-Chantal; Rapp, Maryse; Cellarier, Eric; Guenin, Samuel; D'Incan, Michel; Vasson, Marie-Paule; Chollet, Philippe

    2007-01-01

    Methionine (MET) depletion used in association with chemotherapy improves the therapeutic index in animal models. This potentiating effect may be due to tumor cell sensitization to chloroethylnitrosoureas through their MET dependency and the down-regulation of O6- methylguanine-DNA methyltransferase (MGMT). Our purpose was to evaluate the impact of the association of a dietary MET restriction with nitrosourea treatment on MGMT activity in peripheral blood mononuclear cells (PBMCs). Six patients with metastatic cancer (melanoma and glioma) received 4 cycles of a MET-free diet with cystemustine (60 mg/m2). MGMT activity in PBMCs decreased by an average of 13% from 553+/-90 fnol/mg before the diet to 413+/-59 fmol/mg after the diet + chemotherapy period (p=0.029). The decrease of MGMT activity was not affected by the duration of the MET-free diet period but seems to be correlated to the plasma MET depletion induced by the MET-free diet.

  19. Cord blood buffy coat DNA methylation is comparable to whole cord blood methylation.

    Science.gov (United States)

    Dou, John; Schmidt, Rebecca J; Benke, Kelly S; Newschaffer, Craig; Hertz-Picciotto, Irva; Croen, Lisa A; Iosif, Ana-Maria; LaSalle, Janine M; Fallin, M Daniele; Bakulski, Kelly M

    2018-01-01

    Cord blood DNA methylation is associated with numerous health outcomes and environmental exposures. Whole cord blood DNA reflects all nucleated blood cell types, while centrifuging whole blood separates red blood cells, generating a white blood cell buffy coat. Both sample types are used in DNA methylation studies. Cell types have unique methylation patterns and processing can impact cell distributions, which may influence comparability. We evaluated differences in cell composition and DNA methylation between cord blood buffy coat and whole cord blood samples. Cord blood DNA methylation was measured with the Infinium EPIC BeadChip (Illumina) in eight individuals, each contributing buffy coat and whole blood samples. We analyzed principal components (PC) of methylation, performed hierarchical clustering, and computed correlations of mean-centered methylation between pairs. We conducted moderated t-tests on single sites and estimated cell composition. DNA methylation PCs were associated with individual (P PC1 = 1.4 × 10 -9 ; P PC2 = 2.9 × 10 -5 ; P PC3 = 3.8 × 10 -5 ; P PC4 = 4.2 × 10 -6 ; P PC5 = 9.9 × 10 -13 , P PC6 = 1.3 × 10 -11 ) and not with sample type (P PC1-6 >0.7). Samples hierarchically clustered by individual. Pearson correlations of mean-centered methylation between paired samples ranged from r = 0.66 to r = 0.87. No individual site significantly differed between buffy coat and whole cord blood when adjusting for multiple comparisons (five sites had unadjusted Pcoat and whole cord blood are much lower than inter-individual variation, demonstrating that both sample preparation types can be analytically combined and compared.

  20. Quantitative analysis of DNA methylation in chronic lymphocytic leukemia patients.

    Science.gov (United States)

    Lyko, Frank; Stach, Dirk; Brenner, Axel; Stilgenbauer, Stephan; Döhner, Hartmut; Wirtz, Michaela; Wiessler, Manfred; Schmitz, Oliver J

    2004-06-01

    Changes in the genomic DNA methylation level have been found to be closely associated with tumorigenesis. In order to analyze the relation of aberrant DNA methylation to clinical and biological risk factors, we have determined the cytosine methylation level of 81 patients diagnosed with chronic lymphocytic leukemia (CLL). The analysis was based on DNA hydrolysis followed by derivatization of the 2'-desoxyribonucleoside-3'-monophosphates with BODIPY FL EDA. Derivatives were separated by micellar electrokinetic chromatography, and laser-induced fluorescence was used for detection. We analyzed potential correlations between DNA methylation levels and numerous patient parameters, including clinical observations and biological data. As a result, we observed a significant correlation with the immunoglobulin variable heavy chain gene (VH) mutation status. This factor has been repeatedly proposed as a reliable prognostic marker for CLL, which suggests that the methylation level might be a valuable factor in determining the prognostic outcome of CLL. We are now in the process of refining our method to broaden its application potential. In this context, we show here that the oxidation of the fluorescence marker in the samples and the evaporation of methanol in the electrolytes can be prevented by a film of paraffin oil. In summary, our results thus establish capillary electrophoresis as a valuable tool for analyzing the DNA methylation status of clinical samples.

  1. DNA methylation levels associated with race and childhood asthma severity.

    Science.gov (United States)

    Chan, Marcia A; Ciaccio, Christina E; Gigliotti, Nicole M; Rezaiekhaligh, Mo; Siedlik, Jacob A; Kennedy, Kevin; Barnes, Charles S

    2017-10-01

    Asthma is a common chronic childhood disease worldwide. Socioeconomic status, genetic predisposition and environmental factors contribute to its incidence and severity. A disproportionate number of children with asthma are economically disadvantaged and live in substandard housing with potential indoor environmental exposures such as cockroaches, dust mites, rodents and molds. These exposures may manifest through epigenetic mechanisms that can lead to changes in relevant gene expression. We examined the association of global DNA methylation levels with socioeconomic status, asthma severity and race/ethnicity. We measured global DNA methylation in peripheral blood of children with asthma enrolled in the Kansas City Safe and Healthy Homes Program. Inclusion criteria included residing in the same home for a minimum of 4 days per week and total family income of less than 80% of the Kansas City median family income. DNA methylation levels were quantified by an immunoassay that assessed the percentage of 5-methylcytosine. Our results indicate that overall, African American children had higher levels of global DNA methylation than children of other races/ethnicities (p = 0.029). This difference was more pronounced when socioeconomic status and asthma severity were coupled with race/ethnicity (p = 0.042) where low-income, African American children with persistent asthma had significantly elevated methylation levels relative to other races/ethnicities in the same context (p = 0.006, Hedges g = 1.14). Our study demonstrates a significant interaction effect among global DNA methylation levels, asthma severity, race/ethnicity, and socioeconomic status.

  2. The dynamics of DNA methylation and hydroxymethylation during amelogenesis.

    Science.gov (United States)

    Yoshioka, Hirotaka; Minamizaki, Tomoko; Yoshiko, Yuji

    2015-11-01

    Amelogenesis is a multistep process that relies on specific temporal and spatial signaling networks between the dental epithelium and mesenchymal tissues. Epigenetic modifications of key developmental genes in this process may be closely linked to a network of molecular events. However, the role of epigenetic regulation in amelogenesis remains unclear. Here, we have uncovered the spatial distributions of 5-methylcytosine (5-mC) and 5-hydroxymethylcytosine (5-hmC) to determine epigenetic events in the mandibular incisors of mice. Immunohistochemistry and dot blotting showed that 5-hmC in ameloblasts increased from the secretory stage to the later maturation stage. We also demonstrated the distribution of 5-mC-positive ameloblasts with punctate nuclear labeling from sometime after the initiation of the secretory stage to the later maturation stage; however, dot blotting failed to detect this change. No obvious alteration of 5-mC/5-hmC staining in odontoblasts and dental pulp cells was observed. Concomitant with quantitative expression data, immunohistochemistry showed that maintenance DNA methyltransferase DNMT1 was highly expressed in immature dental epithelial cells and subsequently decreased at later stages of development. Meanwhile, de novo DNA methyltransferase Dnmt3a and Dnmt3b and DNA demethylase Tet family genes were universally expressed, except Tet1 that was highly expressed in immature dental epithelial cells. Thus, DNMT1 may sustain the undifferentiated status of dental epithelial cells through the maintenance of DNA methylation, while the hydroxylation of 5-mC may occur through the whole differentiation process by TET activity. Taken together, these data indicate that the dynamic changes of 5-mC and 5-hmC may be critical for the regulation of amelogenesis.

  3. Effect of nickel chloride on Arabidopsis genomic DNA and methylation of 18S rDNA

    Directory of Open Access Journals (Sweden)

    Zhongai Li

    2015-01-01

    Conclusions: NiCl2 application caused variation of DNA methylation of the Arabidopsis genomic and offspring's. NiCl2 also resulted in nucleolar injury and deformity of root tip cells. The methylation rate of 18S rDNA also changed by adding NiCl2.

  4. DNA Methylation program in normal and alcohol-induced thinning cortex.

    Science.gov (United States)

    Öztürk, Nail Can; Resendiz, Marisol; Öztürk, Hakan; Zhou, Feng C

    2017-05-01

    While cerebral underdevelopment is a hallmark of fetal alcohol spectrum disorders (FASD), the mechanism(s) guiding the broad cortical neurodevelopmental deficits are not clear. DNA methylation is known to regulate early development and tissue specification through gene regulation. Here, we examined DNA methylation in the onset of alcohol-induced cortical thinning in a mouse model of FASD. C57BL/6 (B6) mice were administered a 4% alcohol (v/v) liquid diet from embryonic (E) days 7-16, and their embryos were harvested at E17, along with isocaloric liquid diet and lab chow controls. Cortical neuroanatomy, neural phenotypes, and epigenetic markers of methylation were assessed using immunohistochemistry, Western blot, and methyl-DNA assays. We report that cortical thickness, neuroepithelial proliferation, and neuronal migration and maturity were found to be deterred by alcohol at E17. Simultaneously, DNA methylation, including 5-methylcytosine (5mC) and 5-hydroxcylmethylcytosine (5hmC), which progresses as an intrinsic program guiding normal embryonic cortical development, was severely affected by in utero alcohol exposure. The intricate relationship between cortical thinning and this DNA methylation program disruption is detailed and illustrated. DNA methylation, dynamic across the multiple cortical layers during the late embryonic stage, is highly disrupted by fetal alcohol exposure; this disruption occurs in tandem with characteristic developmental abnormalities, ranging from structural to molecular. Finally, our findings point to a significant question for future exploration: whether epigenetics guides neurodevelopment or whether developmental conditions dictate epigenetic dynamics in the context of alcohol-induced cortical teratogenesis. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Maternal Methyl-Group Donor Intake and Global DNA (HydroxyMethylation before and during Pregnancy

    Directory of Open Access Journals (Sweden)

    Sara Pauwels

    2016-08-01

    Full Text Available It is still unclear to which extent methyl-group intake during pregnancy can affect maternal global DNA (hydroxylmethylation. Pregnancy methylation profiling and its link with methyl-group intake in a healthy population could enhance our understanding of the development of pregnancy related disorders. One hundred forty-eight women were enrolled in the MANOE (MAternal Nutrition and Offspring’s Epigenome study. Thiry-four women were enrolled before pregnancy and 116 during the first trimester of pregnancy. Global DNA (hydroxymethylation in blood using LC-MS/MS and dietary methyl-group intake (methionine, folate, betaine, and choline using a food-frequency questionnaire were estimated pre-pregnancy, during each trimester, and at delivery. Global DNA (hydroxymethylation levels were highest pre-pregnancy and at weeks 18–22 of pregnancy. We observed a positive relation between folic acid and global DNA methylation (p = 0.04 and hydroxymethylation (p = 0.04. A high intake of methionine pre-pregnancy and in the first trimester showed lower (hydroxymethylation percentage in weeks 11–13 and weeks 18–22, respectively. Choline and betaine intake in the first weeks was negatively associated with hydroxymethylation. Women with a high intake of these three methyl groups in the second and third trimester showed higher hyrdoxymethylation/methylation levels in the third trimester. To conclude, a time trend in DNA (hydroxymethylation was found and women with higher methyl-group intake showed higher methylation in the third trimester, and not in earlier phases of pregnancy.

  6. DNA Methylation Alterations in Breast Cancer

    National Research Council Canada - National Science Library

    Yamamoto, Fumiichiro

    2002-01-01

    We have performed the NotI-MseI MS-AFLP experiments using normal and tumor DNA from breast cancer patients and determined the identity of bands exhibiting consistent changes in breast cancer DNA fingerprint...

  7. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    Science.gov (United States)

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  8. The role of DNA methylation in Obesity and Diabetes

    OpenAIRE

    ISHANT KHURANA

    2018-01-01

    A significant proportion of human disease causality remains unexplained. It is increasingly becoming clear that Epigenetics is a key contributor to many diseases, including cardiovascular diseases, atherosclerosis and diabetes. Epigenetics refers to the external modification to DNA that turn genes “ON” and “OFF”. These modifications do not change the DNA sequence, but instead, they effect cells ability to “read” genes. This thesis investigates the role of DNA methylation in Obesity and Diabet...

  9. The effects of reciprocal cross on inheritance of DNA methylation in ...

    African Journals Online (AJOL)

    enoh

    2012-03-20

    Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).

  10. Characterization and functional inferences of a genome-wide DNA methylation profile in the loin ( muscle of swine

    Directory of Open Access Journals (Sweden)

    Woonsu Kim

    2018-01-01

    Full Text Available Objective DNA methylation plays a major role in regulating the expression of genes related to traits of economic interest (e.g., weight gain in livestock animals. This study characterized and investigated the functional inferences of genome-wide DNA methylome in the loin (longissimus dorsi muscle (LDM of swine. Methods A total of 8.99 Gb methylated DNA immunoprecipitation sequence data were obtained from LDM samples of eight Duroc pigs (four pairs of littermates. The reference pig genome was annotated with 78.5% of the raw reads. A total of 33,506 putative methylated regions (PMR were identified from methylated regions that overlapped at least two samples. Results Of these, only 3.1% were commonly observed in all eight samples. DNA methylation patterns between two littermates were as diverse as between unrelated individuals (p = 0.47, indicating that maternal genetic effects have little influence on the variation in DNA methylation of porcine LDM. The highest density of PMR was observed on chromosome 10. A major proportion (47.7% of PMR was present in the repeat regions, followed by introns (21.5%. The highest conservation of PMR was found in CpG islands (12.1%. These results show an important role for DNA methylation in species- and tissue-specific regulation of gene expression. PMR were also significantly related to muscular cell development, cell-cell communication, cellular integrity and transport, and nutrient metabolism. Conclusion This study indicated the biased distribution and functional role of DNA methylation in gene expression of porcine LDM. DNA methylation was related to cell development, cell-cell communication, cellular integrity and transport, and nutrient metabolism (e.g., insulin signaling pathways. Nutritional and environmental management may have a significant impact on the variation in DNA methylation of porcine LDM.

  11. Global DNA methylation responses to low dose radiation exposure

    International Nuclear Information System (INIS)

    Newman, M.R.; Ormsby, R.J.; Blyth, B.J.; Sykes, P.J.; Bezak, E.

    2011-01-01

    Full text: High radiation doses cause breaks in the DNA which are considered the critical lesions in initiation of radiation-induced cancer. However, at very low radiation doses relevant for the general public, the induction of such breaks will be rare, and other changes to the DNA such as DNA methylation which affects gene expression may playa role in radiation responses. We are studying global DNA methylation after low dose radiation exposure to determine if low dose radiation has short- and/or long-term effects on chromatin structure. We developed a sensitive high resolution melt assay to measure the levels of DNA methylation across the mouse genome by analysing a stretch of DNA sequence within Long Interspersed Nuclear Elements-I (LINE I) that comprise a very large proportion of the mouse and human genomes. Our initial results suggest no significant short-term or longterm) changes in global NA methylation after low dose whole-body X-radiation of 10 J1Gyor 10 mGy, with a significant transient increase in NA methylation observed I day after a high dose of I Gy. If the low radiation doses tested are inducing changes in bal DNA methylation, these would appear to be smaller than the variation observed between the sexes and following the general stress of the sham-irradiation procedure itself. This research was funded by the Low Dose Radiation Research Program, Biological and Environmental Research, US DOE, Grant DE-FG02-05ER64104 and MN is the recipient of the FMCF/BHP Dose Radiation Research Scholarship.

  12. DNA methylation, microRNAs, and their crosstalk as potential biomarkers in hepatocellular carcinoma

    Science.gov (United States)

    Anwar, Sumadi Lukman; Lehmann, Ulrich

    2014-01-01

    Epigenetic alterations have been identified as a major characteristic in human cancers. Advances in the field of epigenetics have contributed significantly in refining our knowledge of molecular mechanisms underlying malignant transformation. DNA methylation and microRNA expression are epigenetic mechanisms that are widely altered in human cancers including hepatocellular carcinoma (HCC), the third leading cause of cancer related mortality worldwide. Both DNA methylation and microRNA expression patterns are regulated in developmental stage specific-, cell type specific- and tissue-specific manner. The aberrations are inferred in the maintenance of cancer stem cells and in clonal cell evolution during carcinogenesis. The availability of genome-wide technologies for DNA methylation and microRNA profiling has revolutionized the field of epigenetics and led to the discovery of a number of epigenetically silenced microRNAs in cancerous cells and primary tissues. Dysregulation of these microRNAs affects several key signalling pathways in hepatocarcinogenesis suggesting that modulation of DNA methylation and/or microRNA expression can serve as new therapeutic targets for HCC. Accumulative evidence shows that aberrant DNA methylation of certain microRNA genes is an event specifically found in HCC which correlates with unfavorable outcomes. Therefore, it can potentially serve as a biomarker for detection as well as for prognosis, monitoring and predicting therapeutic responses in HCC. PMID:24976726

  13. Lung function discordance in monozygotic twins and associated differences in blood DNA methylation

    DEFF Research Database (Denmark)

    Bolund, Anneli C S; Starnawska, Anna; Miller, Martin R

    2017-01-01

    Background: Lung function is an important predictor of morbidity and mortality, with accelerated lung function decline reported to have immense consequences for the world's healthcare systems. The lung function decline across individual's lifetime is a consequence of age-related changes in lung...... as TGF-β-receptor-related genes, may be involved in the cross-sectional level and longitudinal change in lung function in middle-aged monozygotic twins....... and genetic factors. DNA methylation plays a crucial role in regulation of gene expression, with increasing evidence linking aberrant DNA methylation levels with a number of common human diseases. In this study, we investigated possible associations between genome-wide DNA methylation levels and lung function...

  14. PPARGC1A DNA methylation in subcutaneous adipose tissue in low birth weight subjects

    DEFF Research Database (Denmark)

    Gillberg, Linn; Jacobsen, Stine; Rönn, Tina

    2014-01-01

    OBJECTIVE: Increased DNA methylation of the metabolic regulator peroxisome proliferator-activated receptor gamma coactivator 1 alpha (PPARGC1A) has been reported in skeletal muscle from type 2 diabetes (T2D) subjects and from low birth weight (LBW) subjects with an increased risk of T2D. High...... and insulin-stimulated SAT from LBW and matched normal birth weight (NBW) subjects during control and high-fat overfeeding. MATERIALS/METHODS: Nineteen young healthy men with LBW and 26 NBW controls were studied after both a 5-day high-fat overfeeding and a control diet in a randomized crossover setting. DNA...... methylation was assessed with bisulfite sequencing and mRNA expression with quantitative real-time PCR. RESULTS: Following high-fat overfeeding, increased SAT PPARGC1A DNA methylation was observed in LBW subjects but not in NBW controls. Basal SAT PPARGC1A mRNA expression was unaffected by diet and similar...

  15. Aberrantly methylated DNA as a biomarker in breast cancer.

    Science.gov (United States)

    Kristiansen, Søren; Jørgensen, Lars M; Guldberg, Per; Sölétormos, György

    2013-01-01

    Aberrant DNA hypermethylation at gene promoters is a frequent event in human breast cancer. Recent genome-wide studies have identified hundreds of genes that exhibit differential methylation between breast cancer cells and normal breast tissue. Due to the tumor-specific nature of DNA hypermethylation events, their use as tumor biomarkers is usually not hampered by analytical signals from normal cells, which is a general problem for existing protein tumor markers used for clinical assessment of breast cancer. There is accumulating evidence that DNA-methylation changes in breast cancer patients occur early during tumorigenesis. This may open up for effective screening, and analysis of blood or nipple aspirate may later help in diagnosing breast cancer. As a more detailed molecular characterization of different types of breast cancer becomes available, the ability to divide patients into subgroups based on DNA biomarkers may improve prognosis. Serial monitoring of DNA-methylation markers in blood during treatment may be useful, particularly when the cancer burden is below the detection level for standard imaging techniques. Overall, aberrant DNA methylation has a great potential as a versatile biomarker tool for screening, diagnosis, prognosis and monitoring of breast cancer. Standardization of methods and biomarker panels will be required to fully exploit this clinical potential.

  16. Diagnostic markers of urothelial cancer based on DNA methylation analysis

    International Nuclear Information System (INIS)

    Chihara, Yoshitomo; Hirao, Yoshihiko; Kanai, Yae; Fujimoto, Hiroyuki; Sugano, Kokichi; Kawashima, Kiyotaka; Liang, Gangning; Jones, Peter A; Fujimoto, Kiyohide; Kuniyasu, Hiroki

    2013-01-01

    Early detection and risk assessment are crucial for treating urothelial cancer (UC), which is characterized by a high recurrence rate, and necessitates frequent and invasive monitoring. We aimed to establish diagnostic markers for UC based on DNA methylation. In this multi-center study, three independent sample sets were prepared. First, DNA methylation levels at CpG loci were measured in the training sets (tumor samples from 91 UC patients, corresponding normal-appearing tissue from these patients, and 12 normal tissues from age-matched bladder cancer-free patients) using the Illumina Golden Gate methylation assay to identify differentially methylated loci. Next, these methylated loci were validated by quantitative DNA methylation by pyrosequencing, using another cohort of tissue samples (Tissue validation set). Lastly, methylation of these markers was analyzed in the independent urine samples (Urine validation set). ROC analysis was performed to evaluate the diagnostic accuracy of these 12 selected markers. Of the 1303 CpG sites, 158 were hyper ethylated and 356 were hypo ethylated in tumor tissues compared to normal tissues. In the panel analysis, 12 loci showed remarkable alterations between tumor and normal samples, with 94.3% sensitivity and 97.8% specificity. Similarly, corresponding normal tissue could be distinguished from normal tissues with 76.0% sensitivity and 100% specificity. Furthermore, the diagnostic accuracy for UC of these markers determined in urine samples was high, with 100% sensitivity and 100% specificity. Based on these preliminary findings, diagnostic markers based on differential DNA methylation at specific loci can be useful for non-invasive and reliable detection of UC and epigenetic field defect

  17. Effects of temperature and relative humidity on DNA methylation.

    Science.gov (United States)

    Bind, Marie-Abele; Zanobetti, Antonella; Gasparrini, Antonio; Peters, Annette; Coull, Brent; Baccarelli, Andrea; Tarantini, Letizia; Koutrakis, Petros; Vokonas, Pantel; Schwartz, Joel

    2014-07-01

    Previous studies have found relationships between DNA methylation and various environmental contaminant exposures. Associations with weather have not been examined. Because temperature and humidity are related to mortality even on non-extreme days, we hypothesized that temperature and relative humidity may affect methylation. We repeatedly measured methylation on long interspersed nuclear elements (LINE-1), Alu, and 9 candidate genes in blood samples from 777 elderly men participating in the Normative Aging Study (1999-2009). We assessed whether ambient temperature and relative humidity are related to methylation on LINE-1 and Alu, as well as on genes controlling coagulation, inflammation, cortisol, DNA repair, and metabolic pathway. We examined intermediate-term associations of temperature, relative humidity, and their interaction with methylation, using distributed lag models. Temperature or relative humidity levels were associated with methylation on tissue factor (F3), intercellular adhesion molecule 1 (ICAM-1), toll-like receptor 2 (TRL-2), carnitine O-acetyltransferase (CRAT), interferon gamma (IFN-γ), inducible nitric oxide synthase (iNOS), and glucocorticoid receptor, LINE-1, and Alu. For instance, a 5°C increase in 3-week average temperature in ICAM-1 methylation was associated with a 9% increase (95% confidence interval: 3% to 15%), whereas a 10% increase in 3-week average relative humidity was associated with a 5% decrease (-8% to -1%). The relative humidity association with ICAM-1 methylation was stronger on hot days than mild days. DNA methylation in blood cells may reflect biological effects of temperature and relative humidity. Temperature and relative humidity may also interact to produce stronger effects.

  18. ROLE OF DNA METHYLATION AS A DIAGNOSTIC BIOMARKER OF SPORADIC BREAST CANCER

    Directory of Open Access Journals (Sweden)

    Wirsma Arif Harahap

    2017-02-01

    Full Text Available The initiation and progression of breast cancer have been recognized for many years to be secondary to the accumulation of genetic mutations which lead to aberrant cellular function. Genetic mutations, either inherited or sporadic, may result in the activation of oncogenes and the inactivation of tumor suppressor genes. The more recent discovery that reversible alterations in histone proteins and deoxyribonucleic acid (DNA can also lead to tumorigenesis has introduced a novel term to the field of cancer research: epigenetics.  Epigenetics refers to the study of heritable changes in gene regulation that do not involve a change in the DNA sequence. The most often studied in epigenetics of breast cancer is DNA methylation. That a promoter methylation result in transcription blockade supports the notion that cellular inhibition takes place. Compared to normal tissues, hypermethylation occurs from double to triple in cancerous ones. DNA methylation plays a crucial role in oncogenesis and is one of the hallmarks of cancer. Detection of aberrantly methylated CpG islands in promoter region of several genes in DNA sample derived from nipple aspirates, serum, or cancer tissue associated with down regulation of expression or loss of function of these genes has been associated with early stages of breast cancer, where  hypermethylation of CpG island points to poorer prognosis in breast cancer.  DNA methylation has been identified as signature for TNBC. Methylation of BRCA1 gene is frequently demonstrated in young, estrogen receptor-negative breast cancer patients. Methylation of specific genes is known to differ across race and socioeconomic status. BRCA1 methylation in premenopausal women with sporadic breast cancer in West Sumatra region has been higher than in Western women. DNA methylation may be used to enhance current breast cancer classification. There is such a distinction between methylation and gene expression profiles of breast cancer that not

  19. Chromosome-wide mapping of DNA methylation patterns in normal and malignant prostate cells reveals pervasive methylation of gene-associated and conserved intergenic sequences

    Directory of Open Access Journals (Sweden)

    De Marzo Angelo M

    2011-06-01

    Full Text Available Abstract Background DNA methylation has been linked to genome regulation and dysregulation in health and disease respectively, and methods for characterizing genomic DNA methylation patterns are rapidly emerging. We have developed/refined methods for enrichment of methylated genomic fragments using the methyl-binding domain of the human MBD2 protein (MBD2-MBD followed by analysis with high-density tiling microarrays. This MBD-chip approach was used to characterize DNA methylation patterns across all non-repetitive sequences of human chromosomes 21 and 22 at high-resolution in normal and malignant prostate cells. Results Examining this data using computational methods that were designed specifically for DNA methylation tiling array data revealed widespread methylation of both gene promoter and non-promoter regions in cancer and normal cells. In addition to identifying several novel cancer hypermethylated 5' gene upstream regions that mediated epigenetic gene silencing, we also found several hypermethylated 3' gene downstream, intragenic and intergenic regions. The hypermethylated intragenic regions were highly enriched for overlap with intron-exon boundaries, suggesting a possible role in regulation of alternative transcriptional start sites, exon usage and/or splicing. The hypermethylated intergenic regions showed significant enrichment for conservation across vertebrate species. A sampling of these newly identified promoter (ADAMTS1 and SCARF2 genes and non-promoter (downstream or within DSCR9, C21orf57 and HLCS genes hypermethylated regions were effective in distinguishing malignant from normal prostate tissues and/or cell lines. Conclusions Comparison of chromosome-wide DNA methylation patterns in normal and malignant prostate cells revealed significant methylation of gene-proximal and conserved intergenic sequences. Such analyses can be easily extended for genome-wide methylation analysis in health and disease.

  20. DNA Methylation as a Biomarker for Body Fluid Identification

    Directory of Open Access Journals (Sweden)

    Rania Gomaa

    2017-12-01

    Full Text Available Currently, available identification techniques for forensic samples are either enzyme or protein based, which can be subjected to degradation, thus limiting its storage potentials. Epigenetic changes arising due to DNA methylation and histone acetylation can be used for body fluid identification. Markers DACT1, USP49, ZC3H12D, FGF7, cg23521140, cg17610929, chromosome 4 (25287119–25287254, chromosome 11 (72085678–72085798, 57171095–57171236, 1493401–1493538, and chromosome 19 (47395505–47395651 are currently being used for semen identification. Markers cg26107890, cg20691722, cg01774894 and cg14991487 are used to differentiate saliva and vaginal secretions from other body fluids. However, such markers show overlapping methylation pattern. This review article aimed to highlight the feasibility of using DNA methylation of certain genetic markers in body fluid identification and its implications for forensic investigations. The reviewed articles have employed molecular genetics techniques such as Bisulfite sequencing PCR (BSP, methylation specific PCR (MSP, Pyrosequencing, Combined Bisulfite Restriction Analysis (COBRA, Methylation-sensitive Single Nucleotide Primer Extension (SNuPE, and Multiplex SNaPshot Microarray. Bioinformatics software such as MATLAB and BiQ Analyzer has been used. Biological fluids have different methylation patterns and thus, this difference can be used to identify the nature of the biological fluid found at the crime scene. Using DNA methylation to identify the body fluids gives accurate results without consumption of the trace evidence and requires a minute amount of DNA for analysis. Recent studies have incorporated next-generation sequencing aiming to find out more reliable markers that can differentiate between different body fluids. Nonetheless, new DNA methylation markers are yet to be discovered to accurately differentiate between saliva and vaginal secretions with high confidence. Epigenetic changes are

  1. Differential DNA Methylation Analysis without a Reference Genome

    Directory of Open Access Journals (Sweden)

    Johanna Klughammer

    2015-12-01

    Full Text Available Genome-wide DNA methylation mapping uncovers epigenetic changes associated with animal development, environmental adaptation, and species evolution. To address the lack of high-throughput methods for DNA methylation analysis in non-model organisms, we developed an integrated approach for studying DNA methylation differences independent of a reference genome. Experimentally, our method relies on an optimized 96-well protocol for reduced representation bisulfite sequencing (RRBS, which we have validated in nine species (human, mouse, rat, cow, dog, chicken, carp, sea bass, and zebrafish. Bioinformatically, we developed the RefFreeDMA software to deduce ad hoc genomes directly from RRBS reads and to pinpoint differentially methylated regions between samples or groups of individuals (http://RefFreeDMA.computational-epigenetics.org. The identified regions are interpreted using motif enrichment analysis and/or cross-mapping to annotated genomes. We validated our method by reference-free analysis of cell-type-specific DNA methylation in the blood of human, cow, and carp. In summary, we present a cost-effective method for epigenome analysis in ecology and evolution, which enables epigenome-wide association studies in natural populations and species without a reference genome.

  2. Quantitative DNA methylation analyses reveal stage dependent DNA methylation and association to clinico-pathological factors in breast tumors

    International Nuclear Information System (INIS)

    Klajic, Jovana; Tost, Jörg; Kristensen, Vessela N; Fleischer, Thomas; Dejeux, Emelyne; Edvardsen, Hege; Warnberg, Fredrik; Bukholm, Ida; Lønning, Per Eystein; Solvang, Hiroko; Børresen-Dale, Anne-Lise

    2013-01-01

    Aberrant DNA methylation of regulatory genes has frequently been found in human breast cancers and correlated to clinical outcome. In the present study we investigate stage specific changes in the DNA methylation patterns in order to identify valuable markers to understand how these changes affect breast cancer progression. Quantitative DNA methylation analyses of 12 candidate genes ABCB1, BRCCA1, CDKN2A, ESR1, GSTP1, IGF2, MGMT, HMLH1, PPP2R2B, PTEN, RASSF1A and FOXC1 was performed by pyrosequencing a series of 238 breast cancer tissue samples from DCIS to invasive tumors stage I to IV. Significant differences in methylation levels between the DCIS and invasive stage II tumors were observed for six genes RASSF1A, CDKN2A, MGMT, ABCB1, GSTP1 and FOXC1. RASSF1A, ABCB1 and GSTP1 showed significantly higher methylation levels in late stage compared to the early stage breast carcinoma. Z-score analysis revealed significantly lower methylation levels in DCIS and stage I tumors compared with stage II, III and IV tumors. Methylation levels of PTEN, PPP2R2B, FOXC1, ABCB1 and BRCA1 were lower in tumors harboring TP53 mutations then in tumors with wild type TP53. Z-score analysis showed that TP53 mutated tumors had significantly lower overall methylation levels compared to tumors with wild type TP53. Methylation levels of RASSF1A, PPP2R2B, GSTP1 and FOXC1 were higher in ER positive vs. ER negative tumors and methylation levels of PTEN and CDKN2A were higher in HER2 positive vs. HER2 negative tumors. Z-score analysis also showed that HER2 positive tumors had significantly higher z-scores of methylation compared to the HER2 negative tumors. Univariate survival analysis identifies methylation status of PPP2R2B as significant predictor of overall survival and breast cancer specific survival. In the present study we report that the level of aberrant DNA methylation is higher in late stage compared with early stage of invasive breast cancers and DCIS for genes mentioned above

  3. Genome-wide Differences in DNA Methylation Changes in Two Contrasting Rice Genotypes in Response to Drought Conditions

    Directory of Open Access Journals (Sweden)

    Wensheng Wang

    2016-11-01

    Full Text Available Differences in drought stress tolerance within diverse rice genotypes have been attributed to genetic diversity and epigenetic alterations. DNA methylation is an important epigenetic modification that influences diverse biological processes, but its effects on rice drought stress tolerance are poorly understood. In this study, methylated DNA immunoprecipitation sequencing and an Affymetrix GeneChip rice genome array were used to profile the DNA methylation patterns and transcriptomes of the drought-tolerant introgression line DK151 and its drought-sensitive recurrent parent IR64 under drought and control conditions. The introgression of donor genomic DNA induced genome-wide DNA methylation changes in DK151 plants. A total of 1190 differentially methylated regions (DMRs were detected between the two genotypes under normal growth conditions, and the DMR-associated genes in DK151 plants were mainly related to stress response, programmed cell death, and nutrient reservoir activity, which are implicated to constitutive drought stress tolerance. A comparison of the DNA methylation changes in the two genotypes under drought conditions indicated that DK151 plants have a more stable methylome, with only 92 drought-induced DMRs, than IR64 plants with 506 DMRs. Gene ontology analyses of the DMR-associated genes in drought-stressed plants revealed that changes to the DNA methylation status of genotype-specific genes are associated with the epigenetic regulation of drought stress responses. Transcriptome analysis further helped to identify a set of 12 and 23 DMR-associated genes that were differentially expressed in DK151 and IR64, respectively, under drought stress compared with respective controls. Correlation analysis indicated that DNA methylation has various effects on gene expression, implying that it affects gene expression directly or indirectly through diverse regulatory pathways. Our results indicate that drought-induced alterations to DNA

  4. A genome-wide study of DNA methylation patterns and gene expression levels in multiple human and chimpanzee tissues.

    Directory of Open Access Journals (Sweden)

    Athma A Pai

    2011-02-01

    Full Text Available The modification of DNA by methylation is an important epigenetic mechanism that affects the spatial and temporal regulation of gene expression. Methylation patterns have been described in many contexts within and across a range of species. However, the extent to which changes in methylation might underlie inter-species differences in gene regulation, in particular between humans and other primates, has not yet been studied. To this end, we studied DNA methylation patterns in livers, hearts, and kidneys from multiple humans and chimpanzees, using tissue samples for which genome-wide gene expression data were also available. Using the multi-species gene expression and methylation data for 7,723 genes, we were able to study the role of promoter DNA methylation in the evolution of gene regulation across tissues and species. We found that inter-tissue methylation patterns are often conserved between humans and chimpanzees. However, we also found a large number of gene expression differences between species that might be explained, at least in part, by corresponding differences in methylation levels. In particular, we estimate that, in the tissues we studied, inter-species differences in promoter methylation might underlie as much as 12%-18% of differences in gene expression levels between humans and chimpanzees.

