WorldWideScience

Sample records for regulates barrier immunity

  1. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  2. Trypanosome infection establishment in the tsetse fly gut is influenced by microbiome-regulated host immune barriers.

    Directory of Open Access Journals (Sweden)

    Brian L Weiss

    Full Text Available Tsetse flies (Glossina spp. vector pathogenic African trypanosomes, which cause sleeping sickness in humans and nagana in domesticated animals. Additionally, tsetse harbors 3 maternally transmitted endosymbiotic bacteria that modulate their host's physiology. Tsetse is highly resistant to infection with trypanosomes, and this phenotype depends on multiple physiological factors at the time of challenge. These factors include host age, density of maternally-derived trypanolytic effector molecules present in the gut, and symbiont status during development. In this study, we investigated the molecular mechanisms that result in tsetse's resistance to trypanosomes. We found that following parasite challenge, young susceptible tsetse present a highly attenuated immune response. In contrast, mature refractory flies express higher levels of genes associated with humoral (attacin and pgrp-lb and epithelial (inducible nitric oxide synthase and dual oxidase immunity. Additionally, we discovered that tsetse must harbor its endogenous microbiome during intrauterine larval development in order to present a parasite refractory phenotype during adulthood. Interestingly, mature aposymbiotic flies (Gmm(Apo present a strong immune response earlier in the infection process than do WT flies that harbor symbiotic bacteria throughout their entire lifecycle. However, this early response fails to confer significant resistance to trypanosomes. Gmm(Apo adults present a structurally compromised peritrophic matrix (PM, which lines the fly midgut and serves as a physical barrier that separates luminal contents from immune responsive epithelial cells. We propose that the early immune response we observe in Gmm(Apo flies following parasite challenge results from the premature exposure of gut epithelia to parasite-derived immunogens in the absence of a robust PM. Thus, tsetse's PM appears to regulate the timing of host immune induction following parasite challenge. Our results

  3. Immune barriers of Ebola virus infection.

    Science.gov (United States)

    McElroy, Anita K; Mühlberger, Elke; Muñoz-Fontela, César

    2018-02-01

    Since its initial emergence in 1976 in northern Democratic Republic of Congo (DRC), Ebola virus (EBOV) has been a global health concern due to its virulence in humans, the mystery surrounding the identity of its host reservoir and the unpredictable nature of Ebola virus disease (EVD) outbreaks. Early after the first clinical descriptions of a disease resembling a 'septic-shock-like syndrome', with coagulation abnormalities and multi-system organ failure, researchers began to evaluate the role of the host immune response in EVD pathophysiology. In this review, we summarize how data gathered during the last 40 years in the laboratory as well as in the field have provided insight into EBOV immunity. From molecular mechanisms involved in EBOV recognition in infected cells, to antigen processing and adaptive immune responses, we discuss current knowledge on the main immune barriers of infection as well as outstanding research questions. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Immune regulation by microbiome metabolites.

    Science.gov (United States)

    Kim, Chang H

    2018-03-22

    Commensal microbes and the host immune system have been co-evolved for mutual regulation. Microbes regulate the host immune system, in part, by producing metabolites. A mounting body of evidence indicates that diverse microbial metabolites profoundly regulate the immune system via host receptors and other target molecules. Immune cells express metabolite-specific receptors such as P2X 7 , GPR41, GPR43, GPR109A, aryl hydrocarbon receptor precursor (AhR), pregnane X receptor (PXR), farnesoid X receptor (FXR), TGR5 and other molecular targets. Microbial metabolites and their receptors form an extensive array of signals to respond to changes in nutrition, health and immunological status. As a consequence, microbial metabolite signals contribute to nutrient harvest from diet, and regulate host metabolism and the immune system. Importantly, microbial metabolites bidirectionally function to promote both tolerance and immunity to effectively fight infection without developing inflammatory diseases. In pathogenic conditions, adverse effects of microbial metabolites have been observed as well. Key immune-regulatory functions of the metabolites, generated from carbohydrates, proteins and bile acids, are reviewed in this article. © 2018 John Wiley & Sons Ltd.

  5. Barriers to Immunizations and Strategies to Enhance Immunization Rates in Adults with Autoimmune Inflammatory Diseases.

    Science.gov (United States)

    Kirchner, Elizabeth; Ruffing, Victoria

    2017-02-01

    For as long as there have been immunizations, there have been barriers to them. Immunization rates in the United States are below target. Rheumatologists and rheumatology practitioners need to understand the issues of immunizations in patients with autoimmune inflammatory disease to identify and overcome barriers to immunization. Several strategies for overcoming these barriers are discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Cytokine regulation of immune tolerance

    OpenAIRE

    Wu, Jie; Xie, Aini; Chen, Wenhao

    2014-01-01

    The immune system provides defenses against invading pathogens while maintaining immune tolerance to self-antigens. This immune homeostasis is harmonized by the direct interactions between immune cells and the cytokine environment in which immune cells develop and function. Herein, we discuss three non-redundant paradigms by which cytokines maintain or break immune tolerance. We firstly describe how anti-inflammatory cytokines exert direct inhibitory effects on immune cells to enforce immune ...

  7. Immune regulation and CNS autoimmune disease

    DEFF Research Database (Denmark)

    Antel, J P; Owens, T

    1999-01-01

    The central nervous system is a demonstrated target of both clinical and experimental immune mediated disorders. Immune regulatory mechanisms operative at the levels of the systemic immune system, the blood brain barrier, and within the CNS parenchyma are important determinants of the intensity...... and duration of the tissue directed injury. Convergence of research, involving direct manipulation of specific cells and molecular mediators in animal models and in vitro analysis of human immune and neural cells and tissues, is providing increasing insight into the role of these immune regulatory functions...

  8. Mechanisms regulating skin immunity and inflammation.

    Science.gov (United States)

    Pasparakis, Manolis; Haase, Ingo; Nestle, Frank O

    2014-05-01

    Immune responses in the skin are important for host defence against pathogenic microorganisms. However, dysregulated immune reactions can cause chronic inflammatory skin diseases. Extensive crosstalk between the different cellular and microbial components of the skin regulates local immune responses to ensure efficient host defence, to maintain and restore homeostasis, and to prevent chronic disease. In this Review, we discuss recent findings that highlight the complex regulatory networks that control skin immunity, and we provide new paradigms for the mechanisms that regulate skin immune responses in host defence and in chronic inflammation.

  9. Microbial-immune cross-talk and regulation of the immune system.

    Science.gov (United States)

    Cahenzli, Julia; Balmer, Maria L; McCoy, Kathy D

    2013-01-01

    We are all born germ-free. Following birth we enter into a lifelong relationship with microbes residing on our body's surfaces. The lower intestine is home to the highest microbial density in our body, which is also the highest microbial density known on Earth (up to 10(12) /g of luminal contents). With our indigenous microbial cells outnumbering our human cells by an order of magnitude our body is more microbial than human. Numerous immune adaptations confine these microbes within the mucosa, enabling most of us to live in peaceful homeostasis with our intestinal symbionts. Intestinal epithelial cells not only form a physical barrier between the bacteria-laden lumen and the rest of the body but also function as multi-tasking immune cells that sense the prevailing microbial (apical) and immune (basolateral) milieus, instruct the underlying immune cells, and adapt functionally. In the constant effort to ensure intestinal homeostasis, the immune system becomes educated to respond appropriately and in turn immune status can shape the microbial consortia. Here we review how the dynamic immune-microbial dialogue underlies maturation and regulation of the immune system and discuss recent findings on the impact of diet on both microbial ecology and immune function. © 2012 The Authors. Immunology © 2012 Blackwell Publishing Ltd.

  10. Complement anaphylatoxins as immune regulators in cancer.

    Science.gov (United States)

    Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T

    2014-08-01

    The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediated suppression of immune effector cells responsible for immunosurveillance within the tumor microenvironment. This paradigm accords with models of immune dysregulation, such as autoimmunity and infectious disease, which have defined a pathophysiological role for abnormal complement signaling. Several types of immune cells express the cognate receptors for the complement anaphylatoxins, C3aR and C5aR, and demonstrate functional modulation in response to complement stimulation. In turn, impairment of antitumor immunity has been intimately tied to tumor progression in animal models of cancer. In this article, the literature was systematically reviewed to identify studies that have characterized the effects of the complement anaphylatoxins on the composition and function of immune cells within the tumor microenvironment. The search identified six studies based upon models of lymphoma and ovarian, cervical, lung, breast, and mammary cancer, which collectively support the paradigm of complement as an immune regulator in the tumor microenvironment. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  11. Assessing Pharmacists' Attitudes and Barriers Involved with Immunizations

    Directory of Open Access Journals (Sweden)

    Sarah Aldrich

    2014-01-01

    Full Text Available Pharmacists are considered the most accessible health care professional. Immunizations create an opportunity for the profession to grow and develop toward direct patient care. Between 1995 and 2004 programs involving immunizations led to a national initiative to train pharmacists that became a significant leap toward pharmacist's involvement in direct patient care. Although immunizations can be considered a catalyst to change the pharmacist's role, little was known about pharmacist's attitudes and the barriers involved with immunizing. Few studies have assessed barriers, attitudes, and practice issues experienced by immunizing pharmacists. The objective of this study was to determine pharmacists' attitudes toward immunizations and more specifically to assess possible barriers involved with this practice. Five hundred pharmacists were randomly selected for inclusion in the study from the State of Ohio Board of Pharmacy Database, of which 137 (27.4% completed the survey. A 37- item questionnaire was administered via an e-mail invitation to take an online survey using Qualtrics software with a Likert-type scale, where 1 = strongly disagree and 7 = strongly agree. Several topics were assessed regarding immunizations including time constraints, workflow constraints, adequacy of training, technician support, worksite conditions and space, immunization processes, reimbursement issues, safety issues, documentation issues, and the future direction of immunizations. Demographics included gender, age, degree, number of years practicing, practice site, and number of years immunizing. Seventy-three percent of pharmacists believed that immunizing could lead to prescription filling errors (mean=4.45, SD=1.79. Pharmacists strongly agreed that having more technicians on staff would make providing immunizations easier (mean=5.80, SD=1.39 and that they play a vital role in keeping the process running smoothly (mean=6.08, SD=1.16. Also, pharmacists strongly agreed

  12. Role of Osmolytes in Regulating Immune System.

    Science.gov (United States)

    Kumar, Tarun; Yadav, Manisha; Singh, Laishram Rajendrakumar

    2016-01-01

    The immune system has evolved to protect the host organism from diverse range of pathogenic microbes that are themselves constantly evolving. It is a complex network of cells, humoral factors, chemokines and cytokines. Dysregulation of immune system results in various kinds of immunological disorders. There are several external agents which govern the regulation of immune system. Recent studies have indicated the role of osmolytes in regulation of various immunological processes such as Ag-Ab interaction, Ig assembly, Ag presentation etc. In this present review, we have systematically discussed the role of osmolytes involved in regulation of several key immunological processes. Osmolytes are involved in the regulation of several key immunological processes such as immunoglobulin assembly and folding, immune cells proliferation, regulation of immune cells function, Ag-Ab interaction, antigen presentation, inflammatory response and protection against photo-immunosuppression. Hence, osmolytes and their transporters might be used as potential drug and drug targets respectively. This review is therefore designed to help clinicians in development of osmolyte based therapeutic strategies in the treatment of various immunological disorders. Appropriate future perspectives have also been included.

  13. Mast cell activators as novel immune regulators.

    Science.gov (United States)

    Johnson-Weaver, Brandi; Choi, Hae Woong; Abraham, Soman N; Staats, Herman F

    2018-05-26

    Mast cells are an important cell type of the innate immune system that when activated, play a crucial role in generating protective innate host responses after bacterial and viral infection. Additionally, activated mast cells influence lymph node composition to regulate the induction of adaptive immune responses. The recognition that mast cells play a beneficial role in host responses to microbial infection and induction of adaptive immunity has provided the rationale to evaluate mast cell activators for use as antimicrobials or vaccine adjuvants. This review summarizes the role of mast cell activators in antimicrobial responses while also discussing the use of different classes of mast cell activators as potent vaccine adjuvants that enhance the induction of protective immune responses. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Intestinal barrier: A gentlemen's agreement between microbiota and immunity.

    Science.gov (United States)

    Caricilli, Andrea Moro; Castoldi, Angela; Câmara, Niels Olsen Saraiva

    2014-02-15

    Our body is colonized by more than a hundred trillion commensals, represented by viruses, bacteria and fungi. This complex interaction has shown that the microbiome system contributes to the host's adaptation to its environment, providing genes and functionality that give flexibility of diet and modulate the immune system in order not to reject these symbionts. In the intestine, specifically, the microbiota helps developing organ structures, participates of the metabolism of nutrients and induces immunity. Certain components of the microbiota have been shown to trigger inflammatory responses, whereas others, anti-inflammatory responses. The diversity and the composition of the microbiota, thus, play a key role in the maintenance of intestinal homeostasis and explain partially the link between intestinal microbiota changes and gut-related disorders in humans. Tight junction proteins are key molecules for determination of the paracellular permeability. In the context of intestinal inflammatory diseases, the intestinal barrier is compromised, and decreased expression and differential distribution of tight junction proteins is observed. It is still unclear what is the nature of the luminal or mucosal factors that affect the tight junction proteins function, but the modulation of the immune cells found in the intestinal lamina propria is hypothesized as having a role in this modulation. In this review, we provide an overview of the current understanding of the interaction of the gut microbiota with the immune system in the development and maintenance of the intestinal barrier.

  15. Complement anaphylatoxins as immune regulators in cancer

    OpenAIRE

    Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T

    2014-01-01

    The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediat...

  16. Effects of Dietary Bacillus licheniformis on Gut Physical Barrier, Immunity, and Reproductive Hormones of Laying Hens.

    Science.gov (United States)

    Wang, Yang; Du, Wei; Lei, Kai; Wang, Baikui; Wang, Yuanyuan; Zhou, Yingshan; Li, Weifen

    2017-09-01

    Previous study showed that dietary Bacillus licheniformis (B. licheniformis) administration contributes to the improvement of laying performance and egg quality in laying hens. In this study, we aimed to further evaluate its underlying mechanisms. Three hundred sixty Hy-Line Variety W-36 hens (28 weeks of age) were randomized into four groups, each group with six replications (n = 15). The control group received the basal diet and the treatment groups received the same basal diets supplemented with 0.01, 0.03, and 0.06% B. licheniformis powder (2 × 10 10  cfu/g) for an 8-week trial. The results demonstrate that B. licheniformis significantly enhance the intestinal barrier functions via decreasing gut permeability, promoting mucin-2 transcription, and regulating inflammatory cytokines. The systemic immunity of layers in B. licheniformis treatment groups is improved through modulating the specific and non-specific immunity. In addition, gene expressions of hormone receptors, including estrogen receptor α, estrogen receptor β, and follicle-stimulating hormone receptor, are also regulated by B. licheniformis. Meanwhile, compared with the control, B. licheniformis significantly increase gonadotropin-releasing hormone level, but markedly reduce ghrelin and inhibin secretions. Overall, our data suggest that dietary inclusion of B. licheniformis can improve the intestinal barrier function and systemic immunity and regulate reproductive hormone secretions, which contribute to better laying performance and egg quality of hens.

  17. Nutritional components regulate the gut immune system and its association with intestinal immune disease development.

    Science.gov (United States)

    Lamichhane, Aayam; Kiyono, Hiroshi; Kunisawa, Jun

    2013-12-01

    The gut is equipped with a unique immune system for maintaining immunological homeostasis, and its functional immune disruption can result in the development of immune diseases such as food allergy and intestinal inflammation. Accumulating evidence has demonstrated that nutritional components play an important role in the regulation of gut immune responses and also in the development of intestinal immune diseases. In this review, we focus on the immunological functions of lipids, vitamins, and nucleotides in the regulation of the intestinal immune system and as potential targets for the control of intestinal immune diseases. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  18. Regulation of intestinal homeostasis by innate immune cells.

    Science.gov (United States)

    Kayama, Hisako; Nishimura, Junichi; Takeda, Kiyoshi

    2013-12-01

    The intestinal immune system has an ability to distinguish between the microbiota and pathogenic bacteria, and then activate pro-inflammatory pathways against pathogens for host defense while remaining unresponsive to the microbiota and dietary antigens. In the intestine, abnormal activation of innate immunity causes development of several inflammatory disorders such as inflammatory bowel diseases (IBD). Thus, activity of innate immunity is finely regulated in the intestine. To date, multiple innate immune cells have been shown to maintain gut homeostasis by preventing inadequate adaptive immune responses in the murine intestine. Additionally, several innate immune subsets, which promote Th1 and Th17 responses and are implicated in the pathogenesis of IBD, have recently been identified in the human intestinal mucosa. The demonstration of both murine and human intestinal innate immune subsets contributing to regulation of adaptive immunity emphasizes the conserved innate immune functions across species and might promote development of the intestinal innate immunity-based clinical therapy.

  19. Regulation of vitamin D homeostasis: implications for the immune system.

    Science.gov (United States)

    van Etten, Evelyne; Stoffels, Katinka; Gysemans, Conny; Mathieu, Chantal; Overbergh, Lut

    2008-10-01

    Vitamin D homeostasis in the immune system is the focus of this review. The production of both the activating (25- and 1alpha-hydroxylase) and the metabolizing (24-hydroxylase) enzymes by cells of the immune system itself, indicates that 1,25(OH)(2)D(3) can be produced locally in immune reaction sites. Moreover, the strict regulation of these enzymes by immune signals is highly suggestive for an autocrine/paracrine role in the immune system, and opens new treatment possibilities.

  20. Microbial Invasion vs. Tick Immune Regulation.

    Science.gov (United States)

    Sonenshine, Daniel E; Macaluso, Kevin R

    2017-01-01

    Ticks transmit a greater variety of pathogenic agents that cause disease in humans and animals than any other haematophagous arthropod, including Lyme disease, Rocky Mountain spotted fever, human granulocytic anaplasmosis, babesiosis, tick-borne encephalitis, Crimean Congo haemorhagic fever, and many others (Gulia-Nuss et al., 2016). Although diverse explanations have been proposed to explain their remarkable vectorial capacity, among the most important are their blood feeding habit, their long term off-host survival, the diverse array of bioactive molecules that disrupt the host's natural hemostatic mechanisms, facilitate blood flow, pain inhibitors, and minimize inflammation to prevent immune rejection (Hajdušek et al., 2013). Moreover, the tick's unique intracellular digestive processes allow the midgut to provide a relatively permissive microenvironment for survival of invading microbes. Although tick-host-pathogen interactions have evolved over more than 300 million years (Barker and Murrell, 2008), few microbes have been able to overcome the tick's innate immune system, comprising both humoral and cellular processes that reject them. Similar to most eukaryotes, the signaling pathways that regulate the innate immune response, i.e., the Toll, IMD (Immunodeficiency) and JAK-STAT (Janus Kinase/ Signal Transducers and Activators of Transcription) also occur in ticks (Gulia-Nuss et al., 2016). Recognition of pathogen-associated molecular patterns (PAMPs) on the microbial surface triggers one or the other of these pathways. Consequently, ticks are able to mount an impressive array of humoral and cellular responses to microbial challenge, including anti-microbial peptides (AMPs), e.g., defensins, lysozymes, microplusins, etc., that directly kill, entrap or inhibit the invaders. Equally important are cellular processes, primarily phagocytosis, that capture, ingest, or encapsulate invading microbes, regulated by a primordial system of thioester-containing proteins

  1. Microbial Invasion vs. Tick Immune Regulation

    Directory of Open Access Journals (Sweden)

    Daniel E. Sonenshine

    2017-09-01

    Full Text Available Ticks transmit a greater variety of pathogenic agents that cause disease in humans and animals than any other haematophagous arthropod, including Lyme disease, Rocky Mountain spotted fever, human granulocytic anaplasmosis, babesiosis, tick-borne encephalitis, Crimean Congo haemorhagic fever, and many others (Gulia-Nuss et al., 2016. Although diverse explanations have been proposed to explain their remarkable vectorial capacity, among the most important are their blood feeding habit, their long term off-host survival, the diverse array of bioactive molecules that disrupt the host's natural hemostatic mechanisms, facilitate blood flow, pain inhibitors, and minimize inflammation to prevent immune rejection (Hajdušek et al., 2013. Moreover, the tick's unique intracellular digestive processes allow the midgut to provide a relatively permissive microenvironment for survival of invading microbes. Although tick-host-pathogen interactions have evolved over more than 300 million years (Barker and Murrell, 2008, few microbes have been able to overcome the tick's innate immune system, comprising both humoral and cellular processes that reject them. Similar to most eukaryotes, the signaling pathways that regulate the innate immune response, i.e., the Toll, IMD (Immunodeficiency and JAK-STAT (Janus Kinase/ Signal Transducers and Activators of Transcription also occur in ticks (Gulia-Nuss et al., 2016. Recognition of pathogen-associated molecular patterns (PAMPs on the microbial surface triggers one or the other of these pathways. Consequently, ticks are able to mount an impressive array of humoral and cellular responses to microbial challenge, including anti-microbial peptides (AMPs, e.g., defensins, lysozymes, microplusins, etc., that directly kill, entrap or inhibit the invaders. Equally important are cellular processes, primarily phagocytosis, that capture, ingest, or encapsulate invading microbes, regulated by a primordial system of thioester

  2. Immune Evasion, Immunopathology and the Regulation of the Immune System

    Directory of Open Access Journals (Sweden)

    Bruno Faivre

    2013-02-01

    Full Text Available Costs and benefits of the immune response have attracted considerable attention in the last years among evolutionary biologists. Given the cost of parasitism, natural selection should favor individuals with the most effective immune defenses. Nevertheless, there exists huge variation in the expression of immune effectors among individuals. To explain this apparent paradox, it has been suggested that an over-reactive immune system might be too costly, both in terms of metabolic resources and risks of immune-mediated diseases, setting a limit to the investment into immune defenses. Here, we argue that this view neglects one important aspect of the interaction: the role played by evolving pathogens. We suggest that taking into account the co-evolutionary interactions between the host immune system and the parasitic strategies to overcome the immune response might provide a better picture of the selective pressures that shape the evolution of immune functioning. Integrating parasitic strategies of host exploitation can also contribute to understand the seemingly contradictory results that infection can enhance, but also protect from, autoimmune diseases. In the last decades, the incidence of autoimmune disorders has dramatically increased in wealthy countries of the northern hemisphere with a concomitant decrease of most parasitic infections. Experimental work on model organisms has shown that this pattern may be due to the protective role of certain parasites (i.e., helminths that rely on the immunosuppression of hosts for their persistence. Interestingly, although parasite-induced immunosuppression can protect against autoimmunity, it can obviously favor the spread of other infections. Therefore, we need to think about the evolution of the immune system using a multidimensional trade-off involving immunoprotection, immunopathology and the parasitic strategies to escape the immune response.

  3. Beneficial Autoimmunity at Body Surfaces – Immune Surveillance and Rapid Type 2 Immunity Regulate Tissue Homeostasis and Cancer

    Science.gov (United States)

    Dalessandri, Tim; Strid, Jessica

    2014-01-01

    Epithelial cells (ECs) line body surface tissues and provide a physicochemical barrier to the external environment. Frequent microbial and non-microbial challenges such as those imposed by mechanical disruption, injury or exposure to noxious environmental substances including chemicals, carcinogens, ultraviolet-irradiation, or toxins cause activation of ECs with release of cytokines and chemokines as well as alterations in the expression of cell-surface ligands. Such display of epithelial stress is rapidly sensed by tissue-resident immunocytes, which can directly interact with self-moieties on ECs and initiate both local and systemic immune responses. ECs are thus key drivers of immune surveillance at body surface tissues. However, ECs have a propensity to drive type 2 immunity (rather than type 1) upon non-invasive challenge or stress – a type of immunity whose regulation and function still remain enigmatic. Here, we review the induction and possible role of type 2 immunity in epithelial tissues and propose that rapid immune surveillance and type 2 immunity are key regulators of tissue homeostasis and carcinogenesis. PMID:25101088

  4. Beneficial autoimmunity at body surfaces - immune surveillance and rapid type 2 immunity regulate tissue homeostasis and cancer.

    Science.gov (United States)

    Dalessandri, Tim; Strid, Jessica

    2014-01-01

    Epithelial cells (ECs) line body surface tissues and provide a physicochemical barrier to the external environment. Frequent microbial and non-microbial challenges such as those imposed by mechanical disruption, injury or exposure to noxious environmental substances including chemicals, carcinogens, ultraviolet-irradiation, or toxins cause activation of ECs with release of cytokines and chemokines as well as alterations in the expression of cell-surface ligands. Such display of epithelial stress is rapidly sensed by tissue-resident immunocytes, which can directly interact with self-moieties on ECs and initiate both local and systemic immune responses. ECs are thus key drivers of immune surveillance at body surface tissues. However, ECs have a propensity to drive type 2 immunity (rather than type 1) upon non-invasive challenge or stress - a type of immunity whose regulation and function still remain enigmatic. Here, we review the induction and possible role of type 2 immunity in epithelial tissues and propose that rapid immune surveillance and type 2 immunity are key regulators of tissue homeostasis and carcinogenesis.

  5. Importins and Exportins Regulating Allergic Immune Responses

    Directory of Open Access Journals (Sweden)

    Ankita Aggarwal

    2014-01-01

    Full Text Available Nucleocytoplasmic shuttling of macromolecules is a well-controlled process involving importins and exportins. These karyopherins recognize and bind to receptor-mediated intracellular signals through specific signal sequences that are present on cargo proteins and transport into and out of the nucleus through nuclear pore complexes. Nuclear localization signals (NLS present on cargo molecules to be imported while nuclear export signals (NES on the molecules to be exported are recognized by importins and exportins, respectively. The classical NLS are found on many transcription factors and molecules that are involved in the pathogenesis of allergic diseases. In addition, several immune modulators, including corticosteroids and vitamin D, elicit their cellular responses by regulating the expression and activity of importin molecules. In this review article, we provide a comprehensive list of importin and exportin molecules and their specific cargo that shuttled between cytoplasm and the nucleus. We also critically review the role and regulation of specific importin and exportin involved in the transport of activated transcription factors in allergic diseases, the underlying molecular mechanisms, and the potential target sites for developing better therapeutic approaches.

  6. Self-regulation of turbulence bursts and transport barriers

    International Nuclear Information System (INIS)

    Floriani, E; Ciraolo, G; Ghendrih, Ph; Sarazin, Y; Lima, R

    2013-01-01

    The interplay between turbulent bursts and transport barriers is analyzed with a simplified model of interchange turbulence in magnetically confined plasmas. The turbulent bursts spread into the transport barriers and, depending on the competing magnitude of the burst and stopping capability of the barrier, can burn through. Simulations of two models of transport barriers are presented: a hard barrier where interchange turbulence modes are stable in a prescribed region and a soft barrier with external plasma biasing. The response of the transport barriers to the non-linear perturbations of the turbulent bursts, addressed in a predator–prey approach, indicates that the barriers monitor an amplification factor of the turbulent bursts, with amplification smaller than one for most bursts and, in some cases, amplification factors that can significantly exceed unity. The weak barriers in corrugated profiles and magnetic structures, as well as the standard barriers, are characterized by these transmission properties, which then regulate the turbulent burst transport properties. The interplays of barriers and turbulent bursts are modeled as competing stochastic processes. For different classes of the probability density function (PDF) of these processes, one can predict the heavy tail properties of the bursts downstream from the barrier, either exponential for a leaky barrier, or with power laws for a tight barrier. The intrinsic probing of the transport barriers by the turbulent bursts thus gives access to the properties of the barriers. The main stochastic variables are the barrier width and the spreading distance of the turbulent bursts within the barrier, together with their level of correlation. One finds that in the case of a barrier with volumetric losses, such as radiation or particle losses as addressed in our present simulations, the stochastic model predicts a leaky behavior with an exponential PDF of escaping turbulent bursts in agreement with the simulation

  7. Immune Regulation by Self-Recognition

    DEFF Research Database (Denmark)

    Andersen, Mads Hald

    2015-01-01

    Circulating T cells that specifically target normal self-proteins expressed by regulatory immune cells were first described in patients with cancer, but can also be detected in healthy individuals. The adaptive immune system is distinguished for its ability to differentiate between self......-antigens and foreign antigens. Thus, it was remarkable to discover T cells that apparently lacked tolerance to important self-proteins, eg, IDO, PD-L1, and FoxP3, expressed in regulatory immune cells. The ability of self-reactive T cells to react to and eliminate regulatory immune cells can influence general immune...... reactions. This suggests that they may be involved in immune homeostasis. It is here proposed that these T cells should be termed antiregulatory T cells (anti-Tregs). The role of anti-Tregs in immune-regulatory networks may be diverse. For example, pro-inflammatory self-reactive T cells that react...

  8. Approaches Mediating Oxytocin Regulation of the Immune System.

    Science.gov (United States)

    Li, Tong; Wang, Ping; Wang, Stephani C; Wang, Yu-Feng

    2016-01-01

    The hypothalamic neuroendocrine system is mainly composed of the neural structures regulating hormone secretion from the pituitary gland and has been considered as the higher regulatory center of the immune system. Recently, the hypothalamo-neurohypophysial system (HNS) emerged as an important component of neuroendocrine-immune network, wherein the oxytocin (OT)-secreting system (OSS) plays an essential role. The OSS, consisting of OT neurons in the supraoptic nucleus, paraventricular nucleus, their several accessory nuclei and associated structures, can integrate neural, endocrine, metabolic, and immune information and plays a pivotal role in the development and functions of the immune system. The OSS can promote the development of thymus and bone marrow, perform immune surveillance, strengthen immune defense, and maintain immune homeostasis. Correspondingly, OT can inhibit inflammation, exert antibiotic-like effect, promote wound healing and regeneration, and suppress stress-associated immune disorders. In this process, the OSS can release OT to act on immune system directly by activating OT receptors or through modulating activities of other hypothalamic-pituitary-immune axes and autonomic nervous system indirectly. However, our understandings of the role of the OSS in neuroendocrine regulation of immune system are largely incomplete, particularly its relationship with other hypothalamic-pituitary-immune axes and the vasopressin-secreting system that coexists with the OSS in the HNS. In addition, it remains unclear about the relationship between the OSS and peripherally produced OT in immune regulation, particularly intrathymic OT that is known to elicit central immunological self-tolerance of T-cells to hypophysial hormones. In this work, we provide a brief review of current knowledge of the features of OSS regulation of the immune system and of potential approaches that mediate OSS coordination of the activities of entire neuroendocrine-immune network.

  9. Immune regulation by pericytes: modulating innate and adaptive immunity

    DEFF Research Database (Denmark)

    Navarro, Rocio; Compte, Marta; Álvarez-Vallina, Luis

    2016-01-01

    Pericytes (PC) are mural cells that surround endothelial cells (EC) in small blood vessels. PC have traditionally been endowed with structural functions, being essential for vessel maturation and stabilization. However, accumulating evidence suggest that PC also display immune properties. They ca...

  10. Immune responses at brain barriers and implications for brain development and neurological function in later life

    Directory of Open Access Journals (Sweden)

    Helen B. Stolp

    2013-08-01

    Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

  11. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Adaptation of innate lymphoid cells to nutrient deprivation promotes type 2 barrier immunity

    Science.gov (United States)

    Survival of the host relies on the establishment of site-specific barrier defense tailored to constrain pressures imposed by commensal and parasitic exposures. The host is confronted with the additional challenge of maintaining barrier immunity in fluctuating states of dietary availability, yet how ...

  13. Dynamic Nature of Noncoding RNA Regulation of Adaptive Immune Response

    Directory of Open Access Journals (Sweden)

    Franca Citarella

    2013-08-01

    Full Text Available Immune response plays a fundamental role in protecting the organism from infections; however, dysregulation often occurs and can be detrimental for the organism, leading to a variety of immune-mediated diseases. Recently our understanding of the molecular and cellular networks regulating the immune response, and, in particular, adaptive immunity, has improved dramatically. For many years, much of the focus has been on the study of protein regulators; nevertheless, recent evidence points to a fundamental role for specific classes of noncoding RNAs (ncRNAs in regulating development, activation and homeostasis of the immune system. Although microRNAs (miRNAs are the most comprehensive and well-studied, a number of reports suggest the exciting possibility that long ncRNAs (lncRNAs could mediate host response and immune function. Finally, evidence is also accumulating that suggests a role for miRNAs and other small ncRNAs in autocrine, paracrine and exocrine signaling events, thus highlighting an elaborate network of regulatory interactions mediated by different classes of ncRNAs during immune response. This review will explore the multifaceted roles of ncRNAs in the adaptive immune response. In particular, we will focus on the well-established role of miRNAs and on the emerging role of lncRNAs and circulating ncRNAs, which all make indispensable contributions to the understanding of the multilayered modulation of the adaptive immune response.

  14. Exercise and the Regulation of Immune Functions.

    Science.gov (United States)

    Simpson, Richard J; Kunz, Hawley; Agha, Nadia; Graff, Rachel

    2015-01-01

    Exercise has a profound effect on the normal functioning of the immune system. It is generally accepted that prolonged periods of intensive exercise training can depress immunity, while regular moderate intensity exercise is beneficial. Single bouts of exercise evoke a striking leukocytosis and a redistribution of effector cells between the blood compartment and the lymphoid and peripheral tissues, a response that is mediated by increased hemodynamics and the release of catecholamines and glucocorticoids following the activation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis. Single bouts of prolonged exercise may impair T-cell, NK-cell, and neutrophil function, alter the Type I and Type II cytokine balance, and blunt immune responses to primary and recall antigens in vivo. Elite athletes frequently report symptoms associated with upper respiratory tract infections (URTI) during periods of heavy training and competition that may be due to alterations in mucosal immunity, particularly reductions in secretory immunoglobulin A. In contrast, single bouts of moderate intensity exercise are "immuno-enhancing" and have been used to effectively increase vaccine responses in "at-risk" patients. Improvements in immunity due to regular exercise of moderate intensity may be due to reductions in inflammation, maintenance of thymic mass, alterations in the composition of "older" and "younger" immune cells, enhanced immunosurveillance, and/or the amelioration of psychological stress. Indeed, exercise is a powerful behavioral intervention that has the potential to improve immune and health outcomes in the elderly, the obese, and patients living with cancer and chronic viral infections such as HIV. © 2015 Elsevier Inc. All rights reserved.

  15. The Immune System Bridges the Gut Microbiota with Systemic Energy Homeostasis: Focus on TLRs, Mucosal Barrier, and SCFAs.

    Science.gov (United States)

    Spiljar, Martina; Merkler, Doron; Trajkovski, Mirko

    2017-01-01

    The gut microbiota is essential for the development and regulation of the immune system and the metabolism of the host. Germ-free animals have altered immunity with increased susceptibility to immunologic diseases and show metabolic alterations. Here, we focus on two of the major immune-mediated microbiota-influenced components that signal far beyond their local environment. First, the activation or suppression of the toll-like receptors (TLRs) by microbial signals can dictate the tone of the immune response, and they are implicated in regulation of the energy homeostasis. Second, we discuss the intestinal mucosal surface is an immunologic component that protects the host from pathogenic invasion, is tightly regulated with regard to its permeability and can influence the systemic energy balance. The short chain fatty acids are a group of molecules that can both modulate the intestinal barrier and escape the gut to influence systemic health. As modulators of the immune response, the microbiota-derived signals influence functions of distant organs and can change susceptibility to metabolic diseases.

  16. Altered Immune Regulation in Type 1 Diabetes

    Science.gov (United States)

    Zóka, András; Műzes, Györgyi; Somogyi, Anikó; Varga, Tímea; Szémán, Barbara; Al-Aissa, Zahra; Hadarits, Orsolya; Firneisz, Gábor

    2013-01-01

    Research in genetics and immunology was going on separate strands for a long time. Type 1 diabetes mellitus might not be characterized with a single pathogenetic factor. It develops when a susceptible individual is exposed to potential triggers in a given sequence and timeframe that eventually disarranges the fine-tuned immune mechanisms that keep autoimmunity under control in health. Genomewide association studies have helped to understand the congenital susceptibility, and hand-in-hand with the immunological research novel paths of immune dysregulation were described in central tolerance, apoptotic pathways, or peripheral tolerance mediated by regulatory T-cells. Epigenetic factors are contributing to the immune dysregulation. The interplay between genetic susceptibility and potential triggers is likely to play a role at a very early age and gradually results in the loss of balanced autotolerance and subsequently in the development of the clinical disease. Genetic susceptibility, the impaired elimination of apoptotic β-cell remnants, altered immune regulatory functions, and environmental factors such as viral infections determine the outcome. Autoreactivity might exist under physiologic conditions and when the integrity of the complex regulatory process is damaged the disease might develop. We summarized the immune regulatory mechanisms that might have a crucial role in disease pathology and development. PMID:24285974

  17. Altered Immune Regulation in Type 1 Diabetes

    Directory of Open Access Journals (Sweden)

    András Zóka

    2013-01-01

    Full Text Available Research in genetics and immunology was going on separate strands for a long time. Type 1 diabetes mellitus might not be characterized with a single pathogenetic factor. It develops when a susceptible individual is exposed to potential triggers in a given sequence and timeframe that eventually disarranges the fine-tuned immune mechanisms that keep autoimmunity under control in health. Genomewide association studies have helped to understand the congenital susceptibility, and hand-in-hand with the immunological research novel paths of immune dysregulation were described in central tolerance, apoptotic pathways, or peripheral tolerance mediated by regulatory T-cells. Epigenetic factors are contributing to the immune dysregulation. The interplay between genetic susceptibility and potential triggers is likely to play a role at a very early age and gradually results in the loss of balanced autotolerance and subsequently in the development of the clinical disease. Genetic susceptibility, the impaired elimination of apoptotic β-cell remnants, altered immune regulatory functions, and environmental factors such as viral infections determine the outcome. Autoreactivity might exist under physiologic conditions and when the integrity of the complex regulatory process is damaged the disease might develop. We summarized the immune regulatory mechanisms that might have a crucial role in disease pathology and development.

  18. Exosomes and their roles in immune regulation and cancer.

    Science.gov (United States)

    Greening, David W; Gopal, Shashi K; Xu, Rong; Simpson, Richard J; Chen, Weisan

    2015-04-01

    Exosomes, a subset of extracellular vesicles (EVs), function as a mode of intercellular communication and molecular transfer. Exosomes facilitate the direct extracellular transfer of proteins, lipids, and miRNA/mRNA/DNAs between cells in vitro and in vivo. The immunological activities of exosomes affect immunoregulation mechanisms including modulating antigen presentation, immune activation, immune suppression, immune surveillance, and intercellular communication. Besides immune cells, cancer cells secrete immunologically active exosomes that influence both physiological and pathological processes. The observation that exosomes isolated from immune cells such as dendritic cells (DCs) modulate the immune response has enforced the way these membranous vesicles are being considered as potential immunotherapeutic reagents. Indeed, tumour- and immune cell-derived exosomes have been shown to carry tumour antigens and promote immunity, leading to eradication of established tumours by CD8(+) T cells and CD4(+) T cells, as well as directly suppressing tumour growth and resistance to malignant tumour development. Further understanding of these areas of exosome biology, and especially of molecular mechanisms involved in immune cell targeting, interaction and manipulation, is likely to provide significant insights into immunorecognition and therapeutic intervention. Here, we review the emerging roles of exosomes in immune regulation and the therapeutic potential in cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Planning and Implementing Immunization Billing Programs at State and Local Health Departments: Barriers and Possible Solutions.

    Science.gov (United States)

    Corriero, Rosemary; Redmon, Ginger

    Before participating in a project funded by the Centers for Disease Control and Prevention, most state and local health departments (LHDs) were not seeking reimbursement or being fully reimbursed by insurance plans for the cost of immunization services (including vaccine costs and administration fees) they provided to insured patients. Centers for Disease Control and Prevention's Billables Project was designed to enable state and LHDs to bill public and private insurance plans for immunization services provided to insured patients. Identify and describe key barriers state and LHDs may encounter while planning and implementing a billing program, as well as possible solutions for overcoming those barriers. This study used reports from Billables Project participants to explore barriers they encountered when planning and implementing a billing program and steps taken to address those barriers. Thirty-eight state immunization programs. Based on project participants' reports, barriers were noted in 7 categories: (1) funding and costs, (2) staff, (3) health department characteristics, (4) third-party payers and insurance plans, (5) software, (6) patient insurance status, and (7) other barriers. Possible solutions for overcoming those barriers included hiring or seeking external help, creating billing guides and training modules, streamlining workflows, and modifying existing software systems. Overcoming barriers during planning and implementation of a billing program can be challenging for state and LHDs, but the experiences and suggestions of past Billables Project participants can help guide future billing program efforts.

  20. RAC1 in keratinocytes regulates crosstalk to immune cells by Arp2/3-dependent control of STAT1

    DEFF Research Database (Denmark)

    Pedersen, Esben Ditlev Kølle; Wang, Zhipeng; Stanley, Alanna

    2012-01-01

    Crosstalk between keratinocytes and immune cells is crucial for the immunological barrier function of the skin, and aberrant crosstalk contributes to inflammatory skin diseases. Using mice with a keratinocyte-restricted deletion of the RAC1 gene we found that RAC1 in keratinocytes plays...... hypersensitive to inflammatory stimuli both in vitro and in vivo, suggesting a major role for RAC1 in regulating the crosstalk between the epidermis and the immune system....

  1. IMMUNE REGULATING ES-PRODUCTS IN PARASITIC NEMATODES

    DEFF Research Database (Denmark)

    Bahlool, Qusay Zuhair Mohammad; Buchmann, Kurt; Kania, Per Walter

    work elucidates the effect of ES substances on the fish immune system by measuring immune gene expression in spleen and liver of rainbow trout (Oncorhynchus mykiss) injected intraperitoneally with ES products isolated from A. simplex third stage larvae. The overall gene expression profile of exposed...... fish showed a generalized down-regulation of the immune genes tested, suggesting a role of ES proteins in minimizing the immune reaction of rainbow trout against invading nematodes. We also tested the enzymatic activity of the ES proteins and found that lipase, esterase lipase, valine and cysteine...... arylamidases, naphthol-AS-BI-phosphohydrolase and a-galactosidase activities were present in the ES solution. This type of hydrolytic enzyme activity may play a role in nematode penetration of host tissue. Based on the notion that A. simplex ES-proteins may have an immune-depressive effect, it could also...

  2. Barriers to the use of reminder/recall interventions for immunizations: a systematic review

    Directory of Open Access Journals (Sweden)

    Pereira Jennifer A

    2012-12-01

    Full Text Available Abstract Background Although many studies have demonstrated the benefits of reminder/recall (RR measures to address patient under-immunization and improve immunization coverage, they are not widely implemented by healthcare providers. We identified providers’ perceived barriers to their use from existing literature. Methods We conducted a systematic review of relevant articles published in English between January 1990 and July 2011 that examined the perceptions of healthcare providers regarding barriers to tracking patient immunization history and implementing RR interventions. We searched MEDLINE, PubMed, EMBASE, Cumulative Index to Nursing and Allied Health Literature, Academic Search Premier, and PsychINFO. Additional strategies included hand-searching the references of pertinent articles and related reviews, and searching keywords in Google Scholar and Google. Results Ten articles were included; all described populations in the United States, and examined perceptions of family physicians, pediatricians, and other immunization staff. All articles were of moderate-high methodological quality; the majority (n=7 employed survey methodology. The most frequently described barriers involved the perceived human and financial resources associated with implementing an RR intervention, as well as low confidence in the accuracy of patient immunization records, given the lack of data sharing between multiple immunization providers. Changes to staff workflow, lack of appropriate electronic patient-tracking functionalities, and uncertainty regarding the success of RR interventions were also viewed as barriers to their adoption. Conclusions Although transitioning to electronic immunization records and registries should facilitate the implementation of RR interventions, numerous perceived barriers must still be overcome before the full benefits of these methods can be realized.

  3. NKT Cell Networks in the Regulation of Tumor Immunity

    Science.gov (United States)

    Robertson, Faith C.; Berzofsky, Jay A.; Terabe, Masaki

    2014-01-01

    CD1d-restricted natural killer T (NKT) cells lie at the interface between the innate and adaptive immune systems and are important mediators of immune responses and tumor immunosurveillance. These NKT cells uniquely recognize lipid antigens, and their rapid yet specific reactions influence both innate and adaptive immunity. In tumor immunity, two NKT subsets (type I and type II) have contrasting roles in which they not only cross-regulate one another, but also impact innate immune cell populations, including natural killer, dendritic, and myeloid lineage cells, as well as adaptive populations, especially CD8+ and CD4+ T cells. The extent to which NKT cells promote or suppress surrounding cells affects the host’s ability to prevent neoplasia and is consequently of great interest for therapeutic development. Data have shown the potential for therapeutic use of NKT cell agonists and synergy with immune response modifiers in both pre-clinical studies and preliminary clinical studies. However, there is room to improve treatment efficacy by further elucidating the biological mechanisms underlying NKT cell networks. Here, we discuss the progress made in understanding NKT cell networks, their consequent role in the regulation of tumor immunity, and the potential to exploit that knowledge in a clinical setting. PMID:25389427

  4. NKT cell networks in the regulation of tumor immunity.

    Science.gov (United States)

    Robertson, Faith C; Berzofsky, Jay A; Terabe, Masaki

    2014-01-01

    CD1d-restricted natural killer T (NKT) cells lie at the interface between the innate and adaptive immune systems and are important mediators of immune responses and tumor immunosurveillance. These NKT cells uniquely recognize lipid antigens, and their rapid yet specific reactions influence both innate and adaptive immunity. In tumor immunity, two NKT subsets (type I and type II) have contrasting roles in which they not only cross-regulate one another, but also impact innate immune cell populations, including natural killer, dendritic, and myeloid lineage cells, as well as adaptive populations, especially CD8(+) and CD4(+) T cells. The extent to which NKT cells promote or suppress surrounding cells affects the host's ability to prevent neoplasia and is consequently of great interest for therapeutic development. Data have shown the potential for therapeutic use of NKT cell agonists and synergy with immune response modifiers in both pre-clinical studies and preliminary clinical studies. However, there is room to improve treatment efficacy by further elucidating the biological mechanisms underlying NKT cell networks. Here, we discuss the progress made in understanding NKT cell networks, their consequent role in the regulation of tumor immunity, and the potential to exploit that knowledge in a clinical setting.

  5. NKT cell networks in the regulation of tumor immunity

    Directory of Open Access Journals (Sweden)

    Faith C Robertson

    2014-10-01

    Full Text Available CD1d-restricted natural killer T (NKT cells lie at the interface between the innate and adaptive immune systems and are important mediators of immune responses and tumor immunosurveillance. These NKT cells uniquely recognize lipid antigens, and their rapid yet specific reactions influence both innate and adaptive immunity. In tumor immunity, two NKT subsets (type I and type II have contrasting roles in which they not only cross-regulate one another, but also impact innate immune cell populations, including natural killer, dendritic and myeloid lineage cells, as well as adaptive populations, especially CD8+ and CD4+ T cells. The extent to which NKT cells promote or suppress surrounding cells affects the host’s ability to prevent neoplasia and is consequently of great interest for therapeutic development. Data have shown the potential for therapeutic use of NKT cell agonists and synergy with immune response modifiers in both pre-clinical studies and preliminary clinical studies. However, there is room to improve treatment efficacy by further elucidating the biological mechanisms underlying NKT cell networks. Here, we discuss the progress made in understanding NKT cell networks, their consequent role in the regulation of tumor immunity, and the potential to exploit that knowledge in a clinical setting.

  6. Understanding the main barriers to immunization in Colombia to better tailor communication strategies.

    Science.gov (United States)

    García L, Diego Alejandro; Velandia-González, Martha; Trumbo, Silas Pierson; Pedreira, M Cristina; Bravo-Alcántara, Pamela; Danovaro-Holliday, M Carolina

    2014-06-30

    The Expanded Program on Immunization (EPI) in Colombia has made great advances since its inception in 1979; however, by 2010 vaccination coverage rates had been declining. In 2010, the EPI commissioned a nationwide study on practices on immunization, attitudes and knowledge, perceived service quality, and barriers to childhood immunization in order to tailor EPI communication strategies. Colombia's 32 geographical departments were divided into 10 regions. Interviewers from an independent polling company administered a survey to 4802 parents and guardians of children aged communication preferences, and parental attitudes on vaccination. Although all respondents indicated that vaccines have health benefits, and 4738 (98.7%) possessed vaccination cards for their children, attitudes and knowledge were not always favorable to immunization. Six groups of immunization barriers were identified: 1) factors related to caregivers (24.4%), 2) vaccinators (19.7%), 3) health centers (18.0%), 4) the health system (13.4%), 5) concerns about adverse events (13.1%), and 6) cultural and religious beliefs (11.4%); groups 1, 5 and 6 together represented almost half (48.9%) of users, indicating problems related to the demand for vaccines as the primary barriers to immunization. Differences in demographics, communication preferences, and reported service quality were found among participants in the six groups and among participants in the 10 regions. Additionally, differences between how participants reported receiving information on vaccination and how they believed such information should be communicated were observed. Better understanding immunization barriers and the users of the EPI can help tailor communication strategies to increase demand for immunization services. Results of the study have been used by Colombia's EPI to inform the design of new communication strategies.

  7. Muslim Scholars' Knowledge, Attitudes and Perceived Barriers Towards Polio Immunization in Pakistan.

    Science.gov (United States)

    Khan, Muhammad Umair; Ahmad, Akram; Salman, Saad; Ayub, Maria; Aqeel, Talieha; Haq, Noman-Ul; Saleem, Fahad; Khan, Muhammad Ubaid

    2017-04-01

    Pakistan is one of the two countries where polio remains endemic. Among multiple reasons of polio prevalence, false religious beliefs are accounted as major barriers towards polio immunization in Pakistan. Within this context, religious scholars are now engaged in polio immunization campaigns to dismantle the myths and battle the resurgence of polio in Pakistan. The objective of this study was to assess knowledge, attitudes and perceived barriers of Muslim scholars towards polio immunization in Pakistan. A descriptive, cross-sectional survey of Muslim scholars was conducted in Quetta and Peshawar divisions of Pakistan. From October to December 2015, a convenience sample of 770 Muslim scholars was recruited from the local mosques and religious institutions to participate in this study. Knowledge, attitudes, and perceived barriers were assessed by using self-administered, anonymous and pretested questionnaire. Descriptive and regression analyses were used to express the results with p polio with a mean score of 7.16 ± 2.12 (based on 14 questions). Knowledge gaps were identified about the transmission (32.6 %) and consequences of poliovirus (39.9 %). Overall, 527 (68.4 %) participants showed positive attitudes towards polio immunization with a mean attitude score of 27.35 ± 2.68 (based on nine statements). The majority of participants agreed on the need of depoliticizing polio immunization issues (87.1 %), while reservations were noted about their willingness to participate in future polio immunization programs (44.6 %). Security (75.8 %) and vaccine management issues (64 %) were reported by the participants as the major barriers towards polio immunization in Pakistan. The findings showed poor knowledge of Muslim scholars towards polio; however, their attitudes were positive towards polio immunization. More studies are required to assess the knowledge and attitudes of Muslim scholars at the national level to validate the findings of this study.

  8. Claudins, dietary milk proteins, and intestinal barrier regulation.

    Science.gov (United States)

    Kotler, Belinda M; Kerstetter, Jane E; Insogna, Karl L

    2013-01-01

    The family of claudin proteins plays an important role in regulating the intestinal barrier by modulating the permeability of tight junctions. The impact of dietary protein on claudin biology has not been studied extensively. Whey proteins have been reported to improve intestinal barrier function, but their mechanism of action is not clear. Recent studies, however, have demonstrated increased intestinal claudin expression in response to milk protein components. Reviewed here are new findings suggesting that whey-protein-derived transforming growth factor β transcriptionally upregulates claudin-4 expression via a Smad-4-dependent pathway. These and other data, including limited clinical studies, are summarized below and, in the aggregate, suggest a therapeutic role for whey protein in diseases of intestinal barrier dysfunction, perhaps, in part, by regulating claudin expression. © 2013 International Life Sciences Institute.

  9. The Mucosal Immune System and Its Regulation by Autophagy.

    Science.gov (United States)

    Kabat, Agnieszka M; Pott, Johanna; Maloy, Kevin J

    2016-01-01

    The gastrointestinal tract presents a unique challenge to the mucosal immune system, which has to constantly monitor the vast surface for the presence of pathogens, while at the same time maintaining tolerance to beneficial or innocuous antigens. In the intestinal mucosa, specialized innate and adaptive immune components participate in directing appropriate immune responses toward these diverse challenges. Recent studies provide compelling evidence that the process of autophagy influences several aspects of mucosal immune responses. Initially described as a "self-eating" survival pathway that enables nutrient recycling during starvation, autophagy has now been connected to multiple cellular responses, including several aspects of immunity. Initial links between autophagy and host immunity came from the observations that autophagy can target intracellular bacteria for degradation. However, subsequent studies indicated that autophagy plays a much broader role in immune responses, as it can impact antigen processing, thymic selection, lymphocyte homeostasis, and the regulation of immunoglobulin and cytokine secretion. In this review, we provide a comprehensive overview of mucosal immune cells and discuss how autophagy influences many aspects of their physiology and function. We focus on cell type-specific roles of autophagy in the gut, with a particular emphasis on the effects of autophagy on the intestinal T cell compartment. We also provide a perspective on how manipulation of autophagy may potentially be used to treat mucosal inflammatory disorders.

  10. [Immune regulation activity and mechanism of Tibetan Kefir exopolysaccharide fractions].

    Science.gov (United States)

    Meng, Li; Zhang, Lanwei

    2009-12-01

    To investigate the effects and mechanism on immune regulation activity in mice of two Tibetan Kefir exoploysaccharides (EPS) with different molecular weight of 0.1 x 10(5) - 3 x 10(5) (fraction 1) and 1.8 x 10(3) (fraction 2). The immune regulation activity experiment was carried out in vitro based on the Functional Assessment Procedure and Test Methods of Health Food, which was issued by Ministry of Health of China. First, we treated mice subjects with EPS at doses of 40 mg/kg, 80 mg/kg, 120 mg/kg through ig. Then we detected the index of immune organs, the ability of antibody production (tested by HC50), activity of NK cell, delayed type hypersensitivity (DTH) and phagocytosis of macrophage in mice. Finally, we examined the expression of Erk protein in Macrophages by Western Blot assay. Fraction 1 could promote HC50, activity of NK cell and DTH in mice which low dose showed better. Fraction 2 could promote DTH, phagocytosis of macrophage which high dose showed better. The expression of Erk and COX-2 had the same trend with Phagocytic index. We verified the two fractions of Tibetan Kefir EPS could enhance immune functions in mice. Fraction 1 regulated immune function through NK cell and B cell while fraction 2 through macrophage cell and T cell. The effects to macrophage of Tibetan Kefir EPS in mice may realize through extra cellular signal-regulated kinase Erk pathway.

  11. Government regulation of business in a changing institutional barrier

    Directory of Open Access Journals (Sweden)

    Novikova I.

    2013-02-01

    Full Text Available The article examines the domestic experience in government regulation of business in a changing institutional barrier.Compared the degree of economic freedom in Ukraine. The emphasis is on the need to develop a national strategy of institutional development of domestic entrepreneurship.

  12. Microparticles as immune regulators in infectious disease

    Directory of Open Access Journals (Sweden)

    Zheng Lung Ling

    2011-11-01

    Full Text Available Despite their clear relationship to immunology, few existing studies have examined potential role of microparticles (MP in infectious disease. Infection with pathogens usually leads to the expression of a range of inflammatory cytokines and chemokines, as well as significant stress in both infected and uninfected cells. It is thus reasonable to infer from studies to date that infection-associated inflammation also leads to MP production. MP are produced by most of the major cell types in the immune system, and appear to be involved at both the innate and adaptive levels, potentially serving different functions at each level. Thus, MP do not appear to have a universal function; instead their functions are source- or stimulus-dependent, although likely to be primarily either pro- or anti-inflammatory. Importantly, in infectious diseases MP may have the ability to deliver antigen to APC via the biological cargo acquired from their cells of origin. Another potential benefit of MP would be to transfer and/or disseminate phenotype and function to target cells. However, MP may also potentially be manipulated, particularly by intracellular pathogens for survival advantage.

  13. FOXO-dependent regulation of innate immune homeostasis.

    Science.gov (United States)

    Becker, Thomas; Loch, Gerrit; Beyer, Marc; Zinke, Ingo; Aschenbrenner, Anna C; Carrera, Pilar; Inhester, Therese; Schultze, Joachim L; Hoch, Michael

    2010-01-21

    The innate immune system represents an ancient host defence mechanism that protects against invading microorganisms. An important class of immune effector molecules to fight pathogen infections are antimicrobial peptides (AMPs) that are produced in plants and animals. In Drosophila, the induction of AMPs in response to infection is regulated through the activation of the evolutionarily conserved Toll and immune deficiency (IMD) pathways. Here we show that AMP activation can be achieved independently of these immunoregulatory pathways by the transcription factor FOXO, a key regulator of stress resistance, metabolism and ageing. In non-infected animals, AMP genes are activated in response to nuclear FOXO activity when induced by starvation, using insulin signalling mutants, or by applying small molecule inhibitors. AMP induction is lost in foxo null mutants but enhanced when FOXO is overexpressed. Expression of AMP genes in response to FOXO activity can also be triggered in animals unable to respond to immune challenges due to defects in both the Toll and IMD pathways. Molecular experiments at the Drosomycin promoter indicate that FOXO directly binds to its regulatory region, thereby inducing its transcription. In vivo studies in Drosophila, but also studies in human lung, gut, kidney and skin cells indicate that a FOXO-dependent regulation of AMPs is evolutionarily conserved. Our results indicate a new mechanism of cross-regulation of metabolism and innate immunity by which AMP genes can be activated under normal physiological conditions in response to the oscillating energy status of cells and tissues. This regulation seems to be independent of the pathogen-responsive innate immunity pathways whose activation is often associated with tissue damage and repair. The sparse production of AMPs in epithelial tissues in response to FOXO may help modulating the defence reaction without harming the host tissues, in particular when animals are suffering from energy shortage

  14. Histone deacetylases as regulators of inflammation and immunity.

    Science.gov (United States)

    Shakespear, Melanie R; Halili, Maria A; Irvine, Katharine M; Fairlie, David P; Sweet, Matthew J

    2011-07-01

    Histone deacetylases (HDACs) remove an acetyl group from lysine residues of target proteins to regulate cellular processes. Small-molecule inhibitors of HDACs cause cellular growth arrest, differentiation and/or apoptosis, and some are used clinically as anticancer drugs. In animal models, HDAC inhibitors are therapeutic for several inflammatory diseases, but exacerbate atherosclerosis and compromise host defence. Loss of HDAC function has also been linked to chronic lung diseases in humans. These contrasting effects might reflect distinct roles for individual HDACs in immune responses. Here, we review the current understanding of innate and adaptive immune pathways that are regulated by classical HDAC enzymes. The objective is to provide a rationale for targeting (or not targeting) individual HDAC enzymes with inhibitors for future immune-related applications. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Therapeutic potential of helminths in autoimmune diseases: helminth-derived immune-regulators and immune balance.

    Science.gov (United States)

    Wang, Meng; Wu, Linxiang; Weng, Rennan; Zheng, Weihong; Wu, Zhongdao; Lv, Zhiyue

    2017-08-01

    Helminths have accompanied human throughout history by releasing immune-evasion molecules that could counteract an aberrant immune response within the host. In the past decades, helminth infections are becoming less prevalent possibly due to the developed sanitation. Meanwhile, the incidence of autoimmune diseases is increasing, which cannot be exclusively explained by the changes of susceptibility genes. While the hygiene hypothesis casts light on the problem. The infections of helminths are believed to interact with and regulate human immunity with the byproduct of suppressing the autoimmune diseases. Thus, helminths are potential to treat or cure the autoimmune diseases. The therapeutic progresses and possible immune suppression mechanisms are illustrated in the review. The helminths that are studied most intensively include Heligmosomoides polygyrus, Hymenolepis diminuta, Schistosoma mansoni, Trichinella spiralis, and Trichuris suis. Special attentions are paid on the booming animal models and clinical trials that are to detect the efficiency of immune-modulating helminth-derived molecules on autoimmune diseases. These trials provide us with a prosperous clinical perspective, but the precise mechanism of the down-regulatory immune response remains to be clarified. More efforts are needed to be dedicated until these parasite-derived immune modulators could be used in clinic to treat or cure the autoimmune diseases under a standard management.

  16. The skin microbiome: impact of modern environments on skin ecology, barrier integrity, and systemic immune programming.