  5. DNA methylation in the APOE genomic region is associated with cognitive function in African Americans.

    Science.gov (United States)

    Liu, Jiaxuan; Zhao, Wei; Ware, Erin B; Turner, Stephen T; Mosley, Thomas H; Smith, Jennifer A

    2018-05-08

    Genetic variations in apolipoprotein E (APOE) and proximal genes (PVRL2, TOMM40, and APOC1) are associated with cognitive function and dementia, particularly Alzheimer's disease. Epigenetic mechanisms such as DNA methylation play a central role in the regulation of gene expression. Recent studies have found evidence that DNA methylation may contribute to the pathogenesis of dementia, but its association with cognitive function in populations without dementia remains unclear. We assessed DNA methylation levels of 48 CpG sites in the APOE genomic region in peripheral blood leukocytes collected from 289 African Americans (mean age = 67 years) from the Genetic Epidemiology Network of Arteriopathy (GENOA) study. Using linear regression, we examined the relationship between methylation in the APOE genomic region and multiple cognitive measures including learning, memory, processing speed, concentration, language and global cognitive function. We identified eight CpG sites in three genes (PVRL2, TOMM40, and APOE) that showed an inverse association between methylation level and delayed recall, a measure of memory, after adjusting for age and sex (False Discovery Rate q-value accounting for known genetic predictors for cognition. Our findings highlight the important role of epigenetic mechanisms in influencing cognitive performance, and suggest that changes in blood methylation may be an early indicator of individuals at risk for dementia as well as potential targets for intervention in asymptomatic populations.

  6. DNA Methylation Pattern in Overweight Women under an Energy-Restricted Diet Supplemented with Fish Oil

    Directory of Open Access Journals (Sweden)

    Cátia Lira do Amaral

    2014-01-01

    Full Text Available Dietary factors modulate gene expression and are able to alter epigenetic signatures in peripheral blood mononuclear cells (PBMC. However, there are limited studies about the effects of omega-3 polyunsaturated fatty acids (n-3 PUFA on the epigenetic mechanisms that regulate gene expression. This research investigates the effects of n-3-rich fish oil supplementation on DNA methylation profile of several genes whose expression has been reported to be downregulated by n-3 PUFA in PBMC: CD36, FFAR3, CD14, PDK4, and FADS1. Young overweight women were supplemented with fish oil or control in a randomized 8-week intervention trial following a balanced diet with 30% energy restriction. Fatty acid receptor CD36 decreased DNA methylation at CpG +477 due to energy restriction. Hypocaloric diet-induced weight loss also reduced the methylation percentages of CpG sites located in CD14, PDK4, and FADS1. The methylation patterns of these genes were only slightly affected by the fish oil supplementation, being the most relevant to the attenuation of the weight loss-induced decrease in CD36 methylation after adjusting by baseline body weight. These results suggest that the n-3 PUFA-induced changes in the expression of these genes in PBMC are not mediated by DNA methylation, although other epigenetic mechanisms cannot be discarded.

  7. Obesity-related DNA methylation at imprinted genes in human sperm: Results from the TIEGER study.

    Science.gov (United States)

    Soubry, Adelheid; Guo, Lisa; Huang, Zhiqing; Hoyo, Cathrine; Romanus, Stephanie; Price, Thomas; Murphy, Susan K

    2016-01-01

    Epigenetic reprogramming in mammalian gametes resets methylation marks that regulate monoallelic expression of imprinted genes. In males, this involves erasure of the maternal methylation marks and establishment of paternal-specific methylation to appropriately guide normal development. The degree to which exogenous factors influence the fidelity of methylation reprogramming is unknown. We previously found an association between paternal obesity and altered DNA methylation in umbilical cord blood, suggesting that the father's endocrine, nutritional, or lifestyle status could potentiate intergenerational heritable epigenetic abnormalities. In these analyses, we examine the relationship between male overweight/obesity and DNA methylation status of imprinted gene regulatory regions in the gametes. Linear regression models were used to compare sperm DNA methylation percentages, quantified by bisulfite pyrosequencing, at 12 differentially methylated regions (DMRs) from 23 overweight/obese and 44 normal weight men. Our study population included 69 volunteers from The Influence of the Environment on Gametic Epigenetic Reprogramming (TIEGER) study, based in NC, USA. After adjusting for age and fertility patient status, semen from overweight or obese men had significantly lower methylation percentages at the MEG3 (β = -1.99; SE = 0.84; p = 0.02), NDN (β = -1.10; SE = 0.47; p = 0.02), SNRPN (β = -0.65; SE = 0.27; p = 0.02), and SGCE/PEG10 (β = -2.5; SE = 1.01; p = 0.01) DMRs. Our data further suggest a slight increase in DNA methylation at the MEG3-IG DMR (β = +1.22; SE = 0.59; p = 0.04) and H19 DMR (β = +1.37; SE = 0.62; p = 0.03) in sperm of overweight/obese men. Our data support that male overweight/obesity status is traceable in the sperm epigenome. Further research is needed to understand the effect of such changes and the point of origin of DNA methylation differences between lean and

  8. Complementary specificity of restriction endonucleases of Diplococcus pneumoniae with respect to DNA methylation. [Haemophilus influenzae, Escherichia coli, Paramecium aurelia

    Energy Technology Data Exchange (ETDEWEB)

    Lacks, S.; Greenberg, B.

    1977-01-01

    Restriction endonucleases Dpn I and Dpn II are produced by two distinct strains of Diplococcus pneumoniae. The two enzymes show complementary specificity with respect to methylation of sites in DNA. From the identity of its cleavage site with that of Mbo I, it appears that Dpn II cleaves at the unmodified sequence 5'-G-A-T-C-3'. Dpn I cleaves at the same sequence when the adenine residue is methylated. Both enzymes produce only double-strand breaks in susceptible DNA. Their susceptibility to Dpn I and not Dpn II shows that essentially all the G-A-T-C sequences are methylated in DNA from the pneumococcal strain that produces Dpn II as well as in DNA from Hemophilus influenzae and Escherichia coli. In the dam-3 mutant of E. coli none of these sequences appear to be methylated. Residual adenine methylation in the dam-3 mutant DNA most likely occurs at different sites. Different but characteristic degrees of methylation at G-A-T-C sites are found in the DNA of bacterial viruses grown in E. coli. DNAs from mammalian cells and viruses are not methylated at this sequence. Mitochondrial DNA from Paramecium aurelia is not methylated, but a small proportion of G-A-T-C sequences in the macronuclear DNA of this eukaryote appear to be methylated. Possible roles of sequence-specific methylation in the accommodation of plasmids, in the replication of DNA, in the regulation of gene function and in the restriction of viral infection are discussed.

  9. Methylated DNA for monitoring tumor growth and regression

    DEFF Research Database (Denmark)

    Kristiansen, Søren; Nielsen, Dorte; Söletormos, Georg

    2014-01-01

    Abstract A wide range of protein cancer biomarkers is currently recommended in international guidelines for monitoring the growth and regression of solid tumors. However, a number of these markers are also present in low concentrations in blood obtained from healthy individuals and from patients...... of gene promoters. Because tumor cells naturally secrete DNA and upon cell death leak DNA, modified methylated DNA can be detected in blood, urine, sputum and other body fluids. At present international guidelines do not include recommendations for monitoring modified methylated DNA. The low level...... of evidence can partly be explained by incomplete collection of serial blood samples, by analytical challenges, and by lack of knowledge of how monitoring studies should be designed and how serial marker data obtained from individual patients should be interpreted. Here, we review the clinical validity...

  10. Dynamics of DNA methylation in recent human and great ape evolution.

    Directory of Open Access Journals (Sweden)

    Irene Hernando-Herraez

    Full Text Available DNA methylation is an epigenetic modification involved in regulatory processes such as cell differentiation during development, X-chromosome inactivation, genomic imprinting and susceptibility to complex disease. However, the dynamics of DNA methylation changes between humans and their closest relatives are still poorly understood. We performed a comparative analysis of CpG methylation patterns between 9 humans and 23 primate samples including all species of great apes (chimpanzee, bonobo, gorilla and orangutan using Illumina Methylation450 bead arrays. Our analysis identified ∼800 genes with significantly altered methylation patterns among the great apes, including ∼170 genes with a methylation pattern unique to human. Some of these are known to be involved in developmental and neurological features, suggesting that epigenetic changes have been frequent during recent human and primate evolution. We identified a significant positive relationship between the rate of coding variation and alterations of methylation at the promoter level, indicative of co-occurrence between evolution of protein sequence and gene regulation. In contrast, and supporting the idea that many phenotypic differences between humans and great apes are not due to amino acid differences, our analysis also identified 184 genes that are perfectly conserved at protein level between human and chimpanzee, yet show significant epigenetic differences between these two species. We conclude that epigenetic alterations are an important force during primate evolution and have been under-explored in evolutionary comparative genomics.

  11. Genome-Wide DNA Methylation Profiles of Phlegm-Dampness Constitution

    Directory of Open Access Journals (Sweden)

    Haiqiang Yao

    2018-03-01

    Full Text Available Background/Aims: Metabolic diseases are leading health concerns in today’s global society. In traditional Chinese medicine (TCM, one body type studied is the phlegm-dampness constitution (PC, which predisposes individuals to complex metabolic disorders. Genomic studies have revealed the potential metabolic disorders and the molecular features of PC. The role of epigenetics in the regulation of PC, however, is unknown. Methods: We analyzed a genome-wide DNA methylation in 12 volunteers using Illumina Infinium Human Methylation450 BeadChip on peripheral blood mononuclear cells (PBMCs. Eight volunteers had PC and 4 had balanced constitutions. Results: Methylation data indicated a genome-scale hyper-methylation pattern in PC. We located 288 differentially methylated probes (DMPs. A total of 256 genes were mapped, and some of these were metabolic-related. SQSTM1, DLGAP2 and DAB1 indicated diabetes mellitus; HOXC4 and SMPD3, obesity; and GRWD1 and ATP10A, insulin resistance. According to Ingenuity Pathway Analysis (IPA, differentially methylated genes were abundant in multiple metabolic pathways. Conclusion: Our results suggest the potential risk for metabolic disorders in individuals with PC. We also explain the clinical characteristics of PC with DNA methylation features.

  12. Genome-scale analysis of aberrant DNA methylation in colorectal cancer

    Science.gov (United States)

    Hinoue, Toshinori; Weisenberger, Daniel J.; Lange, Christopher P.E.; Shen, Hui; Byun, Hyang-Min; Van Den Berg, David; Malik, Simeen; Pan, Fei; Noushmehr, Houtan; van Dijk, Cornelis M.; Tollenaar, Rob A.E.M.; Laird, Peter W.

    2012-01-01

    Colorectal cancer (CRC) is a heterogeneous disease in which unique subtypes are characterized by distinct genetic and epigenetic alterations. Here we performed comprehensive genome-scale DNA methylation profiling of 125 colorectal tumors and 29 adjacent normal tissues. We identified four DNA methylation–based subgroups of CRC using model-based cluster analyses. Each subtype shows characteristic genetic and clinical features, indicating that they represent biologically distinct subgroups. A CIMP-high (CIMP-H) subgroup, which exhibits an exceptionally high frequency of cancer-specific DNA hypermethylation, is strongly associated with MLH1 DNA hypermethylation and the BRAFV600E mutation. A CIMP-low (CIMP-L) subgroup is enriched for KRAS mutations and characterized by DNA hypermethylation of a subset of CIMP-H-associated markers rather than a unique group of CpG islands. Non-CIMP tumors are separated into two distinct clusters. One non-CIMP subgroup is distinguished by a significantly higher frequency of TP53 mutations and frequent occurrence in the distal colon, while the tumors that belong to the fourth group exhibit a low frequency of both cancer-specific DNA hypermethylation and gene mutations and are significantly enriched for rectal tumors. Furthermore, we identified 112 genes that were down-regulated more than twofold in CIMP-H tumors together with promoter DNA hypermethylation. These represent ∼7% of genes that acquired promoter DNA methylation in CIMP-H tumors. Intriguingly, 48/112 genes were also transcriptionally down-regulated in non-CIMP subgroups, but this was not attributable to promoter DNA hypermethylation. Together, we identified four distinct DNA methylation subgroups of CRC and provided novel insight regarding the role of CIMP-specific DNA hypermethylation in gene silencing. PMID:21659424

  13. Insufficient DNA methylation affects healthy aging and promotes age-related health problems.

    Science.gov (United States)

    Liu, Liang; van Groen, Thomas; Kadish, Inga; Li, Yuanyuan; Wang, Deli; James, Smitha R; Karpf, Adam R; Tollefsbol, Trygve O

    2011-08-01

    DNA methylation plays an integral role in development and aging through epigenetic regulation of genome function. DNA methyltransferase 1 (Dnmt1) is the most prevalent DNA methyltransferase that maintains genomic methylation stability. To further elucidate the function of Dnmt1 in aging and age-related diseases, we exploited the Dnmt1+/- mouse model to investigate how Dnmt1 haploinsufficiency impacts the aging process by assessing the changes of several major aging phenotypes. We confirmed that Dnmt1 haploinsufficiency indeed decreases DNA methylation as a result of reduced Dnmt1 expression. To assess the effect of Dnmt1 haploinsufficiency on general body composition, we performed dual-energy X-ray absorptiometry analysis and showed that reduced Dnmt1 activity decreased bone mineral density and body weight, but with no significant impact on mortality or body fat content. Using behavioral tests, we demonstrated that Dnmt1 haploinsufficiency impairs learning and memory functions in an age-dependent manner. Taken together, our findings point to the interesting likelihood that reduced genomic methylation activity adversely affects the healthy aging process without altering survival and mortality. Our studies demonstrated that cognitive functions of the central nervous system are modulated by Dnmt1 activity and genomic methylation, highlighting the significance of the original epigenetic hypothesis underlying memory coding and function.

  14. Longitudinal study of DNA methylation during the first 5 years of life.

    Science.gov (United States)

    Urdinguio, Rocio G; Torró, María Isabel; Bayón, Gustavo F; Álvarez-Pitti, Julio; Fernández, Agustín F; Redon, Pau; Fraga, Mario F; Lurbe, Empar

    2016-06-03

    Early life epigenetic programming influences adult health outcomes. Moreover, DNA methylation levels have been found to change more rapidly during the first years of life. Our aim was the identification and characterization of the CpG sites that are modified with time during the first years of life. We hypothesize that these DNA methylation changes would lead to the detection of genes that might be epigenetically modulated by environmental factors during early childhood and which, if disturbed, might contribute to susceptibility to diseases later in life. The study of the DNA methylation pattern of 485577 CpG sites was performed on 30 blood samples from 15 subjects, collected both at birth and at 5 years old, using Illumina(®) Infinium 450 k array. To identify differentially methylated CpG (dmCpG) sites, the methylation status of each probe was examined using linear models and the Empirical Bayes Moderated t test implemented in the limma package of R/Bioconductor. Surogate variable analysis was used to account for batch effects. DNA methylation levels significantly changed from birth to 5 years of age in 6641 CpG sites. Of these, 36.79 % were hypermethylated and were associated with genes related mainly to developmental ontology terms, while 63.21 % were hypomethylated probes and associated with genes related to immune function. Our results suggest that DNA methylation alterations with age during the first years of life might play a significant role in development and the regulation of leukocyte-specific functions. This supports the idea that blood leukocytes experience genome remodeling related to their interaction with environmental factors, underlining the importance of environmental exposures during the first years of life and suggesting that new strategies should be take into consideration for disease prevention.

  15. Differential DNA Methylation in Relation to Age and Health Risks of Obesity

    Directory of Open Access Journals (Sweden)

    María Luisa Mansego

    2015-07-01

    Full Text Available The aim of this study was to evaluate whether genome-wide levels of DNA methylation are associated with age and the health risks of obesity (HRO; defined according to BMI categories as “Low HRO” (overweight and class 1 obesity versus “High HRO” (class 2 and class 3 obesity. Anthropometric measurements were assessed in a subsample of 48 volunteers from the Metabolic Syndrome Reduction in Navarra (RESMENA study and 24 women from another independent study, Effects of Lipoic Acid and Eicosapentaenoic Acid in Human Obesity (OBEPALIP study. In the pooled population; the methylation levels of 55 CpG sites were significantly associated with age after Benjamini-Hochberg correction. In addition, DNA methylation of three CpG sites located in ELOVL2; HOXC4 and PI4KB were further negatively associated with their mRNA levels. Although no differentially methylated CpG sites were identified in relation to HRO after multiple testing correction; several nominally significant CpG sites were identified in genes related to insulin signaling; energy and lipid metabolism. Moreover, statistically significant associations between BMI or mRNA levels and two HRO-related CpG sites located in GPR133 and ITGB5 are reported. As a conclusion, these findings from two Spanish cohorts add knowledge about the important role of DNA methylation in the age-related regulation of gene expression. In addition; a relevant influence of age on DNA methylation in white blood cells was found, as well as, on a trend level, novel associations between DNA methylation and obesity.

  16. Exercise-associated DNA methylation change in skeletal muscle and the importance of imprinted genes: a bioinformatics meta-analysis.

    Science.gov (United States)

    Brown, William M

    2015-12-01

    Epigenetics is the study of processes--beyond DNA sequence alteration--producing heritable characteristics. For example, DNA methylation modifies gene expression without altering the nucleotide sequence. A well-studied DNA methylation-based phenomenon is genomic imprinting (ie, genotype-independent parent-of-origin effects). We aimed to elucidate: (1) the effect of exercise on DNA methylation and (2) the role of imprinted genes in skeletal muscle gene networks (ie, gene group functional profiling analyses). Gene ontology (ie, gene product elucidation)/meta-analysis. 26 skeletal muscle and 86 imprinted genes were subjected to g:Profiler ontology analysis. Meta-analysis assessed exercise-associated DNA methylation change. g:Profiler found four muscle gene networks with imprinted loci. Meta-analysis identified 16 articles (387 genes/1580 individuals) associated with exercise. Age, method, sample size, sex and tissue variation could elevate effect size bias. Only skeletal muscle gene networks including imprinted genes were reported. Exercise-associated effect sizes were calculated by gene. Age, method, sample size, sex and tissue variation were moderators. Six imprinted loci (RB1, MEG3, UBE3A, PLAGL1, SGCE, INS) were important for muscle gene networks, while meta-analysis uncovered five exercise-associated imprinted loci (KCNQ1, MEG3, GRB10, L3MBTL1, PLAGL1). DNA methylation decreased with exercise (60% of loci). Exercise-associated DNA methylation change was stronger among older people (ie, age accounted for 30% of the variation). Among older people, genes exhibiting DNA methylation decreases were part of a microRNA-regulated gene network functioning to suppress cancer. Imprinted genes were identified in skeletal muscle gene networks and exercise-associated DNA methylation change. Exercise-associated DNA methylation modification could rewind the 'epigenetic clock' as we age. CRD42014009800. Published by the BMJ Publishing Group Limited. For permission to use (where

  17. In vitro analysis of integrated global high-resolution DNA methylation profiling with genomic imbalance and gene expression in osteosarcoma.

    Directory of Open Access Journals (Sweden)

    Bekim Sadikovic

    Full Text Available Genetic and epigenetic changes contribute to deregulation of gene expression and development of human cancer. Changes in DNA methylation are key epigenetic factors regulating gene expression and genomic stability. Recent progress in microarray technologies resulted in developments of high resolution platforms for profiling of genetic, epigenetic and gene expression changes. OS is a pediatric bone tumor with characteristically high level of numerical and structural chromosomal changes. Furthermore, little is known about DNA methylation changes in OS. Our objective was to develop an integrative approach for analysis of high-resolution epigenomic, genomic, and gene expression profiles in order to identify functional epi/genomic differences between OS cell lines and normal human osteoblasts. A combination of Affymetrix Promoter Tilling Arrays for DNA methylation, Agilent array-CGH platform for genomic imbalance and Affymetrix Gene 1.0 platform for gene expression analysis was used. As a result, an integrative high-resolution approach for interrogation of genome-wide tumour-specific changes in DNA methylation was developed. This approach was used to provide the first genomic DNA methylation maps, and to identify and validate genes with aberrant DNA methylation in OS cell lines. This first integrative analysis of global cancer-related changes in DNA methylation, genomic imbalance, and gene expression has provided comprehensive evidence of the cumulative roles of epigenetic and genetic mechanisms in deregulation of gene expression networks.

  18. The application of methylation specific electrophoresis (MSE) to DNA methylation analysis of the 5' CpG island of mucin in cancer cells

    International Nuclear Information System (INIS)

    Yokoyama, Seiya; Yonezawa, Suguru; Kitamoto, Sho; Yamada, Norishige; Houjou, Izumi; Sugai, Tamotsu; Nakamura, Shin-ichi; Arisaka, Yoshifumi; Takaori, Kyoichi; Higashi, Michiyo

    2012-01-01

    Methylation of CpG sites in genomic DNA plays an important role in gene regulation and especially in gene silencing. We have reported mechanisms of epigenetic regulation for expression of mucins, which are markers of malignancy potential and early detection of human neoplasms. Epigenetic changes in promoter regions appear to be the first step in expression of mucins. Thus, detection of promoter methylation status is important for early diagnosis of cancer, monitoring of tumor behavior, and evaluating the response of tumors to targeted therapy. However, conventional analytical methods for DNA methylation require a large amount of DNA and have low sensitivity. Here, we report a modified version of the bisulfite-DGGE (denaturing gradient gel electrophoresis) using a nested PCR approach. We designated this method as methylation specific electrophoresis (MSE). The MSE method is comprised of the following steps: (a) bisulfite treatment of genomic DNA, (b) amplification of the target DNA by a nested PCR approach and (c) applying to DGGE. To examine whether the MSE method is able to analyze DNA methylation of mucin genes in various samples, we apply it to DNA obtained from state cell lines, ethanol-fixed colonic crypts and human pancreatic juices. The MSE method greatly decreases the amount of input DNA. The lower detection limit for distinguishing different methylation status is < 0.1% and the detectable minimum amount of DNA is 20 pg, which can be obtained from only a few cells. We also show that MSE can be used for analysis of challenging samples such as human isolated colonic crypts or human pancreatic juices, from which only a small amount of DNA can be extracted. The MSE method can provide a qualitative information of methylated sequence profile. The MSE method allows sensitive and specific analysis of the DNA methylation pattern of almost any block of multiple CpG sites. The MSE method can be applied to analysis of DNA methylation status in many different clinical

  19. Does DNA methylation pattern mark generative development in winter rape?

    Czech Academy of Sciences Publication Activity Database

    Filek, M.; Janiak, A.; Szarejko, I.; Grabczynska, J.; Macháčková, Ivana; Krekule, Jan

    2006-01-01

    Roč. 61, 5-6 (2006), s. 387-396 ISSN 0939-5075 R&D Projects: GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511 Keywords : DNA methylation * rape * vernalization Subject RIV: EF - Botanics Impact factor: 0.720, year: 2006

  20. Parental epigenetic difference in DNA methylation-level may play ...

    African Journals Online (AJOL)

    Parental epigenetic difference in DNA methylation-level may play contrasting roles for different agronomic traits related to yield heterosis in maize. ... or hybrid vigor has been exploited to nearly the fullest extent, the molecular and genetic basis underlying this remarkable biological phenomenon remains largely an enigma.

  1. Persistent organic pollutants alter DNA methylation during human adipocyte differentiation

    NARCIS (Netherlands)

    Dungen, van den Myrthe W.; Murk, Albertinka J.; Gils-Kok, van Dieuwertje; Steegenga, Wilma T.

    2017-01-01

    Ubiquitous persistent organic pollutants (POPs) can accumulate in humans where they might influence differentiation of adipocytes. The aim of this study was to investigate whether DNA methylation is one of the underlying mechanisms by which POPs affect adipocyte differentiation, and to what

  2. DNMT1-interacting RNAs block gene-specific DNA methylation

    Czech Academy of Sciences Publication Activity Database

    Di Ruscio, A.; Ebralidze, A.; Benoukraf, T.; Amabile, G.; Goff, L.A.; Terragni, J.; Figueroa, M.E.; Pontes, L.L.D.; Alberich-Jorda, Meritxell; Zhang, P.; Wu, M.C.; D´Alo, F.; Melnick, A.; Leone, G.; Ebralidze, K.K.; Pradhan, S.; Rinn, J.L.; Tenen, D.G.

    2013-01-01

    Roč. 503, č. 7476 (2013), s. 371-376 ISSN 0028-0836 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : DNA methylation * non-coding RNA * DNMT1 Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 42.351, year: 2013

  3. Analysis of DNA methylation in Arabidopsis thaliana based on methylation-sensitive AFLP markers.

    Science.gov (United States)

    Cervera, M T; Ruiz-García, L; Martínez-Zapater, J M

    2002-12-01

    AFLP analysis using restriction enzyme isoschizomers that differ in their sensitivity to methylation of their recognition sites has been used to analyse the methylation state of anonymous CCGG sequences in Arabidopsis thaliana. The technique was modified to improve the quality of fingerprints and to visualise larger numbers of scorable fragments. Sequencing of amplified fragments indicated that detection was generally associated with non-methylation of the cytosine to which the isoschizomer is sensitive. Comparison of EcoRI/ HpaII and EcoRI/ MspI patterns in different ecotypes revealed that 35-43% of CCGG sites were differentially digested by the isoschizomers. Interestingly, the pattern of digestion among different plants belonging to the same ecotype is highly conserved, with the rate of intra-ecotype methylation-sensitive polymorphisms being less than 1%. However, pairwise comparisons of methylation patterns between samples belonging to different ecotypes revealed differences in up to 34% of the methylation-sensitive polymorphisms. The lack of correlation between inter-ecotype similarity matrices based on methylation-insensitive or methylation-sensitive polymorphisms suggests that whatever the mechanisms regulating methylation may be, they are not related to nucleotide sequence variation.

  4. Multiple correlation analyses revealed complex relationship between DNA methylation and mRNA expression in human peripheral blood mononuclear cells.

    Science.gov (United States)

    Xie, Fang-Fei; Deng, Fei-Yan; Wu, Long-Fei; Mo, Xing-Bo; Zhu, Hong; Wu, Jian; Guo, Yu-Fan; Zeng, Ke-Qin; Wang, Ming-Jun; Zhu, Xiao-Wei; Xia, Wei; Wang, Lan; He, Pei; Bing, Peng-Fei; Lu, Xin; Zhang, Yong-Hong; Lei, Shu-Feng

    2018-01-01

    DNA methylation is an important regulator on the mRNA expression. However, a genome-wide correlation pattern between DNA methylation and mRNA expression in human peripheral blood mononuclear cells (PBMCs) is largely unknown. The comprehensive relationship between mRNA and DNA methylation was explored by using four types of correlation analyses and a genome-wide methylation-mRNA expression quantitative trait locus (eQTL) analysis in PBMCs in 46 unrelated female subjects. An enrichment analysis was performed to detect biological function for the detected genes. Single pair correlation coefficient (r T1 ) between methylation level and mRNA is moderate (-0.63-0.62) in intensity, and the negative and positive correlations are nearly equal in quantity. Correlation analysis on each gene (T4) found 60.1% genes showed correlations between mRNA and gene-based methylation at P correlation (R T4  > 0.8). Methylation sites have regulation effects on mRNA expression in eQTL analysis, with more often observations in region of transcription start site (TSS). The genes under significant methylation regulation both in correlation analysis and eQTL analysis tend to cluster to the categories (e.g., transcription, translation, regulation of transcription) that are essential for maintaining the basic life activities of cells. Our findings indicated that DNA methylation has predictive regulation effect on mRNA with a very complex pattern in PBMCs. The results increased our understanding on correlation of methylation and mRNA and also provided useful clues for future epigenetic studies in exploring biological and disease-related regulatory mechanisms in PBMC.

  5. Association of season of birth with DNA methylation and allergic disease

    NARCIS (Netherlands)

    Lockett, G. A.; Soto-Ramirez, N.; Ray, M. A.; Everson, T. M.; Xu, C-J.; Patil, V. K.; Terry, W.; Kaushal, A.; Rezwan, F. I.; Ewart, S. L.; Gehring, U.; Postma, D. S.; Koppelman, G. H.; Arshad, S. H.; Zhang, H.; Karmaus, W.; Holloway, J. W.

    Background Season of birth influences allergy risk; however, the biological mechanisms underlying this observation are unclear. The environment affects DNA methylation, with potentially long-lasting effects on gene expression and disease. This study examined whether DNA methylation could underlie

  6. Infraspecific DNA methylation polymorphism in cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Keyte, Anna L; Percifield, Ryan; Liu, Bao; Wendel, Jonathan F

    2006-01-01

    Cytosine methylation is important in the epigenetic regulation of gene expression and development in plants and has been implicated in silencing duplicate genes after polyploid formation in several plant groups. Relatively little information exists, however, on levels and patterns of methylation polymorphism (MP) at homologous loci within species. Here we explored the levels and patterns of methylation-polymorphism diversity at CCGG sites within allotetraploid cotton, Gossypium hirsutum, using a methylation-sensitive amplified fragment length polymorphism screen and a selected set of 20 G. hirsutum accessions for which we have information on genetic polymorphism levels and relationships. Methylation and MP exist at high levels within G. hirsutum: of 150 HpaII/MspI sites surveyed, 48 were methylated at the inner cytosine (32%) and 32 of these were polymorphic (67%). Both these values are higher than comparable measures of genetic diversity using restriction fragment length polymorphisms. The high percentage of methylation-polymorphic sites and potential relationship to gene expression underscore the potential significance of MP within and among populations. We speculate that biased correlation of methylation-polymorphic sites and genes in cotton may be a consequence of polyploidy and the attendant doubling of all genes.

  7. The Role of DNA Methylation in Xylogenesis in Different Tissues of Poplar

    Directory of Open Access Journals (Sweden)

    Qingshi Wang

    2016-07-01

    Full Text Available In trees, xylem tissues play a key role in the formation of woody tissues, which have important uses for pulp and timber production; also DNA methylation plays an important part in gene regulation during xylogenesis in trees. In our study, methylation-sensitive amplified polymorphism (MSAP analysis was used to analyze the role cytosine methylation plays in wood formation in the commercially important tree species Populus tomentosa. This analysis compared the methylation patterns between xylem tissues (developing xylem and mature xylem and non-xylem tissues (cambium, shoot apex, young leaf, mature leaf, phloem, root, male catkin, and female catkin and found 10,316 polymorphic methylation sites. MSAP identified 132 candidate genes with the same methylation patterns in xylem tissues, including seven wood-related genes. The expression of these genes differed significantly between xylem and non-xylem tissue types (P<0.01. This indicated that the difference of expression of specific genes with unique methylation patterns, rather than relative methylation levels between the two tissue types plays a critical role in wood biosynthesis. However, 46.2% of candidate genes with the same methylation pattern in vascular tissues (cambium, phloem, and developing xylem did not have distinct expression patterns in xylem and non-xylem tissue. Also, bisulfite sequencing and transcriptome sequencing of MYB, NAC and FASCICLIN-LIKE AGP 13 revealed that the location of cytosine methylation in the gene might affect the expression of different transcripts from the corresponding gene. The expression of different transcripts that produce distinct proteins from a single gene might play an important role in the regulation of xylogenesis.