    Science.gov (United States)

    Prescott, Susan L; Larcombe, Danica-Lea; Logan, Alan C; West, Christina; Burks, Wesley; Caraballo, Luis; Levin, Michael; Etten, Eddie Van; Horwitz, Pierre; Kozyrskyj, Anita; Campbell, Dianne E

    2017-01-01

    Skin barrier structure and function is essential to human health. Hitherto unrecognized functions of epidermal keratinocytes show that the skin plays an important role in adapting whole-body physiology to changing environments, including the capacity to produce a wide variety of hormones, neurotransmitters and cytokine that can potentially influence whole-body states, and quite possibly, even emotions. Skin microbiota play an integral role in the maturation and homeostatic regulation of keratinocytes and host immune networks with systemic implications. As our primary interface with the external environment, the biodiversity of skin habitats is heavily influenced by the biodiversity of the ecosystems in which we reside. Thus, factors which alter the establishment and health of the skin microbiome have the potential to predispose to not only cutaneous disease, but also other inflammatory non-communicable diseases (NCDs). Indeed, disturbances of the stratum corneum have been noted in allergic diseases (eczema and food allergy), psoriasis, rosacea, acne vulgaris and with the skin aging process. The built environment, global biodiversity losses and declining nature relatedness are contributing to erosion of diversity at a micro-ecological level, including our own microbial habitats. This emphasises the importance of ecological perspectives in overcoming the factors that drive dysbiosis and the risk of inflammatory diseases across the life course.

  17. Mucosal innate immune cells regulate both gut homeostasis and intestinal inflammation.

    Science.gov (United States)

    Kurashima, Yosuke; Goto, Yoshiyuki; Kiyono, Hiroshi

    2013-12-01

    Continuous exposure of intestinal mucosal surfaces to diverse microorganisms and their metabolites reflects the biological necessity for a multifaceted, integrated epithelial and immune cell-mediated regulatory system. The development and function of the host cells responsible for the barrier function of the intestinal surface (e.g., M cells, Paneth cells, goblet cells, and columnar epithelial cells) are strictly regulated through both positive and negative stimulation by the luminal microbiota. Stimulation by damage-associated molecular patterns and commensal bacteria-derived microbe-associated molecular patterns provokes the assembly of inflammasomes, which are involved in maintaining the integrity of the intestinal epithelium. Mucosal immune cells located beneath the epithelium play critical roles in regulating both the mucosal barrier and the relative composition of the luminal microbiota. Innate lymphoid cells and mast cells, in particular, orchestrate the mucosal regulatory system to create a mutually beneficial environment for both the host and the microbiota. Disruption of mucosal homeostasis causes intestinal inflammation such as that seen in inflammatory bowel disease. Here, we review the recent research on the biological interplay among the luminal microbiota, epithelial cells, and mucosal innate immune cells in both healthy and pathological conditions. © 2013 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Molecular mechanisms of aging and immune system regulation in Drosophila.

    Science.gov (United States)

    Eleftherianos, Ioannis; Castillo, Julio Cesar

    2012-01-01

    Aging is a complex process that involves the accumulation of deleterious changes resulting in overall decline in several vital functions, leading to the progressive deterioration in physiological condition of the organism and eventually causing disease and death. The immune system is the most important host-defense mechanism in humans and is also highly conserved in insects. Extensive research in vertebrates has concluded that aging of the immune function results in increased susceptibility to infectious disease and chronic inflammation. Over the years, interest has grown in studying the molecular interaction between aging and the immune response to pathogenic infections. The fruit fly Drosophila melanogaster is an excellent model system for dissecting the genetic and genomic basis of important biological processes, such as aging and the innate immune system, and deciphering parallel mechanisms in vertebrate animals. Here, we review the recent advances in the identification of key players modulating the relationship between molecular aging networks and immune signal transduction pathways in the fly. Understanding the details of the molecular events involved in aging and immune system regulation will potentially lead to the development of strategies for decreasing the impact of age-related diseases, thus improving human health and life span.

  19. MicroRNA regulation of immune events at conception.

    Science.gov (United States)

    Robertson, Sarah A; Zhang, Bihong; Chan, Honyueng; Sharkey, David J; Barry, Simon C; Fullston, Tod; Schjenken, John E

    2017-09-01

    The reproductive tract environment at conception programs the developmental trajectory of the embryo, sets the course of pregnancy, and impacts offspring phenotype and health. Despite the fundamental importance of this stage of reproduction, the rate-limiting regulatory mechanisms operating locally to control fertility and fecundity are incompletely understood. Emerging studies highlight roles for microRNAs (miRNAs) in regulating reproductive and developmental processes and in modulating the quality and strength of the female immune response. Since endometrial receptivity and robust placentation require specific adaptation of the immune response, we hypothesize that miRNAs participate in establishing pregnancy through effects on key gene networks in immune cells. Our recent studies investigated miRNAs that are induced in the peri-conception environment, focusing on miRNAs that have immune-regulatory roles-particularly miR-223, miR-155, and miR-146a. Genetic mouse models deficient in individual miRNAs are proving informative in defining roles for these miRNAs in the generation and stabilization of regulatory T cells (Treg cells) that confer adaptive immune tolerance. Overlapping and redundant functions between miRNAs that target multiple genes, combined with multiple miRNAs targeting individual genes, indicate complex and sensitive regulatory networks. Although to date most data on miRNA regulation of reproductive events are from mice, conserved functions of miRNAs across species imply similar biological pathways operate in all mammals. Understanding the regulation and roles of miRNAs in the peri-conception immune response will advance our knowledge of how environmental determinants act at conception, and could have practical applications for animal breeding as well as human fertility. © 2017 Wiley Periodicals, Inc.

  20. Adopted orphans as regulators of inflammation, immunity and skeletal homeostasis.

    Science.gov (United States)

    Ipseiz, Natacha; Scholtysek, Carina; Culemann, Stephan; Krönke, Gerhard

    2014-01-01

    Adopted orphan nuclear receptors, such as peroxisome proliferator-activated receptors (PPARs) and liver X receptors (LXRs), have emerged as key regulators of inflammation and immunity and likewise control skeletal homeostasis. These properties render them attractive targets for the therapy of various inflammatory and autoimmune diseases affecting the musculoskeletal system. This review summarises the current knowledge on the role of these families of receptors during innate and adaptive immunity as well as during the control of bone turnover and discuss the potential use of targeting these molecules during the treatment of chronic diseases such as osteoarthritis, rheumatoid arthritis and osteoporosis.

  1. Atopic dermatitis results in intrinsic barrier and immune abnormalities: Implications for contact dermatitis

    Science.gov (United States)

    Gittler, Julia K.; Krueger, James G.; Guttman-Yassky, Emma

    2014-01-01

    Atopic dermatitis (AD), as well as irritant contact dermatitis (ICD) and allergic contact dermatitis (ACD), are common skin diseases. These diseases are characterized by skin inflammation mediated by activated innate immunity or acquired immune mechanisms. Although AD, ICD, and ACD can be encountered in pure forms by allergists and dermatologists, patients with AD often present with increased frequency of ICD and ACD. Although a disturbed barrier alone could potentiate immune reactivity in patients with AD through increased antigen penetration, additional immune mechanisms might explain the increased susceptibility of atopic patients to ICD and ACD. This review discusses cellular pathways associated with increased skin inflammation in all 3 conditions and presents mechanisms that might contribute to the increased rate of ICD and ACD in patients with AD. PMID:22939651

  2. Zonulin, a regulator of epithelial and endothelial barrier functions, and its involvement in chronic inflammatory diseases.

    Science.gov (United States)

    Sturgeon, Craig; Fasano, Alessio

    2016-01-01

    Beside digesting nutrients and absorbing solutes and electrolytes, the intestinal epithelium with its barrier function is in charge of a tightly controlled antigen trafficking from the intestinal lumen to the submucosa. This trafficking dictates the delicate balance between tolerance and immune response causing inflammation. Loss of barrier function secondary to upregulation of zonulin, the only known physiological modulator of intercellular tight junctions, leads to uncontrolled influx of dietary and microbial antigens. Additional insights on zonulin mechanism of action and the recent appreciation of the role that altered intestinal permeability can play in the development and progression of chronic inflammatory disorders has increased interest of both basic scientists and clinicians on the potential role of zonulin in the pathogenesis of these diseases. This review focuses on the recent research implicating zonulin as a master regulator of intestinal permeability linked to the development of several chronic inflammatory disorders.

  3. Zonulin and its regulation of intestinal barrier function: the biological door to inflammation, autoimmunity, and cancer.

    Science.gov (United States)

    Fasano, Alessio

    2011-01-01

    The primary functions of the gastrointestinal tract have traditionally been perceived to be limited to the digestion and absorption of nutrients and to electrolytes and water homeostasis. A more attentive analysis of the anatomic and functional arrangement of the gastrointestinal tract, however, suggests that another extremely important function of this organ is its ability to regulate the trafficking of macromolecules between the environment and the host through a barrier mechanism. Together with the gut-associated lymphoid tissue and the neuroendocrine network, the intestinal epithelial barrier, with its intercellular tight junctions, controls the equilibrium between tolerance and immunity to non-self antigens. Zonulin is the only physiological modulator of intercellular tight junctions described so far that is involved in trafficking of macromolecules and, therefore, in tolerance/immune response balance. When the finely tuned zonulin pathway is deregulated in genetically susceptible individuals, both intestinal and extraintestinal autoimmune, inflammatory, and neoplastic disorders can occur. This new paradigm subverts traditional theories underlying the development of these diseases and suggests that these processes can be arrested if the interplay between genes and environmental triggers is prevented by reestablishing the zonulin-dependent intestinal barrier function. This review is timely given the increased interest in the role of a "leaky gut" in the pathogenesis of several pathological conditions targeting both the intestine and extraintestinal organs.

  4. Neuroimmune interaction and the regulation of intestinal immune homeostasis.

    Science.gov (United States)

    Verheijden, Simon; Boeckxstaens, Guy E

    2018-01-01

    Many essential gastrointestinal functions, including motility, secretion, and blood flow, are regulated by the autonomic nervous system (ANS), both through intrinsic enteric neurons and extrinsic (sympathetic and parasympathetic) innervation. Recently identified neuroimmune mechanisms, in particular the interplay between enteric neurons and muscularis macrophages, are now considered to be essential for fine-tuning peristalsis. These findings shed new light on how intestinal immune cells can support enteric nervous function. In addition, both intrinsic and extrinsic neural mechanisms control intestinal immune homeostasis in different layers of the intestine, mainly by affecting macrophage activation through neurotransmitter release. In this mini-review, we discuss recent insights on immunomodulation by intrinsic enteric neurons and extrinsic innervation, with a particular focus on intestinal macrophages. In addition, we discuss the relevance of these novel mechanisms for intestinal immune homeostasis in physiological and pathological conditions, mainly focusing on motility disorders (gastroparesis and postoperative ileus) and inflammatory disorders (colitis).

  5. TIPE2, a negative regulator of innate and adaptive immunity that maintains immune homeostasis.

    Science.gov (United States)

    Sun, Honghong; Gong, Shunyou; Carmody, Ruaidhri J; Hilliard, Anja; Li, Li; Sun, Jing; Kong, Li; Xu, Lingyun; Hilliard, Brendan; Hu, Shimin; Shen, Hao; Yang, Xiaolu; Chen, Youhai H

    2008-05-02

    Immune homeostasis is essential for the normal functioning of the immune system, and its breakdown leads to fatal inflammatory diseases. We report here the identification of a member of the tumor necrosis factor-alpha-induced protein-8 (TNFAIP8) family, designated TIPE2, that is required for maintaining immune homeostasis. TIPE2 is preferentially expressed in lymphoid tissues, and its deletion in mice leads to multiorgan inflammation, splenomegaly, and premature death. TIPE2-deficient animals are hypersensitive to septic shock, and TIPE2-deficient cells are hyper-responsive to Toll-like receptor (TLR) and T cell receptor (TCR) activation. Importantly, TIPE2 binds to caspase-8 and inhibits activating protein-1 and nuclear factor-kappaB activation while promoting Fas-induced apoptosis. Inhibiting caspase-8 significantly blocks the hyper-responsiveness of TIPE2-deficient cells. These results establish that TIPE2 is an essential negative regulator of TLR and TCR function, and its selective expression in the immune system prevents hyperresponsiveness and maintains immune homeostasis.

  6. Antimicrobial peptides in the female reproductive tract: a critical component of the mucosal immune barrier with physiological and clinical implications.

    Science.gov (United States)

    Yarbrough, Victoria L; Winkle, Sean; Herbst-Kralovetz, Melissa M

    2015-01-01

    At the interface of the external environment and the mucosal surface of the female reproductive tract (FRT) lies a first-line defense against pathogen invasion that includes antimicrobial peptides (AMP). Comprised of a unique class of multifunctional, amphipathic molecules, AMP employ a wide range of functions to limit microbial invasion and replication within host cells as well as independently modulate the immune system, dampen inflammation and maintain tissue homeostasis. The role of AMP in barrier defense at the level of the skin and gut has received much attention as of late. Given the far reaching implications for women's health, maternal and fetal morbidity and mortality, and sexually transmissible and polymicrobial diseases, we herein review the distribution and function of key AMP throughout the female reproductive mucosa and assess their role as an essential immunological barrier to microbial invasion throughout the reproductive cycle of a woman's lifetime. A comprehensive search in PubMed/Medline was conducted related to AMP general structure, function, signaling, expression, distribution and barrier function of AMP in the FRT, hormone regulation of AMP, the microbiome of the FRT, and AMP in relation to implantation, pregnancy, fertility, pelvic inflammatory disease, complications of pregnancy and assisted reproductive technology. AMP are amphipathic peptides that target microbes for destruction and have been conserved throughout all living organisms. In the FRT, several major classes of AMP are expressed constitutively and others are inducible at the mucosal epithelium and by immune cells. AMP expression is also under the influence of sex hormones, varying throughout the menstrual cycle, and dependent on the vaginal microbiome. AMP can prevent infection with sexually transmissible and opportunistic pathogens of the female reproductive tissues, although emerging understanding of vaginal dysbiosis suggests induction of a unique AMP profile with increased

  7. HIV enteropathy and aging: gastrointestinal immunity, mucosal epithelial barrier, and microbial translocation.

    Science.gov (United States)

    Wang, Hongyin; Kotler, Donald P

    2014-07-01

    Despite decreases in morbidity and mortality as a result of antiretroviral therapy, gastrointestinal dysfunction remains common in HIV infection. Treated patients are at risk for complications of 'premature' aging, such as cardiovascular disease, osteopenia, neurocognitive decline, malignancies, and frailty. This review summarizes recent observations in this field. Mucosal CD4 lymphocytes, especially Th17 cells, are depleted in acute HIV and simian immune deficiency virus (SIV) infections, although other cell types also are affected. Reconstitution during therapy often is incomplete, especially in mucosa. Mucosal barrier function is affected by both HIV infection and aging and includes paracellular transport via tight junctions and uptake through areas of apoptosis; other factors may affect systemic antigen exposure. The resultant microbial translocation is associated with systemic immune activation in HIV and SIV infections. There is evidence of immune activation and microbial translocation in the elderly. The immune phenotypes of immunosenescence in HIV infection and aging appear similar. There are several targets for intervention; blockage of residual mucosal virus replication, preventing antigen uptake, modulating the microbiome, improving T cell recovery, combining therapies aimed at mucosal integrity, augmenting mucosal immunity, and managing traditional risk factors for premature aging in the general population. Aging may interact with HIV enteropathy to enhance microbial translocation and immune activation.

  8. Probiotics and the Gut Immune System: Indirect Regulation.

    Science.gov (United States)

    La Fata, Giorgio; Weber, Peter; Mohajeri, M Hasan

    2018-03-01

    The gastrointestinal tract (GIT) represents the largest interface between the human organism and the external environment. In the lumen and upper part of the mucus layer, this organ hosts an enormous number of microorganisms whose composition affects the functions of the epithelial barrier and the gut immune system. Consequentially, the microorganisms in the GIT influence the health status of the organism. Probiotics are living microorganisms which, in specific conditions, confer a health benefit to the host. Among others, probiotics have immunomodulatory properties that usually act directly by (a) increasing the activity of macrophages or natural killer cells, (b) modulating the secretion of immunoglobulins or cytokines, or indirectly by (c) enhancing the gut epithelial barrier, (d) altering the mucus secretion, and (e) competitive exclusion of other (pathogenic) bacteria. This review focuses on specific bacteria strains with indirect immunomodulatory properties. Particularly, we describe here the mechanisms through which specific probiotics enhance the gut epithelial barrier and modulate mucus production. Moreover, we describe the antimicrobial properties of specific bacteria strains. Recent data suggest that multiple pathologies are associated with an unbalanced gut microflora (dysbiosis). Although the cause-effect relationship between pathology and gut microflora is not yet well established, consumption of specific probiotics may represent a powerful tool to re-establish gut homeostasis and promote gut health.

  9. DMPD: Innate immune recognition of, and regulation by, DNA. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16979939 Innate immune recognition of, and regulation by, DNA. Ishii KJ, Akira S. T...rends Immunol. 2006 Nov;27(11):525-32. Epub 2006 Sep 18. (.png) (.svg) (.html) (.csml) Show Innate immune recognition... of, and regulation by, DNA. PubmedID 16979939 Title Innate immune recognition of, and regulation b

  10. DMPD: Innate immune responses: crosstalk of signaling and regulation of genetranscription. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16753195 Innate immune responses: crosstalk of signaling and regulation of genetran...l) (.csml) Show Innate immune responses: crosstalk of signaling and regulation of genetranscription. PubmedI...D 16753195 Title Innate immune responses: crosstalk of signaling and regulation o

  11. DMPD: The SAP family of adaptors in immune regulation. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 15541655 The SAP family of adaptors in immune regulation. Latour S, Veillette A. Se...min Immunol. 2004 Dec;16(6):409-19. (.png) (.svg) (.html) (.csml) Show The SAP family of adaptors in immune ...regulation. PubmedID 15541655 Title The SAP family of adaptors in immune regulation. Authors Latour S, Veill

  12. Regulation of TGFβ in the immune system: An emerging role for integrins and dendritic cells

    OpenAIRE

    Worthington, John J.; Fenton, Thomas M.; Czajkowska, Beata I.; Klementowicz, Joanna E.; Travis, Mark A.

    2012-01-01

    Regulation of an immune response requires complex crosstalk between cells of the innate and adaptive immune systems, via both cell?cell contact and secretion of cytokines. An important cytokine with a broad regulatory role in the immune system is transforming growth factor-? (TGF-?). TGF-? is produced by and has effects on many different cells of the immune system, and plays fundamental roles in the regulation of immune responses during homeostasis, infection and disease. Although many cells ...

  13. The placental barrier in allogenic immune conflict in spontaneous early abortions: immunohistochemical and morphological study.

    Science.gov (United States)

    Gurevich, Pavel; Elhayany, Asher; Milovanov, Andrey P; Halperin, Reuvit; Kaganovsky, Ella; Zusman, Itzhak; Ben-Hur, Herzel

    2007-11-01

    Morphologic changes in the placental barrier in spontaneous early abortions under the maternal-embryonic immune conflict, and the role of maternal immunoglobulins (Igs) in these changes. We examined chorionic villi and other tissues obtained from 54 aborts between weeks 3.5 and 8 of pregnancy. Material was divided into two groups. Group 1 (control) contained 15 medically recommended and spontaneous early aborts with no signs of inflammations or pathologic immune processes. Group 2 contained 39 spontaneous early aborts with acute chorionic villitis. Immunohistochemical and morphometric methods were used to study the Igs, different types of immunocompetent cells, and apoptosis-related components of the placental barrier. Acute villitis was found to be characterized by the destruction of all components of the chorionic villi, thrombovasculitis with apoptosis of the endothelium of capillaries and erythroblasts, mucous swelling of the basal membrane, and coagulation of the blood proteins. Due to destruction of the capillaries, the number of avasculate villi increased, and the average number of capillaries per villus decreased. The extremely high number of phagolysosomes with IgG and IgA in the villous monocytes in the group 2 indicates an increase in the phagocytic activity of monocytes against maternal Igs and may reflect the presence of mother-embryo immune conflict. Apoptosis of monocytes and a high number of promonocytes were seen accompanied by a high concentration of p53 protein. A large disturbance in the trophoblast occurred with disappearance of bcl-2 and the appearance of Fas ligand. Massive destruction of maternal Igs in embryonic monocytes and acute villitis in the placental barrier are manifested during the mother-embryo immune conflict, and this may be one of the reasons of spontaneous early abortions.

  14. Sphingosine 1-phosphate receptor 5 mediates the immune quiescence of the human brain endothelial barrier

    Directory of Open Access Journals (Sweden)

    van Doorn Ruben

    2012-06-01

    Full Text Available Abstract Background The sphingosine 1-phosphate (S1P receptor modulator FTY720P (Gilenya® potently reduces relapse rate and lesion activity in the neuroinflammatory disorder multiple sclerosis. Although most of its efficacy has been shown to be related to immunosuppression through the induction of lymphopenia, it has been suggested that a number of its beneficial effects are related to altered endothelial and blood–brain barrier (BBB functionality. However, to date it remains unknown whether brain endothelial S1P receptors are involved in the maintenance of the function of the BBB thereby mediating immune quiescence of the brain. Here we demonstrate that the brain endothelial receptor S1P5 largely contributes to the maintenance of brain endothelial barrier function. Methods We analyzed the expression of S1P5 in human post-mortem tissues using immunohistochemistry. The function of S1P5 at the BBB was assessed in cultured human brain endothelial cells (ECs using agonists and lentivirus-mediated knockdown of S1P5. Subsequent analyses of different aspects of the brain EC barrier included the formation of a tight barrier, the expression of BBB proteins and markers of inflammation and monocyte transmigration. Results We show that activation of S1P5 on cultured human brain ECs by a selective agonist elicits enhanced barrier integrity and reduced transendothelial migration of monocytes in vitro. These results were corroborated by genetically silencing S1P5 in brain ECs. Interestingly, functional studies with these cells revealed that S1P5 strongly contributes to brain EC barrier function and underlies the expression of specific BBB endothelial characteristics such as tight junctions and permeability. In addition, S1P5 maintains the immunoquiescent state of brain ECs with low expression levels of leukocyte adhesion molecules and inflammatory chemokines and cytokines through lowering the activation of the transcription factor NFκB. Conclusion Our

  15. Atopic dermatitis: immune deviation, barrier dysfunction, IgE autoreactivity and new therapies

    Directory of Open Access Journals (Sweden)

    Masutaka Furue

    2017-07-01

    Full Text Available Atopic dermatitis (AD is a chronic or chronically relapsing, eczematous, severely pruritic skin disorder mostly associated with IgE elevation and skin barrier dysfunction due to decreased filaggrin expression. The lesional skin of AD exhibits Th2- and Th22-deviated immune reactions that are progressive during disease chronicity. Th2 and Th22 cytokines further deteriorate the skin barrier by inhibiting filaggrin expression. Some IgEs are reactive to self-antigens. The IgE autoreactivity may precipitate the chronicity of AD. Upon activation of the ORAI1 calcium channel, atopic epidermis releases large amounts of thymic stromal lymphopoietin (TSLP, which initiates the Th2 and Th22 immune response. Th2-derived interleukin-31 and TSLP induce an itch sensation. Taken together, TSLP/Th2/Th22 pathway is a promising target for developing new therapeutics for AD. Enhancing filaggrin expression using ligands for the aryl hydrocarbon receptor may also be an adjunctive measure to restore the disrupted barrier function specifically for AD.

  16. Hydrogen sulfide metabolism regulates endothelial solute barrier function

    Directory of Open Access Journals (Sweden)

    Shuai Yuan

    2016-10-01

    Full Text Available Hydrogen sulfide (H2S is an important gaseous signaling molecule in the cardiovascular system. In addition to free H2S, H2S can be oxidized to polysulfide which can be biologically active. Since the impact of H2S on endothelial solute barrier function is not known, we sought to determine whether H2S and its various metabolites affect endothelial permeability. In vitro permeability was evaluated using albumin flux and transendothelial electrical resistance. Different H2S donors were used to examine the effects of exogenous H2S. To evaluate the role of endogenous H2S, mouse aortic endothelial cells (MAECs were isolated from wild type mice and mice lacking cystathionine γ-lyase (CSE, a predominant source of H2S in endothelial cells. In vivo permeability was evaluated using the Miles assay. We observed that polysulfide donors induced rapid albumin flux across endothelium. Comparatively, free sulfide donors increased permeability only with higher concentrations and at later time points. Increased solute permeability was associated with disruption of endothelial junction proteins claudin 5 and VE-cadherin, along with enhanced actin stress fiber formation. Importantly, sulfide donors that increase permeability elicited a preferential increase in polysulfide levels within endothelium. Similarly, CSE deficient MAECs showed enhanced solute barrier function along with reduced endogenous bound sulfane sulfur. CSE siRNA knockdown also enhanced endothelial junction structures with increased claudin 5 protein expression. In vivo, CSE genetic deficiency significantly blunted VEGF induced hyperpermeability revealing an important role of the enzyme for barrier function. In summary, endothelial solute permeability is critically regulated via exogenous and endogenous sulfide bioavailability with a prominent role of polysulfides.

  17. Sorting Tubules Regulate Blood-Brain Barrier Transcytosis

    Directory of Open Access Journals (Sweden)

    Roberto Villaseñor

    2017-12-01

    Full Text Available Transcytosis across the blood-brain barrier (BBB regulates key processes of the brain, but the intracellular sorting mechanisms that determine successful receptor-mediated transcytosis in brain endothelial cells (BECs remain unidentified. Here, we used Transferrin receptor-based Brain Shuttle constructs to investigate intracellular transport in BECs, and we uncovered a pathway for the regulation of receptor-mediated transcytosis. By combining live-cell imaging and mathematical modeling in vitro with super-resolution microscopy of the BBB, we show that intracellular tubules promote transcytosis across the BBB. A monovalent construct (sFab sorted for transcytosis was localized to intracellular tubules, whereas a bivalent construct (dFab sorted for degradation formed clusters with impaired transport along tubules. Manipulating tubule biogenesis by overexpressing the small GTPase Rab17 increased dFab transport into tubules and induced its transcytosis in BECs. We propose that sorting tubules regulate transcytosis in BECs and may be a general mechanism for receptor-mediated transport across the BBB.

  18. Cystatin F as a regulator of immune cell cytotoxicity.

    Science.gov (United States)

    Kos, Janko; Nanut, Milica Perišić; Prunk, Mateja; Sabotič, Jerica; Dautović, Esmeralda; Jewett, Anahid

    2018-05-10

    Cysteine cathepsins are lysosomal peptidases involved in the regulation of innate and adaptive immune responses. Among the diverse processes, regulation of granule-dependent cytotoxicity of cytotoxic T-lymphocytes (CTLs) and natural killer (NK) cells during cancer progression has recently gained significant attention. The function of cysteine cathepsins is regulated by endogenous cysteine protease inhibitors-cystatins. Whereas other cystatins are generally cytosolic or extracellular proteins, cystatin F is present in endosomes and lysosomes and is thus able to regulate the activity of its target directly. It is delivered to endosomal/lysosomal vesicles as an inactive, disulphide-linked dimer. Proteolytic cleavage of its N-terminal part leads to the monomer, the only form that is a potent inhibitor of cathepsins C, H and L, involved in the activation of granzymes and perforin. In NK cells and CTLs the levels of active cathepsin C and of granzyme B are dependent on the concentration of monomeric, active cystatin F. In tumour microenvironment, inactive dimeric cystatin F can be secreted from tumour cells or immune cells and further taken up by the cytotoxic cells. Subsequent monomerization and inhibition of cysteine cathepsins within the endosomal/lysosomal vesicles impairs granzyme and perforin activation, and provokes cell anergy. Further, the glycosylation pattern has been shown to be important in controlling secretion of cystatin F from target cells, as well as internalization by cytotoxic cells and trafficking to endosomal/lysosomal vesicles. Cystatin F is therefore an important mediator used by bystander cells to reduce NK and T-cell cytotoxicity.

  19. Drosophila as a Model for Human Diseases-Focus on Innate Immunity in Barrier Epithelia.

    Science.gov (United States)

    Bergman, P; Seyedoleslami Esfahani, S; Engström, Y

    2017-01-01

    Epithelial immunity protects the host from harmful microbial invaders but also controls the beneficial microbiota on epithelial surfaces. When this delicate balance between pathogen and symbiont is disturbed, clinical disease often occurs, such as in inflammatory bowel disease, cystic fibrosis, or atopic dermatitis, which all can be in part linked to impairment of barrier epithelia. Many innate immune receptors, signaling pathways, and effector molecules are evolutionarily conserved between human and Drosophila. This review describes the current knowledge on Drosophila as a model for human diseases, with a special focus on innate immune-related disorders of the gut, lung, and skin. The discovery of antimicrobial peptides, the crucial role of Toll and Toll-like receptors, and the evolutionary conservation of signaling to the immune systems of both human and Drosophila are described in a historical perspective. Similarities and differences between human and Drosophila are discussed; current knowledge on receptors, signaling pathways, and effectors are reviewed, including antimicrobial peptides, reactive oxygen species, as well as autophagy. We also give examples of human diseases for which Drosophila appears to be a useful model. In addition, the limitations of the Drosophila model are mentioned. Finally, we propose areas for future research, which include using the Drosophila model for drug screening, as a validation tool for novel genetic mutations in humans and for exploratory research of microbiota-host interactions, with relevance for infection, wound healing, and cancer. © 2017 Elsevier Inc. All rights reserved.

  20. Control of creatine metabolism by HIF is an endogenous mechanism of barrier regulation in colitis.

    Science.gov (United States)

    Glover, Louise E; Bowers, Brittelle E; Saeedi, Bejan; Ehrentraut, Stefan F; Campbell, Eric L; Bayless, Amanda J; Dobrinskikh, Evgenia; Kendrick, Agnieszka A; Kelly, Caleb J; Burgess, Adrianne; Miller, Lauren; Kominsky, Douglas J; Jedlicka, Paul; Colgan, Sean P

    2013-12-03

    Mucosal surfaces of the lower gastrointestinal tract are subject to frequent, pronounced fluctuations in oxygen tension, particularly during inflammation. Adaptive responses to hypoxia are orchestrated largely by the hypoxia-inducible transcription factors (HIFs). As HIF-1α and HIF-2α are coexpressed in mucosal epithelia that constitute the barrier between the lumen and the underlying immune milieu, we sought to define the discrete contribution of HIF-1 and HIF-2 transactivation pathways to intestinal epithelial cell homeostasis. The present study identifies creatine kinases (CKs), key metabolic enzymes for rapid ATP generation via the phosphocreatine-creatine kinase (PCr/CK) system, as a unique gene family that is coordinately regulated by HIF. Cytosolic CKs are expressed in a HIF-2-dependent manner in vitro and localize to apical intestinal epithelial cell adherens junctions, where they are critical for junction assembly and epithelial integrity. Supplementation with dietary creatine markedly ameliorated both disease severity and inflammatory responses in colitis models. Further, enzymes of the PCr/CK metabolic shuttle demonstrate dysregulated mucosal expression in a subset of ulcerative colitis and Crohn disease patients. These findings establish a role for HIF-regulated CK in epithelial homeostasis and reveal a fundamental link between cellular bioenergetics and mucosal barrier.

  1. Regulation of stem-cell mediated host immunity by the sphingolipid ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Regulation of stem-cell mediated host immunity by the sphingolipid pathway ... in the generation of mature immune cells and the functioning of the surrounding ... methods with human cells and genetically engineered mice to examine how the ...

  2. Mechanisms and pathways of innate immune activation and regulation in health and cancer.

    Science.gov (United States)

    Cui, Jun; Chen, Yongjun; Wang, Helen Y; Wang, Rong-Fu

    2014-01-01

    Research on innate immune signaling and regulation has recently focused on pathogen recognition receptors (PRRs) and their signaling pathways. Members of PRRs sense diverse microbial invasions or danger signals, and initiate innate immune signaling pathways, leading to proinflammatory cytokines production, which, in turn, instructs adaptive immune response development. Despite the diverse functions employed by innate immune signaling to respond to a variety of different pathogens, the innate immune response must be tightly regulated. Otherwise, aberrant, uncontrolled immune responses will lead to harmful, or even fatal, consequences. Therefore, it is essential to better discern innate immune signaling and many regulators, controlling various signaling pathways, have been identified. In this review, we focus on the recent advances in our understanding of the activation and regulation of innate immune signaling in the host response to pathogens and cancer.

  3. Flg22-Triggered Immunity Negatively Regulates Key BR Biosynthetic Genes.

    Science.gov (United States)

    Jiménez-Góngora, Tamara; Kim, Seong-Ki; Lozano-Durán, Rosa; Zipfel, Cyril

    2015-01-01

    In plants, activation of growth and activation of immunity are opposing processes that define a trade-off. In the past few years, the growth-promoting hormones brassinosteroids (BR) have emerged as negative regulators of pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI), promoting growth at the expense of defense. The crosstalk between BR and PTI signaling was described as negative and unidirectional, since activation of PTI does not affect several analyzed steps in the BR signaling pathway. In this work, we describe that activation of PTI by the bacterial PAMP flg22 results in the reduced expression of BR biosynthetic genes. This effect does not require BR perception or signaling, and occurs within 15 min of flg22 treatment. Since the described PTI-induced repression of gene expression may result in a reduction in BR biosynthesis, the crosstalk between PTI and BR could actually be negative and bidirectional, a possibility that should be taken into account when considering the interaction between these two pathways.

  4. Regulation of the NADPH Oxidase RBOHD During Plant Immunity.

    Science.gov (United States)

    Kadota, Yasuhiro; Shirasu, Ken; Zipfel, Cyril

    2015-08-01

    Pathogen recognition induces the production of reactive oxygen species (ROS) by NADPH oxidases in both plants and animals. ROS have direct antimicrobial properties, but also serve as signaling molecules to activate further immune outputs. However, ROS production has to be tightly controlled to avoid detrimental effects on host cells, but yet must be produced in the right amount, at the right place and at the right time upon pathogen perception. Plant NADPH oxidases belong to the respiratory burst oxidase homolog (RBOH) family, which contains 10 members in the model plant Arabidopsis thaliana. The perception of pathogen-associated molecular patterns (PAMPs) by pattern recognition receptors (PRRs) leads to a rapid, specific and strong production of ROS, which is dependent on RBOHD. RBOHD is mainly controlled by Ca(2+) via direct binding to EF-hand motifs and phosphorylation by Ca(2+)-dependent protein kinases. Recent studies have, however, revealed a critical role for a Ca(2+)-independent regulation of RBOHD. The plasma membrane-associated cytoplasmic kinase BIK1 (BOTRYTIS-INDUCED KINASE1), which is a direct substrate of the PRR complex, directly interacts with and phosphorylates RBOHD upon PAMP perception. Impairment of these phosphorylation events completely abolishes the function of RBOHD in immunity. These results suggest that RBOHD activity is tightly controlled by multilayered regulations. In this review, we summarize recent advances in our understanding of the regulatory mechanisms controlling RBOHD activation. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  5. Immune regulation in gut and cord : opportunities for directing the immune system

    NARCIS (Netherlands)

    de Roock, S.

    2012-01-01

    The gut is an important organ for the immune system. Microbes and immune cells interact directly or via epithelial cells. Both TH17 and Treg cells mature in this environment. The composition of the microbiota has an important influence on the immune homeostasis. Influencing the immune system via the

  6. Mucosal Immune Regulation in Intestinal Disease. The role of bacterial products, food components and drugs

    NARCIS (Netherlands)

    Bol-Schoenmakers, M.

    2009-01-01

    The challenge of the mucosal gut associated immune system is to remain unresponsive to food products and commensal microbiota, while mounting an appropriate immune response towards pathogens. This implicates the necessity of tight immune regulation within the gut associated lymphoid tissue (GALT).

  7. Regulation of innate and adaptive immunity by the commensal microbiota

    OpenAIRE

    Jarchum, Irene; Pamer, Eric G.

    2011-01-01

    The microbial communities that inhabit the intestinal tract are essential for mammalian health. Communication between the microbiota and the host establishes and maintains immune homeostasis, enabling protective immune responses against pathogens while preventing adverse inflammatory responses to harmless commensal microbes. Specific bacteria, such as segmented filamentous bacteria, Clostridium species, and Bacteroides fragilis, are key contributors to immune homeostasis in the gut. The cellu...

  8. Intestinal dendritic cells in the regulation of mucosal immunity

    DEFF Research Database (Denmark)

    Bekiaris, Vasileios; Persson, Emma K.; Agace, William Winston

    2014-01-01

    immune cells within the mucosa must suitably respond to maintain intestinal integrity, while also providing the ability to mount effective immune responses to potential pathogens. Dendritic cells (DCs) are sentinel immune cells that play a central role in the initiation and differentiation of adaptive....... The recognition that dietary nutrients and microbial communities in the intestine influence both mucosal and systemic immune cell development and function as well as immune-mediated disease has led to an explosion of literature in mucosal immunology in recent years and a growing interest in the functionality...

  9. Consequences of bisphenol a perinatal exposure on immune responses and gut barrier function in mice.

    Science.gov (United States)

    Malaisé, Yann; Ménard, Sandrine; Cartier, Christel; Lencina, Corinne; Sommer, Caroline; Gaultier, Eric; Houdeau, Eric; Guzylack-Piriou, Laurence

    2018-01-01

    The potent immunomodulatory effect of the endocrine disruptor bisphenol A during development and consequences during life span are of increasing concern. Particular interests have been raised from animal studies regarding the risk of developing food intolerance and infection. We aimed to identify immune disorders in mice triggered by perinatal exposure to bisphenol A. Gravid mice were orally exposed to bisphenol (50 μg/kg body weight/day) from day 15 of pregnancy until weaning. Gut barrier function, local and systemic immunity were assessed in adult female offspring. Mice perinatally exposed to bisphenol showed a decrease in ileal lysozyme expression and a fall of fecal antimicrobial activity. In offspring mice exposed to bisphenol, an increase in colonic permeability was observed associated with an increase in interferon-γ level and a drop of colonic IgA + cells and fecal IgA production. Interestingly, altered frequency of innate lymphoid cells type 3 occurred in the small intestine, with an increase in IgG response against commensal bacteria in sera. These effects were related to a defect in dendritic cell maturation in the lamina propria and spleen. Activated and regulatory T cells were decreased in the lamina propria. Furthermore, perinatal exposure to bisphenol promoted a sharp increase in interferon-γ and interleukin-17 production in the intestine and elicited a T helper 17 profile in the spleen. To conclude, perinatal exposure to bisphenol weakens protective and regulatory immune functions in the intestine and at systemic level in adult offspring. The increased susceptibility to inflammatory response is an interesting lead supporting bisphenol-mediated adverse consequences on food reactions and infections.

  10. The cell-mediated immunity of Drosophila melanogaster: hemocyte lineages, immune compartments, microanatomy and regulation.

    Science.gov (United States)

    Honti, Viktor; Csordás, Gábor; Kurucz, Éva; Márkus, Róbert; Andó, István

    2014-01-01

    In the animal kingdom, innate immunity is the first line of defense against invading pathogens. The dangers of microbial and parasitic attacks are countered by similar mechanisms, involving the prototypes of the cell-mediated immune responses, the phagocytosis and encapsulation. Work on Drosophila has played an important role in promoting an understanding of the basic mechanisms of phylogenetically conserved modules of innate immunity. The aim of this review is to survey the developments in the identification and functional definition of immune cell types and the immunological compartments of Drosophila melanogaster. We focus on the molecular and developmental aspects of the blood cell types and compartments, as well as the dynamics of blood cell development and the immune response. Further advances in the characterization of the innate immune mechanisms in Drosophila will provide basic clues to the understanding of the importance of the evolutionary conserved mechanisms of innate immune defenses in the animal kingdom. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Effect of skin barrier disruption on immune responses to topically applied cross-reacting material, CRM(197), of diphtheria toxin.

    Science.gov (United States)

    Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D

    2005-08-01

    The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.

  12. Regulation of intestinal homeostasis and immunity with probiotic lactobacilli.

    Science.gov (United States)

    van Baarlen, Peter; Wells, Jerry M; Kleerebezem, Michiel

    2013-05-01

    The gut microbiota provide important stimuli to the human innate and adaptive immune system and co-mediate metabolic and immune homeostasis. Probiotic bacteria can be regarded as part of the natural human microbiota, and have been associated with improving homeostasis, albeit with different levels of success. Composition of microbiota, probiotic strain identity, and host genetic differences may account for differential modulation of immune responses by probiotics. Here, we review the mechanisms of immunomodulating capacities of specific probiotic strains, the responses they can induce in the host, and how microbiota and genetic differences between individuals may co-influence host responses and immune homeostasis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Regulation of intestinal homeostasis and immunity with probiotic lactobacilli

    NARCIS (Netherlands)

    Baarlen, van P.; Wells, J.; Kleerebezem, M.

    2013-01-01

    The gut microbiota provide important stimuli to the human innate and adaptive immune system and co-mediate metabolic and immune homeostasis. Probiotic bacteria can be regarded as part of the natural human microbiota, and have been associated with improving homeostasis, albeit with different levels

  14. Abl family kinases regulate endothelial barrier function in vitro and in mice.

    Directory of Open Access Journals (Sweden)

    Elizabeth M Chislock

    Full Text Available The maintenance of endothelial barrier function is essential for normal physiology, and increased vascular permeability is a feature of a wide variety of pathological conditions, leading to complications including edema and tissue damage. Use of the pharmacological inhibitor imatinib, which targets the Abl family of non-receptor tyrosine kinases (Abl and Arg, as well as other tyrosine kinases including the platelet-derived growth factor receptor (PDGFR, Kit, colony stimulating factor 1 receptor (CSF1R, and discoidin domain receptors, has shown protective effects in animal models of inflammation, sepsis, and other pathologies characterized by enhanced vascular permeability. However, the imatinib targets involved in modulation of vascular permeability have not been well-characterized, as imatinib inhibits multiple tyrosine kinases not only in endothelial cells and pericytes but also immune cells important for disorders associated with pathological inflammation and abnormal vascular permeability. In this work we employ endothelial Abl knockout mice to show for the first time a direct role for Abl in the regulation of vascular permeability in vivo. Using both Abl/Arg-specific pharmacological inhibition and endothelial Abl knockout mice, we demonstrate a requirement for Abl kinase activity in the induction of endothelial permeability by vascular endothelial growth factor both in vitro and in vivo. Notably, Abl kinase inhibition also impaired endothelial permeability in response to the inflammatory mediators thrombin and histamine. Mechanistically, we show that loss of Abl kinase activity was accompanied by activation of the barrier-stabilizing GTPases Rac1 and Rap1, as well as inhibition of agonist-induced Ca(2+ mobilization and generation of acto-myosin contractility. In all, these findings suggest that pharmacological targeting of the Abl kinases may be capable of inhibiting endothelial permeability induced by a broad range of agonists and that use

  15. DMPD: Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 18406369 Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins...svg) (.html) (.csml) Show Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins. ...PubmedID 18406369 Title Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins

  16. The Bile Acid Receptor GPBAR-1 (TGR5) Modulates Integrity of Intestinal Barrier and Immune Response to Experimental Colitis

    Science.gov (United States)

    Cipriani, Sabrina; Mencarelli, Andrea; Chini, Maria Giovanna; Distrutti, Eleonora; Renga, Barbara; Bifulco, Giuseppe; Baldelli, Franco; Donini, Annibale; Fiorucci, Stefano

    2011-01-01

    Background GP-BAR1, a member G protein coupled receptor superfamily, is a cell surface bile acid-activated receptor highly expressed in the ileum and colon. In monocytes, ligation of GP-BAR1 by secondary bile acids results in a cAMP-dependent attenuation of cytokine generation. Aims To investigate the role GP-BAR1 in regulating intestinal homeostasis and inflammation-driven immune dysfunction in rodent models of colitis. Methods Colitis was induced in wild type and GP-BAR1−/− mice by DSS and TNBS administration. Potential GP-BAR1 agonists were identified by in silico screening and computational docking studies. Results GP-BAR1−/− mice develop an abnormal morphology of colonic mucous cells and an altered molecular architecture of epithelial tight junctions with increased expression and abnormal subcellular distribution of zonulin 1 resulting in increased intestinal permeability and susceptibility to develop severe colitis in response to DSS at early stage of life. By in silico screening and docking studies we identified ciprofloxacin as a GP-BAR1 ligand. In monocytes, ciprofloxacin increases cAMP concentrations and attenuates TNFα release induced by TLR4 ligation in a GP-BAR1 dependent manner. Treating mice rendered colitic by TNBS with ciprofloxacin and oleanolic acid, a well characterized GP-BAR1 ligand, abrogates signs and symptoms of colitis. Colonic expression of GP-BAR1 mRNA increases in rodent models of colitis and tissues from Crohn's disease patients. Flow cytometry analysis demonstrates that ≈90% of CD14+ cells isolated from the lamina propria of TNBS-treated mice stained positively for GP-BAR1. Conclusions GP-BAR1 regulates intestinal barrier structure. Its expression increases in rodent models of colitis and Crohn's disease. Ciprofloxacin is a GP-BAR1 ligand. PMID:22046243

  17. The bile acid receptor GPBAR-1 (TGR5 modulates integrity of intestinal barrier and immune response to experimental colitis.

    Directory of Open Access Journals (Sweden)

    Sabrina Cipriani

    Full Text Available BACKGROUND: GP-BAR1, a member G protein coupled receptor superfamily, is a cell surface bile acid-activated receptor highly expressed in the ileum and colon. In monocytes, ligation of GP-BAR1 by secondary bile acids results in a cAMP-dependent attenuation of cytokine generation. AIMS: To investigate the role GP-BAR1 in regulating intestinal homeostasis and inflammation-driven immune dysfunction in rodent models of colitis. METHODS: Colitis was induced in wild type and GP-BAR1(-/- mice by DSS and TNBS administration. Potential GP-BAR1 agonists were identified by in silico screening and computational docking studies. RESULTS: GP-BAR1(-/- mice develop an abnormal morphology of colonic mucous cells and an altered molecular architecture of epithelial tight junctions with increased expression and abnormal subcellular distribution of zonulin 1 resulting in increased intestinal permeability and susceptibility to develop severe colitis in response to DSS at early stage of life. By in silico screening and docking studies we identified ciprofloxacin as a GP-BAR1 ligand. In monocytes, ciprofloxacin increases cAMP concentrations and attenuates TNFα release induced by TLR4 ligation in a GP-BAR1 dependent manner. Treating mice rendered colitic by TNBS with ciprofloxacin and oleanolic acid, a well characterized GP-BAR1 ligand, abrogates signs and symptoms of colitis. Colonic expression of GP-BAR1 mRNA increases in rodent models of colitis and tissues from Crohn's disease patients. Flow cytometry analysis demonstrates that ≈90% of CD14+ cells isolated from the lamina propria of TNBS-treated mice stained positively for GP-BAR1. CONCLUSIONS: GP-BAR1 regulates intestinal barrier structure. Its expression increases in rodent models of colitis and Crohn's disease. Ciprofloxacin is a GP-BAR1 ligand.

  18. Molecular signaling networks in regulation of immunity and disease

    DEFF Research Database (Denmark)

    Laursen, Janne Marie; Jensen, Stina Rikke; Sørensen, Morten

    and dynamic microbial communities with the immune cell compartment in the gut, and therefore the interaction between components from different gut bacteria can efficiently shape the phenotype of the immune response. A specialized antigenpresenting cell present at mucosal surfaces, the dendritic cell (DC......), plays a crucial role in shaping the nature of the adaptive/memorybased immune response after encountering inflammatory compounds. In the gut, the DC is continuously exposed to microbial and dietary components that are recognized by its innate pattern recognition receptors, and the phenotype developed...... in the DC during activation is of profound importance for the state of immune response and thereby also affects the inflammatory and metabolic status in tissues. We have shown that specific fermentation products from gut bacteria have distinct immunoregulatory effects that effectively inhibit...

  19. [Barriers and opportunities for the regulation of food and beverage advertising to children in Mexico].

    Science.gov (United States)

    Théodore, Florence; Juárez-Ramírez, Clara; Cahuana-Hurtado, Lucero; Blanco, Ilian; Tolentino-Mayo, Lizbeth; Bonvecchio, Anabelle

    2014-01-01

    To identify barriers and opportunities for the regulation of food and beverage advertising to children. A qualitative study. Fourteen key informants from the congress, private sector, officials from the ministry of health and academics involved in the issue of regulation of advertising were interviewed. Barriers identified: conception of obesity as an individual problem, minimization of the negative effects on health, definition of the vulnerability of children bounded to their cognitive development. Facilitators support from various sectors of society regulation, extensive scientific discussion on the subject, successful experience and its lessons on tabacco industry. Mexico has key elements for achieving effective regulation on advertising.

  20. The effect of probiotics on immune regulation, acne, and photoaging

    Directory of Open Access Journals (Sweden)

    Mary-Margaret Kober

    2015-06-01

    Full Text Available Probiotics are live micro-organisms that provide a health benefit to the host. The role of probiotics in the management of disease, as well as immune modification, has recently experienced a renewed interest in society, as probiotics can be found in products ranging from yogurt to facial creams. In this article, we discuss the role of probiotics in the development of the immune system, the treatment of acne and rosacea, and protection against aging and photodamage.

  1. DNA Tumor Virus Regulation of Host DNA Methylation and Its Implications for Immune Evasion and Oncogenesis.

    Science.gov (United States)

    Kuss-Duerkop, Sharon K; Westrich, Joseph A; Pyeon, Dohun

    2018-02-13

    Viruses have evolved various mechanisms to evade host immunity and ensure efficient viral replication and persistence. Several DNA tumor viruses modulate host DNA methyltransferases for epigenetic dysregulation of immune-related gene expression in host cells. The host immune responses suppressed by virus-induced aberrant DNA methylation are also frequently involved in antitumor immune responses. Here, we describe viral mechanisms and virus-host interactions by which DNA tumor viruses regulate host DNA methylation to evade antiviral immunity, which may contribute to the generation of an immunosuppressive microenvironment during cancer development. Recent trials of immunotherapies have shown promising results to treat multiple cancers; however, a significant number of non-responders necessitate identifying additional targets for cancer immunotherapies. Thus, understanding immune evasion mechanisms of cancer-causing viruses may provide great insights for reversing immune suppression to prevent and treat associated cancers.

  2. DNA Tumor Virus Regulation of Host DNA Methylation and Its Implications for Immune Evasion and Oncogenesis

    Directory of Open Access Journals (Sweden)

    Sharon K. Kuss-Duerkop

    2018-02-01

    Full Text Available Viruses have evolved various mechanisms to evade host immunity and ensure efficient viral replication and persistence. Several DNA tumor viruses modulate host DNA methyltransferases for epigenetic dysregulation of immune-related gene expression in host cells. The host immune responses suppressed by virus-induced aberrant DNA methylation are also frequently involved in antitumor immune responses. Here, we describe viral mechanisms and virus–host interactions by which DNA tumor viruses regulate host DNA methylation to evade antiviral immunity, which may contribute to the generation of an immunosuppressive microenvironment during cancer development. Recent trials of immunotherapies have shown promising results to treat multiple cancers; however, a significant number of non-responders necessitate identifying additional targets for cancer immunotherapies. Thus, understanding immune evasion mechanisms of cancer-causing viruses may provide great insights for reversing immune suppression to prevent and treat associated cancers.

  3. ROS-activated calcium signaling mechanisms regulating endothelial barrier function.

    Science.gov (United States)

    Di, Anke; Mehta, Dolly; Malik, Asrar B

    2016-09-01

    Increased vascular permeability is a common pathogenic feature in many inflammatory diseases. For example in acute lung injury (ALI) and its most severe form, the acute respiratory distress syndrome (ARDS), lung microvessel endothelia lose their junctional integrity resulting in leakiness of the endothelial barrier and accumulation of protein rich edema. Increased reactive oxygen species (ROS) generated by neutrophils (PMNs) and other inflammatory cells play an important role in increasing endothelial permeability. In essence, multiple inflammatory syndromes are caused by dysfunction and compromise of the barrier properties of the endothelium as a consequence of unregulated acute inflammatory response. This review focuses on the role of ROS signaling in controlling endothelial permeability with particular focus on ALI. We summarize below recent progress in defining signaling events leading to increased endothelial permeability and ALI. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Pretreatment antigen-specific immunity and regulation - association with subsequent immune response to anti-tumor DNA vaccination.

    Science.gov (United States)

    Johnson, Laura E; Olson, Brian M; McNeel, Douglas G

    2017-07-18

    Immunotherapies have demonstrated clinical benefit for many types of cancers, however many patients do not respond, and treatment-related adverse effects can be severe. Hence many efforts are underway to identify treatment predictive biomarkers. We have reported the results of two phase I trials using a DNA vaccine encoding prostatic acid phosphatase (PAP) in patients with biochemically recurrent prostate cancer. In both trials, persistent PAP-specific Th1 immunity developed in some patients, and this was associated with favorable changes in serum PSA kinetics. In the current study, we sought to determine if measures of antigen-specific or antigen non-specific immunity were present prior to treatment, and associated with subsequent immune response, to identify possible predictive immune biomarkers. Patients who developed persistent PAP-specific, IFNγ-secreting immune responses were defined as immune "responders." The frequency of peripheral T cell and B cell lymphocytes, natural killer cells, monocytes, dendritic cells, myeloid derived suppressor cells, and regulatory T cells were assessed by flow cytometry and clinical laboratory values. PAP-specific immune responses were evaluated by cytokine secretion in vitro, and by antigen-specific suppression of delayed-type hypersensitivity to a recall antigen in an in vivo SCID mouse model. The frequency of peripheral blood cell types did not differ between the immune responder and non-responder groups. Non-responder patients tended to have higher PAP-specific IL-10 production pre-vaccination (p = 0.09). Responder patients had greater preexisting PAP-specific bystander regulatory responses that suppressed DTH to a recall antigen (p = 0.016). While our study population was small (n = 38), these results suggest that different measures of antigen-specific tolerance or regulation might help predict immunological outcome from DNA vaccination. These will be prospectively evaluated in an ongoing randomized, phase II trial.

  5. Extracellular membrane vesicles and immune regulation in the brain

    Directory of Open Access Journals (Sweden)

    Stefano ePluchino

    2012-05-01

    Full Text Available The brain is characterized by a complex and integrated network of interacting cells in which cell-to-cell communication is critical for proper development and function. Initially considered as an immune privileged site, the brain is now regarded as an immune specialized system. Accumulating evidence reveals the presence of immune components in the brain, as well as extensive bidirectional communication that takes place between the nervous and the immune system both under homeostatic and pathological conditions. In recent years the secretion of extracellular membrane vesicles (EMVs has been described as a new and evolutionary well-conserved mechanism of cell-to-cell communication, with EMVs influencing the microenvironment through the traffic of bioactive molecules that include proteins and nucleic acids, such as DNA, protein coding and non coding RNAs. Increasing evidence suggests that EMVs are a promising candidate to study cross-boundary cell-to-cell communication pathways. Herein we review the role of EMVs secreted by neural cells in modulating the immune response(s within the brain under physiological and pathological circumstances.

  6. Activating transcription factor 3 regulates immune and metabolic homeostasis.

    Science.gov (United States)

    Rynes, Jan; Donohoe, Colin D; Frommolt, Peter; Brodesser, Susanne; Jindra, Marek; Uhlirova, Mirka

    2012-10-01

    Integration of metabolic and immune responses during animal development ensures energy balance, permitting both growth and defense. Disturbed homeostasis causes organ failure, growth retardation, and metabolic disorders. Here, we show that the Drosophila melanogaster activating transcription factor 3 (Atf3) safeguards metabolic and immune system homeostasis. Loss of Atf3 results in chronic inflammation and starvation responses mounted primarily by the larval gut epithelium, while the fat body suffers lipid overload, causing energy imbalance and death. Hyperactive proinflammatory and stress signaling through NF-κB/Relish, Jun N-terminal kinase, and FOXO in atf3 mutants deregulates genes important for immune defense, digestion, and lipid metabolism. Reducing the dose of either FOXO or Relish normalizes both lipid metabolism and gene expression in atf3 mutants. The function of Atf3 is conserved, as human ATF3 averts some of the Drosophila mutant phenotypes, improving their survival. The single Drosophila Atf3 may incorporate the diversified roles of two related mammalian proteins.

  7. Intestinal bacteria and the regulation of immune cell homeostasis.

    Science.gov (United States)

    Hill, David A; Artis, David

    2010-01-01

    The human intestine is colonized by an estimated 100 trillion bacteria. Some of these bacteria are essential for normal physiology, whereas others have been implicated in the pathogenesis of multiple inflammatory diseases including IBD and asthma. This review examines the influence of signals from intestinal bacteria on the homeostasis of the mammalian immune system in the context of health and disease. We review the bacterial composition of the mammalian intestine, known bacterial-derived immunoregulatory molecules, and the mammalian innate immune receptors that recognize them. We discuss the influence of bacterial-derived signals on immune cell function and the mechanisms by which these signals modulate the development and progression of inflammatory disease. We conclude with an examination of successes and future challenges in using bacterial communities or their products in the prevention or treatment of human disease.

  8. Immune regulation in chronic hepatitis C virus infection

    DEFF Research Database (Denmark)

    Hartling, Hans Jakob; Ballegaard, Vibe Cecilie; Nielsen, Nick Schou

    2016-01-01

    The immunological result of infection with Hepatitis C virus (HCV) depends on the delicate balance between a vigorous immune response that may clear the infection, but with a risk of unspecific inflammation and, or a less inflammatory response that leads to chronic infection. In general, exhaustion...... and impairment of cytotoxic function of HCV-specific T cells and NK cells are found in patients with chronic HCV infection. In contrast, an increase in immune regulatory functions is found primarily in form of increased IL-10 production possibly due to increased level and function of anti-inflammatory Tregs...

  9. Tumor-associated fibrosis as a regulator of tumor immunity and response to immunotherapy.

    Science.gov (United States)

    Jiang, Hong; Hegde, Samarth; DeNardo, David G

    2017-08-01

    Tumor-associated fibrosis is characterized by unchecked pro-fibrotic and pro-inflammatory signaling. The components of fibrosis including significant numbers of cancer-associated fibroblasts, dense collagen deposition, and extracellular matrix stiffness, are well appreciated regulators of tumor progression but may also be critical regulators of immune surveillance. While this suggests that the efficacy of immunotherapy may be limited in highly fibrotic cancers like pancreas, it also suggests a therapeutic opportunity to target fibrosis in these tumor types to reawaken anti-tumor immunity. This review discusses the mechanisms by which fibrosis might subvert tumor immunity and how to overcome these mechanisms.

  10. Regulation of intestinal homeostasis by innate and adaptive immunity.

    Science.gov (United States)

    Kayama, Hisako; Takeda, Kiyoshi

    2012-11-01

    The intestine is a unique tissue where an elaborate balance is maintained between tolerance and immune responses against a variety of environmental factors such as food and the microflora. In a healthy individual, the microflora stimulates innate and adaptive immune systems to maintain gut homeostasis. However, the interaction of environmental factors with particular genetic backgrounds can lead to dramatic changes in the composition of the microflora (i.e. dysbiosis). Many of the specific commensal-bacterial products and the signaling pathways they trigger have been characterized. The role of T(h)1, T(h)2 and T(h)17 cells in inflammatory bowel disease has been widely investigated, as has the contribution of epithelial cells and subsets of dendritic cells and macrophages. To date, multiple regulatory cells in adaptive immunity, such as regulatory T cells and regulatory B cells, have been shown to maintain gut homeostasis by preventing inappropriate innate and adaptive immune responses to commensal bacteria. Additionally, regulatory myeloid cells have recently been identified that prevent intestinal inflammation by inhibiting T-cell proliferation. An increasing body of evidence has shown that multiple regulatory mechanisms contribute to the maintenance of gut homeostasis.

  11. Mucosal Immune Regulation in Early Infancy: Monitoring and Intervention

    NARCIS (Netherlands)

    J. Hol (Jeroen)

    2011-01-01

    textabstractThe mucosal immune system of infants is dependent on the maintenance of mucosal homeostasis. Homeostasis results from the interaction between the mucosa and exogenous factors such as dietar and microbial agents. Induction and maintenance of homeostasis is a highly regluated system that

  12. Studying brain-regulation of immunity with optogenetics and chemogenetics; A new experimental platform.

    Science.gov (United States)

    Ben-Shaanan, Tamar; Schiller, Maya; Rolls, Asya

    2017-10-01

    The interactions between the brain and the immune system are bidirectional. Nevertheless, we have far greater understanding of how the immune system affects the brain than how the brain affects immunity. New technological developments such as optogenetics and chemogenetics (using DREADDs; Designer Receptors Exclusively Activated by Designer Drugs) can bridge this gap in our understanding, as they enable an unprecedented mechanistic and systemic analysis of the communication between the brain and the immune system. In this review, we discuss new experimental approaches for revealing neuronal circuits that can participate in regulation of immunity. In addition, we discuss methods, specifically optogenetics and chemogenetics, that enable targeted neuronal manipulation to reveal how different brain regions affect immunity. We describe how these techniques can be used as an experimental platform to address fundamental questions in psychoneuroimmunology and to understand how neuronal circuits associate with different psychological states can affect physiology. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Roquin--a multifunctional regulator of immune homeostasis.