  8. Genome-Wide Analysis of DNA Methylation During Ovule Development of Female-Sterile Rice fsv1

    Directory of Open Access Journals (Sweden)

    Helian Liu

    2017-11-01

    Full Text Available The regulation of female fertility is an important field of rice sexual reproduction research. DNA methylation is an essential epigenetic modification that dynamically regulates gene expression during development processes. However, few reports have described the methylation profiles of female-sterile rice during ovule development. In this study, ovules were continuously acquired from the beginning of megaspore mother cell meiosis until the mature female gametophyte formation period, and global DNA methylation patterns were compared in the ovules of a high-frequency female-sterile line (fsv1 and a wild-type rice line (Gui99 using whole-genome bisulfite sequencing (WGBS. Profiling of the global DNA methylation revealed hypo-methylation, and 3471 significantly differentially methylated regions (DMRs were observed in fsv1 ovules compared with Gui99. Based on functional annotation and Kyoto encyclopedia of genes and genomes (KEGG pathway analysis of differentially methylated genes (DMGs, we observed more DMGs enriched in cellular component, reproduction regulation, metabolic pathway, and other pathways. In particular, many ovule development genes and plant hormone-related genes showed significantly different methylation patterns in the two rice lines, and these differences may provide important clues for revealing the mechanism of female gametophyte abortion.

  9. Altered DNA methylation associated with a translocation linked to major mental illness

    OpenAIRE

    McCartney, Daniel L; Walker, Rosie M; Morris, Stewart W; Anderson, Susan M; Duff, Barbara J; Marioni, Riccardo E; Millar, J Kirsty; McCarthy, Shane E; Ryan, Niamh M; Lawrie, Stephen M; Watson, Andrew R; Blackwood, Douglas H R; Thomson, Pippa A; McIntosh, Andrew M; McCombie, W Richard

    2018-01-01

    Recent work has highlighted a possible role for altered epigenetic modifications, including differential DNA methylation, in susceptibility to psychiatric illness. Here, we investigate blood-based DNA methylation in a large family where a balanced translocation between chromosomes 1 and 11 shows genome-wide significant linkage to psychiatric illness. Genome-wide DNA methylation was profiled in whole-blood-derived DNA from 41 individuals using the Infinium HumanMethylation450 BeadChip (Illumin...

  10. Blood as a surrogate marker for tissue-specific DNA methylation and changes due to folate depletion in post-partum female mice.

    Science.gov (United States)

    McKay, Jill A; Xie, Long; Harris, Sarah; Wong, Yi K; Ford, Dianne; Mathers, John C

    2011-07-01

    DNA methylation patterns are tissue specific and may influence tissue-specific gene regulation. Human studies investigating DNA methylation in relation to environmental factors primarily use blood-derived DNA as a surrogate for DNA from target tissues. It is therefore important to know if DNA methylation changes in blood in response to environmental changes reflect those in target tissues. Folate intake can influence DNA methylation, via altered methyl donor supply. Previously, manipulations of maternal folate intake during pregnancy altered the patterns of DNA methylation in offspring but, to our knowledge, the consequences for maternal DNA methylation are unknown. Given the increased requirement for folate during pregnancy, mothers may be susceptible to aberrant DNA methylation due to folate depletion. Female mice were fed folate-adequate (2 mg folic acid/kg diet) or folate-deplete (0.4 mg folic acid/kg diet) diets prior to mating and during pregnancy and lactation. Following weaning, dams were killed and DNA methylation was assessed by pyrosequencing® in blood, liver, and kidney at the Esr1, Igf2 differentially methylated region (DMR)1, Igf2 DMR2, Slc39a4CGI1, and Slc39a4CGI2 loci. We observed tissue-specific differences in methylation at all loci. Folate depletion reduced Igf2 DMR1 and Slc39a4CGI1 methylation across all tissues and altered Igf2 DMR2 methylation in a tissue-specific manner (pmethylation measurements may not always reflect methylation within other tissues. Further measurements of blood-derived and tissue-specific methylation patterns are warranted to understand the complexity of tissue-specific responses to altered nutritional exposure. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Analysis of DNA methylation level by methylation-sensitive amplification polymorphism in half smooth tongue sole ( Cynoglossus semilaevis) subjected to salinity stress

    Science.gov (United States)

    Li, Siping; He, Feng; Wen, Haishen; Li, Jifang; Si, Yufeng; Liu, Mingyuan; He, Huiwen; Huang, Zhengju

    2017-04-01

    Increasingly arisen environmental constraints may contribute to heritable phenotypic variation including methylation changes, which can help the animals with development, growth and survival. In this study, we assessed the DNA methylation levels in three tissues (gonad, kidney and gill) of half smooth tongue sole under the salinity stress. The methylation-sensitive amplification polymorphism (MSAP) technique was applied to illustrate the regulation of epigenetic mechanism in environmental stimuli. Fish were subjected to 15 salinity treatment for 7 and 60 days, respectively. A total of 11259 fragments were amplified with 8 pairs of selective primers. The levels of methylated DNA in different tissues of females and males without salinity stress were analyzed, which were 32.76% and 47.32% in gonad; 38.13% and 37.69% in kidney; 37.58% and 34.96% in gill, respectively. In addition, the significant difference was observed in gonad between females and males, indicating that discrepant regulation in gonadal development and differentiation may involve sex-related genes. Further analysis showed that total and hemi-methylation were significantly decreased under 15 salinity for 7 days, probably resulting in up-regulating salt-tolerance genes expression to adjust salt changing. With the adjustment for 60 days, total and hemi-methylation prominently went back to its normal levels to obtain equilibrium. Particularly, full methylation levels were steady along with salinity stress to maintain the stability of gene expression. Additionally, the data showed that gonads in females and gills in males were superior in adaptability. As a result, DNA methylation regulates tissue- specific epiloci, and may respond to salinity stress by regulating gene expression to maintain animal survival and activity.

  12. DNA methylation based biomarkers: Practical considerations and applications

    DEFF Research Database (Denmark)

    Nielsen, Helene Myrtue; How Kit, Alexandre; Tost, Jorg

    2012-01-01

    of biochemical molecules such as proteins, DNA, RNA or lipids, whereby protein biomarkers have been the most extensively studied and used, notably in blood-based protein quantification tests or immunohistochemistry. The rise of interest in epigenetic mechanisms has allowed the identification of a new type...... of biomarker, DNA methylation, which is of great potential for many applications. This stable and heritable covalent modification mostly affects cytosines in the context of a CpG dinucleotide in humans. It can be detected and quantified by a number of technologies including genome-wide screening methods...... as well as locus- or gene-specific high-resolution analysis in different types of samples such as frozen tissues and FFPE samples, but also in body fluids such as urine, plasma, and serum obtained through non-invasive procedures. In some cases, DNA methylation based biomarkers have proven to be more...

  13. DNA methylation of miRNA coding sequences putatively associated with childhood obesity.

    Science.gov (United States)

    Mansego, M L; Garcia-Lacarte, M; Milagro, F I; Marti, A; Martinez, J A

    2017-02-01

    Epigenetic mechanisms may be involved in obesity onset and its consequences. The aim of the present study was to evaluate whether DNA methylation status in microRNA (miRNA) coding regions is associated with childhood obesity. DNA isolated from white blood cells of 24 children (identification sample: 12 obese and 12 non-obese) from the Grupo Navarro de Obesidad Infantil study was hybridized in a 450 K methylation microarray. Several CpGs whose DNA methylation levels were statistically different between obese and non-obese were validated by MassArray® in 95 children (validation sample) from the same study. Microarray analysis identified 16 differentially methylated CpGs between both groups (6 hypermethylated and 10 hypomethylated). DNA methylation levels in miR-1203, miR-412 and miR-216A coding regions significantly correlated with body mass index standard deviation score (BMI-SDS) and explained up to 40% of the variation of BMI-SDS. The network analysis identified 19 well-defined obesity-relevant biological pathways from the KEGG database. MassArray® validation identified three regions located in or near miR-1203, miR-412 and miR-216A coding regions differentially methylated between obese and non-obese children. The current work identified three CpG sites located in coding regions of three miRNAs (miR-1203, miR-412 and miR-216A) that were differentially methylated between obese and non-obese children, suggesting a role of miRNA epigenetic regulation in childhood obesity. © 2016 World Obesity Federation.

  14. FXR silencing in human colon cancer by DNA methylation and KRAS signaling.

    Science.gov (United States)

    Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L

    2014-01-01

    Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.

  15. Does DNA Methylation of PPARGC1A Influence Insulin Action in First Degree Relatives of Patients with Type 2 Diabetes?

    DEFF Research Database (Denmark)

    Gillberg, Linn; Jacobsen, Stine; Ribel-Madsen, Rasmus

    2013-01-01

    and in muscle from individuals at risk of T2D. This study aimed to investigate DNA promoter methylation and gene expression of PPARGC1A in skeletal muscle from first degree relatives (FDR) of T2D patients, and to determine the association with insulin action as well as the influence of family relation. We...... genetic regulation to play a role. No significant effect of familiality on DNA methylation was found. Taken together, increased DNA methylation of the PPARGC1A promoter is unlikely to play a major causal role for the development of insulin resistance in FDR of patients with T2D....... included 124 Danish FDR of T2D patients from 46 different families. Skeletal muscle biopsies were excised from vastus lateralis and insulin action was assessed by oral glucose tolerance tests. DNA methylation and mRNA expression levels were measured using bisulfite sequencing and quantitative real-time PCR...

  16. DNA methylation of angiotensin II receptor gene in nonalcoholic steatohepatitis-related liver fibrosis.

    Science.gov (United States)

    Asada, Kiyoshi; Aihara, Yosuke; Takaya, Hiroaki; Noguchi, Ryuichi; Namisaki, Tadashi; Moriya, Kei; Uejima, Masakazu; Kitade, Mitsuteru; Mashitani, Tsuyoshi; Takeda, Kosuke; Kawaratani, Hideto; Okura, Yasushi; Kaji, Kosuke; Douhara, Akitoshi; Sawada, Yasuhiko; Nishimura, Norihisa; Seki, Kenichiro; Mitoro, Akira; Yamao, Junichi; Yoshiji, Hitoshi

    2016-10-08

    To clarify whether Agtr1a methylation is involved in the development of nonalcoholic steatohepatitis (NASH)-related liver fibrosis in adult rats. A choline-deficient amino acid (CDAA) diet model was employed for methylation analysis of NASH-related liver fibrosis. Agtr1a methylation levels were measured in the livers of CDAA- and control choline-sufficient amino acid (CSAA)-fed rats for 8 and 12 wk using quantitative methylation-specific PCR. Hepatic stellate cells (HSCs) were isolated by collagenase digestion of the liver, followed by centrifugation of the crude cell suspension through a density gradient. Agtr1a methylation and its gene expression were also analyzed during the activation of HSCs. The mean levels of Agtr1a methylation in the livers of CDAA-fed rats (11.5% and 18.6% at 8 and 12 wk, respectively) tended to be higher ( P = 0.06 and 0.09, respectively) than those in the livers of CSAA-fed rats (2.1% and 5.3% at 8 and 12 wk, respectively). Agtr1a was not methylated at all in quiescent HSCs, but was clearly methylated in activated HSCs (13.8%, P < 0.01). Interestingly, although Agtr1a was hypermethylated, the Agtr1a mRNA level increased up to 2.2-fold ( P < 0.05) in activated HSCs compared with that in quiescent HSCs, suggesting that Agtr1a methylation did not silence its expression but instead had the potential to upregulate its expression. These findings indicate that Agtr1a methylation and its upregulation of gene expression are associated with the development of NASH-related liver fibrosis. This is the first study to show that DNA methylation is potentially involved in the regulation of a renin-angiotensin system-related gene expression during liver fibrosis.

  17. Usability of human Infinium MethylationEPIC BeadChip for mouse DNA methylation studies.

    Science.gov (United States)

    Needhamsen, Maria; Ewing, Ewoud; Lund, Harald; Gomez-Cabrero, David; Harris, Robert Adam; Kular, Lara; Jagodic, Maja

    2017-11-15

    The advent of array-based genome-wide DNA methylation methods has enabled quantitative measurement of single CpG methylation status at relatively low cost and sample input. Whereas the use of Infinium Human Methylation BeadChips has shown great utility in clinical studies, no equivalent tool is available for rodent animal samples. We examined the feasibility of using the new Infinium MethylationEPIC BeadChip for studying DNA methylation in mouse. In silico, we identified 19,420 EPIC probes (referred as mEPIC probes), which align with a unique best alignment score to the bisulfite converted reference mouse genome mm10. Further annotation revealed that 85% of mEPIC probes overlapped with mm10.refSeq genes at different genomic features including promoters (TSS1500 and TSS200), 1st exons, 5'UTRs, 3'UTRs, CpG islands, shores, shelves, open seas and FANTOM5 enhancers. Hybridization of mouse samples to Infinium Human MethylationEPIC BeadChips showed successful measurement of mEPIC probes and reproducibility between inter-array biological replicates. Finally, we demonstrated the utility of mEPIC probes for data exploration such as hierarchical clustering. Given the absence of cost and labor convenient genome-wide technologies in the murine system, our findings show that the Infinium MethylationEPIC BeadChip platform is suitable for investigation of the mouse methylome. Furthermore, we provide the "mEPICmanifest" with genomic features, available to users of Infinium Human MethylationEPIC arrays for mouse samples.

  18. Epigenetic Variation in Monozygotic Twins: A Genome-Wide Analysis of DNA Methylation in Buccal Cells

    NARCIS (Netherlands)

    van Dongen, J.; Ehli, E.A.; Slieker, R.C.; Bartels, M.; Weber, Z.M.; Davies, G.E.; Slagboom, P.E.; Heijmans, B.T.; Boomsma, D.I.

    2014-01-01

    DNA methylation is one of the most extensively studied epigenetic marks in humans. Yet, it is largely unknown what causes variation in DNA methylation between individuals. The comparison of DNA methylation profiles of monozygotic (MZ) twins offers a unique experimental design to examine the extent

  19. GAD1 mRNA expression and DNA methylation in prefrontal cortex of subjects with schizophrenia.

    Directory of Open Access Journals (Sweden)

    Hsien-Sung Huang

    2007-08-01

    Full Text Available Dysfunction of prefrontal cortex in schizophrenia includes changes in GABAergic mRNAs, including decreased expression of GAD1, encoding the 67 kDa glutamate decarboxylase (GAD67 GABA synthesis enzyme. The underlying molecular mechanisms remain unclear. Alterations in DNA methylation as an epigenetic regulator of gene expression are thought to play a role but this hypothesis is difficult to test because no techniques are available to extract DNA from GAD1 expressing neurons efficiently from human postmortem brain. Here, we present an alternative approach that is based on immunoprecipitation of mononucleosomes with anti-methyl-histone antibodies differentiating between sites of potential gene expression as opposed to repressive or silenced chromatin. Methylation patterns of CpG dinucleotides at the GAD1 proximal promoter and intron 2 were determined for each of the two chromatin fractions separately, using a case-control design for 14 schizophrenia subjects affected by a decrease in prefrontal GAD1 mRNA levels. In controls, the methylation frequencies at CpG dinucleotides, while overall higher in repressive as compared to open chromatin, did not exceed 5% at the proximal GAD1 promoter and 30% within intron 2. Subjects with schizophrenia showed a significant, on average 8-fold deficit in repressive chromatin-associated DNA methylation at the promoter. These results suggest that chromatin remodeling mechanisms are involved in dysregulated GABAergic gene expression in schizophrenia.

  20. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  1. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  2. DNA methylation modulates H19 and IGF2 expression in porcine female eye

    Directory of Open Access Journals (Sweden)

    Dongxu Wang

    2017-03-01

    Full Text Available Abstract The sexually dimorphic expression of H19/IGF2 is evolutionarily conserved. To investigate whether the expression of H19/IGF2 in the female porcine eye is sex-dependent, gene expression and methylation status were evaluated using quantitative real-time PCR (qPCR and bisulfite sequencing PCR (BSP. We hypothesized that H19/IGF2 might exhibit a different DNA methylation status in the female eye. In order to evaluate our hypothesis, parthenogenetic (PA cells were used for analysis by qPCR and BSP. Our results showed that H19 and IGF2 were over-expressed in the female eye compared with the male eye (3-fold and 2-fold, respectively. We observed a normal monoallelic methylation pattern for H19 differentially methylated regions (DMRs. Compared with H19 DMRs, IGF2 DMRs showed a different methylation pattern in the eye. Taken together, these results suggest that elevated expression of H19/IGF2 is caused by a specific chromatin structure that is regulated by the DNA methylation status of IGF2 DMRs in the female eye.

  3. DNA methylation modulates H19 and IGF2 expression in porcine female eye

    Science.gov (United States)

    Wang, Dongxu; Wang, Guodong; Yang, Hao; Liu, Haibo; Li, Cuie; Li, Xiaolan; Lin, Chao; Song, Yuning; Li, Zhanjun; Liu, Dianfeng

    2017-01-01

    Abstract The sexually dimorphic expression of H19/IGF2 is evolutionarily conserved. To investigate whether the expression of H19/IGF2 in the female porcine eye is sex-dependent, gene expression and methylation status were evaluated using quantitative real-time PCR (qPCR) and bisulfite sequencing PCR (BSP). We hypothesized that H19/IGF2 might exhibit a different DNA methylation status in the female eye. In order to evaluate our hypothesis, parthenogenetic (PA) cells were used for analysis by qPCR and BSP. Our results showed that H19 and IGF2 were over-expressed in the female eye compared with the male eye (3-fold and 2-fold, respectively). We observed a normal monoallelic methylation pattern for H19 differentially methylated regions (DMRs). Compared with H19 DMRs, IGF2 DMRs showed a different methylation pattern in the eye. Taken together, these results suggest that elevated expression of H19/IGF2 is caused by a specific chromatin structure that is regulated by the DNA methylation status of IGF2 DMRs in the female eye. PMID:28266684

  4. Genome-wide screen of ovary-specific DNA methylation in polycystic ovary syndrome.

    Science.gov (United States)

    Yu, Ying-Ying; Sun, Cui-Xiang; Liu, Yin-Kun; Li, Yan; Wang, Li; Zhang, Wei

    2015-07-01

    To compare genome-wide DNA methylation profiles in ovary tissue from women with polycystic ovary syndrome (PCOS) and healthy controls. Case-control study matched for age and body mass index. University-affiliated hospital. Ten women with PCOS who underwent ovarian drilling to induce ovulation and 10 healthy women who were undergoing laparoscopic sterilization, hysterectomy for benign conditions, diagnostic laparoscopy for pelvic pain, or oophorectomy for nonovarian indications. None. Genome-wide DNA methylation patterns determined by immunoprecipitation and microarray (MeDIP-chip) analysis. The methylation levels were statistically significantly higher in CpG island shores (CGI shores), which lie outside of core promoter regions, and lower within gene bodies in women with PCOS relative to the controls. In addition, high CpG content promoters were the most frequently hypermethylated promoters in PCOS ovaries but were more often hypomethylated in controls. Second, 872 CGIs, specifically methylated in PCOS, represented 342 genes that could be associated with various molecular functions, including protein binding, hormone activity, and transcription regulator activity. Finally, methylation differences were validated in seven genes by methylation-specific polymerase chain reaction. These genes correlated to several functional families related to the pathogenesis of PCOS and may be potential biomarkers for this disease. Our results demonstrated that epigenetic modification differs between PCOS and normal ovaries, which may help to further understand the pathophysiology of this disease. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  5. Characterization of the Methylation Status of Pax7 and Myogenic Regulator Factors in Cell Myogenic Differentiation.

    Science.gov (United States)

    Chao, Zhe; Zheng, Xin-Li; Sun, Rui-Ping; Liu, Hai-Long; Huang, Li-Li; Cao, Zong-Xi; Deng, Chang-Yan; Wang, Feng

    2016-07-01

    Epigenetic processes in the development of skeletal muscle have been appreciated for over a decade. DNA methylation is a major epigenetic modification important for regulating gene expression and suppressing spurious transcription. Up to now, the importance of epigenetic marks in the regulation of Pax7 and myogenic regulatory factors (MRFs) expression is far less explored. In the present study, semi-quantitative the real-time polymerase chain reaction (RT-PCR) analyses showed MyoD and Myf5 were expressed in activated and quiescent C2C12 cells. MyoG was expressed in a later stage of myogenesis. Pax7 was weakly expressed in differentiated C2C12 cells. To further understand the regulation of expression of these genes, the DNA methylation status of Pax7, MyoD, and Myf5 was determined by bisulfite sequencing PCR. During the C2C12 myoblasts fusion process, the changes of promoter and exon 1 methylation of Pax7, MyoD, and Myf5 genes were observed. In addition, an inverse relationship of low methylation and high expression was found. These results suggest that DNA methylation may be an important mechanism regulating Pax7 and MRFs transcription in cell myogenic differentiation.

  6. Infant sex-specific placental cadmium and DNA methylation associations

    Energy Technology Data Exchange (ETDEWEB)

    Mohanty, April F., E-mail: april.mohanty@va.gov [Cardiovascular Health Research Unit, University of Washington, 1730 Minor Ave, Seattle, WA 98101 (United States); Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Farin, Fred M., E-mail: freddy@u.washington.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way N.E., Suite #100, Seattle, WA 98105 (United States); Bammler, Theo K., E-mail: tbammler@u.washington.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way N.E., Suite #100, Seattle, WA 98105 (United States); MacDonald, James W., E-mail: jmacdon@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way N.E., Suite #100, Seattle, WA 98105 (United States); Afsharinejad, Zahra, E-mail: zafshari@u.washington.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, 4225 Roosevelt Way N.E., Suite #100, Seattle, WA 98105 (United States); Burbacher, Thomas M., E-mail: tmb@uw.edu [Department of Environmental and Occupational Health Sciences, School of Public Health, University of Washington, Box: 357234, 1705 N.E. Pacific Street, Seattle, WA 98195 (United States); Siscovick, David S., E-mail: dsiscovick@nyam.org [Cardiovascular Health Research Unit, University of Washington, 1730 Minor Ave, Seattle, WA 98101 (United States); Department of Epidemiology, School of Public Health, University of Washington, Seattle, WA (United States); Department of Medicine, University of Washington, Seattle, WA (United States); and others

    2015-04-15

    Background: Recent evidence suggests that maternal cadmium (Cd) burden and fetal growth associations may vary by fetal sex. However, mechanisms contributing to these differences are unknown. Objectives: Among 24 maternal-infant pairs, we investigated infant sex-specific associations between placental Cd and placental genome-wide DNA methylation. Methods: We used ANOVA models to examine sex-stratified associations of placental Cd (dichotomized into high/low Cd using sex-specific Cd median cutoffs) with DNA methylation at each cytosine-phosphate-guanine site or region. Statistical significance was defined using a false discovery rate cutoff (<0.10). Results: Medians of placental Cd among females and males were 5 and 2 ng/g, respectively. Among females, three sites (near ADP-ribosylation factor-like 9 (ARL9), siah E3 ubiquitin protein ligase family member 3 (SIAH3), and heparin sulfate (glucosamine) 3-O-sulfotransferase 4 (HS3ST4) and one region on chromosome 7 (including carnitine O-octanoyltransferase (CROT) and TP5S target 1 (TP53TG1)) were hypomethylated in high Cd placentas. Among males, high placental Cd was associated with methylation of three sites, two (hypomethylated) near MDS1 and EVI1 complex locus (MECOM) and one (hypermethylated) near spalt-like transcription factor 1 (SALL1), and two regions (both hypomethylated, one on chromosome 3 including MECOM and another on chromosome 8 including rho guanine nucleotide exchange factor (GEF) 10 (ARHGEF10). Differentially methylated sites were at or close to transcription start sites of genes involved in cell damage response (SIAH3, HS3ST4, TP53TG1) in females and cell differentiation, angiogenesis and organ development (MECOM, SALL1) in males. Conclusions: Our preliminary study supports infant sex-specific placental Cd-DNA methylation associations, possibly accounting for previously reported differences in Cd-fetal growth associations across fetal sex. Larger studies are needed to replicate and extend these

  7. Infant sex-specific placental cadmium and DNA methylation associations

    International Nuclear Information System (INIS)

    Mohanty, April F.; Farin, Fred M.; Bammler, Theo K.; MacDonald, James W.; Afsharinejad, Zahra; Burbacher, Thomas M.; Siscovick, David S.

    2015-01-01

    Background: Recent evidence suggests that maternal cadmium (Cd) burden and fetal growth associations may vary by fetal sex. However, mechanisms contributing to these differences are unknown. Objectives: Among 24 maternal-infant pairs, we investigated infant sex-specific associations between placental Cd and placental genome-wide DNA methylation. Methods: We used ANOVA models to examine sex-stratified associations of placental Cd (dichotomized into high/low Cd using sex-specific Cd median cutoffs) with DNA methylation at each cytosine-phosphate-guanine site or region. Statistical significance was defined using a false discovery rate cutoff (<0.10). Results: Medians of placental Cd among females and males were 5 and 2 ng/g, respectively. Among females, three sites (near ADP-ribosylation factor-like 9 (ARL9), siah E3 ubiquitin protein ligase family member 3 (SIAH3), and heparin sulfate (glucosamine) 3-O-sulfotransferase 4 (HS3ST4) and one region on chromosome 7 (including carnitine O-octanoyltransferase (CROT) and TP5S target 1 (TP53TG1)) were hypomethylated in high Cd placentas. Among males, high placental Cd was associated with methylation of three sites, two (hypomethylated) near MDS1 and EVI1 complex locus (MECOM) and one (hypermethylated) near spalt-like transcription factor 1 (SALL1), and two regions (both hypomethylated, one on chromosome 3 including MECOM and another on chromosome 8 including rho guanine nucleotide exchange factor (GEF) 10 (ARHGEF10). Differentially methylated sites were at or close to transcription start sites of genes involved in cell damage response (SIAH3, HS3ST4, TP53TG1) in females and cell differentiation, angiogenesis and organ development (MECOM, SALL1) in males. Conclusions: Our preliminary study supports infant sex-specific placental Cd-DNA methylation associations, possibly accounting for previously reported differences in Cd-fetal growth associations across fetal sex. Larger studies are needed to replicate and extend these

  8. Fingerprinting DNA oxidation processes: IR characterization of the 5-methyl-2'-deoxycytidine radical cation.

    Science.gov (United States)

    Bucher, Dominik B; Pilles, Bert M; Pfaffeneder, Toni; Carell, Thomas; Zinth, Wolfgang

    2014-02-24

    Methylated cytidine plays an important role as an epigenetic signal in gene regulation. Its oxidation products are assumed to be involved in active demethylation processes but also in damaging DNA. Here, we report the photochemical production of the 5-methyl-2'-deoxycytidine radical cation via a two-photon ionization process. The radical cation is detected by time-resolved IR spectroscopy and identified by band assignment using density functional theory calculations. Two final oxidation products are characterized with liquid chromatography coupled to mass spectrometry. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Longitudinal Analysis of DNA Methylation in CD34+ Hematopoietic Progenitors in Myelodysplastic Syndrome

    DEFF Research Database (Denmark)

    Wong, Yan Fung; Micklem, Chris N; Taguchi, Masataka

    2014-01-01

    Myelodysplastic syndrome (MDS) is a disorder of hematopoietic stem cells (HSCs) that is often treated with DNA methyltransferase 1 (DNMT1) inhibitors (5-azacytidine [AZA], 5-aza-2'-deoxycytidine), suggesting a role for DNA methylation in disease progression. How DNMT inhibition retards disease...... regulators not expressed within the hematopoietic compartment and was distinct from that observed between healthy hematopoietic cell types. After AZA treatment, we observed only limited DNA demethylation at sites that varied between patients. This suggests that a subset of the stem cell population...... is resistant to AZA and provides a basis for disease relapse. Using gene expression data from patient samples and an in vitro AZA treatment study, we identified differentially methylated genes that can be activated following treatment and that remain silent in the CD34+ stem cell compartment of high-risk MDS...

  10. Effect of DNA methylation on identification of aggressive prostate cancer.

    Science.gov (United States)

    Alumkal, Joshi J; Zhang, Zhe; Humphreys, Elizabeth B; Bennett, Christina; Mangold, Leslie A; Carducci, Michael A; Partin, Alan W; Garrett-Mayer, Elizabeth; DeMarzo, Angelo M; Herman, James G

    2008-12-01

    Biochemical (prostate-specific antigen) recurrence of prostate cancer after radical prostatectomy remains a major problem. Better biomarkers are needed to identify high-risk patients. DNA methylation of promoter regions leads to gene silencing in many cancers. In this study, we assessed the effect of DNA methylation on the identification of recurrent prostate cancer. We studied the methylation status of 15 pre-specified genes using methylation-specific polymerase chain reaction on tissue samples from 151 patients with localized prostate cancer and at least 5 years of follow-up after prostatectomy. On multivariate logistic regression analysis, a high Gleason score and involvement of the capsule, lymph nodes, seminal vesicles, or surgical margin were associated with an increased risk of biochemical recurrence. Methylation of CDH13 by itself (odds ratio 5.50, 95% confidence interval [CI] 1.34 to 22.67; P = 0.02) or combined with methylation of ASC (odds ratio 5.64, 95% CI 1.47 to 21.7; P = 0.01) was also associated with an increased risk of biochemical recurrence. The presence of methylation of ASC and/or CDH13 yielded a sensitivity of 72.3% (95% CI 57% to 84.4%) and negative predictive value of 79% (95% CI 66.8% to 88.3%), similar to the weighted risk of recurrence (determined from the lymph node status, seminal vesicle status, surgical margin status, and postoperative Gleason score), a powerful clinicopathologic prognostic score. However, 34% (95% CI 21% to 49%) of the patients with recurrence were identified by the methylation profile of ASC and CDH13 rather than the weighted risk of recurrence. The results of our study have shown that methylation of CDH13 alone or combined with methylation of ASC is independently associated with an increased risk of biochemical recurrence after radical prostatectomy even considering the weighted risk of recurrence score. These findings should be validated in an independent, larger cohort of patients with prostate cancer who have

  11. MethylMeter(®): bisulfite-free quantitative and sensitive DNA methylation profiling and mutation detection in FFPE samples.

    Science.gov (United States)

    McCarthy, David; Pulverer, Walter; Weinhaeusel, Andreas; Diago, Oscar R; Hogan, Daniel J; Ostertag, Derek; Hanna, Michelle M

    2016-06-01

    Development of a sensitive method for DNA methylation profiling and associated mutation detection in clinical samples. Formalin-fixed and paraffin-embedded tumors received by clinical laboratories often contain insufficient DNA for analysis with bisulfite or methylation sensitive restriction enzymes-based methods. To increase sensitivity, methyl-CpG DNA capture and Coupled Abscription PCR Signaling detection were combined in a new assay, MethylMeter(®). Gliomas were analyzed for MGMT methylation, glioma CpG island methylator phenotype and IDH1 R132H. MethylMeter had 100% assay success rate measuring all five biomarkers in formalin-fixed and paraffin-embedded tissue. MGMT methylation results were supported by survival and mRNA expression data. MethylMeter is a sensitive and quantitative method for multitarget DNA methylation profiling and associated mutation detection. The MethylMeter-based GliomaSTRAT assay measures methylation of four targets and one mutation to simultaneously grade gliomas and predict their response to temozolomide. This information is clinically valuable in management of gliomas.

  12. A multiplex microplatform for the detection of multiple DNA methylation events using gold-DNA affinity.

    Science.gov (United States)

    Sina, Abu Ali Ibn; Foster, Matthew Thomas; Korbie, Darren; Carrascosa, Laura G; Shiddiky, Muhammad J A; Gao, Jing; Dey, Shuvashis; Trau, Matt

    2017-10-07

    We report a new multiplexed strategy for the electrochemical detection of regional DNA methylation across multiple regions. Using the sequence dependent affinity of bisulfite treated DNA towards gold surfaces, the method integrates the high sensitivity of a micro-fabricated multiplex device comprising a microarray of gold electrodes, with the powerful multiplexing capability of multiplex-PCR. The synergy of this combination enables the monitoring of the methylation changes across several genomic regions simultaneously from as low as 500 pg μl -1 of DNA with no sequencing requirement.

  13. Aberrant DNA Methylation: Implications in Racial Health Disparity.

    Directory of Open Access Journals (Sweden)

    Xuefeng Wang

    Full Text Available Incidence and mortality rates of colorectal carcinoma (CRC are higher in African Americans (AAs than in Caucasian Americans (CAs. Deficient micronutrient intake due to dietary restrictions in racial/ethnic populations can alter genetic and molecular profiles leading to dysregulated methylation patterns and the inheritance of somatic to germline mutations.Total DNA and RNA samples of paired tumor and adjacent normal colon tissues were prepared from AA and CA CRC specimens. Reduced Representation Bisulfite Sequencing (RRBS and RNA sequencing were employed to evaluate total genome methylation of 5'-regulatory regions and dysregulation of gene expression, respectively. Robust analysis was conducted using a trimming-and-retrieving scheme for RRBS library mapping in conjunction with the BStool toolkit.DNA from the tumor of AA CRC patients, compared to adjacent normal tissues, contained 1,588 hypermethylated and 100 hypomethylated differentially methylated regions (DMRs. Whereas, 109 hypermethylated and 4 hypomethylated DMRs were observed in DNA from the tumor of CA CRC patients; representing a 14.6-fold and 25-fold change, respectively. Specifically; CHL1, 4 anti-inflammatory genes (i.e., NELL1, GDF1, ARHGEF4, and ITGA4, and 7 miRNAs (of which miR-9-3p and miR-124-3p have been implicated in CRC were hypermethylated in DNA samples from AA patients with CRC. From the same sample set, RNAseq analysis revealed 108 downregulated genes (including 14 ribosomal proteins and 34 upregulated genes (including POLR2B and CYP1B1 [targets of miR-124-3p] in AA patients with CRC versus CA patients.DNA methylation profile and/or products of its downstream targets could serve as biomarker(s addressing racial health disparity.

  14. eMethylsorb: electrochemical quantification of DNA methylation at CpG resolution using DNA-gold affinity interactions.

    Science.gov (United States)

    Sina, Abu Ali Ibn; Howell, Sidney; Carrascosa, Laura G; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt

    2014-11-07

    We report a simple electrochemical method referred to as "eMethylsorb" for the detection of DNA methylation. The method relies on the base dependent affinity interaction of DNA with gold. The methylation status of DNA is quantified by monitoring the electrochemical current as a function of the relative adsorption level of bisulphite treated DNA samples onto a bare gold electrode. This method can successfully distinguish methylated and unmethylated epigenotypes at single CpG resolution.

  15. A DNA methylation microarray-based study identifies ERG as a gene commonly methylated in prostate cancer.

    Science.gov (United States)

    Schwartzman, Jacob; Mongoue-Tchokote, Solange; Gibbs, Angela; Gao, Lina; Corless, Christopher L; Jin, Jennifer; Zarour, Luai; Higano, Celestia; True, Lawrence D; Vessella, Robert L; Wilmot, Beth; Bottomly, Daniel; McWeeney, Shannon K; Bova, G Steven; Partin, Alan W; Mori, Motomi; Alumkal, Joshi

    2011-10-01

    DNA methylation of promoter regions is a common event in prostate cancer, one of the most common cancers in men worldwide. Because prior reports demonstrating that DNA methylation is important in prostate cancer studied a limited number of genes, we systematically quantified the DNA methylation status of 1505 CpG dinucleotides for 807 genes in 78 paraffin-embedded prostate cancer samples and three normal prostate samples. The ERG gene, commonly repressed in prostate cells in the absence of an oncogenic fusion to the TMPRSS2 gene, was one of the most commonly methylated genes, occurring in 74% of prostate cancer specimens. In an independent group of patient samples, we confirmed that ERG DNA methylation was common, occurring in 57% of specimens, and cancer-specific. The ERG promoter is marked by repressive chromatin marks mediated by polycomb proteins in both normal prostate cells and prostate cancer cells, which may explain ERG's predisposition to DNA methylation and the fact that tumors with ERG DNA methylation were more methylated, in general. These results demonstrate that bead arrays offer a high-throughput method to discover novel genes with promoter DNA methylation such as ERG, whose measurement may improve our ability to more accurately detect prostate cancer.

  16. Comprehensive analysis of preeclampsia-associated DNA methylation in the placenta.

    Directory of Open Access Journals (Sweden)

    Tianjiao Chu

    Full Text Available A small number of recent reports have suggested that altered placental DNA methylation may be associated with early onset preeclampsia. It is important that further studies be undertaken to confirm and develop these findings. We therefore undertook a systematic analysis of DNA methylation patterns in placental tissue from 24 women with preeclampsia and 24 with uncomplicated pregnancy outcome.We analyzed the DNA methylation status of approximately 27,000 CpG sites in placental tissues in a massively parallel fashion using an oligonucleotide microarray. Follow up analysis of DNA methylation at specific CpG loci was performed using the Epityper MassArray approach and high-throughput bisulfite sequencing.Preeclampsia-specific DNA methylation changes were identified in placental tissue samples irrespective of gestational age of delivery. In addition, we identified a group of CpG sites within specific gene sequences that were only altered in early onset-preeclampsia (EOPET although these DNA methylation changes did not correlate with altered mRNA transcription. We found evidence that fetal gender influences DNA methylation at autosomal loci but could find no clear association between DNA methylation and gestational age.Preeclampsia is associated with altered placental DNA methylation. Fetal gender should be carefully considered during the design of future studies in which placental DNA is analyzed at the level of DNA methylation. Further large-scale analyses of preeclampsia-associated DNA methylation are necessary.

  17. Advances in DNA methylation: 5-hydroxymethylcytosine revisited

    DEFF Research Database (Denmark)

    Dahl, Christina; Grønbæk, Kirsten; Guldberg, Per

    2011-01-01

    modification involved in gene regulation, X-chromosome inactivation, genomic imprinting, long-term silencing of transposons and cancer development is well described. 5hmC, on the other hand, has only recently entered center stage when it was shown that the Ten-Eleven-Translocation (TET) family of oxygenases...... in cancer development, and developing sequencing methodologies that can accurately distinguish among cytosine, 5mC and 5hmC at single-base-pair resolution....

  18. Minimal methylation classifier (MIMIC): A novel method for derivation and rapid diagnostic detection of disease-associated DNA methylation signatures.

    Science.gov (United States)

    Schwalbe, E C; Hicks, D; Rafiee, G; Bashton, M; Gohlke, H; Enshaei, A; Potluri, S; Matthiesen, J; Mather, M; Taleongpong, P; Chaston, R; Silmon, A; Curtis, A; Lindsey, J C; Crosier, S; Smith, A J; Goschzik, T; Doz, F; Rutkowski, S; Lannering, B; Pietsch, T; Bailey, S; Williamson, D; Clifford, S C

    2017-10-18

    Rapid and reliable detection of disease-associated DNA methylation patterns has major potential to advance molecular diagnostics and underpin research investigations. We describe the development and validation of minimal methylation classifier (MIMIC), combining CpG signature design from genome-wide datasets, multiplex-PCR and detection by single-base extension and MALDI-TOF mass spectrometry, in a novel method to assess multi-locus DNA methylation profiles within routine clinically-applicable assays. We illustrate the application of MIMIC to successfully identify the methylation-dependent diagnostic molecular subgroups of medulloblastoma (the most common malignant childhood brain tumour), using scant/low-quality samples remaining from the most recently completed pan-European medulloblastoma clinical trial, refractory to analysis by conventional genome-wide DNA methylation analysis. Using this approach, we identify critical DNA methylation patterns from previously inaccessible cohorts, and reveal novel survival differences between the medulloblastoma disease subgroups with significant potential for clinical exploitation.

  19. Effects of Genotype and Child Abuse on DNA Methylation and Gene Expression at the Serotonin Transporter

    Directory of Open Access Journals (Sweden)

    Meeshanthini eVijayendran

    2012-06-01

    Full Text Available Altered regulation of the serotonin transporter (SLC6A4 is hypothesized to be a key event in many forms of neuropsychiatric illness, yet our understanding of the molecular mechanisms through which changes in gene function could lead to illness remains incomplete. In prior studies, we and others have demonstrated that methylation of CpG residues in the promoter associated CpG island alters SLC6A4 gene expression, that the extent of that DNA methylation in child abuse is genotype dependent, and that adverse childhood experiences such as child sex abuse are related to methylation. However, we have not examined whether these effects are splice variant specific, whether the association of methylation to gene expression varies as a function of genotype, and whether methylation in other SLC6A4 gene regions are more likely candidates for GxE effects. In the current investigation we measured methylation in lymphoblast DNA from 158 female subjects in the Iowa Adoption Studies at 16 CpG residues spread across the SLC6A4 locus, and analyzed their relationship to gene expression for two SLC6A4 splice variants. Methylation of two CpG residues in the shore of the CpG island (cg22584138 and cg05951817, a location immediately upstream from exon 1A, predicted gene expression for the splice variant containing Exon 1A + 1B. Methylation at two residues in the CpG island itself (cg 25769822 and cg05016953 was associated with total SLC6A4 expression. Examination of these four CpG residues indicated that methylation of cg22584138 was influenced by both genotype and sex abuse, whereas methylation of cg05016953 was influenced only by sex abuse history. Factors influencing methylation at other CpG dinucleotide pairs were not identified. We conclude that methylation effects on transcription may vary as a function of underlying gene motif and splice variant, and that the shore of CpG islands, upstream of TSS, may be of particular interest in examining environmental effects

  20. Analysis of DNA methylation related to rice adult plant resistance to bacterial blight based on methylation-sensitive AFLP (MSAP) analysis.

    Science.gov (United States)

    Sha, A H; Lin, X H; Huang, J B; Zhang, D P

    2005-07-01

    DNA methylation is known to play an important role in the regulation of gene expression in eukaryotes. The rice cultivar Wase Aikoku 3 becomes resistant to the blight pathogen Xanthomonas oryzae pv. oryzae at the adult stage. Using methylation-sensitive amplified polymorphism (MSAP) analysis, we compared the patterns of cytosine methylation in seedlings and adult plants of the rice cultivar Wase Aikoku 3 that had been inoculated with the pathogen Xanthomonas oryzae pv. oryzae, subjected to mock inoculation or left untreated. In all, 2000 DNA fragments, each representing a recognition site cleaved by either or both of two isoschizomers, were amplified using 60 pairs of selective primers. A total of 380 sites were found to be methylated. Of these, 45 showed differential cytosine methylation among the seedlings and adult plants subjected to different treatments, and overall levels of methylation were higher in adult plants than in seedlings. All polymorphic fragments were sequenced, and six showed homology to genes that code for products of known function. Northern analysis of three fragments indicated that their expression varied with methylation pattern, with hypermethylation being correlated with repression of transcription, as expected. The results suggest that significant differences in cytosine methylation exist between seedlings and adult plants, and that hypermethylation or hypomethylation of specific genes may be involved in the development of adult plant resistance (APR) in rice plants.

  1. Use of MSAP markers to analyse the effects of salt stress on DNA methylation in rapeseed (Brassica napus var. oleifera.

    Directory of Open Access Journals (Sweden)

    Gianpiero Marconi

    Full Text Available Excessive soil salinity is a major ecological and agronomical problem, the adverse effects of which are becoming a serious issue in regions where saline water is used for irrigation. Plants can employ regulatory strategies, such as DNA methylation, to enable relatively rapid adaptation to new conditions. In this regard, cytosine methylation might play an integral role in the regulation of gene expression at both the transcriptional and post-transcriptional levels. Rapeseed, which is the most important oilseed crop in Europe, is classified as being tolerant of salinity, although cultivars can vary substantially in their levels of tolerance. In this study, the Methylation Sensitive Amplified Polymorphism (MSAP approach was used to assess the extent of cytosine methylation under salinity stress in salinity-tolerant (Exagone and salinity-sensitive (Toccata rapeseed cultivars. Our data show that salinity affected the level of DNA methylation. In particular methylation decreased in Exagone and increased in Toccata. Nineteen DNA fragments showing polymorphisms related to differences in methylation were sequenced. In particular, two of these were highly similar to genes involved in stress responses (Lacerata and trehalose-6-phosphatase synthase S4 and were chosen to further characterization. Bisulfite sequencing and quantitative RT-PCR analysis of selected MSAP loci showed that cytosine methylation changes under salinity as well as gene expression varied. In particular, our data show that salinity stress influences the expression of the two stress-related genes. Moreover, we quantified the level of trehalose in Exagone shoots and found that it was correlated to TPS4 expression and, therefore, to DNA methylation. In conclusion, we found that salinity could induce genome-wide changes in DNA methylation status, and that these changes, when averaged across different genotypes and developmental stages, accounted for 16.8% of the total site

  2. Aberrant DNA methylation in 5'regions of DNA methyltransferase genes in aborted bovine clones

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    High rate of abortion and developmental abnormalities is thought to be closely associated with inefficient epigenetic reprogramming of the transplanted nuclei during bovine cloning.It is known that one of the important mechanisms for epigenetic reprogramming is DNA methylation.DNA methylation is established and maintained by DNA methyltransferases(DNMTs),therefore,it is postulated that the inefficient epigenetic reprogramming of transplanted nuclei may be due to abnormal expression of DNMTs.Since DNA methylation can strongly inhibit gene expression,aberrant DNA methylation of DNMT genes may disturb gene expression.But presently,it is not clear whether the methylation abnormality of DNMT genes is related to developmental failure of somatic cell nuclear transfer embryos.In our study,we analyzed methylation patterns of the 5' regions of four DNMT genes including Dnmt3a,Dnmt3b,Dnmtl and Dnmt2 in four aborted bovine clones.Using bisulfite sequencing method,we found that 3 out of 4 aborted bovine clones(AF1,AF2 and AF3)showed either hypermethylation or hypomethylation in the 5' regions of Dnmt3a and Dnmt3b.indicating that Dnmt3a and Dnmt3b genes are not properly reprogrammed.However,the individual AF4 exhibited similar methylation level and pattern to age-matched in vitro fertilized (IVF)fetuses.Besides,we found that tle 5'regions of Dnmtl and Dnmt2 were nearly completely unmethylated in all normal adults.IVF fetuses,sperm and aborted clones.Together,our results suggest that the aberrant methylation of Dnmt3a and Dnmt3b 5' regions is probably associated with the high abortion of bovine clones.

  3. Resource base influences genome-wide DNA methylation levels in wild baboons (Papio cynocephalus)

    Science.gov (United States)

    Lea, Amanda J.; Altmann, Jeanne; Alberts, Susan C.; Tung, Jenny

    2015-01-01

    Variation in resource availability commonly exerts strong effects on fitness-related traits in wild animals. However, we know little about the molecular mechanisms that mediate these effects, or about their persistence over time. To address these questions, we profiled genome-wide whole blood DNA methylation levels in two sets of wild baboons: (i) ‘wild-feeding’ baboons that foraged naturally in a savanna environment and (ii) ‘Lodge’ baboons that had ready access to spatially concentrated human food scraps, resulting in high feeding efficiency and low daily travel distances. We identified 1,014 sites (0.20% of sites tested) that were differentially methylated between wild-feeding and Lodge baboons, providing the first evidence that resource availability shapes the epigenome in a wild mammal. Differentially methylated sites tended to occur in contiguous stretches (i.e., in differentially methylated regions or DMRs), in promoters and enhancers, and near metabolism-related genes, supporting their functional importance in gene regulation. In agreement, reporter assay experiments confirmed that methylation at the largest identified DMR, located in the promoter of a key glycolysis-related gene, was sufficient to causally drive changes in gene expression. Intriguingly, all dispersing males carried a consistent epigenetic signature of their membership in a wild-feeding group, regardless of whether males dispersed into or out of this group as adults. Together, our findings support a role for DNA methylation in mediating ecological effects on phenotypic traits in the wild, and emphasize the dynamic environmental sensitivity of DNA methylation levels across the life course. PMID:26508127

  4. Identification of DNA methylation changes associated with human gastric cancer

    Directory of Open Access Journals (Sweden)

    Park Jung-Hoon

    2011-12-01

    Full Text Available Abstract Background Epigenetic alteration of gene expression is a common event in human cancer. DNA methylation is a well-known epigenetic process, but verifying the exact nature of epigenetic changes associated with cancer remains difficult. Methods We profiled the methylome of human gastric cancer tissue at 50-bp resolution using a methylated DNA enrichment technique (methylated CpG island recovery assay in combination with a genome analyzer and a new normalization algorithm. Results We were able to gain a comprehensive view of promoters with various CpG densities, including CpG Islands (CGIs, transcript bodies, and various repeat classes. We found that gastric cancer was associated with hypermethylation of 5' CGIs and the 5'-end of coding exons as well as hypomethylation of repeat elements, such as short interspersed nuclear elements and the composite element SVA. Hypermethylation of 5' CGIs was significantly correlated with downregulation of associated genes, such as those in the HOX and histone gene families. We also discovered long-range epigenetic silencing (LRES regions in gastric cancer tissue and identified several hypermethylated genes (MDM2, DYRK2, and LYZ within these regions. The methylation status of CGIs and gene annotation elements in metastatic lymph nodes was intermediate between normal and cancerous tissue, indicating that methylation of specific genes is gradually increased in cancerous tissue. Conclusions Our findings will provide valuable data for future analysis of CpG methylation patterns, useful markers for the diagnosis of stomach cancer, as well as a new analysis method for clinical epigenomics investigations.

  5. Cluster analysis for DNA methylation profiles having a detection threshold

    Directory of Open Access Journals (Sweden)

    Siegmund Kimberly D

    2006-07-01

    Full Text Available Abstract Background DNA methylation, a molecular feature used to investigate tumor heterogeneity, can be measured on many genomic regions using the MethyLight technology. Due to the combination of the underlying biology of DNA methylation and the MethyLight technology, the measurements, while being generated on a continuous scale, have a large number of 0 values. This suggests that conventional clustering methodology may not perform well on this data. Results We compare performance of existing methodology (such as k-means with two novel methods that explicitly allow for the preponderance of values at 0. We also consider how the ability to successfully cluster such data depends upon the number of informative genes for which methylation is measured and the correlation structure of the methylation values for those genes. We show that when data is collected for a sufficient number of genes, our models do improve clustering performance compared to methods, such as k-means, that do not explicitly respect the supposed biological realities of the situation. Conclusion The performance of analysis methods depends upon how well the assumptions of those methods reflect the properties of the data being analyzed. Differing technologies will lead to data with differing properties, and should therefore be analyzed differently. Consequently, it is prudent to give thought to what the properties of the data are likely to be, and which analysis method might therefore be likely to best capture those properties.

  6. Epigenetic control of viral life-cycle by a DNA-methylation dependent transcription factor.

    Directory of Open Access Journals (Sweden)

    Kirsty Flower

    Full Text Available Epstein-Barr virus (EBV encoded transcription factor Zta (BZLF1, ZEBRA, EB1 is the prototype of a class of transcription factor (including C/EBPalpha that interact with CpG-containing DNA response elements in a methylation-dependent manner. The EBV genome undergoes a biphasic methylation cycle; it is extensively methylated during viral latency but is reset to an unmethylated state following viral lytic replication. Zta is expressed transiently following infection and again during the switch between latency and lytic replication. The requirement for CpG-methylation at critical Zta response elements (ZREs has been proposed to regulate EBV replication, specifically it could aid the activation of viral lytic gene expression from silenced promoters on the methylated genome during latency in addition to preventing full lytic reactivation from the non-methylated EBV genome immediately following infection. We developed a computational approach to predict the location of ZREs which we experimentally assessed using in vitro and in vivo DNA association assays. A remarkably different binding motif is apparent for the CpG and non-CpG ZREs. Computational prediction of the location of these binding motifs in EBV revealed that the majority of lytic cycle genes have at least one and many have multiple copies of methylation-dependent CpG ZREs within their promoters. This suggests that the abundance of Zta protein coupled with the methylation status of the EBV genome act together to co-ordinate the expression of lytic cycle genes at the majority of EBV promoters.

  7. The multi-domain protein Np95 connects DNA methylation and histone modification

    Science.gov (United States)

    Rottach, Andrea; Frauer, Carina; Pichler, Garwin; Bonapace, Ian Marc; Spada, Fabio; Leonhardt, Heinrich

    2010-01-01

    DNA methylation and histone modifications play a central role in the epigenetic regulation of gene expression and cell differentiation. Recently, Np95 (also known as UHRF1 or ICBP90) has been found to interact with Dnmt1 and to bind hemimethylated DNA, indicating together with genetic studies a central role in the maintenance of DNA methylation. Using in vitro binding assays we observed a weak preference of Np95 and its SRA (SET- and Ring-associated) domain for hemimethylated CpG sites. However, the binding kinetics of Np95 in living cells was not affected by the complete loss of genomic methylation. Investigating further links with heterochromatin, we could show that Np95 preferentially binds histone H3 N-terminal tails with trimethylated (H3K9me3) but not acetylated lysine 9 via a tandem Tudor domain. This domain contains three highly conserved aromatic amino acids that form an aromatic cage similar to the one binding H3K9me3 in the chromodomain of HP1ß. Mutations targeting the aromatic cage of the Np95 tandem Tudor domain (Y188A and Y191A) abolished specific H3 histone tail binding. These multiple interactions of the multi-domain protein Np95 with hemimethylated DNA and repressive histone marks as well as with DNA and histone methyltransferases integrate the two major epigenetic silencing pathways. PMID:20026581

  8. The multi-domain protein Np95 connects DNA methylation and histone modification.

    Science.gov (United States)

    Rottach, Andrea; Frauer, Carina; Pichler, Garwin; Bonapace, Ian Marc; Spada, Fabio; Leonhardt, Heinrich

    2010-04-01

    DNA methylation and histone modifications play a central role in the epigenetic regulation of gene expression and cell differentiation. Recently, Np95 (also known as UHRF1 or ICBP90) has been found to interact with Dnmt1 and to bind hemimethylated DNA, indicating together with genetic studies a central role in the maintenance of DNA methylation. Using in vitro binding assays we observed a weak preference of Np95 and its SRA (SET- and Ring-associated) domain for hemimethylated CpG sites. However, the binding kinetics of Np95 in living cells was not affected by the complete loss of genomic methylation. Investigating further links with heterochromatin, we could show that Np95 preferentially binds histone H3 N-terminal tails with trimethylated (H3K9me3) but not acetylated lysine 9 via a tandem Tudor domain. This domain contains three highly conserved aromatic amino acids that form an aromatic cage similar to the one binding H3K9me3 in the chromodomain of HP1ss. Mutations targeting the aromatic cage of the Np95 tandem Tudor domain (Y188A and Y191A) abolished specific H3 histone tail binding. These multiple interactions of the multi-domain protein Np95 with hemimethylated DNA and repressive histone marks as well as with DNA and histone methyltransferases integrate the two major epigenetic silencing pathways.

  9. Potential of DNA methylation in rectal cancer as diagnostic and prognostic biomarkers

    OpenAIRE

    Exner, Ruth; Pulverer, Walter; Diem, Martina; Spaller, Lisa; Woltering, Laura; Schreiber, Martin; Wolf, Brigitte; Sonntagbauer, Markus; Schr?der, Fabian; Stift, Judith; Wrba, Fritz; Bergmann, Michael; Weinh?usel, Andreas; Egger, Gerda

    2015-01-01

    Background: Aberrant DNA methylation is more prominent in proximal compared with distal colorectal cancers. Although a number of methylation markers were identified for colon cancer, yet few are available for rectal cancer. Methods: DNA methylation differences were assessed by a targeted DNA microarray for 360 marker candidates between 22 fresh frozen rectal tumour samples and 8 controls and validated by microfluidic high-throughput and methylation-sensitive qPCR in fresh frozen and formalin-...

  10. Genomic DNA methylation-demethylation during aging and reinvigoration of Pinus radiata.

    Science.gov (United States)

    Fraga, Mario F; Rodríguez, Roberto; Cañal, Maria Jesús

    2002-08-01

    In animals, DNA methylation is related to gene silencing during ontogenic development. Little is known about DNA methylation in plants, although occasional changes in the DNA methylation state of specific gene promoters have been reported in angiosperms during some developmental processes. We found large differences in the extent of DNA methylation between meristematic areas of juvenile and mature Pinus radiata D. Don. trees, whereas differences in the extent of DNA methylation between differentiated tissues of juvenile and mature trees were small. In meristematic areas, there was a gradual decrease in extent of DNA methylation as the degree of reinvigoration increased. The observed changes in extent of DNA methylation during aging and reinvigoration indicate that reinvigoration could be a consequence of epigenetic modifications opposite in direction to those that occur during aging.

  11. DNA Methylation Analysis of BRD1 Promoter Regions and the Schizophrenia rs138880 Risk Allele.

    Directory of Open Access Journals (Sweden)

    Mads Dyrvig

    Full Text Available The bromodomain containing 1 gene, BRD1 is essential for embryogenesis and CNS development. It encodes a protein that participates in histone modifying complexes and thereby regulates the expression of a large number of genes. Genetic variants in the BRD1 locus show association with schizophrenia and bipolar disorder and risk alleles in the promoter region correlate with reduced BRD1 expression. Insights into the transcriptional regulation of BRD1 and the pathogenic mechanisms associated with BRD1 risk variants, however, remain sparse. By studying transcripts in human HeLa and SH-SY5Y cells we provide evidence for differences in relative expression of BRD1 transcripts with three alternative 5' UTRs (exon 1C, 1B, and 1A. We further show that expression of these transcript variants covaries negatively with DNA methylation proportions in their upstream promoter regions suggesting that promoter usage might be regulated by DNA methylation. In line with findings that the risk allele of the rs138880 SNP in the BRD1 promoter region correlates with reduced BRD1 expression, we find that it is also associated with moderate regional BRD1 promoter hypermethylation in both adipose tissue and blood. Importantly, we demonstrate by inspecting available DNA methylation and expression data that these regions undergo changes in methylation during fetal brain development and that differences in their methylation proportions in fetal compared to postnatal frontal cortex correlate significantly with BRD1 expression. These findings suggest that BRD1 may be dysregulated in both the developing and mature brain of risk allele carriers. Finally, we demonstrate that commonly used mood stabilizers Lithium, Valproate, and Carbamazepine affect the expression of BRD1 in SH-SY5Y cells. Altogether this study indicates a link between genetic risk and epigenetic dysregulation of BRD1 which raises interesting perspectives for targeting the mechanisms pharmacologically.

  12. Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter

    International Nuclear Information System (INIS)

    Dávalos-Salas, Mercedes; Furlan-Magaril, Mayra; González-Buendía, Edgar; Valdes-Quezada, Christian; Ayala-Ortega, Erandi; Recillas-Targa, Félix

    2011-01-01

    Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb) gene promoter in different tumoral cell lines. To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing

  13. DNA methylation changes detected by methylation-sensitive amplified polymorphism in two contrasting rice genotypes under salt stress.

    Science.gov (United States)

    Wang, Wensheng; Zhao, Xiuqin; Pan, Yajiao; Zhu, Linghua; Fu, Binying; Li, Zhikang

    2011-09-20

    DNA methylation, one of the most important epigenetic phenomena, plays a vital role in tuning gene expression during plant development as well as in response to environmental stimuli. In the present study, a methylation-sensitive amplified polymorphism (MSAP) analysis was performed to profile DNA methylation changes in two contrasting rice genotypes under salt stress. Consistent with visibly different phenotypes in response to salt stress, epigenetic markers classified as stable inter-cultivar DNA methylation differences were determined between salt-tolerant FL478 and salt-sensitive IR29. In addition, most tissue-specific DNA methylation loci were conserved, while many of the growth stage-dependent DNA methylation loci were dynamic between the two genotypes. Strikingly, salt stress induced a decrease in DNA methylation specifically in roots at the seedling stage that was more profound in IR29 than in the FL478. This result may indicate that demethylation of genes is an active epigenetic response to salt stress in roots at the seedling stage, and helps to further elucidate the implications of DNA methylation in crop growth and development. Copyright © 2011. Published by Elsevier Ltd.

  14. Genome-Wide DNA Methylation Analysis and Epigenetic Variations Associated with Congenital Aortic Valve Stenosis (AVS.

    Directory of Open Access Journals (Sweden)

    Uppala Radhakrishna

    Full Text Available Congenital heart defect (CHD is the most common cause of death from congenital anomaly. Among several candidate epigenetic mechanisms, DNA methylation may play an important role in the etiology of CHDs. We conducted a genome-wide DNA methylation analysis using an Illumina Infinium 450k human methylation assay in a cohort of 24 newborns who had aortic valve stenosis (AVS, with gestational-age matched controls. The study identified significantly-altered CpG methylation at 59 sites in 52 genes in AVS subjects as compared to controls (either hypermethylated or demethylated. Gene Ontology analysis identified biological processes and functions for these genes including positive regulation of receptor-mediated endocytosis. Consistent with prior clinical data, the molecular function categories as determined using DAVID identified low-density lipoprotein receptor binding, lipoprotein receptor binding and identical protein binding to be over-represented in the AVS group. A significant epigenetic change in the APOA5 and PCSK9 genes known to be involved in AVS was also observed. A large number CpG methylation sites individually demonstrated good to excellent diagnostic accuracy for the prediction of AVS status, thus raising possibility of molecular screening markers for this disorder. Using epigenetic analysis we were able to identify genes significantly involved in the pathogenesis of AVS.

  15. Genome-Wide DNA Methylation Analysis and Epigenetic Variations Associated with Congenital Aortic Valve Stenosis (AVS).

    Science.gov (United States)

    Radhakrishna, Uppala; Albayrak, Samet; Alpay-Savasan, Zeynep; Zeb, Amna; Turkoglu, Onur; Sobolewski, Paul; Bahado-Singh, Ray O

    2016-01-01

    Congenital heart defect (CHD) is the most common cause of death from congenital anomaly. Among several candidate epigenetic mechanisms, DNA methylation may play an important role in the etiology of CHDs. We conducted a genome-wide DNA methylation analysis using an Illumina Infinium 450k human methylation assay in a cohort of 24 newborns who had aortic valve stenosis (AVS), with gestational-age matched controls. The study identified significantly-altered CpG methylation at 59 sites in 52 genes in AVS subjects as compared to controls (either hypermethylated or demethylated). Gene Ontology analysis identified biological processes and functions for these genes including positive regulation of receptor-mediated endocytosis. Consistent with prior clinical data, the molecular function categories as determined using DAVID identified low-density lipoprotein receptor binding, lipoprotein receptor binding and identical protein binding to be over-represented in the AVS group. A significant epigenetic change in the APOA5 and PCSK9 genes known to be involved in AVS was also observed. A large number CpG methylation sites individually demonstrated good to excellent diagnostic accuracy for the prediction of AVS status, thus raising possibility of molecular screening markers for this disorder. Using epigenetic analysis we were able to identify genes significantly involved in the pathogenesis of AVS.

  16. Functional analyses of PtRDM1 gene overexpression in poplars and evaluation of its effect on DNA methylation and response to salt stress.

    Science.gov (United States)

    Movahedi, Ali; Zhang, Jiaxin; Sun, Weibo; Mohammadi, Kourosh; Almasi Zadeh Yaghuti, Amir; Wei, Hui; Wu, Xiaolong; Yin, Tongming; Zhuge, Qiang

    2018-06-01

    Epigenetic modification by DNA methylation is necessary for all cellular processes, including genetic expression events, DNA repair, genomic imprinting and regulation of tissue development. It occurs almost exclusively at the C5 position of symmetric CpG and asymmetric CpHpG and CpHpH sites in genomic DNA. The RNA-directed DNA methylation (RDM1) gene is crucial for heterochromatin and DNA methylation. We overexpressed PtRDM1 gene from Populus trichocarpa to amplify transcripts of orthologous RDM1 in 'Nanlin895' (P. deltoides × P. euramericana 'Nanlin895'). This overexpression resulted in increasing RDM1 transcript levels: by ∼150% at 0 mM NaCl treatment and by ∼300% at 60 mM NaCl treatment compared to WT (control) poplars. Genomic cytosine methylation was monitored within 5.8S rDNA and histone H3 loci by bisulfite sequencing. In total, transgenic poplars revealed more DNA methylation than WT plants. In our results, roots revealed more methylated CG contexts than stems and leaves whereas, histone H3 presented more DNA methylation than 5.8S rDNA in both WT and transgenic poplars. The NaCl stresses enhanced more DNA methylation in transgenic poplars than WT plants through histone H3 and 5.8 rDNA loci. Also, the overexpression of PtRDM1 resulted in hyper-methylation, which affected plant phenotype. Transgenic poplars revealed significantly more regeneration of roots than WT poplars via NaCl treatments. Our results proved that RDM1 protein enhanced the DNA methylation by chromatin remodeling (e.g. histone H3) more than repetitive DNA sequences (e.g. 5.8S rDNA). Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  17. DNA Methylation Analysis of HTR2A Regulatory Region in Leukocytes of Autistic Subjects.

    Science.gov (United States)

    Hranilovic, Dubravka; Blazevic, Sofia; Stefulj, Jasminka; Zill, Peter

    2016-02-01

    Disturbed brain and peripheral serotonin homeostasis is often found in subjects with autism spectrum disorder (ASD). The role of the serotonin receptor 2A (HTR2A) in the regulation of central and peripheral serotonin homeostasis, as well as its altered expression in autistic subjects, have implicated the HTR2A gene as a major candidate for the serotonin disturbance seen in autism. Several studies, yielding so far inconclusive results, have attempted to associate autism with a functional SNP -1438 G/A (rs6311) in the HTR2A promoter region, while possible contribution of epigenetic mechanisms, such as DNA methylation, to HTR2A dysregulation in autism has not yet been investigated. In this study, we compared the mean DNA methylation within the regulatory region of the HTR2A gene between autistic and control subjects. DNA methylation was analysed in peripheral blood leukocytes using bisulfite conversion and sequencing of the HTR2A region containing rs6311 polymorphism. Autistic subjects of rs6311 AG genotype displayed higher mean methylation levels within the analysed region than the corresponding controls (P epigenetic mechanisms might contribute to HTR2A dysregulation observed in individuals with ASD. © 2015 International Society for Autism Research, Wiley Periodicals, Inc.

  18. Characterization of Dnmt1 Binding and DNA Methylation on Nucleosomes and Nucleosomal Arrays.

    Directory of Open Access Journals (Sweden)

    Anna Schrader

    Full Text Available The packaging of DNA into nucleosomes and the organisation into higher order structures of chromatin limits the access of sequence specific DNA binding factors to DNA. In cells, DNA methylation is preferentially occuring in the linker region of nucleosomes, suggesting a structural impact of chromatin on DNA methylation. These observations raise the question whether DNA methyltransferases are capable to recognize the nucleosomal substrates and to modify the packaged DNA. Here, we performed a detailed analysis of nucleosome binding and nucleosomal DNA methylation by the maintenance DNA methyltransferase Dnmt1. Our binding studies show that Dnmt1 has a DNA length sensing activity, binding cooperatively to DNA, and requiring a minimal DNA length of 20 bp. Dnmt1 needs linker DNA to bind to nucleosomes and most efficiently recognizes nucleosomes with symmetric DNA linkers. Footprinting experiments reveal that Dnmt1 binds to both DNA linkers exiting the nucleosome core. The binding pattern correlates with the efficient methylation of DNA linkers. However, the enzyme lacks the ability to methylate nucleosomal CpG sites on mononucleosomes and nucleosomal arrays, unless chromatin remodeling enzymes create a dynamic chromatin state. In addition, our results show that Dnmt1 functionally interacts with specific chromatin remodeling enzymes to enable complete methylation of hemi-methylated DNA in chromatin.