    Science.gov (United States)

    Schaefer, J S; Klein, J R

    2016-03-01

    Roquin-1 (Rc3h1) is an E3 ubiquitin ligase originally discovered in a mutational screen for genetic factors contributory to systemic lupus erythematosus-like symptoms in mice. A single base-pair mutation in the Rc3h1 gene resulted in the manifestation of autoantibody production and sustained immunological inflammation characterized by excessive T follicular helper cell activation and formation of germinal centers. Subsequent studies have uncovered a multifactorial process by which Roquin-1 contributes to the maintenance of immune homeostasis. Through its interactions with partner proteins, Roquin-1 targets mRNAs for decay with inducible costimulator being a primary target. In this review, we discuss newly discovered functions of Roquin-1 in the immune system and inflammation, and in disease manifestation, and discuss avenues of further research. A model is presented for the role of Roquin in health and disease.

  14. Regulation of host metabolism and immunity by the gut microbiome

    DEFF Research Database (Denmark)

    Laursen, Janne Marie

    During recent years, central roles of the gut microbiome in metabolic and immunological diseases have been uncovered, and multiple studies have shown that bacterial-derived components shape host physiology and immune responses via direct cellular interactions. The intestinal immune system...... developed a computational framework for identifying bacteria that produce specific endotoxin variants with opposing immunological effects in metagenomic fecal samples. This framework was used to identify the endotoxin variant distribution amongst bacteria in the gut microbiome of Danes and Chinese...... with obesity and type 2 diabetes. We show for the first time that species producing pro-inflammatory endotoxin variants are vastly underrepresented in the gut microbiome compared to species producing non-inflammatory endotoxin and we identify country-specific gram-negative bacterial modules associated...

  15. Roles and Regulation of Gastrointestinal Eosinophils in Immunity and Disease

    Science.gov (United States)

    Jung, YunJae; Rothenberg, Marc E.

    2014-01-01

    Eosinophils have been considered to be destructive end-stage effector cells that have a role in parasitic infections and allergy reactions by the release of their granule-derived cytotoxic proteins. However, an increasing number of experimental observations indicate that eosinophils also are multifunctional leukocytes involved in diverse inflammatory and physiologic immune responses. Under homeostatic conditions, eosinophils are particularly abundant in the lamina propria of the gastrointestinal tract where their involvement in various biological processes within the gastrointestinal tract has been posited. In this review, we summarize the molecular steps involved in eosinophil development and describe eosinophil trafficking to the gastrointestinal tract. We synthesize the current findings on the phenotypic and functional properties of gastrointestinal eosinophils and the accumulating evidence that they have a contributory role in gastrointestinal disorders, with a focus on primary eosinophilic gastrointestinal disorders. Finally, we discuss the potential role of eosinophils as modulators of the intestinal immune system. PMID:25049430

  16. Mucosal Immune Regulation in Early Infancy: Monitoring and Intervention

    OpenAIRE

    Hol, Jeroen

    2011-01-01

    textabstractThe mucosal immune system of infants is dependent on the maintenance of mucosal homeostasis. Homeostasis results from the interaction between the mucosa and exogenous factors such as dietar and microbial agents. Induction and maintenance of homeostasis is a highly regluated system that involves different cell types. If homeostasis is lost this may lead to disease, including allergy and chronic intestinal inflammation. In this thesis we observed whether loss of homeostasis leading ...

  17. Does immunity regulate ejaculate quality and fertility in humans?

    OpenAIRE

    Philip A. Skau; Ivar Folstad

    2005-01-01

    The production of high-quality ejaculates may represent significant costs during male reproduction. Spermatozoa are perceived as nonself by the immune system and are exposed to immunological attacks in the male reproductive tract. Autoimmunity to spermatozoa results in the production of antisperm antibodies that reduce sperm quality and hence fertility. Thus, males are dependent on the testis being an immunoprivileged site to reduce immunological reactions against their own sperm, and immunop...

  18. Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis

    Science.gov (United States)

    Rynes, Jan; Donohoe, Colin D.; Frommolt, Peter; Brodesser, Susanne; Jindra, Marek

    2012-01-01

    Integration of metabolic and immune responses during animal development ensures energy balance, permitting both growth and defense. Disturbed homeostasis causes organ failure, growth retardation, and metabolic disorders. Here, we show that the Drosophila melanogaster activating transcription factor 3 (Atf3) safeguards metabolic and immune system homeostasis. Loss of Atf3 results in chronic inflammation and starvation responses mounted primarily by the larval gut epithelium, while the fat body suffers lipid overload, causing energy imbalance and death. Hyperactive proinflammatory and stress signaling through NF-κB/Relish, Jun N-terminal kinase, and FOXO in atf3 mutants deregulates genes important for immune defense, digestion, and lipid metabolism. Reducing the dose of either FOXO or Relish normalizes both lipid metabolism and gene expression in atf3 mutants. The function of Atf3 is conserved, as human ATF3 averts some of the Drosophila mutant phenotypes, improving their survival. The single Drosophila Atf3 may incorporate the diversified roles of two related mammalian proteins. PMID:22851689

  19. Innate immunity in the lung regulates the development of asthma.

    Science.gov (United States)

    DeKruyff, Rosemarie H; Yu, Sanhong; Kim, Hye Young; Umetsu, Dale T

    2014-07-01

    The lung, while functioning as a gas exchange organ, encounters a large array of environmental factors, including particulate matter, toxins, reactive oxygen species, chemicals, allergens, and infectious microbes. To rapidly respond to and counteract these elements, a number of innate immune mechanisms have evolved that can lead to lung inflammation and asthma, which is the focus of this review. These innate mechanisms include a role for two incompletely understood cell types, invariant natural killer T (iNKT) cells and innate lymphoid cells (ILCs), which together produce a wide range of cytokines, including interleukin-4 (IL-4), IL-5, IL-13, interferon-γ, IL-17, and IL-22, independently of adaptive immunity and conventional antigens. The specific roles of iNKT cells and ILCs in immunity are still being defined, but both cell types appear to play important roles in the lungs, particularly in asthma. As we gain a better understanding of these innate cell types, we will acquire great insight into the mechanisms by which allergic and non-allergic asthma phenotypes develop. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. An update: Epstein-Barr virus and immune evasion via microRNA regulation.

    Science.gov (United States)

    Zuo, Lielian; Yue, Wenxin; Du, Shujuan; Xin, Shuyu; Zhang, Jing; Liu, Lingzhi; Li, Guiyuan; Lu, Jianhong

    2017-06-01

    Epstein-Barr virus (EBV) is an oncogenic virus that ubiquitously establishes life-long persistence in humans. To ensure its survival and maintain its B cell transformation function, EBV has developed powerful strategies to evade host immune responses. Emerging evidence has shown that microRNAs (miRNAs) are powerful regulators of the maintenance of cellular homeostasis. In this review, we summarize current progress on how EBV utilizes miRNAs for immune evasion. EBV encodes miRNAs targeting both viral and host genes involved in the immune response. The miRNAs are found in two gene clusters, and recent studies have demonstrated that lack of these clusters increases the CD4 + and CD8 + T cell response of infected cells. These reports strongly indicate that EBV miRNAs are critical for immune evasion. In addition, EBV is able to dysregulate the expression of a variety of host miRNAs, which influence multiple immune-related molecules and signaling pathways. The transport via exosomes of EBV-regulated miRNAs and viral proteins contributes to the construction and modification of the inflammatory tumor microenvironment. During EBV immune evasion, viral proteins, immune cells, chemokines, pro-inflammatory cytokines, and pro-apoptosis molecules are involved. Our increasing knowledge of the role of miRNAs in immune evasion will improve the understanding of EBV persistence and help to develop new treatments for EBV-associated cancers and other diseases.

  1. Regulation of TGFβ in the immune system: an emerging role for integrins and dendritic cells.

    Science.gov (United States)

    Worthington, John J; Fenton, Thomas M; Czajkowska, Beata I; Klementowicz, Joanna E; Travis, Mark A

    2012-12-01

    Regulation of an immune response requires complex crosstalk between cells of the innate and adaptive immune systems, via both cell-cell contact and secretion of cytokines. An important cytokine with a broad regulatory role in the immune system is transforming growth factor-β (TGF-β). TGF-β is produced by and has effects on many different cells of the immune system, and plays fundamental roles in the regulation of immune responses during homeostasis, infection and disease. Although many cells can produce TGFβ, it is always produced as an inactive complex that must be activated to bind to the TGFβ receptor complex and promote downstream signalling. Thus, regulation of TGFβ activation is a crucial step in controlling TGFβ function. This review will discuss how TGFβ controls diverse immune responses and how TGFβ function is regulated, with a focus on recent work highlighting a critical role for the integrin αvβ8 expressed by dendritic cells in activating TGFβ. Copyright © 2012 Elsevier GmbH. All rights reserved.

  2. Immunization

    Science.gov (United States)

    ... a lot worse. Some are even life-threatening. Immunization shots, or vaccinations, are essential. They protect against ... B, polio, tetanus, diphtheria, and pertussis (whooping cough). Immunizations are important for adults as well as children. ...

  3. Regulation of immune responses and tolerance: the microRNA perspective

    Science.gov (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

    2013-01-01

    Summary Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/ or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. PMID:23550642

  4. IL-35, a hallmark of immune-regulation in cancer progression, chronic infections and inflammatory diseases.

    Science.gov (United States)

    Teymouri, Manouchehr; Pirro, Matteo; Fallarino, Francesca; Gargaro, Marco; Sahebkar, Amirhosein

    2018-03-25

    Cytokine members of the IL-12 family have attracted enormous attention in the last few years, with IL-35 being the one of the most attractive-suppressive cytokine. IL-35 is an important mediator of regulatory T cell function. Regulatory T cells play key roles in restoring immune homeostasis after facing challenges such as infection by specific pathogens. Moreover, a crucial role for regulatory T cell populations has been demonstrated in several physiological processes, including establishment of fetal-maternal tolerance, maintenance of self-tolerance and prevention of autoimmune diseases. However, a deleterious involvement of immune regulatory T cells has been documented in specific inhibition of immune responses against tumor cells, promotion of chronic infections and establishment of chronic inflammatory disorders. In this review, we attempt to shed light on the concept of immune-homoeostasis on the aforementioned issues, taking IL-35 as the hallmark of regulatory responses. The dilemma between immune-mediated cancer treatment and inflammation is discussed. Histopathological indications of chronic vs. acute infections are elaborated. Moreover, the evidence that IL-35 requires additional immune-regulatory cytokines, such as IL-10 and TGF-β, to induce effective and maximal anti-inflammatory effects suggest that immune-regulation requires multi-factorial analysis of many immune playmakers rather than a specific immune target. © 2018 UICC.

  5. The TAM family receptor tyrosine kinase TYRO3 is a negative regulator of type 2 immunity

    Science.gov (United States)

    Chan, Pamela Y.; Carrera Silva, Eugenio A.; De Kouchkovsky, Dimitri; Joannas, Leonel D.; Hao, Liming; Hu, Donglei; Huntsman, Scott; Eng, Celeste; Licona-Limón, Paula; Weinstein, Jason S.; Herbert, De’Broski R.; Craft, Joseph E.; Flavell, Richard A.; Repetto, Silvia; Correale, Jorge; Burchard, Esteban G.; Torgerson, Dara G.; Ghosh, Sourav; Rothlin, Carla V.

    2016-01-01

    Host responses against metazoan parasites or an array of environmental substances elicit type 2 immunity. Despite its protective function, type 2 immunity also drives allergic diseases. The mechanisms that regulate the magnitude of the type 2 response remain largely unknown. Here, we show that genetic ablation of a receptor tyrosine kinase encoded by Tyro3 in mice or the functional neutralization of its ortholog in human dendritic cells resulted in enhanced type 2 immunity. Furthermore, the TYRO3 agonist PROS1 was induced in T cells by the quintessential type 2 cytokine, interleukin-4. T cell–specific Pros1 knockouts phenocopied the loss of Tyro3. Thus, a PROS1-mediated feedback from adaptive immunity engages a rheostat, TYRO3, on innate immune cells to limit the intensity of type 2 responses. PMID:27034374

  6. Innate lymphoid cells and their role in immune response regulation

    Directory of Open Access Journals (Sweden)

    Bibiana Patricia Ruiz-Sánchez

    2017-10-01

    Full Text Available Innate lymphoid cells (ILCs are lymphocytes lacking antigen recognition receptors and become activated in response to cytokines and through microbe-associated molecular pattern (MAMP receptors. ILCs are found mainly in mucosal tissues and participate in the immune response against infections and in chronic inflammatory conditions. ILCs are divided in ILC-1, ILC-2 and ILC-3, and these cells have analogue functions to those of immune adaptive response lymphocytes Th1, Th2 and Th17. ILC-1 express T-bet, produce IFNγ, protect against infections with intracellular microorganisms and are related to inflammatory bowel disease immunopathology. ILC-2 express GATA3, produce IL-4, IL-5, IL-13 and amphiregulin, protect against parasitic infections and related to allergy and obesity immunopathology. ILC-3 express ROR(γt, produce IL-17 and IL-22, protect against fungal infections and contribute to tolerance to intestinal microbiota and intestinal repair. They are related to inflammatory bowel disease and psoriasis immunopathology. In general terms, ILCs maintain homeostasis and coadjuvate in the protection against infections.

  7. Vitamin B5 Reduces Bacterial Growth via Regulating Innate Immunity and Adaptive Immunity in Mice Infected with Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Wenting He

    2018-02-01

    Full Text Available The mechanisms by which vitamins regulate immunity and their effect as an adjuvant treatment for tuberculosis have gradually become very important research topics. Studies have found that vitamin B5 (VB5 can promote epithelial cells to express inflammatory cytokines. We aimed to examine the proinflammatory and antibacterial effect of VB5 in macrophages infected with Mycobacterium tuberculosis (MTB strain H37Rv and the therapeutic potential of VB5 in vivo with tuberculosis. We investigated the activation of inflammatory signal molecules (NF-κB, AKT, JNK, ERK, and p38, the expression of two primary inflammatory cytokines (tumor necrosis factor and interleukin-6 and the bacterial burdens in H37Rv-infected macrophages stimulated with VB5 to explore the effect of VB5 on the inflammatory and antibacterial responses of macrophages. We further treated the H37Rv-infected mice with VB5 to explore VB5’s promotion of the clearance of H37Rv in the lungs and the effect of VB5 on regulating the percentage of inflammatory cells. Our data showed that VB5 enhanced the phagocytosis and inflammatory response in macrophages infected with H37Rv. Oral administration of VB5 decreased the number of colony-forming units of H37Rv in lungs of mice at 1, 2, and 4 weeks after infection. In addition, VB5 regulated the percentage of macrophages and promoted CD4+ T cells to express interferon-γ and interleukin-17; however, it had no effect on the percentage of polymorphonuclear neutrophils, CD4+ and CD8+ T cells. In conclusion, VB5 significantly inhibits the growth of MTB by regulating innate immunity and adaptive immunity.

  8. Endogenous ligands for C-type lectin receptors: the true regulators of immune homeostasis.

    Science.gov (United States)

    García-Vallejo, Juan J; van Kooyk, Yvette

    2009-07-01

    C-type lectin receptors (CLRs) have long been known as pattern-recognition receptors implicated in the recognition of pathogens by the innate immune system. However, evidence is accumulating that many CLRs are also able to recognize endogenous 'self' ligands and that this recognition event often plays an important role in immune homeostasis. In the present review, we focus on the human and mouse CLRs for which endogenous ligands have been described. Special attention is given to the signaling events initiated upon recognition of the self ligand and the regulation of glycosylation as a switch modulating CLR recognition, and therefore, immune homeostasis.

  9. Immunopathophysiology of inflammatory bowel disease: how genetics link barrier dysfunction and innate immunity to inflammation.

    Science.gov (United States)

    Mehta, Minesh; Ahmed, Shifat; Dryden, Gerald

    2017-08-01

    Inflammatory bowel diseases (IBD) comprise a distinct set of clinical symptoms resulting from chronic or relapsing immune activation and corresponding inflammation within the gastrointestinal (GI) tract. Diverse genetic mutations, encoding important aspects of innate immunity and mucosal homeostasis, combine with environmental triggers to create inappropriate, sustained inflammatory responses. Recently, significant advances have been made in understanding the interplay of the intestinal epithelium, mucosal immune system, and commensal bacteria as a foundation of the pathogenesis of inflammatory bowel disease. Complex interactions between specialized intestinal epithelial cells and mucosal immune cells determine different outcomes based on the environmental input: the development of tolerance in the presence of commensal bacterial or the promotion of inflammation upon recognition of pathogenic organisms. This article reviews key genetic abnormalities involved in inflammatory and homeostatic pathways that enhance susceptibility to immune dysregulation and combine with environmental triggers to trigger the development of chronic intestinal inflammation and IBD.

  10. Mechanisms Underlying the Regulation of Innate and Adaptive Immunity by Vitamin D.

    Science.gov (United States)

    Wei, Ran; Christakos, Sylvia

    2015-09-24

    Non-classical actions of vitamin D were first suggested over 30 years ago when receptors for the active form of vitamin D, 1,25-dihydroxyvitamin D3 (1,25(OH)2D3), were detected in various tissues and cells that are not associated with the regulation of calcium homeostasis, including activated human inflammatory cells. The question that remained was the biological significance of the presence of vitamin D receptors in the different tissues and cells and, with regard to the immune system, whether or not vitamin D plays a role in the normal immune response and in modifying immune mediated diseases. In this article findings indicating that vitamin D is a key factor regulating both innate and adaptive immunity are reviewed with a focus on the molecular mechanisms involved. In addition, the physiological significance of vitamin D action, as suggested by in vivo studies in mouse models is discussed. Together, the findings indicate the importance of 1,25(OH)2D3 as a regulator of key components of the immune system. An understanding of the mechanisms involved will lead to potential therapeutic applications for the treatment of immune mediated diseases.

  11. A chitinase from pacific white shrimp Litopenaeus vannamei involved in immune regulation.

    Science.gov (United States)

    Niu, Shengwen; Yang, Linwei; Zuo, Hongliang; Zheng, Jiefu; Weng, Shaoping; He, Jianguo; Xu, Xiaopeng

    2018-08-01

    Chitinases are a group of hydrolytic enzymes that hydrolyze chitin and widely exist in organisms. Studies in mammals have demonstrated that chitinases play important roles in regulation of humoral and cellular immune responses. In arthropods, although it is well known that chitinases are involved in growth, molting and development, the current knowledge on the role of chitinases in immunity, especially in immune regulation, remains largely unknown. In this study, a chitinase (LvChi5) from Litopenaeus vannamei was representatively selected for studying its immune function. The start codon of LvChi5 was corrected by 5'RACE analysis and its protein sequence was reanalyzed. LvChi5 contains a catalytic domain and a chitin binding domain and shows no inhibitory effect on growth of bacteria in vitro. However, in vivo experiments demonstrated that silencing of LvChi5 increased the mortality of shrimp infected with white spot syndrome virus (WSSV) and Vibro parahaemolyticus and significantly upregulated the load of pathogens in tissues. The expression of various immune related genes, including transcription factors, antimicrobial peptides and other functional proteins with antibacterial and antiviral activities, was widely changed in LvChi5 silencing shrimp. Moreover, the recombinant LvChi5 protein could enhance the phagocytic activity of hemocytes against bacteria. These suggested that shrimp chitinase could play a role in regulation of both humoral and cellular immune responses in shrimp. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Innate lymphoid cells as regulators of immunity, inflammation and tissue homeostasis.

    Science.gov (United States)

    Klose, Christoph S N; Artis, David

    2016-06-21

    Research over the last 7 years has led to the formal identification of innate lymphoid cells (ILCs), increased the understanding of their tissue distribution and has established essential functions of ILCs in diverse physiological processes. These include resistance to pathogens, the regulation of autoimmune inflammation, tissue remodeling, cancer and metabolic homeostasis. Notably, many ILC functions appear to be regulated by mechanisms distinct from those of other innate and adaptive immune cells. In this Review, we focus on how group 2 ILC (ILC2) and group 3 ILC (ILC3) responses are regulated and how these cells interact with other immune and non-immune cells to mediate their functions. We highlight experimental evidence from mouse models and patient-based studies that have elucidated the effects of ILCs on the maintenance of tissue homeostasis and the consequences for health and disease.

  13. Regulation of aeroallergen immunity by the innate immune system: laboratory evidence for a new paradigm.

    Science.gov (United States)

    Horner, Anthony A

    2010-01-01

    Over the last decade, it has become increasingly clear that innate responses to microbes are mediated largely by toll-like receptors (TLRs), which recognize a diverse family of molecules produced by viruses, bacteria and fungi. This article will present evidence that TLRs also play a dominant role in innate responses to non-infectious immunostimulatory materials present in house dust extracts (HDEs) and the living environments they represent. However, our investigations challenge the commonly held view that microbial products in ambient air protect against the allergic march by promoting protective Th1 biased responses to inspired aeroallergens. Instead, all HDEs studied to date have preferentially promoted the development of Th2 biased airway hypersensitivities when used as adjuvants for intranasal (i.n.) vaccination. In contrast, daily low dose i.n. HDE delivery was found to promote the development of aeroallergen tolerance. This article will review these experimental findings as evidence to propose a new paradigm by which airborne TLR ligands and other stimulants of innate immunity may influence aeroallergen specific immunity and the genesis of allergic respiratory diseases.

  14. Desmoglein 2 regulates the intestinal epithelial barrier via p38 mitogen-activated protein kinase.

    Science.gov (United States)

    Ungewiß, Hanna; Vielmuth, Franziska; Suzuki, Shintaro T; Maiser, Andreas; Harz, Hartmann; Leonhardt, Heinrich; Kugelmann, Daniela; Schlegel, Nicolas; Waschke, Jens

    2017-07-24

    Intestinal epithelial barrier properties are maintained by a junctional complex consisting of tight junctions (TJ), adherens junctions (AJ) and desmosomes. Desmoglein 2 (Dsg2), an adhesion molecule of desmosomes and the only Dsg isoform expressed in enterocytes, is required for epithelial barrier properties and may contribute to barrier defects in Crohn's disease. Here, we identified extradesmosomal Dsg2 on the surface of polarized enterocytes by Triton extraction, confocal microscopy, SIM and STED. Atomic force microscopy (AFM) revealed Dsg2-specific binding events along the cell border on the surface of enterocytes with a mean unbinding force of around 30pN. Binding events were blocked by an inhibitory antibody targeting Dsg2 which under same conditions activated p38MAPK but did not reduce cell cohesion. In enterocytes deficient for Dsg2, p38MAPK activity was reduced and both barrier integrity and reformation were impaired. Dsc2 rescue did not restore p38MAPK activity indicating that Dsg2 is required. Accordingly, direct activation of p38MAPK in Dsg2-deficient cells enhanced barrier reformation demonstrating that Dsg2-mediated activation of p38MAPK is crucial for barrier function. Collectively, our data show that Dsg2, beside its adhesion function, regulates intestinal barrier function via p38MAPK signalling. This is in contrast to keratinocytes and points towards tissue-specific signalling functions of desmosomal cadherins.

  15. Sphingosine 1-phosphate as a novel immune regulator of dendritic ...

    Indian Academy of Sciences (India)

    Although originally described as an intracellular second messenger, sphingosine 1-phosphate (S1P) has recently been shown to be involved in several physiological and pathological functions as an extracellular mediator. S1P receptors are widely expressed and thought to regulate important functions in cell signalling.

  16. Tax regulating carbon market in Brazil: barriers and perspectives

    International Nuclear Information System (INIS)

    Marques, Fernando; Magalhaes, Gerusa; Parente, Virginia

    2010-01-01

    The world is moving towards a low carbon economy to fight global warming caused by increases in anthropogenic emissions of greenhouse gases (GHGs). The carbon market beckons as a promising opportunity for Brazil through Clean Development Mechanism (CDM) projects, which result in Certified Emission Reductions (CERs). Although Brazil is responsible for about 8% of all CDM projects in the world, there is still no specific tax regulation for CERs, thus hindering the development of carbon market in Brazil. It is essential that Brazil have a consistent internal framework which guarantees to potential investors a minimum security on the legal and fiscal operations of CERs. There are government institutions, considering the current law and that, given the number of bills being processed in Congress, are not definitive. Such bills have different understandings for the legal classification of CERs and the related tax treatment. This article supports an urgent need for a regulatory tax system for CERs, proposing a tax exemption on transactions involving CERs in order to encourage the effective development of carbon markets in Brazil in the context of the currently international legal system in which Kyoto Protocol is based. (author)

  17. Interplay among gut microbiota, intestinal mucosal barrier and enteric neuro-immune system: a common path to neurodegenerative diseases?

    Science.gov (United States)

    Pellegrini, Carolina; Antonioli, Luca; Colucci, Rocchina; Blandizzi, Corrado; Fornai, Matteo

    2018-05-24

    Neurological diseases, such as Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS) and multiple sclerosis, are often associated with functional gastrointestinal disorders. These gastrointestinal disturbances may occur at all stages of the neurodegenerative diseases, to such an extent that they are now considered an integral part of their clinical picture. Several lines of evidence support the contention that, in central neurodegenerative diseases, changes in gut microbiota and enteric neuro-immune system alterations could contribute to gastrointesinal dysfunctions as well as initiation and upward spreading of the neurologic disorder. The present review has been intended to provide a comprehensive overview of the available knowledge on the role played by enteric microbiota, mucosal immune system and enteric nervous system, considered as an integrated network, in the pathophysiology of the main neurological diseases known to be associated with intestinal disturbances. In addition, based on current human and pre-clinical evidence, our intent was to critically discuss whether changes in the dynamic interplay between gut microbiota, intestinal epithelial barrier and enteric neuro-immune system are a consequence of the central neurodegeneration or might represent the starting point of the neurodegenerative process. Special attention has been paid also to discuss whether alterations of the enteric bacterial-neuro-immune network could represent a common path driving the onset of the main neurodegenerative diseases, even though each disease displays its own distinct clinical features.

  18. Facilitators and barriers for RhD-immunized women to become and remain anti-D donors.

    Science.gov (United States)

    Slootweg, Yolentha Maria; Koelewijn, Johanna Maria; de Kort, Wim L; de Haas, Masja; Merz, Eva-Maria

    2018-04-01

    The successful introduction of prophylaxis with anti-RhD immunoglobulin has resulted in a significant decline of pregnancy-related RhD immunizations but also has decreased the availability of naturally immunized women as (new) anti-D donors. An influx of new donors is necessary to maintain a sufficient pool of anti-D donors. We investigated motivators, barriers, and predictors for anti-D donorship in RhD-immunized women. A mixed-methods design was applied, including focus group discussions and questionnaires. Two focus groups (including 11 women) served as input for the questionnaire. In total, 47.6% of 750 anti-D donors and potential donors completed the questionnaire (50.4% donors; 38% nondonors; 11.6% former donors). Almost 70% of the nondonors would have become donors if they had known about the possibility. Travel time investment was reported as a disadvantage; one-half of donors mentioned no disadvantages. Motivators for anti-D donorship were "doing something in return" (31.2%) and "preventing others having a sick child or losing a child" (33.9%). In multivariable analysis, living single (odds ratio, 5.8; p = 0.02) and living partnered without resident children (odds ratio, 7.9; p = 0.03), compared with living partnered with children, were predictors for anti-D donorship. Not being registered as an organ donor (odds ratio, 0.25; p anti-D donor. The main barrier for anti-D donorship was a lack of knowledge. Positive predictors of anti-D donorship were living without resident children, altruism, and being registered as an organ donor. A blood bank should develop targeted recruitment strategies with a focus on spreading knowledge about anti-D donorship among RhD-immunized women. © 2018 AABB.

  19. The Potential Role of circRNA in Tumor Immunity Regulation and Immunotherapy

    OpenAIRE

    Xu, Zihao; Li, Peiyao; Fan, Li; Wu, Minghua

    2018-01-01

    Non-coding RNAs (ncRNAs) can be divided into circular non-coding RNAs (circRNAs) and linear ncRNAs. ncRNAs exist in different cell types, including normal cells, tumor cells and immunocytes. Linear ncRNAs, such as long ncRNAs and microRNAs, have been found to play important roles in the regulation of tumor immunity and immunotherapy; however, the functions of circRNAs in tumor immunity and immunotherapy are less known. Here, we review the current status of ncRNAs in the regulation of tumor im...

  20. NLRC5: a key regulator of MHC class I-dependent immune responses.

    Science.gov (United States)

    Kobayashi, Koichi S; van den Elsen, Peter J

    2012-12-01

    The expression of MHC class I molecules is crucial for the initiation and regulation of adaptive immune responses against pathogens. NOD-, LRR- and CARD-containing 5 (NLRC5) was recently identified as a specific transactivator of MHC class I genes (CITA). NLRC5 and the master regulator for MHC class II genes, class II transactivator (CIITA), interact with similar MHC promoter-bound factors. Here, we provide a broad overview of the molecular mechanisms behind MHC class I transcription and the role of the class I transactivator NLRC5 in MHC class I-dependent immune responses.

  1. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis.

    Science.gov (United States)

    Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia

    2017-08-01

    Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on T1D development in nonobese diabetic mice. Female nonobese diabetic mice were weaned to long- and short-chain ITFs [ITF(l) and ITF(s), 5%] supplemented diet up to 24 weeks. T1D incidence, pancreatic-gut immune responses, gut barrier function, and microbiota composition were analyzed. ITF(l) but not ITF(s) supplementation dampened the incidence of T1D. ITF(l) promoted modulatory T-cell responses, as evidenced by increased CD25 + Foxp3 + CD4 + regulatory T cells, decreased IL17A + CD4 + Th17 cells, and modulated cytokine production profile in the pancreas, spleen, and colon. Furthermore, ITF(l) suppressed NOD like receptor protein 3 caspase-1-p20-IL-1β inflammasome in the colon. Expression of barrier reinforcing tight junction proteins occludin and claudin-2, antimicrobial peptides β-defensin-1, and cathelicidin-related antimicrobial peptide as well as short-chain fatty acid production were enhanced by ITF(l). Next-generation sequencing analysis revealed that ITF(l) enhanced Firmicutes/Bacteroidetes ratio to an antidiabetogenic balance and enriched modulatory Ruminococcaceae and Lactobacilli. Our data demonstrate that ITF(l) but not ITF(s) delays the development of T1D via modulation of gut-pancreatic immunity, barrier function, and microbiota homeostasis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Endothelial Regulator of Calcineurin 1 Promotes Barrier Integrity and Modulates Histamine-Induced Barrier Dysfunction in Anaphylaxis

    Directory of Open Access Journals (Sweden)

    Constanza Ballesteros-Martinez

    2017-10-01

    Full Text Available Anaphylaxis, the most serious and life-threatening allergic reaction, produces the release of inflammatory mediators by mast cells and basophils. Regulator of calcineurin 1 (Rcan1 is a negative regulator of mast-cell degranulation. The action of mediators leads to vasodilation and an increase in vascular permeability, causing great loss of intravascular volume in a short time. Nevertheless, the molecular basis remains unexplored on the vascular level. We investigated Rcan1 expression induced by histamine, platelet-activating factor (PAF, and epinephrine in primary human vein (HV-/artery (HA-derived endothelial cells (ECs and human dermal microvascular ECs (HMVEC-D. Vascular permeability was analyzed in vitro in human ECs with forced Rcan1 expression using Transwell migration assays and in vivo using Rcan1 knockout mice. Histamine, but neither PAF nor epinephrine, induced Rcan1-4 mRNA and protein expression in primary HV-ECs, HA-ECs, and HMVEC-D through histamine receptor 1 (H1R. These effects were prevented by pharmacological inhibition of calcineurin with cyclosporine A. Moreover, intravenous histamine administration increased Rcan1 expression in lung tissues of mice undergoing experimental anaphylaxis. Functional in vitro assays showed that overexpression of Rcan1 promotes barrier integrity, suggesting a role played by this molecule in vascular permeability. Consistent with these findings, in vivo models of subcutaneous and intravenous histamine-mediated fluid extravasation showed increased response in skin, aorta, and lungs of Rcan1-deficient mice compared with wild-type animals. These findings reveal that endothelial Rcan1 is synthesized in response to histamine through a calcineurin-sensitive pathway and may reduce barrier breakdown, thus contributing to the strengthening of the endothelium and resistance to anaphylaxis. These new insights underscore its potential role as a regulator of sensitivity to anaphylaxis in humans.

  3. Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Joanna Bandoła

    2017-08-01

    Full Text Available Plasmacytoid dendritic cells (pDCs regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR by the antigen-presenting pDCs, mediated by toll-like receptor (TLR 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.

  4. Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells.

    Science.gov (United States)

    Bandoła, Joanna; Richter, Cornelia; Ryser, Martin; Jamal, Arshad; Ashton, Michelle P; von Bonin, Malte; Kuhn, Matthias; Dorschner, Benjamin; Alexopoulou, Dimitra; Navratiel, Katrin; Roeder, Ingo; Dahl, Andreas; Hedrich, Christian M; Bonifacio, Ezio; Brenner, Sebastian; Thieme, Sebastian

    2017-01-01

    Plasmacytoid dendritic cells (pDCs) regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR) by the antigen-presenting pDCs, mediated by toll-like receptor (TLR) 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.

  5. Abscisic Acid as Pathogen Effector and Immune Regulator

    Science.gov (United States)

    Lievens, Laurens; Pollier, Jacob; Goossens, Alain; Beyaert, Rudi; Staal, Jens

    2017-01-01

    Abscisic acid (ABA) is a sesquiterpene signaling molecule produced in all kingdoms of life. To date, the best known functions of ABA are derived from its role as a major phytohormone in plant abiotic stress resistance. Different organisms have developed different biosynthesis and signal transduction pathways related to ABA. Despite this, there are also intriguing common themes where ABA often suppresses host immune responses and is utilized by pathogens as an effector molecule. ABA also seems to play an important role in compatible mutualistic interactions such as mycorrhiza and rhizosphere bacteria with plants, and possibly also the animal gut microbiome. The frequent use of ABA in inter-species communication could be a possible reason for the wide distribution and re-invention of ABA as a signaling molecule in different organisms. In humans and animal models, it has been shown that ABA treatment or nutrient-derived ABA is beneficial in inflammatory diseases like colitis and type 2 diabetes, which confer potential to ABA as an interesting nutraceutical or pharmacognostic drug. The anti-inflammatory activity, cellular metabolic reprogramming, and other beneficial physiological and psychological effects of ABA treatment in humans and animal models has sparked an interest in this molecule and its signaling pathway as a novel pharmacological target. In contrast to plants, however, very little is known about the ABA biosynthesis and signaling in other organisms. Genes, tools and knowledge about ABA from plant sciences and studies of phytopathogenic fungi might benefit biomedical studies on the physiological role of endogenously generated ABA in humans. PMID:28469630

  6. Barriers to Construction Health and Safety Self-regulation: A Scoping Case of Nigeria

    Directory of Open Access Journals (Sweden)

    Umeokafor Nnedinma

    2017-03-01

    Full Text Available This scoping study builds on the recent uncovering that in terms of health and safety (H&S, the Nigerian construction industry is self-regulated in various forms, not unregulated and that the size of company can further explain H&S self-regulation. Consequently, the barriers identified through literature review were assessed using questionnaires. Analysis of the data collected from construction practitioners in Nigeria shows that ‘economic factors’ mostly explains the barriers to construction H&S self-regulation. This is followed by the ‘ability to self-regulate’ and ‘lack of awareness’. Furthermore, the results show significant differences among small, medium and large construction contractors on seven factors of which include ‘normative case’ factors, ‘H&S is a duty’, ‘H&S is the right thing’ and ‘unfair H&S standards or legislation’. Although a scoping study, the study draws attention to the barriers to construction H&S self-regulation in Nigeria and demonstrates an alternative to state regulation of H&S.

  7. Could tight junctions regulate the barrier function of the aged skin?

    Science.gov (United States)

    Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš

    2016-03-01

    The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Three Pairs of Protease-Serpin Complexes Cooperatively Regulate the Insect Innate Immune Responses*

    OpenAIRE

    Jiang, Rui; Kim, Eun-Hye; Gong, Ji-Hee; Kwon, Hyun-Mi; Kim, Chan-Hee; Ryu, Kyoung-Hwa; Park, Ji-Won; Kurokawa, Kenji; Zhang, Jinghai; Gubb, David; Lee, Bok-Luel

    2009-01-01

    Serpins are known to be necessary for the regulation of several serine protease cascades. However, the mechanisms of how serpins regulate the innate immune responses of invertebrates are not well understood due to the uncertainty of the identity of the serine proteases targeted by the serpins. We recently reported the molecular activation mechanisms of three serine protease-mediated Toll and melanin synthesis cascades in a large beetle, Tenebrio molitor. Here, we purified three novel serpins ...

  9. Impact of exogenous lipase supplementation on growth, intestinal function, mucosal immune and physical barrier, and related signaling molecules mRNA expression of young grass carp (Ctenopharyngodon idella).

    Science.gov (United States)

    Liu, Sen; Feng, Lin; Jiang, Wei-Dan; Liu, Yang; Jiang, Jun; Wu, Pei; Zeng, Yun-Yun; Xu, Shu-De; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu

    2016-08-01

    This study investigated the effects of exogenous lipase supplementation on the growth performance, intestinal growth and function, immune response and physical barrier function, and related signaling molecules mRNA expression of young grass carp (Ctenopharyngodon idella). A total of 450 grass carp (255.02 ± 0.34 g) were fed five diets for 60 days. There were 5 dietary treatments that included a normal protein and lipid diet containing 30% crude protein (CP) with 5% ether extract (EE), and the low-protein and high-lipid diets (28% CP, 6% EE) supplemented with graded levels of exogenous lipase supplementation activity at 0, 1193, 2560 and 3730 U/kg diet. The results indicated that compared with a normal protein and lipid diet (30% CP, 5% EE), a low-protein and high-lipid diet (28% CP, 6% EE) (un-supplemented lipase) improved lysozyme activities and complement component 3 contents in the distal intestine (DI), interleukin 10 mRNA expression in the proximal intestine (PI), and glutathione S-transferases activity and glutathione content in the intestine of young grass carp. In addition, in low-protein and high-lipid diets, optimal exogenous lipase supplementation significantly increased acid phosphatase (ACP) activities and complement component 3 (C3) contents (P exogenous lipase supplementation significantly decreased reactive oxygen species (ROS), malondialdehyde (MDA) and protein carbonyl (PC) contents (P exogenous lipase supplementation significantly elevated the mRNA levels of tight junction proteins (Occludin, zonula occludens 1, Claudin b, Claudin c and Claudin 3) (P exogenous lipase supplementation improved growth, intestinal growth and function, intestinal immunity, physical barrier, and regulated the mRNA expression of related signal molecules of fish. The optimal level of exogenous lipase supplementation in young grass carp (255-771 g) was estimated to be 1193 U kg(-1) diet. Copyright © 2016. Published by Elsevier Ltd.

  10. CBL-interacting protein kinase 6 negatively regulates immune response to Pseudomonas syringae in Arabidopsis.

    Science.gov (United States)

    Sardar, Atish; Nandi, Ashis Kumar; Chattopadhyay, Debasis

    2017-06-15

    Cytosolic calcium ion (Ca2+) is an essential mediator of the plant innate immune response. Here, we report that a calcium-regulated protein kinase Calcineurin B-like protein (CBL)-interacting protein kinase 6 (CIPK6) functions as a negative regulator of immunity against the bacterial pathogen Pseudomonas syringae in Arabidopsis thaliana. Arabidopsis lines with compromised expression of CIPK6 exhibited enhanced disease resistance to the bacterial pathogen and to P. syringae harboring certain but not all avirulent effectors, while restoration of CIPK6 expression resulted in abolition of resistance. Plants overexpressing CIPK6 were more susceptible to P. syringae. Enhanced resistance in the absence of CIPK6 was accompanied by increased accumulation of salicylic acid and elevated expression of defense marker genes. Salicylic acid accumulation was essential for improved immunity in the absence of CIPK6. CIPK6 negatively regulated the oxidative burst associated with perception of pathogen-associated microbial patterns (PAMPs) and bacterial effectors. Accelerated and enhanced activation of the mitogen-activated protein kinase cascade in response to bacterial and fungal elicitors was observed in the absence of CIPK6. The results of this study suggested that CIPK6 negatively regulates effector-triggered and PAMP-triggered immunity in Arabidopsis. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  11. Rupture, Invasion and Inflammatory Destruction of the Intestinal Barrier by Shigella: The Yin and Yang of Innate Immunity

    Directory of Open Access Journals (Sweden)

    Philippe J Sansonetti

    2006-01-01

    Full Text Available Shigella is a Gram-negative bacterial species of the family Enterobacteriaceae that causes bacillary dysentery in humans. This acute colitis reflects the capacity of the microorganism to disrupt, invade and cause the inflammatory destruction of the intestinal epithelium. The pathogenesis of the Shigella infection can be seen as a disruption of the homeostatic balance that protects the gut against inflammation in the presence of its commensal flora. This provides the unified view that enteroinvasive pathogens allow for the identification of key signalling molecules and pathways involved in the regulation of intestinal inflammation, and more generally, in the regulation of the innate and adaptive immune response.

  12. Regulation of immune responses and tolerance: the microRNA perspective.

    Science.gov (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

    2013-05-01

    Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. © 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  13. Forkhead, a new cross regulator of metabolism and innate immunity downstream of TOR in Drosophila.

    Science.gov (United States)

    Varma, Disha; Bülow, Margret H; Pesch, Yanina-Yasmin; Loch, Gerrit; Hoch, Michael

    2014-10-01

    Antimicrobial peptides (AMPs) are conserved cationic peptides which act both as defense molecules of the host immune system and as regulators of the commensal microbiome. Expression of AMPs is induced in response to infection by the Toll and Imd pathway. Under non-infected conditions, the transcription factor dFOXO directly regulates a set of AMP expression at low levels when nutrients are limited. Here we have analyzed whether target of rapamycin (TOR), another major regulator of growth and metabolism, also modulates AMP responses in Drosophila. We found that downregulation of TOR by feeding the drug rapamycin or by overexpressing the negative TOR regulators TSC1/TSC2, resulted in a specific induction of the AMPs Diptericin (Dpt) and Metchnikowin (Mtk). In contrast, overexpression of Rheb, which positively regulates TOR led to a repression of the two AMPs. Genetic and pharmacological experiments indicate that Dpt and Mtk activation is controlled by the transcription factor Forkhead (FKH), the founding member of the FoxO family. Shuttling of FKH from the cytoplasm to the nucleus is induced in the fat body and in the posterior midgut in response to TOR downregulation. The FKH-dependent induction of Dpt and Mtk can be triggered in dFOXO null mutants and in immune-compromised Toll and IMD pathway mutants indicating that FKH acts in parallel to these regulators. Together, we have discovered that FKH is the second conserved member of the FoxO family cross-regulating metabolism and innate immunity. dFOXO and FKH, which are activated upon downregulation of insulin or TOR activities, respectively, act in parallel to induce different sets of AMPs, thereby modulating the immune status of metabolic tissues such as the fat body or the gut in response to the oscillating energy status of the organism. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. [The role of gut microbiota in the regulation of the immune response].

    Science.gov (United States)

    Alarcón, Pedro; González, Margarita; Castro, Érica

    2016-07-01

    The gastrointestinal tract hosts around 10(14) bacterial microorganisms, in a constantly growing density from the stomach to the distal colon. This microbiota is composed by more than 500 species of bacteria, which are quickly acquired after birth, fairly stable during the host’s life, and essential for human homeostasis. These bacteria have important functions, such as stimulating the immune system, protecting the host from invading bacteria and viruses, and improving digestion, especially of complex carbohydrates. Also, the gut microbiota interacts directly with the immune system. However, the interaction of the intestinal epithelium and its microbiota with the immune system has yet to be fully understood. Secretory immunoglobulin A, produced by the plasma cells in Peyer’s patches and in the lamina propria, maintains non-invasive commensal bacteria and neutralize invasive pathogens. Dendritic cells migrate from the lamina propria of the secondary lymphoid organs to regulate gut immunity. They also have a key role maintaining luminal IgA and inducing the growth of regulatory T cells. Dendritic cells supervise the gut microenvironment too, keeping an immunological equilibrium and tolerance. The importance of the gut microbiota in regulating the immune system lies mostly in the homeostasis-or positive equilibrium. Thus, many diseases are a consequence of poor interactions or a loss of this equilibrium.

  15. Delicate regulation of the cGAS-MITA-mediated innate immune response.

    Science.gov (United States)

    Luo, Wei-Wei; Shu, Hong-Bing

    2018-02-19

    Although it has long been demonstrated that cytosolic DNA is a potent immune stimulant, it is only in recent years that the molecular mechanisms of DNA-stimulated innate immune responses have emerged. Studies have established critical roles for the DNA sensor cyclic GMP-AMP synthase (cGAS) and the adapter protein MITA/STING in the innate immune response to cytosolic DNA or DNA viruses. Although the regulation of cGAS-MITA/STING-mediated signaling remains to be fully investigated, understanding the processes involved may help to explain the mechanisms of innate immune signaling events and perhaps autoinflammatory diseases and to provide potential therapeutic targets for drug intervention. In this review, we summarize recent progress on the regulation of the cGAS-MITA/STING-mediated innate immune response to DNA viruses at the organelle-trafficking, post-translational and transcriptional levels.Cellular & Molecular Immunology advance online publication, 19 February 2018; doi:10.1038/cmi.2016.51.

  16. NKp46 clusters at the immune synapse and regulates NK cell polarization

    Directory of Open Access Journals (Sweden)

    Uzi eHadad

    2015-09-01

    Full Text Available Natural killer cells play an important role in first-line defense against tumor and virus-infected cells. The activity of NK cells is tightly regulated by a repertoire of cell-surface expressed inhibitory and activating receptors. NKp46 is a major NK cell activating receptor that is involved in the elimination of target cells. NK cells form different types of synapses that result in distinct functional outcomes: cytotoxic, inhibitory, and regulatory. Recent studies revealed that complex integration of NK receptor signaling controls cytoskeletal rearrangement and other immune synapse-related events. However the distinct nature by which NKp46 participates in NK immunological synapse formation and function remains unknown. In this study we determined that NKp46 forms microclusters structures at the immune synapse between NK cells and target cells. Over-expression of human NKp46 is correlated with increased accumulation of F-actin mesh at the immune synapse. Concordantly, knock-down of NKp46 in primary human NK cells decreased recruitment of F-actin to the synapse. Live cell imaging experiments showed a linear correlation between NKp46 expression and lytic granules polarization to the immune synapse. Taken together, our data suggest that NKp46 signaling directly regulates the NK lytic immune synapse from early formation to late function.

  17. The essential role of G protein-coupled receptor (GPCR) signaling in regulating T cell immunity.

    Science.gov (United States)

    Wang, Dashan

    2018-06-01

    The aim of this paper is to clarify the critical role of GPCR signaling in T cell immunity. The G protein-coupled receptors (GPCRs) are the most common targets in current pharmaceutical industry, and represent the largest and most versatile family of cell surface communicating molecules. GPCRs can be activated by a diverse array of ligands including neurotransmitters, chemokines as well as sensory stimuli. Therefore, GPCRs are involved in many key cellular and physiological processes, such as sense of light, taste and smell, neurotransmission, metabolism, endocrine and exocrine secretion. In recent years, GPCRs have been found to play an important role in immune system. T cell is an important type of immune cell, which plays a central role in cell-mediated immunity. A variety of GPCRs and their signaling mediators (RGS proteins, GRKs and β-arrestin) have been found to express in T cells and involved T cell-mediated immunity. We will summarize the role of GPCR signaling and their regulatory molecules in T cell activation, homeostasis and function in this article. GPCR signaling plays an important role in T cell activation, homeostasis and function. GPCR signaling is critical in regulating T cell immunity.

  18. MicroRNAs (MiRs) Precisely Regulate Immune System Development and Function in Immunosenescence Process.

    Science.gov (United States)

    Aalaei-Andabili, Seyed Hossein; Rezaei, Nima

    2016-01-01

    Human aging is a complex process with pivotal changes in gene expression of biological pathways. Immune system dysfunction has been recognized as one of the most important abnormalities induced by senescent names immunosenescence. Emerging evidences suggest miR role in immunosenescence. We aimed to systemically review all relevant reports to clearly state miR effects on immunosenescence process. Sensitive electronic searches carried out. Quality assessment has been performed. Since majority of the included studies were laboratory works, and therefore heterogen, we discussed miR effects on immunological aging process nonstatically. Forty-six articles were found in the initial search. After exclusion of 34 articles, 12 studies enrolled to the final stage. We found that miRs have crucial roles in exact function of immune system. MiRs are involved in the regulation of the aging process in the immune system components and target certain genes, promoting or inhibiting immune system reaction to invasion. Also, miRs control life span of the immune system members by regulation of the genes involved in the apoptosis. Interestingly, we found that immunosenescence is controllable by proper manipulation of the various miRs expression. DNA methylation and histone acetylation have been discovered as novel strategies, altering NF-κB binding ability to the miR promoter sites. Effect of miRs on impairment of immune system function due to the aging is emerging. Although it has been accepted that miRs have determinant roles in the regulation of the immunosenescence; however, most of the reports are concluded from animal/laboratory works, suggesting the necessity of more investigations in human.

  19. MicroRNA-mediated networks underlie immune response regulation in papillary thyroid carcinoma

    Science.gov (United States)

    Huang, Chen-Tsung; Oyang, Yen-Jen; Huang, Hsuan-Cheng; Juan, Hsueh-Fen

    2014-09-01

    Papillary thyroid carcinoma (PTC) is a common endocrine malignancy with low death rate but increased incidence and recurrence in recent years. MicroRNAs (miRNAs) are small non-coding RNAs with diverse regulatory capacities in eukaryotes and have been frequently implied in human cancer. Despite current progress, however, a panoramic overview concerning miRNA regulatory networks in PTC is still lacking. Here, we analyzed the expression datasets of PTC from The Cancer Genome Atlas (TCGA) Data Portal and demonstrate for the first time that immune responses are significantly enriched and under specific regulation in the direct miRNA-target network among distinctive PTC variants to different extents. Additionally, considering the unconventional properties of miRNAs, we explore the protein-coding competing endogenous RNA (ceRNA) and the modulatory networks in PTC and unexpectedly disclose concerted regulation of immune responses from these networks. Interestingly, miRNAs from these conventional and unconventional networks share general similarities and differences but tend to be disparate as regulatory activities increase, coordinately tuning the immune responses that in part account for PTC tumor biology. Together, our systematic results uncover the intensive regulation of immune responses underlain by miRNA-mediated networks in PTC, opening up new avenues in the management of thyroid cancer.

  20. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  1. Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function

    Directory of Open Access Journals (Sweden)

    Kathryn M. Lenz

    2018-04-01

    Full Text Available Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer’s disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.

  2. Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function.

    Science.gov (United States)

    Lenz, Kathryn M; Nelson, Lars H

    2018-01-01

    Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer's disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.

  3. Neonatal immune challenge does not affect body weight regulation in rats.

    Science.gov (United States)

    Spencer, Sarah J; Mouihate, Abdeslam; Galic, Michael A; Ellis, Shaun L; Pittman, Quentin J

    2007-08-01

    The perinatal environment plays a crucial role in programming many aspects of adult physiology. Myriad stressors during pregnancy, from maternal immune challenge to nutritional deficiency, can alter long-term body weight set points of the offspring. In light of the increasing concern over body weight issues, such as obesity and anorexia, in modern societies and accumulating evidence that developmental stressors have long-lasting effects on other aspects of physiology (e.g., fever, pain), we explored the role of immune system activation during neonatal development and its impact on body weight regulation in adulthood. Here we present a thorough evaluation of the effects of immune system activation (LPS, 100 microg/kg ip) at postnatal days 3, 7, or 14 on long-term body weight, adiposity, and body weight regulation after a further LPS injection (50 microg/kg ip) or fasting and basal and LPS-induced circulating levels of the appetite-regulating proinflammatory cytokine leptin. We show that neonatal exposure to LPS at various times during the neonatal period has no long-term effects on growth, body weight, or adiposity. We also observed no effects on body weight regulation in response to a short fasting period or a further exposure to LPS. Despite reductions in circulating leptin levels in response to LPS during the neonatal period, no long-term effects on leptin were seen. These results convincingly demonstrate that adult body weight and weight regulation are, unlike many other aspects of adult physiology, resistant to programming by a febrile-dose neonatal immune challenge.

  4. GDSL LIPASE1 Modulates Plant Immunity through Feedback Regulation of Ethylene Signaling1[W

    Science.gov (United States)

    Kim, Hye Gi; Kwon, Sun Jae; Jang, Young Jin; Nam, Myung Hee; Chung, Joo Hee; Na, Yun-Cheol; Guo, Hongwei; Park, Ohkmae K.

    2013-01-01

    Ethylene is a key signal in the regulation of plant defense responses. It is required for the expression and function of GDSL LIPASE1 (GLIP1) in Arabidopsis (Arabidopsis thaliana), which plays an important role in plant immunity. Here, we explore molecular mechanisms underlying the relationship between GLIP1 and ethylene signaling by an epistatic analysis of ethylene response mutants and GLIP1-overexpressing (35S:GLIP1) plants. We show that GLIP1 expression is regulated by ethylene signaling components and, further, that GLIP1 expression or application of petiole exudates from 35S:GLIP1 plants affects ethylene signaling both positively and negatively, leading to ETHYLENE RESPONSE FACTOR1 activation and ETHYLENE INSENSITIVE3 (EIN3) down-regulation, respectively. Additionally, 35S:GLIP1 plants or their exudates increase the expression of the salicylic acid biosynthesis gene SALICYLIC ACID INDUCTION-DEFICIENT2, known to be inhibited by EIN3 and EIN3-LIKE1. These results suggest that GLIP1 regulates plant immunity through positive and negative feedback regulation of ethylene signaling, and this is mediated by its activity to accumulate a systemic signal(s) in the phloem. We propose a model explaining how GLIP1 regulates the fine-tuning of ethylene signaling and ethylene-salicylic acid cross talk. PMID:24170202

  5. Glucose Transporters at the Blood-Brain Barrier: Function, Regulation and Gateways for Drug Delivery.

    Science.gov (United States)

    Patching, Simon G

    2017-03-01

    Glucose transporters (GLUTs) at the blood-brain barrier maintain the continuous high glucose and energy demands of the brain. They also act as therapeutic targets and provide routes of entry for drug delivery to the brain and central nervous system for treatment of neurological and neurovascular conditions and brain tumours. This article first describes the distribution, function and regulation of glucose transporters at the blood-brain barrier, the major ones being the sodium-independent facilitative transporters GLUT1 and GLUT3. Other GLUTs and sodium-dependent transporters (SGLTs) have also been identified at lower levels and under various physiological conditions. It then considers the effects on glucose transporter expression and distribution of hypoglycemia and hyperglycemia associated with diabetes and oxygen/glucose deprivation associated with cerebral ischemia. A reduction in glucose transporters at the blood-brain barrier that occurs before the onset of the main pathophysiological changes and symptoms of Alzheimer's disease is a potential causative effect in the vascular hypothesis of the disease. Mutations in glucose transporters, notably those identified in GLUT1 deficiency syndrome, and some recreational drug compounds also alter the expression and/or activity of glucose transporters at the blood-brain barrier. Approaches for drug delivery across the blood-brain barrier include the pro-drug strategy whereby drug molecules are conjugated to glucose transporter substrates or encapsulated in nano-enabled delivery systems (e.g. liposomes, micelles, nanoparticles) that are functionalised to target glucose transporters. Finally, the continuous development of blood-brain barrier in vitro models is important for studying glucose transporter function, effects of disease conditions and interactions with drugs and xenobiotics.

  6. Immune Regulator MCPIP1 Modulates TET Expression during Early Neocortical Development

    Directory of Open Access Journals (Sweden)

    Huihui Jiang

    2016-09-01

    Full Text Available MCPIP1 is a recently identified immune regulator that plays critical roles in preventing immune disorders, and is also present in the brain. Currently an unresolved question remains as to how MCPIP1 performs its non-immune functions in normal brain development. Here, we report that MCPIP1 is abundant in neural progenitor cells (NPCs and newborn neurons during the early stages of neurogenesis. The suppression of MCPIP1 expression impairs normal neuronal differentiation, cell-cycle exit, and concomitant NPC proliferation. MCPIP1 is important for maintenance of the NPC pool. Notably, we demonstrate that MCPIP1 reduces TET (TET1/TET2/TET3 levels and then decreases 5-hydroxymethylcytosine levels. Furthermore, the MCPIP1 interaction with TETs is involved in neurogenesis and in establishing the proper number of NPCs in vivo. Collectively, our findings not only demonstrate that MCPIP1 plays an important role in early cortical neurogenesis but also reveal an unexpected link between neocortical development, immune regulators, and epigenetic modification.

  7. Notch1 Signaling Regulates the Th17/Treg Immune Imbalance in Patients with Psoriasis Vulgaris.

    Science.gov (United States)

    Ma, Lei; Xue, HaiBo; Gao, Tianqin; Gao, MeiLan; Zhang, YuJie

    2018-01-01

    To evaluate the regulating effect of Notch1 signaling on Th17/Treg immune imbalance in psoriasis vulgaris (PV). Notch1, Hes-1, ROR γ t, Foxp3, IL-17, and IL-10 mRNA expression, as well as Th17 and Treg cell percentages in peripheral CD4 + T cells, were detected by real-time quantitative RT-PCR and flow cytometry, and serum concentrations of IL-17 and IL-10 were detected by ELISA in 36 PV patients and 32 healthy controls. Additionally, CD4 + T cells from 12 PV patients were treated with γ -secretase inhibitor DAPT, and the above indexes were measured. PV patients presented distinct Th17/Treg immune imbalance and highly expressed Notch1 and Hes-1 mRNA levels, which were positively correlated with psoriasis area and severity index (PASI) and the ratios of Th17/Treg and ROR γ t/Foxp3. DAPT treatment resulted in the obvious downregulation of Th17 cell percentage in cocultured CD4 + T cells, ROR γ t and IL-17 mRNA levels, and IL-17 concentration in cell-free supernatant from cocultured CD4 + T cells of PV patients in a dose-dependent manner, while there was no significant influence on Treg cell percentage, Foxp3, and IL-10 expression, therefore leading to the recovery of Th17/Treg immune imbalance. Notch1 signaling may contribute to the pathogenesis of PV by regulating Th17/Treg immune imbalance.

  8. Innate Immune Cytokines, Fibroblast Phenotypes, and Regulation of Extracellular Matrix in Lung.

    Science.gov (United States)

    Richards, Carl D

    2017-02-01

    Chronic inflammation can be caused by adaptive immune responses in autoimmune and allergic conditions, driven by a T lymphocyte subset balance (TH1, TH2, Th17, Th22, and/or Treg) and skewed cellular profiles in an antigen-specific manner. However, several chronic inflammatory diseases have no clearly defined adaptive immune mechanisms that drive chronicity. These conditions include those that affect the lung such as nonatopic asthma or idiopathic pulmonary fibrosis comprising significant health problems. The remodeling of extracellular matrix (ECM) causes organ dysfunction, and it is largely generated by fibroblasts as the major cell controlling net ECM. As such, these are potential targets of treatment approaches in the context of ECM pathology. Fibroblast phenotypes contribute to ECM and inflammatory cell accumulation, and they are integrated into chronic disease mechanisms including cancer. Evidence suggests that innate cytokine responses may be critical in nonallergic/nonautoimmune disease, and they enable environmental agent exposure mechanisms that are independent of adaptive immunity. Innate immune cytokines derived from macrophage subsets (M1/M2) and innate lymphoid cell (ILC) subsets can directly regulate fibroblast function. We also suggest that STAT3-activating gp130 cytokines can sensitize fibroblasts to the innate cytokine milieu to drive phenotypes and exacerbate existing adaptive responses. Here, we review evidence exploring innate cytokine regulation of fibroblast behavior.

  9. Skin barrier homeostasis in atopic dermatitis: feedback regulation of kallikrein activity.

    Directory of Open Access Journals (Sweden)

    Reiko J Tanaka

    Full Text Available Atopic dermatitis (AD is a widely spread cutaneous chronic disease characterised by sensitive reactions (eg. eczema to normally innocuous elements. Although relatively little is understood about its underlying mechanisms due to its complexity, skin barrier dysfunction has been recognised as a key factor in the development of AD. Skin barrier homeostasis requires tight control of the activity of proteases, called kallikreins (KLKs, whose activity is regulated by a complex network of protein interactions that remains poorly understood despite its pathological importance. Characteristic symptoms of AD include the outbreak of inflammation triggered by external (eg. mechanical and chemical stimulus and the persistence and aggravation of inflammation even if the initial stimulus disappears. These characteristic symptoms, together with some experimental data, suggest the presence of positive feedback regulation for KLK activity by inflammatory signals. We developed simple mathematical models for the KLK activation system to study the effects of feedback loops and carried out bifurcation analysis to investigate the model behaviours corresponding to inflammation caused by external stimulus. The model analysis confirmed that the hypothesised core model mechanisms capture the essence of inflammation outbreak by a defective skin barrier. Our models predicted the outbreaks of inflammation at weaker stimulus and its longer persistence in AD patients compared to healthy control. We also proposed a novel quantitative indicator for inflammation level by applying principal component analysis to microarray data. The model analysis reproduced qualitative AD characteristics revealed by this indicator. Our results strongly implicate the presence and importance of feedback mechanisms in KLK activity regulation. We further proposed future experiments that may provide informative data to enhance the system-level understanding on the regulatory mechanisms of skin barrier

  10. Exercise protects from cancer through regulation of immune function and inflammation

    DEFF Research Database (Denmark)

    Hojman, Pernille

    2017-01-01

    Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection are...... regulation of immune and inflammatory functions, and exercise may be pursued as anticancer treatment through incorporation into standard oncological therapy to the benefit of the cancer patients.......Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection...... are just starting to be elucidated. To this end, evasion of immune surveillance and tumor-associated inflammation are established as hallmarks of cancer, and exercise may target cancer incidence and progression through regulation of these mechanisms. Here, I review the role of exercise in protection from...

  11. Identification of novel immune and barrier genes in atopic dermatitis by means of laser capture microdissection

    DEFF Research Database (Denmark)

    Esaki, Hitokazu; Ewald, David Adrian; Ungar, Benjamin

    2015-01-01

    are unknown. Objective : We sought to establish the genomic profile of the epidermal and dermal compartments of lesional and nonlesional AD skin compared with normal skin. Methods : Laser capture microdissection was performed to separate the epidermis and dermis of lesional and nonlesional skin from patients...... epidermal and dermal genomic signatures of lesional and nonlesional AD skin and normal skin compared with whole tissues. These data establish the utility of laser capture microdissection to separate different compartments and cellular subsets in patients with AD, allowing localization of key barrier...

  12. IRAK-M regulation and function in host defense and immune homeostasis

    Directory of Open Access Journals (Sweden)

    Leah L.N. Hubbard

    2010-06-01

    Full Text Available Antigen presenting cells (APCs of the innate immune system sense a wide range of pathogens via pattern recognition receptors (PRRs. Engagement of certain PRRs can induce production of pro-inflammatory mediators that facilitate effective clearance of pathogen. Toll-like receptors (TLRs are a well described group of PRRs that belong to the TLR/Interleukin-1 receptor (IL-1R superfamily. However, TLR/IL-1R induction of pro-inflammatory mediators must be regulated to prevent excessive inflammation and tissue damage. One molecule of recent interest that is known to inhibit TLR/IL-1R signaling is interleukin-1 receptor associated kinase (IRAK-M, also known as IRAK-3. IRAK-M is expressed in a number of immune and epithelial cells types, and through its inhibition of pro-inflammatory cytokine production, IRAK-M can regulate immune homeostasis and tolerance in a number of infectious and non-infectious diseases. Furthermore, use of IRAK-M deficient animals has increased our understanding of the importance of IRAK-M in regulating immune responsiveness to a variety of pathogens. Although IRAK-M expression is typically induced through TLR signaling, IRAK-M can also be expressed in response to various endogenous and exogenous soluble factors as well as cell surface and intracellular signaling molecules. This review will focus on clinical scenarios in which expression of IRAK-M is beneficial (as in early sepsis and those situations where IRAK-M expression is harmful to the host (as in cancer and following bone marrow transplant. There is strong rationale for therapeutic targeting of IRAK-M for clinical benefit. However, effective targeting will require a greater understanding of the transcriptional regulation of this gene.

  13. Regulation of Thrombin-Induced Lung Endothelial Cell Barrier Disruption by Protein Kinase C Delta.

    Directory of Open Access Journals (Sweden)

    Lishi Xie

    Full Text Available Protein Kinase C (PKC plays a significant role in thrombin-induced loss of endothelial cell (EC barrier integrity; however, the existence of more than 10 isozymes of PKC and tissue-specific isoform expression has limited our understanding of this important second messenger in vascular homeostasis. In this study, we show that PKCδ isoform promotes thrombin-induced loss of human pulmonary artery EC barrier integrity, findings substantiated by PKCδ inhibitory studies (rottlerin, dominant negative PKCδ construct and PKCδ silencing (siRNA. In addition, we identified PKCδ as a signaling mediator upstream of both thrombin-induced MLC phosphorylation and Rho GTPase activation affecting stress fiber formation, cell contraction and loss of EC barrier integrity. Our inhibitor-based studies indicate that thrombin-induced PKCδ activation exerts a positive feedback on Rho GTPase activation and contributes to Rac1 GTPase inhibition. Moreover, PKD (or PKCμ and CPI-17, two known PKCδ targets, were found to be activated by PKCδ in EC and served as modulators of cytoskeleton rearrangement. These studies clarify the role of PKCδ in EC cytoskeleton regulation, and highlight PKCδ as a therapeutic target in inflammatory lung disorders, characterized by the loss of barrier integrity, such as acute lung injury and sepsis.

  14. Sick and tired: how molecular regulators of human sleep schedules and duration impact immune function.

    Science.gov (United States)

    Kurien, Philip A; Chong, S Y Christin; Ptáček, Louis J; Fu, Ying-Hui

    2013-10-01

    Why do we need to sleep? What regulates when we sleep? And what dictates the number of hours we require? These are often viewed as three separate biological questions. Here, we propose they share molecular etiologies, whereby regulators of sleep schedules and sleep duration also govern the physiological purposes of sleep. To support our hypothesis, we review Mendelian human genetic variants sufficient to advance sleep-wake onset (PER2) and shorten sleep length (DEC2), and evaluate their emerging roles in immune responses that may rely on a sound night of slumber. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Leptin and zinc relation : In regulation of food intake and immunity

    Directory of Open Access Journals (Sweden)

    Abdulkerim Kasim Baltaci

    2012-01-01

    Full Text Available Leptin is synthesized and released by the adipose tissue. Leptin, which carries the information about energy reserves of the body to the brain, controls food intake by acting on neuropeptide Y (NPY, which exercises a food-intake-increasing effect through relevant receptors in the hypothalamus. Zinc deficiency is claimed to result in anorexia, weight loss, poor food efficiency, and growth impairment. The fact that obese individuals have low zinc and high leptin levels suggests that there is a relation between zinc and nutrition, and consequently also between zinc and leptin. Leptin deficiency increases the predisposition to infections and this increase is associated with the impairments in the production of cytokines. Zinc has a key role in the sustenance of immune resistance against infections. Dietary zinc deficiency negatively affects CD +4 cells, Th functions, and consequently, cell-mediated immunity by causing a decrease in the production of IL-2, IF-γ, and TNF-α, which are Th1 products. The relation between zinc and the concerned cytokines in particular, and the fact that leptin has a part in the immune responses mediated by these cytokines demonstrate that an interaction among cellular immunity, leptin and zinc is inevitable. An overall evaluation of the information presented above suggests that there are complex relations among food intake, leptin and zinc on one hand and among cellular immunity, leptin and zinc on the other. The aim of the present review was to draw attention to the possible relation between zinc and leptin in dietary regulation and cellular immunity.

  16. Serotonergic Chemosensory Neurons Modify the C. elegans Immune Response by Regulating G-Protein Signaling in Epithelial Cells

    Science.gov (United States)

    Anderson, Alexandra; Laurenson-Schafer, Henry; Partridge, Frederick A.; Hodgkin, Jonathan; McMullan, Rachel

    2013-01-01

    The nervous and immune systems influence each other, allowing animals to rapidly protect themselves from changes in their internal and external environment. However, the complex nature of these systems in mammals makes it difficult to determine how neuronal signaling influences the immune response. Here we show that serotonin, synthesized in Caenorhabditis elegans chemosensory neurons, modulates the immune response. Serotonin released from these cells acts, directly or indirectly, to regulate G-protein signaling in epithelial cells. Signaling in these cells is required for the immune response to infection by the natural pathogen Microbacterium nematophilum. Here we show that serotonin signaling suppresses the innate immune response and limits the rate of pathogen clearance. We show that C. elegans uses classical neurotransmitters to alter the immune response. Serotonin released from sensory neurons may function to modify the immune system in response to changes in the animal's external environment such as the availability, or quality, of food. PMID:24348250

  17. Gut TFH and IgA: key players for regulation of bacterial communities and immune homeostasis.

    Science.gov (United States)

    Kato, Lucia M; Kawamoto, Shimpei; Maruya, Mikako; Fagarasan, Sidonia

    2014-01-01

    The main function of the immune system is to protect the host against pathogens. However, unlike the systemic immune system, the gut immune system does not eliminate, but instead nourishes complex bacterial communities and establishes advanced symbiotic relationships. Immunoglobulin A (IgA) is the most abundant antibody isotype in mammals, produced mainly in the gut. The primary function of IgA is to maintain homeostasis at mucosal surfaces, and studies in mice have demonstrated that IgA diversification has an essential role in the regulation of gut microbiota. Dynamic diversification and constant adaptation of IgA responses to local microbiota require expression of activation-induced cytidine deaminase by B cells and control from T follicular helper and Foxp3(+) T cells in germinal centers (GCs). We discuss the finely tuned regulatory mechanisms for IgA synthesis in GCs of Peyer's patches and emphasize the roles of CD4(+) T cells for IgA selection and the maintenance of appropriate gut microbial communities required for immune homeostasis.

  18. Regulation of intestinal immune responses through TLR activation: implications for pro- and prebiotics

    Directory of Open Access Journals (Sweden)

    Sander eDe Kivit

    2014-02-01

    Full Text Available The intestinal mucosa is constantly facing a high load of antigens including bacterial antigens derived from the microbiota and food. Despite this, the immune cells present in the gastrointestinal tract do not initiate a pro-inflammatory immune response. Toll-like receptors (TLRs are pattern recognition receptors expressed by various cells in the gastrointestinal tract, including intestinal epithelial cells (IEC and resident immune cells in the lamina propria. Many diseases, including chronic intestinal inflammation (e.g. inflammatory bowel disease, irritable bowel syndrome (IBS, allergic gastroenteritis (e.g. eosinophilic gastroenteritis and allergic IBS and infections are nowadays associated with a deregulated microbiota. The microbiota may directly interact with TLR. In addition, differences in intestinal TLR expression in health and disease may suggest that TLR play an essential role in disease pathogenesis and may be novel targets for therapy. TLR signaling in the gut is involved in either maintaining intestinal homeostasis or the induction of an inflammatory response. This mini review provides an overview of the current knowledge regarding the contribution of intestinal epithelial TLR signaling in both tolerance induction or promoting intestinal inflammation, with a focus on food allergy. We will also highlight a potential role of the microbiota in regulating gut immune responses, especially through TLR activation.

  19. Autoimmunity in Arabidopsis acd11 is mediated by epigenetic regulation of an immune receptor.

    Directory of Open Access Journals (Sweden)

    Kristoffer Palma

    Full Text Available Certain pathogens deliver effectors into plant cells to modify host protein targets and thereby suppress immunity. These target modifications can be detected by intracellular immune receptors, or Resistance (R proteins, that trigger strong immune responses including localized host cell death. The accelerated cell death 11 (acd11 "lesion mimic" mutant of Arabidopsis thaliana exhibits autoimmune phenotypes such as constitutive defense responses and cell death without pathogen perception. ACD11 encodes a putative sphingosine transfer protein, but its precise role during these processes is unknown. In a screen for lazarus (laz mutants that suppress acd11 death we identified two genes, LAZ2 and LAZ5. LAZ2 encodes the histone lysine methyltransferase SDG8, previously shown to epigenetically regulate flowering time via modification of histone 3 (H3. LAZ5 encodes an RPS4-like R-protein, defined by several dominant negative alleles. Microarray and chromatin immunoprecipitation analyses showed that LAZ2/SDG8 is required for LAZ5 expression and H3 lysine 36 trimethylation at LAZ5 chromatin to maintain a transcriptionally active state. We hypothesize that LAZ5 triggers cell death in the absence of ACD11, and that cell death in other lesion mimic mutants may also be caused by inappropriate activation of R genes. Moreover, SDG8 is required for basal and R protein-mediated pathogen resistance in Arabidopsis, revealing the importance of chromatin remodeling as a key process in plant innate immunity.

  20. Mesenchymal Stromal Cells Can Regulate the Immune Response in the Tumor Microenvironment

    Directory of Open Access Journals (Sweden)

    Alessandro Poggi

    2016-11-01

    Full Text Available The tumor microenvironment is a good target for therapy in solid tumors and hematological malignancies. Indeed, solid tumor cells’ growth and expansion can influence neighboring cells’ behavior, leading to a modulation of mesenchymal stromal cell (MSC activities and remodeling of extracellular matrix components. This leads to an altered microenvironment, where reparative mechanisms, in the presence of sub-acute inflammation, are not able to reconstitute healthy tissue. Carcinoma cells can undergo epithelial mesenchymal transition (EMT, a key step to generate metastasis; these mesenchymal-like cells display the functional behavior of MSC. Furthermore, MSC can support the survival and growth of leukemic cells within bone marrow participating in the leukemic cell niche. Notably, MSC can inhibit the anti-tumor immune response through either carcinoma-associated fibroblasts or bone marrow stromal cells. Experimental data have indicated their relevance in regulating cytolytic effector lymphocytes of the innate and adaptive arms of the immune system. Herein, we will discuss some of the evidence in hematological malignancies and solid tumors. In particular, we will focus our attention on the means by which it is conceivable to inhibit MSC-mediated immune suppression and trigger anti-tumor innate immunity.

  1. Gap junctions in cells of the immune system: structure, regulation and possible functional roles

    Directory of Open Access Journals (Sweden)

    J.C. Sáez

    2000-04-01

    Full Text Available Gap junction channels are sites of cytoplasmic communication between contacting cells. In vertebrates, they consist of protein subunits denoted connexins (Cxs which are encoded by a gene family. According to their Cx composition, gap junction channels show different gating and permeability properties that define which ions and small molecules permeate them. Differences in Cx primary sequences suggest that channels composed of different Cxs are regulated differentially by intracellular pathways under specific physiological conditions. Functional roles of gap junction channels could be defined by the relative importance of permeant substances, resulting in coordination of electrical and/or metabolic cellular responses. Cells of the native and specific immune systems establish transient homo- and heterocellular contacts at various steps of the immune response. Morphological and functional studies reported during the last three decades have revealed that many intercellular contacts between cells in the immune response present gap junctions or "gap junction-like" structures. Partial characterization of the molecular composition of some of these plasma membrane structures and regulatory mechanisms that control them have been published recently. Studies designed to elucidate their physiological roles suggest that they might permit coordination of cellular events which favor the effective and timely response of the immune system.

  2. Understanding how commensal obligate anaerobic bacteria regulate immune functions in the large intestine.

    Science.gov (United States)

    Maier, Eva; Anderson, Rachel C; Roy, Nicole C

    2014-12-24

    The human gastrointestinal tract is colonised by trillions of commensal bacteria, most of which are obligate anaerobes residing in the large intestine. Appropriate bacterial colonisation is generally known to be critical for human health. In particular, the development and function of the immune system depends on microbial colonisation, and a regulated cross-talk between commensal bacteria, intestinal epithelial cells and immune cells is required to maintain mucosal immune homeostasis. This homeostasis is disturbed in various inflammatory disorders, such as inflammatory bowel diseases. Several in vitro and in vivo studies indicate a role for Faecalibacterium prausnitzii, Bacteroides thetaiotaomicron, Bacteroides fragilis, Akkermansia muciniphila and segmented filamentous bacteria in maintaining intestinal immune homeostasis. These obligate anaerobes are abundant in the healthy intestine but reduced in several inflammatory diseases, suggesting an association with protective effects on human health. However, knowledge of the mechanisms underlying the effects of obligate anaerobic intestinal bacteria remains limited, in part due to the difficulty of co-culturing obligate anaerobes together with oxygen-requiring human epithelial cells. By using novel dual-environment co-culture models, it will be possible to investigate the effects of the unstudied majority of intestinal microorganisms on the human epithelia. This knowledge will provide opportunities for improving human health and reducing the risk of inflammatory diseases.

  3. Understanding How Commensal Obligate Anaerobic Bacteria Regulate Immune Functions in the Large Intestine

    Science.gov (United States)

    Maier, Eva; Anderson, Rachel C.; Roy, Nicole C.

    2014-01-01

    The human gastrointestinal tract is colonised by trillions of commensal bacteria, most of which are obligate anaerobes residing in the large intestine. Appropriate bacterial colonisation is generally known to be critical for human health. In particular, the development and function of the immune system depends on microbial colonisation, and a regulated cross-talk between commensal bacteria, intestinal epithelial cells and immune cells is required to maintain mucosal immune homeostasis. This homeostasis is disturbed in various inflammatory disorders, such as inflammatory bowel diseases. Several in vitro and in vivo studies indicate a role for Faecalibacterium prausnitzii, Bacteroides thetaiotaomicron, Bacteroides fragilis, Akkermansia muciniphila and segmented filamentous bacteria in maintaining intestinal immune homeostasis. These obligate anaerobes are abundant in the healthy intestine but reduced in several inflammatory diseases, suggesting an association with protective effects on human health. However, knowledge of the mechanisms underlying the effects of obligate anaerobic intestinal bacteria remains limited, in part due to the difficulty of co-culturing obligate anaerobes together with oxygen-requiring human epithelial cells. By using novel dual-environment co-culture models, it will be possible to investigate the effects of the unstudied majority of intestinal microorganisms on the human epithelia. This knowledge will provide opportunities for improving human health and reducing the risk of inflammatory diseases. PMID:25545102

  4. The role of innate immunity in the regulation of brown and beige adipogenesis.

    Science.gov (United States)

    Alexaki, Vasileia Ismini; Chavakis, Triantafyllos

    2016-03-01

    The adipose tissue (AT) is multifunctional, acting as an endocrine tissue and participating in the regulation of the organism's homeostasis. Metabolic, endocrine and inflammatory mechanisms are tightly intertwined within the AT, regulating its function. Disruption of the equilibrium among these mechanisms leads to pathologies, the most common being obesity-related insulin resistance. Two types of AT exist, the white and the brown AT. Traditionally the white AT (WAT) was thought to store energy in the form of lipids, while the brown AT (BAT) was known to mediate heat generation. Recently, the 'brite' or 'beige' AT was identified, which is localized predominantly in subcutaneous WAT, but shares functional features with the BAT and is capable of heat production. The major stimulus triggering beige and brown adipogenesis is cold exposure and catecholamine signalling. However, several further signals and mechanisms exist, which can orchestrate and fine-tune beige and brown AT function. Immune cells and inflammation have emerged as regulators of beige and brown AT function. The present review will focus on the recently identified crosstalk between innate immunity and the regulation of beige and brown adipogenesis.

  5. Metabolite-Sensing G Protein-Coupled Receptors-Facilitators of Diet-Related Immune Regulation.

    Science.gov (United States)

    Tan, Jian K; McKenzie, Craig; Mariño, Eliana; Macia, Laurence; Mackay, Charles R

    2017-04-26

    Nutrition and the gut microbiome regulate many systems, including the immune, metabolic, and nervous systems. We propose that the host responds to deficiency (or sufficiency) of dietary and bacterial metabolites in a dynamic way, to optimize responses and survival. A family of G protein-coupled receptors (GPCRs) termed the metabolite-sensing GPCRs bind to various metabolites and transmit signals that are important for proper immune and metabolic functions. Members of this family include GPR43, GPR41, GPR109A, GPR120, GPR40, GPR84, GPR35, and GPR91. In addition, bile acid receptors such as GPR131 (TGR5) and proton-sensing receptors such as GPR65 show similar features. A consistent feature of this family of GPCRs is that they provide anti-inflammatory signals; many also regulate metabolism and gut homeostasis. These receptors represent one of the main mechanisms whereby the gut microbiome affects vertebrate physiology, and they also provide a link between the immune and metabolic systems. Insufficient signaling through one or more of these metabolite-sensing GPCRs likely contributes to human diseases such as asthma, food allergies, type 1 and type 2 diabetes, hepatic steatosis, cardiovascular disease, and inflammatory bowel diseases.

  6. Porcine models for the study of local and systemic regulation of innate immune factors in obesity

    DEFF Research Database (Denmark)

    Højbøge, Tina Rødgaard

    state of low-grade inflammation in the adipose tissues, which involves several factors of the innate immune response having a range of systemic effects and which has been implicated in the development of the metabolic syndrome. To investigate the impact of obesity and obesity-related diseases good...... translational animal models are needed, and as such pigs have been proposed as relevant models for human obesity-induced inflammation as pigs share many genetic, anatomical and physiological features with humans. In this project the up- and downregulation of genes and proteins involved in the innate immune...... the number of animals to be used in a trial to obtain statistical power. For the gene regulation analysis, two platforms for quantitative real-time PCR (qPCR) were employed: The Rotor-Gene Q instrument and the microfluidics-based high-throughput Bio-Mark. For the serum protein concentrations analysis several...

  7. CD8(+)NKT-like cells regulate the immune response by killing antigen-bearing DCs.

    Science.gov (United States)

    Wang, Chao; Liu, Xi; Li, Zhengyuan; Chai, Yijie; Jiang, Yunfeng; Wang, Qian; Ji, Yewei; Zhu, Zhongli; Wan, Ying; Yuan, Zhenglong; Chang, Zhijie; Zhang, Minghui

    2015-09-15

    CD1d-dependent NKT cells have been extensively studied; however, the function of CD8(+)NKT-like cells, which are CD1d-independent T cells with NK markers, remains unknown. Here, we report that CD1d-independent CD8(+)NKT-like cells, which express both T cell markers (TCRβ and CD3) and NK cell receptors (NK1.1, CD49b and NKG2D), are activated and significantly expanded in mice immunized with GFP-expressing dendritic cells. Distinct from CD1d-dependent NKT cells, CD8(+)NKT-like cells possess a diverse repertoire of TCRs and secrete high levels of IFN-gamma but not IL-4. CD8(+)NKT-like cell development is normal in CD1d(-/-) mice, which suggests that CD8(+)NKT-like cells undergo a unique development pathway that differs from iNKT cells. Further functional analyses show that CD8(+)NKT-like cells suppress T-cell responses through elimination of dendritic cells in an antigen-specific manner. Adoptive transfer of antigen-specific CD8(+)NKT-like cells into RIP-OVA mice prevented subsequent development of diabetes in the animals induced by activated OT-I CD8 T cells. Our study suggests that CD8(+)NKT-like cells can function as antigen-specific suppressive cells to regulate the immune response through killing antigen-bearing DCs. Antigen-specific down regulation may provide an active and precise method for constraining an excessive immune response and avoiding bypass suppression of necessary immune responses to other antigens.

  8. CD8+NKT-like cells regulate the immune response by killing antigen-bearing DCs

    Science.gov (United States)

    Wang, Chao; Liu, Xi; Li, Zhengyuan; Chai, Yijie; Jiang, Yunfeng; Wang, Qian; Ji, Yewei; Zhu, Zhongli; Wan, Ying; Yuan, Zhenglong; Chang, Zhijie; Zhang, Minghui

    2015-01-01

    CD1d-dependent NKT cells have been extensively studied; however, the function of CD8+NKT-like cells, which are CD1d-independent T cells with NK markers, remains unknown. Here, we report that CD1d-independent CD8+NKT-like cells, which express both T cell markers (TCRβ and CD3) and NK cell receptors (NK1.1, CD49b and NKG2D), are activated and significantly expanded in mice immunized with GFP-expressing dendritic cells. Distinct from CD1d-dependent NKT cells, CD8+NKT-like cells possess a diverse repertoire of TCRs and secrete high levels of IFN-gamma but not IL-4. CD8+NKT-like cell development is normal in CD1d−/− mice, which suggests that CD8+NKT-like cells undergo a unique development pathway that differs from iNKT cells. Further functional analyses show that CD8+NKT-like cells suppress T-cell responses through elimination of dendritic cells in an antigen-specific manner. Adoptive transfer of antigen-specific CD8+NKT-like cells into RIP-OVA mice prevented subsequent development of diabetes in the animals induced by activated OT-I CD8 T cells. Our study suggests that CD8+NKT-like cells can function as antigen-specific suppressive cells to regulate the immune response through killing antigen-bearing DCs. Antigen-specific down regulation may provide an active and precise method for constraining an excessive immune response and avoiding bypass suppression of necessary immune responses to other antigens. PMID:26369936

  9. Endocannabinoid system acts as a regulator of immune homeostasis in the gut.

    Science.gov (United States)

    Acharya, Nandini; Penukonda, Sasi; Shcheglova, Tatiana; Hagymasi, Adam T; Basu, Sreyashi; Srivastava, Pramod K

    2017-05-09

    Endogenous cannabinoids (endocannabinoids) are small molecules biosynthesized from membrane glycerophospholipid. Anandamide (AEA) is an endogenous intestinal cannabinoid that controls appetite and energy balance by engagement of the enteric nervous system through cannabinoid receptors. Here, we uncover a role for AEA and its receptor, cannabinoid receptor 2 (CB2), in the regulation of immune tolerance in the gut and the pancreas. This work demonstrates a major immunological role for an endocannabinoid. The pungent molecule capsaicin (CP) has a similar effect as AEA; however, CP acts by engagement of the vanilloid receptor TRPV1, causing local production of AEA, which acts through CB2. We show that the engagement of the cannabinoid/vanilloid receptors augments the number and immune suppressive function of the regulatory CX3CR1 hi macrophages (Mϕ), which express the highest levels of such receptors among the gut immune cells. Additionally, TRPV1 -/- or CB2 -/- mice have fewer CX3CR1 hi Mϕ in the gut. Treatment of mice with CP also leads to differentiation of a regulatory subset of CD4 + cells, the Tr1 cells, in an IL-27-dependent manner in vitro and in vivo. In a functional demonstration, tolerance elicited by engagement of TRPV1 can be transferred to naïve nonobese diabetic (NOD) mice [model of type 1 diabetes (T1D)] by transfer of CD4 + T cells. Further, oral administration of AEA to NOD mice provides protection from T1D. Our study unveils a role for the endocannabinoid system in maintaining immune homeostasis in the gut/pancreas and reveals a conversation between the nervous and immune systems using distinct receptors.

  10. C/EBPβ Promotes Immunity to Oral Candidiasis through Regulation of β-Defensins.

    Science.gov (United States)

    Simpson-Abelson, Michelle R; Childs, Erin E; Ferreira, M Carolina; Bishu, Shrinivas; Conti, Heather R; Gaffen, Sarah L

    2015-01-01

    Humans or mice subjected to immunosuppression, such as corticosteroids or anti-cytokine biologic therapies, are susceptible to mucosal infections by the commensal fungus Candida albicans. Recently it has become evident that the Th17/IL-17 axis is essential for immunity to candidiasis, but the downstream events that control immunity to this fungus are poorly understood. The CCAAT/Enhancer Binding Protein-β (C/EBPβ) transcription factor is important for signaling by multiple inflammatory stimuli, including IL-17. C/EBPβ is regulated in a variety of ways by IL-17, and controls several downstream IL-17 target genes. However, the role of C/EBPβ in vivo is poorly understood, in part because C/EBPβ-deficient mice are challenging to breed and work with. In this study, we sought to understand the role of C/EBPβ in the context of an IL-17-dependent immune response, using C. albicans infection as a model system. Confirming prior findings, we found that C/EBPβ is required for immunity to systemic candidiasis. In contrast, C/EBPβ(-/-) mice were resistant to oropharyngeal candidiasis (OPC), in a manner indistinguishable from immunocompetent WT mice. However, C/EBPβ(-/-) mice experienced more severe OPC than WT mice in the context of cortisone-induced immunosuppression. Expression of the antimicrobial peptide β-defensin (BD)-3 correlated strongly with susceptibility in C/EBPβ(-/-) mice, but no other IL-17-dependent genes were associated with susceptibility. Therefore, C/EBPβ contributes to immunity to mucosal candidiasis during cortisone immunosuppression in a manner linked to β-defensin 3 expression, but is apparently dispensable for the IL-17-dependent response.

  11. The Gateway Reflex, a Novel Neuro-Immune Interaction for the Regulation of Regional Vessels

    Directory of Open Access Journals (Sweden)

    Yuki Tanaka

    2017-10-01

    Full Text Available The gateway reflex is a new phenomenon that explains how immune cells bypass the blood–brain barrier to infiltrate the central nervous system (CNS and trigger neuroinflammation. To date, four examples of gateway reflexes have been discovered, each described by the stimulus that evokes the reflex. Gravity, electricity, pain, and stress have all been found to create gateways at specific regions of the CNS. The gateway reflex, the most recently discovered of the four, has also been shown to upset the homeostasis of organs in the periphery through its action on the CNS. These reflexes provide novel therapeutic targets for the control of local neuroinflammation and organ function. Each gateway reflex is activated by different neural activations and induces inflmammation at different regions in the CNS. Therefore, it is theoretically possible to manipulate each independently, providing a novel therapeutic strategy to control local neuroinflammation and peripheral organ homeostasis.

  12. Disturbance of ion environment and immune regulation following biodistribution of magnetic iron oxide nanoparticles injected intravenously.

    Science.gov (United States)

    Park, Eun-Jung; Kim, Sang-Wook; Yoon, Cheolho; Kim, Younghun; Kim, Jong Sung

    2016-01-22

    Although it is expected that accumulation of metal oxide nanoparticles that can induce redox reaction in the biological system may influence ion homeostasis and immune regulation through generation of free radicals, the relationship is still unclear. In this study, mice received magnetic iron oxide nanoparticles (M-FeNPs, 2 and 4 mg/kg) a single via the tail vein, and their distribution in tissues was investigated over time (1, 4, and 13 weeks). In addition, we evaluated the effects on homeostasis of redox reaction-related elements, the ion environment and immune regulation. The iron level in tissues reached at the maximum on 4 weeks after injection and M-FeNPs the most distributed in the spleen at 13 weeks. Additionally, levels of redox reaction-related elements in tissues were notably altered since 1 week post-injection. While levels of K(+) and Na(+) in tissue tended to decrease with time, Ca(2+) levels reached to the maximum at 4 weeks post-injection. On 13 weeks post-injection, the increased percentages of neutrophils and eosinophils, the enhanced release of LDH, and the elevated secretion of IL-8 and IL-6 were clearly observed in the blood of M-FeNP-treated mice compared to the control. While expression of antigen presentation related-proteins and the maturation of dendritic cells were markedly inhibited following distribution of M-FeNPs, the expression of several chemokines, including CXCR2, CCR5, and CD123, was enhanced on the splenocytes of the treated groups. Taken together, we suggest that accumulation of M-FeNPs may induce adverse health effects by disturbing homeostasis of the immune regulation and ion environment. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  13. Subversion of Immunity by Leishmania amazonensis Parasites: Possible Role of Phosphatidylserine as a Main Regulator

    Directory of Open Access Journals (Sweden)

    Joao Luiz Mendes Wanderley

    2012-01-01

    Full Text Available Leishmania amazonensis parasites cause progressive disease in most inbred mouse strains and are associated with the development of diffuse cutaneous leishmaniasis in humans. The poor activation of an effective cellular response is correlated with the ability of these parasites to infect mononuclear phagocytic cells without triggering their activation or actively suppressing innate responses of these cells. Here we discuss the possible role of phosphatidylserine exposure by these parasites as a main regulator of the mechanism underlying subversion of the immune system at different steps during the infection.

  14. Immune regulation by CD40-CD40-l interactions - 2; Y2K update.

    Science.gov (United States)

    van Kooten, C

    2000-11-01

    CD40 is a cell surface receptor, which belongs to the TNF-R family, and which was first identified and functionally characterized on B lymphocytes. However, in recent years it has become clear that CD40 is expressed much broader, including expression on monocytes, dendritic cells, endothelial cells and epithelial cells. Therefore it is now thought that CD40 plays a more general role in immune regulation. The present paper reviews recent developments in this field of research, with main emphasis on CD40 signal transduction and on in vivo functions of CD40/CD40-L interactions.

  15. The nuclear IκB family of proteins controls gene regulation and immune homeostasis.

    Science.gov (United States)

    MaruYama, Takashi

    2015-10-01

    The inhibitory IκB family of proteins is subdivided into two groups based on protein localization in the cytoplasm or in the nucleus. These proteins interact with NF-κB, a major transcription factor regulating the expression of many inflammatory cytokines, by modulating its transcriptional activity. However, nuclear IκB family proteins not only interact with NF-κB to change its transcriptional activity, but they also bind to chromatin and control gene expression. This review provides an overview of nuclear IκB family proteins and their role in immune homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. The known two types of transglutaminases regulate immune and stress responses in white shrimp, Litopenaeus vannamei.

    Science.gov (United States)

    Chang, Chin-Chyuan; Chang, Hao-Che; Liu, Kuan-Fu; Cheng, Winton

    2016-06-01

    Transglutaminases (TGs) play critical roles in blood coagulation, immune responses, and other biochemical functions, which undergo post-translational remodeling such as acetylation, phosphorylation and fatty acylation. Two types of TG have been identified in white shrimp, Litopenaeus vannamei, and further investigation on their potential function was conducted by gene silencing in the present study. Total haemocyte count (THC), differential haemocyte count (DHC), phenoloxidase activity, respiratory bursts (release of superoxide anion), superoxide dismutase activity, transglutaminase (TG) activity, haemolymph clotting time, and phagocytic activity and clearance efficiency to the pathogen Vibrio alginolyticus were measured when shrimps were individually injected with diethyl pyrocarbonate-water (DEPC-H2O) or TG dsRNAs. In addition, haemolymph glucose and lactate, and haemocytes crustin, lysozyme, crustacean hyperglycemic hormone (CHH), transglutaminaseI (TGI), transglutaminaseII (TGII) and clotting protein (CP) mRNA expression were determined in the dsRNA injected shrimp under hypothermal stress. Results showed that TG activity, phagocytic activity and clearance efficiency were significantly decreased, but THC, hyaline cells (HCs) and haemolymph clotting time were significantly increased in the shrimp which received LvTGI dsRNA and LvTGI + LvTGII dsRNA after 3 days. However, respiratory burst per haemocyte was significantly decreased in only LvTGI + LvTGII silenced shrimp. In hypothermal stress studies, elevation of haemolymph glucose and lactate was observed in all treated groups, and were advanced in LvTGI and LvTGI + LvTGII silenced shrimp following exposure to 22 °C. LvCHH mRNA expression was significantly up-regulated, but crustin and lysozyme mRNA expressions were significantly down-regulated in LvTGI and LvTGI + LvTGII silenced shrimp; moreover, LvTGII was significantly increased, but LvTGI was significantly decreased in LvTGI silenced shrimp

  17. Genotype-Specific Regulation of Oral Innate Immunity by T2R38 Taste Receptor

    Science.gov (United States)

    Gil, Sucheol; Coldwell, Susan; Drury, Jeanie L.; Arroyo, Fabiola; Phi, Tran; Saadat, Sanaz; Kwong, Danny; Chung, Whasun Oh

    2015-01-01

    The bitter taste receptor T2R38 has been shown to regulate mucosal innate immune responses in the upper airway epithelium. Furthermore, SNPs in T2R38 influence the sensitivity to 6-n-propylthiouracil (PROP) and are associated with caries risk/protection. However, no study has been reported on the role of T2R38 in the innate immune responses to oral bacteria. We hypothesize that T2R38 regulates oral innate immunity and that this regulation is genotype-specific. Primary gingival epithelial cells carrying three common genotypes, PAV/PAV (PROP super-taster), AVI/PAV (intermediate) and AVI/AVI (non-taster) were stimulated with cariogenic bacteria Streptococcus mutans, periodontal pathogen Porphyromonas gingivalis or non-pathogen Fusobacterium nucleatum. QRT-PCR analyzed T2R38 mRNA, and T2R38-specific siRNA and ELISA were utilized to evaluate induction of hBD-2 (antimicrobial peptide), IL-1α and IL-8 in various donor-lines. Experiments were set up in duplicate and repeated three times. T2R38 mRNA induction in response to S. mutans was highest in PAV/PAV (4.3-fold above the unstimulated controls; p<0.05), while lowest in AVI/AVI (1.2-fold). In PAV/PAV, hBD-2 secretion in response to S. mutans was decreased by 77% when T2R38 was silenced. IL-1α secretion was higher in PAV/PAV compared to AVI/PAV or AVI/AVI with S. mutans stimulation, but it was reduced by half when T2R38 was silenced (p<0.05). In response to P. gingivalis, AVI/AVI showed 4.4-fold increase (p<0.05) in T2R38 expression, whereas the levels in PAV/PAV and AVI/PAV remained close to that of the controls. Secretion levels of IL-1α and IL-8 decreased in AVI/AVI in response to P. gingivalis when T2R38 was silenced (p<0.05), while the changes were not significant in PAV/PAV. Our data suggest that the regulation of gingival innate immunity by T2R38 is genotype-dependent and that the ability to induce a high level of hBD-2 by PAV/PAV carriers may be a reason for protection against caries in this group. PMID

  18. Trauma-Induced Heterotopic Ossification Regulates the Blood-Nerve Barrier

    Directory of Open Access Journals (Sweden)

    Zbigniew Gugala

    2018-06-01

    Full Text Available De novo bone formation can occur in soft tissues as a result of traumatic injury. This process, known as heterotopic ossification (HO, has recently been linked to the peripheral nervous system. Studies suggest that HO may resemble neural crest-derived bone formation and is activated through the release of key bone matrix proteins leading to opening of the blood-nerve barrier (BNB. One of the first steps in this process is the activation of a neuro-inflammatory cascade, which results in migration of chondro-osseous progenitors, and other cells from both the endoneurial and perineurial regions of the peripheral nerves. The perineurial cells undergo brown adipogenesis, to form essential support cells, which regulate expression and activation of matrix metallopeptidase 9 (MMP9 an essential regulatory protein involved in opening the BNB. However, recent studies suggest that, in mice, a key bone matrix protein, bone morphogenetic protein 2 (BMP2 is able to immediately cross the BNB to activate signaling in specific cells within the endoneurial compartment. BMP signaling correlates with bone formation and appears critical for the induction of HO. Surprisingly, several other bone matrix proteins have also been reported to regulate the BNB, leading us to question whether these matrix proteins are important in regulating the BNB. However, this temporary regulation of the BNB does not appear to result in degeneration of the peripheral nerve, but rather may represent one of the first steps in innervation of the newly forming bone.

  19. Evidence of a Redox-Dependent Regulation of Immune Responses to Exercise-Induced Inflammation

    Directory of Open Access Journals (Sweden)

    Alexandra Sakelliou

    2016-01-01

    Full Text Available We used thiol-based antioxidant supplementation (n-acetylcysteine, NAC to determine whether immune mobilisation following skeletal muscle microtrauma induced by exercise is redox-sensitive in healthy humans. According to a two-trial, double-blind, crossover, repeated measures design, 10 young men received either placebo or NAC (20 mg/kg/day immediately after a muscle-damaging exercise protocol (300 eccentric contractions and for eight consecutive days. Blood sampling and performance assessments were performed before exercise, after exercise, and daily throughout recovery. NAC reduced the decline of reduced glutathione in erythrocytes and the increase of plasma protein carbonyls, serum TAC and erythrocyte oxidized glutathione, and TBARS and catalase activity during recovery thereby altering postexercise redox status. The rise of muscle damage and inflammatory markers (muscle strength, creatine kinase activity, CRP, proinflammatory cytokines, and adhesion molecules was less pronounced in NAC during the first phase of recovery. The rise of leukocyte and neutrophil count was decreased by NAC after exercise. Results on immune cell subpopulations obtained by flow cytometry indicated that NAC ingestion reduced the exercise-induced rise of total macrophages, HLA+ macrophages, and 11B+ macrophages and abolished the exercise-induced upregulation of B lymphocytes. Natural killer cells declined only in PLA immediately after exercise. These results indicate that thiol-based antioxidant supplementation blunts immune cell mobilisation in response to exercise-induced inflammation suggesting that leukocyte mobilization may be under redox-dependent regulation.

  20. dOCRL maintains immune cell quiescence by regulating endosomal traffic.

    Directory of Open Access Journals (Sweden)

    Steven J Del Signore

    2017-10-01

    Full Text Available Lowe Syndrome is a developmental disorder characterized by eye, kidney, and neurological pathologies, and is caused by mutations in the phosphatidylinositol-5-phosphatase OCRL. OCRL plays diverse roles in endocytic and endolysosomal trafficking, cytokinesis, and ciliogenesis, but it is unclear which of these cellular functions underlie specific patient symptoms. Here, we show that mutation of Drosophila OCRL causes cell-autonomous activation of hemocytes, which are macrophage-like cells of the innate immune system. Among many cell biological defects that we identified in docrl mutant hemocytes, we pinpointed the cause of innate immune cell activation to reduced Rab11-dependent recycling traffic and concomitantly increased Rab7-dependent late endosome traffic. Loss of docrl amplifies multiple immune-relevant signals, including Toll, Jun kinase, and STAT, and leads to Rab11-sensitive mis-sorting and excessive secretion of the Toll ligand Spåtzle. Thus, docrl regulation of endosomal traffic maintains hemocytes in a poised, but quiescent state, suggesting mechanisms by which endosomal misregulation of signaling may contribute to symptoms of Lowe syndrome.

  1. RNase L Interacts with Filamin A To Regulate Actin Dynamics and Barrier Function for Viral Entry

    Science.gov (United States)

    Siddiqui, Mohammad Adnan; Dayal, Shubham; Naji, Merna; Ezelle, Heather J.; Zeng, Chun; Zhou, Aimin; Hassel, Bret A.

    2014-01-01

    ABSTRACT The actin cytoskeleton and its network of associated proteins constitute a physical barrier that viruses must circumvent to gain entry into cells for productive infection. The mechanisms by which the physical signals of infection are sensed by the host to activate an innate immune response are not well understood. The antiviral endoribonuclease RNase L is ubiquitously expressed in a latent form and activated upon binding 2-5A, a unique oligoadenylate produced during viral infections. We provide evidence that RNase L in its inactive form interacts with the actin-binding protein Filamin A to modulate the actin cytoskeleton and inhibit virus entry. Cells lacking either RNase L or Filamin A displayed increased virus entry which was exacerbated in cells lacking both proteins. RNase L deletion mutants that reduced Filamin A interaction displayed a compromised ability to restrict virus entry, supporting the idea of an important role for the RNase L-Filamin A complex in barrier function. Remarkably, both the wild type and a catalytically inactive RNase L mutant were competent to reduce virus entry when transfected into RNase L-deficient cells, indicating that this novel function of RNase L is independent of its enzymatic activity. Virus infection and RNase L activation disrupt its association with Filamin A and release RNase L to mediate its canonical nuclease-dependent antiviral activities. The dual functions of RNase L as a constitutive component of the actin cytoskeleton and as an induced mediator of antiviral signaling and effector functions provide insights into its mechanisms of antiviral activity and opportunities for the development of novel antiviral agents. PMID:25352621

  2. Interchromosomal Transfer of Immune Regulation During Infection of Barley with the Powdery Mildew Pathogen

    Directory of Open Access Journals (Sweden)

    Priyanka Surana

    2017-10-01

    Full Text Available Powdery mildew pathogens colonize over 9500 plant species, causing critical yield loss. The Ascomycete fungus, Blumeria graminis f. sp. hordei (Bgh, causes powdery mildew disease in barley (Hordeum vulgare L.. Successful infection begins with penetration of host epidermal cells, culminating in haustorial feeding structures, facilitating delivery of fungal effectors to the plant and exchange of nutrients from host to pathogen. We used expression Quantitative Trait Locus (eQTL analysis to dissect the temporal control of immunity-associated gene expression in a doubled haploid barley population challenged with Bgh. Two highly significant regions possessing trans eQTL were identified near the telomeric ends of chromosomes (Chr 2HL and 1HS. Within these regions reside diverse resistance loci derived from barley landrace H. laevigatum (MlLa and H. vulgare cv. Algerian (Mla1, which associate with the altered expression of 961 and 3296 genes during fungal penetration of the host and haustorial development, respectively. Regulatory control of transcript levels for 299 of the 961 genes is reprioritized from MlLa on 2HL to Mla1 on 1HS as infection progresses, with 292 of the 299 alternating the allele responsible for higher expression, including Adaptin Protein-2 subunit μ AP2M and Vesicle Associated Membrane Protein VAMP72 subfamily members VAMP721/722. AP2M mediates effector-triggered immunity (ETI via endocytosis of plasma membrane receptor components. VAMP721/722 and SNAP33 form a Soluble N-ethylmaleimide-sensitive factor Attachment Protein REceptor (SNARE complex with SYP121 (PEN1, which is engaged in pathogen associated molecular pattern (PAMP-triggered immunity via exocytosis. We postulate that genes regulated by alternate chromosomal positions are repurposed as part of a conserved immune complex to respond to different pathogen attack scenarios.

  3. Interchromosomal Transfer of Immune Regulation During Infection of Barley with the Powdery Mildew Pathogen

    Science.gov (United States)

    Surana, Priyanka; Xu, Ruo; Fuerst, Gregory; Chapman, Antony V. E.; Nettleton, Dan; Wise, Roger P.

    2017-01-01

    Powdery mildew pathogens colonize over 9500 plant species, causing critical yield loss. The Ascomycete fungus, Blumeria graminis f. sp. hordei (Bgh), causes powdery mildew disease in barley (Hordeum vulgare L.). Successful infection begins with penetration of host epidermal cells, culminating in haustorial feeding structures, facilitating delivery of fungal effectors to the plant and exchange of nutrients from host to pathogen. We used expression Quantitative Trait Locus (eQTL) analysis to dissect the temporal control of immunity-associated gene expression in a doubled haploid barley population challenged with Bgh. Two highly significant regions possessing trans eQTL were identified near the telomeric ends of chromosomes (Chr) 2HL and 1HS. Within these regions reside diverse resistance loci derived from barley landrace H. laevigatum (MlLa) and H. vulgare cv. Algerian (Mla1), which associate with the altered expression of 961 and 3296 genes during fungal penetration of the host and haustorial development, respectively. Regulatory control of transcript levels for 299 of the 961 genes is reprioritized from MlLa on 2HL to Mla1 on 1HS as infection progresses, with 292 of the 299 alternating the allele responsible for higher expression, including Adaptin Protein-2 subunit μ AP2M and Vesicle Associated Membrane Protein VAMP72 subfamily members VAMP721/722. AP2M mediates effector-triggered immunity (ETI) via endocytosis of plasma membrane receptor components. VAMP721/722 and SNAP33 form a Soluble N-ethylmaleimide-sensitive factor Attachment Protein REceptor (SNARE) complex with SYP121 (PEN1), which is engaged in pathogen associated molecular pattern (PAMP)-triggered immunity via exocytosis. We postulate that genes regulated by alternate chromosomal positions are repurposed as part of a conserved immune complex to respond to different pathogen attack scenarios. PMID:28790145

  4. Immunological regulation of metabolism--a novel quintessential role for the immune system in health and disease.

    Science.gov (United States)

    Schaefer, Jeremy S; Klein, John R

    2011-01-01

    The hypothalamus-pituitary-thyroid (HPT) axis is an integrated hormone network that is essential for maintaining metabolic homeostasis. It has long been known that thyroid stimulating hormone (TSH), a central component of the HPT axis, can be made by cells of the immune system; however, the role of immune system TSH remains enigmatic and most studies have viewed it as a cytokine used to regulate immune function. Recent studies now indicate that immune system-derived TSH, in particular, a splice variant of TSHβ that is preferentially made by cells of the immune system, is produced by a subset of hematopoietic cells that traffic to the thyroid. On the basis of these and other findings, we propose the novel hypothesis that the immune system is an active participant in the regulation of basal metabolism. We further speculate that this process plays a critical role during acute and chronic infections and that it contributes to a wide range of chronic inflammatory conditions with links to thyroid dysregulation. This hypothesis, which is amenable to empirical analysis, defines a previously unknown role for the immune system in health and disease, and it provides a dynamic connection between immune-endocrine interactions at the organismic level.

  5. Regulation of NO synthesis, local inflammation, and innate immunity to pathogens by BET family proteins.

    Science.gov (United States)

    Wienerroither, Sebastian; Rauch, Isabella; Rosebrock, Felix; Jamieson, Amanda M; Bradner, James; Muhar, Matthias; Zuber, Johannes; Müller, Mathias; Decker, Thomas

    2014-02-01

    Transcriptional activation of the Nos2 gene, encoding inducible nitric oxide synthase (iNOS), during infection or inflammation requires coordinate assembly of an initiation complex by the transcription factors NF-κB and type I interferon-activated ISGF3. Here we show that infection of macrophages with the intracellular bacterial pathogen Listeria monocytogenes caused binding of the BET proteins Brd2, Brd3, and, most prominently, Brd4 to the Nos2 promoter and that a profound reduction of Nos2 expression occurred in the presence of the BET inhibitor JQ1. RNA polymerase activity at the Nos2 gene was regulated through Brd-mediated C-terminal domain (CTD) phosphorylation at serine 5. Underscoring the critical importance of Brd for the regulation of immune responses, application of JQ1 reduced NO production in mice infected with L. monocytogenes, as well as innate resistance to L. monocytogenes and influenza virus. In a murine model of inflammatory disease, JQ1 treatment increased the colitogenic activity of dextran sodium sulfate (DSS). The data presented in our study suggest that BET protein inhibition in a clinical setting poses the risk of altering the innate immune response to infectious or inflammatory challenge.

  6. Bim: guardian of tissue homeostasis and critical regulator of the immune system, tumorigenesis and bone biology.

    Science.gov (United States)

    Akiyama, Toru; Tanaka, Sakae

    2011-08-01

    One of the most important roles of apoptosis is the maintenance of tissue homeostasis. Impairment of apoptosis leads to a number of pathological conditions. In response to apoptotic signals, various proteins are activated in a pathway and signal-specific manner. Recently, the pro-apoptotic molecule Bim has attracted increasing attention as a pivotal regulator of tissue homeostasis. The Bim expression level is strictly controlled in both transcriptional and post-transcriptional levels. This control is dependent on cell, tissue and apoptotic stimuli. The phenotype of Bim-deficient mice is a systemic lupus erythematosus-like autoimmune disease with an abnormal accumulation of hematopoietic cells. Bim is thus a critical regulator of hematopoietic cells and immune system. Further studies have revealed the critical roles of Bim in various normal and pathological conditions, including bone homeostasis and tumorigenesis. The current understanding of Bim signaling and roles in the maintenance of tissue homeostasis is reviewed in this paper, focusing on the immune system, bone biology and tumorigenesis to illustrate the diversified role of Bim.

  7. IAPs Regulate Distinct Innate Immune Pathways to Co-ordinate the Response to Bacterial Peptidoglycans.

    Science.gov (United States)

    Stafford, Che A; Lawlor, Kate E; Heim, Valentin J; Bankovacki, Aleksandra; Bernardini, Jonathan P; Silke, John; Nachbur, Ueli

    2018-02-06

    Inhibitors of apoptosis (IAPs) proteins are critical regulators of innate immune signaling pathways and therefore have potential as drug targets. X-linked IAP (XIAP) and cellular IAP1 and IAP2 (cIAP1 and cIAP2) are E3 ligases that have been shown to be required for signaling downstream of NOD2, an intracellular receptor for bacterial peptidoglycan. We used genetic and biochemical approaches to compare the responses of IAP-deficient mice and cells to NOD2 stimulation. In all cell types tested, XIAP is the only IAP required for signaling immediately downstream of NOD2, while cIAP1 and cIAP2 are dispensable for NOD2-induced nuclear factor κB (NF-κB) and mitogen-activated protein kinase (MAPK) activation. However, mice lacking cIAP1 or TNFR1 have a blunted cytokine response to NOD2 stimulation. We conclude that cIAPs regulate NOD2-dependent autocrine TNF signaling in vivo and highlight the importance of physiological context in the interplay of innate immune signaling pathways. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  8. Shrimp miRNAs regulate innate immune response against white spot syndrome virus infection.

    Science.gov (United States)

    Kaewkascholkul, Napol; Somboonviwat, Kulwadee; Asakawa, Shuichi; Hirono, Ikuo; Tassanakajon, Anchalee; Somboonwiwat, Kunlaya

    2016-07-01

    MicroRNAs are short noncoding RNAs of RNA interference pathways that regulate gene expression through partial complementary base-pairing to target mRNAs. In this study, miRNAs that are expressed in white spot syndrome virus (WSSV)-infected Penaeus monodon, were identified using next generation sequencing. Forty-six miRNA homologs were identified from WSSV-infected shrimp hemocyte. Stem-loop real-time RT-PCR analysis showed that 11 out of 16 selected miRNAs were differentially expressed upon WSSV infection. Of those, pmo-miR-315 and pmo-miR-750 were highly responsive miRNAs. miRNA target prediction revealed that the miRNAs were targeted at 5'UTR, ORF, and 3'UTR of several immune-related genes such as genes encoding antimicrobial peptides, signaling transduction proteins, heat shock proteins, oxidative stress proteins, proteinases or proteinase inhibitors, proteins in blood clotting system, apoptosis-related proteins, proteins in prophenoloxidase system, pattern recognition proteins and other immune molecules. The highly conserved miRNA homolog, pmo-bantam, was characterized for its function in shrimp. The pmo-bantam was predicted to target the 3'UTR of Kunitz-type serine protease inhibitor (KuSPI). Binding of pmo-bantam to the target sequence of KuSPI gene was analyzed by luciferase reporter assay. Correlation of pmo-bantam and KuSPI expression was observed in lymphoid organ of WSSV-infected shrimp. These results implied that miRNAs might play roles as immune gene regulators in shrimp antiviral response. Copyright © 2016. Published by Elsevier Ltd.

  9. HIC1 links retinoic acid signalling to group 3 innate lymphoid cell-dependent regulation of intestinal immunity and homeostasis

    Science.gov (United States)

    Antignano, Frann; Korinek, Vladimir; Underhill, T. Michael

    2018-01-01

    The intestinal immune system must be able to respond to a wide variety of infectious organisms while maintaining tolerance to non-pathogenic microbes and food antigens. The Vitamin A metabolite all-trans-retinoic acid (atRA) has been implicated in the regulation of this balance, partially by regulating innate lymphoid cell (ILC) responses in the intestine. However, the molecular mechanisms of atRA-dependent intestinal immunity and homeostasis remain elusive. Here we define a role for the transcriptional repressor Hypermethylated in cancer 1 (HIC1, ZBTB29) in the regulation of ILC responses in the intestine. Intestinal ILCs express HIC1 in a vitamin A-dependent manner. In the absence of HIC1, group 3 ILCs (ILC3s) that produce IL-22 are lost, resulting in increased susceptibility to infection with the bacterial pathogen Citrobacter rodentium. Thus, atRA-dependent expression of HIC1 in ILC3s regulates intestinal homeostasis and protective immunity. PMID:29470558

  10. MicroRNA-147b regulates vascular endothelial barrier function by targeting ADAM15 expression.

    Directory of Open Access Journals (Sweden)

    Victor Chatterjee

    Full Text Available A disintegrin and metalloproteinase15 (ADAM15 has been shown to be upregulated and mediate endothelial hyperpermeability during inflammation and sepsis. This molecule contains multiple functional domains with the ability to modulate diverse cellular processes including cell adhesion, extracellular matrix degradation, and ectodomain shedding of transmembrane proteins. These characteristics make ADAM15 an attractive therapeutic target in various diseases. The lack of pharmacological inhibitors specific to ADAM15 prompted our efforts to identify biological or molecular tools to alter its expression for further studying its function and therapeutic implications. The goal of this study was to determine if ADAM15-targeting microRNAs altered ADAM15-induced endothelial barrier dysfunction during septic challenge by bacterial lipopolysaccharide (LPS. An in silico analysis followed by luciferase reporter assay in human vascular endothelial cells identified miR-147b with the ability to target the 3' UTR of ADAM15. Transfection with a miR-147b mimic led to decreased total, as well as cell surface expression of ADAM15 in endothelial cells, while miR-147b antagomir produced an opposite effect. Functionally, LPS-induced endothelial barrier dysfunction, evidenced by a reduction in transendothelial electric resistance and increase in albumin flux across endothelial monolayers, was attenuated in cells treated with miR-147b mimics. In contrast, miR-147b antagomir exerted a permeability-increasing effect in vascular endothelial cells similar to that caused by LPS. Taken together, these data suggest the potential role of miR147b in regulating endothelial barrier function by targeting ADAM15 expression.

  11. Influence of intestinal early enteral nutrition therapy on intestinal barrier function and immune response of patients with radiation enteritis

    International Nuclear Information System (INIS)

    Liu Guohui; Kang Xin; Chen Gong; Wang Guangyi

    2012-01-01

    Objective: To investigate the influence of early enteral nutrition therapy on the intestinal barrier function and immune response of the patients with radiation enteritis (ER) so as to find a relatively simple and effective method to treat RE. Methods: Fifty-six patients with radiation enteritis (RE) diagnosed by colonoscopy, X-rays, and pathology were randomly divided into 2 equal groups: experimental group undergoing enteral nutrition therapy, and control group undergoing conventional therapy only. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Five cases from the experimental group and 5 cases from the control group underwent second-time operation because of incomplete intestinal obstruction, intestinal stenosis, or recurrent tumor respectively. The biopsy specimens of the terminal ileum or distal descending colon taken during the first and second operations underwent pathological examination. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Results: There were no significant differences in the intestinal function and blood immunological indices between these 2 groups. The levels of DAO, D-lactic acid, and endotoxin,and the L/M ratio 11 days after admission of the experiment group were all significantly lower than those of the control group (t=2.568, 2.427, 2.143, 2.443, P<0.05), and all those indices 21 days after admission of the experiment group were all much more significantly lower in comparison with the control group (t=6.019, 12.834, 7.837, 7.997, P<0.01). The levels of IgG, IgM, and IgA, and CD4/CD8 ratio 11 days after admission of the experimental group were all significantly higher than

  12. Elsevier Trophoblast Research Award Lecture: Unique properties of decidual T cells and their role in immune regulation during human pregnancy.

    Science.gov (United States)

    Tilburgs, T; Claas, F H J; Scherjon, S A

    2010-03-01

    Maternal lymphocytes at the fetal-maternal interface play a key role in the immune acceptance of the allogeneic fetus. Most studies focus on decidual NK cells and their interaction with fetal trophoblasts, whereas limited data are available on the mechanisms of fetus specific immune recognition and immune regulation by decidual T cells at the fetal-maternal interface. The aim of this review is to describe the phenotypic characteristics of decidual T cell subsets present at the fetal-maternal interface, their interaction with HLA-C expressed by fetal trophoblasts and their role in immune recognition and regulation at the fetal-maternal interface during human pregnancy. Copyright 2010 Elsevier Ltd. All rights reserved.

  13. Regulation of Mucosal Immune Responses – The Missing Link in IBD?

    Directory of Open Access Journals (Sweden)

    Charles O Elson

    1996-01-01

    Full Text Available Although the etiology of inflammatory bowel disease (IBD remains unknown, a major working hypothesis is that it represents a dysregulated immune response to common enteric bacterial antigens. Until recently there has been a relative dearth of experimental models to study this hypothesis. However, exciting developments in experimental models of colitis, including spontaneous, transgenic and knockout mice, now allow this and other hypotheses to be tested. The regulation of mucosal immune responses is not well understood in the normal animal, much less in those with chronic intestinal inflammation. Clearly the CD4 Th1 and Th2 pathways are important in the host response to microbial pathogens, and recent data indicate that the intestinal mucosa seems to be a site of preferential Th2 responses toward exogenous antigens. Deletion of certain cytokine genes involved in maintaining this Th1/Th2 balance (interleukin [IL]-2, IL-10 resulted in colitis, although deletion of others (IL-4, interferon-gamma that are also involved did not. Whether these cytokine gene deletions cause a dysregulation of the mucosal immune response has yet to be shown. However, the importance of regulation can be demonstrated in a model in which a normal CD4+ T cell subset (CD45Rbhigh is transferred into syngeneic severe combined immunodeficiency syndrome recipients. This results in a striking colitis over the ensuing weeks with chronic diarrhea and wasting of the animals. If the reciprocal CD4+ subset (CD45Rblow is co-transferred or if whole CD4+ T cells are transferred no colitis ensues. Therefore, T cells capable of causing colitis are present in normal animals but are prevented from doing so by immunoregulatory mechanisms. The antigens that drive the colitis in several of these models (IL-2 knockout mouse, human leukocyte antigen B27/β2M transgenic rat appear to be those of the normal enteric bacterial flora because germ-free animals do not get the disease. Spontaneously

  14. A novel role for adiponectin in regulating the immune responses in chronic hepatitis C virus infection.

    Science.gov (United States)

    Palmer, Clovis; Hampartzoumian, Taline; Lloyd, Andrew; Zekry, Amany

    2008-08-01

    Adipose tissue releases pro-inflammatory and anti-inflammatory mediators, including adiponectin, which elicit a broad range of metabolic and immunological effects. The study aim was to determine in subjects infected with chronic hepatitis C virus (HCV) the effects of total adiponectin and its high-molecular-weight (HMW) and low-molecular-weight isoforms on HCV-specific immune responses. Serum levels of total adiponectin and its isoforms were determined by immunoassay. The ex vivo effect of adiponectin on the HCV-specific T-cell response was examined by interferon gamma (IFN-gamma) enzyme-linked immunosorbent spot and enzyme-linked immunosorbent assay cytokine assays. The role of the mitogen-activated protein kinase (MAPK) signaling pathway in mediating the adiponectin effect on T cells was also evaluated. We found that serum levels of total and HMW adiponectin were significantly decreased in subjects with chronic HCV and increased body mass index (BMI) compared with HCV-infected lean subjects. The presence of an anti-HCV specific immune response was strongly associated with lower BMI (P = 0.004) and higher serum total (P = 0.01) and HMW (P = 0.02) adiponectin. In ex vivo assays, total adiponectin and the HMW adiponectin isoform enhanced HCV-specific IFN-gamma production (P = 0.02 and 0.03, respectively). Adiponectin-R1 receptors were expressed on T cells and monocytes. In depletion experiments, the IFN-gamma response to adiponectin was entirely dependent on the simultaneous presence of both CD4 and CD8 T cells, and to a lesser extent, natural killer cells. Selective inhibition of p38MAPK activity by SB203580 abrogated the IFN-gamma response to adiponectin, whereas extracellular signal-regulated kinase 1/2 inhibition by PD98059 did not affect the response. In chronic HCV, a reciprocal association exists between BMI, adiponectin, and the anti-HCV immune responses, emphasizing the important role played by adiposity in regulating the immune response in HCV infection.