  19. DNA methylation in sugarcane somaclonal variants assessed through methylation-sensitive amplified polymorphism.

    Science.gov (United States)

    Francischini, J H M B; Kemper, E L; Costa, J B; Manechini, J R V; Pinto, L R

    2017-05-04

    Micropropagation is an important tool for large-scale multiplication of plant superior genotypes. However, somaclonal variation is one of the drawbacks of this process. Changes in DNA methylation have been widely reported as one of the main causes of somaclonal variations in plants. In order to investigate the occurrence of changes in the methylation pattern of sugarcane somaclonal variants, the MSAP (methylation-sensitive amplified polymorphism) technique was applied to micro-propagated plantlets sampled at the third subculture phase. The mother plant, in vitro normal plantlets, and in vitro abnormal plantlets (somaclonal variants) of four sugarcane clones were screened against 16 MSAP selective primers for EcoRI/MspI and EcoRI/HpaII restriction enzymes. A total of 1005 and 1200 MSAP-derived markers with polymorphism percentages of 28.36 and 40.67 were obtained for EcoRI/HpaII and EcoRI/MspI restriction enzyme combinations, respectively. The genetic similarity between the mother plant and the somaclonal variants ranged from 0.877 to 0.911 (EcoRI/MspI) and from 0.928 to 0.955 (EcoRI/HpaII). Most of the MASPs among mother plant and micro-propagated plantlets were derived from EcoRI/MspI restriction enzymes suggesting alteration due to gain or loss of internal cytosine methylation. A higher rate of loss of methylation (hypomethylation) than gain of methylation (hypermethylation) was observed in the abnormal in vitro sugarcane plantlets. Although changes in the methylation pattern were also observed in the in vitro normal plantlets, they were lower than those observed for the in vitro abnormal plantlets. The MASP technique proved to be a promising tool to early assessment of genetic fidelity of micro-propagated sugarcane plants.

  20. Genes with stable DNA methylation levels show higher evolutionary conservation than genes with fluctuant DNA methylation levels.

    Science.gov (United States)

    Zhang, Ruijie; Lv, Wenhua; Luan, Meiwei; Zheng, Jiajia; Shi, Miao; Zhu, Hongjie; Li, Jin; Lv, Hongchao; Zhang, Mingming; Shang, Zhenwei; Duan, Lian; Jiang, Yongshuai

    2015-11-24

    Different human genes often exhibit different degrees of stability in their DNA methylation levels between tissues, samples or cell types. This may be related to the evolution of human genome. Thus, we compared the evolutionary conservation between two types of genes: genes with stable DNA methylation levels (SM genes) and genes with fluctuant DNA methylation levels (FM genes). For long-term evolutionary characteristics between species, we compared the percentage of the orthologous genes, evolutionary rate dn/ds and protein sequence identity. We found that the SM genes had greater percentages of the orthologous genes, lower dn/ds, and higher protein sequence identities in all the 21 species. These results indicated that the SM genes were more evolutionarily conserved than the FM genes. For short-term evolutionary characteristics among human populations, we compared the single nucleotide polymorphism (SNP) density, and the linkage disequilibrium (LD) degree in HapMap populations and 1000 genomes project populations. We observed that the SM genes had lower SNP densities, and higher degrees of LD in all the 11 HapMap populations and 13 1000 genomes project populations. These results mean that the SM genes had more stable chromosome genetic structures, and were more conserved than the FM genes.

  1. Dietary and supplemental maternal methyl-group donor intake and cord blood DNA methylation.

    Science.gov (United States)

    Pauwels, Sara; Ghosh, Manosij; Duca, Radu Corneliu; Bekaert, Bram; Freson, Kathleen; Huybrechts, Inge; A S Langie, Sabine; Koppen, Gudrun; Devlieger, Roland; Godderis, Lode

    2017-01-02

    Maternal nutrition is critically involved in the development and health of the fetus. We evaluated maternal methyl-group donor intake through diet (methionine, betaine, choline, folate) and supplementation (folic acid) before and during pregnancy in relation to global DNA methylation and hydroxymethylation and gene specific (IGF2 DMR, DNMT1, LEP, RXRA) cord blood methylation. A total of 115 mother-infant pairs were enrolled in the MAternal Nutrition and Offspring's Epigenome (MANOE) study. The intake of methyl-group donors was assessed using a food-frequency questionnaire. LC-MS/MS and pyrosequencing were used to measure global and gene specific methylation, respectively. Dietary intake of methyl-groups before and during pregnancy was associated with changes in LEP, DNMT1, and RXRA cord blood methylation. Statistically significant higher cord blood LEP methylation was observed when mothers started folic acid supplementation more than 6 months before conception compared with 3-6 months before conception (34.6 ± 6.3% vs. 30.1 ± 3.6%, P = 0.011, LEP CpG1) or no folic acid used before conception (16.2 ± 4.4% vs. 13.9 ± 3%, P = 0.036 for LEP CpG3 and 24.5 ± 3.5% vs. 22.2 ± 3.5%, P = 0.045 for LEP mean CpG). Taking folic acid supplements during the entire pregnancy resulted in statistically significantly higher cord blood RXRA methylation as compared with stopping supplementation in the second trimester (12.3 ± 1.9% vs. 11.1 ± 2%, P = 0.008 for RXRA mean CpG). To conclude, long-term folic acid use before and during pregnancy was associated with higher LEP and RXRA cord blood methylation, respectively. To date, pregnant women are advised to take a folic acid supplement of 400 µg/day from 4 weeks before until 12 weeks of pregnancy. Our results suggest significant epigenetic modifications when taking a folic acid supplement beyond the current advice.

  2. Effects of TET2 mutations on DNA methylation in chronic myelomonocytic leukemia

    Science.gov (United States)

    TET2 enzymatically converts 5-methyl-cytosine to 5-hydroxymethyl-cytosine, possibly leading to loss of DNA methylation. TET2 mutations are common in myeloid leukemia and were proposed to contribute to leukemogenesis through DNA methylation. To expand on this concept, we studied chronic myelomonocyti...

  3. Indices of methylation in sperm DNA from fertile men differ between distinct geographical regions

    DEFF Research Database (Denmark)

    Consales, C; Leter, G; Bonde, Jens Peter

    2014-01-01

    STUDY QUESTION: Which are the main determinants, if any, of sperm DNA methylation levels? SUMMARY ANSWER: Geographical region resulted associated with the sperm methylation status assessed on genome-wide repetitive sequences. WHAT IS KNOWN ALREADY: DNA methylation level, assessed on repetitive se...

  4. Differential DNA methylation profiles of coding and non-coding genes define hippocampal sclerosis in human temporal lobe epilepsy

    Science.gov (United States)

    Miller-Delaney, Suzanne F.C.; Bryan, Kenneth; Das, Sudipto; McKiernan, Ross C.; Bray, Isabella M.; Reynolds, James P.; Gwinn, Ryder; Stallings, Raymond L.

    2015-01-01

    Temporal lobe epilepsy is associated with large-scale, wide-ranging changes in gene expression in the hippocampus. Epigenetic changes to DNA are attractive mechanisms to explain the sustained hyperexcitability of chronic epilepsy. Here, through methylation analysis of all annotated C-phosphate-G islands and promoter regions in the human genome, we report a pilot study of the methylation profiles of temporal lobe epilepsy with or without hippocampal sclerosis. Furthermore, by comparative analysis of expression and promoter methylation, we identify methylation sensitive non-coding RNA in human temporal lobe epilepsy. A total of 146 protein-coding genes exhibited altered DNA methylation in temporal lobe epilepsy hippocampus (n = 9) when compared to control (n = 5), with 81.5% of the promoters of these genes displaying hypermethylation. Unique methylation profiles were evident in temporal lobe epilepsy with or without hippocampal sclerosis, in addition to a common methylation profile regardless of pathology grade. Gene ontology terms associated with development, neuron remodelling and neuron maturation were over-represented in the methylation profile of Watson Grade 1 samples (mild hippocampal sclerosis). In addition to genes associated with neuronal, neurotransmitter/synaptic transmission and cell death functions, differential hypermethylation of genes associated with transcriptional regulation was evident in temporal lobe epilepsy, but overall few genes previously associated with epilepsy were among the differentially methylated. Finally, a panel of 13, methylation-sensitive microRNA were identified in temporal lobe epilepsy including MIR27A, miR-193a-5p (MIR193A) and miR-876-3p (MIR876), and the differential methylation of long non-coding RNA documented for the first time. The present study therefore reports select, genome-wide DNA methylation changes in human temporal lobe epilepsy that may contribute to the molecular architecture of the epileptic brain. PMID

  5. Association of Tissue-Specific DNA Methylation Alterations with α-Thalassemia Southeast Asian Deletion

    Directory of Open Access Journals (Sweden)

    Tanapat Pangeson

    2017-11-01

    Full Text Available In the wild-type allele, DNA methylation levels of 10 consecutive CpG sites adjacent to the upstream 5′-breakpoint of α-thalassemia Southeast Asian (SEA deletion are not different between placenta and leukocytes. However, no previous study has reported the map of DNA methylation in the SEA allele. This report aims to show that the SEA mutation is associated with DNA methylation changes, resulting in differential methylation between placenta and leukocytes. Methylation-sensitive high-resolution analysis was used to compare DNA methylation among placenta, leukocytes, and unmethylated control DNA. The result indicates that the DNA methylation between placenta and leukocyte DNA is different and shows that the CpG status of both is not fully unmethylated. Mapping of individual CpG sites was performed by targeted bisulfite sequencing. The DNA methylation level of the 10 consecutive CpG sites was different between placenta and leukocyte DNA. When the 10th CpG of the mutation allele was considered as a hallmark for comparing DNA methylation level, it was totally different from the unmethylated 10th CpG of the wild-type allele. Finally, the distinct DNA methylation patterns between both DNA were extracted. In total, 24 patterns were found in leukocyte samples and 9 patterns were found in placenta samples. This report shows that the large deletion is associated with DNA methylation change. In further studies for clinical application, the distinct DNA methylation pattern might be a potential marker for detecting cell-free fetal DNA.

  6. An RNA polymerase II-and AGO4-associated protein acts in RNA-directed DNA methylation

    KAUST Repository

    Gao, Zhihuan

    2010-04-21

    DNA methylation is an important epigenetic mark in many eukaryotes. In plants, 24-nucleotide small interfering RNAs (siRNAs) bound to the effector protein, Argonaute 4 (AGO4), can direct de novo DNA methylation by the methyltransferase DRM2 (refs 2, 4-6). Here we report a new regulator of RNA-directed DNA methylation (RdDM) in Arabidopsis: RDM1. Loss-of-function mutations in the RDM1 gene impair the accumulation of 24-nucleotide siRNAs, reduce DNA methylation, and release transcriptional gene silencing at RdDM target loci. RDM1 encodes a small protein that seems to bind single-stranded methyl DNA, and associates and co-localizes with RNA polymerase II (Pol II, also known as NRPB), AGO4 and DRM2 in the nucleus. Our results indicate that RDM1 is a component of the RdDM effector complex and may have a role in linking siRNA production with pre-existing or de novo cytosine methylation. Our results also indicate that, although RDM1 and Pol V (also known as NRPE) may function together at some RdDM target sites in the peri-nucleolar siRNA processing centre, Pol II rather than Pol V is associated with the RdDM effector complex at target sites in the nucleoplasm. © 2010 Macmillan Publishers Limited. All rights reserved.

  7. Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease.

    Science.gov (United States)

    Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru

    2018-01-01

    Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score ([Formula: see text]) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing [Formula: see text] >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of [Formula: see text] (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 ([Formula: see text] = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). We confirmed the existence of cis-regulated ASM around

  8. Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease

    Science.gov (United States)

    Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru

    2018-01-01

    Background Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. Methods CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score (ΔRAS¯) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing ΔRAS¯ >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. Results We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of ΔRAS¯ (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 (ΔRAS¯ = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). Conclusions We confirmed the existence of cis-regulated ASM around IBD

  9. Common DNA methylation alterations in multiple brain regions in autism.

    Science.gov (United States)

    Ladd-Acosta, C; Hansen, K D; Briem, E; Fallin, M D; Kaufmann, W E; Feinberg, A P

    2014-08-01

    Autism spectrum disorders (ASD) are increasingly common neurodevelopmental disorders defined clinically by a triad of features including impairment in social interaction, impairment in communication in social situations and restricted and repetitive patterns of behavior and interests, with considerable phenotypic heterogeneity among individuals. Although heritability estimates for ASD are high, conventional genetic-based efforts to identify genes involved in ASD have yielded only few reproducible candidate genes that account for only a small proportion of ASDs. There is mounting evidence to suggest environmental and epigenetic factors play a stronger role in the etiology of ASD than previously thought. To begin to understand the contribution of epigenetics to ASD, we have examined DNA methylation (DNAm) in a pilot study of postmortem brain tissue from 19 autism cases and 21 unrelated controls, among three brain regions including dorsolateral prefrontal cortex, temporal cortex and cerebellum. We measured over 485,000 CpG loci across a diverse set of functionally relevant genomic regions using the Infinium HumanMethylation450 BeadChip and identified four genome-wide significant differentially methylated regions (DMRs) using a bump hunting approach and a permutation-based multiple testing correction method. We replicated 3/4 DMRs identified in our genome-wide screen in a different set of samples and across different brain regions. The DMRs identified in this study represent suggestive evidence for commonly altered methylation sites in ASD and provide several promising new candidate genes.

  10. Identification of DNA methylation biomarkers from Infinium arrays

    Directory of Open Access Journals (Sweden)

    Richard D Emes

    2012-08-01

    Full Text Available Epigenetic modifications of DNA, such as cytosine methylation are differentially abundant in diseases such as cancer. A goal for clinical research is finding sites that are differentially methylated between groups of samples to act as potential biomarkers for disease outcome. However, clinical samples are often limited in availability, represent a heterogeneous collection of cells or are of uncertain clinical class. Array based methods for identification of methylation provide a cost effective method to survey a proportion of the methylome at single base resolution. The Illumina Infinium array has become a popular and reliable high throughput method in this field and are proving useful in the identification of biomarkers for disease. Here, we compare a commonly used statistical test with a new intuitive and flexible computational approach to quickly detect differentially methylated sites. The method rapidly identifies and ranks candidate lists with greatest inter-group variability whilst controlling for intra-group variability. Intuitive and biologically relevant filters can be imposed to quickly identify sites and genes of interest.

  11. DNA methylation and gene expression of HIF3A

    DEFF Research Database (Denmark)

    Main, Ailsa Maria; Gillberg, Linn; Jacobsen, Anna Louisa

    2016-01-01

    from 48 families, from whom we had SAT and muscle biopsies. DNA methylation of four CpG sites in the HIF3A promoter was analyzed in the blood and SAT by pyrosequencing, and HIF3A gene expression was analyzed in SAT and muscle by qPCR. An index of whole-body insulin sensitivity was estimated from oral...... individuals, and whether HIF3A gene expression in SAT and skeletal muscle biopsies showed associations with BMI and insulin resistance. Furthermore, we aimed to investigate gender specificity and heritability of these traits. METHODS: We studied 137 first-degree relatives of type 2 diabetes (T2D) patients...... glucose tolerance tests. RESULTS: BMI was associated with HIF3A methylation at one CpG site in the blood, and there was a positive association between the blood and SAT methylation levels at a different CpG site within the individuals. The SAT methylation level did not correlate with HIF3A gene expression...

  12. Global DNA methylation in earthworms: A candidate biomarker of epigenetic risks related to the presence of metals/metalloids in terrestrial environments

    Energy Technology Data Exchange (ETDEWEB)

    Maldonado Santoyo, Maria; Rodriguez Flores, Crescencio; Lopez Torres, Adolfo; Wrobel, Kazimierz [Department of Chemistry, University of Guanajuato, L de Retana No 5, 36000 Guanajuato (Mexico); Wrobel, Katarzyna, E-mail: katarzyn@quijote.ugto.mx [Department of Chemistry, University of Guanajuato, L de Retana No 5, 36000 Guanajuato (Mexico)

    2011-10-15

    In this work, possible relationships between global DNA methylation and metal/metalloid concentrations in earthworms have been explored. Direct correlation was observed between soil and tissue As, Se, Sb, Zn, Cu, Mn, Ag, Co, Hg, Pb (p < 0.05). Speciation results obtained for As and Hg hint at the capability of earthworms for conversion of inorganic element forms present in soil to methylated species. Inverse correlation was observed between the percentage of methylated DNA cytosines and total tissue As, As + Hg, As + Hg + Se + Sb ({beta} = -0.8456, p = 0.071; {beta} = -0.9406, p = 0.017; {beta} = -0.9526, p = 0.012 respectively), as well as inorganic As + Hg ({beta} = -0.8807, p = 0.049). It was concluded that earthworms would be particularly helpful as bioindicators of elements undergoing in vivo methylation and might also be used to assess the related risk of epigenetic changes in DNA methylation. - Graphical abstract: Display Omitted Highlights: > Several metals and metalloids contribute to epigenetic gene regulation. > As, Hg, Se, Sb inversely correlated with global DNA methylation in earthworms. > Biomethylation of the above elements in worms suggested. > Elements biomethylation apparently competes with DNA methylation. > DNA methylation a biomarker of epigenetic risks related to soil metals/metalloids. - Biomethylation of As, Hg in earthworms versus DNA methylation - a candidate biomarker of epigenetic risks related to the presence of metals/metalloids in soil.

  13. [Analysis of genomic DNA methylation level in radish under cadmium stress by methylation-sensitive amplified polymorphism technique].

    Science.gov (United States)

    Yang, Jin-Lan; Liu, Li-Wang; Gong, Yi-Qin; Huang, Dan-Qiong; Wang, Feng; He, Ling-Li

    2007-06-01

    The level of cytosine methylation induced by cadmium in radish (Raphanus sativus L.) genome was analysed using the technique of methylation-sensitive amplified polymorphism (MSAP). The MSAP ratios in radish seedling exposed to cadmium chloride at the concentration of 50, 250 and 500 mg/L were 37%, 43% and 51%, respectively, and the control was 34%; the full methylation levels (C(m)CGG in double strands) were at 23%, 25% and 27%, respectively, while the control was 22%. The level of increase in MSAP and full methylation indicated that de novo methylation occurred in some 5'-CCGG sites under Cd stress. There was significant positive correlation between increase of total DNA methylation level and CdCl(2) concentration. Four types of MSAP patterns: de novo methylation, de-methylation, atypical pattern and no changes of methylation pattern were identified among CdCl(2) treatments and the control. DNA methylation alteration in plants treated with CdCl(2) was mainly through de novo methylation.

  14. Links between DNA methylation and nucleosome occupancy in the human genome.

    Science.gov (United States)

    Collings, Clayton K; Anderson, John N

    2017-01-01

    DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

  15. DNA methylation in the pathophysiology of hyperphenylalaninemia in the PAH(enu2) mouse model of phenylketonuria.

    Science.gov (United States)

    Dobrowolski, S F; Lyons-Weiler, J; Spridik, K; Vockley, J; Skvorak, K; Biery, A

    2016-09-01

    Phenylalanine hydroxylase deficient phenylketonuria (PKU) is the paradigm for a treatable inborn error of metabolism where maintaining plasma phenylalanine (Phe) in the therapeutic range relates to improved clinical outcomes. While Phe is the presumed intoxicating analyte causal in neurologic damage, the mechanism(s) of Phe toxicity has remained elusive. Altered DNA methylation is a recognized response associated with exposure to numerous small molecule toxic agents. Paralleling this effect, we hypothesized that chronic Phe over-exposure in the brain would lead to aberrant DNA methylation with secondary influence upon gene regulation that would ultimately contribute to PKU neuropathology. The PAH(enu2) mouse models human PKU with intrinsic hyperphenylalaninemia, abnormal response to Phe challenge, and neurologic deficit. To examine this hypothesis, we assessed DNA methylation patterns in brain tissues using methylated DNA immunoprecipitation and paired end sequencing in adult PAH(enu2) animals maintained under either continuous dietary Phe restriction or chronic hyperphenylalaninemia. Heterozygous PAH(enu2/WT) litter mates served as controls for normal Phe exposure. Extensive repatterning of DNA methylation was observed in brain tissue of hyperphenylalaninemic animals while Phe restricted animals displayed an attenuated pattern of aberrant DNA methylation. Affected gene coding regions displayed aberrant hypermethylation and hypomethylation. Gene body methylation of noncoding RNA genes was observed and among these microRNA genes were prominent. Of particular note, observed only in hyperphenylalaninemic animals, was hypomethylation of miRNA genes within the imprinted Dlk1-Dio3 locus on chromosome 12. Aberrant methylation of microRNA genes influenced their expression which has secondary effects upon the expression of targeted protein coding genes. Differential hypermethylation of gene promoters was exclusive to hyperphenylalaninemic PAH(enu2) animals. Genes with

  16. Methylation patterns of repetitive DNA sequences in germ cells of Mus musculus.

    Science.gov (United States)

    Sanford, J; Forrester, L; Chapman, V; Chandley, A; Hastie, N

    1984-03-26

    The major and the minor satellite sequences of Mus musculus were undermethylated in both sperm and oocyte DNAs relative to the amount of undermethylation observed in adult somatic tissue DNA. This hypomethylation was specific for satellite sequences in sperm DNA. Dispersed repetitive and low copy sequences show a high degree of methylation in sperm DNA; however, a dispersed repetitive sequence was undermethylated in oocyte DNA. This finding suggests a difference in the amount of total genomic DNA methylation between sperm and oocyte DNA. The methylation levels of the minor satellite sequences did not change during spermiogenesis, and were not associated with the onset of meiosis or a specific stage in sperm development.

  17. Variations in DNA methylation, acetylated histone H4, and methylated histone H3 during Pinus radiata needle maturation in relation to the loss of in vitro organogenic capability.

    Science.gov (United States)

    Valledor, Luis; Meijón, Mónica; Hasbún, Rodrigo; Jesús Cañal, Maria; Rodríguez, Roberto

    2010-03-15

    Needle differentiation is a very complex process associated with the formation of a mature photosynthetic organ. From meristem differentiation to leaf maturation, gene control must play an important role switching required genes on and off to define tissue functions, with the epigenetic code being one of the main regulation mechanisms. In this work, we examined the connections between the variation in the levels of some epigenetic players (DNA methylation, acetylated histone H4 and histone H3 methylation at Lys 4 and Lys 9) at work during needle maturation. Our results indicate that needle maturation, which is associated with a decrease in organogenic capability, is related to an increase in heterochromatin-related epigenetic markers (high DNA methylation and low acetylated histone H4 levels, and the presence of histone H3 methylated at lys 9). Immunohistochemical analyses also showed that the DNA methylation of palisade parenchyma cell layers during the transition from immature to mature scions is associated with the loss of the capacity to induce adventitious organs. Copyright 2009 Elsevier GmbH. All rights reserved.

  18. Haloperidol induces pharmacoepigenetic response by modulating miRNA expression, global DNA methylation and expression profiles of methylation maintenance genes and genes involved in neurotransmission in neuronal cells.

    Directory of Open Access Journals (Sweden)

    Babu Swathy

    Full Text Available Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects.SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study.Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes involved in

  19. Haloperidol induces pharmacoepigenetic response by modulating miRNA expression, global DNA methylation and expression profiles of methylation maintenance genes and genes involved in neurotransmission in neuronal cells.

    Science.gov (United States)

    Swathy, Babu; Banerjee, Moinak

    2017-01-01

    Haloperidol has been extensively used in various psychiatric conditions. It has also been reported to induce severe side effects. We aimed to evaluate whether haloperidol can influence host methylome, and if so what are the possible mechanisms for it in neuronal cells. Impact on host methylome and miRNAs can have wide spread alterations in gene expression, which might possibly help in understanding how haloperidol may impact treatment response or induce side effects. SK-N-SH, a neuroblasoma cell line was treated with haloperidol at 10μm concentration for 24 hours and global DNA methylation was evaluated. Methylation at global level is maintained by methylation maintenance machinery and certain miRNAs. Therefore, the expression of methylation maintenance genes and their putative miRNA expression profiles were assessed. These global methylation alterations could result in gene expression changes. Therefore genes expressions for neurotransmitter receptors, regulators, ion channels and transporters were determined. Subsequently, we were also keen to identify a strong candidate miRNA based on biological and in-silico approach which can reflect on the pharmacoepigenetic trait of haloperidol and can also target the altered neuroscience panel of genes used in the study. Haloperidol induced increase in global DNA methylation which was found to be associated with corresponding increase in expression of various epigenetic modifiers that include DNMT1, DNMT3A, DNMT3B and MBD2. The expression of miR-29b that is known to putatively regulate the global methylation by modulating the expression of epigenetic modifiers was observed to be down regulated by haloperidol. In addition to miR-29b, miR-22 was also found to be downregulated by haloperidol treatment. Both these miRNA are known to putatively target several genes associated with various epigenetic modifiers, pharmacogenes and neurotransmission. Interestingly some of these putative target genes involved in neurotransmission

  20. Genome-wide DNA methylation analysis in jejunum of Sus scrofa with intrauterine growth restriction.

    Science.gov (United States)

    Hu, Yue; Hu, Liang; Gong, Desheng; Lu, Hanlin; Xuan, Yue; Wang, Ru; Wu, De; Chen, Daiwen; Zhang, Keying; Gao, Fei; Che, Lianqiang

    2018-02-01

    Intrauterine growth restriction (IUGR) may elicit a series of postnatal body developmental and metabolic diseases due to their impaired growth and development in the mammalian embryo/fetus during pregnancy. In the present study, we hypothesized that IUGR may lead to abnormally regulated DNA methylation in the intestine, causing intestinal dysfunctions. We applied reduced representation bisulfite sequencing (RRBS) technology to study the jejunum tissues from four newborn IUGR piglets and their normal body weight (NBW) littermates. The results revealed extensively regional DNA methylation changes between IUGR/NBW pairs from different gilts, affecting dozens of genes. Hiseq-based bisulfite sequencing PCR (Hiseq-BSP) was used for validations of 19 genes with epigenetic abnormality, confirming three genes (AIFM1, MTMR1, and TWIST2) in extra samples. Furthermore, integrated analysis of these 19 genes with proteome data indicated that there were three main genes (BCAP31, IRAK1, and AIFM1) interacting with important immunity- or metabolism-related proteins, which could explain the potential intestinal dysfunctions of IUGR piglets. We conclude that IUGR can lead to disparate DNA methylation in the intestine and these changes may affect several important biological processes such as cell apoptosis, cell differentiation, and immunity, which provides more clues linking IUGR and its long-term complications.

  1. Senataxin Mutation Reveals How R-Loops Promote Transcription by Blocking DNA Methylation at Gene Promoters.

    Science.gov (United States)

    Grunseich, Christopher; Wang, Isabel X; Watts, Jason A; Burdick, Joshua T; Guber, Robert D; Zhu, Zhengwei; Bruzel, Alan; Lanman, Tyler; Chen, Kelian; Schindler, Alice B; Edwards, Nancy; Ray-Chaudhury, Abhik; Yao, Jianhua; Lehky, Tanya; Piszczek, Grzegorz; Crain, Barbara; Fischbeck, Kenneth H; Cheung, Vivian G

    2018-02-01

    R-loops are three-stranded nucleic acid structures found abundantly and yet often viewed as by-products of transcription. Studying cells from patients with a motor neuron disease (amyotrophic lateral sclerosis 4 [ALS4]) caused by a mutation in senataxin, we uncovered how R-loops promote transcription. In ALS4 patients, the senataxin mutation depletes R-loops with a consequent effect on gene expression. With fewer R-loops in ALS4 cells, the expression of BAMBI, a negative regulator of transforming growth factor β (TGF-β), is reduced; that then leads to the activation of the TGF-β pathway. We uncovered that genome-wide R-loops influence promoter methylation of over 1,200 human genes. DNA methyl-transferase 1 favors binding to double-stranded DNA over R-loops. Thus, in forming R-loops, nascent RNA blocks DNA methylation and promotes further transcription. Hence, our results show that nucleic acid structures, in addition to sequences, influence the binding and activity of regulatory proteins. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. MIRA: An R package for DNA methylation-based inference of regulatory activity.

    Science.gov (United States)

    Lawson, John T; Tomazou, Eleni M; Bock, Christoph; Sheffield, Nathan C

    2018-03-01

    DNA methylation contains information about the regulatory state of the cell. MIRA aggregates genome-scale DNA methylation data into a DNA methylation profile for independent region sets with shared biological annotation. Using this profile, MIRA infers and scores the collective regulatory activity for each region set. MIRA facilitates regulatory analysis in situations where classical regulatory assays would be difficult and allows public sources of open chromatin and protein binding regions to be leveraged for novel insight into the regulatory state of DNA methylation datasets. R package available on Bioconductor: http://bioconductor.org/packages/release/bioc/html/MIRA.html. nsheffield@virginia.edu.

  3. Antagonism between DNA and H3K27 methylation at the imprinted Rasgrf1 locus

    DEFF Research Database (Denmark)

    Lindroth, Anders M; Park, Yoon Jung; McLean, Chelsea M

    2008-01-01

    At the imprinted Rasgrf1 locus in mouse, a cis-acting sequence controls DNA methylation at a differentially methylated domain (DMD). While characterizing epigenetic marks over the DMD, we observed that DNA and H3K27 trimethylation are mutually exclusive, with DNA and H3K27 methylation limited...... to the paternal and maternal sequences, respectively. The mutual exclusion arises because one mark prevents placement of the other. We demonstrated this in five ways: using 5-azacytidine treatments and mutations at the endogenous locus that disrupt DNA methylation; using a transgenic model in which the maternal...

  4. Environmental pollution and DNA methylation: carcinogenesis, clinical significance, and practical applications.

    Science.gov (United States)

    Cao, Yi

    2015-09-01

    Environmental pollution is one of the main causes of human cancer. Exposures to environmental carcinogens result in genetic and epigenetic alterations which induce cell transformation. Epigenetic changes caused by environmental pollution play important roles in the development and progression of environmental pollution-related cancers. Studies on DNA methylation are among the earliest and most conducted epigenetic research linked to cancer. In this review, the roles of DNA methylation in carcinogenesis and their significance in clinical medicine were summarized, and the effects of environmental pollutants, particularly air pollutants, on DNA methylation were introduced. Furthermore, prospective applications of DNA methylation to environmental pollution detection and cancer prevention were discussed.

  5. Genome-wide DNA methylation reprogramming in response to inorganic arsenic links inhibition of CTCF binding, DNMT expression and cellular transformation

    Science.gov (United States)

    Rea, Matthew; Eckstein, Meredith; Eleazer, Rebekah; Smith, Caroline; Fondufe-Mittendorf, Yvonne N.

    2017-02-01

    Chronic low dose inorganic arsenic (iAs) exposure leads to changes in gene expression and epithelial-to-mesenchymal transformation. During this transformation, cells adopt a fibroblast-like phenotype accompanied by profound gene expression changes. While many mechanisms have been implicated in this transformation, studies that focus on the role of epigenetic alterations in this process are just emerging. DNA methylation controls gene expression in physiologic and pathologic states. Several studies show alterations in DNA methylation patterns in iAs-mediated pathogenesis, but these studies focused on single genes. We present a comprehensive genome-wide DNA methylation analysis using methyl-sequencing to measure changes between normal and iAs-transformed cells. Additionally, these differential methylation changes correlated positively with changes in gene expression and alternative splicing. Interestingly, most of these differentially methylated genes function in cell adhesion and communication pathways. To gain insight into how genomic DNA methylation patterns are regulated during iAs-mediated carcinogenesis, we show that iAs probably targets CTCF binding at the promoter of DNA methyltransferases, regulating their expression. These findings reveal how CTCF binding regulates DNA methyltransferase to reprogram the methylome in response to an environmental toxin.

  6. DNA methyl transferase (DNMT gene polymorphisms could be a primary event in epigenetic susceptibility to schizophrenia.

    Directory of Open Access Journals (Sweden)

    Koramannil Radha Saradalekshmi

    Full Text Available DNA methylation has been implicated in the etiopathology of various complex disorders. DNA methyltransferases are involved in maintaining and establishing new methylation patterns. The aim of the present study was to investigate the inherent genetic variations within DNA methyltransferase genes in predisposing to susceptibility to schizophrenia. We screened for polymorphisms in DNA methyltransferases, DNMT1, DNMT3A, DNMT3B and DNMT3L in 330 schizophrenia patients and 302 healthy controls for association with Schizophrenia in south Indian population. These polymorphisms were also tested for subgroup analysis with patient's gender, age of onset and family history. DNMT1 rs2114724 (genotype P = .004, allele P = 0.022 and rs2228611 (genotype P = 0.004, allele P = 0.022 were found to be significantly associated at genotypic and allelic level with Schizophrenia in South Indian population. DNMT3B rs2424932 genotype (P = 0.023 and allele (P = 0.0063 increased the risk of developing schizophrenia in males but not in females. DNMT3B rs1569686 (genotype P = 0.027, allele P = 0.033 was found to be associated with early onset of schizophrenia and also with family history and early onset (genotype P = 0.009. DNMT3L rs2070565 (genotype P = 0.007, allele P = 0.0026 confers an increased risk of developing schizophrenia at an early age in individuals with family history. In-silico prediction indicated functional relevance of these SNPs in regulating the gene. These observations might be crucial in addressing and understanding the genetic control of methylation level differences from ethnic viewpoint. Functional significance of genotype variations within the DNMTs indeed suggest that the genetic nature of methyltransferases should be considered while addressing epigenetic events mediated by methylation in Schizophrenia.