  15. Endothelial Regulator of Calcineurin 1 Promotes Barrier Integrity and Modulates Histamine-Induced Barrier Dysfunction in Anaphylaxis

    DEFF Research Database (Denmark)

    Ballesteros-Martinez, Constanza; Mendez-Barbero, Nerea; Montalvo-Yuste, Alma

    2017-01-01

    Anaphylaxis, the most serious and life-threatening allergic reaction, produces the release of inflammatory mediators by mast cells and basophils. Regulator of calcineurin 1 (Rcan1) is a negative regulator of mast-cell degranulation. The action of mediators leads to vasodilation and an increase in...

  16. Insight into the mechanisms regulating immune homeostasis in health and disease.

    Science.gov (United States)

    Sirisinha, Stitaya

    2011-03-01

    Innate and adaptive immune systems consist of cells and molecules that work together in concert to fight against microbial infection and maintain homeostasis. Hosts encounter microbes / exogenous pathogen-associated molecular patterns (PAMPs) and endogenous damage-associated molecular patterns (DAMPs) all the time and they must have proper mechanisms to counteract the danger such that appropriate responses (e.g., degree of inflammation and types of mediators induced) can be mounted in different scenarios. Increasing numbers of endogenous danger signals of host origin are being identified including, for example, uric acid and cholesterol crystals, high mobility group box1 (HMGB1) protein, oxidized LDL, vesicans, heat shock proteins (HSPs) and self DNA. Many of these endogenous ligands have been shown to be associated with inflammation-related diseases like atherosclerosis, gout and type 2 diabetes. Several DAMPs appear to have the ability to interact with more than one receptor. We are now beginning to understand how the immune system can distinguish infection from endogenous ligands elaborated following cellular insults and tissue damage. Appropriate responses to maintain the homeostatic state in health and disease depend largely on the recognition and response to these stimuli by germline encoded pattern-recognition receptors (PRRs) present on both immune and non-immune cells. These receptors are, for example, Toll-like receptors (TLRs), C-type lectin receptors (CLRs) and cytosolic receptors (e.g., RLRs, NLRs and some intracellular DNA sensors). Atypical PRR "danger" receptors, like the receptor for advanced glycation end products (RAGE) and their ligands have been identified. A proper response to maintain homeostasis relies on specific negative regulators and regulatory pathways to dampen its response to tissue injury while maintaining the capacity to eliminate infection and induce proper tissue repair. Moreover, some PRRs (e.g., TLR2,TLR4 and NLRP3) and atypical

  17. Role of ion channels in regulating Ca²⁺ homeostasis during the interplay between immune and cancer cells.

    Science.gov (United States)

    Bose, T; Cieślar-Pobuda, A; Wiechec, E

    2015-02-19

    Ion channels are abundantly expressed in both excitable and non-excitable cells, thereby regulating the Ca(2+) influx and downstream signaling pathways of physiological processes. The immune system is specialized in the process of cancer cell recognition and elimination, and is regulated by different ion channels. In comparison with the immune cells, ion channels behave differently in cancer cells by making the tumor cells more hyperpolarized and influence cancer cell proliferation and metastasis. Therefore, ion channels comprise an important therapeutic target in anti-cancer treatment. In this review, we discuss the implication of ion channels in regulation of Ca(2+) homeostasis during the crosstalk between immune and cancer cell as well as their role in cancer progression.

  18. The Arabidopsis homolog of human G3BP1 is a key regulator of stomatal and apoplastic immunity

    KAUST Repository

    Abulfaraj, Aala A.; Mariappan, Kiruthiga; Bigeard, Jean; Manickam, Prabhu; Blilou, Ikram; Guo, Xiujie; Al-Babili, Salim; Pflieger, Delphine; Hirt, Heribert; Rayapuram, Naganand

    2018-01-01

    Mammalian Ras-GTPase–activating protein SH3-domain–binding proteins (G3BPs) are a highly conserved family of RNA-binding proteins that link kinase receptor-mediated signaling to RNA metabolism. Mammalian G3BP1 is a multifunctional protein that functions in viral immunity. Here, we show that the Arabidopsis thaliana homolog of human G3BP1 negatively regulates plant immunity. Arabidopsis g3bp1 mutants showed enhanced resistance to the virulent bacterial pathogen Pseudomonas syringae pv. tomato. Pathogen resistance was mediated in Atg3bp1 mutants by altered stomatal and apoplastic immunity. Atg3bp1 mutants restricted pathogen entry into stomates showing insensitivity to bacterial coronatine–mediated stomatal reopening. AtG3BP1 was identified as a negative regulator of defense responses, which correlated with moderate up-regulation of salicylic acid biosynthesis and signaling without growth penalty.

  19. The Arabidopsis homolog of human G3BP1 is a key regulator of stomatal and apoplastic immunity

    KAUST Repository

    Abulfaraj, Aala Abdulaziz Hussien

    2018-05-31

    Mammalian Ras-GTPase–activating protein SH3-domain–binding proteins (G3BPs) are a highly conserved family of RNA-binding proteins that link kinase receptor-mediated signaling to RNA metabolism. Mammalian G3BP1 is a multifunctional protein that functions in viral immunity. Here, we show that the Arabidopsis thaliana homolog of human G3BP1 negatively regulates plant immunity. Arabidopsis g3bp1 mutants showed enhanced resistance to the virulent bacterial pathogen Pseudomonas syringae pv. tomato. Pathogen resistance was mediated in Atg3bp1 mutants by altered stomatal and apoplastic immunity. Atg3bp1 mutants restricted pathogen entry into stomates showing insensitivity to bacterial coronatine–mediated stomatal reopening. AtG3BP1 was identified as a negative regulator of defense responses, which correlated with moderate up-regulation of salicylic acid biosynthesis and signaling without growth penalty.

  20. Interactions between host metabolism, immune regulation, and the gut microbiota in diet-associated obesity and metabolic dysfunction

    DEFF Research Database (Denmark)

    Andersen, Daniel

    The increase in the prevalence of obesity and obesity-associated complications such as the metabolic syndrome is becoming a global challenge. Dietary habits and nutrient consumption modulates host homeostasis, which manifests in various diet-induced complications marked by changes in host...... metabolism and immune regulation, which are intricately linked. In addition, diet effectively shapes the gut microbiota composition and activity, which in turn interacts with the host to modulate host metabolism and immune regulation. In the three studies included in this PhD thesis, we have explored...... the impact of specific dietary components on host metabolic function, immune regulation and gut microbiota composition and activity. In the first study, we have characterized the effect of a combined high-fat and gliadin-rich diet, since dietary gliadin has been reported to be associated with intestinal...

  1. The short isoform of the CEACAM1 receptor in intestinal T cells regulates mucosal immunity and homeostasis via Tfh cell induction.

    Science.gov (United States)

    Chen, Lanfen; Chen, Zhangguo; Baker, Kristi; Halvorsen, Elizabeth M; da Cunha, Andre Pires; Flak, Magdalena B; Gerber, Georg; Huang, Yu-Hwa; Hosomi, Shuhei; Arthur, Janelle C; Dery, Ken J; Nagaishi, Takashi; Beauchemin, Nicole; Holmes, Kathryn V; Ho, Joshua W K; Shively, John E; Jobin, Christian; Onderdonk, Andrew B; Bry, Lynn; Weiner, Howard L; Higgins, Darren E; Blumberg, Richard S

    2012-11-16

    Carcinoembryonic antigen cell adhesion molecule like I (CEACAM1) is expressed on activated T cells and signals through either a long (L) cytoplasmic tail containing immune receptor tyrosine based inhibitory motifs, which provide inhibitory function, or a short (S) cytoplasmic tail with an unknown role. Previous studies on peripheral T cells show that CEACAM1-L isoforms predominate with little to no detectable CEACAM1-S isoforms in mouse and human. We show here that this was not the case in tissue resident T cells of intestines and gut associated lymphoid tissues, which demonstrated predominant expression of CEACAM1-S isoforms relative to CEACAM1-L isoforms in human and mouse. This tissue resident predominance of CEACAM1-S expression was determined by the intestinal environment where it served a stimulatory function leading to the regulation of T cell subsets associated with the generation of secretory IgA immunity, the regulation of mucosal commensalism, and defense of the barrier against enteropathogens. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Honey constituents up-regulate detoxification and immunity genes in the western honey bee Apis mellifera.

    Science.gov (United States)

    Mao, Wenfu; Schuler, Mary A; Berenbaum, May R

    2013-05-28

    As a managed pollinator, the honey bee Apis mellifera is critical to the American agricultural enterprise. Recent colony losses have thus raised concerns; possible explanations for bee decline include nutritional deficiencies and exposures to pesticides and pathogens. We determined that constituents found in honey, including p-coumaric acid, pinocembrin, and pinobanksin 5-methyl ether, specifically induce detoxification genes. These inducers are primarily found not in nectar but in pollen in the case of p-coumaric acid (a monomer of sporopollenin, the principal constituent of pollen cell walls) and propolis, a resinous material gathered and processed by bees to line wax cells. RNA-seq analysis (massively parallel RNA sequencing) revealed that p-coumaric acid specifically up-regulates all classes of detoxification genes as well as select antimicrobial peptide genes. This up-regulation has functional significance in that that adding p-coumaric acid to a diet of sucrose increases midgut metabolism of coumaphos, a widely used in-hive acaricide, by ∼60%. As a major component of pollen grains, p-coumaric acid is ubiquitous in the natural diet of honey bees and may function as a nutraceutical regulating immune and detoxification processes. The widespread apicultural use of honey substitutes, including high-fructose corn syrup, may thus compromise the ability of honey bees to cope with pesticides and pathogens and contribute to colony losses.

  3. Solute Carrier NTCP Regulates Innate Antiviral Immune Responses Targeting Hepatitis C Virus Infection of Hepatocytes.

    Science.gov (United States)

    Verrier, Eloi R; Colpitts, Che C; Bach, Charlotte; Heydmann, Laura; Zona, Laetitia; Xiao, Fei; Thumann, Christine; Crouchet, Emilie; Gaudin, Raphaël; Sureau, Camille; Cosset, François-Loïc; McKeating, Jane A; Pessaux, Patrick; Hoshida, Yujin; Schuster, Catherine; Zeisel, Mirjam B; Baumert, Thomas F

    2016-10-25

    Chronic hepatitis B, C, and D virus (HBV, HCV, and HDV) infections are the leading causes of liver disease and cancer worldwide. Recently, the solute carrier and sodium taurocholate co-transporter NTCP has been identified as a receptor for HBV and HDV. Here, we uncover NTCP as a host factor regulating HCV infection. Using gain- and loss-of-function studies, we show that NTCP mediates HCV infection of hepatocytes and is relevant for cell-to-cell transmission. NTCP regulates HCV infection by augmenting the bile-acid-mediated repression of interferon-stimulated genes (ISGs), including IFITM3. In conclusion, our results uncover NTCP as a mediator of innate antiviral immune responses in the liver, and they establish a role for NTCP in the infection process of multiple viruses via distinct mechanisms. Collectively, our findings suggest a role for solute carriers in the regulation of innate antiviral responses, and they have potential implications for virus-host interactions and antiviral therapies. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  4. Solute Carrier NTCP Regulates Innate Antiviral Immune Responses Targeting Hepatitis C Virus Infection of Hepatocytes

    Directory of Open Access Journals (Sweden)

    Eloi R. Verrier

    2016-10-01

    Full Text Available Chronic hepatitis B, C, and D virus (HBV, HCV, and HDV infections are the leading causes of liver disease and cancer worldwide. Recently, the solute carrier and sodium taurocholate co-transporter NTCP has been identified as a receptor for HBV and HDV. Here, we uncover NTCP as a host factor regulating HCV infection. Using gain- and loss-of-function studies, we show that NTCP mediates HCV infection of hepatocytes and is relevant for cell-to-cell transmission. NTCP regulates HCV infection by augmenting the bile-acid-mediated repression of interferon-stimulated genes (ISGs, including IFITM3. In conclusion, our results uncover NTCP as a mediator of innate antiviral immune responses in the liver, and they establish a role for NTCP in the infection process of multiple viruses via distinct mechanisms. Collectively, our findings suggest a role for solute carriers in the regulation of innate antiviral responses, and they have potential implications for virus-host interactions and antiviral therapies.

  5. Oestrogen, an evolutionary conserved regulator of T cell differentiation and immune tolerance in jawed vertebrates?

    Science.gov (United States)

    Paiola, Matthieu; Knigge, Thomas; Duflot, Aurélie; Pinto, Patricia I S; Farcy, Emilie; Monsinjon, Tiphaine

    2018-07-01

    In teleosts, as in mammals, the immune system is tightly regulated by sexual steroid hormones, such as oestrogens. We investigated the effects of 17β-oestradiol on the expression of several genes related to T cell development and resulting T cell subpopulations in sea bass, Dicentrarchus labrax, for a primary lymphoid organ, the thymus, and two secondary lymphoid organs, the head-kidney and the spleen. In parallel, the oxidative burst capacity was assessed in leucocytes of the secondary lymphoid organs. Apoptosis- and proliferation-related genes, indicative of B and T cell clonal selection and lymphoid progenitor activity, were not affected by elevated oestrogen-levels. Sex-related oestrogen-responsiveness in T cell and antigen-presenting cell markers was observed, the expression of which was differentially induced by oestrogen-exposure in the three lymphoid organs. Remarkably, in the spleen, oestrogen increased regulatory T cell-related gene expression was associated with a decrease in oxidative burst capacity. To the best of our knowledge, this study indicates for the first time that physiological levels of oestrogen are likely to promote immune tolerance by modulating thymic function (i.e., T cell development and output) and peripheral T cells in teleosts, similar to previously reported oestrogenic effects in mammals. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Regulation of the Immune Response to α-Gal and Vector-borne Diseases.

    Science.gov (United States)

    Cabezas-Cruz, Alejandro; Mateos-Hernández, Lourdes; Pérez-Cruz, Magdiel; Valdés, James J; Mera, Isabel G Fernández de; Villar, Margarita; de la Fuente, José

    2015-10-01

    Vector-borne diseases (VBD) challenge our understanding of emerging diseases. Recently, arthropod vectors have been involved in emerging anaphylactic diseases. In particular, the immunoglobulin E (IgE) antibody response to the carbohydrate Galα1-3Galβ1-(3)4GlcNAc-R (α-gal) following a tick bite was associated with allergies to red meat, cetuximab, and gelatin. By contrast, an anti-α-gal IgM antibody response was shown to protect against mosquito-borne malaria. Herein, we highlight the interplay between the gut microbiota, vectors, transmitted pathogens, and the regulation of the immune response as a model to understand the protective or allergic effect of α-gal. Establishing the source of α-gal in arthropod vectors and the immune response to vector bites and transmitted pathogens will be essential for diagnosing, treating, and ultimately preventing these emerging anaphylactic and other vector-borne diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. A TNF-Regulated Recombinatorial Macrophage Immune Receptor Implicated in Granuloma Formation in Tuberculosis

    Science.gov (United States)

    Streich, Roswita; Breysach, Caroline; Raddatz, Dirk; Oniga, Septimia; Peccerella, Teresa; Findeisen, Peter; Kzhyshkowska, Julia; Gratchev, Alexei; Schweyer, Stefan; Saunders, Bernadette; Wessels, Johannes T.; Möbius, Wiebke; Keane, Joseph; Becker, Heinz; Ganser, Arnold; Neumaier, Michael; Kaminski, Wolfgang E.

    2011-01-01

    Macrophages play a central role in host defense against mycobacterial infection and anti- TNF therapy is associated with granuloma disorganization and reactivation of tuberculosis in humans. Here, we provide evidence for the presence of a T cell receptor (TCR) αβ based recombinatorial immune receptor in subpopulations of human and mouse monocytes and macrophages. In vitro, we find that the macrophage-TCRαβ induces the release of CCL2 and modulates phagocytosis. TNF blockade suppresses macrophage-TCRαβ expression. Infection of macrophages from healthy individuals with mycobacteria triggers formation of clusters that express restricted TCR Vβ repertoires. In vivo, TCRαβ bearing macrophages abundantly accumulate at the inner host-pathogen contact zone of caseous granulomas from patients with lung tuberculosis. In chimeric mouse models, deletion of the variable macrophage-TCRαβ or TNF is associated with structurally compromised granulomas of pulmonary tuberculosis even in the presence of intact T cells. These results uncover a TNF-regulated recombinatorial immune receptor in monocytes/macrophages and demonstrate its implication in granuloma formation in tuberculosis. PMID:22114556

  8. A TNF-regulated recombinatorial macrophage immune receptor implicated in granuloma formation in tuberculosis.

    Directory of Open Access Journals (Sweden)

    Alexander W Beham

    2011-11-01

    Full Text Available Macrophages play a central role in host defense against mycobacterial infection and anti- TNF therapy is associated with granuloma disorganization and reactivation of tuberculosis in humans. Here, we provide evidence for the presence of a T cell receptor (TCR αβ based recombinatorial immune receptor in subpopulations of human and mouse monocytes and macrophages. In vitro, we find that the macrophage-TCRαβ induces the release of CCL2 and modulates phagocytosis. TNF blockade suppresses macrophage-TCRαβ expression. Infection of macrophages from healthy individuals with mycobacteria triggers formation of clusters that express restricted TCR Vβ repertoires. In vivo, TCRαβ bearing macrophages abundantly accumulate at the inner host-pathogen contact zone of caseous granulomas from patients with lung tuberculosis. In chimeric mouse models, deletion of the variable macrophage-TCRαβ or TNF is associated with structurally compromised granulomas of pulmonary tuberculosis even in the presence of intact T cells. These results uncover a TNF-regulated recombinatorial immune receptor in monocytes/macrophages and demonstrate its implication in granuloma formation in tuberculosis.

  9. Extra-adrenal glucocorticoid synthesis: immune regulation and aspects on local organ homeostasis.

    Science.gov (United States)

    Talabér, Gergely; Jondal, Mikael; Okret, Sam

    2013-11-05

    Systemic glucocorticoids (GCs) mainly originate from de novo synthesis in the adrenal cortex under the control of the hypothalamus-pituitary-adrenal (HPA)-axis. However, research during the last 1-2 decades has revealed that additional organs express the necessary enzymes and have the capacity for de novo synthesis of biologically active GCs. This includes the thymus, intestine, skin and the brain. Recent research has also revealed that locally synthesized GCs most likely act in a paracrine or autocrine manner and have significant physiological roles in local homeostasis, cell development and immune cell activation. In this review, we summarize the nature, regulation and known physiological roles of extra-adrenal GC synthesis. We specifically focus on the thymus in which GC production (by both developing thymocytes and epithelial cells) has a role in the maintenance of proper immunological function. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  10. Circadian transcription factor BMAL1 regulates innate immunity against select RNA viruses.

    Science.gov (United States)

    Majumdar, Tanmay; Dhar, Jayeeta; Patel, Sonal; Kondratov, Roman; Barik, Sailen

    2017-02-01

    BMAL1 (brain and muscle ARNT-like protein 1, also known as MOP3 or ARNT3) belongs to the family of the basic helix-loop-helix (bHLH)-PAS domain-containing transcription factors, and is a key component of the molecular oscillator that generates circadian rhythms. Here, we report that BMAL1-deficient cells are significantly more susceptible to infection by two major respiratory viruses of the Paramyxoviridae family, namely RSV and PIV3. Embryonic fibroblasts from Bmal1 -/- mice produced nearly 10-fold more progeny virus than their wild type controls. These results were supported by animal studies whereby pulmonary infection of RSV produced a more severe disease and morbidity in Bmal1 -/- mice. These results show that BMAL1 can regulate cellular innate immunity against specific RNA viruses.

  11. Autoimmunity in Arabidopsis acd11 Is Mediated by Epigenetic Regulation of an Immune Receptor

    DEFF Research Database (Denmark)

    Palma, K.; Thorgrimsen, S.; Malinovsky, F.G.

    2010-01-01

    . In a screen for lazarus (laz) mutants that suppress acd11 death we identified two genes, LAZ2 and LAZ5. LAZ2 encodes the histone lysine methyltransferase SDG8, previously shown to epigenetically regulate flowering time via modification of histone 3 (H3). LAZ5 encodes an RPS4-like R-protein, defined by several...... dominant negative alleles. Microarray and chromatin immunoprecipitation analyses showed that LAZ2/SDG8 is required for LAZ5 expression and H3 lysine 36 trimethylation at LAZ5 chromatin to maintain a transcriptionally active state. We hypothesize that LAZ5 triggers cell death in the absence of ACD11......, and that cell death in other lesion mimic mutants may also be caused by inappropriate activation of R genes. Moreover, SDG8 is required for basal and R protein-mediated pathogen resistance in Arabidopsis, revealing the importance of chromatin remodeling as a key process in plant innate immunity....

  12. Innate immune responses: Crosstalk of signaling and regulation of gene transcription

    International Nuclear Information System (INIS)

    Zhong Bo; Tien Po; Shu Hongbing

    2006-01-01

    Innate immune responses to pathogens such as bacteria and viruses are triggered by recognition of specific structures of invading pathogens called pathogen-associated molecular patterns (PAMPs) by cellular pattern recognition receptors (PRRs) that are located at plasma membrane or inside cells. Stimulation of different PAMPs activates Toll-like receptor (TLR)-dependent and -independent signaling pathways that lead to activation of transcription factors nuclear factor-κB (NF-κB), interferon regulatory factor 3/7 (IRF3/7) and/or activator protein-1 (AP-1), which collaborate to induce transcription of a large number of downstream genes. This review focuses on the rapid progress that has recently improved our understanding of the crosstalk among the pathways and the precise regulation of transcription of the downstream genes

  13. Bacteria in the vaginal microbiome alter the innate immune response and barrier properties of the human vaginal epithelia in a species-specific manner.

    Science.gov (United States)

    Doerflinger, Sylvie Y; Throop, Andrea L; Herbst-Kralovetz, Melissa M

    2014-06-15

    Bacterial vaginosis increases the susceptibility to sexually transmitted infections and negatively affects women's reproductive health. To investigate host-vaginal microbiota interactions and the impact on immune barrier function, we colonized 3-dimensional (3-D) human vaginal epithelial cells with 2 predominant species of vaginal microbiota (Lactobacillus iners and Lactobacillus crispatus) or 2 prevalent bacteria associated with bacterial vaginosis (Atopobium vaginae and Prevotella bivia). Colonization of 3-D vaginal epithelial cell aggregates with vaginal microbiota was observed with direct attachment to host cell surface with no cytotoxicity. A. vaginae infection yielded increased expression membrane-associated mucins and evoked a robust proinflammatory, immune response in 3-D vaginal epithelial cells (ie, expression of CCL20, hBD-2, interleukin 1β, interleukin 6, interleukin 8, and tumor necrosis factor α) that can negatively affect barrier function. However, P. bivia and L. crispatus did not significantly upregulate pattern-recognition receptor-signaling, mucin expression, antimicrobial peptides/defensins, or proinflammatory cytokines in 3-D vaginal epithelial cell aggregates. Notably, L. iners induced pattern-recognition receptor-signaling activity, but no change was observed in mucin expression or secretion of interleukin 6 and interleukin 8. We identified unique species-specific immune signatures from vaginal epithelial cells elicited by colonization with commensal and bacterial vaginosis-associated bacteria. A. vaginae elicited a signature that is consistent with significant disruption of immune barrier properties, potentially resulting in enhanced susceptibility to sexually transmitted infections during bacterial vaginosis. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. Free Total Rhubarb Anthraquinones Protect Intestinal Injury via Regulation of the Intestinal Immune Response in a Rat Model of Severe Acute Pancreatitis

    Directory of Open Access Journals (Sweden)

    Yuxia Xiong

    2018-02-01

    Full Text Available Intestinal mucosal immune barrier dysfunction plays a key role in the pathogenesis of severe acute pancreatitis (SAP. Rhubarb is a commonly used traditional Chinese medicine as a laxative in China. It markedly protects pancreatic acinar cells from trypsin-induced injury in rats. Free total rhubarb anthraquinones (FTRAs isolated and extracted from rhubarb display the beneficial effects of antibacteria, anti-inflammation, antivirus, and anticancer. The principal aim of the present study was to investigate the effects of FTRAs on the protection of intestinal injury and modification of the intestinal barrier function through regulation of intestinal immune function in rats with SAP. We established a rat model of SAP by injecting 3.5% sodium taurocholate (STC, 350 mg/kg into the biliopancreatic duct via retrograde injection and treated the rats with FTRAs (36 or 72 mg/kg or normal saline (control immediately and 12 h after STC injection. Then, we evaluated the protective effect of FTRAs on intestinal injury by pathological analysis and determined the levels of endotoxin (ET, interleukin 1β (IL-1β, tumor necrosis factor α (TNF-α, nitric oxide (NO, myeloperoxidase (MPO, capillary permeability, nucleotide-binding oligomerization domain-like receptors 3 (NLRP3, apoptosis-associated speck-like protein containing a CARD domain (ASC, casepase-1, secretary immunoglobulin A (SIgA, regulatory T cells (Tregs, and the ratio of Th1/Th2 in the blood and/or small intestinal tissues or mesenteric lymph node (MLN cells. Moreover, the chemical profile of FTRAs was analyzed by HPLC-UV chromatogram. The results showed that FTRAs significantly protected intestinal damage and decreased the levels of ET, IL-1β, TNF-α, and NO in the blood and TNF-α, IL-1β, and protein extravasation in the intestinal tissues in SAP rats. Furthermore, FTRAs significantly decreased the expressions of NLRP3, ASC, and caspase-1, the number of Tregs and the ratio of Th1/Th2, while

  15. Spatio-temporal regulation of Hsp90-ligand complex leads to immune activation.

    Directory of Open Access Journals (Sweden)

    Yasuaki eTamura

    2016-05-01

    Full Text Available Hsp90 is the most abundant cytosolic HSP and is known to act as a molecular chaperone. We found that an Hsp90-cancer antigen peptide complex was efficiently cross-presented by human monocyte-derived dendritic cells and induced peptide-specific cytotoxic T lymphocytes. Furthermore, we observed that the internalized Hsp90-peptide complex was strictly sorted to the Rab5+, EEA1+ static early endosome and the Hsp90-chaperoned peptide was processed and bound to MHC class I molecules through a endosome-recycling pathway. We also found that extracellular Hsp90 complexed with CpG-A or self-DNA stimulates production of a large amount of IFN-α from pDCs via static early endosome targeting. Thus, extracellular Hsp90 can target the antigen or nucleic acid to a static early endosome by spatio-temporal regulation. Moreover, we showed that Hsp90 associates with and delivers TLR7/9 from the ER to early endosomes for ligand recognition. Hsp90 inhibitor, geldanamycin derivative inhibited the Hsp90 association with TLR7/9, resulting in inhibition IFN-α production, leading to improvement of SLE symptoms. Interstingly, we observed that serum Hsp90 is clearly increased in patients with active SLE compared with that in patients with inactive disease. Serum Hsp90 detected in SLE patients binds to self-DNA and/or anti-DNA Ab, thus leading to stimulation of pDCs to produce IFN-α. Thus, Hsp90 plays a crucial role in the pathogenesis of SLE and that an Hsp90 inhibitor will therefore provide a new therapeutic approach to SLE and other nucleic acid-related autoimmune diseases. We will discuss how spatio-temporal regulation of Hsp90-ligand complexes within antigen-presenting cells affects the innate immunity and adaptive immunity.

  16. Saccharomyces boulardii CNCM I-745 Restores intestinal Barrier Integrity by Regulation of E-cadherin Recycling.

    Science.gov (United States)

    Terciolo, Chloé; Dobric, Aurélie; Ouaissi, Mehdi; Siret, Carole; Breuzard, Gilles; Silvy, Françoise; Marchiori, Bastien; Germain, Sébastien; Bonier, Renaté; Hama, Adel; Owens, Roisin; Lombardo, Dominique; Rigot, Véronique; André, Frédéric

    2017-08-01

    Alteration in intestinal permeability is the main factor underlying the pathogenesis of many diseases affecting the gut, such as inflammatory bowel disease [IBD]. Characterization of molecules targeting the restoration of intestinal barrier integrity is therefore vital for the development of alternative therapies. The yeast Saccharomyces boulardii CNCM I-745 [Sb], used to prevent and treat antibiotic-associated infectious and functional diarrhea, may have a beneficial effect in the treatment of IBD. We analyzed the impact of Sb supernatant on tissue integrity and components of adherens junctions using cultured explants of colon from both IBD and healthy patients. To evaluate the pathways by which Sb regulates the expression of E-cadherin at the cell surface, we developed in vitro assays using human colonic cell lines, including cell aggregation, a calcium switch assay, real-time measurement of transepithelial electrical resistance [TEER] and pulse-chase experiments. We showed that Sb supernatant treatment of colonic explants protects the epithelial morphology and maintains E-cadherin expression at the cell surface. In vitro experiments revealed that Sb supernatant enhances E-cadherin delivery to the cell surface by re-routing endocytosed E-cadherin back to the plasma membrane. This process, involving Rab11A-dependent recycling endosome, leads to restoration of enterocyte adherens junctions, in addition to the overall restoration and strengthening of intestinal barrier function. These findings open new possibilities of discovering novel options for prevention and therapy of diseases that affect intestinal permeability. Copyright © 2017 European Crohn's and Colitis Organisation (ECCO). Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com

  17. Vasoinhibins regulate the inner and outer blood-retinal barrier and limit retinal oxidative stress.

    Science.gov (United States)

    Arredondo Zamarripa, David; Díaz-Lezama, Nundehui; Meléndez García, Rodrigo; Chávez Balderas, Jesús; Adán, Norma; Ledesma-Colunga, Maria G; Arnold, Edith; Clapp, Carmen; Thebault, Stéphanie

    2014-01-01

    Vasoinhibins are prolactin fragments present in the retina, where they have been shown to prevent the hypervasopermeability associated with diabetes. Enhanced bradykinin (BK) production contributes to the increased transport through the blood-retina barrier (BRB) in diabetes. Here, we studied if vasoinhibins regulate BRB permeability by targeting the vascular endothelium and retinal pigment epithelium (RPE) components of this barrier. Intravitreal injection of BK in male rats increased BRB permeability. Vasoinhibins prevented this effect, as did the B2 receptor antagonist Hoe-140. BK induced a transient decrease in mouse retinal and brain capillary endothelial monolayer resistance that was blocked by vasoinhibins. Both vasoinhibins and the nitric oxide (NO) synthase inhibitor L-NAME, but not the antioxidant N-acetyl cysteine (NAC), blocked the transient decrease in bovine umbilical vein endothelial cell (BUVEC) monolayer resistance induced by BK; this block was reversed by the NO donor DETANONOate. Vasoinhibins also prevented the BK-induced actin cytoskeleton redistribution, as did L-NAME. BK transiently decreased human RPE (ARPE-19) cell monolayer resistance, and this effect was blocked by vasoinhibins, L-NAME, and NAC. DETANONOate reverted the blocking effect of vasoinhibins. Similar to BK, the radical initiator Luperox induced a reduction in ARPE-19 cell monolayer resistance, which was prevented by vasoinhibins. These effects on RPE resistance coincided with actin cytoskeleton redistribution. Intravitreal injection of vasoinhibins reduced the levels of reactive oxygen species (ROS) in retinas of streptozotocin-induced diabetic rats, particularly in the RPE and capillary-containing layers. Thus, vasoinhibins reduce BRB permeability by targeting both its main inner and outer components through NO- and ROS-dependent pathways, offering potential treatment strategies against diabetic retinopathies.

  18. Vasoinhibins regulate the inner and outer blood-retinal barrier and limit retinal oxidative stress

    Directory of Open Access Journals (Sweden)

    David eArredondo Zamarripa

    2014-10-01

    Full Text Available Vasoinhibins are prolactin fragments present in the retina, where they have been shown to prevent the hypervasopermeability associated with diabetes. Enhanced bradykinin (BK production contributes to the increased transport through the blood-retina barrier (BRB in diabetes. Here, we studied if vasoinhibins regulate BRB permeability by targeting the vascular endothelium and retinal pigment epithelium (RPE components of this barrier. Intravitreal injection of BK in male rats increased BRB permeability. Vasoinhibins prevented this effect, as did the B2 receptor antagonist Hoe-140. BK induced a transient decrease in mouse retinal and brain capillary endothelial monolayer resistance that was blocked by vasoinhibins. Both vasoinhibins and the nitric oxide (NO synthase inhibitor L-NAME, but not the antioxidant N-acetyl cysteine (NAC, blocked the transient decrease in bovine umbilical vein endothelial cell (BUVEC monolayer resistance induced by BK; this block was reversed by the NO donor DETANONOate. Vasoinhibins also prevented the BK-induced actin cytoskeleton redistribution, as did L-NAME. BK transiently decreased human RPE (ARPE-19 cell monolayer resistance, and this effect was blocked by vasoinhibins, L-NAME, and NAC. DETANONOate reverted the blocking effect of vasoinhibins. Similar to BK, the radical initiator Luperox induced a reduction in ARPE-19 cell monolayer resistance, which was prevented by vasoinhibins. These effects on RPE resistance coincided with actin cytoskeleton redistribution. Intravitreal injection of vasoinhibins reduced the levels of reactive oxygen species (ROS in retinas of streptozotocin-induced diabetic rats, particularly in the RPE and capillary-containing layers. Thus, vasoinhibins reduce BRB permeability by targeting both its main inner and outer components through NO- and ROS-dependent pathways, offering potential treatment strategies against diabetic retinopathies.

  19. Immune-regulating effects of exercise on cigarette smoke-induced inflammation

    Science.gov (United States)

    Madani, Ashkan; Alack, Katharina; Richter, Manuel Jonas; Krüger, Karsten

    2018-01-01

    Long-term cigarette smoking (LTCS) represents an important risk factor for cardiac infarction and stroke and the central risk factor for the development of a bronchial carcinoma, smoking-associated interstitial lung fibrosis, and chronic obstructive pulmonary disease. The pathophysiologic development of these diseases is suggested to be promoted by chronic and progressive inflammation. Cigarette smoking induces repetitive inflammatory insults followed by a chronic and progressive activation of the immune system. In the pulmonary system of cigarette smokers, oxidative stress, cellular damage, and a chronic activation of pattern recognition receptors are described which are followed by the translocation of the NF-kB, the release of pro-inflammatory cytokines, chemokines, matrix metalloproteases, and damage-associated molecular patterns. In parallel, smoke pollutants cross directly through the alveolus–capillary interface and spread through the systemic bloodstream targeting different organs. Consequently, LTCS induces a systemic low-grade inflammation and increased oxidative stress in the vascular system. In blood, these processes promote an increased coagulation and endothelial dysfunction. In muscle tissue, inflammatory processes activate catabolic signaling pathways followed by muscle wasting and sarcopenia. In brain, several characteristics of neuroinflammation were described. Regular exercise training has been shown to be an effective nonpharmacological treatment strategy in smoke-induced pulmonary diseases. It is well established that exercise training exerts immune-regulating effects by activating anti-inflammatory signaling pathways. In this regard, the release of myokines from contracting skeletal muscle, the elevations of cortisol and adrenalin, the reduced expression of Toll-like receptors, and the increased mobilization of immune-regulating leukocyte subtypes might be of vital importance. Exercise training also increases the local and systemic

  20. Immune-regulating effects of exercise on cigarette smoke-induced inflammation

    Directory of Open Access Journals (Sweden)

    Madani A

    2018-04-01

    . It is well established that exercise training exerts immune-regulating effects by activating anti-inflammatory signaling pathways. In this regard, the release of myokines from contracting skeletal muscle, the elevations of cortisol and adrenalin, the reduced expression of Toll-like receptors, and the increased mobilization of immune-regulating leukocyte subtypes might be of vital importance. Exercise training also increases the local and systemic antioxidative capacity and several compensatory mechanisms in tissues such as an increased anabolic signaling in muscle or an increased compliance of the vascular system. Accordingly, regular exercise training seems to protect long-term smokers against some important negative local and systemic consequences of smoking. Data suggest that it seems to be important to start exercise training as early as possible. Keywords: physical activity, pulmonary system, muscle wasting, lymphocytes, tobacco, airway epithelial cells

  1. The role of the adaptive immune system in regulation of gut microbiota.

    Science.gov (United States)

    Kato, Lucia M; Kawamoto, Shimpei; Maruya, Mikako; Fagarasan, Sidonia

    2014-07-01

    The gut nourishes rich bacterial communities that affect profoundly the functions of the immune system. The relationship between gut microbiota and the immune system is one of reciprocity. The microbiota contributes to nutrient processing and the development, maturation, and function of the immune system. Conversely, the immune system, particularly the adaptive immune system, plays a key role in shaping the repertoire of gut microbiota. The fitness of host immune system is reflected in the gut microbiota, and deficiencies in either innate or adaptive immunity impact on diversity and structures of bacterial communities in the gut. Here, we discuss the mechanisms that underlie this reciprocity and emphasize how the adaptive immune system via immunoglobulins (i.e. IgA) contributes to diversification and balance of gut microbiota required for immune homeostasis. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Tribbles ortholog NIPI-3 and bZIP transcription factor CEBP-1 regulate a Caenorhabditis elegans intestinal immune surveillance pathway.

    Science.gov (United States)

    McEwan, Deborah L; Feinbaum, Rhonda L; Stroustrup, Nicholas; Haas, Wilhelm; Conery, Annie L; Anselmo, Anthony; Sadreyev, Ruslan; Ausubel, Frederick M

    2016-12-07

    Many pathogens secrete toxins that target key host processes resulting in the activation of immune pathways. The secreted Pseudomonas aeruginosa toxin Exotoxin A (ToxA) disrupts intestinal protein synthesis, which triggers the induction of a subset of P. aeruginosa-response genes in the nematode Caenorhabditis elegans. We show here that one ToxA-induced C. elegans gene, the Tribbles pseudokinase ortholog nipi-3, is essential for host survival following exposure to P. aeruginosa or ToxA. We find that NIPI-3 mediates the post-developmental expression of intestinal immune genes and proteins and primarily functions in parallel to known immune pathways, including p38 MAPK signaling. Through mutagenesis screening, we identify mutants of the bZIP C/EBP transcription factor cebp-1 that suppress the hypersusceptibility defects of nipi-3 mutants. NIPI-3 is a negative regulator of CEBP-1, which in turn negatively regulates protective immune mechanisms. This pathway represents a previously unknown innate immune signaling pathway in intestinal epithelial cells that is involved in the surveillance of cellular homeostasis. Because NIPI-3 and CEBP-1 are also essential for C. elegans development, NIPI-3 is analogous to other key innate immune signaling molecules such as the Toll receptors in Drosophila that have an independent role during development.

  3. Epigenetic regulation of cancer biology and anti-tumor immunity by EZH2.

    Science.gov (United States)

    Christofides, Anthos; Karantanos, Theodoros; Bardhan, Kankana; Boussiotis, Vassiliki A

    2016-12-20

    Polycomb group proteins regulate chromatin structure and have an important regulatory role on gene expression in various cell types. Two polycomb group complexes (Polycomb repressive complex 1 (PRC1) and 2 (PRC2)) have been identified in mammalian cells. Both PRC1 and PRC2 compact chromatin, and also catalyze histone modifications. PRC1 mediates monoubiquitination of histone H2A, whereas PRC2 catalyzes methylation of histone H3 on lysine 27. These alterations of histones can lead to altered gene expression patterns by regulating chromatin structure. Numerous studies have highlighted the role of the PRC2 catalytic component enhancer of zeste homolog 2 (EZH2) in neoplastic development and progression, and EZH2 mutations have been identified in various malignancies. Through modulating the expression of critical genes, EZH2 is actively involved in fundamental cellular processes such as cell cycle progression, cell proliferation, differentiation and apoptosis. In addition to cancer cells, EZH2 also has a decisive role in the differentiation and function of T effector and T regulatory cells. In this review we summarize the recent progress regarding the role of EZH2 in human malignancies, highlight the molecular mechanisms by which EZH2 aberrations promote the pathogenesis of cancer, and discuss the anti-tumor effects of EZH2 targeting via activating direct anti-cancer mechanisms and anti-tumor immunity.

  4. Tetraspanin CD9: A Key Regulator of Cell Adhesion in the Immune System

    Directory of Open Access Journals (Sweden)

    Raquel Reyes

    2018-04-01

    Full Text Available The tetraspanin CD9 is expressed by all the major subsets of leukocytes (B cells, CD4+ T cells, CD8+ T cells, natural killer cells, granulocytes, monocytes and macrophages, and immature and mature dendritic cells and also at a high level by endothelial cells. As a typical member of the tetraspanin superfamily, a prominent feature of CD9 is its propensity to engage in a multitude of interactions with other tetraspanins as well as with different transmembrane and intracellular proteins within the context of defined membranal domains termed tetraspanin-enriched microdomains (TEMs. Through these associations, CD9 influences many cellular activities in the different subtypes of leukocytes and in endothelial cells, including intracellular signaling, proliferation, activation, survival, migration, invasion, adhesion, and diapedesis. Several excellent reviews have already covered the topic of how tetraspanins, including CD9, regulate these cellular processes in the different cells of the immune system. In this mini-review, however, we will focus particularly on describing and discussing the regulatory effects exerted by CD9 on different adhesion molecules that play pivotal roles in the physiology of leukocytes and endothelial cells, with a particular emphasis in the regulation of adhesion molecules of the integrin and immunoglobulin superfamilies.

  5. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Science.gov (United States)

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  6. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Directory of Open Access Journals (Sweden)

    Alene Kast

    2015-05-01

    Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  7. Using self-regulation theory to examine patient goals, barriers, and facilitators for taking medication.

    Science.gov (United States)

    Kucukarslan, Suzan N; Thomas, Sheena; Bazzi, Abraham; Virant-Young, Deborah

    2009-12-01

    : Self-regulation theory predicts that patient behavior is determined by the patient's assessment of his/her condition (illness presentation) and related health goals. Patients will adapt their behavior to achieve those goals. However, there are multiple levels of goals. In such cases, those lower-level goals (health goals) that are strongly correlated with higher-level goals (i.e. quality of life [QOL]) are more likely to drive patient behavior. Medication non-compliance is a health behavior that challenges healthcare practitioners. Thus, the primary aim of this paper is to explore the relationship between the lower-level goals for taking medication with higher-level goals. This paper also identifies patient-perceived barriers and facilitators toward achieving goals as they may relate to patients' illness representation. : To identify lower- and higher-level goals associated with medication use for chronic conditions. To determine if there is a relationship between higher-level (global) goals and lower-level (health-related) goals. To identify patient-perceived facilitators and barriers to achieving those goals. : This was a prospective, observational study using a mailed survey. The setting was a US Midwestern state-wide survey. Participants were patients living in the community with hypertension, heart disease, diabetes mellitus, or arthritis, and taking prescription medication for any one of those conditions. The main outcome measures were lower- and higher-level goals related to medication use. The survey asked the participants if they had achieved their goals and to identify factors that may pose as barriers or facilitators to achieving them. Pearson correlation was used to test the relationship between the lower- and higher-level goals at p goals existed (p = 0.03). Preventing future health problems was the most important lower-level goal for almost half of the respondents. Approximately 43% of the respondents said 'improving or maintaining quality of

  8. Human Leukocyte Antigen (HLA and Immune Regulation: How Do Classical and Non-Classical HLA Alleles Modulate Immune Response to Human Immunodeficiency Virus and Hepatitis C Virus Infections?

    Directory of Open Access Journals (Sweden)

    Nicole B. Crux

    2017-07-01

    Full Text Available The genetic factors associated with susceptibility or resistance to viral infections are likely to involve a sophisticated array of immune response. These genetic elements may modulate other biological factors that account for significant influence on the gene expression and/or protein function in the host. Among them, the role of the major histocompatibility complex in viral pathogenesis in particular human immunodeficiency virus (HIV and hepatitis C virus (HCV, is very well documented. We, recently, added a novel insight into the field by identifying the molecular mechanism associated with the protective role of human leukocyte antigen (HLA-B27/B57 CD8+ T cells in the context of HIV-1 infection and why these alleles act as a double-edged sword protecting against viral infections but predisposing the host to autoimmune diseases. The focus of this review will be reexamining the role of classical and non-classical HLA alleles, including class Ia (HLA-A, -B, -C, class Ib (HLA-E, -F, -G, -H, and class II (HLA-DR, -DQ, -DM, and -DP in immune regulation and viral pathogenesis (e.g., HIV and HCV. To our knowledge, this is the very first review of its kind to comprehensively analyze the role of these molecules in immune regulation associated with chronic viral infections.

  9. Regulator-dependent mechanisms of C3b processing by factor i allow differentiation of immune responses

    NARCIS (Netherlands)

    Xue, Xiaoguang|info:eu-repo/dai/nl/413576841; Wu, Jin|info:eu-repo/dai/nl/304829552; Ricklin, Daniel; Forneris, Federico|info:eu-repo/dai/nl/341358622; Di Crescenzio, Patrizia; Schmidt, Christoph Q.; Granneman, Joke|info:eu-repo/dai/nl/304839396; Sharp, Thomas H; Lambris, John D; Gros, Piet|info:eu-repo/dai/nl/075243016

    2017-01-01

    The complement system labels microbes and host debris for clearance. Degradation of surface-bound C3b is pivotal to direct immune responses and protect host cells. How the serine protease factor I (FI), assisted by regulators, cleaves either two or three distant peptide bonds in the CUB domain of

  10. Extracts from Hericium erinaceus relieve inflammatory bowel disease by regulating immunity and gut microbiota.

    Science.gov (United States)

    Diling, Chen; Xin, Yang; Chaoqun, Zheng; Jian, Yang; Xiaocui, Tang; Jun, Chen; Ou, Shuai; Yizhen, Xie

    2017-10-17

    Hericium erinaceus (HE), a traditional edible mushroom, is known as a medicine food homology to ameliorate gastrointestinal diseases. To investigate whether HE is clinically effective in alleviating inflammatory bowel disease (IBD), HE extracts (polysaccharide, alcoholic extracts and whole extracts were prepared using solvent extraction methods) were administrated for 2 weeks in rats with IBD induced by trinitro-benzene-sulfonic acid (TNBS) enema (150 mg/kg). Significant clinical and histological changes in IBD rats were identified, including damage activity, common morphous and tissue damage index scores in colonic mucosa and myeloperoxidase (MPO) activity. The damage activity, common morphous and tissue damage index scores in colonic mucosa ( P <0.05) were improved, MPO activities were decreased. Inflammatory factors were also differentially expressed in colonic mucosa in IBD rats, including serum cytokines, Foxp3 and interleukin (IL)-10 were increased while NF-κB p65 and tumor necrosis factor (TNF)-α were decreased ( P <0.05), and T cells were activated ( P <0.05), especially in the alcohol extracts-treated group. We also found that the structure of gut microbiota of the H. erinaceus extracts-treated groups changed significantly by compared with the model group. Further studies revealed that the polysaccharides in HE extracts may play a prebiotic role, whereas the alcoholic extracts show bactericidin-like and immunomodulatory effects. Taken together, we demonstrated that H. erinaceus extracts could promote the growth of beneficial gut bacteria and improve the host immunity in vivo IBD model, which shows clinical potential in relieving IBD by regulating gut microbiota and immune system.

  11. Intergovernmental Immunities in Litigation, Taxation, and Regulation: Separation of Powers Issues in Controversies About Federalism

    Science.gov (United States)

    Tribe, Laurence H.

    1976-01-01

    The author argues that attention to the question of who should decide an intergovernmental immunity issue--the states, the federal courts, the federal executive, or Congress--illuminates the law of eleventh amendment immunities and intergovernmental tax and regulatory immunities and supports all but a handful of the results courts have reached.…

  12. Air pollution and children: neural and tight junction antibodies and combustion metals, the role of barrier breakdown and brain immunity in neurodegeneration.

    Science.gov (United States)

    Calderón-Garcidueñas, Lilian; Vojdani, Aristo; Blaurock-Busch, Eleonore; Busch, Yvette; Friedle, Albrecht; Franco-Lira, Maricela; Sarathi-Mukherjee, Partha; Martínez-Aguirre, Xavier; Park, Su-Bin; Torres-Jardón, Ricardo; D'Angiulli, Amedeo

    2015-01-01

    Millions of children are exposed to concentrations of air pollutants, including fine particulate matter (PM2.5), above safety standards. In the Mexico City Metropolitan Area (MCMA) megacity, children show an early brain imbalance in oxidative stress, inflammation, innate and adaptive immune response-associated genes, and blood-brain barrier breakdown. We investigated serum and cerebrospinal fluid (CSF) antibodies to neural and tight junction proteins and environmental pollutants in 139 children ages 11.91 ± 4.2 y with high versus low air pollution exposures. We also measured metals in serum and CSF. MCMA children showed significantly higher serum actin IgG, occludin/zonulin 1 IgA, IgG, myelin oligodendrocyte glycoprotein IgG and IgM (p < 0.01), myelin basic protein IgA and IgG, S-100 IgG and IgM, and cerebellar IgG (p < 0.001). Serum IgG antibodies to formaldehyde, benzene, and bisphenol A, and concentrations of Ni and Cd were significantly higher in exposed children (p < 0.001). CSF MBP antibodies and nickel concentrations were higher in MCMA children (p = 0.03). Air pollution exposure damages epithelial and endothelial barriers and is a robust trigger of tight junction and neural antibodies. Cryptic 'self' tight junction antigens can trigger an autoimmune response potentially contributing to the neuroinflammatory and Alzheimer and Parkinson's pathology hallmarks present in megacity children. The major factor determining the impact of neural antibodies is the integrity of the blood-brain barrier. Defining the air pollution linkage of the brain/immune system interactions and damage to physical and immunological barriers with short and long term neural detrimental effects to children's brains ought to be of pressing importance for public health.

  13. The immune-regulating effect of Xiao'er Qixingcha in constipated mice induced by high-heat and high-protein diet.

    Science.gov (United States)

    Qu, Chang; Yang, Guang-Hua; Zheng, Rong-Bo; Yu, Xiu-Ting; Peng, Shao-Zhong; Xie, Jian-Hui; Chen, Jian-Nan; Wang, Xiu-Fen; Su, Zi-Ren; Zhang, Xiao-Jun

    2017-03-31

    both models. EXQ exhibited prominent laxative activity and effectively protected the colonic mucosal barrier in two models of constipated mice, of which the mechanism might be closely associated with its propulsive and immune-regulating properties. The current results not only validated the rationale for the clinical application of EXQ in pediatric constipation related symptoms, but also threw new light on the immune-inflammatory responses accompanied with chronic constipation pathology.

  14. RFX Transcription Factor DAF-19 Regulates 5-HT and Innate Immune Responses to Pathogenic Bacteria in Caenorhabditis elegans

    Science.gov (United States)

    Choi, Sunju; Xu, Lu; Sze, Ji Ying

    2013-01-01

    In Caenorhabditis elegans the Toll-interleukin receptor domain adaptor protein TIR-1 via a conserved mitogen-activated protein kinase (MAPK) signaling cascade induces innate immunity and upregulates serotonin (5-HT) biosynthesis gene tph-1 in a pair of ADF chemosensory neurons in response to infection. Here, we identify transcription factors downstream of the TIR-1 signaling pathway. We show that common transcription factors control the innate immunity and 5-HT biosynthesis. We demonstrate that a cysteine to tyrosine substitution in an ARM motif of the HEAT/Arm repeat region of the TIR-1 protein confers TIR-1 hyperactivation, leading to constitutive tph-1 upregulation in the ADF neurons, increased expression of intestinal antimicrobial genes, and enhanced resistance to killing by the human opportunistic pathogen Pseudomonas aeruginosa PA14. A forward genetic screen for suppressors of the hyperactive TIR-1 led to the identification of DAF-19, an ortholog of regulatory factor X (RFX) transcription factors that are required for human adaptive immunity. We show that DAF-19 concerts with ATF-7, a member of the activating transcription factor (ATF)/cAMP response element-binding B (CREB) family of transcription factors, to regulate tph-1 and antimicrobial genes, reminiscent of RFX-CREB interaction in human immune cells. daf-19 mutants display heightened susceptibility to killing by PA14. Remarkably, whereas the TIR-1-MAPK-DAF-19/ATF-7 pathway in the intestinal immunity is regulated by DKF-2/protein kinase D, we found that the regulation of tph-1 expression is independent of DKF-2 but requires UNC-43/Ca2+/calmodulin-dependent protein kinase (CaMK) II. Our results suggest that pathogenic cues trigger a common core-signaling pathway via tissue-specific mechanisms and demonstrate a novel role for RFX factors in neuronal and innate immune responses to infection. PMID:23505381

  15. The kinase TBK1 functions in dendritic cells to regulate T cell homeostasis, autoimmunity, and antitumor immunity.

    Science.gov (United States)

    Xiao, Yichuan; Zou, Qiang; Xie, Xiaoping; Liu, Ting; Li, Haiyan S; Jie, Zuliang; Jin, Jin; Hu, Hongbo; Manyam, Ganiraju; Zhang, Li; Cheng, Xuhong; Wang, Hui; Marie, Isabelle; Levy, David E; Watowich, Stephanie S; Sun, Shao-Cong

    2017-05-01

    Dendritic cells (DCs) are crucial for mediating immune responses but, when deregulated, also contribute to immunological disorders, such as autoimmunity. The molecular mechanism underlying the function of DCs is incompletely understood. In this study, we have identified TANK-binding kinase 1 (TBK1), a master innate immune kinase, as an important regulator of DC function. DC-specific deletion of Tbk1 causes T cell activation and autoimmune symptoms and also enhances antitumor immunity in animal models of cancer immunotherapy. The TBK1-deficient DCs have up-regulated expression of co-stimulatory molecules and increased T cell-priming activity. We further demonstrate that TBK1 negatively regulates the induction of a subset of genes by type I interferon receptor (IFNAR). Deletion of IFNAR1 could largely prevent aberrant T cell activation and autoimmunity in DC-conditional Tbk1 knockout mice. These findings identify a DC-specific function of TBK1 in the maintenance of immune homeostasis and tolerance. © 2017 Xiao et al.

  16. Functional analysis of Arabidopsis immune-related MAPKs uncovers a role for MPK3 as negative regulator of inducible defences

    KAUST Repository

    Frei dit Frey, Nicolas

    2014-06-30

    Background Mitogen-activated protein kinases (MAPKs) are key regulators of immune responses in animals and plants. In Arabidopsis, perception of microbe-associated molecular patterns (MAMPs) activates the MAPKs MPK3, MPK4 and MPK6. Increasing information depicts the molecular events activated by MAMPs in plants, but the specific and cooperative contributions of the MAPKs in these signalling events are largely unclear. Results In this work, we analyse the behaviour of MPK3, MPK4 and MPK6 mutants in early and late immune responses triggered by the MAMP flg22 from bacterial flagellin. A genome-wide transcriptome analysis reveals that 36% of the flg22-upregulated genes and 68% of the flg22-downregulated genes are affected in at least one MAPK mutant. So far MPK4 was considered as a negative regulator of immunity, whereas MPK3 and MPK6 were believed to play partially redundant positive functions in defence. Our work reveals that MPK4 is required for the regulation of approximately 50% of flg22-induced genes and we identify a negative role for MPK3 in regulating defence gene expression, flg22-induced salicylic acid accumulation and disease resistance to Pseudomonas syringae. Among the MAPK-dependent genes, 27% of flg22-upregulated genes and 76% of flg22-downregulated genes require two or three MAPKs for their regulation. The flg22-induced MAPK activities are differentially regulated in MPK3 and MPK6 mutants, both in amplitude and duration, revealing a highly interdependent network. Conclusions These data reveal a new set of distinct functions for MPK3, MPK4 and MPK6 and indicate that the plant immune signalling network is choreographed through the interplay of these three interwoven MAPK pathways.

  17. CovR Regulates Streptococcus mutans Susceptibility To Complement Immunity and Survival in Blood

    Science.gov (United States)

    Alves, Lívia A.; Nomura, Ryota; Mariano, Flávia S.; Harth-Chu, Erika N.; Stipp, Rafael N.; Nakano, Kazuhiko

    2016-01-01

    Streptococcus mutans, a major pathogen of dental caries, may promote systemic infections after accessing the bloodstream from oral niches. In this study, we investigate pathways of complement immunity against S. mutans and show that the orphan regulator CovR (CovRSm) modulates susceptibility to complement opsonization and survival in blood. S. mutans blood isolates showed reduced susceptibility to C3b deposition compared to oral isolates. Reduced expression of covRSm in blood strains was associated with increased transcription of CovRSm-repressed genes required for S. mutans interactions with glucans (gbpC, gbpB, and epsC), sucrose-derived exopolysaccharides (EPS). Consistently, blood strains showed an increased capacity to bind glucan in vitro. Deletion of covRSm in strain UA159 (UAcov) impaired C3b deposition and binding to serum IgG and C-reactive protein (CRP) as well as phagocytosis through C3b/iC3b receptors and killing by neutrophils. Opposite effects were observed in mutants of gbpC, epsC, or gtfBCD (required for glucan synthesis). C3b deposition on UA159 was abolished in C1q-depleted serum, implying that the classical pathway is essential for complement activation on S. mutans. Growth in sucrose-containing medium impaired the binding of C3b and IgG to UA159, UAcov, and blood isolates but had absent or reduced effects on C3b deposition in gtfBCD, gbpC, and epsC mutants. UAcov further showed increased ex vivo survival in human blood in an EPS-dependent way. Consistently, reduced survival was observed for the gbpC and epsC mutants. Finally, UAcov showed an increased ability to cause bacteremia in a rat model. These results reveal that CovRSm modulates systemic virulence by regulating functions affecting S. mutans susceptibility to complement opsonization. PMID:27572331

  18. Immunosenescence Is Associated With Altered Gene Expression And Epigenetic Regulation In Primary And Secondary Immune Organs

    Directory of Open Access Journals (Sweden)

    Corinne eSidler

    2013-10-01

    Full Text Available Deterioration of the immune system (immunosenescence with age is associated with an increased susceptibility to infection, autoimmune disease and cancer, and reduced responsiveness to vaccination. Immunosenescence entails a reduced supply of naïve T cells from the thymus and increased specialization of peripheral T cell clones. Both thymic involution and peripheral T cell homeostasis are thought to involve cellular senescence. In order to analyze this at the molecular level, we studied gene expression profiles, epigenetic status and genome stability in the thymus and spleen of 1-month, 4-month and 18-month-old Long Evans rats. In the thymus, altered gene expression, DNA and histone hypomethylation, increased genome instability and apoptosis were observed in 18-month-old animals compared to 1- and 4-month-old animals. In the spleen, alterations in gene expression and epigenetic regulation occurred already by the age of 4 months compared to 1 month and persisted in 18-month-old compared to 1-month-old rats. In both organs, these changes were accompanied by the altered composition of resident T cell populations. Our study suggests that both senescence and apoptosis may be involved in altered organ function.

  19. Cysteine-dependent immune regulation by TRX and MIF/GIF family proteins.

    Science.gov (United States)

    Kondo, Norihiko; Ishii, Yasuyuki; Son, Aoi; Sakakura-Nishiyama, Junko; Kwon, Yong-Won; Tanito, Masaki; Nishinaka, Yumiko; Matsuo, Yoshiyuki; Nakayama, Toshinori; Taniguchi, Masaru; Yodoi, Junji

    2004-03-29

    Thioredoxin (TRX) superfamily proteins that contain a conserved redox-active site -Cys-Xa.a.-Xa.a.-Cys- includes proinflammatory cytokine, macrophage migration inhibiting factor (MIF) and the immune regulatory cytokine, glycosylation inhibiting factor (GIF) in which Cys-60 is cysteinylated. In this report, we have analyzed the functional interaction between TRX and MIF/GIF. The stable Jurkat T cell line transfected with human TRX gene (TRX-transfectant) was highly resistant to hydrogen peroxide-induced apoptosis, but not the cell line transfected with vector (mock-transfectant). The expression level of MIF/GIF protein of TRX-transfectant was lower than that of mock-transfectant. Conversely, the expression level of intracellular TRX protein in CD4(+)-T cells derived from MIF -/- mice were significantly higher than that from background BALB/c mice. These findings collectively suggest that oxidative stress-induced apoptosis on T lymphocytes might be protected by the reciprocal regulation of TRX and MIF/GIF expression.

  20. MiR-155-regulated molecular network orchestrates cell fate in the innate and adaptive immune response to Mycobacterium tuberculosis.

    Science.gov (United States)

    Rothchild, Alissa C; Sissons, James R; Shafiani, Shahin; Plaisier, Christopher; Min, Deborah; Mai, Dat; Gilchrist, Mark; Peschon, Jacques; Larson, Ryan P; Bergthaler, Andreas; Baliga, Nitin S; Urdahl, Kevin B; Aderem, Alan

    2016-10-11

    The regulation of host-pathogen interactions during Mycobacterium tuberculosis (Mtb) infection remains unresolved. MicroRNAs (miRNAs) are important regulators of the immune system, and so we used a systems biology approach to construct an miRNA regulatory network activated in macrophages during Mtb infection. Our network comprises 77 putative miRNAs that are associated with temporal gene expression signatures in macrophages early after Mtb infection. In this study, we demonstrate a dual role for one of these regulators, miR-155. On the one hand, miR-155 maintains the survival of Mtb-infected macrophages, thereby providing a niche favoring bacterial replication; on the other hand, miR-155 promotes the survival and function of Mtb-specific T cells, enabling an effective adaptive immune response. MiR-155-induced cell survival is mediated through the SH2 domain-containing inositol 5-phosphatase 1 (SHIP1)/protein kinase B (Akt) pathway. Thus, dual regulation of the same cell survival pathway in innate and adaptive immune cells leads to vastly different outcomes with respect to bacterial containment.

  1. "Letting the leaders pass": barriers to using traditional ecological knowledge in comanagement as the basis of formal hunting regulations

    Directory of Open Access Journals (Sweden)

    Elisabeth Padilla

    2014-06-01

    Full Text Available We studied a case of failure in applying traditional ecological knowledge (TEK in comanagement as the basis for formal hunting regulations. We based the study on the Porcupine Caribou (Rangifer tarandus Herd "let the leaders pass" policy, established for the Dempster Highway of the Western Canadian Arctic, and identified conditions creating barriers in the successful application of TEK through comanagement. Stated as propositions, identified barriers include: (1 the context-specific nature of TEK limits its application in resource management regulations; (2 changes in traditional authority systems, hunting technology, and the social organization of harvesting caribou affect the effectiveness of TEK approaches in a contemporary social setting; (3 indigenous efforts toward self-government and political autonomy limit regional comanagement consensus in a heterogeneous cultural landscape; (4 the mismatch of agency enforcement of hunting regulations and TEK-based education is problematic. We analyzed the case through four historical phases of caribou management, complementing the study with a literature review of TEK and wildlife comanagement to explain why TEK integration of caribou leaders in regulatory resource management fell short of success. Identifying and understanding the social dynamics related to these barriers make apparent solutions for transforming the comanagement process.

  2. Positive regulation of humoral and innate immune responses induced by inactivated Avian Influenza Virus vaccine in broiler chickens.

    Science.gov (United States)

    Abdallah, Fatma; Hassanin, Ola

    2015-12-01

    Avian Influenza (AI) vaccines are widely used for mammals and birds in a trial to eliminate the Avian Influenza virus (AIV) infection from the world. However and up till now the virus is still existed via modulation of its antigenic structure to evade the pressure of host immune responses. For a complete understanding of the immune responses following AI vaccination in chickens, the modulations of the chickens humoral immune responses and interferon-alpha signaling pathway, as a fundamental part of the innate immune responses, were investigated. In our study, we measured the humoral immune response using hemagglutination-inhibition (HI) and enzyme-linked immunosorbent assay (ELISA) tests. In addition, chicken interferon-alpha pathway components was measured at RNA levels using Quantitative Real-time PCR (qRT-PCR) following one dose of inactivated H5N1 influenza vaccine at 14 days of age. In this study, the protective levels of humoral antibody responses were observed at 14, 21 and 28 days following immunization with inactivated (Re-1/H5N1) AI vaccine. In the chicken spleen cells, up regulation in the chicken interferon-alpha pathway components (MX1 & IRF7) was existed as early as 48 h post vaccination and remained until 28 days post vaccination at the endogenous state. However, after the recall with ex-vivo stimulation, the up regulation was more pronounced in the transcriptional factor (IRF7) compared to the antiviral gene (MX1) at 28 days post vaccination. So far, from our results it appears that the inactivated H5N1 vaccine can trigger the chicken interferon-alpha signaling pathway as well as it can elicit protective humoral antibody responses.

  3. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  4. Arabidopsis AtERF15 positively regulates immunity against Pseudomonas syringae pv. tomato DC3000 and Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Huijuan eZhang

    2015-09-01

    Full Text Available Upon pathogen infection, activation of immune response requires effective transcriptional reprogramming that regulates inducible expression of a large set of defense genes. A number of ethylene-responsive factor transcription factors have been shown to play critical roles in regulating immune responses in plants. In the present study, we explored the functions of Arabidopsis AtERF15 in immune responses against Pseudomonas syringae pv. tomato (Pst DC3000, a (hemibiotrophic bacterial pathogen, and Botrytis cinerea, a necrotrophic fungal pathogen. Expression of AtERF15 was induced by infection of Pst DC3000 and B. cinerea and by treatments with salicylic acid (SA and methyl jasmonate. Biochemical assays demonstrated that AtERF15 is a nucleus-localized transcription activator. The AtERF15-overexpressing (AtERF15-OE plants displayed enhanced resistance while the AtERF15-RNAi plants exhibited decreased resistance against Pst DC3000 and B. cinerea. Meanwhile, Pst DC3000- or B. cinerea-induced expression of defense genes was upregulated in AtERF15-OE plants but downregulated in AtERF15-RNAi plants, as compared to the expression in wild type plants. In response to infection with B. cinerea, the AtERF15-OE plants accumulated less reactive oxygen species (ROS while the AtERF15-RNAi plants accumulated more ROS. The flg22- and chitin-induced oxidative burst was abolished and expression levels of the pattern-triggered immunity-responsive genes AtFRK1 and AtWRKY53 were suppressed in AtER15-RNAi plants upon treatment with flg22 or chitin. Furthermore, SA-induced defense response was also partially impaired in the AtERF15-RNAi plants. These data demonstrate that AtERF15 is a positive regulator of multiple layers of the immune responses in Arabidopsis.

  5. Regulation of anti-Plasmodium immunity by a LITAF-like transcription factor in the malaria vector Anopheles gambiae.

    Directory of Open Access Journals (Sweden)

    Ryan C Smith

    Full Text Available The mosquito is the obligate vector for malaria transmission. To complete its development within the mosquito, the malaria parasite Plasmodium must overcome the protective action of the mosquito innate immune system. Here we report on the involvement of the Anopheles gambiae orthologue of a conserved component of the vertebrate immune system, LPS-induced TNFα transcription factor (LITAF, and its role in mosquito anti-Plasmodium immunity. An. gambiae LITAF-like 3 (LL3 expression is up-regulated in response to midgut invasion by both rodent and human malaria parasites. Silencing of LL3 expression greatly increases parasite survival, indicating that LL3 is part of an anti-Plasmodium defense mechanism. Electrophoretic mobility shift assays identified specific LL3 DNA-binding motifs within the promoter of SRPN6, a gene that also mediates mosquito defense against Plasmodium. Further experiments indicated that these motifs play a direct role in LL3 regulation of SRPN6 expression. We conclude that LL3 is a transcription factor capable of modulating SRPN6 expression as part of the mosquito anti-Plasmodium immune response.

  6. Learning from the Messengers: Innate Sensing of Viruses and Cytokine Regulation of Immunity — Clues for Treatments and Vaccines

    Directory of Open Access Journals (Sweden)

    Jesper Melchjorsen

    2013-01-01

    Full Text Available Virus infections are a major global public health concern, and only via substantial knowledge of virus pathogenesis and antiviral immune responses can we develop and improve medical treatments, and preventive and therapeutic vaccines. Innate immunity and the shaping of efficient early immune responses are essential for control of viral infections. In order to trigger an efficient antiviral defense, the host senses the invading microbe via pattern recognition receptors (PRRs, recognizing distinct conserved pathogen-associated molecular patterns (PAMPs. The innate sensing of the invading virus results in intracellular signal transduction and subsequent production of interferons (IFNs and proinflammatory cytokines. Cytokines, including IFNs and chemokines, are vital molecules of antiviral defense regulating cell activation, differentiation of cells, and, not least, exerting direct antiviral effects. Cytokines shape and modulate the immune response and IFNs are principle antiviral mediators initiating antiviral response through induction of antiviral proteins. In the present review, I describe and discuss the current knowledge on early virus–host interactions, focusing on early recognition of virus infection and the resulting expression of type I and type III IFNs, proinflammatory cytokines, and intracellular antiviral mediators. In addition, the review elucidates how targeted stimulation of innate sensors, such as toll-like receptors (TLRs and intracellular RNA and DNA sensors, may be used therapeutically. Moreover, I present and discuss data showing how current antimicrobial therapies, including antibiotics and antiviral medication, may interfere with, or improve, immune response.

  7. Post-translational regulation of Foxp3 : identification of novel molecular targets for immune modulation

    NARCIS (Netherlands)

    van Loosdregt, J.

    2011-01-01

    Maintenance of immune homeostasis is a complex process allowing the immune system to be both aggressive enough to eradicate cells that express foreign antigens, and yet provide sensitivity to tolerate cells expressing self antigens. Key modulators allowing tolerance of host antigens, thereby

  8. Neuroendocrine-immune interaction: regulation of inflammation via G-protein coupled receptors

    NARCIS (Netherlands)

    Verburg-van Kemenade, B.M.L.; Aa, van der L.M.; Chadzinska, M.K.

    2013-01-01

    Neuroendocrine- and immune systems interact in a bi-directional fashion to communicate the status of pathogen recognition to the brain and the immune response is influenced by physiological changes. The network of ligands and their receptors involved includes cytokines and chemokines,

  9. The receptor kinase FER is a RALF-regulated scaffold controlling plant immune signaling

    NARCIS (Netherlands)

    Stegmann, Martin; Monaghan, Jacqueline; Smakowska-Luzan, Elwira; Rovenich, Hanna; Lehner, Anita; Holton, Nicholas; Belkhadir, Youssef; Zipfel, Cyril

    2017-01-01

    In plants, perception of invading pathogens involves cell-surface immune receptor kinases. Here, we report that the Arabidopsis SITE-1 PROTEASE (S1P) cleaves endogenous RAPID ALKALINIZATION FACTOR (RALF) propeptides to inhibit plant immunity. This inhibition is mediated by the malectin-like receptor

  10. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis

    NARCIS (Netherlands)

    Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia

    Scope: Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on

  11. Single-walled carbon nanotubes disturbed the immune and metabolic regulation function 13-weeks after a single intratracheal instillation

    Energy Technology Data Exchange (ETDEWEB)

    Park, Eun-Jung, E-mail: pejtoxic@hanmail.net [Myunggok Eye Research Institute, Konyang University, Daejeon 302-718 (Korea, Republic of); Hong, Young-Shick [Division of Food and Nutrition, Chonnam National University, Yongbong-Ro, Buk-Gu, Gwangju 500-757 (Korea, Republic of); Lee, Byoung-Seok [Toxicologic Pathology Center, Korea Institute of Toxicology, Daejeon (Korea, Republic of); Yoon, Cheolho [Seoul Center, Korea Basic Science Institute, Seoul 126-16 (Korea, Republic of); Jeong, Uiseok; Kim, Younghun [Department of Chemical Engineering, Kwangwoon University, Seoul 139-701 (Korea, Republic of)

    2016-07-15

    Due to their unique physicochemical properties, the potential health effects of single-walled carbon nanotubes (SWCNTs) have attracted continuous attention together with their extensive application. In this study, we aimed to identify local and systemic health effects following pulmonary persistence of SWCNTs. As expected, SWCNTs remained in the lung for 13 weeks after a single intratracheal instillation (50, 100, and 200 μg/kg). In the lung, the total number of cells and the percentages of lymphocytes and neutrophils significantly increased at 200 μg/kg compared to the control, and the Th1-polarized immune response was induced accompanying enhanced expression of tissue damage-related genes and increased release of chemokines. Additionally, SWCNTs enhanced the expression of antigen presentation-related proteins on the surface of antigen-presenting cells, however, maturation of dendritic cells was inhibited by their persistence. As compared to the control, a significant increase in the percentage of neutrophils and a remarkable decrease of BUN and potassium level were observed in the blood of mice treated with the highest dose. This was accompanied by the down-regulation of the expression of antigen presentation-related proteins on splenocytes. Moreover, protein and glucose metabolism were disturbed with an up-regulation of fatty acid β-oxidation. Taken together, we conclude that SWCNTs may induce adverse health effects by disturbing immune and metabolic regulation functions in the body. Therefore, careful application of SWCNTs is necessary for the enforcement of safety in nano-industries. - Highlights: • We evaluated local and systemic health effects following persistence of SWCNTs. • SWCNTs remained in the lung for 13 weeks after a single intratracheal instillation. • Th1-polarized immune response was induced in the lung. • The expression of antigen presentation-related proteins was altered. • Immune and metabolic regulation function were disturbed.

  12. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    Energy Technology Data Exchange (ETDEWEB)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)

    2010-07-02

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  13. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    International Nuclear Information System (INIS)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma

    2010-01-01

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  14. Deficiency of autoimmune regulator impairs the immune tolerance effect of bone marrow-derived dendritic cells in mice.

    Science.gov (United States)

    Huo, Feifei; Li, Dongbei; Zhao, Bo; Luo, Yadong; Zhao, Bingjie; Zou, Xueyang; Li, Yi; Yang, Wei

    2018-02-01

    As a transcription factor, autoimmune regulator (Aire) participates in thymic negative selection and maintains immune tolerance mainly by regulating the ectopic expression of tissue-restricted antigens (TRAs) in medullary thymic epithelial cells (mTECs). Aire is also expressed in dendritic cells (DCs). DCs are professional antigen-presenting cells (APCs) that affect the differentiation of T cells toward distinct subpopulations and participate in the immune response and tolerance, thereby playing an important role in maintaining homeostasis. To determine the role of Aire in maintaining immune tolerance by bone marrow-derived dendritic cells (BMDCs), in the present study we utilized Aire-knockout mice to examine the changes of maturation status and TRAs expression on BMDCs, additionally investigate the differentiation of CD4 + T cells. The results showed that expression of costimulatory molecule and major histocompatibility complex class II (MHC-II) molecule was increased and expression of various TRAs was decreased in BMDCs from Aire-knockout mice. Aire deficiency reduced the differentiation of naïve CD4 + T cells into type 2T helper (Th2) cells and regulatory T cells (Tregs) but enhanced the differentiation of naïve CD4 + T cells into Th1 cells, Th17 cells, and follicular helper T (Tfh) cells. The results demonstrate that Aire expressed by BMDCs plays an important role in the maintenance of homeostasis by regulating TRA expression and the differentiation of T cell subsets.

  15. Immune regulation of systemic hypertension, pulmonary arterial hypertension, and preeclampsia: shared disease mechanisms and translational opportunities.

    Science.gov (United States)

    Jafri, Salema; Ormiston, Mark L

    2017-12-01

    Systemic hypertension, preeclampsia, and pulmonary arterial hypertension (PAH) are diseases of high blood pressure in the systemic or pulmonary circulation. Beyond the well-defined contribution of more traditional pathophysiological mechanisms, such as changes in the renin-angiotensin-aldosterone system, to the development of these hypertensive disorders, there is substantial clinical evidence supporting an important role for inflammation and immunity in the pathogenesis of each of these three conditions. Over the last decade, work in small animal models, bearing targeted deficiencies in specific cytokines or immune cell subsets, has begun to clarify the immune-mediated mechanisms that drive changes in vascular structure and tone in hypertensive disease. By summarizing the clinical and experimental evidence supporting a contribution of the immune system to systemic hypertension, preeclampsia, and PAH, the current review highlights the cellular and molecular pathways that are common to all three hypertensive disorders. These mechanisms are centered on an imbalance in CD4 + helper T cell populations, defined by excessive Th17 responses and impaired T reg activity, as well as the excessive activation or impairment of additional immune cell types, including macrophages, dendritic cells, CD8 + T cells, B cells, and natural killer cells. The identification of common immune mechanisms in systemic hypertension, preeclampsia, and PAH raises the possibility of new therapeutic strategies that target the immune component of hypertension across multiple disorders. Copyright © 2017 the American Physiological Society.

  16. Differential Regulation of Two-Tiered Plant Immunity and Sexual Reproduction by ANXUR Receptor-Like Kinases.

    Science.gov (United States)

    Mang, Hyunggon; Feng, Baomin; Hu, Zhangjian; Boisson-Dernier, Aurélien; Franck, Christina M; Meng, Xiangzong; Huang, Yanyan; Zhou, Jinggeng; Xu, Guangyuan; Wang, Taotao; Shan, Libo; He, Ping

    2017-12-01

    Plants have evolved two tiers of immune receptors to detect infections: cell surface-resident pattern recognition receptors (PRRs) that sense microbial signatures and intracellular nucleotide binding domain leucine-rich repeat (NLR) proteins that recognize pathogen effectors. How PRRs and NLRs interconnect and activate the specific and overlapping plant immune responses remains elusive. A genetic screen for components controlling plant immunity identified ANXUR1 (ANX1), a malectin-like domain-containing receptor-like kinase, together with its homolog ANX2, as important negative regulators of both PRR- and NLR-mediated immunity in Arabidopsis thaliana ANX1 constitutively associates with the bacterial flagellin receptor FLAGELLIN-SENSING2 (FLS2) and its coreceptor BRI1-ASSOCIATED RECEPTOR KINASE1 (BAK1). Perception of flagellin by FLS2 promotes ANX1 association with BAK1, thereby interfering with FLS2-BAK1 complex formation to attenuate PRR signaling. In addition, ANX1 complexes with the NLR proteins RESISTANT TO PSEUDOMONAS SYRINGAE2 (RPS2) and RESISTANCE TO P. SYRINGAE PV MACULICOLA1. ANX1 promotes RPS2 degradation and attenuates RPS2-mediated cell death. Surprisingly, a mutation that affects ANX1 function in plant immunity does not disrupt its function in controlling pollen tube growth during fertilization. Our study thus reveals a molecular link between PRR and NLR protein complexes that both associate with cell surface-resident ANX1 and uncovers uncoupled functions of ANX1 and ANX2 during plant immunity and sexual reproduction. © 2017 American Society of Plant Biologists. All rights reserved.

  17. Macrophage-derived insulin-like growth factor-1 affects influenza vaccine efficacy through the regulation of immune cell homeostasis.

    Science.gov (United States)

    Yoon, Il-Sub; Park, Hyelim; Kwak, Hye-Won; Woo Jung, Yong; Nam, Jae-Hwan

    2017-08-24

    The level of antibody production induced by a vaccine involves a variety of host factors. One of these, insulin-like growth factor-1 (IGF-1), plays an important role in lymphocyte maturation and antibody expression. Here, we investigated the role of macrophage-derived IGF-1 in the induction of influenza vaccine-specific antibodies using macrophage-derived IGF-1 gene knockout (MIKO) mice. The titers of vaccine-specific total immunoglobulin G (IgG) and IgG1 after immunization were about two- to fourfold lower in MIKO mice than in WT mice. Moreover, MIKO mice showed a relatively weak booster effect of repeated immunization. In contrast, antigen-nonspecific total IgG was about threefold higher in MIKO mice than in WT mice. After viral challenge, the viral titer and the pathological damage in lungs of MIKO mice were higher than those in WT mice despite vaccination. Interestingly, the proportions of proinflammatory immune cells including M1 macrophages, Th1 and Th17 cells was higher in unvaccinated MIKO mice than in unvaccinated WT mice. This suggests that nonspecific activation of immune cells may paradoxically impair the response to the vaccine. In addition, although the proportions of T follicular helper (Tfh) cells and GL-7 + germinal center (GC) B cells were higher in MIKO mice than in WT mice, the population of CD138 + B220 + antibody-secreting plasmablasts was lower in MIKO mice, which may be a cause of the low influenza-specific antibody titer in MIKO mice. Taken together, these results suggest that macrophage-derived IGF-1 might play an important role in the vaccine-triggered immune response by regulating immune cell homeostasis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Autoimmunity in Arabidopsis acd11 Is Mediated by Epigenetic Regulation of an Immune Receptor

    DEFF Research Database (Denmark)

    Palma, K.; Thorgrimsen, S.; Malinovsky, F.G.

    2010-01-01

    Certain pathogens deliver effectors into plant cells to modify host protein targets and thereby suppress immunity. These target modifications can be detected by intracellular immune receptors, or Resistance (R) proteins, that trigger strong immune responses including localized host cell death....... The accelerated cell death 11 (acd11) "lesion mimic" mutant of Arabidopsis thaliana exhibits autoimmune phenotypes such as constitutive defense responses and cell death without pathogen perception. ACD11 encodes a putative sphingosine transfer protein, but its precise role during these processes is unknown......, and that cell death in other lesion mimic mutants may also be caused by inappropriate activation of R genes. Moreover, SDG8 is required for basal and R protein-mediated pathogen resistance in Arabidopsis, revealing the importance of chromatin remodeling as a key process in plant innate immunity....

  19. Neuroendocrine immune interaction in fish: differential regulation of phagocyte activity by neuroendocrine factors

    NARCIS (Netherlands)

    Verburg-van Kemenade, B.M.L.; Ribeiro, C.M.S.; Chadzinska, M.K.

    2011-01-01

    Coping with physical, chemical and biological disturbances depends on an extensive repertoire of physiological, endocrinological and immunological responses. Fish provide intriguing models to study bi-directional interaction between the neuroendocrine and the immune systems. Macrophages and

  20. SUMO-, MAPK- and resistance protein-signaling converge at transcription complexes that regulate plant innate immunity

    NARCIS (Netherlands)

    Burg, van den H.A.; Takken, F.L.W.

    2010-01-01

    Upon pathogen perception plant innate immune receptors activate various signaling pathways that trigger host defenses. PAMP-triggered defense signaling requires mitogen-activated protein kinase (MAPK) pathways, which modulate the activity of transcription factors through phosphorylation. Here, we

  1. SUMO-, MAPK-, and resistance protein-signaling converge at transcription complexes that regulate plant innate immunity

    NARCIS (Netherlands)

    van den Burg, H.A.; Takken, F.L.W.

    2010-01-01

    Upon pathogen perception plant innate immune receptors activate various signaling pathways that trigger host defenses. PAMP-triggered defense signaling requires mitogen-activated protein kinase (MAPK) pathways, which modulate the activity of transcription factors through phosphorylation. Here, we

  2. Adenosine A1 receptors contribute to immune regulation after neonatal hypoxic ischemic brain injury

    OpenAIRE

    Winerdal, Max; Winerdal, Malin E.; Wang, Ying-Qing; Fredholm, Bertil B.; Winqvist, Ola; Ådén, Ulrika

    2015-01-01

    Neonatal brain hypoxic ischemia (HI) often results in long-term motor and cognitive impairments. Post-ischemic inflammation greatly effects outcome and adenosine receptor signaling modulates both HI and immune cell function. Here, we investigated the influence of adenosine A1 receptor deficiency (A1R−/−) on key immune cell populations in a neonatal brain HI model. Ten-day-old mice were subjected to HI. Functional outcome was assessed by open locomotion and beam walking test and infarction siz...

  3. The role of beneficial bacteria wall elasticity in regulating innate immune response

    OpenAIRE

    ?okrozub, Viktoria V.; Lazarenko, Liudmyla M.; Sichel, Liubov M.; Babenko, Lidia P.; Lytvyn, Petro M.; Demchenko, Olga M.; Melnichenko, Yulia O.; Boyko, Nadiya V.; Biavati, Bruno; DiGioia, Diana; Bubnov, Rostyslav V.; Spivak, Mykola Ya

    2015-01-01

    Background Probiotics have great potential to contribute to development of healthy dietary regimes, preventive care, and an integrated approach to immunity-related disease management. The bacterial wall is a dynamic entity, depending on many components and playing an essential role in modulating immune response. The impact of cell wall elasticity on the beneficial effects of probiotic strains has not been sufficiently studied. The aim was to investigate the effect of lactic acid bacteria (LAB...

  4. Expression of GIMAP1, a GTPase of the immunity-associated protein family, is not up-regulated in malaria

    Directory of Open Access Journals (Sweden)

    Carter Christine

    2009-04-01

    Full Text Available Abstract Background GIMAP (GTPase of the immunity-associated protein family proteins are a family of putative GTPases believed to be regulators of cell death in lymphomyeloid cells. GIMAP1 was the first reported member of this gene family, identified as a gene up-regulated at the RNA level in the spleens of mice infected with the malarial parasite, Plasmodium chabaudi. Methods A monoclonal antibody against mouse GIMAP1 was developed and was used to analyse the expression of the endogenous protein in tissues of normal mice and in defined sub-populations of cells prepared from lymphoid tissues using flow cytometry. It was also used to assess the expression of GIMAP1 protein after infection and/or immunization of mice with P. chabaudi. Real-time PCR analysis was employed to measure the expression of GIMAP1 for comparison with the protein level analysis. Results GIMAP1 protein expression was detected in all lineages of lymphocytes (T, B, NK, in F4/80+ splenic macrophages and in some lymphoid cell lines. Additional evidence is presented suggesting that the strong expression by mature B cells of GIMAP1 and other GIMAP genes and proteins seen in mice may be a species-dependent characteristic. Unexpectedly, no increase was found in the expression of GIMAP1 in P. chabaudi infected mice at either the mRNA or protein level, and this remained so despite applying a number of variations to the protocol. Conclusion The model of up-regulation of GIMAP1 in response to infection/immunization with P. chabaudi is not a robustly reproducible experimental system. The GIMAP1 protein is widely expressed in lymphoid cells, with an interesting increase in expression in the later stages of B cell development. Alternative approaches will be required to define the functional role of this GTPase in immune cells.

  5. Overcoming Barriers between Volunteer Professionals Advising Project-Based Learning Teams with Regulation Tools

    Science.gov (United States)

    Rees Lewis, Daniel G.; Easterday, Matthew W.; Harburg, Emily; Gerber, Elizabeth M.; Riesbeck, Christopher K.

    2018-01-01

    To provide the substantial support required for project-based learning (PBL), educators can incorporate professional experts as "design coaches." However, previous work shows barriers incorporating design coaches who can rarely meet face-to-face: (1) communication online is time-consuming, (2) updating coaches online is not perceived as…

  6. β-Glucan Size Controls Dectin-1-Mediated Immune Responses in Human Dendritic Cells by Regulating IL-1β Production

    Directory of Open Access Journals (Sweden)

    Matthew J. Elder

    2017-07-01

    Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.

  7. Negative regulation of humoral immunity due to interplay between the SLAMF1, SLAMF5, and SLAMF6 receptors

    Directory of Open Access Journals (Sweden)

    Ninghai eWang

    2015-04-01

    Full Text Available Whereas the SLAMF-associated protein (SAP is involved in differentiation of TFH cells and antibody responses, the precise requirements of SLAMF receptors in humoral immune responses are incompletely understood. By analyzing mice with targeted disruptions of the SLAMF1, SLAMF5 and SLAMF6 genes, we found that both T-dependent and T-independent antibody responses were twofold higher compared to those in single knockout mice. These data suggest a suppressive synergy of SLAMF1, SLAMF5 and SLAMF6 in humoral immunity, which contrasts the decreased antibody responses resulting from a defective GC reaction in the absence of the adapter SAP. In adoptive co-transfer assays, both [Slamf1+5+6]-/- B and T cells were capable of inducing enhanced antibody responses, but more pronounced enhancement was observed after adoptive transfer of [Slamf1+5+6]-/- B cells compared to that of [Slamf1+5+6]-/- T cells. In support of [Slamf1+5+6]-/- B cell intrinsic activity, [Slamf1+5+6]-/- mice also mounted significantly higher antibody responses to T-independent type 2 antigen. Furthermore, treatment of mice with anti-SLAMF6 monoclonal antibody results in severe inhibition of the development of TFH cells and GC B cells, confirming a suppressive effect of SLAMF6. Taken together, these results establish SLAMF1, SLAMF5 and SLAMF6 as important negative regulators of humoral immune response, consistent with the notion that SLAM family receptors have dual functions in immune responses.

  8. The Mannose Receptor in Regulation of Helminth-Mediated Host Immunity

    Directory of Open Access Journals (Sweden)

    Irma van Die

    2017-11-01

    Full Text Available Infection with parasitic helminths affects humanity and animal welfare. Parasitic helminths have the capacity to modulate host immune responses to promote their survival in infected hosts, often for a long time leading to chronic infections. In contrast to many infectious microbes, however, the helminths are able to induce immune responses that show positive bystander effects such as the protection to several immune disorders, including multiple sclerosis, inflammatory bowel disease, and allergies. They generally promote the generation of a tolerogenic immune microenvironment including the induction of type 2 (Th2 responses and a sub-population of alternatively activated macrophages. It is proposed that this anti-inflammatory response enables helminths to survive in their hosts and protects the host from excessive pathology arising from infection with these large pathogens. In any case, there is an urgent need to enhance understanding of how helminths beneficially modulate inflammatory reactions, to identify the molecules involved and to promote approaches to exploit this knowledge for future therapeutic interventions. Evidence is increasing that C-type lectins play an important role in driving helminth-mediated immune responses. C-type lectins belong to a large family of calcium-dependent receptors with broad glycan specificity. They are abundantly present on immune cells, such as dendritic cells and macrophages, which are essential in shaping host immune responses. Here, we will focus on the role of the C-type lectin macrophage mannose receptor (MR in helminth–host interactions, which is a critically understudied area in the field of helminth immunobiology. We give an overview of the structural aspects of the MR including its glycan specificity, and the functional implications of the MR in helminth–host interactions focusing on a few selected helminth species.

  9. Induced ER-chaperones regulate a novel receptor-like kinase to mediate a viral innate immune response

    Science.gov (United States)

    Caplan, Jeffrey L.; Zhu, Xiaohong; Mamillapalli, Padmavathi; Marathe, Rajendra; Anandalakshmi, Radhamani; Dinesh-Kumar, S. P.

    2009-01-01

    Summary The plant innate immune response requires a rapid, global reprogramming of cellular processes. Here we employed two complementary proteomic methods, two-dimensional differential in-gel electrophoresis (2D-DIGE) and iTRAQ, to identify differentially regulated proteins early during a defense response. Besides defense-related proteins, the constituents of the largest category of up-regulated proteins were cytoplasmic- and endoplasmic reticulum (ER)-residing molecular chaperones. Silencing of ER-resident protein disulfide isomerases, NbERp57 and NbP5, and the calreticulins, NbCRT2 and NbCRT3, lead to a partial loss of N immune receptor-mediated defense against Tobacco mosaic virus (TMV). Furthermore, NbCRT2 and NbCRT3 are required for the expression of a novel induced receptor-like kinase (IRK). IRK is a plasma membrane-localized protein required for the N-mediated hypersensitive response programmed cell death (HR-PCD) and resistance to TMV. These data support a model in which ER-resident chaperones are required for the accumulation of membrane bound or secreted proteins that are necessary for innate immunity. PMID:19917500

  10. XAP5 CIRCADIAN TIMEKEEPER Positively Regulates RESISTANCE TO POWDERY MILDEW8.1–Mediated Immunity in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Yong-Ju Xu

    2017-11-01

    Full Text Available Ectopic expression of the Arabidopsis RESISTANCE TO POWDERY MILDEW8.1 (RPW8.1 boosts pattern-triggered immunity leading to enhanced resistance to different pathogens in Arabidopsis and rice. However, the underlying regulatory mechanism remains largely elusive. Here, we report that XAP5 CIRCADIAN TIMEKEEPER (XCT, At2g21150 positively regulates RPW8.1-mediated cell death and disease resistance. Forward genetic screen identified the b3-17 mutant that exhibited less cell death and susceptibility to powdery mildew and bacterial pathogens. Map-based cloning identified a G-to-A point mutation at the 3′ splice site of the 8th intron, which resulted in splice shift to 8-bp down-stream of the original splice site of XCT in b3-17, and introduced into a stop codon after two codons leading to a truncated XCT. XCT has previously been identified as a circadian clock gene required for small RNA biogenesis and acting down-stream of ETHYLENE-INSENSITIVE3 (EIN3 in the ethylene-signaling pathway. Here we further showed that mutation or down-regulation of XCT by artificial microRNA reduced RPW8.1-mediated immunity in R1Y4, a transgenic line expressing RPW8.1-YFP from the RPW8.1 native promoter. On the contrary, overexpression of XCT in R1Y4 background enhanced RPW8.1-mediated cell death, H2O2 production and resistance against powdery mildew. Consistently, the expression of RPW8.1 was down- and up-regulated in xct mutant and XCT overexpression lines, respectively. Taken together, these results indicate that XCT positively regulates RPW8.1-mediated cell death and disease resistance, and provide new insight into the regulatory mechanism of RPW8.1-mediated immunity.

  11. Sphingosine 1-Phosphate (S1P) Carrier-dependent Regulation of Endothelial Barrier

    Science.gov (United States)

    Wilkerson, Brent A.; Grass, G. Daniel; Wing, Shane B.; Argraves, W. Scott; Argraves, Kelley M.

    2012-01-01

    Sphingosine 1-phosphate (S1P) is a blood-borne lysosphingolipid that acts to promote endothelial cell (EC) barrier function. In plasma, S1P is associated with both high density lipoproteins (HDL) and albumin, but it is not known whether the carriers impart different effects on S1P signaling. Here we establish that HDL-S1P sustains EC barrier longer than albumin-S1P. We showed that the sustained barrier effects of HDL-S1P are dependent on signaling by the S1P receptor, S1P1, and involve persistent activation of Akt and endothelial NOS (eNOS), as well as activity of the downstream NO target, soluble guanylate cyclase (sGC). Total S1P1 protein levels were found to be higher in response to HDL-S1P treatment as compared with albumin-S1P, and this effect was not associated with increased S1P1 mRNA or dependent on de novo protein synthesis. Several pieces of evidence indicate that long term EC barrier enhancement activity of HDL-S1P is due to specific effects on S1P1 trafficking. First, the rate of S1P1 degradation, which is proteasome-mediated, was slower in HDL-S1P-treated cells as compared with cells treated with albumin-S1P. Second, the long term barrier-promoting effects of HDL-S1P were abrogated by treatment with the recycling blocker, monensin. Finally, cell surface levels of S1P1 and levels of S1P1 in caveolin-enriched microdomains were higher after treatment with HDL-S1P as compared with albumin-S1P. Together, the findings reveal S1P carrier-specific effects on S1P1 and point to HDL as the physiological mediator of sustained S1P1-PI3K-Akt-eNOS-sGC-dependent EC barrier function. PMID:23135269

  12. Concerted regulation of retinal pigment epithelium basement membrane and barrier function by angiocrine factors.

    Science.gov (United States)

    Benedicto, Ignacio; Lehmann, Guillermo L; Ginsberg, Michael; Nolan, Daniel J; Bareja, Rohan; Elemento, Olivier; Salfati, Zelda; Alam, Nazia M; Prusky, Glen T; Llanos, Pierre; Rabbany, Sina Y; Maminishkis, Arvydas; Miller, Sheldon S; Rafii, Shahin; Rodriguez-Boulan, Enrique

    2017-05-19

    The outer blood-retina barrier is established through the coordinated terminal maturation of the retinal pigment epithelium (RPE), fenestrated choroid endothelial cells (ECs) and Bruch's membrane, a highly organized basement membrane that lies between both cell types. Here we study the contribution of choroid ECs to this process by comparing their gene expression profile before (P5) and after (P30) the critical postnatal period when mice acquire mature visual function. Transcriptome analyses show that expression of extracellular matrix-related genes changes dramatically over this period. Co-culture experiments support the existence of a novel regulatory pathway: ECs secrete factors that remodel RPE basement membrane, and integrin receptors sense these changes triggering Rho GTPase signals that modulate RPE tight junctions and enhance RPE barrier function. We anticipate our results will spawn a search for additional roles of choroid ECs in RPE physiology and disease.

  13. Curcumin-mediated regulation of intestinal barrier function: The mechanism underlying its beneficial effects.

    Science.gov (United States)

    Ghosh, Siddhartha S; He, Hongliang; Wang, Jing; Gehr, Todd W; Ghosh, Shobha

    2018-01-02

    Curcumin has anti-inflammatory, anti-oxidant and anti-proliferative properties established largely by in vitro studies. Accordingly, oral administration of curcumin beneficially modulates many diseases including diabetes, fatty-liver disease, atherosclerosis, arthritis, cancer and neurological disorders such as depression, Alzheimer's or Parkinson's disease. However, limited bioavailability and inability to detect curcumin in circulation or target tissues has hindered the validation of a causal role. We established curcumin-mediated decrease in the release of gut bacteria-derived lipopolysaccharide (LPS) into circulation by maintaining the integrity of the intestinal barrier function as the mechanism underlying the attenuation of metabolic diseases (diabetes, atherosclerosis, kidney disease) by curcumin supplementation precluding the need for curcumin absorption. In view of the causative role of circulating LPS and resulting chronic inflammation in the development of diseases listed above, this review summarizes the mechanism by which curcumin affects the several layers of the intestinal barrier and, despite negligible absorption, can beneficially modulate these diseases.

  14. Pathogenesis of cerebral palsy through the prism of immune regulation of nervous tissue homeostasis: literature review.

    Science.gov (United States)

    Lisovska, Natalya; Daribayev, Zholtay; Lisovskyy, Yevgeny; Kussainova, Kenzhe; Austin, Lana; Bulekbayeva, Sholpan

    2016-11-01

    The cerebral palsy is highly actual issue of pediatrics, causing significant neurological disability. Though the great progress in the neuroscience has been recently achieved, the pathogenesis of cerebral palsy is still poorly understood. In this work, we reviewed available experimental and clinical data concerning the role of immune cells in pathogenesis of cerebral palsy. Maintaining of homeostasis in nervous tissue and its transformation in case of periventricular leukomalacia were analyzed. The reviewed data demonstrate involvement of immune regulatory cells in the formation of nervous tissue imbalance and chronicity of inborn brain damage. The supported opinion, that periventricular leukomalacia is not a static phenomenon, but developing process, encourages our optimism about the possibility of its correction. The further studies of changes of the nervous and immune systems in cerebral palsy are needed to create fundamentally new directions of the specific therapy and individual schemes of rehabilitation.

  15. Effect of glutamine-enriched nutritional support on intestinal mucosal barrier function, MMP-2, MMP-9 and immune function in patients with advanced gastric cancer during perioperative chemotherapy.

    Science.gov (United States)

    Wang, Juan; Li, Yanfen; Qi, Yuanling

    2017-09-01

    We studied the effects of glutamine-enriched nutritional support on intestinal mucosal barrier, matrix metalloproteinase (MMP)-2, MMP-9 and immune function during perioperative chemotherapy in patients with advanced gastric cancer. The study was conducted on 94 patients with advanced gastric cancer admitted from April 2015 to March 2016. They were randomly divided into observation and control groups, n=47. Control group was given basic nutritional support whereas glutamine-enriched nutritional support was given to patients in observation group. High-performance liquid chromatography was used to measure lactulose and mannitol ratio in urine (L/M) and ELISA was used to measure D-lactate levels before chemotherapy and in the 1st, 2nd and 3rd cycle of chemotherapy. Immunoglobulin level was detected by immune turbidimetry assay, T lymphocyte subsets were determined by flow cytometry after 3 cycles of chemotherapy, MMP-2 and MMP-9 of patients were compared between the two groups. The serious adverse reactions incidence (grade and IV) of patients were observed. To evaluate the life quality of patients, QLQ-C30 was used after 6 months. The levels of L/M and D-lactate in both groups after the first cycle of chemotherapy were significantly higher than that before chemotherapy; they began to decline after the second or third cycle, but were still significantly higher than the levels before chemotherapy (pgroups after 1st, 2nd, 3rd cycle after chemotherapy, L/M and D-lactate levels of patients in the observation group were significantly lower than in the control group (pgroup was significantly lower than control group (pgroup were significantly higher than control group (pnutritional support can effectively protect the intestinal mucosal barrier function in patients with advanced gastric cancer in their perioperative chemotherapy, improve the level of MMP-2 and MMP-9 in patients with advanced gastric cancer, enhance their immune function, reduce the incidence of adverse

  16. Barriers to access to opioid medicines for patients with opioid dependence: a review of legislation and regulations in eleven central and eastern European countries.

    Science.gov (United States)

    Vranken, Marjolein J M; Mantel-Teeuwisse, Aukje K; Jünger, Saskia; Radbruch, Lukas; Scholten, Willem; Lisman, John A; Subataite, Marija; Schutjens, Marie-Hélène D B

    2017-06-01

    Barriers linked to drug control systems are considered to contribute to inequitable access to controlled medicines, leaving millions of people in pain and suffering. Most studies focus on access to opioids for the treatment of severe (cancer) pain. This study aims to identify specific access barriers for patients with opioid dependence in legislation and regulations of 11 central and eastern European countries. This study builds on a previous analysis of legislation and regulations as part of the EU 7th Framework Access To Opioid Medication in Europe (ATOME) project. An in-depth analysis was undertaken to determine specific barriers for patients with opioid dependence in need of opioid analgesics or opioid agonist therapy (OAT). For each country, the number and nature of specific potential barriers for these patients were assessed according to eight categories: prescribing; dispensing; manufacturing; usage; trade and distribution; affordability; penalties; and other. An additional keyword search was conducted to minimize the omission of barriers. Barriers in an additional category, language, were recorded qualitatively. Countries included Bulgaria, Cyprus, Estonia, Greece, Hungary, Latvia, Lithuania, Serbia, Slovakia, Slovenia and Turkey. Ten of the 11 countries (all except Estonia) showed specific potential barriers in their legislation and regulations. The total number of barriers varied from two (Slovenia) to 46 (Lithuania); the number of categories varied from one (Slovenia) to five (Lithuania). Most specific potential barriers were shown in the categories 'prescribing', 'usage' and 'other'. The total number in a single category varied from one to 18 (Lithuania, prescribing). Individual differences between countries in the same specific potential barrier were shown; for example, variation in minimum age criteria for admission to OAT ranging from 15 (Lithuania, in special cases) to 20 years (Greece). All countries had stigmatizing language in their legislation

  17. Listeria monocytogenes Induces a Virulence-Dependent microRNA Signature That Regulates the Immune Response in Galleria mellonella

    Directory of Open Access Journals (Sweden)

    Gopala K. Mannala

    2017-12-01

    Full Text Available microRNAs (miRNAs coordinate several physiological and pathological processes by regulating the fate of mRNAs. Studies conducted in vitro indicate a role of microRNAs in the control of host-microbe interactions. However, there is limited understanding of miRNA functions in in vivo models of bacterial infections. In this study, we systematically explored changes in miRNA expression levels of Galleria mellonella larvae (greater-wax moth, a model system that recapitulates the vertebrate innate immunity, following infection with L. monocytogenes. Using an insect-specific miRNA microarray with more than 2000 probes, we found differential expression of 90 miRNAs (39 upregulated and 51 downregulated in response to infection with L. monocytogenes. We validated the expression of a subset of miRNAs which have mammalian homologs of known or predicted function. In contrast, non-pathogenic L. innocua failed to induce these miRNAs, indicating a virulence-dependent miRNA deregulation. To predict miRNA targets using established algorithms, we generated a publically available G. mellonella transcriptome database. We identified miRNA targets involved in innate immunity, signal transduction and autophagy, including spätzle, MAP kinase, and optineurin, respectively, which exhibited a virulence-specific differential expression. Finally, in silico estimation of minimum free energy of miRNA-mRNA duplexes of validated microRNAs and target transcripts revealed a regulatory network of the host immune response to L. monocytogenes. In conclusion, this study provides evidence for a role of miRNAs in the regulation of the innate immune response following bacterial infection in a simple, rapid and scalable in vivo model that may predict host-microbe interactions in higher vertebrates.

  18. Respiratory Syncytial Virus-Infected Mesenchymal Stem Cells Regulate Immunity via Interferon Beta and Indoleamine-2,3-Dioxygenase.

    Directory of Open Access Journals (Sweden)

    Michael B Cheung

    Full Text Available Respiratory syncytial virus (RSV has been reported to infect human mesenchymal stem cells (MSCs but the consequences are poorly understood. MSCs are present in nearly every organ including the nasal mucosa and the lung and play a role in regulating immune responses and mediating tissue repair. We sought to determine whether RSV infection of MSCs enhances their immune regulatory functions and contributes to RSV-associated lung disease. RSV was shown to replicate in human MSCs by fluorescence microscopy, plaque assay, and expression of RSV transcripts. RSV-infected MSCs showed differentially altered expression of cytokines and chemokines such as IL-1β, IL6, IL-8 and SDF-1 compared to epithelial cells. Notably, RSV-infected MSCs exhibited significantly increased expression of IFN-β (~100-fold and indoleamine-2,3-dioxygenase (IDO (~70-fold than in mock-infected MSCs. IDO was identified in cytosolic protein of infected cells by Western blots and enzymatic activity was detected by tryptophan catabolism assay. Treatment of PBMCs with culture supernatants from RSV-infected MSCs reduced their proliferation in a dose dependent manner. This effect on PBMC activation was reversed by treatment of MSCs with the IDO inhibitors 1-methyltryptophan and vitamin K3 during RSV infection, a result we confirmed by CRISPR/Cas9-mediated knockout of IDO in MSCs. Neutralizing IFN-β prevented IDO expression and activity. Treatment of MSCs with an endosomal TLR inhibitor, as well as a specific inhibitor of the TLR3/dsRNA complex, prevented IFN-β and IDO expression. Together, these results suggest that RSV infection of MSCs alters their immune regulatory function by upregulating IFN-β and IDO, affecting immune cell proliferation, which may account for the lack of protective RSV immunity and for chronicity of RSV-associated lung diseases such as asthma and COPD.

  19. The selenium metabolite methylselenol regulates the expression of ligands that trigger immune activation through the lymphocyte receptor NKG2D

    DEFF Research Database (Denmark)

    Hagemann-Jensen, Michael Henrik; Uhlenbrock, Franziska Katharina; Kehlet, Stephanie

    2014-01-01

    For decades Selenium (Se) research has been focused on the identification of active metabolites, which are crucial for Se chemoprevention of cancer. In this context, the metabolite methylselenol (CH3SeH) is known for its action to selectively kill transformed cells through mechanisms that include...... ligands. A balanced cell-surface expression of NKG2D ligands is considered as an innate barrier against tumor development. Our work therefore indicates that the application of selenium compounds, which are metabolized to CH3SeH, could improve NKG2D-based immune therapy.......: Increased formation of reactive oxygen species (ROS), induction of DNA damage, triggering of apoptosis and the inhibition of angiogenesis. Here, we revealed that CH3SeH modulates cell surface expression of NKG2D ligands. The expression of NKG2D ligands is induced by stress-associated pathways, which occur...

  20. The calcium-dependent protein kinase CPK28 buffers plant immunity and regulates BIK1 turnover

    DEFF Research Database (Denmark)

    Monaghan, Jacqueline; Matschi, Susanne; Shorinola, Oluwaseyi

    2014-01-01

    Plant perception of pathogen-associated molecular patterns (PAMPs) triggers a phosphorylation relay leading to PAMP-triggered immunity (PTI). Despite increasing knowledge of PTI signaling, how immune homeostasis is maintained remains largely unknown. Here we describe a forward-genetic screen...... the plasma-membrane-associated cytoplasmic kinase BIK1, an important convergent substrate of multiple pattern recognition receptor (PRR) complexes. We find that BIK1 is rate limiting in PTI signaling and that it is continuously turned over to maintain cellular homeostasis. We further show that CPK28...

  1. Regulation of dendritic cell development by GM-CSF: molecular control and implications for immune homeostasis and therapy.

    Science.gov (United States)

    van de Laar, Lianne; Coffer, Paul J; Woltman, Andrea M

    2012-04-12

    Dendritic cells (DCs) represent a small and heterogeneous fraction of the hematopoietic system, specialized in antigen capture, processing, and presentation. The different DC subsets act as sentinels throughout the body and perform a key role in the induction of immunogenic as well as tolerogenic immune responses. Because of their limited lifespan, continuous replenishment of DC is required. Whereas the importance of GM-CSF in regulating DC homeostasis has long been underestimated, this cytokine is currently considered a critical factor for DC development under both steady-state and inflammatory conditions. Regulation of cellular actions by GM-CSF depends on the activation of intracellular signaling modules, including JAK/STAT, MAPK, PI3K, and canonical NF-κB. By directing the activity of transcription factors and other cellular effector proteins, these pathways influence differentiation, survival and/or proliferation of uncommitted hematopoietic progenitors, and DC subset-specific precursors, thereby contributing to specific aspects of DC subset development. The specific intracellular events resulting from GM-CSF-induced signaling provide a molecular explanation for GM-CSF-dependent subset distribution as well as clues to the specific characteristics and functions of GM-CSF-differentiated DCs compared with DCs generated by fms-related tyrosine kinase 3 ligand. This knowledge can be used to identify therapeutic targets to improve GM-CSF-dependent DC-based strategies to regulate immunity.

  2. Regulation of Innate Immune Responses is Required for S. mansoni Development

    Science.gov (United States)

    2013-01-07

    Trop Med Hyg 48: 496-503. 52. Patton EA, Brunet LR, La Flamme AC, Pedras- Vasconcelos J, Kopf M, et al. (2001) Severe schistosomiasis in the absence of...dependent on immune priming during parasite maturation. J Immunol 158: 301-307. 14. Patton EA, Brunet LR, La Flamme AC, Pedras- Vasconcelos J, Kopf M

  3. The Role of Epigenetic Regulation in Transcriptional Memory in the Immune System.

    Science.gov (United States)

    Woodworth, A M; Holloway, A F

    The immune system is exquisitely poised to identify, respond to, and eradicate pathogens from the body, as well as to produce a more rapid and augmented response to a subsequent encounter with the pathogen. These cellular responses rely on the highly coordinated and rapid activation of gene expression programs as well as the ability of the cell to retain a memory of the initial gene response. It is clear that chromatin structure and epigenetic mechanisms play a crucial role in determining these gene responses, and in fact the immune system has proved an instructive model for investigating the multifaceted mechanisms through which the chromatin landscape contributes to gene expression programs. These mechanisms include modifications to the DNA and histone proteins, the positioning, composition, and remodeling of nucleosomes, as well as the formation of higher-order chromatin structures. Moreover, it is now apparent that epigenetic mechanisms also provide an instrument by which cells can retain memory of the initial transcriptional response, "priming" the genome so that it can respond more quickly to subsequent exposure to the signal. Here, we use the immune system as a model to demonstrate the complex interplay between transcription factors and the chromatin landscape required to orchestrate precise gene responses to external stimuli and further to demonstrate how these interactions can establish memory of past transcriptional events. We focus on what we have learnt from the immune system and how this can inform our understanding of other cellular systems. © 2017 Elsevier Inc. All rights reserved.

  4. Exosome RNA Released by Hepatocytes Regulates Innate Immune Responses to Hepatitis B Virus Infection

    Directory of Open Access Journals (Sweden)

    Takahisa Kouwaki

    2016-08-01

    Full Text Available The innate immune system is essential for controlling viral infection. Hepatitis B virus (HBV persistently infects human hepatocytes and causes hepatocellular carcinoma. However, the innate immune response to HBV infection in vivo remains unclear. Using a tree shrew animal model, we showed that HBV infection induced hepatic interferon (IFN-γ expression during early infection. Our in vitro study demonstrated that hepatic NK cells produced IFN-γ in response to HBV only in the presence of hepatic F4/80+ cells. Moreover, extracellular vesicles released from HBV-infected hepatocytes contained viral nucleic acids and induced NKG2D ligand expression in macrophages by stimulating MyD88, TICAM-1, and MAVS-dependent pathways. In addition, depletion of exosomes from extracellular vesicles markedly reduced NKG2D ligand expression, suggesting the importance of exosomes for NK cell activation. In contrast, infection of hepatocytes with HBV increased immunoregulatory microRNA levels in extracellular vesicles and exosomes, which were transferred to macrophages, thereby suppressing IL-12p35 mRNA expression in macrophages to counteract the host innate immune response. IFN-γ increased the hepatic expression of DDX60 and augmented the DDX60-dependent degradation of cytoplasmic HBV RNA. Our results elucidated the crucial role of exosomes in antiviral innate immune response against HBV.

  5. Immune regulation following pediatric cardiac surgery - What goes up must come down

    NARCIS (Netherlands)

    Schadenberg, A.W.L.

    2013-01-01

    The immune system is a dynamic system that is designed to respond rapidly to potential harmful stimuli. Following activation tight control mechanisms are in place to avoid collateral damage. Cardiac surgery is well known to induce an acute systemic inflammatory response and therefore, elective

  6. Inhalable Andrographolide-β-cyclodextrin Inclusion Complexes for Treatment of Staphylococcus aureus Pneumonia by Regulating Immune Responses.

    Science.gov (United States)

    Zhang, Tongtong; Zhu, Lifei; Li, Miao; Hu, Yuzhen; Zhang, Erfeng; Jiang, Qingcheng; Han, Guang; Jin, Yiguang

    2017-05-01

    Bacterial pneumonia is a serious disease with high mortality if no appropriate and immediate therapy is available. Andrographolide (AG) is an anti-inflammatory agent extracted from a traditional Chinese herb andrographis paniculata. Oral AG tablets and pills are clinically applied for treatment of upper respiratory tract infections. However, the low solubility and bioavailability of AG lead to high doses and long-term therapy. Here we developed an andrographolide-β-cyclodextrin inclusion complex (AG-β-CD) for inhalation therapy of Staphylococcus aureus pneumonia. AG-β-CD was identified with X-ray diffraction and FT-IR. Surprisingly, both AG-β-CD and AG showed little in vitro anti-S. aureus activity. However, pulmonary delivery of AG, AG-β-CD, or penicillin had significant anti-S. aureus pneumonia effects. Leukocytes, neutrophils, white blood cells, total proteins, TNF-α, IL-6, NF-κB p65 expression, and bacterial colonies in the bronchoalveolar lavage fluids were detected. Pulmonary delivery of AG and AG-β-CD led to bacterial inhibition and inflammation alleviation by regulating immune responses, while penicillin only killed bacteria without significant immune regulation. Moreover, the antipneumonia activity of AG-β-CD was much higher than that of AG, probably resulting from locally accelerated AG dissolution due to β-CD inclusion. The aerodynamic diameter of AG-β-CD powders was 2.03 μm, suitable for pulmonary delivery. Inhalable AG-β-CD is a promising antibacterial and anti-inflammatory medicine for the treatment of S. aureus pneumonia by regulating immune responses, and the effect is enhanced by β-CD inclusion. AG and its formulations might be potent weapons against the resistant bacterial pneumonia due to their specific mechanism in the future.

  7. Identification of Methylosome Components as Negative Regulators of Plant Immunity Using Chemical Genetics.

    Science.gov (United States)

    Huang, Shuai; Balgi, Aruna; Pan, Yaping; Li, Meng; Zhang, Xiaoran; Du, Lilin; Zhou, Ming; Roberge, Michel; Li, Xin

    2016-12-05

    Nucleotide-binding leucine-rich repeat (NLR) proteins serve as immune receptors in both plants and animals. To identify components required for NLR-mediated immunity, we designed and carried out a chemical genetics screen to search for small molecules that can alter immune responses in Arabidopsis thaliana. From 13 600 compounds, we identified Ro 8-4304 that was able to specifically suppress the severe autoimmune phenotypes of chs3-2D (chilling sensitive 3, 2D), including the arrested growth morphology and heightened PR (Pathogenesis Related) gene expression. Further, six Ro 8-4304 insensitive mutants were uncovered from the Ro 8-4304-insensitive mutant (rim) screen using a mutagenized chs3-2D population. Positional cloning revealed that rim1 encodes an allele of AtICln (I, currents; Cl, chloride; n, nucleotide). Genetic and biochemical analysis demonstrated that AtICln is in the same protein complex with the methylosome components small nuclear ribonucleoprotein D3b (SmD3b) and protein arginine methyltransferase 5 (PRMT5), which are required for the biogenesis of small nuclear ribonucleoproteins (snRNPs) involved in mRNA splicing. Double mutant analysis revealed that SmD3b is also involved in the sensitivity to Ro 8-4304, and the prmt5-1 chs3-2D double mutant is lethal. Loss of AtICln, SmD3b, or PRMT5 function results in enhanced disease resistance against the virulent oomycete pathogen Hyaloperonospora arabidopsidis Noco2, suggesting that mRNA splicing plays a previously unknown negative role in plant immunity. The successful implementation of a high-throughput chemical genetic screen and the identification of a small-molecule compound affecting plant immunity indicate that chemical genetics is a powerful tool to study whole-organism plant defense pathways. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

  8. Innate Lymphoid Cells (ILCs): Cytokine Hubs Regulating Immunity and Tissue Homeostasis

    NARCIS (Netherlands)

    Nagasawa, Maho; Spits, Hergen; Ros, Xavier Romero

    2017-01-01

    Innate lymphoid cells (ILCs) have emerged as an expanding family of effector cells particularly enriched in the mucosal barriers. ILCs are promptly activated by stress signals and multiple epithelial- and myeloid-cell-derived cytokines. In response, ILCs rapidly secrete effector cytokines, which

  9. Hydrogel elasticity and microarchitecture regulate dental-derived mesenchymal stem cell-host immune system cross-talk.

    Science.gov (United States)

    Ansari, Sahar; Chen, Chider; Hasani-Sadrabadi, Mohammad Mahdi; Yu, Bo; Zadeh, Homayoun H; Wu, Benjamin M; Moshaverinia, Alireza

    2017-09-15

    The host immune system (T-lymphocytes and their pro-inflammatory cytokines) has been shown to compromise bone regeneration ability of mesenchymal stem cells (MSCs). We have recently shown that hydrogel, used as an encapsulating biomaterial affects the cross-talk among host immune cells and MSCs. However, the role of hydrogel elasticity and porosity in regulation of cross-talk between dental-derived MSCs and immune cells is unclear. In this study, we demonstrate that the modulus of elasticity and porosity of the scaffold influence T-lymphocyte-dental MSC interplay by regulating the penetration of inflammatory T cells and their cytokines. Moreover, we demonstrated that alginate hydrogels with different elasticity and microporous structure can regulate the viability and determine the fate of the encapsulated MSCs through modulation of NF-kB pathway. Our in vivo data show that alginate hydrogels with smaller pores and higher elasticity could prevent pro-inflammatory cytokine-induced MSC apoptosis by down-regulating the Caspase-3- and 8- associated proapoptotic cascades, leading to higher amounts of ectopic bone regeneration. Additionally, dental-derived MSCs encapsulated in hydrogel with higher elasticity exhibited lower expression levels of NF-kB p65 and Cox-2 in vivo. Taken together, our findings demonstrate that the mechanical characteristics and microarchitecture of the microenvironment encapsulating MSCs, in addition to presence of T-lymphocytes and their pro-inflammatory cytokines, affect the fate of encapsulated dental-derived MSCs. In this study, we demonstrate that alginate hydrogel regulates the viability and the fate of the encapsulated dental-derived MSCs through modulation of NF-kB pathway. Alginate hydrogels with smaller pores and higher elasticity prevent pro-inflammatory cytokine-induced MSC apoptosis by down-regulating the Caspase-3- and 8- associated proapoptotic cascade, leading to higher amounts of ectopic bone regeneration. MSCs encapsulated in

  10. Foxp3(+) T cells regulate immunoglobulin a selection and facilitate diversification of bacterial species responsible for immune homeostasis.