  7. Retrotransposon silencing by DNA methylation can drive mammalian genomic imprinting.

    Directory of Open Access Journals (Sweden)

    Shunsuke Suzuki

    2007-04-01

    Full Text Available Among mammals, only eutherians and marsupials are viviparous and have genomic imprinting that leads to parent-of-origin-specific differential gene expression. We used comparative analysis to investigate the origin of genomic imprinting in mammals. PEG10 (paternally expressed 10 is a retrotransposon-derived imprinted gene that has an essential role for the formation of the placenta of the mouse. Here, we show that an orthologue of PEG10 exists in another therian mammal, the marsupial tammar wallaby (Macropus eugenii, but not in a prototherian mammal, the egg-laying platypus (Ornithorhynchus anatinus, suggesting its close relationship to the origin of placentation in therian mammals. We have discovered a hitherto missing link of the imprinting mechanism between eutherians and marsupials because tammar PEG10 is the first example of a differentially methylated region (DMR associated with genomic imprinting in marsupials. Surprisingly, the marsupial DMR was strictly limited to the 5' region of PEG10, unlike the eutherian DMR, which covers the promoter regions of both PEG10 and the adjacent imprinted gene SGCE. These results not only demonstrate a common origin of the DMR-associated imprinting mechanism in therian mammals but provide the first demonstration that DMR-associated genomic imprinting in eutherians can originate from the repression of exogenous DNA sequences and/or retrotransposons by DNA methylation.

  8. DNA methylation mediates genetic variation for adaptive transgenerational plasticity.

    Science.gov (United States)

    Herman, Jacob J; Sultan, Sonia E

    2016-09-14

    Environmental stresses experienced by individual parents can influence offspring phenotypes in ways that enhance survival under similar conditions. Although such adaptive transgenerational plasticity is well documented, its transmission mechanisms are generally unknown. One possible mechanism is environmentally induced DNA methylation changes. We tested this hypothesis in the annual plant Polygonum persicaria, a species known to express adaptive transgenerational plasticity in response to parental drought stress. Replicate plants of 12 genetic lines (sampled from natural populations) were grown in dry versus moist soil. Their offspring were exposed to the demethylating agent zebularine or to control conditions during germination and then grown in dry soil. Under control germination conditions, the offspring of drought-stressed parents grew longer root systems and attained greater biomass compared with offspring of well-watered parents of the same genetic lines. Demethylation removed these adaptive developmental effects of parental drought, but did not significantly alter phenotypic expression in offspring of well-watered parents. The effect of demethylation on the expression of the parental drought effect varied among genetic lines. Differential seed provisioning did not contribute to the effect of parental drought on offspring phenotypes. These results demonstrate that DNA methylation can mediate adaptive, genotype-specific effects of parental stress on offspring phenotypes. © 2016 The Author(s).

  9. Identifying aggressive prostate cancer foci using a DNA methylation classifier.

    Science.gov (United States)

    Mundbjerg, Kamilla; Chopra, Sameer; Alemozaffar, Mehrdad; Duymich, Christopher; Lakshminarasimhan, Ranjani; Nichols, Peter W; Aron, Manju; Siegmund, Kimberly D; Ukimura, Osamu; Aron, Monish; Stern, Mariana; Gill, Parkash; Carpten, John D; Ørntoft, Torben F; Sørensen, Karina D; Weisenberger, Daniel J; Jones, Peter A; Duddalwar, Vinay; Gill, Inderbir; Liang, Gangning

    2017-01-12

    Slow-growing prostate cancer (PC) can be aggressive in a subset of cases. Therefore, prognostic tools to guide clinical decision-making and avoid overtreatment of indolent PC and undertreatment of aggressive disease are urgently needed. PC has a propensity to be multifocal with several different cancerous foci per gland. Here, we have taken advantage of the multifocal propensity of PC and categorized aggressiveness of individual PC foci based on DNA methylation patterns in primary PC foci and matched lymph node metastases. In a set of 14 patients, we demonstrate that over half of the cases have multiple epigenetically distinct subclones and determine the primary subclone from which the metastatic lesion(s) originated. Furthermore, we develop an aggressiveness classifier consisting of 25 DNA methylation probes to determine aggressive and non-aggressive subclones. Upon validation of the classifier in an independent cohort, the predicted aggressive tumors are significantly associated with the presence of lymph node metastases and invasive tumor stages. Overall, this study provides molecular-based support for determining PC aggressiveness with the potential to impact clinical decision-making, such as targeted biopsy approaches for early diagnosis and active surveillance, in addition to focal therapy.

  10. DNA Methylation and the HOXC6 Paradox in Prostate Cancer

    International Nuclear Information System (INIS)

    Vinarskaja, Anna; Yamanaka, Masanori; Ingenwerth, Marc; Schulz, Wolfgang A.

    2011-01-01

    Overexpression of the classical homeobox transcription factor HOXC6 is frequent in prostate cancers and correlates with adverse clinical parameters. Since surprisingly many HOXC6 target genes are downregulated in prostate cancer, it has been posited that oncogenic effects of HOXC6 in prostate cancer may be unmasked by concurrent epigenetic downregulation of target genes exerting tumor suppressive effects. To test this hypothesis, we have studied the expression of three HOXC6 target genes, CNTN1 (encoding a cell adhesion protein), DKK3 and WIF1 (encoding WNT growth factor antagonists) as well as DNA methylation of DKK3 and WIF1. HOXC6 upregulation and association with poor prognosis were confirmed in our tissue series. The three target genes were each significantly downregulated in cancer tissues and expression of each one correlated inversely with that of HOXC6. Cases with lower WIF1 expression showed significantly earlier recurrence (p = 0.021), whereas no statistical significance was reached for CNTN1 and DKK3. Hypermethylation of DKK3 or WIF1 gene promoters was observed in a subset of cancers with downregulated expression, but was often weak. Our data support the hypothesis that HOXC6 target genes exerting tumor-suppressive effects are epigenetically downregulated in prostate cancer, but DNA methylation appears to follow or bolster rather than to cause their transcriptional inactivation

  11. Altered DNA methylation and expression of PLAGL1 in cord blood from assisted reproductive technology pregnancies compared with natural conceptions.

    Science.gov (United States)

    Vincent, Rebecca N; Gooding, Luke D; Louie, Kenny; Chan Wong, Edgar; Ma, Sai

    2016-09-01

    To investigate DNA methylation and expression of imprinted genes and an imprinted gene network (IGN) in neonates conceived via assisted reproductive technology (ART). Case control. Research institution. Two hundred sixty-four cases of cord blood and/or placental villi from neonates (101 IVF, 81 ICSI, 82 naturally conceived). Placentas were obtained at birth for biopsy and cord blood extraction. DNA methylation and expression of imprinted genes. DNA methylation at the PLAGL1 differentially methylated region (DMR) was significantly higher in IVF cord blood (48.0%) compared with controls (46.0%). No differences were found in DNA methylation between conception modes for KvDMR1 and LINE-1 in cord blood and placenta as well as PLAGL1 and PEG10 in placenta villi. PLAGL1 expression was lower in both IVF and ICSI cord blood groups than in controls (relative quantification of 0.65, 0.74, 0.89, respectively). Analyzing the expression of 3 genes in a PLAGL1 regulated IGN revealed different expression between conception modes and a significant correlation to PLAGL1 expression in only one (KCNQ1OT1). Our results suggest a stability of DNA methylation at imprinted DMRs; however, we show PLAGL1 methylation/expression to be altered after ART. As PLAGL1 expression correlated with only one of the three IGN genes in cord blood, we propose there is a more complex mechanism of regulating the IGN that may involve other genes and epigenetic modifications in this tissue. Further research investigating IGN-implicated genes in various neonatal tissues is warranted to elucidate the full effects ART-induced alterations to PLAGL1 and the IGN may have on fetal growth/development. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  12. DNA-methylation profiling of fetal tissues reveals marked epigenetic differences between chorionic and amniotic samples.

    Directory of Open Access Journals (Sweden)

    Christel Eckmann-Scholz

    Full Text Available Epigenetic mechanisms including DNA methylation are supposed to play a key role in fetal development. Here we have investigated fetal DNA-methylation levels of 27,578 CpG loci in 47 chorionic villi (CVS and 16 amniotic cell (AC samples. Methylation levels differed significantly between karyotypically normal AC and CVS for 2,014 genes. AC showed more extreme DNA-methylation levels of these genes than CVS and the differentially methylated genes are significantly enriched for processes characteristic for the different cell types sampled. Furthermore, we identified 404 genes differentially methylated in CVS with trisomy 21. These genes were significantly enriched for high CG dinucleotid (CpG content and developmental processes associated with Down syndrome. Our study points to major tissue-specific differences of fetal DNA-methylation and gives rise to the hypothesis that part of the Down syndrome phenotype is epigenetically programmed in the first trimester of pregnancy.

  13. Reference Materials for Calibration of Analytical Biases in Quantification of DNA Methylation.

    Science.gov (United States)

    Yu, Hannah; Hahn, Yoonsoo; Yang, Inchul

    2015-01-01

    Most contemporary methods for the quantification of DNA methylation employ bisulfite conversion and PCR amplification. However, many reports have indicated that bisulfite-mediated PCR methodologies can result in inaccurate measurements of DNA methylation owing to amplification biases. To calibrate analytical biases in quantification of gene methylation, especially those that arise during PCR, we utilized reference materials that represent exact bisulfite-converted sequences with 0% and 100% methylation status of specific genes. After determining relative quantities using qPCR, pairs of plasmids were gravimetrically mixed to generate working standards with predefined DNA methylation levels at 10% intervals in terms of mole fractions. The working standards were used as controls to optimize the experimental conditions and also as calibration standards in melting-based and sequencing-based analyses of DNA methylation. Use of the reference materials enabled precise characterization and proper calibration of various biases during PCR and subsequent methylation measurement processes, resulting in accurate measurements.

  14. Combination of methylated-DNA precipitation and methylation-sensitive restriction enzymes (COMPARE-MS) for the rapid, sensitive and quantitative detection of DNA methylation.

    Science.gov (United States)

    Yegnasubramanian, Srinivasan; Lin, Xiaohui; Haffner, Michael C; DeMarzo, Angelo M; Nelson, William G

    2006-02-09

    Hypermethylation of CpG island (CGI) sequences is a nearly universal somatic genome alteration in cancer. Rapid and sensitive detection of DNA hypermethylation would aid in cancer diagnosis and risk stratification. We present a novel technique, called COMPARE-MS, that can rapidly and quantitatively detect CGI hypermethylation with high sensitivity and specificity in hundreds of samples simultaneously. To quantitate CGI hypermethylation, COMPARE-MS uses real-time PCR of DNA that was first digested by methylation-sensitive restriction enzymes and then precipitated by methyl-binding domain polypeptides immobilized on a magnetic solid matrix. We show that COMPARE-MS could detect five genome equivalents of methylated CGIs in a 1000- to 10,000-fold excess of unmethylated DNA. COMPARE-MS was used to rapidly quantitate hypermethylation at multiple CGIs in >155 prostate tissues, including benign and malignant prostate specimens, and prostate cell lines. This analysis showed that GSTP1, MDR1 and PTGS2 CGI hypermethylation as determined by COMPARE-MS could differentiate between malignant and benign prostate with sensitivities >95% and specificities approaching 100%. This novel technology could significantly improve our ability to detect CGI hypermethylation.

  15. Spaceflight induces both transient and heritable alterations in DNA methylation and gene expression in rice (Oryza sativa L.)

    Energy Technology Data Exchange (ETDEWEB)

    Ou Xiufang [Key Laboratory of Molecular Epigenetic of MOE and Institute of Genetics and Cytology, Northeast Normal University, Changchun 130024 (China); Long Likun [Inspection and Quarantine Technology Centre of Zhongshan Entry-Exit Inspection and Quarantine Bureau, Zhongshan 528400, Guangdong Province (China); Zhang Yunhong; Xue Yiqun; Liu Jingchun; Lin Xiuyun [Key Laboratory of Molecular Epigenetic of MOE and Institute of Genetics and Cytology, Northeast Normal University, Changchun 130024 (China); Liu Bao [Key Laboratory of Molecular Epigenetic of MOE and Institute of Genetics and Cytology, Northeast Normal University, Changchun 130024 (China)], E-mail: baoliu6677@yahoo.com.cn

    2009-03-09

    Spaceflight represents a complex environmental condition in which several interacting factors such as cosmic radiation, microgravity and space magnetic fields are involved, which may provoke stress responses and jeopardize genome integrity. Given the inherent property of epigenetic modifications to respond to intrinsic as well as external perturbations, it is conceivable that epigenetic markers like DNA methylation may undergo alterations in response to spaceflight. We report here that extensive alteration in both DNA methylation and gene expression occurred in rice plants subjected to a spaceflight, as revealed by a set of characterized sequences including 6 transposable elements (TEs) and 11 cellular genes. We found that several features characterize the alterations: (1) All detected alterations are hypermethylation events; (2) whereas alteration in both CG and CNG methylation occurred in the TEs, only alteration in CNG methylation occurred in the cellular genes; (3) alteration in expression includes both up- and down-regulations, which did not show a general correlation with alteration in methylation; (4) altered methylation patterns in both TEs and cellular genes are heritable to progenies at variable frequencies; however, stochastic reversion to wild-type patterns and further de novo changes in progenies are also apparent; and (5) the altered expression states in both TEs and cellular genes are also heritable to selfed progenies but with markedly lower transmission frequencies than altered DNA methylation states. Furthermore, we found that a set of genes encoding for the various putative DNA methyltransferases, 5-methylcytosine DNA glycosylases, the SWI/SNF chromatin remodeller (DDM1) and siRNA-related proteins are extremely sensitive to perturbation by spaceflight, which might be an underlying cause for the altered methylation patterns in the space-flown plants. We discuss implications of spaceflight-induced epigenetic variations with regard to health safety

  16. Spaceflight induces both transient and heritable alterations in DNA methylation and gene expression in rice (Oryza sativa L.)

    International Nuclear Information System (INIS)

    Ou Xiufang; Long Likun; Zhang Yunhong; Xue Yiqun; Liu Jingchun; Lin Xiuyun; Liu Bao

    2009-01-01

    Spaceflight represents a complex environmental condition in which several interacting factors such as cosmic radiation, microgravity and space magnetic fields are involved, which may provoke stress responses and jeopardize genome integrity. Given the inherent property of epigenetic modifications to respond to intrinsic as well as external perturbations, it is conceivable that epigenetic markers like DNA methylation may undergo alterations in response to spaceflight. We report here that extensive alteration in both DNA methylation and gene expression occurred in rice plants subjected to a spaceflight, as revealed by a set of characterized sequences including 6 transposable elements (TEs) and 11 cellular genes. We found that several features characterize the alterations: (1) All detected alterations are hypermethylation events; (2) whereas alteration in both CG and CNG methylation occurred in the TEs, only alteration in CNG methylation occurred in the cellular genes; (3) alteration in expression includes both up- and down-regulations, which did not show a general correlation with alteration in methylation; (4) altered methylation patterns in both TEs and cellular genes are heritable to progenies at variable frequencies; however, stochastic reversion to wild-type patterns and further de novo changes in progenies are also apparent; and (5) the altered expression states in both TEs and cellular genes are also heritable to selfed progenies but with markedly lower transmission frequencies than altered DNA methylation states. Furthermore, we found that a set of genes encoding for the various putative DNA methyltransferases, 5-methylcytosine DNA glycosylases, the SWI/SNF chromatin remodeller (DDM1) and siRNA-related proteins are extremely sensitive to perturbation by spaceflight, which might be an underlying cause for the altered methylation patterns in the space-flown plants. We discuss implications of spaceflight-induced epigenetic variations with regard to health safety

  17. Variation in the DNA methylation pattern of expressed and nonexpressed genes in chicken.

    Science.gov (United States)

    Cooper, D N; Errington, L H; Clayton, R M

    1983-01-01

    Using methyl-sensitive and -insensitive restriction enzymes, Hpa II and Msp I, the methylation status of various chicken genes was examined in different tissues and developmental stages. Tissue-specific differences in methylation were found for the delta-crystallin, beta-tubulin, G3PDH, rDNA, and actin genes but not for the histone genes. Developmental decreases in methylation were noted for the delta-crystallin and actin genes in chicken kidney between embryo and adult. Since most of the sequences examined were housekeeping genes, transcriptional differences are apparently not a necessary accompaniment to changes in DNA methylation at the CpG sites examined. The only exception is sperm DNA where the delta-crystallin, beta-tubulin, and actin genes are highly methylated and almost certainly not transcribed. However the G3PDH genes are no more highly methylated in sperm than in other somatic tissues. Many sequences homologous to the rDNA and histone probes used are unmethylated in all tissues examined including sperm, but a methylated rDNA subfraction is more heavily methylated in sperm than in other tissues. We speculate as to the significance of these differences in sperm DNA methylation in the light of possible requirements for early gene activation and the probable deleterious mutagenic effects of heavy methylation within coding sequences.

  18. Frequent silencing of RASSF1A by DNA methylation in thymic neuroendocrine tumours.

    Science.gov (United States)

    Kajiura, Koichiro; Takizawa, Hiromitsu; Morimoto, Yuki; Masuda, Kiyoshi; Tsuboi, Mitsuhiro; Kishibuchi, Reina; Wusiman, Nuliamina; Sawada, Toru; Kawakita, Naoya; Toba, Hiroaki; Yoshida, Mitsuteru; Kawakami, Yukikiyo; Naruto, Takuya; Imoto, Issei; Tangoku, Akira; Kondo, Kazuya

    2017-09-01

    Aberrant methylation of promoter CpG islands (CGIs) of tumour suppressor genes is a common epigenetic mechanism underlying cancer pathogenesis. The methylation patterns of thymic tumours have not been studied in detail since such tumours are rare. Herein, we sought to identify genes that could serve as epigenetic targets for thymic neuroendocrine tumour (NET) therapy. Genome-wide screening for aberrantly methylated CGIs was performed in three NET samples, seven thymic carcinoma (TC) samples, and eight type-B3 thymoma samples. The methylation status of thymic epithelial tumours (TETs) samples was validated by pyrosequencing in a larger cohort. The expression status was analysed by quantitative polymerase chain reaction (PCR) and immunohistochemistry. We identified a CGI on a novel gene, RASSF1A, which was strongly hypermethylated in NET, but not in thymic carcinoma or B3 thymoma. RASSF1A was identified as a candidate gene statistically and bibliographically, as it showed frequent CGI hypermethylation in NET by genome-wide screening. Pyrosequencing confirmed significant hypermethylation of a RASSF1A CGI in NET. Low-grade NET tissue was more strongly methylated than high-grade NET. Quantitative PCR and immunohistochemical staining revealed that RASSF1A mRNA and protein expression levels were negatively regulated by DNA methylation. RASSF1A is a tumour suppressor gene epigenetically dysregulated in NET. Aberrant methylation of RASSF1A has been reported in various tumours, but this is the first report of RASSF1A hypermethylation in TETs. RASSF1A may represent an epigenetic therapeutic target in thymic NET. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Patterns of DNA methylation in the normal colon vary by anatomical location, gender, and age

    Science.gov (United States)

    Kaz, Andrew M; Wong, Chao-Jen; Dzieciatkowski, Slavomir; Luo, Yanxin; Schoen, Robert E; Grady, William M

    2014-01-01

    Alterations in DNA methylation have been proposed to create a field cancerization state in the colon, where molecular alterations that predispose cells to transformation occur in histologically normal tissue. However, our understanding of the role of DNA methylation in field cancerization is limited by an incomplete characterization of the methylation state of the normal colon. In order to determine the colon’s normal methylation state, we extracted DNA from normal colon biopsies from the rectum, sigmoid, transverse, and ascending colon and assessed the methylation status of the DNA by pyrosequencing candidate loci as well as with HumanMethylation450 arrays. We found that methylation levels of repetitive elements LINE-1 and SAT-α showed minimal variability throughout the colon in contrast to other loci. Promoter methylation of EVL was highest in the rectum and progressively lower in the proximal segments, whereas ESR1 methylation was higher in older individuals. Genome-wide methylation analysis of normal DNA revealed 8388, 82, and 93 differentially methylated loci that distinguished right from left colon, males from females, and older vs. younger individuals, respectively. Although variability in methylation between biopsies and among different colon segments was minimal for repetitive elements, analyses of specific cancer-related genes as well as a genome-wide methylation analysis demonstrated differential methylation based on colon location, individual age, and gender. These studies advance our knowledge regarding the variation of DNA methylation in the normal colon, a prerequisite for future studies aimed at understanding methylation differences indicative of a colon field effect. PMID:24413027

  20. Effect of DNA sequence, ionic strength, and cationic DNA affinity binders on the methylation of DNA by N-methyl-N-nitrosourea

    International Nuclear Information System (INIS)

    Wurdeman, R.L.; Gold, B.

    1988-01-01

    DNA alkylation by N-alkyl-N-nitrosoureas is generally accepted to be responsible for their mutagenic, carcinogenic, and antineoplastic activities. The exact nature of the ultimate alkylating intermediate is still controversial, with a variety of species having been nominated. The sequence specificity for DNA alkylation by simple N-alkyl-N-nitrosoureas has not been reported, although such information is basic in understanding the specific point mutations induced by these compounds in oncogene targets. These two points are addressed by using N-methyl-N-nitrosourea methylation of a 576 base-pair 32 P-end-labeled DNA restriction fragment and high-resolution polyacrylamide sequencing gels. This method provides information on the formation of N 7 -methylguanine, by the generation of single-strand breaks upon exposure to piperidine

  1. DNA methylation analysis of allotetraploid hybrids of red crucian carp (Carassius auratus red var. and common carp (Cyprinus carpio L..

    Directory of Open Access Journals (Sweden)

    Jun Xiao

    Full Text Available Hybridization and polyploidization may lead to divergence in adaptation and boost speciation in angiosperms and some lower animals. Epigenetic change plays a significant role in the formation and adaptation of polyploidy. Studies of the effects of methylation on genomic recombination and gene expression in allopolyploid plants have achieved good progress. However, relevant advances in polyploid animals have been relatively slower. In the present study, we used the bisexual, fertile, genetically stable allotetraploid generated by hybridization of Carassius auratus red var. and Cyprinus carpio L. to investigate cytosine methylation level using methylation-sensitive amplification polymorphism (MSAP analysis. We observed 38.31% of the methylation changes in the allotetraploid compared with the parents at 355 randomly selected CCGG sites. In terms of methylation status, these results indicate that the level of methylation modification in the allotetraploid may have increased relative to that in the parents. We also found that the major methylation changes were hypermethylation on some genomic fragments and genes related to metabolism or cell cycle regulation. These results provide circumstantial evidence that DNA methylation might be related to the gene expression and phenotype variation in allotetraploid hybrids. Our study partly fulfils the need for epigenetic research in polyploid animals, and provides evidence for the epigenetic regulation of allopolyploids.

  2. Critical threshold levels of DNA methyltransferase 1 are required to maintain DNA methylation across the genome in human cancer cells.

    Science.gov (United States)

    Cai, Yi; Tsai, Hsing-Chen; Yen, Ray-Whay Chiu; Zhang, Yang W; Kong, Xiangqian; Wang, Wei; Xia, Limin; Baylin, Stephen B

    2017-04-01

    Reversing DNA methylation abnormalities and associated gene silencing, through inhibiting DNA methyltransferases (DNMTs) is an important potential cancer therapy paradigm. Maximizing this potential requires defining precisely how these enzymes maintain genome-wide, cancer-specific DNA methylation. To date, there is incomplete understanding of precisely how the three DNMTs, 1, 3A, and 3B, interact for maintaining DNA methylation abnormalities in cancer. By combining genetic and shRNA depletion strategies, we define not only a dominant role for DNA methyltransferase 1 (DNMT1) but also distinct roles of 3A and 3B in genome-wide DNA methylation maintenance. Lowering DNMT1 below a threshold level is required for maximal loss of DNA methylation at all genomic regions, including gene body and enhancer regions, and for maximally reversing abnormal promoter DNA hypermethylation and associated gene silencing to reexpress key genes. It is difficult to reach this threshold with patient-tolerable doses of current DNMT inhibitors (DNMTIs). We show that new approaches, like decreasing the DNMT targeting protein, UHRF1, can augment the DNA demethylation capacities of existing DNA methylation inhibitors for fully realizing their therapeutic potential. © 2017 Cai et al.; Published by Cold Spring Harbor Laboratory Press.

  3. Regulation of homocysteine metabolism and methylation in human and mouse tissues

    Science.gov (United States)

    Chen, Natalie C.; Yang, Fan; Capecci, Louis M.; Gu, Ziyu; Schafer, Andrew I.; Durante, William; Yang, Xiao-Feng; Wang, Hong

    2010-01-01

    Hyperhomocysteinemia is an independent risk factor for cardiovascular disease. Homocysteine (Hcy) metabolism involves multiple enzymes; however, tissue Hcy metabolism and its relevance to methylation remain unknown. Here, we established gene expression profiles of 8 Hcy metabolic and 12 methylation enzymes in 20 human and 19 mouse tissues through bioinformatic analysis using expression sequence tag clone counts in tissue cDNA libraries. We analyzed correlations between gene expression, Hcy, S-adenosylhomocysteine (SAH), and S-adenosylmethionine (SAM) levels, and SAM/SAH ratios in mouse tissues. Hcy metabolic and methylation enzymes were classified into two types. The expression of Type 1 enzymes positively correlated with tissue Hcy and SAH levels. These include cystathionine β-synthase, cystathionine-γ-lyase, paraxonase 1, 5,10-methylenetetrahydrofolate reductase, betaine:homocysteine methyltransferase, methionine adenosyltransferase, phosphatidylethanolamine N-methyltransferases and glycine N-methyltransferase. Type 2 enzyme expressions correlate with neither tissue Hcy nor SAH levels. These include SAH hydrolase, methionyl-tRNA synthase, 5-methyltetrahydrofolate:Hcy methyltransferase, S-adenosylmethionine decarboxylase, DNA methyltransferase 1/3a, isoprenylcysteine carboxyl methyltransferases, and histone-lysine N-methyltransferase. SAH is the only Hcy metabolite significantly correlated with Hcy levels and methylation enzyme expression. We established equations expressing combined effects of methylation enzymes on tissue SAH, SAM, and SAM/SAH ratios. Our study is the first to provide panoramic tissue gene expression profiles and mathematical models of tissue methylation regulation.—Chen, N. C., Yang, F., Capecci, L. M., Gu, Z., Schafer, A. I., Durante, W., Yang, X.-F., Wang, H. Regulation of homocysteine metabolism and methylation in human and mouse tissues. PMID:20305127

  4. Gene structure, expression, and DNA methylation characteristics of sea cucumber cyclin B gene during aestivation.

    Science.gov (United States)

    Zhu, Aijun; Chen, Muyan; Zhang, Xiumei; Storey, Kenneth B

    2016-12-05

    The sea cucumber, Apostichopus japonicus, is a good model for studying environmentally-induced aestivation by a marine invertebrate. One of the central requirements of aestivation is the repression of energy-expensive cellular processes such as cell cycle progression. The present study identified the gene structure of the cell cycle regulator, cyclin B, and detected the expression levels of this gene over three stages of the annual aestivation-arousal cycle. Furthermore, the DNA methylation characteristics of cyclin B were analyzed in non-aestivation and deep-aestivation stages of sea cucumbers. We found that the cyclin B promoter contains a CpG island, three CCAAT-boxes and three cell cycle gene homology regions (CHRs). Application of qRT-PCR analysis showed significant downregulation of cyclin B transcript levels during deep-aestivation in comparison with non-aestivation in both intestine and longitudinal muscle, and these returned to basal levels after arousal from aestivation. Methylation analysis of the cyclin B core promoter revealed that its methylation level showed significant differences between non-aestivation and deep-aestivation stages (p<0.05) and interestingly, a positive correlation between Cyclin B transcripts expression and methylation levels of the core promoter was also observed. Our findings suggest that cell cycle progression may be reversibly arrested during aestivation as indicated by the changes in cyclin B expression levels and we propose that DNA methylation is one of the regulatory mechanisms involved in cyclin B transcriptional variation. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Aberrant DNA methylation of matrix remodeling and cell adhesion related genes in pterygium.

    Directory of Open Access Journals (Sweden)

    Andri K Riau

    Full Text Available BACKGROUND: Pterygium is a common ocular surface disease characterized by abnormal epithelial and fibrovascular proliferation, invasion, and matrix remodeling. This lesion, which migrates from the periphery to the center of the cornea, impairs vision and causes considerable irritation. The mechanism of pterygium formation remains ambiguous, and current treatment is solely surgical excision, with a significant risk of recurrence after surgery. Here, we investigate the role of methylation in DNA sequences that regulate matrix remodeling and cell adhesion in pterygium formation. METHODOLOGY/PRINCIPAL FINDINGS: Pterygium and uninvolved conjunctiva samples were obtained from the same eye of patients undergoing surgery. The EpiTYPER Sequenom technology, based on differential base cleavage and bisulfite sequencing was used to evaluate the extent of methylation of 29 matrix and adhesion related genes. In pterygium, three CpG sites at -268, -32 and -29 bp upstream of transglutaminase 2 (TGM-2 transcription initiation were significantly hypermethylated (p<0.05, whereas hypomethylation was detected at CpGs +484 and +602 bp downstream of matrix metalloproteinase 2 (MMP-2 transcription start site, and -809, -762, -631 and -629 bp upstream of the CD24 transcription start site. RT-qPCR, western blot and immunofluorescent staining showed that transcript and protein expression were reduced for TGM-2 and increased for MMP-2 and CD24. Inhibition of methylation in cultured conjunctival epithelial cells increased these transcripts. CONCLUSIONS/SIGNIFICANCE: We found regions of aberrant DNA methylation which were consistent with alteration of TGM-2, MMP-2, and CD24 transcript and protein expression, and that inhibition of methylation in cultured cells can increase the expression of these genes. Since these genes were related to cell adhesion and matrix remodeling, dysregulation may lead to fibroblastic and neovascular changes and pterygium formation. These results

  6. Altered DNA methylation profile in Norwegian patients with Autoimmune Addison's Disease.

    Science.gov (United States)

    Bjanesoy, Trine E; Andreassen, Bettina Kulle; Bratland, Eirik; Reiner, Andrew; Islam, Shahinul; Husebye, Eystein S; Bakke, Marit

    2014-06-01

    Autoimmune Addison's Disease (AAD) is an endocrine and immunological disease of uncertain pathogenesis resulting from the immune system's destruction of the hormone producing cells of the adrenal cortex. The underlying molecular mechanisms are largely unknown, but it is commonly accepted that a combination of genetic susceptibility and environmental impact is critical. In the present study, we identified multiple hypomethylated gene promoter regions in patients with isolated AAD using DNA isolated from CD4+ T cells. The identified differentially methylated regions were distributed evenly across the 10.5-kb-promoter regions covered by the array, and a substantial number localized to promoters of genes involved in immune regulation and autoimmunity. This study reveals a hypomethylated status in CD4+ T cells from AAD patients and indicates differential methylation of promoters of key genes involved in immune responses. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  7. Genome-wide DNA methylation profiles reveal novel candidate genes associated with meat quality at different age stages in hens.

    Science.gov (United States)

    Zhang, Meng; Yan, Feng-Bin; Li, Fang; Jiang, Ke-Ren; Li, Dong-Hua; Han, Rui-Li; Li, Zhuan-Jan; Jiang, Rui-Rui; Liu, Xiao-Jun; Kang, Xiang-Tao; Sun, Gui-Rong

    2017-04-05

    Poultry meat quality is associated with breed, age, tissue and other factors. Many previous studies have focused on distinct breeds; however, little is known regarding the epigenetic regulatory mechanisms in different age stages, such as DNA methylation. Here, we compared the global DNA methylation profiles between juvenile (20 weeks old) and later laying-period (55 weeks old) hens and identified candidate genes related to the development and meat quality of breast muscle using whole-genome bisulfite sequencing. The results showed that the later laying-period hens, which had a higher intramuscular fat (IMF) deposition capacity and water holding capacity (WHC) and less tenderness, exhibited higher global DNA methylation levels than the juvenile hens. A total of 2,714 differentially methylated regions were identified in the present study, which corresponded to 378 differentially methylated genes, mainly affecting muscle development, lipid metabolism, and the ageing process. Hypermethylation of the promoters of the genes ABCA1, COL6A1 and GSTT1L and the resulting transcriptional down-regulation in the later laying-period hens may be the reason for the significant difference in the meat quality between the juvenile and later laying-period hens. These findings contribute to a better understanding of epigenetic regulation in the skeletal muscle development and meat quality of chicken.

  8. The global DNA methylation surrogate LINE-1 methylation is correlated with MGMT promoter methylation and is a better prognostic factor for glioma.

    Directory of Open Access Journals (Sweden)

    Fumiharu Ohka

    Full Text Available Gliomas are the most frequently occurring primary brain tumor in the central nervous system of adults. Glioblastoma multiformes (GBMs, WHO grade 4 have a dismal prognosis despite the use of the alkylating agent, temozolomide (TMZ, and even low grade gliomas (LGGs, WHO grade 2 eventually transform to malignant secondary GBMs. Although GBM patients benefit from promoter hypermethylation of the O(6-methylguanine-DNA methyltransferase (MGMT that is the main determinant of resistance to TMZ, recent studies suggested that MGMT promoter methylation is of prognostic as well as predictive significance for the efficacy of TMZ. Glioma-CpG island methylator phenotype (G-CIMP in the global genome was shown to be a significant predictor of improved survival in patients with GBM. Collectively, we hypothesized that MGMT promoter methylation might reflect global DNA methylation. Additionally in LGGs, the significance of MGMT promoter methylation is still undetermined. In the current study, we aimed to determine the correlation between clinical, genetic, and epigenetic profiles including LINE-1 and different cancer-related genes and the clinical outcome in newly diagnosed 57 LGG and 54 GBM patients. Here, we demonstrated that (1 IDH1/2 mutation is closely correlated with MGMT promoter methylation and 1p/19q codeletion in LGGs, (2 LINE-1 methylation levels in primary and secondary GBMs are lower than those in LGGs and normal brain tissues, (3 LINE-1 methylation is proportional to MGMT promoter methylation in gliomas, and (4 higher LINE-1 methylation is a favorable prognostic factor in primary GBMs, even compared to MGMT promoter methylation. As a global DNA methylation marker, LINE-1 may be a promising marker in gliomas.