    Science.gov (United States)

    Kawamoto, Shimpei; Maruya, Mikako; Kato, Lucia M; Suda, Wataru; Atarashi, Koji; Doi, Yasuko; Tsutsui, Yumi; Qin, Hongyan; Honda, Kenya; Okada, Takaharu; Hattori, Masahira; Fagarasan, Sidonia

    2014-07-17

    Foxp3(+) T cells play a critical role for the maintenance of immune tolerance. Here we show that in mice, Foxp3(+) T cells contributed to diversification of gut microbiota, particularly of species belonging to Firmicutes. The control of indigenous bacteria by Foxp3(+) T cells involved regulatory functions both outside and inside germinal centers (GCs), consisting of suppression of inflammation and regulation of immunoglobulin A (IgA) selection in Peyer's patches, respectively. Diversified and selected IgAs contributed to maintenance of diversified and balanced microbiota, which in turn facilitated the expansion of Foxp3(+) T cells, induction of GCs, and IgA responses in the gut through a symbiotic regulatory loop. Thus, the adaptive immune system, through cellular and molecular components that are required for immune tolerance and through the diversification as well as selection of antibody repertoire, mediates host-microbial symbiosis by controlling the richness and balance of bacterial communities required for homeostasis. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Conditional ablation of CD205+ conventional dendritic cells impacts the regulation of T-cell immunity and homeostasis in vivo.

    Science.gov (United States)

    Fukaya, Tomohiro; Murakami, Ryuichi; Takagi, Hideaki; Sato, Kaori; Sato, Yumiko; Otsuka, Haruna; Ohno, Michiko; Hijikata, Atsushi; Ohara, Osamu; Hikida, Masaki; Malissen, Bernard; Sato, Katsuaki

    2012-07-10

    Dendritic cells (DCs) are composed of multiple subsets that play a dual role in inducing immunity and tolerance. However, it is unclear how CD205(+) conventional DCs (cDCs) control immune responses in vivo. Here we generated knock-in mice with the selective conditional ablation of CD205(+) cDCs. CD205(+) cDCs contributed to antigen-specific priming of CD4(+) T cells under steady-state conditions, whereas they were dispensable for antigen-specific CD4(+) T-cell responses under inflammatory conditions. In contrast, CD205(+) cDCs were required for antigen-specific priming of CD8(+) T cells to generate cytotoxic T lymphocytes (CTLs) mediated through cross-presentation. Although CD205(+) cDCs were involved in the thymic generation of CD4(+) regulatory T cells (Tregs), they maintained the homeostasis of CD4(+) Tregs and CD4(+) effector T cells in peripheral and mucosal tissues. On the other hand, CD205(+) cDCs were involved in the inflammation triggered by Toll-like receptor ligand as well as bacterial and viral infections. Upon microbial infections, CD205(+) cDCs contributed to the cross-priming of CD8(+) T cells for generating antimicrobial CTLs to efficiently eliminate pathogens, whereas they suppressed antimicrobial CD4(+) T-cell responses. Thus, these findings reveal a critical role for CD205(+) cDCs in the regulation of T-cell immunity and homeostasis in vivo.

  12. Homeostatic NF-κB Signaling in Steady-State Migratory Dendritic Cells Regulates Immune Homeostasis and Tolerance.

    Science.gov (United States)

    Baratin, Myriam; Foray, Chloe; Demaria, Olivier; Habbeddine, Mohamed; Pollet, Emeline; Maurizio, Julien; Verthuy, Christophe; Davanture, Suzel; Azukizawa, Hiroaki; Flores-Langarica, Adriana; Dalod, Marc; Lawrence, Toby

    2015-04-21

    Migratory non-lymphoid tissue dendritic cells (NLT-DCs) transport antigens to lymph nodes (LNs) and are required for protective immune responses in the context of inflammation and to promote tolerance to self-antigens in steady-state. However, the molecular mechanisms that elicit steady-state NLT-DC maturation and migration are unknown. By comparing the transcriptome of NLT-DCs in the skin with their migratory counterparts in draining LNs, we have identified a novel NF-κB-regulated gene network specific to migratory DCs. We show that targeted deletion of IKKβ in DCs, a major activator of NF-κB, prevents NLT-DC accumulation in LNs and compromises regulatory T cell conversion in vivo. This was associated with impaired tolerance and autoimmunity. NF-κB is generally considered the prototypical pro-inflammatory transcription factor, but this study describes a role for NF-κB signaling in DCs for immune homeostasis and tolerance that could have implications in autoimmune diseases and immunity. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Tumor necrosis factor receptor- associated factor 6 (TRAF6) regulation of development, function, and homeostasis of the immune system.

    Science.gov (United States)

    Walsh, Matthew C; Lee, JangEun; Choi, Yongwon

    2015-07-01

    Tumor necrosis factor receptor (TNFR)-associated factor 6 (TRAF6) is an adapter protein that mediates a wide array of protein-protein interactions via its TRAF domain and a RING finger domain that possesses non-conventional E3 ubiquitin ligase activity. First identified nearly two decades ago as a mediator of interleukin-1 receptor (IL-1R)-mediated activation of NFκB, TRAF6 has since been identified as an actor downstream of multiple receptor families with immunoregulatory functions, including members of the TNFR superfamily, the Toll-like receptor (TLR) family, tumor growth factor-β receptors (TGFβR), and T-cell receptor (TCR). In addition to NFκB, TRAF6 may also direct activation of mitogen-activated protein kinase (MAPK), phosphoinositide 3-kinase (PI3K), and interferon regulatory factor pathways. In the context of the immune system, TRAF6-mediated signals have proven critical for the development, homeostasis, and/or activation of B cells, T cells, and myeloid cells, including macrophages, dendritic cells, and osteoclasts, as well as for organogenesis of thymic and secondary lymphoid tissues. In multiple cellular contexts, TRAF6 function is essential not only for proper activation of the immune system but also for maintaining immune tolerance, and more recent work has begun to identify mechanisms of contextual specificity for TRAF6, involving both regulatory protein interactions, and messenger RNA regulation by microRNAs. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Tumor necrosis factor receptor associated factor 6 (TRAF6) regulation of development, function, and homeostasis of the immune system

    Science.gov (United States)

    Walsh, Matthew C.; Lee, JangEun; Choi, Yongwon

    2016-01-01

    Summary Tumor necrosis factor receptor (TNFR)-associated factor 6 (TRAF6) is an adaptor protein that mediates a wide array of protein-protein interactions via its TRAF domain and a RING finger domain that possesses non-conventional E3 ubiquitin ligase activity. First identified nearly two decades ago as a mediator of IL-1 receptor (IL-1R)-mediated activation of NFκB, TRAF6 has since been identified as an actor downstream of multiple receptor families with immunoregulatory functions, including members of the TNFR superfamily, the toll-like receptor (TLR) family, tumor growth factor-β receptors (TGFβR), and T cell receptor (TCR). In addition to NFκB, TRAF6 may also direct activation of mitogen-activated protein kinase (MAPK), phosphoinositide 3-kinase (PI3K), and interferon regulatory factor (IRF) pathways. In the context of the immune system, TRAF6-mediated signals have proven critical for the development, homeostasis, and/or activation of B cells, T cells, and myeloid cells, including macrophages, dendritic cells, and osteoclasts, as well as for organogenesis of thymic and secondary lymphoid tissues. In multiple cellular contexts, TRAF6 function is essential not only for proper activation of the immune system, but also for maintaining immune tolerance, and more recent works have begun to identify mechanisms of contextual specificity for TRAF6, involving both regulatory protein interactions, and messenger RNA regulation by microRNAs. PMID:26085208

  15. Semaphorin7A and its receptors: pleiotropic regulators of immune cell function, bone homeostasis, and neural development.

    Science.gov (United States)

    Jongbloets, Bart C; Ramakers, Geert M J; Pasterkamp, R Jeroen

    2013-03-01

    Semaphorins form a large, evolutionary conserved family of cellular guidance signals. The semaphorin family contains several secreted and transmembrane proteins, but only one GPI-anchored member, Semaphorin7A (Sema7A). Although originally identified in immune cells, as CDw108, Sema7A displays widespread expression outside the immune system. It is therefore not surprising that accumulating evidence supports roles for this protein in a wide variety of biological processes in different organ systems and in disease. Well-characterized biological effects of Sema7A include those during bone and immune cell regulation, neuron migration and neurite growth. These effects are mediated by two receptors, plexinC1 and integrins. However, most of what is known today about Sema7A signaling concerns Sema7A-integrin interactions. Here, we review our current knowledge of Sema7A function and signaling in different organ systems, highlighting commonalities between the cellular effects and signaling pathways activated by Sema7A in different cell types. Furthermore, we discuss a potential role for Sema7A in disease and provide directions for further research. Copyright © 2013 Elsevier Ltd. All rights reserved.

  16. Genetic association analyses implicate aberrant regulation of innate and adaptive immunity genes in the pathogenesis of systemic lupus erythematosus

    Science.gov (United States)

    Graham, Deborah S Cunninghame; Pinder, Christopher L; Tombleson, Philip; Behrens, Timothy W; Martín, Javier; Fairfax, Benjamin P; Knight, Julian C; Chen, Lingyan; Replogle, Joseph; Syvänen, Ann-Christine; Rönnblom, Lars; Graham, Robert R; Wither, Joan E; Rioux, John D; Alarcón-Riquelme, Marta E; Vyse, Timothy J

    2015-01-01

    Systemic lupus erythematosus (SLE; OMIM 152700) is a genetically complex autoimmune disease characterized by loss of immune tolerance to nuclear and cell surface antigens. Previous genome-wide association studies (GWAS) had modest sample sizes, reducing their scope and reliability. Our study comprised 7,219 cases and 15,991 controls of European ancestry: a new GWAS, meta-analysis with a published GWAS and a replication study. We have mapped 43 susceptibility loci, including 10 novel associations. Assisted by dense genome coverage, imputation provided evidence for missense variants underpinning associations in eight genes. Other likely causal genes were established by examining associated alleles for cis-acting eQTL effects in a range of ex vivo immune cells. We found an over-representation (n=16) of transcription factors among SLE susceptibility genes. This supports the view that aberrantly regulated gene expression networks in multiple cell types in both the innate and adaptive immune response contribute to the risk of developing SLE. PMID:26502338

  17. Possible Immune Regulation of Natural Killer T Cells in a Murine Model of Metal Ion-Induced Allergic Contact Dermatitis

    Directory of Open Access Journals (Sweden)

    Kenichi Kumagai

    2016-01-01

    Full Text Available Metal often causes delayed-type hypersensitivity reactions, which are possibly mediated by accumulating T cells in the inflamed skin, called irritant or allergic contact dermatitis. However, accumulating T cells during development of a metal allergy are poorly characterized because a suitable animal model is unavailable. We have previously established novel murine models of metal allergy and found accumulation of both metal-specific T cells and natural killer (NK T cells in the inflamed skin. In our novel models of metal allergy, skin hypersensitivity responses were induced through repeated sensitizations by administration of metal chloride and lipopolysaccharide into the mouse groin followed by metal chloride challenge in the footpad. These models enabled us to investigate the precise mechanisms of the immune responses of metal allergy in the inflamed skin. In this review, we summarize the immune responses in several murine models of metal allergy and describe which antigen-specific responses occur in the inflamed skin during allergic contact dermatitis in terms of the T cell receptor. In addition, we consider the immune regulation of accumulated NK T cells in metal ion–induced allergic contact dermatitis.

  18. The role of metalloproteinase ADAM17 in regulating ICOS ligand-mediated humoral immune responses

    DEFF Research Database (Denmark)

    Marczynska, Joanna; Ozga, Aleksandra; Wlodarczyk, Agnieszka

    2014-01-01

    results in spleen and lymph node enlargement, as well as increased levels of Ag-specific class-switched Ig production following immunization with OVA together with anti-CD40 mAbs and polyinosinic-polycytidylic acid. Moreover, we demonstrate that the costimulatory ligand ICOS ligand (ICOSL) is selectively...... downregulated on the surface of B cells in an ADAM17-specific manner, although it is not proteolitically processed by recombinant ADAM17 in vitro. Finally, we show that higher cell surface levels of ICOSL in ADAM17(ex/ex) mice may contribute to the development of excessive Ab responses. Therefore, our data...... suggest a functional link between ADAM17 and ICOSL in controlling adaptive immune responses....

  19. Adenosine A1 receptors contribute to immune regulation after neonatal hypoxic ischemic brain injury.

    Science.gov (United States)

    Winerdal, Max; Winerdal, Malin E; Wang, Ying-Qing; Fredholm, Bertil B; Winqvist, Ola; Ådén, Ulrika

    2016-03-01

    Neonatal brain hypoxic ischemia (HI) often results in long-term motor and cognitive impairments. Post-ischemic inflammation greatly effects outcome and adenosine receptor signaling modulates both HI and immune cell function. Here, we investigated the influence of adenosine A1 receptor deficiency (A1R(-/-)) on key immune cell populations in a neonatal brain HI model. Ten-day-old mice were subjected to HI. Functional outcome was assessed by open locomotion and beam walking test and infarction size evaluated. Flow cytometry was performed on brain-infiltrating cells, and semi-automated analysis of flow cytometric data was applied. A1R(-/-) mice displayed larger infarctions (+33%, p beam walking tests (44% more mistakes, p < 0.05) than wild-type (WT) mice. Myeloid cell activation after injury was enhanced in A1R(-/-) versus WT brains. Activated B lymphocytes expressing IL-10 infiltrated the brain after HI in WT, but were less activated and did not increase in relative frequency in A1R(-/-). Also, A1R(-/-) B lymphocytes expressed less IL-10 than their WT counterparts, the A1R antagonist DPCPX decreased IL-10 expression whereas the A1R agonist CPA increased it. CD4(+) T lymphocytes including FoxP3(+) T regulatory cells, were unaffected by genotype, whereas CD8(+) T lymphocyte responses were smaller in A1R(-/-) mice. Using PCA to characterize the immune profile, we could discriminate the A1R(-/-) and WT genotypes as well as sham operated from HI-subjected animals. We conclude that A1R signaling modulates IL-10 expression by immune cells, influences the activation of these cells in vivo, and affects outcome after HI.

  20. MHC class I down-regulation: Tumour escape from immune surveillance? (Review)

    Czech Academy of Sciences Publication Activity Database

    Bubeník, Jan

    2004-01-01

    Roč. 25, č. 2 (2004), s. 487-491 ISSN 1019-6439 R&D Projects: GA MZd NC7148; GA ČR GA301/04/0492; GA AV ČR IAA5052203 Institutional research plan: CEZ:AV0Z5052915 Keywords : MHC class I- tumour cells * immune surveillance Subject RIV: EC - Immunology Impact factor: 3.056, year: 2004

  1. Treatment of autoimmune inflammation by a TLR7 ligand regulating the innate immune system.

    Directory of Open Access Journals (Sweden)

    Tomoko Hayashi

    Full Text Available The Toll-like receptors (TLR have been advocated as attractive therapeutic targets because TLR signaling plays dual roles in initiating adaptive immune responses and perpetuating inflammation. Paradoxically, repeated stimulation of bone marrow mononuclear cells with a synthetic TLR7 ligand 9-benzyl-8-hydroxy-2-(2-methoxyethoxy adenine (called 1V136 leads to subsequent TLR hyporesponsiveness. Further studies on the mechanism of action of this pharmacologic agent demonstrated that the TLR7 ligand treatment depressed dendritic cell activation, but did not directly affect T cell function. To verify this mechanism, we utilized experimental allergic encephalitis (EAE as an in vivo T cell dependent autoimmune model. Drug treated SJL/J mice immunized with proteolipid protein (PLP(139-151 peptide had attenuated disease severity, reduced accumulation of mononuclear cells in the central nervous system (CNS, and limited demyelination, without any apparent systemic toxicity. Splenic T cells from treated mice produced less cytokines upon antigenic rechallenge. In the spinal cords of 1V136-treated EAE mice, the expression of chemoattractants was also reduced, suggesting innate immune cell hyposensitization in the CNS. Indeed, systemic 1V136 did penetrate the CNS. These experiments indicated that repeated doses of a TLR7 ligand may desensitize dendritic cells in lymphoid organs, leading to diminished T cell responses. This treatment strategy might be a new modality to treat T cell mediated autoimmune diseases.

  2. Concerted down-regulation of immune-system related genes predicts metastasis in colorectal carcinoma

    International Nuclear Information System (INIS)

    Fehlker, Marion; Huska, Matthew R; Jöns, Thomas; Andrade-Navarro, Miguel A; Kemmner, Wolfgang

    2014-01-01

    This study aimed at the identification of prognostic gene expression markers in early primary colorectal carcinomas without metastasis at the time point of surgery by analyzing genome-wide gene expression profiles using oligonucleotide microarrays. Cryo-conserved tumor specimens from 45 patients with early colorectal cancers were examined, with the majority of them being UICC stage II or earlier and with a follow-up time of 41–115 months. Gene expression profiling was performed using Whole Human Genome 4x44K Oligonucleotide Microarrays. Validation of microarray data was performed on five of the genes in a smaller cohort. Using a novel algorithm based on the recursive application of support vector machines (SVMs), we selected a signature of 44 probes that discriminated between patients developing later metastasis and patients with a good prognosis. Interestingly, almost half of the genes was related to the patients’ immune response and showed reduced expression in the metastatic cases. Whereas up to now gene signatures containing genes with various biological functions have been described for prediction of metastasis in CRC, in this study metastasis could be well predicted by a set of gene expression markers consisting exclusively of genes related to the MHC class II complex involved in immune response. Thus, our data emphasize that the proper function of a comprehensive network of immune response genes is of vital importance for the survival of colorectal cancer patients

  3. Garlic Lowers Blood Pressure in Hypertensive Individuals, Regulates Serum Cholesterol, and Stimulates Immunity: An Updated Meta-analysis and Review.

    Science.gov (United States)

    Ried, Karin

    2016-02-01

    Garlic has been shown to have cardiovascular protective and immunomodulatory properties. We updated a previous meta-analysis on the effect of garlic on blood pressure and reviewed the effect of garlic on cholesterol and immunity. We searched the Medline database for randomized controlled trials (RCTs) published between 1955 and December 2013 on the effect of garlic preparations on blood pressure. In addition, we reviewed the effect of garlic on cholesterol and immunity. Our updated meta-analysis on the effect of garlic on blood pressure, which included 20 trials with 970 participants, showed a mean ± SE decrease in systolic blood pressure (SBP) of 5.1 ± 2.2 mm Hg (P garlic on blood lipids, which included 39 primary RCTs and 2300 adults treated for a minimum of 2 wk, suggested garlic to be effective in reducing total and LDL cholesterol by 10% if taken for >2 mo by individuals with slightly elevated concentrations [e.g., total cholesterol >200 mg/dL (>5.5 mmol/L)]. Garlic has immunomodulating effects by increasing macrophage activity, natural killer cells, and the production of T and B cells. Clinical trials have shown garlic to significantly reduce the number, duration, and severity of upper respiratory infections. Our review suggests that garlic supplements have the potential to lower blood pressure in hypertensive individuals, to regulate slightly elevated cholesterol concentrations, and to stimulate the immune system. Garlic supplements are highly tolerated and may be considered as a complementary treatment option for hypertension, slightly elevated cholesterol, and stimulation of immunity. Future long-term trials are needed to elucidate the effect of garlic on cardiovascular morbidity and mortality. © 2016 American Society for Nutrition.

  4. Recombination at DNA replication fork barriers is not universal and is differentially regulated by Swi1.

    Science.gov (United States)

    Pryce, David W; Ramayah, Soshila; Jaendling, Alessa; McFarlane, Ramsay J

    2009-03-24

    DNA replication stress has been implicated in the etiology of genetic diseases, including cancers. It has been proposed that genomic sites that inhibit or slow DNA replication fork progression possess recombination hotspot activity and can form potential fragile sites. Here we used the fission yeast, Schizosaccharomyces pombe, to demonstrate that hotspot activity is not a universal feature of replication fork barriers (RFBs), and we propose that most sites within the genome that form RFBs do not have recombination hotspot activity under nonstressed conditions. We further demonstrate that Swi1, the TIMELESS homologue, differentially controls the recombination potential of RFBs, switching between being a suppressor and an activator of recombination in a site-specific fashion.

  5. Immune-Challenged Fish Up-Regulate Their Metabolic Scope to Support Locomotion.

    Directory of Open Access Journals (Sweden)

    Camille Bonneaud

    Full Text Available Energy-based trade-offs occur when investment in one fitness-related trait diverts energy away from other traits. The extent to which such trade-offs are shaped by limits on the rate of conversion of energy ingested in food (e.g. carbohydrates into chemical energy (ATP by oxidative metabolism rather than by the amount of food ingested in the first place is, however, unclear. Here we tested whether the ATP required for mounting an immune response will lead to a trade-off with ATP available for physical activity in mosquitofish (Gambusia holbrooki. To this end, we challenged fish either with lipopolysaccharide (LPS from E. coli or with Sheep Red Blood Cells (SRBC, and measured oxygen consumption at rest and during swimming at maximum speed 24h, 48h and 7 days post-challenge in order to estimate metabolic rates. Relative to saline-injected controls, only LPS-injected fish showed a significantly greater resting metabolic rate two days post-challenge and significantly higher maximal metabolic rates two and seven days post-challenge. This resulted in a significantly greater metabolic scope two days post-challenge, with LPS-fish transiently overcompensating by increasing maximal ATP production more than would be required for swimming in the absence of an immune challenge. LPS-challenged fish therefore increased their production of ATP to compensate physiologically for the energetic requirements of immune functioning. This response would avoid ATP shortages and allow fish to engage in an aerobically-challenging activity (swimming even when simultaneously mounting an immune response. Nevertheless, relative to controls, both LPS- and SRBC-fish displayed reduced body mass gain one week post-injection, and LPS-fish actually lost mass. The concomitant increase in metabolic scope and reduced body mass gain of LPS-challenged fish indicates that immune-associated trade-offs are not likely to be shaped by limited oxidative metabolic capacities, but may instead

  6. Conserved microRNA miR-8 in fat body regulates innate immune homeostasis in Drosophila.

    Science.gov (United States)

    Choi, In Kyou; Hyun, Seogang

    2012-05-01

    Antimicrobial peptides (AMPs) constitute a major arm of the innate immune system across diverse organisms. In Drosophila, septic injury by microbial pathogens rapidly induces the production of the AMPs in fat body via well elucidated pathways such as Toll and IMD. However, several epithelial tissues were reported to locally express AMPs without septic injury via poorly characterized ways. Here, we report that microRNA miR-8 regulates the levels of AMPs basally expressed in Drosophila. The levels of AMPs such as Drosomycin and Diptericin are significantly increased in miR-8 null animals in non-pathogen stimulated conditions. Analysis of various larval tissues revealed that the increase of Drosomycin is fat body specific. Supporting this observation, re-introduction of miR-8 only in the fat body restored the altered AMP expression in miR-8 null flies. Although loss of miR-8 impedes PI3K in the fat body, inhibition of PI3K does not phenocopy the AMP expression of miR-8 null flies, indicating that miR-8 regulates AMP independently of PI3K. Together, our findings suggest a role of miR-8 in systemic immune homeostasis in generally non-pathogenic conditions in flies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. CYLD Limits Lys63- and Met1-Linked Ubiquitin at Receptor Complexes to Regulate Innate Immune Signaling

    Directory of Open Access Journals (Sweden)

    Matous Hrdinka

    2016-03-01

    Full Text Available Innate immune signaling relies on the deposition of non-degradative polyubiquitin at receptor-signaling complexes, but how these ubiquitin modifications are regulated by deubiquitinases remains incompletely understood. Met1-linked ubiquitin (Met1-Ub is assembled by the linear ubiquitin assembly complex (LUBAC, and this is counteracted by the Met1-Ub-specific deubiquitinase OTULIN, which binds to the catalytic LUBAC subunit HOIP. In this study, we report that HOIP also interacts with the deubiquitinase CYLD but that CYLD does not regulate ubiquitination of LUBAC components. Instead, CYLD limits extension of Lys63-Ub and Met1-Ub conjugated to RIPK2 to restrict signaling and cytokine production. Accordingly, Met1-Ub and Lys63-Ub were individually required for productive NOD2 signaling. Our study thus suggests that LUBAC, through its associated deubiquitinases, coordinates the deposition of not only Met1-Ub but also Lys63-Ub to ensure an appropriate response to innate immune receptor activation.

  8. A Quantitative RNAi Screen for JNK Modifiers Identifies Pvr as a Novel Regulator of Drosophila Immune Signaling

    Science.gov (United States)

    Bond, David; Foley, Edan

    2009-01-01

    Drosophila melanogaster responds to gram-negative bacterial challenges through the IMD pathway, a signal transduction cassette that is driven by the coordinated activities of JNK, NF-κB and caspase modules. While many modifiers of NF-κB activity were identified in cell culture and in vivo assays, the regulatory apparatus that determines JNK inputs into the IMD pathway is relatively unexplored. In this manuscript, we present the first quantitative screen of the entire genome of Drosophila for novel regulators of JNK activity in the IMD pathway. We identified a large number of gene products that negatively or positively impact on JNK activation in the IMD pathway. In particular, we identified the Pvr receptor tyrosine kinase as a potent inhibitor of JNK activation. In a series of in vivo and cell culture assays, we demonstrated that activation of the IMD pathway drives JNK-dependent expression of the Pvr ligands, Pvf2 and Pvf3, which in turn act through the Pvr/ERK MAP kinase pathway to attenuate the JNK and NF-κB arms of the IMD pathway. Our data illuminate a poorly understood arm of a critical and evolutionarily conserved innate immune response. Furthermore, given the pleiotropic involvement of JNK in eukaryotic cell biology, we believe that many of the novel regulators identified in this screen are of interest beyond immune signaling. PMID:19893628

  9. Expression and potential roles of IL-33/ST2 in the immune regulation during Clonorchis sinensis infection.

    Science.gov (United States)

    Yu, Qian; Li, Xiang-Yang; Cheng, Xiao-Dan; Shen, Li-Ping; Fang, Fan; Zhang, Bo; Hua, Hui; Yan, Chao; Tang, Ren-Xian; Zheng, Kui-Yang

    2016-06-01

    During clonorchiasis, immune responses of hosts are responsible for the removal of the worms and also are involved in the progress of the pathological damage caused by Clonorchis sinensis. Interleukin-33 (IL-33), a recently described cytokine signaling through the ST2 receptor, has emerged as a potent inducer to bile duct proliferation and fibrosis; however, little is known of this signaling in the pathogen-caused periductal inflammation and fibrosis. In the present study, using immunohistochemistry, real-time PCR, enzyme-linked immunosorbent assay (ELISA), and flow cytometry, we studied the expression of IL-33/ST2 during C. sinensis infection, as well as their potential roles in C. sinensis-induced host immune responses. The results showed that a higher level of IL-33 was detected in the sera of patients of clonorchiasis (n = 45), compared with in those of healthy donors (n = 16). Similarly, in FVB mice experimentally infected with C. sinensis, a higher level of IL-33 was detected at latent stage both in the serum and in the liver, as well as the up-regulated expression of ST2 receptor on the inflammatory cells, especially on CD4(+) T cells in the liver of infected mice. Our results, for the first time, indicated that the increased IL-33/ST2 may be involved in the regulation of immunopathology induced by C. sinensis.

  10. Epigenetic Mechanisms Regulate Innate Immunity against Uropathogenic and Commensal-Like Escherichia coli in the Surrogate Insect Model Galleria mellonella.

    Science.gov (United States)

    Heitmueller, Miriam; Billion, André; Dobrindt, Ulrich; Vilcinskas, Andreas; Mukherjee, Krishnendu

    2017-10-01

    Innate-immunity-related genes in humans are activated during urinary tract infections (UTIs) caused by pathogenic strains of Escherichia coli but are suppressed by commensals. Epigenetic mechanisms play a pivotal role in the regulation of gene expression in response to environmental stimuli. To determine whether epigenetic mechanisms can explain the different behaviors of pathogenic and commensal bacteria, we infected larvae of the greater wax moth, Galleria mellonella , a widely used model insect host, with a uropathogenic E. coli (UPEC) strain that causes symptomatic UTIs in humans or a commensal-like strain that causes asymptomatic bacteriuria (ABU). Infection with the UPEC strain (CFT073) was more lethal to larvae than infection with the attenuated ABU strain (83972) due to the recognition of each strain by different Toll-like receptors, ultimately leading to differential DNA/RNA methylation and histone acetylation. We used next-generation sequencing and reverse transcription (RT)-PCR to correlate epigenetic changes with the induction of innate-immunity-related genes. Transcriptomic analysis of G. mellonella larvae infected with E. coli strains CFT073 and 83972 revealed strain-specific variations in the class and expression levels of genes encoding antimicrobial peptides, cytokines, and enzymes controlling DNA methylation and histone acetylation. Our results provide evidence for the differential epigenetic regulation of transcriptional reprogramming by UPEC and ABU strains of E. coli in G. mellonella larvae, which may be relevant to understanding the different behaviors of these bacterial strains in the human urinary tract. Copyright © 2017 American Society for Microbiology.

  11. Characterization of a RacGTPase up-regulated in the large yellow croaker Pseudosciaena crocea immunity.

    Science.gov (United States)

    Han, Fang; Wang, Xiaoqing; Yang, Qilian; Cai, Mingyi; Wang, Zhi Yong

    2011-02-01

    The Rac proteins are members of the Rho family of small G proteins and are implicated in the regulation of several pathways, including those leading to cytoskeleton reorganization, gene expression, cell proliferation, cell adhesion and cell migration and survival. In this investigation, a Rac gene (named as LycRac gene) was obtained from the large yellow croaker and it was expressed in Escherichia coli and purified. Subsequently the specific antibody was raised using the purified fusion protein (GST-LycRac). Moreover, the GTP-binding assay showed that the LycRac protein had GTP-binding activity. The LycRac gene was ubiquitously transcribed and expressed in 9 tissues. Quantitative real-time RT-PCR and Western blot analysis revealed the highest expression in gill and the weakest expression in spleen. Time-course analysis revealed that LycRac expression was obviously up-regulated in blood, spleen and liver after immunization with polyinosinic polycytidynic acid (poly I:C), formalin-inactive Gram-negative bacterium Vibrio parahemolyticus and bacterial lipopolysaccharides (LPS). These results suggested that LycRac protein might play an important role in the immune response against microorganisms in large yellow croaker. Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

  12. Regulation of brain copper homeostasis by the brain barrier systems: Effects of Fe-overload and Fe-deficiency

    Energy Technology Data Exchange (ETDEWEB)

    Monnot, Andrew D.; Behl, Mamta; Ho, Sanna; Zheng, Wei, E-mail: wzheng@purdue.edu

    2011-11-15

    Maintaining brain Cu homeostasis is vital for normal brain function. The role of systemic Fe deficiency (FeD) or overload (FeO) due to metabolic diseases or environmental insults in Cu homeostasis in the cerebrospinal fluid (CSF) and brain tissues remains unknown. This study was designed to investigate how blood-brain barrier (BBB) and blood-SCF barrier (BCB) regulated Cu transport and how FeO or FeD altered brain Cu homeostasis. Rats received an Fe-enriched or Fe-depleted diet for 4 weeks. FeD and FeO treatment resulted in a significant increase (+ 55%) and decrease (- 56%) in CSF Cu levels (p < 0.05), respectively; however, neither treatment had any effect on CSF Fe levels. The FeD, but not FeO, led to significant increases in Cu levels in brain parenchyma and the choroid plexus. In situ brain perfusion studies demonstrated that the rate of Cu transport into the brain parenchyma was significantly faster in FeD rats (+ 92%) and significantly slower (- 53%) in FeO rats than in controls. In vitro two chamber Transwell transepithelial transport studies using primary choroidal epithelial cells revealed a predominant efflux of Cu from the CSF to blood compartment by the BCB. Further ventriculo-cisternal perfusion studies showed that Cu clearance by the choroid plexus in FeD animals was significantly greater than control (p < 0.05). Taken together, our results demonstrate that both the BBB and BCB contribute to maintain a stable Cu homeostasis in the brain and CSF. Cu appears to enter the brain primarily via the BBB and is subsequently removed from the CSF by the BCB. FeD has a more profound effect on brain Cu levels than FeO. FeD increases Cu transport at the brain barriers and prompts Cu overload in the CNS. The BCB plays a key role in removing the excess Cu from the CSF.

  13. The long noncoding RNA TUG1 regulates blood-tumor barrier permeability by targeting miR-144.

    Science.gov (United States)

    Cai, Heng; Xue, Yixue; Wang, Ping; Wang, Zhenhua; Li, Zhen; Hu, Yi; Li, Zhiqing; Shang, Xiuli; Liu, Yunhui

    2015-08-14

    Blood-tumor barrier (BTB) limits the delivery of chemotherapeutic agent to brain tumor tissues. Long non-coding RNAs (lncRNAs) have been shown to play critical regulatory roles in various biologic processes of tumors. However, the role of lncRNAs in BTB permeability is unclear. LncRNA TUG1 (taurine upregulated gene 1) was highly expressed in glioma vascular endothelial cells from glioma tissues. It also upregulated in glioma co-cultured endothelial cells (GEC) from BTB model in vitro. Knockdown of TUG1 increased BTB permeability, and meanwhile down-regulated the expression of the tight junction proteins ZO-1, occludin, and claudin-5. Both bioinformatics and luciferase reporter assays demonstrated that TUG1 influenced BTB permeability via binding to miR-144. Furthermore, Knockdown of TUG1 also down-regulated Heat shock transcription factor 2 (HSF2), a transcription factor of the heat shock transcription factor family, which was defined as a direct and functional downstream target of miR-144. HSF2 up-regulated the promoter activities and interacted with the promoters of ZO-1, occludin, and claudin-5 in GECs. In conclusion, our results indicate that knockdown of TUG1 increased BTB permeability via binding to miR-144 and then reducing EC tight junction protein expression by targeting HSF2. Thus, TUG1 may represent a useful future therapeutic target for enhancing BTB permeability.

  14. Senescence-related functional nuclear barrier by down-regulation of nucleo-cytoplasmic trafficking gene expression

    International Nuclear Information System (INIS)

    Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae; Park, Sang Chul

    2010-01-01

    One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin α, karyopherin β, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.

  15. Senescence-related functional nuclear barrier by down-regulation of nucleo-cytoplasmic trafficking gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of); Park, Sang Chul, E-mail: scpark@snu.ac.kr [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of)

    2010-01-01

    One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin {alpha}, karyopherin {beta}, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.

  16. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    International Nuclear Information System (INIS)

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C.; Ballestas, Mary E.; Elmets, Craig A.; Robbins, David J.; Matalon, Sadis; Deshane, Jessy S.; Afaq, Farrukh; Bickers, David R.; Athar, Mohammad

    2013-01-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions

  17. Targeting Autophagy in the Tumor Microenvironment: New Challenges and Opportunities for Regulating Tumor Immunity

    Directory of Open Access Journals (Sweden)

    Bassam Janji

    2018-04-01

    Full Text Available Cancer cells evolve in the tumor microenvironment, which is now well established as an integral part of the tumor and a determinant player in cancer cell adaptation and resistance to anti-cancer therapies. Despite the remarkable and fairly rapid progress over the past two decades regarding our understanding of the role of the tumor microenvironment in cancer development, its precise contribution to cancer resistance is still fragmented. This is mainly related to the complexity of the “tumor ecosystem” and the diversity of the stromal cell types that constitute the tumor microenvironment. Emerging data indicate that several factors, such as hypoxic stress, activate a plethora of resistance mechanisms, including autophagy, in tumor cells. Hypoxia-induced autophagy in the tumor microenvironment also activates several tumor escape mechanisms, which effectively counteract anti-tumor immune responses mediated by natural killer and cytotoxic T lymphocytes. Therefore, strategies aiming at targeting autophagy in cancer cells in combination with other therapeutic strategies have inspired significant interest to overcome immunological tolerance and promote tumor regression. However, a number of obstacles still hamper the application of autophagy inhibitors in clinics. First, the lack of selectivity of the current pharmacological inhibitors of autophagy makes difficult to draw a clear statement about its effective contribution in cancer. Second, autophagy has been also described as an important mechanism in tumor cells involved in presentation of antigens to T cells. Third, there is a circumstantial evidence that autophagy activation in some innate immune cells may support the maturation of these cells, and it is required for their anti-tumor activity. In this review, we will address these aspects and discuss our current knowledge on the benefits and the drawbacks of targeting autophagy in the context of anti-tumor immunity. We believe that it is

  18. An interaction map of circulating metabolites, immune gene networks, and their genetic regulation.

    Science.gov (United States)

    Nath, Artika P; Ritchie, Scott C; Byars, Sean G; Fearnley, Liam G; Havulinna, Aki S; Joensuu, Anni; Kangas, Antti J; Soininen, Pasi; Wennerström, Annika; Milani, Lili; Metspalu, Andres; Männistö, Satu; Würtz, Peter; Kettunen, Johannes; Raitoharju, Emma; Kähönen, Mika; Juonala, Markus; Palotie, Aarno; Ala-Korpela, Mika; Ripatti, Samuli; Lehtimäki, Terho; Abraham, Gad; Raitakari, Olli; Salomaa, Veikko; Perola, Markus; Inouye, Michael

    2017-08-01

    Immunometabolism plays a central role in many cardiometabolic diseases. However, a robust map of immune-related gene networks in circulating human cells, their interactions with metabolites, and their genetic control is still lacking. Here, we integrate blood transcriptomic, metabolomic, and genomic profiles from two population-based cohorts (total N = 2168), including a subset of individuals with matched multi-omic data at 7-year follow-up. We identify topologically replicable gene networks enriched for diverse immune functions including cytotoxicity, viral response, B cell, platelet, neutrophil, and mast cell/basophil activity. These immune gene modules show complex patterns of association with 158 circulating metabolites, including lipoprotein subclasses, lipids, fatty acids, amino acids, small molecules, and CRP. Genome-wide scans for module expression quantitative trait loci (mQTLs) reveal five modules with mQTLs that have both cis and trans effects. The strongest mQTL is in ARHGEF3 (rs1354034) and affects a module enriched for platelet function, independent of platelet counts. Modules of mast cell/basophil and neutrophil function show temporally stable metabolite associations over 7-year follow-up, providing evidence that these modules and their constituent gene products may play central roles in metabolic inflammation. Furthermore, the strongest mQTL in ARHGEF3 also displays clear temporal stability, supporting widespread trans effects at this locus. This study provides a detailed map of natural variation at the blood immunometabolic interface and its genetic basis, and may facilitate subsequent studies to explain inter-individual variation in cardiometabolic disease.

  19. Unfolded protein response (UPR) signaling regulates arsenic trioxide-mediated macrophage innate immune function disruption

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Ritesh K.; Li, Changzhao; Chaudhary, Sandeep C. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Ballestas, Mary E. [Department of Pediatrics Infectious Disease, Children' s of Alabama, School of Medicine, University of Alabama at Birmingham, AL (United States); Elmets, Craig A. [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Robbins, David J. [Department of Surgery, Molecular Oncology Program, Miller School of Medicine, University of Miami, Miami (United States); Matalon, Sadis [Department of Anesthesiology, University of Alabama at Birmingham, Birmingham, AL (United States); Deshane, Jessy S. [Department of Medicine, Division of Pulmonary, Allergy and Critical Care Medicine, University of Alabama at Birmingham, Birmingham, AL (United States); Afaq, Farrukh [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States); Bickers, David R. [Department of Dermatology, Columbia University Medical Center, New York (United States); Athar, Mohammad, E-mail: mathar@uab.edu [Department of Dermatology and Skin Diseases Research Center, University of Alabama at Birmingham, Birmingham, AL (United States)

    2013-11-01

    Arsenic exposure is known to disrupt innate immune functions in humans and in experimental animals. In this study, we provide a mechanism by which arsenic trioxide (ATO) disrupts macrophage functions. ATO treatment of murine macrophage cells diminished internalization of FITC-labeled latex beads, impaired clearance of phagocytosed fluorescent bacteria and reduced secretion of pro-inflammatory cytokines. These impairments in macrophage functions are associated with ATO-induced unfolded protein response (UPR) signaling pathway characterized by the enhancement in proteins such as GRP78, p-PERK, p-eIF2α, ATF4 and CHOP. The expression of these proteins is altered both at transcriptional and translational levels. Pretreatment with chemical chaperon, 4-phenylbutyric acid (PBA) attenuated the ATO-induced activation in UPR signaling and afforded protection against ATO-induced disruption of macrophage functions. This treatment also reduced ATO-mediated reactive oxygen species (ROS) generation. Interestingly, treatment with antioxidant N-acetylcysteine (NAC) prior to ATO exposure, not only reduced ROS production and UPR signaling but also improved macrophage functions. These data demonstrate that UPR signaling and ROS generation are interdependent and are involved in the arsenic-induced pathobiology of macrophage. These data also provide a novel strategy to block the ATO-dependent impairment in innate immune responses. - Highlights: • Inorganic arsenic to humans and experimental animals disrupt innate immune responses. • The mechanism underlying arsenic impaired macrophage functions involves UPR signaling. • Chemical chaperon attenuates arsenic-mediated macrophage function impairment. • Antioxidant, NAC blocks impairment in arsenic-treated macrophage functions.

  20. Dietary zinc deficiency reduced growth performance, intestinal immune and physical barrier functions related to NF-κB, TOR, Nrf2, JNK and MLCK signaling pathway of young grass carp (Ctenopharyngodon idella).

    Science.gov (United States)

    Song, Zheng-Xing; Jiang, Wei-Dan; Liu, Yang; Wu, Pei; Jiang, Jun; Zhou, Xiao-Qiu; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Feng, Lin

    2017-07-01

    Our study investigated the effects of dietary zinc (Zn) deficiency on growth performance, intestinal immune and physical barrier functions of young grass carp (Ctenopharyngodon idella). A total of 630 grass carp (244.14 ± 0.40 g) were fed graded levels of zinc lactate (10.71, 30.21, 49.84, 72.31, 92.56, 110.78 mg Zn/kg diet) and one zinc sulfate group (56.9 mg Zn/kg diet) for 60 days. At the end of the feeding trial, fish were challenged with Aeromonas hydrophila for 14 days. These results indicated that compared with optimal dietary Zn level, dietary Zn deficiency (10.71 mg/kg diet) decreased the production of antibacterial compounds, up-regulated pro-inflammatory cytokines related to nuclear factor kappa B (NF-κB) and down-regulated anti-inflammatory cytokines related to target of rapamycin (TOR) in three intestinal segments of young grass carp (P zinc lactate as Zn source) based on percent weight gain (PWG), against enteritis morbidity, acid phosphatase (ACP) activity in the proximal intestine (PI) and malondialdehyde (MDA) content in the PI of young grass carp was estimated to be 61.2, 61.4, 69.2 and 69.5 mg/kg diet, respectively. Finally, based on specific growth rate (SGR), feed efficiency (FE) and against enteritis morbidity of young grass carp, the efficacy of zinc lactate relative to zinc sulfate were 132.59%, 135.27% and 154.04%, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Class I gene regulation of haplotype preference may influence antiviral immunity in vivo

    DEFF Research Database (Denmark)

    Thomsen, Allan Randrup; Marker, O

    1989-01-01

    targets. In regard to the in vivo significance of haplotype preference it was found that (C X C3) F1 mice expressed an earlier and stronger virus-specific delayed type hypersensitivity response and exerted a more efficient virus control than did (C-H-2dm2 X C3) F1. Taken together these findings suggest...... that haplotype preference reflects a selection process favoring the restriction element associated with the most efficient immune response in vivo. The implications of this are discussed....

  2. Cupping regulates local immunomodulation to activate neural-endocrine-immune worknet.

    Science.gov (United States)

    Guo, Yang; Chen, Bo; Wang, Dong-Qiang; Li, Ming-Yue; Lim, Calista Hui-Min; Guo, Yi; Chen, Zelin

    2017-08-01

    Research on cupping therapy is lacking at home and abroad. However, cupping and acupuncture therapy are both surface stimulation therapies. This paper suggests the mechanism of cupping therapy and proposes that the same mechanism underlies both cupping and acupuncture therapy. The microenvironment is changed when stimulating the surface of the skin, and physical signals transform into biological signals, which also interact with each other in the body. These signalling cascades activate the neuroendocrine-immune system, which produces the therapeutic effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Oxysterol-EBI2 signaling in immune regulation and viral infection

    DEFF Research Database (Denmark)

    Daugvilaite, Viktorija; Arfelt, Kristine Niss; Benned-Jensen, Tau

    2014-01-01

    The seven transmembrane G protein-coupled receptor Epstein-Barr virus (EBV) induced gene 2 (EBI2; also known as GPR183) was identified in 1993 on the basis of its substantial upregulation in EBV-infected cells. It is primarily expressed in lymphoid cells; most abundantly in B cells. EBI2 is central...... in the EBV life cycle. We also summarize the structural and functional properties of EBI2 interaction with oxysterol agonists and small molecule antagonists and discuss EBI2 as therapeutic target for diseases of the immune system....

  4. The role of beneficial bacteria wall elasticity in regulating innate immune response.

    Science.gov (United States)

    Мokrozub, Viktoria V; Lazarenko, Liudmyla M; Sichel, Liubov M; Babenko, Lidia P; Lytvyn, Petro M; Demchenko, Olga M; Melnichenko, Yulia O; Boyko, Nadiya V; Biavati, Bruno; DiGioia, Diana; Bubnov, Rostyslav V; Spivak, Mykola Ya

    2015-01-01

    Probiotics have great potential to contribute to development of healthy dietary regimes, preventive care, and an integrated approach to immunity-related disease management. The bacterial wall is a dynamic entity, depending on many components and playing an essential role in modulating immune response. The impact of cell wall elasticity on the beneficial effects of probiotic strains has not been sufficiently studied. The aim was to investigate the effect of lactic acid bacteria (LAB) and bifidobacteria strains on phagocytic system cells (macrophages) as related to bacterial wall elasticity, estimated using atomic force microscopy (AFM). We conducted studies on Balb/c line mice 18-20 g in weight using lyophilized strains of LAB-Lactobacillus acidophilus IMV B-7279, Lactobacillus casei IMV B-7280, Lactobacillus delbrueckii subsp. bulgaricus IMV B-7281, and bifidobacteria-Bifidobacterium animalis VKL and Bifidobacterium animalis VKB. We cultivated the macrophages obtained from the peritoneal cavity of mice individually with the strains of LAB and bifidobacteria and evaluated their effect on macrophages, oxygen-dependent bactericidal activity, nitric oxide production, and immunoregulatory cytokines. We used AFM scanning to estimate bacterial cell wall elasticity. All strains had a stimulating effect on the functional activity of macrophages and ability to produce NO/NO2 in vitro. Lactobacilli strains increased the production of IL-12 and IFN-γ in vitro. The AFM demonstrated different cell wall elasticity levels in various strains of LAB and bifidobacteria. The rigidity of the cell walls among lactobacilli was distributed as follows: Lactobacillus acidophilus IMV B-7279 > Lactobacillus casei IMV B-7280 > Lactobacillus delbrueckii subsp. bulgaricus IMV B-7281; among the strains of bifidobacteria: B. animalis VKB > B. animalis VKL. Probiotic strain survival in the macrophages depended on the bacterial cell wall elasticity and on the time of their joint cultivation. LAB

  5. The Microbiota Regulates Immunity and Immunologic Diseases in Dogs and Cats.

    Science.gov (United States)

    Tizard, Ian R; Jones, Sydney W

    2018-03-01

    The complex commensal microbiota found on body surfaces controls immune responses and the development of allergic and inflammatory diseases. New genetic technologies permit investigators to determine the composition of the complex microbial populations found on these surfaces. Changes in the microbiota (dysbiosis) as a result of antibiotic use, diet, or other factors thus influence the development of many diseases in the dog and cat. The most important of these include chronic gastrointestinal disease; respiratory allergies, such as asthma; skin diseases, especially atopic dermatitis; and some autoimmune diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Mesenchymal Stem Cells Regulate Blood Brain Barrier Integrity in Traumatic Brain Injury Through Production of the Soluble Factor TIMP3

    Science.gov (United States)

    Menge, Tyler; Zhao, Yuhai; Zhao, Jing; Wataha, Kathryn; Geber, Michael; Zhang, Jianhu; Letourneau, Phillip; Redell, John; Shen, Li; Wang, Jing; Peng, Zhalong; Xue, Hasen; Kozar, Rosemary; Cox, Charles S.; Khakoo, Aarif Y.; Holcomb, John B.; Dash, Pramod K.; Pati, Shibani

    2013-01-01

    Mesenchymal stem cells (MCSs) have been shown to have therapeutic potential in multiple disease states associated with vascular instability including traumatic brain injury (TBI). In the present study, Tissue Inhibitor of Matrix Metalloproteinase-3 (TIMP3) is identified as the soluble factor produced by MSCs that can recapitulate the beneficial effects of MSCs on endothelial function and blood brain barrier (BBB) compromise in TBI. Attenuation of TIMP3 expression in MSCs completely abrogates the effect of MSCs on BBB permeability and stability, while intravenous administration of rTIMP3 alone can inhibit BBB permeability in TBI. Our results demonstrate that MSCs increase circulating levels of soluble TIMP3, which inhibits VEGF-A induced breakdown of endothelial AJs in vitro and in vivo. These findings elucidate a clear molecular mechanism for the effects of MSCs on the BBB in TBI, and directly demonstrate a role for TIMP3 in regulation of BBB integrity. PMID:23175708

  7. PPAR-α, a lipid-sensing transcription factor, regulates blood-brain barrier efflux transporter expression.

    Science.gov (United States)

    More, Vijay R; Campos, Christopher R; Evans, Rebecca A; Oliver, Keith D; Chan, Gary Ny; Miller, David S; Cannon, Ronald E

    2017-04-01

    Lipid sensor peroxisome proliferator-activated receptor alpha (PPAR- α) is the master regulator of lipid metabolism. Dietary release of endogenous free fatty acids, fibrates, and certain persistent environmental pollutants, e.g. perfluoroalkyl fire-fighting foam components, are peroxisome proliferator-activated receptor alpha ligands. Here, we define a role for peroxisome proliferator-activated receptor alpha in regulating the expression of three ATP-driven drug efflux transporters at the rat and mouse blood-brain barriers: P-glycoprotein (Abcb1), breast cancer resistance protein (Bcrp/Abcg2), and multidrug resistance-associated protein 2 (Mrp2/Abcc2). Exposing isolated rat brain capillaries to linoleic acid, clofibrate, or PKAs increased the transport activity and protein expression of the three ABC transporters. These effects were blocked by the PPAR- α antagonist, GW6471. Dosing rats with 20 mg/kg or 200 mg/kg of clofibrate decreased the brain accumulation of the P-glycoprotein substrate, verapamil, by 50% (in situ brain perfusion; effects blocked by GW6471) and increased P-glycoprotein expression and activity in capillaries ex vivo. Fasting C57Bl/6 wild-type mice for 24 h increased both serum lipids and brain capillary P-glycoprotein transport activity. Fasting did not alter P-glycoprotein activity in PPAR- α knockout mice. These results indicate that hyperlipidemia, lipid-lowering fibrates and exposure to certain fire-fighting foam components activate blood-brain barrier peroxisome proliferator-activated receptor alpha, increase drug efflux transporter expression and reduce drug delivery to the brain.

  8. Dengue Virus Infection Differentially Regulates Endothelial Barrier Function over Time through Type I Interferon Effects

    Science.gov (United States)

    Liu, Ping; Woda, Marcia; Ennis, Francis A.; Libraty, Daniel H.

    2013-01-01

    Background The morbidity and mortality resulting from dengue hemorrhagic fever (DHF) are largely caused by endothelial barrier dysfunction and a unique vascular leakage syndrome. The mechanisms that lead to the location and timing of vascular leakage in DHF are poorly understood. We hypothesized that direct viral effects on endothelial responsiveness to inflammatory and angiogenesis mediators can explain the DHF vascular leakage syndrome. Methods We used an in vitro model of human endothelium to study the combined effects of dengue virus (DENV) type 2 (DENV2) infection and inflammatory mediators on paracellular macromolecule permeability over time. Results Over the initial 72 h after infection, DENV2 suppressed tumor necrosis factor (TNF)–α–mediated hyperpermeability in human umbilical vein endothelial cell (HUVEC) monolayers. This suppressive effect was mediated by type I interferon (IFN). By 1 week, TNF-α stimulation of DENV2-infected HUVECs synergistically increased cell cycling, angiogenic changes, and macromolecule permeability. This late effect could be prevented by the addition of exogenous type I IFN. Conclusions DENV infection of primary human endothelial cells differentially modulates TNF-α–driven angiogenesis and hyperpermeability over time. Type I IFN plays a central role in this process. Our findings suggest a rational model for the DHF vascular leakage syndrome. PMID:19530939

  9. Delicate balance among three types of T cells in concurrent regulation of tumor immunity.

    Science.gov (United States)

    Izhak, Liat; Ambrosino, Elena; Kato, Shingo; Parish, Stanley T; O'Konek, Jessica J; Weber, Hannah; Xia, Zheng; Venzon, David; Berzofsky, Jay A; Terabe, Masaki

    2013-03-01

    The nature of the regulatory cell types that dominate in any given tumor is not understood at present. Here, we addressed this question for regulatory T cells (Treg) and type II natural killer T (NKT) cells in syngeneic models of colorectal and renal cancer. In mice with both type I and II NKT cells, or in mice with neither type of NKT cell, Treg depletion was sufficient to protect against tumor outgrowth. Surprisingly, in mice lacking only type I NKT cells, Treg blockade was insufficient for protection. Thus, we hypothesized that type II NKT cells may be neutralized by type I NKT cells, leaving Tregs as the primary suppressor, whereas in mice lacking type I NKT cells, unopposed type II NKT cells could suppress tumor immunity even when Tregs were blocked. We confirmed this hypothesis in 3 ways by reconstituting type I NKT cells as well as selectively blocking or activating type II NKT cells with antibody or the agonist sulfatide, respectively. In this manner, we showed that blockade of both type II NKT cells and Tregs is necessary to abrogate suppression of tumor immunity, but a third cell, the type I NKT cell, determines the balance between these regulatory mechanisms. As patients with cancer often have deficient type I NKT cell function, managing this delicate balance among 3 T-cell subsets may be critical for the success of immunotherapy for human cancer. ©2012 AACR.

  10. Delicate balance among three types of T cells in concurrent regulation of tumor immunity

    Science.gov (United States)

    Izhak, Liat; Ambrosino, Elena; Kato, Shingo; Parish, Stanley T.; O’Konek, Jessica J.; Weber, Hannah; Xia, Zheng; Venzon, David; Berzofsky, Jay A.; Terabe, Masaki

    2013-01-01

    The nature of the regulatory cell types that dominate in any given tumor is not understood at present. Here we addressed this question for Tregs and type II NKT cells in syngeneic models of colorectal and renal cancer. In mice with both type I and type II NKT cells, or in mice with neither type of NKT cell, Treg depletion was sufficient to protect against tumor outgrowth. Surprisingly, in mice lacking only type I NKT cells, Treg blockade was insufficient for protection. Thus, we hypothesized that type II NKT cells may be neutralized by type I NKT cells, leaving Treg cells as the primary suppressor, whereas in mice lacking type I NKT cells, unopposed type II NKT cells could suppress tumor immunity even when Tregs were blocked. We confirmed this hypothesis in three ways by reconstituting type I NKT cells as well as selectively blocking or activating type II NKT cells with antibody or the agonist sulfatide, respectively. In this manner, we demonstrated that blockade of both type II NKT cells and Tregs is necessary to abrogate suppression of tumor immunity, but a third cell, the type I NKT cell, determines the balance between these regulatory mechanisms. As cancer patients often have deficient type I NKT cell function, managing this delicate balance among three T cell subsets may be critical for the success of immunotherapy of human cancer. PMID:23319803

  11. Surface receptor Toso controls B cell-mediated regulation of T cell immunity.

    Science.gov (United States)

    Yu, Jinbo; Duong, Vu Huy Hoang; Westphal, Katrin; Westphal, Andreas; Suwandi, Abdulhadi; Grassl, Guntram A; Brand, Korbinian; Chan, Andrew C; Föger, Niko; Lee, Kyeong-Hee

    2018-05-01

    The immune system is tightly controlled by regulatory processes that allow for the elimination of invading pathogens, while limiting immunopathological damage to the host. In the present study, we found that conditional deletion of the cell surface receptor Toso on B cells unexpectedly resulted in impaired proinflammatory T cell responses, which led to impaired immune protection in an acute viral infection model and was associated with reduced immunopathological tissue damage in a chronic inflammatory context. Toso exhibited its B cell-inherent immunoregulatory function by negatively controlling the pool of IL-10-competent B1 and B2 B cells, which were characterized by a high degree of self-reactivity and were shown to mediate immunosuppressive activity on inflammatory T cell responses in vivo. Our results indicate that Toso is involved in the differentiation/maintenance of regulatory B cells by fine-tuning B cell receptor activation thresholds. Furthermore, we showed that during influenza A-induced pulmonary inflammation, the application of Toso-specific antibodies selectively induced IL-10-competent B cells at the site of inflammation and resulted in decreased proinflammatory cytokine production by lung T cells. These findings suggest that Toso may serve as a novel therapeutic target to dampen pathogenic T cell responses via the modulation of IL-10-competent regulatory B cells.

  12. Ectopic expression of X-linked lymphocyte-regulated protein pM1 renders tumor cells resistant to antitumor immunity.

    Science.gov (United States)

    Kang, Tae Heung; Noh, Kyung Hee; Kim, Jin Hee; Bae, Hyun Cheol; Lin, Ken Y; Monie, Archana; Pai, Sara I; Hung, Chien-Fu; Wu, T-C; Kim, Tae Woo

    2010-04-15

    Tumor immune escape is a major obstacle in cancer immunotherapy, but the mechanisms involved remain poorly understood. We have previously developed an immune evasion tumor model using an in vivo immune selection strategy and revealed Akt-mediated immune resistance to antitumor immunity induced by various cancer immunotherapeutic agents. In the current study, we used microarray gene analysis to identify an Akt-activating candidate molecule overexpressed in immune-resistant tumors compared with parental tumors. X-linked lymphocyte-regulated protein pM1 (XLR) gene was the most upregulated in immune-resistant tumors compared with parental tumor cells. Furthermore, the retroviral transduction of XLR in parental tumor cells led to activation of Akt, resulting in upregulation of antiapoptotic proteins and the induction of immune resistance phenotype in parental tumor cells. In addition, we found that transduction of parental tumor cells with other homologous genes from the mouse XLR family, such as synaptonemal complex protein 3 (SCP3) and XLR-related, meiosis-regulated protein (XMR) and its human counterpart of SCP3 (hSCP3), also led to activation of Akt, resulting in the upregulation of antiapoptotic proteins and induction of immune resistance phenotype. Importantly, characterization of a panel of human cervical cancers revealed relatively higher expression levels of hSCP3 in human cervical cancer tissue compared with normal cervical tissue. Thus, our data indicate that ectopic expression of XLR and its homologues in tumor cells represents a potentially important mechanism for tumor immune evasion and serves as a promising molecular target for cancer immunotherapy. (c) 2010 AACR.

  13. Non-classical mechanisms of transcriptional regulation by the vitamin D receptor: insights into calcium homeostasis, immune system regulation and cancer chemoprevention.

    Science.gov (United States)

    Dimitrov, Vassil; Salehi-Tabar, Reyhaneh; An, Beum-Soo; White, John H

    2014-10-01

    Hormonal 1,25-dihydroxyvitamin D [1,25(OH)2D] signals through the nuclear vitamin D receptor (VDR), a ligand-regulated transcription factor. Gene expression profiling studies have revealed that 1,25(OH)2D signaling through the VDR can lead to activation or repression of target gene transcription in roughly equal proportions. Classically, transcriptional regulation by the VDR, similar to other nuclear receptors, has been characterized by its capacity to recognize high affinity cognate vitamin D response elements (VDREs), located in the regulatory regions of target genes. Several biochemical studies revealed that the VDRE-bound receptor recruits a series of coregulatory proteins, leading to transactivation of adjacent target genes. However, genome-wide and other analyses of VDR binding have revealed that a subset of VDR binding sites does not contain VDREs, and that VDREs are not associated with transcriptionally repressed VDR target genes. Work over the last ∼20 years and in particular recent findings have revealed a diverse array of mechanisms by which VDR can form complexes with several other classes of transcriptional activators, leading to repression of gene transcription. Moreover, these efforts have led to several insights into the molecular basis for the physiological regulation of calcium homeostasis, immune system function and cancer chemoprevention by 1,25(OH)2D/VDR signaling. This article is part of a Special Issue entitled '16th Vitamin D Workshop'. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Effects of the genome on immune regulation in type 1 diabetes

    DEFF Research Database (Denmark)

    Pociot, Flemming; Kaur, Simranjeet; Nielsen, Lotte B

    2016-01-01

    Type 1 diabetes (T1DM) is a complex disease, arising through the interaction of an incompletely defined combination of genetic susceptibility and environmental factors. It is well accepted that T1DM results from selective immune-mediated destruction of the insulin-producing β cells in the islets...... CCL2 and CCL4 in recent onset T1DM patients. Finally, we report that genetic variants predict autoantibody positivity in T1DM cases....... into a limited number of DRB1 and DQB1 amino acid residues that account for most of the HLA-risk. Second, we use the Immunochip data to look for functional significance by correlation to circulating levels of chemokines and demonstrate that genetic variation at chromosome 2, 3, and 6 correlates with circulating...