  9. Genome-wide signatures of differential DNA methylation in pediatric acute lymphoblastic leukemia

    DEFF Research Database (Denmark)

    Nordlund, Jessica; Bäcklin, Christofer L; Wahlberg, Per

    2013-01-01

    BACKGROUND: Although aberrant DNA methylation has been observed previously in acute lymphoblastic leukemia (ALL), the patterns of differential methylation have not been comprehensively determined in all subtypes of ALL on a genome-wide scale. The relationship between DNA methylation, cytogenetic...... background, drug resistance and relapse in ALL is poorly understood. RESULTS: We surveyed the DNA methylation levels of 435,941 CpG sites in samples from 764 children at diagnosis of ALL and from 27 children at relapse. This survey uncovered four characteristic methylation signatures. First, compared...... cells at relapse, compared with matched samples at diagnosis. Analysis of relapse-free survival identified CpG sites with subtype-specific differential methylation that divided the patients into different risk groups, depending on their methylation status. CONCLUSIONS: Our results suggest an important...

  10. A Flexible, Efficient Binomial Mixed Model for Identifying Differential DNA Methylation in Bisulfite Sequencing Data

    Science.gov (United States)

    Lea, Amanda J.

    2015-01-01

    Identifying sources of variation in DNA methylation levels is important for understanding gene regulation. Recently, bisulfite sequencing has become a popular tool for investigating DNA methylation levels. However, modeling bisulfite sequencing data is complicated by dramatic variation in coverage across sites and individual samples, and because of the computational challenges of controlling for genetic covariance in count data. To address these challenges, we present a binomial mixed model and an efficient, sampling-based algorithm (MACAU: Mixed model association for count data via data augmentation) for approximate parameter estimation and p-value computation. This framework allows us to simultaneously account for both the over-dispersed, count-based nature of bisulfite sequencing data, as well as genetic relatedness among individuals. Using simulations and two real data sets (whole genome bisulfite sequencing (WGBS) data from Arabidopsis thaliana and reduced representation bisulfite sequencing (RRBS) data from baboons), we show that our method provides well-calibrated test statistics in the presence of population structure. Further, it improves power to detect differentially methylated sites: in the RRBS data set, MACAU detected 1.6-fold more age-associated CpG sites than a beta-binomial model (the next best approach). Changes in these sites are consistent with known age-related shifts in DNA methylation levels, and are enriched near genes that are differentially expressed with age in the same population. Taken together, our results indicate that MACAU is an efficient, effective tool for analyzing bisulfite sequencing data, with particular salience to analyses of structured populations. MACAU is freely available at www.xzlab.org/software.html. PMID:26599596

  11. Paternal stress prior to conception alters DNA methylation and behaviour of developing rat offspring.

    Science.gov (United States)

    Mychasiuk, R; Harker, A; Ilnytskyy, S; Gibb, R

    2013-06-25

    Although there has been an abundance of research focused on offspring outcomes associated with maternal experiences, there has been limited examination of the relationship between paternal experiences and offspring brain development. As spermatogenesis is a continuous process, experiences that have the ability to alter epigenetic regulation in fathers may actually change developmental trajectories of offspring. The purpose of this study was to examine the effects of paternal stress prior to conception on behaviour and the epigenome of both male and female developing rat offspring. Male Long-Evans rats were stressed for 27 consecutive days and then mated with control female rats. Early behaviour was tested in offspring using the negative geotaxis task and the open field. At P21 offspring were sacrificed and global DNA methylation levels in the hippocampus and frontal cortex were analysed. Paternal stress prior to conception altered behaviour of all offspring on the negative geotaxis task, delaying acquisition of the task. In addition, male offspring demonstrated a reduction in stress reactivity in the open field paradigm spending more time than expected in the centre of the open field. Paternal stress also altered DNA methylation patterns in offspring at P21, global methylation was reduced in the frontal cortex of female offspring, but increased in the hippocampus of both male and female offspring. The results from this study clearly demonstrate that paternal stress during spermatogenesis can influence offspring behaviour and DNA methylation patterns, and these affects occur in a sex-dependent manner. Development takes place in the centre of a complex interaction between maternal, paternal, and environmental influences, which combine to produce the various phenotypes and individual differences that we perceive. Copyright © 2013 IBRO. Published by Elsevier Ltd. All rights reserved.

  12. Protective effects of folic acid on DNA damage and DNA methylation levels induced by N-methyl- N'-nitro- N-nitrosoguanidine in Kazakh esophageal epithelial cells.

    Science.gov (United States)

    Chen, Y; Feng, H; Chen, D; Abuduwaili, K; Li, X; Zhang, H

    2018-01-01

    The protective effects of folic acid on DNA damage and DNA methylation induced by N-methyl- N'-nitro- N-nitrosoguanidine (MNNG) in Kazakh esophageal epithelial cells were investigated using a 3 × 3 factorial design trial. The cells were cultured in vitro and exposed to media containing different concentrations of folic acid and MNNG, after which growth indices were detected. DNA damage levels were measured using comet assays, and genome-wide DNA methylation levels (MLs) were measured using high-performance liquid chromatography. The DNA methylation of methylenetetrahydrofolate reductase (MTHFR) and folate receptor- α (FR α) genes was detected by bisulfite sequencing polymerase chain reaction (PCR). The results showed significant increases in tail DNA concentration, tail length, and Olive tail moment ( p methylation frequencies of MTHFR and FR α genes. In particular, significant differences were observed in the promoter regions of both genes ( p methylation in Kazakh esophageal epithelial cells upon MNNG exposure. Thus, sufficient folic acid levels could play a protective role against the damage induced by this compound.

  13. Stress-induced DNA methylation changes and their heritability in asexual dandelions

    NARCIS (Netherlands)

    Verhoeven, K.J.F.; Jansen, J.J.; Van Dijk, P.J.; Biere, A.

    2010-01-01

    DNA methylation can cause heritable phenotypic modifications in the absence of changes in DNA sequence. Environmental stresses can trigger methylation changes and this may have evolutionary consequences, even in the absence of sequence variation. However, it remains largely unknown to what extent

  14. Stress-induced DNA methylation changes and their heritability in asexual dandelions

    NARCIS (Netherlands)

    Verhoeven, K.J.F.; Jansen, J.J.; Dijk, P.J.; Biere, A.

    2010-01-01

    DNA methylation can cause heritable phenotypic modifications in the absence of changes in DNA sequence. Environmental stresses can trigger methylation changes and this may have evolutionary consequences, even in the absence of sequence variation. However, it remains largely unknown to what extent

  15. Association of season of birth with DNA methylation and allergic disease

    NARCIS (Netherlands)

    Lockett, G. A.; Soto-Ramirez, N.; Ray, M. A.; Everson, T. M.; Xu, C-J.; Patil, V. K.; Terry, W.; Kaushal, A.; Rezwan, F. I.; Ewart, S. L.; Gehring, U.; Postma, D. S.; Koppelman, G. H.; Arshad, S. H.; Zhang, H.; Karmaus, W.; Holloway, J. W.

    BackgroundSeason of birth influences allergy risk; however, the biological mechanisms underlying this observation are unclear. The environment affects DNA methylation, with potentially long-lasting effects on gene expression and disease. This study examined whether DNA methylation could underlie the

  16. GWAS of DNA Methylation Variation Within Imprinting Control Regions Suggests Parent-of-Origin Association

    NARCIS (Netherlands)

    Renteria, M.E.; Coolen, M.W.; Statham, A.L.; Choi, R.S.; Qu, W.; Campbell, M.J.; Smith, S.; Henders, A.K.; Montgomery, G.W.; Clark, S. J.; Martin, N.G.; Medland, S.E.

    2013-01-01

    Imprinting control regions (ICRs) play a fundamental role in establishing and maintaining the non-random monoallelic expression of certain genes, via common regulatory elements such as non-coding RNAs and differentially methylated regions (DMRs) of DNA. We recently surveyed DNA methylation levels

  17. Genome-wide DNA methylation analysis of the porcine hypothalamus-pituitary-ovary axis

    DEFF Research Database (Denmark)

    Yuan, Xiao Long; Zhang, Zhe; Li, Bin

    2017-01-01

    Previous studies have suggested that DNA methylation in both CpG and CpH (where H = C, T or A) contexts plays a critical role in biological functions of different tissues. However, the genome-wide DNA methylation patterns of porcine hypothalamus-pituitary-ovary (HPO) tissues remain virtually unex...

  18. The interplay between environmental factors and DNA methylation in psychotic disorders : Environmental orchestration of the epigenome

    NARCIS (Netherlands)

    Houtepen, LC

    2016-01-01

    Introduction: Environmental exposures during early- life increase the risk of developing a psychotic disorder, but it remains unclear how early life events can have such persistent later life consequences. DNA methylation is the addition of a methyl group to a DNA base and is part of a group of

  19. Involvement of DNA methylation in memory processing in the honey bee.

    Science.gov (United States)

    Lockett, Gabrielle A; Helliwell, Paul; Maleszka, Ryszard

    2010-08-23

    DNA methylation, an important and evolutionarily conserved epigenetic mechanism, is implicated in learning and memory processes in vertebrates, but its role in behaviour in invertebrates is unknown. We examined the role of DNA methylation in memory in the honey bee using an appetitive Pavlovian olfactory discrimination task, and by assessing the expression of DNA methyltransferase3, a key driver of epigenetic reprogramming. Here we report that DNA methyltransferase inhibition reduces acquisition retention and alters the extinction depending on treatment time, and DNA methyltransferase3 is upregulated after training. Our findings add to the understanding of epigenetic mechanisms in learning and memory, extending known roles of DNA methylation to appetitive and extinction memory, and for the first time implicate DNA methylation in memory in invertebrates.

  20. Aberrantly methylated DNA as a biomarker in breast cancer

    DEFF Research Database (Denmark)

    Kristiansen, Søren; Jørgensen, Lars Mønster; Guldberg, Per

    2013-01-01

    hypermethylation events, their use as tumor biomarkers is usually not hampered by analytical signals from normal cells, which is a general problem for existing protein tumor markers used for clinical assessment of breast cancer. There is accumulating evidence that DNA-methylation changes in breast cancer patients...... occur early during tumorigenesis. This may open up for effective screening, and analysis of blood or nipple aspirate may later help in diagnosing breast cancer. As a more detailed molecular characterization of different types of breast cancer becomes available, the ability to divide patients...... as a versatile biomarker tool for screening, diagnosis, prognosis and monitoring of breast cancer. Standardization of methods and biomarker panels will be required to fully exploit this clinical potential....

  1. DNA methylation-based classification of central nervous system tumours

    DEFF Research Database (Denmark)

    Capper, David; Jones, David T.W.; Sill, Martin

    2018-01-01

    Accurate pathological diagnosis is crucial for optimal management of patients with cancer. For the approximately 100 known tumour types of the central nervous system, standardization of the diagnostic process has been shown to be particularly challenging - with substantial inter-observer variabil......Accurate pathological diagnosis is crucial for optimal management of patients with cancer. For the approximately 100 known tumour types of the central nervous system, standardization of the diagnostic process has been shown to be particularly challenging - with substantial inter......-observer variability in the histopathological diagnosis of many tumour types. Here we present a comprehensive approach for the DNA methylation-based classification of central nervous system tumours across all entities and age groups, and demonstrate its application in a routine diagnostic setting. We show...

  2. DNA methylation program in developing hippocampus and its alteration by alcohol.

    Directory of Open Access Journals (Sweden)

    Yuanyuan Chen

    Full Text Available During hippocampal development, the Cornus Ammonis (CA and the dentate gyrus (DG undergo waves of neurogenesis and neuronal migration and maturation independently. This stage is widely known to be vulnerable to environmental stresses, but its underlying mechanism is unclear. Alcohol exposure has been shown to alter the expression of genes that regulate the fate, survival, migration and differentiation of pyramidal and granule cells. Undermining this process might compromise hippocampal development underlying the learning and memory deficits known in Fetal Alcohol Spectrum Disorders (FASD. We have previously demonstrated that DNA methylation was programmed along with neural tube development. Here, we demonstrated that DNA methylation program (DMP proceeded along with hippocampal neuronal differentiation and maturation, and how this DMP was affected by fetal alcohol exposure. C57BL/6 mice were treated with 4% v/v ethanol through a liquid diet along with pair-fed and chow-fed controls from gestation day (E 7 to E16. We found that a characteristic DMP, including 5-methylcytidine (5mC, 5-hydroxylmethylcytidine (5hmC and their binding proteins, led the hippocampal neuronal differentiation and maturation spatiotemporally as indicated by their phenotypic marks in the CA and DG pre- and post-natally. Alcohol hindered the acquisition and progression of methylation marks, and altered the chromatin translocation of these marks in the nucleus, which was correlated with developmental retardation.

  3. EXTRACELLULAR DNA AND THE LEVEL OF ITS METHYLATION IN DIFFERENT RHEUMATIC DISEASES

    Directory of Open Access Journals (Sweden)

    N O Shubayeva

    2012-01-01

    Conclusion. RDs are characterized by the higher concentration of apoptotic and necrotic DNA, impaired exDNA methylation, varying complexification of exDNA with monometinic proteins, which is associated with the hyperproduction of autoantibodies (including anti-exDNA antibodies and inflammatory markers.

  4. A unique regulatory phase of DNA methylation in the early mammalian embryo

    OpenAIRE

    Smith, Zachary D.; Chan, Michelle M.; Mikkelsen, Tarjei S.; Gu, Hongcang; Gnirke, Andreas; Regev, Aviv; Meissner, Alexander

    2012-01-01

    Summary DNA methylation is highly dynamic during mammalian embryogenesis. It is broadly accepted that the paternal genome is actively depleted of 5-methyl cytosine at fertilization, followed by passive loss that reaches a minimum at the blastocyst stage. However, this model is based on limited data, and to date no base-resolution maps exist to support and refine it. Here, we generated genome-scale DNA methylation maps in mouse gametes and through post-implantation embryogenesis. We find that ...

  5. The dynamic changes of DNA methylation and histone modifications of salt responsive transcription factor genes in soybean.

    Directory of Open Access Journals (Sweden)

    Yuguang Song

    Full Text Available Epigenetic modification contributes to the regulation of gene expression and plant development under salinity stress. Here we describe the identification of 49 soybean transcription factors by microarray analysis as being inducible by salinity stress. A semi-quantitative RT-PCR-based expression assay confirmed the salinity stress inducibility of 45 of these 49 transcription factors, and showed that ten of them were up-regulated when seedlings were exposed to the demethylation agent 5-aza-2-deoxycytidine. Salinity stress was shown to affect the methylation status of four of these ten transcription factors (one MYB, one b-ZIP and two AP2/DREB family members using a combination of bisulfite sequencing and DNA methylation-sensitive DNA gel blot analysis. ChIP analysis indicated that the activation of three of the four DNA methylated transcription factors was correlated with an increased level of histone H3K4 trimethylation and H3K9 acetylation, and/or a reduced level of H3K9 demethylation in various parts of the promoter or coding regions. Our results suggest a critical role for some transcription factors' activation/repression by DNA methylation and/or histone modifications in soybean tolerance to salinity stress.

  6. Reduced DNA repair in mouse satellite DNA after treatment with methylmethanesulfonate, and N-methyl-N-nitrosourea.

    Science.gov (United States)

    Bodell, W J; Banerjee, M R

    1976-01-01

    We have measured DNA repair in mouse satellite and main band DNA as resolved by Ag+-Cs2SO4 centrifugation in response to treatment with the alkylating agents, methyl methanesulfonate, and N-methyl-N-nitrosourea. We find that there is a statistically significant lower incorporation of 3H-Tdr into the satellite DNA as compared to the main band at varying periods after treatment with the alkylating agents. This suggests a reduced repair activity in the satellite DNA. We have measured the extent of binding of 14C-methyl methanesulfonate to the satellite, and main band DNA, and no difference in binding was observed, indicating that the reduced repair activity of satellite DNA is not due to a difference in binding of alkylating agents. We believe that the reduced incorporation of 3H-Tdr into satellite DNA may be due to its location in the condensed chromatin fraction. PMID:184436

  7. Dietary selenomethionine increases exon-specific DNA methylation of the p53 gene in rat liver and colon mucosa.

    Science.gov (United States)

    Zeng, Huawei; Yan, Lin; Cheng, Wen-Hsing; Uthus, Eric O

    2011-08-01

    The regulation of site-specific DNA methylation of tumor suppressor genes has been considered as a leading mechanism by which certain nutrients exert their anticancer property. This study was to investigate whether selenium (Se) affects the methylation of globe genomic DNA and the exon-specific p53 gene. Three groups of rats (n = 6-7/group) were fed the AIN-93G basal diet supplemented with 0 [Se deficient (D)], 0.15 [Se adequate (A)], or 4 mg [Se supranutritional (S)] (Se as l-selenomethionine)/kg diet for 104 d, respectively. Rats fed the A or S diet had greater plasma and liver glutathione peroxidase activity, liver thioredoxin reductase activity, and plasma homocysteine concentration than those fed the D diet. However, compared with the A diet, rats fed the S diet did not further increase these Se-dependent enzyme activities or homocysteine concentration. In contrast, Se concentrations in kidney, liver, gastrocnemius muscle, and plasma were increased in a Se-dose-dependent manner. Interestingly, rats fed the S diet had significantly less global liver genomic DNA methylation than those fed the D diet. However, the S diet significantly increased the methylation of the p53 gene (exons 5-8) but not the β-actin gene (exons 2-3) DNA in liver and colon mucosa compared with those fed the D diet. Taken together, long-term Se consumption not only affects selenoprotein enzyme activities, homocysteine, tissue Se concentrations, and global genomic DNA methylation but also increases exon-specific DNA methylation of the p53 gene in a Se-dose-dependent manner in rat liver and colon mucosa.

  8. Role of methionine on epigenetic modification of DNA methylation and gene expression in animals

    Directory of Open Access Journals (Sweden)

    Naifeng Zhang

    2018-03-01

    Full Text Available DNA methylation is one of the main epigenetic phenomena affecting gene expression. It is an important mechanism for the development of embryo, growth and health of animals. As a key nutritional factor limiting the synthesis of protein, methionine serves as the precursor of S-adenosylmethionine (SAM in the hepatic one-carbon metabolism. The dietary fluctuation of methionine content can alter the levels of metabolic substrates in one-carbon metabolism, e.g., the SAM, S-adenosylhomocysteine (SAH, and change the expression of genes related to the growth and health of animals by DNA methylation reactions. The ratio of SAM to SAH is called ‘methylation index’ but it should be carefully explained because the complexity of methylation reaction. Alterations of methylation in a specific cytosine-guanine (CpG site, rather than the whole promoter region, might be enough to change gene expression. Aberrant methionine cycle may provoke molecular changes of one-carbon metabolism that results in deregulation of cellular hemostasis and health problems. The importance of DNA methylation has been underscored but the mechanisms of methionine affecting DNA methylation are poorly understood. Nutritional epigenomics provides a promising insight into the targeting epigenetic changes in animals from a nutritional standpoint, which will deepen and expand our understanding of genes, molecules, tissues, and animals in which methionine alteration influences DNA methylation and gene expression. Keywords: Epigenetics, Methionine, DNA methylation, Gene expression, Epigenetic modification

  9. Trichloroethylene-induced gene expression and DNA methylation changes in B6C3F1 mouse liver.

    Directory of Open Access Journals (Sweden)

    Yan Jiang

    Full Text Available Trichloroethylene (TCE, widely used as an organic solvent in the industry, is a common contaminant in air, soil, and water. Chronic TCE exposure induced hepatocellular carcinoma in mice, and occupational exposure in humans was suggested to be associated with liver cancer. To understand the role of non-genotoxic mechanism(s for TCE action, we examined the gene expression and DNA methylation changes in the liver of B6C3F1 mice orally administered with TCE (0, 100, 500 and 1000 mg/kg b.w. per day for 5 days. After 5 days TCE treatment at a dose level of 1000 mg/kg b.w., a total of 431 differentially expressed genes were identified in mouse liver by microarray, of which 291 were up-regulated and 140 down-regulated. The expression changed genes were involved in key signal pathways including PPAR, proliferation, apoptosis and homologous recombination. Notably, the expression level of a number of vital genes involved in the regulation of DNA methylation, such as Utrf1, Tet2, DNMT1, DNMT3a and DNMT3b, were dysregulated. Although global DNA methylation change was not detected in the liver of mice exposed to TCE, the promoter regions of Cdkn1a and Ihh were found to be hypo- and hypermethylated respectively, which correlated negatively with their mRNA expression changes. Furthermore, the gene expression and DNA methylation changes induced by TCE were dose dependent. The overall data indicate that TCE exposure leads to aberrant DNA methylation changes, which might alter the expression of genes involved in the TCE-induced liver tumorgenesis.

  10. The MTHFR 677TT genotype and folate intake interact to lower global leukocyte DNA methylation in young Mexican American women.

    OpenAIRE

    Axume, Juan; Smith, Steven S; Pogribny, Igor P; Moriarty, David J.; Caudill., Marie A.

    2007-01-01

    DNA methylation is an epigenetic feature that is associated with X chromosome inactivation, genomic imprinting, transcriptional silencing of genes and genomic stability. Folate provides a labile source of methyl groups which may be used for cellular methylation reactions including DNA methylation. The methylenetetrahydrofolate reductase (MTHFR) 677C→T variant is an important determinant of folate nutriture and may influence DNA methylation. This study sought to assess the influence of the MTH...

  11. Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

    International Nuclear Information System (INIS)

    Tian, Kegui; Wang, Yuezeng; Huang, Yu; Sun, Boqiao; Li, Yuxin; Xu, Haopeng

    2008-01-01

    Previous results showed that over-expression of the WTH3 gene in MDR cells reduced MDR1 gene expression and converted their resistance to sensitivity to various anticancer drugs. In addition, the WTH3 gene promoter was hypermethylated in the MCF7/AdrR cell line and primary drug resistant breast cancer epithelial cells. WTH3 was also found to be directly targeted and up regulated by the p53 gene. Furthermore, over expression of the WTH3 gene promoted the apoptotic phenotype in various host cells. To further confirm WTH3's drug resistant related characteristics, we recently employed the small hairpin RNA (shRNA) strategy to knockdown its expression in HEK293 cells. In addition, since the WTH3 promoter's p53-binding site was located in a CpG island that was targeted by methylation, we were interested in testing the possible effect this epigenetic modification had on the p53 transcription factor relative to WTH3 expression. To do so, the in vitro methylation method was utilized to examine the p53 transgene's influence on either the methylated or non-methylated WTH3 promoter. The results generated from the gene knockdown strategy showed that reduction of WTH3 expression increased MDR1 expression and elevated resistance to Doxorubicin as compared to the original control cells. Data produced from the methylation studies demonstrated that DNA methylation adversely affected the positive impact of p53 on WTH3 promoter activity. Taken together, our studies provided further evidence that WTH3 played an important role in MDR development and revealed one of its transcription regulatory mechanisms, DNA methylation, which antagonized p53's positive impact on WTH3 expression

  12. Epigenetic Variation in Monozygotic Twins: A Genome-Wide Analysis of DNA Methylation in Buccal Cells

    Directory of Open Access Journals (Sweden)

    Jenny van Dongen

    2014-05-01

    Full Text Available DNA methylation is one of the most extensively studied epigenetic marks in humans. Yet, it is largely unknown what causes variation in DNA methylation between individuals. The comparison of DNA methylation profiles of monozygotic (MZ twins offers a unique experimental design to examine the extent to which such variation is related to individual-specific environmental influences and stochastic events or to familial factors (DNA sequence and shared environment. We measured genome-wide DNA methylation in buccal samples from ten MZ pairs (age 8–19 using the Illumina 450k array and examined twin correlations for methylation level at 420,921 CpGs after QC. After selecting CpGs showing the most variation in the methylation level between subjects, the mean genome-wide correlation (rho was 0.54. The correlation was higher, on average, for CpGs within CpG islands (CGIs, compared to CGI shores, shelves and non-CGI regions, particularly at hypomethylated CpGs. This finding suggests that individual-specific environmental and stochastic influences account for more variation in DNA methylation in CpG-poor regions. Our findings also indicate that it is worthwhile to examine heritable and shared environmental influences on buccal DNA methylation in larger studies that also include dizygotic twins.

  13. Cocoa Consumption Alters the Global DNA Methylation of Peripheral Leukocytes in Humans with Cardiovascular Disease Risk Factors: A Randomized Controlled Trial.

    Science.gov (United States)

    Crescenti, Anna; Solà, Rosa; Valls, Rosa M; Caimari, Antoni; Del Bas, Josep M; Anguera, Anna; Anglés, Neus; Arola, Lluís

    2013-01-01

    DNA methylation regulates gene expression and can be modified by different bioactive compounds in foods, such as polyphenols. Cocoa is a rich source of polyphenols, but its role in DNA methylation is still unknown. The objective was to assess the effect of cocoa consumption on DNA methylation and to determine whether the enzymes involved in the DNA methylation process participate in the mechanisms by which cocoa exerts these effects in humans. The global DNA methylation levels in the peripheral blood were evaluated in 214 volunteers who were pre-hypertensive, stage-1 hypertensive or hypercholesterolemic. The volunteers were divided into two groups: 110 subjects who consumed cocoa (6 g/d) for two weeks and 104 control subjects. In addition, the peripheral blood mononuclear cells (PBMCs) from six subjects were treated with a cocoa extract to analyze the mRNA levels of the DNA methyltransferases (DNMTs), methylenetetrahydrofolate reductase (MTHFR), and methionine synthase reductase (MTRR) genes. Cocoa consumption significantly reduced the DNA methylation levels (2.991±0.366 vs. 3.909±0.380, pcocoa effects on DNA methylation and three polymorphisms located in the MTHFR, MTRR, and DNMT3B genes. Furthermore, in PBMCs, the cocoa extract significantly lowered the mRNA levels of the DNMTs, MTHFR, and MTRR. Our study demonstrates for the first time that the consumption of cocoa decreases the global DNA methylation of peripheral leukocytes in humans with cardiovascular risk factors. In vitro experiments with PBMCs suggest that cocoa may exert this effect partially via the down-regulation of DNMTs, MTHFR and MTRR, which are key genes involved in this epigenetic process. Clinicaltrials.govNCT00511420 and NCT00502047.

  14. Cocoa Consumption Alters the Global DNA Methylation of Peripheral Leukocytes in Humans with Cardiovascular Disease Risk Factors: A Randomized Controlled Trial.

    Directory of Open Access Journals (Sweden)

    Anna Crescenti

    Full Text Available DNA methylation regulates gene expression and can be modified by different bioactive compounds in foods, such as polyphenols. Cocoa is a rich source of polyphenols, but its role in DNA methylation is still unknown. The objective was to assess the effect of cocoa consumption on DNA methylation and to determine whether the enzymes involved in the DNA methylation process participate in the mechanisms by which cocoa exerts these effects in humans. The global DNA methylation levels in the peripheral blood were evaluated in 214 volunteers who were pre-hypertensive, stage-1 hypertensive or hypercholesterolemic. The volunteers were divided into two groups: 110 subjects who consumed cocoa (6 g/d for two weeks and 104 control subjects. In addition, the peripheral blood mononuclear cells (PBMCs from six subjects were treated with a cocoa extract to analyze the mRNA levels of the DNA methyltransferases (DNMTs, methylenetetrahydrofolate reductase (MTHFR, and methionine synthase reductase (MTRR genes. Cocoa consumption significantly reduced the DNA methylation levels (2.991±0.366 vs. 3.909±0.380, p<0.001. Additionally, we found an association between the cocoa effects on DNA methylation and three polymorphisms located in the MTHFR, MTRR, and DNMT3B genes. Furthermore, in PBMCs, the cocoa extract significantly lowered the mRNA levels of the DNMTs, MTHFR, and MTRR. Our study demonstrates for the first time that the consumption of cocoa decreases the global DNA methylation of peripheral leukocytes in humans with cardiovascular risk factors. In vitro experiments with PBMCs suggest that cocoa may exert this effect partially via the down-regulation of DNMTs, MTHFR and MTRR, which are key genes involved in this epigenetic process.Clinicaltrials.govNCT00511420 and NCT00502047.

  15. Towards an understanding of CG methylation in DNA transcription

    International Nuclear Information System (INIS)

    Chela-Flores, J.; Migoni, R.L.

    1989-09-01

    A simple model of DNA is considered in which the nucleotides cytosine (C) and guanine (G) are not assumed to be identical, and in which macroscopic thermodynamic quantities may be calculated exactly. The H bonds between the C and G nucleotides are assumed to be Morse potentials. We discuss the statistical mechanics of the DNA molecule in the configuration (5'...GGG...3'; 3'...CCC...5'), which may be copied by RNA polymerase into a messenger RNA (mRNA) strand (5'...CCC...3'). This model suggests that replacements of C by 5-methylcytosine (5mC) may be a secondary effect in the inhibition of genetic expression, not interfering directly with the formation of an open state. An experimental test is suggested. The implications of this result are discussed for a related system, in which the enzyme methylase is known to methylate almost exclusively those Cs that are followed by Gs as a regulatory strategy employed by some eukaryotes. (author). 14 refs, 2 figs

  16. ATM Mediates pRB Function To Control DNMT1 Protein Stability and DNA Methylation

    Science.gov (United States)

    Suzuki, Misa; Hayashi, Naoyuki; Kobayashi, Masahiko; Sasaki, Nobunari; Nishiuchi, Takumi; Doki, Yuichiro; Okamoto, Takahiro; Kohno, Susumu; Muranaka, Hayato; Kitajima, Shunsuke; Yamamoto, Ken-ichi

    2013-01-01

    The retinoblastoma tumor suppressor gene (RB) product has been implicated in epigenetic control of gene expression owing to its ability to physically bind to many chromatin modifiers. However, the biological and clinical significance of this activity was not well elucidated. To address this, we performed genetic and epigenetic analyses in an Rb-deficient mouse thyroid C cell tumor model. Here we report that the genetic interaction of Rb and ATM regulates DNMT1 protein stability and hence controls the DNA methylation status in the promoters of at least the Ink4a, Shc2, FoxO6, and Noggin genes. Furthermore, we demonstrate that inactivation of pRB promotes Tip60 (acetyltransferase)-dependent ATM activation; allows activated ATM to physically bind to DNMT1, forming a complex with Tip60 and UHRF1 (E3 ligase); and consequently accelerates DNMT1 ubiquitination driven by Tip60-dependent acetylation. Our results indicate that inactivation of the pRB pathway in coordination with aberration in the DNA damage response deregulates DNMT1 stability, leading to an abnormal DNA methylation pattern and malignant progression. PMID:23754744

  17. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  18. Caulobacter crescentus Cell Cycle-Regulated DNA Methyltransferase Uses a Novel Mechanism for Substrate Recognition.

    Science.gov (United States)

    Woodcock, Clayton B; Yakubov, Aziz B; Reich, Norbert O

    2017-08-01

    Caulobacter crescentus relies on DNA methylation by the cell cycle-regulated methyltransferase (CcrM) in addition to key transcription factors to control the cell cycle and direct cellular differentiation. CcrM is shown here to efficiently methylate its cognate recognition site 5'-GANTC-3' in single-stranded and hemimethylated double-stranded DNA. We report the K m , k cat , k methylation , and K d for single-stranded and hemimethylated substrates, revealing discrimination of 10 7 -fold for noncognate sequences. The enzyme also shows a similar discrimination against single-stranded RNA. Two independent assays clearly show that CcrM is highly processive with single-stranded and hemimethylated DNA. Collectively, the data provide evidence that CcrM and other DNA-modifying enzymes may use a new mechanism to recognize DNA in a key epigenetic process.

  19. Adjustment of Cell-Type Composition Minimizes Systematic Bias in Blood DNA Methylation Profiles Derived by DNA Collection Protocols.

    Science.gov (United States)

    Shiwa, Yuh; Hachiya, Tsuyoshi; Furukawa, Ryohei; Ohmomo, Hideki; Ono, Kanako; Kudo, Hisaaki; Hata, Jun; Hozawa, Atsushi; Iwasaki, Motoki; Matsuda, Koichi; Minegishi, Naoko; Satoh, Mamoru; Tanno, Kozo; Yamaji, Taiki; Wakai, Kenji; Hitomi, Jiro; Kiyohara, Yutaka; Kubo, Michiaki; Tanaka, Hideo; Tsugane, Shoichiro; Yamamoto, Masayuki; Sobue, Kenji; Shimizu, Atsushi

    2016-01-01

    Differences in DNA collection protocols may be a potential confounder in epigenome-wide association studies (EWAS) using a large number of blood specimens from multiple biobanks and/or cohorts. Here we show that pre-analytical procedures involved in DNA collection can induce systematic bias in the DNA methylation profiles of blood cells that can be adjusted by cell-type composition variables. In Experiment 1, whole blood from 16 volunteers was collected to examine the effect of a 24 h storage period at 4°C on DNA methylation profiles as measured using the Infinium HumanMethylation450 BeadChip array. Our statistical analysis showed that the P-value distribution of more than 450,000 CpG sites was similar to the theoretical distribution (in quantile-quantile plot, λ = 1.03) when comparing two control replicates, which was remarkably deviated from the theoretical distribution (λ = 1.50) when comparing control and storage conditions. We then considered cell-type composition as a possible cause of the observed bias in DNA methylation profiles and found that the bias associated with the cold storage condition was largely decreased (λ adjusted = 1.14) by taking into account a cell-type composition variable. As such, we compared four respective sample collection protocols used in large-scale Japanese biobanks or cohorts as well as two control replicates. Systematic biases in DNA methylation profiles were observed between control and three of four protocols without adjustment of cell-type composition (λ = 1.12-1.45) and no remarkable biases were seen after adjusting for cell-type composition in all four protocols (λ adjusted = 1.00-1.17). These results revealed important implications for comparing DNA methylation profiles between blood specimens from different sources and may lead to discovery of disease-associated DNA methylation markers and the development of DNA methylation profile-based predictive risk models.

  20. Adjustment of Cell-Type Composition Minimizes Systematic Bias in Blood DNA Methylation Profiles Derived by DNA Collection Protocols.

    Directory of Open Access Journals (Sweden)

    Yuh Shiwa

    Full Text Available Differences in DNA collection protocols may be a potential confounder in epigenome-wide association studies (EWAS using a large number of blood specimens from multiple biobanks and/or cohorts. Here we show that pre-analytical procedures involved in DNA collection can induce systematic bias in the DNA methylation profiles of blood cells that can be adjusted by cell-type composition variables. In Experiment 1, whole blood from 16 volunteers was collected to examine the effect of a 24 h storage period at 4°C on DNA methylation profiles as measured using the Infinium HumanMethylation450 BeadChip array. Our statistical analysis showed that the P-value distribution of more than 450,000 CpG sites was similar to the theoretical distribution (in quantile-quantile plot, λ = 1.03 when comparing two control replicates, which was remarkably deviated from the theoretical distribution (λ = 1.50 when comparing control and storage conditions. We then considered cell-type composition as a possible cause of the observed bias in DNA methylation profiles and found that the bias associated with the cold storage condition was largely decreased (λ adjusted = 1.14 by taking into account a cell-type composition variable. As such, we compared four respective sample collection protocols used in large-scale Japanese biobanks or cohorts as well as two control replicates. Systematic biases in DNA methylation profiles were observed between control and three of four protocols without adjustment of cell-type composition (λ = 1.12-1.45 and no remarkable biases were seen after adjusting for cell-type composition in all four protocols (λ adjusted = 1.00-1.17. These results revealed important implications for comparing DNA methylation profiles between blood specimens from different sources and may lead to discovery of disease-associated DNA methylation markers and the development of DNA methylation profile-based predictive risk models.

  1. Elevated polygenic burden for autism is associated with differential DNA methylation at birth

    DEFF Research Database (Denmark)

    Hannon, Eilis; Schendel, Diana; Ladd-Acosta, Christine

    2018-01-01

    BACKGROUND: Autism spectrum disorder (ASD) is a severe neurodevelopmental disorder characterized by deficits in social communication and restricted, repetitive behaviors, interests, or activities. The etiology of ASD involves both inherited and environmental risk factors, with epigenetic processes...... hypothesized as one mechanism by which both genetic and non-genetic variation influence gene regulation and pathogenesis. The aim of this study was to identify DNA methylation biomarkers of ASD detectable at birth. METHODS: We quantified neonatal methylomic variation in 1263 infants-of whom ~ 50% went...... on to subsequently develop ASD-using DNA isolated from archived blood spots taken shortly after birth. We used matched genotype data from the same individuals to examine the molecular consequences of ASD-associated genetic risk variants, identifying methylomic variation associated with elevated polygenic burden...

  2. Hydroxylation of methylated DNA by TET1 in chondrocyte differentiation of C3H10T1/2 cells

    Directory of Open Access Journals (Sweden)

    Ryo Ito

    2016-03-01

    Full Text Available DNA methylation is closely involved in the regulation of cellular differentiation, including chondrogenic differentiation of mesenchymal stem cells. Recent studies showed that Ten–eleven translocation (TET family proteins converted 5-methylcytosine (5mC to 5-hydroxymethylcytosine, 5-formylcytosine and 5carboxylcytosine by oxidation. These reactions constitute potential mechanisms for active demethylation of methylated DNA. However, the relationship between the DNA methylation patterns and the effects of TET family proteins in chondrocyte differentiation is still unclear. In this study, we showed that DNA hydroxylation of 5mC was increased during chondrocytic differentiation of C3H10T1/2 cells and that the expression of Tet1 was particularly enhanced. Moreover, knockdown experiments revealed that the downregulation of Tet1 expression caused decreases in chondrogenesis markers such as type 2 and type 10 collagens. Furthermore, we found that TET proteins had a site preference for hydroxylation of 5mC on the Insulin-like growth factor 1 (Igf1 promoter in chondrocytes. Taken together, we showed that the expression of Tet1 was specifically facilitated in chondrocyte differentiation and Tet1 can regulate chondrocyte marker gene expression presumably through its hydroxylation activity for DNA.

  3. Impact of neonatal iron deficiency on hippocampal DNA methylation and gene transcription in a porcine biomedical model of cognitive development.

    Science.gov (United States)

    Schachtschneider, Kyle M; Liu, Yingkai; Rund, Laurie A; Madsen, Ole; Johnson, Rodney W; Groenen, Martien A M; Schook, Lawrence B

    2016-11-03

    Iron deficiency is a common childhood micronutrient deficiency that results in altered hippocampal function and cognitive disorders. However, little is known about the mechanisms through which neonatal iron deficiency results in long lasting alterations in hippocampal gene expression and function. DNA methylation is an epigenetic mark involved in gene regulation and altered by environmental factors. In this study, hippocampal DNA methylation and gene expression were assessed via reduced representation bisulfite sequencing and RNA-seq on samples from a previous study reporting reduced hippocampal-based learning and memory in a porcine biomedical model of neonatal iron deficiency. In total 192 differentially expressed genes (DEGs) were identified between the iron deficient and control groups. GO term and pathway enrichment analysis identified DEGs associated with hypoxia, angiogenesis, increased blood brain barrier (BBB) permeability, and altered neurodevelopment and function. Of particular interest are genes previously implicated in cognitive deficits and behavioral disorders in humans and mice, including HTR2A, HTR2C, PAK3, PRSS12, and NETO1. Altered genome-wide DNA methylation was observed across 0.5 million CpG and 2.4 million non-CpG sites. In total 853 differentially methylated (DM) CpG and 99 DM non-CpG sites were identified between groups. Samples clustered by group when comparing DM non-CpG sites, suggesting high conservation of non-CpG methylation in response to neonatal environment. In total 12 DM sites were associated with 9 DEGs, including genes involved in angiogenesis, neurodevelopment, and neuronal function. Neonatal iron deficiency leads to altered hippocampal DNA methylation and gene regulation involved in hypoxia, angiogenesis, increased BBB permeability, and altered neurodevelopment and function. Together, these results provide new insights into the mechanisms through which neonatal iron deficiency results in long lasting reductions in cognitive

  4. DNA Methylation in Peripheral Blood Cells of Pigs Cloned by Somatic Cell Nuclear Transfer

    DEFF Research Database (Denmark)

    Gao, Fei; Li, Shengting; Lin, Lin

    2011-01-01

    To date, the genome-wide DNA methylation status of cloned pigs has not been investigated. Due to the relatively low success rate of pig cloning by somatic cell nuclear transfer, a better understanding of the epigenetic reprogramming and the global methylation patterns associated with development...... in cloned pigs is required. In this study we applied methylation-specific digital karyotyping tag sequencing by Solexa technology and investigated the genome-wide DNA methylation profiles of peripheral blood cells in cloned pigs with normal phenotypes in comparison with their naturally bred controls....... In the result, we found that globally there was no significant difference of DNA methylation patterns between the two groups. Locus-specifically, some genes involved in embryonic development presented a generally increased level of methylation. Our findings suggest that in cloned pigs with normal phenotypes...

  5. Obesity is associated with depot-specific alterations in adipocyte DNA methylation and gene expression

    DEFF Research Database (Denmark)

    Sonne, Si Brask; Yadav, Rachita; Yin, Guangliang

    2017-01-01

    The present study aimed to identify genes exhibiting concomitant obesity-dependent changes in DNA methylation and gene expression in adipose tissues in the mouse using diet-induced obese (DIO) C57BL/6J and genetically obese ob/ob mice as models. Mature adipocytes were isolated from epididymal...... and inguinal adipose tissues of ob/ob and DIO C57BL/6J mice. DNA methylation was analyzed by MeDIP-sequencing and gene expression by microarray analysis. The majority of differentially methylated regions (DMRs) were hypomethylated in obese mice. Global methylation of long interspersed elements indicated......57BL/6J mice occurred primarily in exons, whereas inguinal adipocytes of ob/ob mice exhibited a higher enrichment of DMRs in promoter regions than in other regions of the genome, suggesting an influence of leptin on DNA methylation in inguinal adipocytes. We observed altered methylation...

  6. DNA damage, repair monitoring and epigenetic DNA methylation changes in seedlings of Chernobyl soybeans.

    Science.gov (United States)

    Georgieva, Mariyana; Rashydov, Namik M; Hajduch, Martin

    2017-02-01

    This pilot study was carried out to assess the effect of radio-contaminated Chernobyl environment on plant genome integrity 27 years after the accident. For this purpose, nuclei were isolated from root tips of the soybean seedlings harvested from plants grown in the Chernobyl area for seven generations. Neutral, neutral-alkaline, and methylation-sensitive comet assays were performed to evaluate the induction and repair of primary DNA damage and the epigenetic contribution to stress adaptation mechanisms. An increased level of single and double strand breaks in the radio-contaminated Chernobyl seedlings at the stage of primary root development was detected in comparison to the controls. However, the kinetics of the recovery of DNA breaks of radio-contaminated Chernobyl samples revealed that lesions were efficiently repaired at the stage of cotyledon. Methylation-sensitive comet assay revealed comparable levels in the CCGG methylation pattern between control and radio-contaminated samples with a slight increase of approximately 10% in the latter ones. The obtained preliminary data allow us to speculate about the onset of mechanisms providing an adaptation potential to the accumulated internal irradiation after the Chernobyl accident. Despite the limitations of this study, we showed that comet assay is a sensitive and flexible technique which can be efficiently used for genotoxic screening of plant specimens in natural and human-made radio-contaminated areas, as well as for safety monitoring of agricultural products. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Gene transcription profiles, global DNA methylation and potential transgenerational epigenetic effects related to Zn exposure history in Daphnia magna

    International Nuclear Information System (INIS)

    Vandegehuchte, Michiel B.; De Coninck, Dieter; Vandenbrouck, Tine; De Coen, Wim M.; Janssen, Colin R.

    2010-01-01

    A reduced level of DNA methylation has recently been described in both Zn-exposed and non-exposed offspring of Daphnia magna exposed to Zn. The hypothesis examined in this study is that DNA hypomethylation has an effect on gene transcription. A second hypothesis is that accumulative epigenetic effects can affect gene transcription in non-exposed offspring from parents with an exposure history of more than one generation. Transcriptional gene regulation was studied with a cDNA microarray. In the exposed and non-exposed hypomethylated daphnids, a large proportion of common genes were similarly up- or down-regulated, indicating a possible effect of the DNA hypomethylation. Two of these genes can be mechanistically involved in DNA methylation reduction. The similar transcriptional regulation of two and three genes in the F 0 and F 1 exposed daphnids on one hand and their non-exposed offspring on the other hand, could be the result of a one-generation temporary transgenerational epigenetic effect, which was not accumulative. - Zn-induced DNA hypomethylation is related to gene transcription in Daphnia magna and Zn exposure potentially induced limited temporary transgenerational effects on gene transcription.

  8. Genome-wide association between DNA methylation and alternative splicing in an invertebrate

    Directory of Open Access Journals (Sweden)

    Flores Kevin

    2012-09-01

    Full Text Available Abstract Background Gene bodies are the most evolutionarily conserved targets of DNA methylation in eukaryotes. However, the regulatory functions of gene body DNA methylation remain largely unknown. DNA methylation in insects appears to be primarily confined to exons. Two recent studies in Apis mellifera (honeybee and Nasonia vitripennis (jewel wasp analyzed transcription and DNA methylation data for one gene in each species to demonstrate that exon-specific DNA methylation may be associated with alternative splicing events. In this study we investigated the relationship between DNA methylation, alternative splicing, and cross-species gene conservation on a genome-wide scale using genome-wide transcription and DNA methylation data. Results We generated RNA deep sequencing data (RNA-seq to measure genome-wide mRNA expression at the exon- and gene-level. We produced a de novo transcriptome from this RNA-seq data and computationally predicted splice variants for the honeybee genome. We found that exons that are included in transcription are higher methylated than exons that are skipped during transcription. We detected enrichment for alternative splicing among methylated genes compared to unmethylated genes using fisher’s exact test. We performed a statistical analysis to reveal that the presence of DNA methylation or alternative splicing are both factors associated with a longer gene length and a greater number of exons in genes. In concordance with this observation, a conservation analysis using BLAST revealed that each of these factors is also associated with higher cross-species gene conservation. Conclusions This study constitutes the first genome-wide analysis exhibiting a positive relationship between exon-level DNA methylation and mRNA expression in the honeybee. Our finding that methylated genes are enriched for alternative splicing suggests that, in invertebrates, exon-level DNA methylation may play a role in the construction of splice

  9. Genome-wide DNA methylation patterns in wild samples of two morphotypes of threespine stickleback (Gasterosteus aculeatus).

    Science.gov (United States)

    Smith, Gilbert; Smith, Carl; Kenny, John G; Chaudhuri, Roy R; Ritchie, Michael G

    2015-04-01

    Epigenetic marks such as DNA methylation play important biological roles in gene expression regulation and cellular differentiation during development. To examine whether DNA methylation patterns are potentially associated with naturally occurring phenotypic differences, we examined genome-wide DNA methylation within Gasterosteus aculeatus, using reduced representation bisulfite sequencing. First, we identified highly methylated regions of the stickleback genome, finding such regions to be located predominantly within genes, and associated with genes functioning in metabolism and biosynthetic processes, cell adhesion, signaling pathways, and blood vessel development. Next, we identified putative differentially methylated regions (DMRs) of the genome between complete and low lateral plate morphs of G. aculeatus. We detected 77 DMRs that were mainly located in intergenic regions. Annotations of genes associated with these DMRs revealed potential functions in a number of known divergent adaptive phenotypes between G. aculeatus ecotypes, including cardiovascular development, growth, and neuromuscular development. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Methylation effect on the ohmic resistance of a poly-GC DNA-like chain

    Energy Technology Data Exchange (ETDEWEB)

    Moura, F.A.B.F. de, E-mail: fidelis@fis.ufal.br [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Almeida, M.L. de; Ourique, G.S.; Fulco, U.L.; Albuquerque, E.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil)

    2016-10-14

    We determine, by using a tight-binding model Hamiltonian, the characteristic current–voltage (IxV) curves of a 5-methylated cytosine single strand poly-GC DNA-like finite segment, considering the methyl groups attached laterally to a random fraction of the cytosine basis. Striking, we found that the methylation significantly impacts the ohmic resistance (R) of the DNA-like segments, indicating that measurements of R can be used as a biosensor tool to probe the presence of anomalous methylation. - Highlights: • Ohmic resistance of finite segments of poly-CG DNA-like segments. • Possibility for the development of biosensor devices. • Methylation effect and electronic transport in DNA-like segments.

  11. Variation of DNA methylation patterns associated with gene expression in rice (Oryza sativa) exposed to cadmium.

    Science.gov (United States)

    Feng, Sheng Jun; Liu, Xue Song; Tao, Hua; Tan, Shang Kun; Chu, Shan Shan; Oono, Youko; Zhang, Xian Duo; Chen, Jian; Yang, Zhi Min

    2016-12-01

    We report genome-wide single-base resolution maps of methylated cytosines and transcriptome change in Cd-exposed rice. Widespread differences were identified in CG and non-CG methylation marks between Cd-exposed and Cd-free rice genomes. There are 2320 non-redundant differentially methylated regions detected in the genome. RNA sequencing revealed 2092 DNA methylation-modified genes differentially expressed under Cd exposure. More genes were found hypermethylated than those hypomethylated in CG, CHH and CHG (where H is A, C or T) contexts in upstream, gene body and downstream regions. Many of the genes were involved in stress response, metal transport and transcription factors. Most of the DNA methylation-modified genes were transcriptionally altered under Cd stress. A subset of loss of function mutants defective in DNA methylation and histone modification activities was used to identify transcript abundance of selected genes. Compared with wide type, mutation of MET1 and DRM2 resulted in general lower transcript levels of the genes under Cd stress. Transcripts of OsIRO2, OsPR1b and Os09g02214 in drm2 were significantly reduced. A commonly used DNA methylation inhibitor 5-azacytidine was employed to investigate whether DNA demethylation affected physiological consequences. 5-azacytidine provision decreased general DNA methylation levels of selected genes, but promoted growth of rice seedlings and Cd accumulation in rice plant. © 2016 John Wiley & Sons Ltd.

  12. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  13. The Role of DNA Methylation and Histone Modifications in Neurodegenerative Diseases: A Systematic Review.

    Directory of Open Access Journals (Sweden)

    Ke-Xin Wen

    Full Text Available Epigenetic modifications of the genome, such as DNA methylation and histone modifications, have been reported to play a role in neurodegenerative diseases (ND such as Alzheimer's disease (AD and Parkinson's disease (PD.To systematically review studies investigating epigenetic marks in AD or PD.Eleven bibliographic databases (Embase.com, Medline (Ovid, Web-of-Science, Scopus, PubMed, Cinahl (EBSCOhost, Cochrane Central, ProQuest, Lilacs, Scielo and Google Scholar were searched until July 11th 2016 to identify relevant articles. We included all randomized controlled trials, cohort, case-control and cross-sectional studies in humans that examined associations between epigenetic marks and ND. Two independent reviewers, with a third reviewer available for disagreements, performed the abstract and full text selection. Data was extracted using a pre-designed data collection form.Of 6,927 searched references, 73 unique case-control studies met our inclusion criteria. Overall, 11,453 individuals were included in this systematic review (2,640 AD and 2,368 PD outcomes. There was no consistent association between global DNA methylation pattern and any ND. Studies reported epigenetic regulation of 31 genes (including cell communication, apoptosis, and neurogenesis genes in blood and brain tissue in relation to AD and PD. Methylation at the BDNF, SORBS3 and APP genes in AD were the most consistently reported associations. Methylation of α-synuclein gene (SNCA was also found to be associated with PD. Seven studies reported histone protein alterations in AD and PD.Many studies have investigated epigenetics and ND. Further research should include larger cohort or longitudinal studies, in order to identify clinically significant epigenetic changes. Identifying relevant epigenetic changes could lead to interventional strategies in ND.

  14. DNA Methylation and Gene Expression Profiling of Ewing Sarcoma Primary Tumors Reveal Genes That Are Potential Targets of Epigenetic Inactivation

    Directory of Open Access Journals (Sweden)

    Nikul Patel

    2012-01-01

    Full Text Available The role of aberrant DNA methylation in Ewing sarcoma is not completely understood. The methylation status of 503 genes in 52 formalin-fixed paraffin-embedded EWS tumors and 3 EWS cell lines was compared to human mesenchymal stem cell primary cultures (hMSCs using bead chip methylation analysis. Relative expression of methylated genes was assessed in 5-Aza-2-deoxycytidine-(5-AZA-treated EWS cell lines and in a cohort of primary EWS samples and hMSCs by gene expression and quantitative RT-PCR. 129 genes demonstrated statistically significant hypermethylation in EWS tumors compared to hMSCs. Thirty-six genes were profoundly methylated in EWS and unmethylated in hMSCs. 5-AZA treatment of EWS cell lines resulted in upregulation of expression of hundreds of genes including 162 that were increased by at least 2-fold. The expression of 19 of 36 candidate hypermethylated genes was increased following 5-AZA. Analysis of gene expression from an independent cohort of tumors confirmed decreased expression of six of nineteen hypermethylated genes (AXL, COL1A1, CYP1B1, LYN, SERPINE1, and VCAN. Comparing gene expression and DNA methylation analyses proved to be an effective way to identify genes epigenetically regulated in EWS. Further investigation is ongoing to elucidate the role of these epigenetic alterations in EWS pathogenesis.

  15. Regulation of MLH1 mRNA and protein expression by promoter methylation in primary colorectal cancer

    DEFF Research Database (Denmark)

    Jensen, Lars Henrik; Rasmussen, Anders Aamann; Byriel, Lene

    2013-01-01

    In colorectal cancer MLH1 deficiency causes microsatellite instability, which is relevant for the patient's prognosis and treatment, and its putative heredity. Dysfunction of MLH1 is caused by sporadic gene promoter hypermethylation or by hereditary mutations as seen in Lynch Syndrome. The aim...... of this study was to determine in detail how DNA methylation regulates MLH1 expression and impacts clinical management....

  16. Transcription and chromatin determinants of de novo DNA methylation timing in oocytes.

    Science.gov (United States)

    Gahurova, Lenka; Tomizawa, Shin-Ichi; Smallwood, Sébastien A; Stewart-Morgan, Kathleen R; Saadeh, Heba; Kim, Jeesun; Andrews, Simon R; Chen, Taiping; Kelsey, Gavin

    2017-01-01

    Gametogenesis in mammals entails profound re-patterning of the epigenome. In the female germline, DNA methylation is acquired late in oogenesis from an essentially unmethylated baseline and is established largely as a consequence of transcription events. Molecular and functional studies have shown that imprinted genes become methylated at different times during oocyte growth; however, little is known about the kinetics of methylation gain genome wide and the reasons for asynchrony in methylation at imprinted loci. Given the predominant role of transcription, we sought to investigate whether transcription timing is rate limiting for de novo methylation and determines the asynchrony of methylation events. Therefore, we generated genome-wide methylation and transcriptome maps of size-selected, growing oocytes to capture the onset and progression of methylation. We find that most sequence elements, including most classes of transposable elements, acquire methylation at similar rates overall. However, methylation of CpG islands (CGIs) is delayed compared with the genome average and there are reproducible differences amongst CGIs in onset of methylation. Although more highly transcribed genes acquire methylation earlier, the major transitions in the oocyte transcriptome occur well before the de novo methylation phase, indicating that transcription is generally not rate limiting in conferring permissiveness to DNA methylation. Instead, CGI methylation timing negatively correlates with enrichment for histone 3 lysine 4 (H3K4) methylation and dependence on the H3K4 demethylases KDM1A and KDM1B, implicating chromatin remodelling as a major determinant of methylation timing. We also identified differential enrichment of transcription factor binding motifs in CGIs acquiring methylation early or late in oocyte growth. By combining these parameters into multiple regression models, we were able to account for about a fifth of the variation in methylation timing of CGIs. Finally

  17. Mitochondrial nicotinamide adenine dinucleotide reduced (NADH) oxidation links the tricarboxylic acid (TCA) cycle with methionine metabolism and nuclear DNA methylation.

    Science.gov (United States)

    Lozoya, Oswaldo A; Martinez-Reyes, Inmaculada; Wang, Tianyuan; Grenet, Dagoberto; Bushel, Pierre; Li, Jianying; Chandel, Navdeep; Woychik, Richard P; Santos, Janine H

    2018-04-18

    Mitochondrial function affects many aspects of cellular physiology, and, most recently, its role in epigenetics has been reported. Mechanistically, how mitochondrial function alters DNA methylation patterns in the nucleus remains ill defined. Using a cell culture model of induced mitochondrial DNA (mtDNA) depletion, in this study we show that progressive mitochondrial dysfunction leads to an early transcriptional and metabolic program centered on the metabolism of various amino acids, including those involved in the methionine cycle. We find that this program also increases DNA methylation, which occurs primarily in the genes that are differentially expressed. Maintenance of mitochondrial nicotinamide adenine dinucleotide reduced (NADH) oxidation in the context of mtDNA loss rescues methionine salvage and polyamine synthesis and prevents changes in DNA methylation and gene expression but does not affect serine/folate metabolism or transsulfuration. This work provides a novel mechanistic link between mitochondrial function and epigenetic regulation of gene expression that involves polyamine and methionine metabolism responding to changes in the tricarboxylic acid (TCA) cycle. Given the implications of these findings, future studies across different physiological contexts and in vivo are warranted.

  18. Implications for x-chromosome regulation from studies of human x-chromosome DNA

    International Nuclear Information System (INIS)

    Wolf, S.F.; Migeon, B.R.

    1983-01-01

    It is clear that there must be multiple events involved in the regulation of the mammalian X chromosome. The initial event, occurring about the time of implantation results in inactivation of all but a single X chromosome in diploid cells. A popular working hypothesis is that DNA modification, such as methylation or sequence rearrangement, might be responsible for maintenance of the inactive state. Methylation is particularly attractive, since the preference for methylating half-methylated sites might result in perpetuation of the differentiated state. In this paper we discuss several facets of our studies of X inactivation; specifically, our general strategy, studies of X DNA methylation, and studies of loci that escape inactivation. 47 references, 8 figures, 2 tables

  19. Role of DNA methylation in miR-200c/141 cluster silencing in invasive breast cancer cells.

    Science.gov (United States)

    Neves, Rui; Scheel, Christina; Weinhold, Sandra; Honisch, Ellen; Iwaniuk, Katharina M; Trompeter, Hans-Ingo; Niederacher, Dieter; Wernet, Peter; Santourlidis, Simeon; Uhrberg, Markus

    2010-08-03

    The miR-200c/141 cluster has recently been implicated in the epithelial to mesenchymal transition (EMT) process. The expression of these two miRNAs is inversely correlated with tumorigenicity and invasiveness in several human cancers. The role of these miRNAs in cancer progression is based in part on their capacity to target the EMT activators ZEB1 and ZEB2, two transcription factors, which in turn repress expression of E-cadherin. Little is known about the regulation of the mir200c/141 cluster, whose targeting has been proposed as a promising new therapy for the most aggressive tumors. We show that the miR-200c/141 cluster is repressed by DNA methylation of a CpG island located in the promoter region of these miRNAs. Whereas in vitro methylation of the miR-200c/141 promoter led to shutdown of promoter activity, treatment with a demethylating agent caused transcriptional reactivation in breast cancer cells formerly lacking expression of miR-200c and miR-141. More importantly, we observed that DNA methylation of the identified miR-200c/141 promoter was tightly correlated with phenotype and the invasive capacity in a panel of 8 human breast cancer cell lines. In line with this, in vitro induction of EMT by ectopic expression of the EMT transcription factor Twist in human immortalized mammary epithelial cells (HMLE) was accompanied by increased DNA methylation and concomitant repression of the miR-200c/141 locus. The present study demonstrates that expression of the miR-200c/141 cluster is regulated by DNA methylation, suggesting epigenetic regulation of this miRNA locus in aggressive breast cancer cell lines as well as untransformed mammary epithelial cells. This epigenetic silencing mechanism might represent a novel component of the regulatory circuit for the maintenance of EMT programs in cancer and normal cells.

  20. DNMT1 but not its interaction with the replication machinery is required for maintenance of DNA methylation in human cells

    Science.gov (United States)

    Spada, Fabio; Haemmer, Andrea; Kuch, David; Rothbauer, Ulrich; Schermelleh, Lothar; Kremmer, Elisabeth; Carell, Thomas; Längst, Gernot; Leonhardt, Heinrich

    2007-01-01

    DNA methylation plays a central role in the epigenetic regulation of gene expression in vertebrates. Genetic and biochemical data indicated that DNA methyltransferase 1 (Dnmt1) is indispensable for the maintenance of DNA methylation patterns in mice, but targeting of the DNMT1 locus in human HCT116 tumor cells had only minor effects on genomic methylation and cell viability. In this study, we identified an alternative splicing in these cells that bypasses the disrupting selective marker and results in a catalytically active DNMT1 protein lacking the proliferating cell nuclear antigen–binding domain required for association with the replication machinery. Using a mechanism-based trapping assay, we show that this truncated DNMT1 protein displays only twofold reduced postreplicative DNA methylation maintenance activity in vivo. RNA interference–mediated knockdown of this truncated DNMT1 results in global genomic hypomethylation and cell death. These results indicate that DNMT1 is essential in mouse and human cells, but direct coupling of the replication of genetic and epigenetic information is not strictly required. PMID:17312023

  1. Identification of body fluid-specific DNA methylation markers for use in forensic science.

    Science.gov (United States)

    Park, Jong-Lyul; Kwon, Oh-Hyung; Kim, Jong Hwan; Yoo, Hyang-Sook; Lee, Han-Chul; Woo, Kwang-Man; Kim, Seon-Young; Lee, Seung-Hwan; Kim, Yong Sung

    2014-11-01

    DNA methylation, which occurs at the 5'-position of the cytosine in CpG dinucleotides, has great potential for forensic identification of body fluids, because tissue-specific patterns of DNA methylation have been demonstrated, and DNA is less prone to degradation than proteins or RNA. Previous studies have reported several body fluid-specific DNA methylation markers, but DNA methylation differences are sometimes low in saliva and vaginal secretions. Moreover, specific DNA methylation markers in four types of body fluids (blood, saliva, semen, and vaginal secretions) have not been investigated with genome-wide profiling. Here, we investigated novel DNA methylation markers for identification of body fluids for use in forensic science using the Illumina HumanMethylation 450K bead array, which contains over 450,000 CpG sites. Using methylome data from 16 samples of blood, saliva, semen, and vaginal secretions, we first selected 2986 hypermethylated or hypomethylated regions that were specific for each type of body fluid. We then selected eight CpG sites as novel, forensically relevant DNA methylation markers: cg06379435 and cg08792630 for blood, cg26107890 and cg20691722 for saliva, cg23521140 and cg17610929 for semen, and cg01774894 and cg14991487 for vaginal secretions. These eight selected markers were evaluated in 80 body fluid samples using pyrosequencing, and all showed high sensitivity and specificity for identification of the target body fluid. We suggest that these eight DNA methylation markers may be good candidates for developing an effective molecular assay for identification of body fluids in forensic science. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  2. A combined HM-PCR/SNuPE method for high sensitive detection of rare DNA methylation

    Directory of Open Access Journals (Sweden)

    Tierling Sascha

    2010-06-01

    Full Text Available Abstract Background DNA methylation changes are widely used as early molecular markers in cancer detection. Sensitive detection and classification of rare methylation changes in DNA extracted from circulating body fluids or complex tissue samples is crucial for the understanding of tumor etiology, clinical diagnosis and treatment. In this paper, we describe a combined method to monitor the presence of methylated tumor DNA in an excess of unmethylated background DNA of non-tumorous cells. The method combines heavy methyl-PCR, which favors preferential amplification of methylated marker sequence from bisulfite-treated DNA with a methylation-specific single nucleotide primer extension monitored by ion-pair, reversed-phase, high-performance liquid chromatography separation. Results This combined method allows detection of 14 pg (that is, four to five genomic copies of methylated chromosomal DNA in a 2000-fold excess (that is, 50 ng of unmethylated chromosomal background, with an analytical sensitivity of > 90%. We outline a detailed protocol for the combined assay on two examples of known cancer markers (SEPT9 and TMEFF2 and discuss general aspects of assay design and data interpretation. Finally, we provide an application example for rapid testing on tumor methylation in plasma DNA derived from a small cohort of patients with colorectal cancer. Conclusion The method allows unambiguous detection of rare DNA methylation, for example in body fluid or DNA isolates from cells or tissues, with very high sensitivity and accuracy. The application combines standard technologies and can easily be adapted to any target region of interest. It does not require costly reagents and can be used for routine screening of many samples.

  3. DNA methylation results depend on DNA integrity – role of post mortem interval

    Directory of Open Access Journals (Sweden)

    Mathias eRhein

    2015-05-01

    Full Text Available Major questions of neurological and psychiatric mechanisms involve the brain functions on a molecular level and cannot be easily addressed due to limitations in access to tissue samples. Post mortem studies are able to partly bridge the gap between brain tissue research retrieved from animal trials and the information derived from peripheral analysis (e.g. measurements in blood cells in patients. Here, we wanted to know how fast DNA degradation is progressing under controlled conditions in order to define thresholds for tissue quality to be used in respective trials. Our focus was on the applicability of partly degraded samples for bisulfite sequencing and the determination of simple means to define cut-off values.After opening the brain cavity, we kept two consecutive pig skulls at ambient temperature (19-21°C and removed cortex tissue up to a post mortem interval (PMI of 120h. We calculated the percentage of degradation on DNA gel electrophoresis of brain DNA to estimate quality and relate this estimation spectrum to the quality of human post-mortem control samples. Functional DNA quality was investigated by bisulfite sequencing of two functionally relevant genes for either the serotonin receptor 5 (SLC6A4 or aldehyde dehydrogenase 2 (ALDH2.Testing our approach in a heterogeneous collective of human blood and brain samples, we demonstrate integrity of measurement quality below the threshold of 72h PMI.While sequencing technically worked for all timepoints irrespective of conceivable DNA degradation, there is a good correlation between variance of methylation to degradation levels documented in the gel (R2=0.4311, p=0.0392 for advancing post mortem intervals (PMI. This otherwise elusive phenomenon is an important prerequisite for the interpretation and evaluation of samples prior to in-depth processing via an affordable and easy assay to estimate identical sample quality and thereby comparable methylation measurements.

  4. RESEARCH ARTICLE Changes of Host DNA Methylation in ...

    Indian Academy of Sciences (India)

    Navya

    2016-11-17

    Nov 17, 2016 ... *These authors contributed equally to this