  15. IFN-gamma shapes immune invasion of the central nervous system via regulation of chemokines

    DEFF Research Database (Denmark)

    Tran, E H; Prince, E N; Owens, T

    2000-01-01

    Dynamic interplay between cytokines and chemokines directs trafficking of leukocyte subpopulations to tissues in autoimmune inflammation. We have examined the role of IFN-gamma in directing chemokine production and leukocyte infiltration to the CNS in experimental autoimmune encephalomyelitis (EA......-gamma in EAE, acting on T cell proliferation and directing chemokine production, with profound implications for the onset and progression of disease.......). BALB/c and C57BL/6 mice are resistant to induction of EAE by immunization with myelin basic protein. However, IFN-gamma-deficient (BALB/c) and IFN-gammaR-deficient (C57BL/6) mice developed rapidly progressing lethal disease. Widespread demyelination and disseminated leukocytic infiltration of spinal...

  16. Involvement of CD244 in regulating CD4+ T cell immunity in patients with active tuberculosis.

    Directory of Open Access Journals (Sweden)

    Bingfen Yang

    Full Text Available CD244 (2B4 is a member of the signaling lymphocyte activation molecule (SLAM family of immune cell receptors and it plays an important role in modulating NK cell and CD8(+ T cell immunity. In this study, we investigated the expression and function of CD244/2B4 on CD4(+ T cells from active TB patients and latent infection individuals. Active TB patients had significantly elevated CD244/2B4 expression on M. tuberculosis antigen-specific CD4(+ T cells compared with latent infection individuals. The frequencies of CD244/2B4-expressing antigen-specific CD4(+ T cells were significantly higher in retreatment active TB patients than in new active TB patients. Compared with CD244/2B4-dull and -middle CD4(+ T cells, CD244/2B4-bright CD4(+ T cell subset had significantly reduced expression of IFN-γ, suggesting that CD244/2B4 expression may modulate IFN-γ production in M. tuberculosis antigen-responsive CD4(+ T cells. Activation of CD244/2B4 signaling by cross-linking led to significantly decreased production of IFN-γ. Blockage of CD244/2B4 signaling pathway of T cells from patients with active TB resulted in significantly increased production of IFN-γ, compared with isotype antibody control. In conclusion, CD244/2B4 signaling pathway has an inhibitory role on M. tuberculosis antigen-specific CD4(+ T cell function.

  17. PAI-1 and IFN-γ in the regulation of innate immune homeostasis during sublethal yersiniosis.

    Science.gov (United States)

    Wang, Zheng; Zhao, Qi; Han, Yuxia; Zhang, Dongxia; Zhang, Liangyan; Luo, Deyan

    2013-03-01

    Plasminogen activator inhibitor type 1 (PAI-l), a key part of the fibrinolytic system, plays a critical host protective role during the acute phase of infection by regulating interferon(IFN)-γ release. IFN-γ regulates PAI-1 expression, which suggests an intricate interplay between PAI-1 and IFN-γ. Here, using the notion of a feedback loop, we report the complicated regulatory relationship between PAI-1 and IFN-γ. Mice were inoculated intravenously with 1×10(3) colony forming units of Yersinia enterocolitica; PAI-1 deficiency enhanced lethality (pimmune homeostasis. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Understanding regulation of the host-mediated gut symbiont population and the symbiont-mediated host immunity in the Riptortus-Burkholderia symbiosis system.

    Science.gov (United States)

    Kim, Jiyeun Kate; Lee, Jun Beom; Jang, Ho Am; Han, Yeon Soo; Fukatsu, Takema; Lee, Bok Luel

    2016-11-01

    Valuable insect models have tremendously contributed to our understanding of innate immunity and symbiosis. Bean bug, Riptortus pedestris, is a useful insect symbiosis model due to harboring cultivable monospecific gut symbiont, genus Burkholderia. Bean bug is a hemimetabolous insect whose immunity is not well-understood. However, we recently identified three major antimicrobial peptides of Riptortus and examined the relationship between gut symbiosis and host immunity. We found that the presence of Burkholderia gut symbiont positively affects Riptortus immunity. From studying host regulation mechanisms of symbiont population, we revealed that the symbiotic Burkholderia cells are much more susceptible to Riptortus immune responses than the cultured cells. We further elucidated that the immune-susceptibility of the Burkholderia gut symbionts is due to the drastic change of bacterial cell envelope. Finally, we show that the immune-susceptible Burkholderia symbionts are able to prosper in host owing to the suppression of immune responses of the symbiotic midgut. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Regulation of taurine transport at the blood-placental barrier by calcium ion, PKC activator and oxidative stress conditions

    Directory of Open Access Journals (Sweden)

    Lee Na-Young

    2010-08-01

    Full Text Available Abstract Background In the present study, we investigated the changes of uptake and efflux transport of taurine under various stress conditions using rat conditionally immortalized syncytiotrophoblast cell line (TR-TBT cells, as in vitro blood-placental barrier (BPB model. Methods The transport of taurine in TR-TBT cells were characterized by cellular uptake study using radiolabeled taurine. The efflux of taurine was measured from the amount of radiolabeled taurine remaining in the cells after the uptake of radiolabeled taurine for 60 min. Results Taurine uptake was significantly decreased by phosphorylation of protein kinase C (PKC activator in TR-TBT cells. Also, calcium ion (Ca2+ was involved in taurine transport in TR-TBT cells. Taurine uptake was inhibited and efflux was enhanced under calcium free conditions in the cells. In addition, oxidative stress induced the change of taurine transport in TR-TBT cells, but the changes were different depending on the types of oxidative stress inducing agents. Tumor necrosis factor-α (TNF-α, lipopolysaccharide (LPS and diethyl maleate (DEM significantly increased taurine uptake, but H2O2 and nitric oxide (NO donor decreased taurine uptake in the cells. Taurine efflux was down-regulated by TNF-α in TR-TBT cells. Conclusion Taurine transport in TR-TBT cells were regulated diversely at extracellular Ca2+ level, PKC activator and oxidative stress conditions. It suggested that variable stresses affected the taurine supplies from maternal blood to fetus and taurine level of fetus.

  20. Transcription profiling suggests that mitochondrial topoisomerase IB acts as a topological barrier and regulator of mitochondrial DNA transcription.

    Science.gov (United States)

    Dalla Rosa, Ilaria; Zhang, Hongliang; Khiati, Salim; Wu, Xiaolin; Pommier, Yves

    2017-12-08

    Mitochondrial DNA (mtDNA) is essential for cell viability because it encodes subunits of the respiratory chain complexes. Mitochondrial topoisomerase IB (TOP1MT) facilitates mtDNA replication by removing DNA topological tensions produced during mtDNA transcription, but it appears to be dispensable. To test whether cells lacking TOP1MT have aberrant mtDNA transcription, we performed mitochondrial transcriptome profiling. To that end, we designed and implemented a customized tiling array, which enabled genome-wide, strand-specific, and simultaneous detection of all mitochondrial transcripts. Our technique revealed that Top1mt KO mouse cells process the mitochondrial transcripts normally but that protein-coding mitochondrial transcripts are elevated. Moreover, we found discrete long noncoding RNAs produced by H-strand transcription and encompassing the noncoding regulatory region of mtDNA in human and murine cells and tissues. Of note, these noncoding RNAs were strongly up-regulated in the absence of TOP1MT. In contrast, 7S DNA, produced by mtDNA replication, was reduced in the Top1mt KO cells. We propose that the long noncoding RNA species in the D-loop region are generated by the extension of H-strand transcripts beyond their canonical stop site and that TOP1MT acts as a topological barrier and regulator for mtDNA transcription and D-loop formation.

  1. Uncovering the Role of Erythrocyte-Derived Extracellular Vesicles in Malaria: From Immune Regulation to Cell Communication

    Directory of Open Access Journals (Sweden)

    Johan Ankarklev

    2014-05-01

    Full Text Available Investigation of the involvement of extracellular vesicles (EVs in parasite biology has burgeoned in recent years. Human infecting protozoan parasites, such as Trypanosoma cruzi, Lesihmania sp . and Trichomonas vaginalis , have all demonstrated the utilization of EVs as virulence factors in order to activate or hamper host immunity. Novel findings have provided evidence that the deployment of EVs by Plasmodium sp . has a major impact in disease outcomes and serves as an integral part in controlling stage switching in its life cycle. Clinical studies have highlighted elevated levels of EVs in patients with severe malaria disease and EVs have been linked to increased sequestration of infected red blood cells to the endothelium, causing obstruction of blood flow. It has also been found that EVs produced during malaria disease activate innate immunity. Intriguingly, recent discoveries indicate that Plasmodium sp . “highjack” the erythrocyte microvesiculation system in order to cross-communicate. Both the transfer of DNA and parasite density regulation has been suggested as key mechanisms of EVs in malaria biology.

  2. Nitric oxide and TNFα are critical regulators of reversible lymph node vascular remodeling and adaptive immune response.

    Directory of Open Access Journals (Sweden)

    Stephanie L Sellers

    Full Text Available Lymph node (LN vascular growth, at the level of the main arteriole, was recently characterized for the first time during infection. Arteriole diameter was shown to increase for at least seven days and to occur via a CD4(+ T cell dependent mechanism, with vascular expansion playing a critical role in regulating induction of adaptive immune response. Here, using intravital microscopy of the inguinal LN during herpes simplex type II (HSV-2 infection, the data provides the first studies that demonstrate arteriole expansion during infection is a reversible vascular event that occurs via eutrophic outward remodeling. Furthermore, using genetic ablation models, and pharmacological blockade, we reveal arteriole remodeling and LN hypertrophy to be dependent upon both endothelial nitric oxide synthase (eNOS and TNFα expression. Additionally, we reveal transient changes in nitric oxide (NO levels to be a notable feature of response to viral infection and LN vascular remodeling and provide evidence that mast cells are the critical source of TNFα required to drive arteriole remodeling. Overall, this study is the first to fully characterize LN arteriole vascular changes throughout the course of infection. It effectively reveals a novel role for NO and TNFα in LN cellularity and changes in LN vascularity, which represent key advances in understanding LN vascular physiology and adaptive immune response.

  3. Olive leaf down-regulates the oxidative stress and immune dysregulation in streptozotocin-induced diabetic mice.

    Science.gov (United States)

    Park, Jung-Hyun; Jung, Ji-Hye; Yang, Jin-Young; Kim, Hyun-Sook

    2013-11-01

    Type 1 diabetes is an endocrinologic disorder characterized by uncontrolled glucose regulation and oxidative stress. Olive leaves have been studied extensively for their antioxidant activity and capacity to improve immune function. We hypothesized that olive leaf powder supplementation will be effective in inhibiting the oxidative stress and immune dysregulation in streptozotocin (STZ)-induced diabetic mice. Mice were assigned to 1 of 5 groups: control (C), STZ-induced diabetes (D), and STZ-induced diabetes supplemented with very low dose (VLOL), low dose (LOL), or high dose of olive leaf powder (HOL). Blood glucose in the VLOL and LOL groups was lower than that in the D group (P LOL groups. Nitric oxide levels decreased in the VLOL and LOL groups, as compared with the D group. The messenger RNA expression levels of inducible nitric oxide synthase were significantly decreased in the VLOL and HOL groups, and interferon-γ levels were significantly decreased in the liver of the VLOL, LOL, and HOL groups compared with the levels in the D group. Interleukin-17 levels were significantly decreased in the VLOL and HOL groups. Th1 and Th17 cytokine levels were increased in the D group but decreased in all the experimental groups. Th2 cytokine levels were increased in all olive leaf-supplemented groups compared with those in the D group. These results indicate a reduction in the levels of proinflammatory cytokines, suggesting that olive leaves have the potential to provide therapeutic inhibition of diabetic complications. © 2013.

  4. The Bacterial Second Messenger Cyclic di-GMP Regulates Brucella Pathogenesis and Leads to Altered Host Immune Response.

    Science.gov (United States)

    Khan, Mike; Harms, Jerome S; Marim, Fernanda M; Armon, Leah; Hall, Cherisse L; Liu, Yi-Ping; Banai, Menachem; Oliveira, Sergio C; Splitter, Gary A; Smith, Judith A

    2016-12-01

    Brucella species are facultative intracellular bacteria that cause brucellosis, a chronic debilitating disease significantly impacting global health and prosperity. Much remains to be learned about how Brucella spp. succeed in sabotaging immune host cells and how Brucella spp. respond to environmental challenges. Multiple types of bacteria employ the prokaryotic second messenger cyclic di-GMP (c-di-GMP) to coordinate responses to shifting environments. To determine the role of c-di-GMP in Brucella physiology and in shaping host-Brucella interactions, we utilized c-di-GMP regulatory enzyme deletion mutants. Our results show that a ΔbpdA phosphodiesterase mutant producing excess c-di-GMP displays marked attenuation in vitro and in vivo during later infections. Although c-di-GMP is known to stimulate the innate sensor STING, surprisingly, the ΔbpdA mutant induced a weaker host immune response than did wild-type Brucella or the low-c-di-GMP guanylate cyclase ΔcgsB mutant. Proteomics analysis revealed that c-di-GMP regulates several processes critical for virulence, including cell wall and biofilm formation, nutrient acquisition, and the type IV secretion system. Finally, ΔbpdA mutants exhibited altered morphology and were hypersensitive to nutrient-limiting conditions. In summary, our results indicate a vital role for c-di-GMP in allowing Brucella to successfully navigate stressful and shifting environments to establish intracellular infection. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  5. Inhibitors of apoptosis (IAPs) regulate intestinal immunity and inflammatory bowel disease (IBD) inflammation

    DEFF Research Database (Denmark)

    Pedersen, Jannie; LaCasse, Eric C; Seidelin, Jakob B

    2014-01-01

    The inhibitor of apoptosis (IAP) family members, notably cIAP1, cIAP2, and XIAP, are critical and universal regulators of tumor necrosis factor (TNF) mediated survival, inflammatory, and death signaling pathways. Furthermore, IAPs mediate the signaling of nucleotide-binding oligomerization domain...

  6. Applying Statistical and Complex Network Methods to Explore the Key Signaling Molecules of Acupuncture Regulating Neuroendocrine-Immune Network

    Directory of Open Access Journals (Sweden)

    Kuo Zhang

    2018-01-01

    Full Text Available The mechanisms of acupuncture are still unclear. In order to reveal the regulatory effect of manual acupuncture (MA on the neuroendocrine-immune (NEI network and identify the key signaling molecules during MA modulating NEI network, we used a rat complete Freund’s adjuvant (CFA model to observe the analgesic and anti-inflammatory effect of MA, and, what is more, we used statistical and complex network methods to analyze the data about the expression of 55 common signaling molecules of NEI network in ST36 (Zusanli acupoint, and serum and hind foot pad tissue. The results indicate that MA had significant analgesic, anti-inflammatory effects on CFA rats; the key signaling molecules may play a key role during MA regulating NEI network, but further research is needed.

  7. The two-component system VicRK regulates functions associated with Streptococcus mutans resistance to complement immunity.

    Science.gov (United States)

    Alves, Livia A; Harth-Chu, Erika N; Palma, Thais H; Stipp, Rafael N; Mariano, Flávia S; Höfling, José F; Abranches, Jacqueline; Mattos-Graner, Renata O

    2017-10-01

    Streptococcus mutans, a dental caries pathogen, can promote systemic infections upon reaching the bloodstream. The two-component system (TCS) VicRK Sm of S. mutans regulates the synthesis of and interaction with sucrose-derived exopolysaccharides (EPS), processes associated with oral and systemic virulence. In this study, we investigated the mechanisms by which VicRK Sm affects S. mutans susceptibility to blood-mediated immunity. Compared with parent strain UA159, the vicK Sm isogenic mutant (UAvic) showed reduced susceptibility to deposition of C3b of complement, low binding to serum immunoglobulin G (IgG), and low frequency of C3b/IgG-mediated opsonophagocytosis by polymorphonuclear cells in a sucrose-independent way (Pmutans employs mechanisms of complement evasion through peptidases, which are controlled by VicRK Sm. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Reversible epigenetic down-regulation of MHC molecules by devil facial tumour disease illustrates immune escape by a contagious cancer

    DEFF Research Database (Denmark)

    Siddle, Hannah V; Kreiss, Alexandre; Tovar, Cesar

    2013-01-01

    Contagious cancers that pass between individuals as an infectious cell line are highly unusual pathogens. Devil facial tumor disease (DFTD) is one such contagious cancer that emerged 16 y ago and is driving the Tasmanian devil to extinction. As both a pathogen and an allograft, DFTD cells should...... be rejected by the host-immune response, yet DFTD causes 100% mortality among infected devils with no apparent rejection of tumor cells. Why DFTD cells are not rejected has been a question of considerable confusion. Here, we show that DFTD cells do not express cell surface MHC molecules in vitro or in vivo......, MHC class I molecules can be restored to the surface of DFTD cells in vitro by using recombinant devil IFN-γ, which is associated with up-regulation of the MHC class II transactivator, a key transcription factor with deacetylase activity. Further, expression of MHC class I molecules by DFTD cells can...

  9. Immune mechanisms regulating pharmacokinetics and pharmacodynamics of PEGylated liposomal anticancer agents

    Science.gov (United States)

    Song, Gina

    Nanotechnology has made significant advances in drug delivery system for the treatment of cancer. Among various nanoparticle (NP) platforms, liposomes have been most widely used as a NP drug carrier for cancer therapy. High variation in pharmacokinetics (PK) and pharmacodynamics (PD) of liposome-based therapeutics has been reported. However, the interaction of liposome-based therapeutics with the immune system, specifically the mononuclear phagocyte system (MPS), and underlying molecular mechanisms for variable responses to liposomal drugs remain poorly understood. The objective of this dissertation was to elucidate immune mechanisms for the variable responses to PEGylated liposomal doxorubicin (PLD; DoxilRTM), a clinically relevant NP, in animal models and in patients. In vitro, in vivo and clinical systems were investigated to evaluate the effects of chemokines (CCL2 and CCL5), heterogeneity of the tumor microenvironment, and genetic variations on PK and PD of PLD. Results showed that there was a significantly positive linear relationship between PLD exposure (AUC) and total amount of CCL2 and CCL5, most prevalent chemokines in plasma, in patients with recurrent ovarian cancer. Consistent with these findings, preclinical studies using mice bearing SKOV3 orthotopic ovarian cancer xenografts demonstrated that PLD induced the production and secretion of chemokines into plasma. In addition, in vitro studies using human monocytic THP-1 cells demonstrated that PLD altered monocyte migration towards CCL2 and CCL5. The PK and efficacy studies of PLD in murine models of breast cancer showed that heterogeneous tumor microenvironment was associated with significantly different tumor delivery and efficacy of PLD, but not small molecule doxorubicin between two breast tumor models. A candidate genetic locus that was associated with clearance of PLD in 23 inbred mouse strains contains a gene that encodes for engulfment adapter PTB domain containing 1 (Gulp1). By using

  10. REGULATION OF IMMUNE RESPONSE OF PATIENTS WITH PARTIALLY CONTROLLED vs CONTROLLED BRONCHIAL ASTHMA

    Directory of Open Access Journals (Sweden)

    E. Yu. Barabash

    2017-01-01

    Full Text Available A control group included seventeen conditionally healthy people (Group 1. Eighty-eight patients with proven bronchial asthma (BA at the age of 22 to 48 were enrolled into the study. I.e., Group 2 included nine patients with well-controlled BA. Group 3 included persons with partially controlled BA (n=79. There were 8 people with easily treated BA in group 2, and 57 such cases in Group 3. The levels of interleukins (IL-4, IL-10, IL-17A, interferon-γ (IFNγ, and tumor-α necrosis factor (TNFα were monitored by means of flow cytometry technique. The parameters of cellular immunity were registered by flow cytofluorimetry assays. Phagocytosis indicators were studied by means of D. Mayansky method, metabolic activity of neutrophils, by the B.Park method, as modified by E.Shmelev. Evaluation of cellular immunity did not reveal statistically significant differences for distinct CD subpopulations between healthy controls and BA patients. The patients with controlled and partially controlled BA exhibited some changes in cytokine concentrations, i.e., increased IL-4, IL-17А, IL-10 and TNFα levels; changes in phagocytosis and oxygen dependent bactericidal activities of neutrophils. We have revealed higher concentrations of IL-4, IL-17А in the less controlled BA (group 3 , as compared with group 2. TNFα induction remained at significantly higher level in both groups of BA patients, exceeding mean control values by 2.3 times. The degree of IL-10 production in group 2 with controlled BA was significantly higher than in group with partial disease control (group 3, p < 0.001, thus suggesting application of IL-10 levels as an index of active inflammation control. Patients with BA (groups 2, 3 exhibited a decrease of basal IFNγ, as compared to healthy people (p < 0.001. In group 3 (partial control, this parameter was 3-fold lower than in healthy persons. Evaluation of monocyte/phagocyte functions showed statistically significant differences between BA

  11. SH2 domain-containing protein tyrosine phosphatase 2 and focal adhesion kinase protein interactions regulate pulmonary endothelium barrier function.

    Science.gov (United States)

    Chichger, Havovi; Braza, Julie; Duong, Huetran; Harrington, Elizabeth O

    2015-06-01

    Enhanced protein tyrosine phosphorylation is associated with changes in vascular permeability through formation and dissolution of adherens junctions and regulation of stress fiber formation. Inhibition of the protein tyrosine phosphorylase SH2 domain-containing protein tyrosine phosphatase 2 (SHP2) increases tyrosine phosphorylation of vascular endothelial cadherin and β-catenin, resulting in disruption of the endothelial monolayer and edema formation in the pulmonary endothelium. Vascular permeability is a hallmark of acute lung injury (ALI); thus, enhanced SHP2 activity offers potential therapeutic value for the pulmonary vasculature in diseases such as ALI, but this has not been characterized. To assess whether SHP2 activity mediates protection against edema in the endothelium, we assessed the effect of molecular activation of SHP2 on lung endothelial barrier function in response to the edemagenic agents LPS and thrombin. Both LPS and thrombin reduced SHP2 activity, correlated with decreased focal adhesion kinase (FAK) phosphorylation (Y(397) and Y(925)) and diminished SHP2 protein-protein associations with FAK. Overexpression of constitutively active SHP2 (SHP2(D61A)) enhanced baseline endothelial monolayer resistance and completely blocked LPS- and thrombin-induced permeability in vitro and significantly blunted pulmonary edema formation induced by either endotoxin (LPS) or Pseudomonas aeruginosa exposure in vivo. Chemical inhibition of FAK decreased SHP2 protein-protein interactions with FAK concomitant with increased permeability; however, overexpression of SHP2(D61A) rescued the endothelium and maintained FAK activity and FAK-SHP2 protein interactions. Our data suggest that SHP2 activation offers the pulmonary endothelium protection against barrier permeability mediators downstream of the FAK signaling pathway. We postulate that further studies into the promotion of SHP2 activation in the pulmonary endothelium may offer a therapeutic approach for patients

  12. Regulation of DC development and DC-mediated T-cell immunity via CISH

    OpenAIRE

    Miah, Mohammad Alam; Bae, Yong-Soo

    2013-01-01

    Cytokine inducible SH2-containing protein (CISH) plays a crucial role in type 1 dendritic cell (DC) development as well as in the DC-mediated activation of cytotoxic T lymphocytes (CTLs). CISH expression at late DC developmental stages shuts down the proliferation of DC progenitors by negatively regulating signal transducer and activator of transcription 5 (STAT5) and facilitates the differentiation of DCs into potent stimulators of CTLs.

  13. Regulation of DC development and DC-mediated T-cell immunity via CISH.

    Science.gov (United States)

    Miah, Mohammad Alam; Bae, Yong-Soo

    2013-03-01

    Cytokine inducible SH2-containing protein (CISH) plays a crucial role in type 1 dendritic cell (DC) development as well as in the DC-mediated activation of cytotoxic T lymphocytes (CTLs). CISH expression at late DC developmental stages shuts down the proliferation of DC progenitors by negatively regulating signal transducer and activator of transcription 5 (STAT5) and facilitates the differentiation of DCs into potent stimulators of CTLs.

  14. KLF2 in Regulation of NF-κB-Mediated Immune Cell Function and Inflammation

    Directory of Open Access Journals (Sweden)

    Prerana Jha

    2017-11-01

    Full Text Available KLF2 (Kruppel-like factor 2 is a member of the zinc finger transcription factor family, which critically regulates embryonic lung development, function of endothelial cells and maintenance of quiescence in T-cells and monocytes. It is expressed in naïve T-cells and monocytes, however its level of expression decreases during activation and differentiation. KLF2 also plays critical regulatory role in various inflammatory diseases and their pathogenesis. Nuclear factor-kappaB (NF-κB is an important inducer of inflammation and the inflammation is mediated through the transcription of several proinflammatory cytokines, chemokines and adhesion molecules. So, both transcriptional factors KLF2 and NF-κB are being associated with the similar cellular functions and their maintenance. It was shown that KLF2 regulates most of the NF-κB-mediated activities. In this review, we focused on emphasizing the involvement of KLF2 in health and disease states and how they interact with transcriptional master regulator NF-κB.

  15. Regulation of brain copper homeostasis by the brain barrier systems: Effects of Fe-overload and Fe-deficiency

    International Nuclear Information System (INIS)

    Monnot, Andrew D.; Behl, Mamta; Ho, Sanna; Zheng, Wei

    2011-01-01

    Maintaining brain Cu homeostasis is vital for normal brain function. The role of systemic Fe deficiency (FeD) or overload (FeO) due to metabolic diseases or environmental insults in Cu homeostasis in the cerebrospinal fluid (CSF) and brain tissues remains unknown. This study was designed to investigate how blood-brain barrier (BBB) and blood-SCF barrier (BCB) regulated Cu transport and how FeO or FeD altered brain Cu homeostasis. Rats received an Fe-enriched or Fe-depleted diet for 4 weeks. FeD and FeO treatment resulted in a significant increase (+ 55%) and decrease (− 56%) in CSF Cu levels (p < 0.05), respectively; however, neither treatment had any effect on CSF Fe levels. The FeD, but not FeO, led to significant increases in Cu levels in brain parenchyma and the choroid plexus. In situ brain perfusion studies demonstrated that the rate of Cu transport into the brain parenchyma was significantly faster in FeD rats (+ 92%) and significantly slower (− 53%) in FeO rats than in controls. In vitro two chamber Transwell transepithelial transport studies using primary choroidal epithelial cells revealed a predominant efflux of Cu from the CSF to blood compartment by the BCB. Further ventriculo-cisternal perfusion studies showed that Cu clearance by the choroid plexus in FeD animals was significantly greater than control (p < 0.05). Taken together, our results demonstrate that both the BBB and BCB contribute to maintain a stable Cu homeostasis in the brain and CSF. Cu appears to enter the brain primarily via the BBB and is subsequently removed from the CSF by the BCB. FeD has a more profound effect on brain Cu levels than FeO. FeD increases Cu transport at the brain barriers and prompts Cu overload in the CNS. The BCB plays a key role in removing the excess Cu from the CSF.

  16. Fine tuning of reactive oxygen species homeostasis regulates primed immune responses in Arabidopsis.

    Science.gov (United States)

    Pastor, Victoria; Luna, Estrella; Ton, Jurriaan; Cerezo, Miguel; García-Agustín, Pilar; Flors, Victor

    2013-11-01

    Selected stimuli can prime the plant immune system for a faster and stronger defense reaction to pathogen attack. Pretreatment of Arabidopsis with the chemical agent β-aminobutyric acid (BABA) augmented H2O2 and callose production after induction with the pathogen-associated molecular pattern (PAMP) chitosan, or inoculation with the necrotrophic fungus Plectosphaerella cucumerina. However, BABA failed to prime H2O2 and callose production after challenge with the bacterial PAMP Flg22. Analysis of Arabidopsis mutants in reactive oxygen species (ROS) production (rbohD) or ROS scavenging (pad2, vtc1, and cat2) suggested a regulatory role for ROS homeostasis in priming of chitosan- and P. cucumerina-inducible callose and ROS. Moreover, rbohD and pad2 were both impaired in BABA-induced resistance against P. cucumerina. Gene expression analysis revealed direct induction of NADPH/respiratory burst oxidase protein D (RBOHD), γ-glutamylcysteine synthetase 1 (GSH1), and vitamin C defective 1 (VTC1) genes after BABA treatment. Conversely, ascorbate peroxidase 1 (APX1) transcription was repressed by BABA after challenge with chitosan or P. cucumerina, probably to provide a more oxidized environment in the cell and facilitate augmented ROS accumulation. Measuring ratios between reduced and oxidized glutathione confirmed that augmented defense expression in primed plants is associated with a more oxidized cellular status. Together, our data indicate that an altered ROS equilibrium is required for augmented defense expression in primed plants.

  17. α-1 Antitrypsin regulates human neutrophil chemotaxis induced by soluble immune complexes and IL-8.

    LENUS (Irish Health Repository)

    Bergin, David A

    2010-12-01

    Hereditary deficiency of the protein α-1 antitrypsin (AAT) causes a chronic lung disease in humans that is characterized by excessive mobilization of neutrophils into the lung. However, the reason for the increased neutrophil burden has not been fully elucidated. In this study we have demonstrated using human neutrophils that serum AAT coordinates both CXCR1- and soluble immune complex (sIC) receptor-mediated chemotaxis by divergent pathways. We demonstrated that glycosylated AAT can bind to IL-8 (a ligand for CXCR1) and that AAT-IL-8 complex formation prevented IL-8 interaction with CXCR1. Second, AAT modulated neutrophil chemotaxis in response to sIC by controlling membrane expression of the glycosylphosphatidylinositol-anchored (GPI-anchored) Fc receptor FcγRIIIb. This process was mediated through inhibition of ADAM-17 enzymatic activity. Neutrophils isolated from clinically stable AAT-deficient patients were characterized by low membrane expression of FcγRIIIb and increased chemotaxis in response to IL-8 and sIC. Treatment of AAT-deficient individuals with AAT augmentation therapy resulted in increased AAT binding to IL-8, increased AAT binding to the neutrophil membrane, decreased FcγRIIIb release from the neutrophil membrane, and normalization of chemotaxis. These results provide new insight into the mechanism underlying the effect of AAT augmentation therapy in the pulmonary disease associated with AAT deficiency.

  18. Chitinase-like proteins as regulators of innate immunity and tissue repair: helpful lessons for asthma?

    Science.gov (United States)

    Sutherland, Tara E

    2018-02-19

    Chitinases and chitinase-like proteins (CLPs) belong to the glycoside hydrolase family 18 of proteins. Chitinases are expressed in mammals and lower organisms, facilitate chitin degradation, and hence act as host-defence enzymes. Gene duplication and loss-of-function mutations of enzymatically active chitinases have resulted in the expression of a diverse range of CLPs across different species. CLPs are genes that are increasingly associated with inflammation and tissue remodelling not only in mammals but also across distant species. While the focus has remained on understanding the functions and expression patterns of CLPs during disease in humans, studies in mouse and lower organisms have revealed important and overlapping roles of the CLP family during physiology, host defence and pathology. This review will summarise recent insights into the regulatory functions of CLPs on innate immune pathways and discuss how these effects are not only important for host defence and tissue injury/repair after pathogen invasion, but also how they have extensive implications for pathological processes involved in diseases such as asthma. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  19. Immune and Metabolic Regulation Mechanism of Dangguiliuhuang Decoction against Insulin Resistance and Hepatic Steatosis

    Directory of Open Access Journals (Sweden)

    Hui Cao

    2017-07-01

    Full Text Available Dangguiliuhuang decoction (DGLHD is a traditional Chinese medicine (TCM formula, which mainly consists of angelica, radix rehmanniae, radix rehmanniae praeparata, scutellaria baicalensis, coptis chinensis, astragalus membranaceus, and golden cypress, and used for the treatment of diabetes and some autoimmune diseases. In this study, we explored the potential mechanism of DGLHD against insulin resistance and fatty liver in vivo and in vitro. Our data revealed that DGLHD normalized glucose and insulin level, increased the expression of adiponectin, diminished fat accumulation and lipogenesis, and promoted glucose uptake. Metabolomic analysis also demonstrated that DGLHD decreased isoleucine, adenosine, and cholesterol, increased glutamine levels in liver and visceral adipose tissue (VAT of ob/ob mice. Importantly, DGLHD promoted the shift of pro-inflammatory to anti-inflammatory cytokines, suppressed T lymphocytes proliferation, and enhanced regulatory T cells (Tregs differentiation. DGLHD also inhibited dendritic cells (DCs maturation, attenuated DCs-stimulated T cells proliferation and secretion of IL-12p70 cytokine from DCs, and promoted the interaction of DCs with Tregs. Further studies indicated that the changed PI3K/Akt signaling pathway and elevated PPAR-γ expression were not only observed with the ameliorated glucose and lipid metabolism in adipocytes and hepatocytes, but also exhibited in DCs and T cells by DGLHD. Collectively, our results suggest that DGLHD exerts anti-insulin resistant and antisteatotic effects by improving abnormal immune and metabolic homeostasis. And DGLHD may be a novel approach to the treatment of obesity-related insulin resistance and hepatic steatosis.

  20. Peripheral Tumor Necrosis Factor-Alpha (TNF-α) Modulates Amyloid Pathology by Regulating Blood-Derived Immune Cells and Glial Response in the Brain of AD/TNF Transgenic Mice.

    Science.gov (United States)

    Paouri, Evi; Tzara, Ourania; Kartalou, Georgia-Ioanna; Zenelak, Sofia; Georgopoulos, Spiros

    2017-05-17

    Increasing evidence has suggested that systemic inflammation along with local brain inflammation can play a significant role in Alzheimer's disease (AD) pathogenesis. Identifying key molecules that regulate the crosstalk between the immune and the CNS can provide potential therapeutic targets. TNF-α is a proinflammatory cytokine implicated in the pathogenesis of systemic inflammatory and neurodegenerative diseases, such as rheumatoid arthritis (RA) and AD. Recent studies have reported that anti-TNF-α therapy or RA itself can modulate AD pathology, although the underlying mechanism is unclear. To investigate the role of peripheral TNF-α as a mediator of RA in the pathogenesis of AD, we generated double-transgenic 5XFAD/Tg197 AD/TNF mice that develop amyloid deposits and inflammatory arthritis induced by human TNF-α (huTNF-α) expression. We found that 5XFAD/Tg197 mice display decreased amyloid deposition, compromised neuronal integrity, and robust brain inflammation characterized by extensive gliosis and elevated blood-derived immune cell populations, including phagocytic macrophages and microglia. To evaluate the contribution of peripheral huTNF-α in the observed brain phenotype, we treated 5XFAD/Tg197 mice systemically with infliximab, an anti-huTNF-α antibody that does not penetrate the blood-brain barrier and prevents arthritis. Peripheral inhibition of huTNF-α increases amyloid deposition, rescues neuronal impairment, and suppresses gliosis and recruitment of blood-derived immune cells, without affecting brain huTNF-α levels. Our data report, for the first time, a distinctive role for peripheral TNF-α in the modulation of the amyloid phenotype in mice by regulating blood-derived and local brain inflammatory cell populations involved in β-amyloid clearance. SIGNIFICANCE STATEMENT Mounting evidence supports the active involvement of systemic inflammation, in addition to local brain inflammation, in Alzheimer's disease (AD) progression. TNF-α is a

  1. Immune system development during early childhood in tropical Latin America: evidence for the age-dependent down regulation of the innate immune response.

    Science.gov (United States)

    Teran, Rommy; Mitre, Edward; Vaca, Maritza; Erazo, Silvia; Oviedo, Gisela; Hübner, Marc P; Chico, Martha E; Mattapallil, Joseph J; Bickle, Quentin; Rodrigues, Laura C; Cooper, Philip J

    2011-03-01

    The immune response that develops in early childhood underlies the development of inflammatory diseases such as asthma and there are few data from tropical Latin America (LA). This study investigated the effects of age on the development of immunity during the first 5 years of life by comparing innate and adaptive immune responses in Ecuadorian children aged 6-9 months, 22-26 months, and 48-60 months. Percentages of naïve CD4+ T cells declined with age while those of memory CD4(+) and CD8(+) T cells increased indicating active development of the immune system throughout the first five years. Young infants had greater innate immune responses to TLR agonists compared to older children while regulatory responses including SEB-induced IL-10 and percentages of FoxP3(+) T-regulatory cells decreased with age. Enhanced innate immunity in early life may be important for host defense against pathogens but may increase the risk of immunopathology. Copyright © 2010 Elsevier Inc. All rights reserved.

  2. Skin innate immune system

    Directory of Open Access Journals (Sweden)

    Berna Aksoy

    2013-06-01

    Full Text Available All multicellular organisms protect themselves from external universe and microorganisms by innate immune sytem that is constitutively present. Skin innate immune system has several different components composed of epithelial barriers, humoral factors and cellular part. In this review information about skin innate immune system and its components are presented to the reader. Innate immunity, which wasn’t adequately interested in previously, is proven to provide a powerfull early protection system, control many infections before the acquired immunity starts and directs acquired immunity to develop optimally

  3. Type II NKT-TFH cells against Gaucher lipids regulate B-cell immunity and inflammation.

    Science.gov (United States)

    Nair, Shiny; Boddupalli, Chandra Sekhar; Verma, Rakesh; Liu, Jun; Yang, Ruhua; Pastores, Gregory M; Mistry, Pramod K; Dhodapkar, Madhav V

    2015-02-19

    Chronic inflammation including B-cell activation is commonly observed in both inherited (Gaucher disease [GD]) and acquired disorders of lipid metabolism. However, the cellular mechanisms underlying B-cell activation in these settings remain to be elucidated. Here, we report that β-glucosylceramide 22:0 (βGL1-22) and glucosylsphingosine (LGL1), 2 major sphingolipids accumulated in GD, can be recognized by a distinct subset of CD1d-restricted human and murine type II natural killer T (NKT) cells. Human βGL1-22- and LGL1-reactive CD1d tetramer-positive T cells have a distinct T-cell receptor usage and genomic and cytokine profiles compared with the classical type I NKT cells. In contrast to type I NKT cells, βGL1-22- and LGL1-specific NKT cells constitutively express T-follicular helper (TFH) phenotype. Injection of these lipids leads to an increase in respective lipid-specific type II NKT cells in vivo and downstream induction of germinal center B cells, hypergammaglobulinemia, and production of antilipid antibodies. Human βGL1-22- and LGL1-specific NKT cells can provide efficient cognate help to B cells in vitro. Frequency of LGL1-specific T cells in GD mouse models and patients correlates with disease activity and therapeutic response. Our studies identify a novel type II NKT-mediated pathway for glucosphingolipid-mediated dysregulation of humoral immunity and increased risk of B-cell malignancy observed in metabolic lipid disorders. © 2015 by The American Society of Hematology.

  4. Immune regulation in T1D and T2D: prospective role of Foxp3+ Treg cells in disease pathogenesis and treatment

    Directory of Open Access Journals (Sweden)

    Mara eKornete

    2013-06-01

    Full Text Available There is increasing evidence that dysregulated immune responses play key roles in the pathogenesis and complications of type 1 but also type 2 diabetes. Indeed, chronic inflammation and autoimmunity, which are salient features of type 1 diabetes, are now believed to actively contribute to the pathogenesis of type 2 diabetes. The accumulation of activated innate and adaptive immune cells in various metabolic tissues results in the release of inflammatory mediators, which promote insulin resistance and β-cell damage. Moreover, these dysregulated immune responses can also mutually influence the prevalence of both type 1 and 2 diabetes. In this review article, we discuss the central role of immune responses in the patho-physiology and complications of type 1 and 2 diabetes, and provide evidence that regulation of these responses, particularly through the action of regulatory T cells, may be a possible therapeutic avenue for the treatment of these disease and their respective complications.

  5. Interleukin-17 receptor A (IL-17RA) as a central regulator of the protective immune response against Giardia.

    Science.gov (United States)

    Paerewijck, Oonagh; Maertens, Brecht; Dreesen, Leentje; Van Meulder, Frederik; Peelaers, Iris; Ratman, Dariusz; Li, Robert W; Lubberts, Erik; De Bosscher, Karolien; Geldhof, Peter

    2017-08-17

    The protozoan parasite Giardia is a highly prevalent intestinal pathogen with a wide host range. Data obtained in mice, cattle and humans revealed the importance of IL-17A in the development of a protective immune response against Giardia. The aim of this study was to further unravel the protective effector mechanisms triggered by IL-17A following G. muris infection in mice, by an RNA-sequencing approach. C57BL/6 WT and C57BL/6 IL-17RA KO mice were orally infected with G. muris cysts. Three weeks post infection, intestinal tissue samples were collected for RNA-sequencing, with samples from uninfected C57BL/6 WT and C57BL/6 IL-17RA KO animals serving as negative controls. Differential expression analysis showed that G. muris infection evoked the transcriptional upregulation of a wide array of genes, mainly in animals with competent IL-17RA signaling. IL-17RA signaling induced the production of various antimicrobial peptides, such as angiogenin 4 and α- and β-defensins and regulated complement activation through mannose-binding lectin 2. The expression of the receptor that regulates the secretion of IgA into the intestinal lumen, the polymeric immunoglobulin receptor, was also dependent on IL-17RA signaling. Interestingly, the transcriptome data showed for the first time the involvement of the circadian clock in the host response following Giardia infection.

  6. Yeast functional genomic screens lead to identification of a role for a bacterial effector in innate immunity regulation.

    Directory of Open Access Journals (Sweden)

    Roger W Kramer

    2007-02-01

    Full Text Available Numerous bacterial pathogens manipulate host cell processes to promote infection and ultimately cause disease through the action of proteins that they directly inject into host cells. Identification of the targets and molecular mechanisms of action used by these bacterial effector proteins is critical to understanding pathogenesis. We have developed a systems biological approach using the yeast Saccharomyces cerevisiae that can expedite the identification of cellular processes targeted by bacterial effector proteins. We systematically screened the viable yeast haploid deletion strain collection for mutants hypersensitive to expression of the Shigella type III effector OspF. Statistical data mining of the results identified several cellular processes, including cell wall biogenesis, which when impaired by a deletion caused yeast to be hypersensitive to OspF expression. Microarray experiments revealed that OspF expression resulted in reversed regulation of genes regulated by the yeast cell wall integrity pathway. The yeast cell wall integrity pathway is a highly conserved mitogen-activated protein kinase (MAPK signaling pathway, normally activated in response to cell wall perturbations. Together these results led us to hypothesize and subsequently demonstrate that OspF inhibited both yeast and mammalian MAPK signaling cascades. Furthermore, inhibition of MAPK signaling by OspF is associated with attenuation of the host innate immune response to Shigella infection in a mouse model. These studies demonstrate how yeast systems biology can facilitate functional characterization of pathogenic bacterial effector proteins.

  7. Regulation of dietary glutamine on the growth, intestinal function, immunity and antioxidant capacity of sea cucumber Apostichopus japonicus (Selenka).

    Science.gov (United States)

    Yu, Haibo; Gao, Qinfeng; Dong, Shuanglin; Lan, Ying; Ye, Zhi; Wen, Bin

    2016-03-01

    The present study examined the effects of dietary glutamine (Gln) on the growth, intestinal function, immunity and antioxidant capacity of sea cucumber Apostichopus japonicus (Selenka). The specific growth rate, intestinal morphology, activity of digestive enzymes, activity and gene expression of lysozyme and antioxidative enzymes of the sea cucumbers were determined after feeding 5 experimental diets with additions of increasing levels of Gln (at 0%, 0.4%, 0.8%,1.2% and 1.6%, respectively) for 60 days. We discovered that the specific growth rate of the sea cucumbers in 0.4%, 0.8% and 1.2% groups increased 35.3%, 27.3% and 24.1%, respectively, compared to the control (0%) group with significant differences. Dietary Gln can improve the intestinal function of the sea cucumbers by increasing the activities of trypsin and lipase in the intestine and the villus height and villus density of the intestine, eventhough significant differences were not observed in some groups. 0.4%-0.8% of dietary Gln can significantly increase the activity of lysozyme (LSZ) in the coelomic fluid of the sea cucumbers. Significant improvements were observed on the SOD activity in coelomic fluid of the sea cucumbers fed diets supplemented with 0.4%-1.6% of Gln compared to the control group. Similarly, the CAT activity in coelomic fluid of the sea cucumbers significantly increased in 0.8%, 1.2% and 1.6% groups compared to the control and 0.4% groups. Change pattern of the activity of CAT was consistent with the change pattern of the expression of CAT gene, indicating the dietary Gln can up-regulate the expression of CAT gene and consequently promote the secretion of CAT. However, the down-regulation of the expression of SOD gene by dietary Gln were observed in almost all of the treatment groups, which is in contrast with the change pattern of the activity of SOD, indicating the negative feedback regulation of the secretion of SOD on the expression of SOD gene. In summary, the suitable

  8. Nuclear sensing of viral DNA, epigenetic regulation of herpes simplex virus infection, and innate immunity

    International Nuclear Information System (INIS)

    Knipe, David M.

    2015-01-01

    Herpes simplex virus (HSV) undergoes a lytic infection in epithelial cells and a latent infection in neuronal cells, and epigenetic mechanisms play a major role in the differential gene expression under the two conditions. HSV viron DNA is not associated with histones but is rapidly loaded with heterochromatin upon entry into the cell. Viral proteins promote reversal of the epigenetic silencing in epithelial cells while the viral latency-associated transcript promotes additional heterochromatin in neuronal cells. The cellular sensors that initiate the chromatinization of foreign DNA have not been fully defined. IFI16 and cGAS are both essential for innate sensing of HSV DNA, and new evidence shows how they work together to initiate innate signaling. IFI16 also plays a role in the heterochromatinization of HSV DNA, and this review will examine how IFI16 integrates epigenetic regulation and innate sensing of foreign viral DNA to show how these two responses are related. - Highlights: • HSV lytic and latent gene expression is regulated differentially by epigenetic processes. • The sensors of foreign DNA have not been defined fully. • IFI16 and cGAS cooperate to sense viral DNA in HSV-infected cells. • IFI16 plays a role in both innate sensing of HSV DNA and in restricting its expression

  9. Nuclear sensing of viral DNA, epigenetic regulation of herpes simplex virus infection, and innate immunity

    Energy Technology Data Exchange (ETDEWEB)

    Knipe, David M., E-mail: david_knipe@hms.harvard.edu

    2015-05-15

    Herpes simplex virus (HSV) undergoes a lytic infection in epithelial cells and a latent infection in neuronal cells, and epigenetic mechanisms play a major role in the differential gene expression under the two conditions. HSV viron DNA is not associated with histones but is rapidly loaded with heterochromatin upon entry into the cell. Viral proteins promote reversal of the epigenetic silencing in epithelial cells while the viral latency-associated transcript promotes additional heterochromatin in neuronal cells. The cellular sensors that initiate the chromatinization of foreign DNA have not been fully defined. IFI16 and cGAS are both essential for innate sensing of HSV DNA, and new evidence shows how they work together to initiate innate signaling. IFI16 also plays a role in the heterochromatinization of HSV DNA, and this review will examine how IFI16 integrates epigenetic regulation and innate sensing of foreign viral DNA to show how these two responses are related. - Highlights: • HSV lytic and latent gene expression is regulated differentially by epigenetic processes. • The sensors of foreign DNA have not been defined fully. • IFI16 and cGAS cooperate to sense viral DNA in HSV-infected cells. • IFI16 plays a role in both innate sensing of HSV DNA and in restricting its expression.

  10. 7a, 25-dihydroxycholesterol-mediated activation of EBI2 in immune regulation and diseases

    Directory of Open Access Journals (Sweden)

    Siquan eSun

    2015-03-01

    Full Text Available EBI2, aka GPR183, is a G-couple receptor originally identified in 1993 as one of main genes induced in Burkitt’s lymphoma cell line BL41 by Epstein-Barr virus (EBV infection. After it was reported in 2009 that the receptor played a key role in regulating B cell migration and responses, we initiated an effort in looking for its endogenous ligand. In 2011 we and another group reported the identification of 7a, 25-dihydroxyxcholesterol (7a, 25-OHC, an oxysterol, as the likely physiological ligand of EBI2. A few subsequently published studies further elucidated how 7a, 25-OHC bound to EBI2, and how a gradient of 7a, 25-OHC could be generated in vivo and regulated migration, activation, and functions of B cells, T cells, dendritic cells (DC, monocytes/macrophages and astrocytes. The identification of 7a, 25-OHC as a GPCR ligand revealed a previously unknown signaling system of oxysterols, a class of molecules which exert profound biological functions. Dysregulation of the synthesis or functions of these molecules is believed to contribute to inflammation and autoimmune diseases, cardiovascular diseases, neurodegenerative diseases, cancer as well as metabolic diseases such as diabetes, obesity, and dyslipidemia. Therefore EBI2 may represent a promising target for therapeutic interventions for human diseases.

  11. A systems biology approach reveals that tissue tropism to West Nile virus is regulated by antiviral genes and innate immune cellular processes.

    Directory of Open Access Journals (Sweden)

    Mehul S Suthar

    2013-02-01

    Full Text Available The actions of the RIG-I like receptor (RLR and type I interferon (IFN signaling pathways are essential for a protective innate immune response against the emerging flavivirus West Nile virus (WNV. In mice lacking RLR or IFN signaling pathways, WNV exhibits enhanced tissue tropism, indicating that specific host factors of innate immune defense restrict WNV infection and dissemination in peripheral tissues. However, the immune mechanisms by which the RLR and IFN pathways coordinate and function to impart restriction of WNV infection are not well defined. Using a systems biology approach, we defined the host innate immune response signature and actions that restrict WNV tissue tropism. Transcriptional profiling and pathway modeling to compare WNV-infected permissive (spleen and nonpermissive (liver tissues showed high enrichment for inflammatory responses, including pattern recognition receptors and IFN signaling pathways, that define restriction of WNV replication in the liver. Assessment of infected livers from Mavs(-/- × Ifnar(-/- mice revealed the loss of expression of several key components within the natural killer (NK cell signaling pathway, including genes associated with NK cell activation, inflammatory cytokine production, and NK cell receptor signaling. In vivo analysis of hepatic immune cell infiltrates from WT mice demonstrated that WNV infection leads to an increase in NK cell numbers with enhanced proliferation, maturation, and effector action. In contrast, livers from Mavs(-/- × Ifnar(-/- infected mice displayed reduced immune cell infiltration, including a significant reduction in NK cell numbers. Analysis of cocultures of dendritic and NK cells revealed both cell-intrinsic and -extrinsic roles for the RLR and IFN signaling pathways to regulate NK cell effector activity. Taken together, these observations reveal a complex innate immune signaling network, regulated by the RLR and IFN signaling pathways, that drives tissue

  12. The Roles of Two miRNAs in Regulating the Immune Response of Sea Cucumber.

    Science.gov (United States)

    Zhang, Pengjuan; Li, Chenghua; Zhang, Ran; Zhang, Weiwei; Jin, Chunhua; Wang, Lingling; Song, Linsheng

    2015-12-01

    MicroRNAs (miRNAs) have emerged as key regulators in many pathological processes by suppressing the transcriptional and post-transcriptional expression of target genes. MiR-2008 was previously found to be significantly up-regulated in diseased sea cucumber Apostichopus japonicus by high-through sequencing, whereas the reads of miR-137, a well-documented tumor repressor, displayed no significant change. In the present study, we found that miR-137 expression was slightly attenuated and miR-2008 was significantly enhanced after Vibrio splendidus infection or Lipopolysaccharides application. Further target screening and dual-luciferase reporter assay revealed that the two important miRNAs shared a common target gene of betaine-homocysteine S-methyltransferase (AjBHMT), which exhibited noncorrelated messenger RNA and protein expression patterns after bacterial challenge. In order to fully understand their regulatory mechanisms, we conducted the functional experiments in vitro and in vivo. The overexpression of miR-137 in sea cucumber or primary coelomocytes significantly decreased, whereas the inhibition of miR-137 increased the mRNA and protein expression levels of AjBHMT. In contrast, miR-2008 overexpression and inhibition showed no effect on AjBHMT mRNA levels, but the concentration of AjBHMT protein displayed significant changes both in vitro and in vivo. Consistently, the homocysteine (Hcy) contents were also accordingly altered in the aberrant expression analysis of both miRNAs, consistent with the results of the AjBHMT silencing assay in vitro and in vivo. More importantly, small interfering RNA mediated AjBHMT knockdown and Hcy exposure analyses both significantly increased reactive oxygen species (ROS) production and decreased the number of surviving invasive pathogen in sea cucumber coelomocytes. Taken together, these findings confirmed the differential roles of sea cucumber miR-137 and miR-2008 in regulating the common target AjBHMT to promote ROS production

  13. Cauliflower mosaic virus protein P6 inhibits signaling responses to salicylic acid and regulates innate immunity.

    Directory of Open Access Journals (Sweden)

    Andrew J Love

    Full Text Available Cauliflower mosaic virus (CaMV encodes a multifunctional protein P6 that is required for translation of the 35S RNA and also acts as a suppressor of RNA silencing. Here we demonstrate that P6 additionally acts as a pathogenicity effector of an unique and novel type, modifying NPR1 (a key regulator of salicylic acid (SA- and jasmonic acid (JA-dependent signaling and inhibiting SA-dependent defence responses We find that that transgene-mediated expression of P6 in Arabidopsis and transient expression in Nicotiana benthamiana has profound effects on defence signaling, suppressing expression of representative SA-responsive genes and increasing expression of representative JA-responsive genes. Relative to wild-type Arabidopsis P6-expressing transgenics had greatly reduced expression of PR-1 following SA-treatment, infection by CaMV or inoculation with an avirulent bacterial pathogen Pseudomonas syringae pv tomato (Pst. Similarly transient expression in Nicotiana benthamiana of P6 (including a mutant form defective in translational transactivation activity suppressed PR-1a transcript accumulation in response to Agrobacterium infiltration and following SA-treatment. As well as suppressing the expression of representative SA-regulated genes, P6-transgenic Arabidopsis showed greatly enhanced susceptibility to both virulent and avirulent Pst (titres elevated 10 to 30-fold compared to non-transgenic controls but reduced susceptibility to the necrotrophic fungus Botrytis cinerea. Necrosis following SA-treatment or inoculation with avirulent Pst was reduced and delayed in P6-transgenics. NPR1 an important regulator of SA/JA crosstalk, was more highly expressed in the presence of P6 and introduction of the P6 transgene into a transgenic line expressing an NPR1:GFP fusion resulted in greatly increased fluorescence in nuclei even in the absence of SA. Thus in the presence of P6 an inactive form of NPR1 is mislocalized in the nucleus even in uninduced plants

  14. Immune regulation in Chandipura virus infection: characterization of CD4+ T regulatory cells from infected mice

    Directory of Open Access Journals (Sweden)

    Shahir Prajakta

    2011-05-01

    Full Text Available Abstract Back ground Chandipura virus produces acute infection in mice. During infection drastic reduction of CD4+, CD8+ and CD19 + cell was noticed. Depletion of lymphocytes also noticed in spleen. The reduction may be due to the regulatory mechanism of immune system to prevent the bystander host tissue injury. There are several mechanisms like generation of regulatory cells, activation induced cell death (ACID etc were indicated to control the activation and maintain cellular homeostasis. Role of regulatory cells in homeostasis has been described in several viral diseases. This study was undertaken to characterize CD4+T regulatory cells from the infected mice. Method In this study we purified the CD4+ T cells from Chandipura virus infected susceptible Balb/c mice. CD4+ T regulatory cells were identified by expression of cell surface markers CD25, CD127 and CTLA-4 and intracellular markers Foxp3, IL-10 and TGF-beta. Antigen specificity and ability to suppress the proliferation of other lymphocytes were studied in vitro by purified CD4+CD25+T regulatory cells from infected mice. The proliferation was calculated by proliferation module of Flow Jo software. Expression of death receptors on regulatory cells were studied by flowcytometer. Results The CD4+ T cells isolated from infected mice expressed characteristic markers of regulatory phenotype at all post infective hours tested. The CD4+ T regulatory cells were proliferated when stimulated with Chandipura virus antigen. The regulatory cells did not suppress the proliferation of splenocytes stimulated with anti CD3 antibody when co cultured with them. Interesting observation was, while purification of CD4+ T cells by negative selection, the population of cells negative for CD4 also co purified along with CD4+ T cell. Flow cytometry analysis and light microscopy revealed that CD4 negative cells were of different size and shape (atypical compared to the normal lymphocytes. Greater percentage of

  15. Humoral and cellular immune responses to glucose regulated protein 78 - a novel Leishmania donovani antigen

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Ismail, Ahmed; Gaafar, Ameera

    2002-01-01

    The recently cloned glucose regulated protein 78 (GRP78) of Leishmania donovani has been suggested as a new and promising Leishmania vaccine candidate. We assessed antibody and T-cell reactivity to GRP78 in an enzyme-linked immunosorbent assay (ELISA) and in lymphoproliferative assays. Serological...... with a positive leishmanin skin test showed antibody reactivity to recombinant GRP78 (rGRP78). In lymphoproliferative assays, 9 of 13 isolates of peripheral blood mononuclear cells (PBMC) from individuals previously infected with L. donovani and one of three individuals previously infected with L. major showed...... in an area endemic for malaria but free of leishmaniasis and plasma from healthy Danes was negative in the assay. GRP78 antibody was detected in 10% and 5% of plasma samples from Sudanese and Ghanaian malaria patients, respectively, whereas 35% of plasma samples from otherwise healthy Sudanese individuals...

  16. DMPD: Translational mini-review series on Toll-like receptors: networks regulated byToll-like receptors mediate innate and adaptive immunity. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 17223959 Translational mini-review series on Toll-like receptors: networks regulate...ol. 2007 Feb;147(2):199-207. (.png) (.svg) (.html) (.csml) Show Translational mini-review series on Toll-lik... immunity. PubmedID 17223959 Title Translational mini-review series on Toll-like receptors: networks regulat

  17. Cholinergic Modulation of Type 2 Immune Responses

    Directory of Open Access Journals (Sweden)

    Goele Bosmans

    2017-12-01

    Full Text Available In recent years, the bidirectional relationship between the nervous and immune system has become increasingly clear, and its role in both homeostasis and inflammation has been well documented over the years. Since the introduction of the cholinergic anti-inflammatory pathway, there has been an increased interest in parasympathetic regulation of both innate and adaptive immune responses, including T helper 2 responses. Increasing evidence has been emerging suggesting a role for the parasympathetic nervous system in the pathophysiology of allergic diseases, including allergic rhinitis, asthma, food allergy, and atopic dermatitis. In this review, we will highlight the role of cholinergic modulation by both nicotinic and muscarinic receptors in several key aspects of the allergic inflammatory response, including barrier function, innate and adaptive immune responses, and effector cells responses. A better understanding of these cholinergic processes mediating key aspects of type 2 immune disorders might lead to novel therapeutic approaches to treat allergic diseases.

  18. Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

    Science.gov (United States)

    O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

    1999-01-01

    Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

  19. The DAF-16/FOXO transcription factor functions as a regulator of epidermal innate immunity.

    Science.gov (United States)

    Zou, Cheng-Gang; Tu, Qiu; Niu, Jie; Ji, Xing-Lai; Zhang, Ke-Qin

    2013-01-01

    The Caenorhabditis elegans DAF-16 transcription factor is critical for diverse biological processes, particularly longevity and stress resistance. Disruption of the DAF-2 signaling cascade promotes DAF-16 activation, and confers resistance to killing by pathogenic bacteria, such as Pseudomonas aeruginosa, Staphylococcus aureus, and Enterococcus faecalis. However, daf-16 mutants exhibit similar sensitivity to these bacteria as wild-type animals, suggesting that DAF-16 is not normally activated by these bacterial pathogens. In this report, we demonstrate that DAF-16 can be directly activated by fungal infection and wounding in wild-type animals, which is independent of the DAF-2 pathway. Fungal infection and wounding initiate the Gαq signaling cascade, leading to Ca(2+) release. Ca(2+) mediates the activation of BLI-3, a dual-oxidase, resulting in the production of reactive oxygen species (ROS). ROS then activate DAF-16 through a Ste20-like kinase-1/CST-1. Our results indicate that DAF-16 in the epidermis is required for survival after fungal infection and wounding. Thus, the EGL-30-Ca(2+)-BLI-3-CST-1-DAF-16 signaling represents a previously unknown pathway to regulate epidermal damage response.

  20. NKG2H-Expressing T Cells Negatively Regulate Immune Responses

    Directory of Open Access Journals (Sweden)

    Daniela Dukovska

    2018-03-01

    Full Text Available The biology and function of NKG2H receptor, unlike the better characterized members of the NKG2 family NKG2A, NKG2C, and NKG2D, remains largely unclear. Here, we show that NKG2H is able to associate with the signaling adapter molecules DAP12 and DAP10 suggesting that this receptor can signal for cell activation. Using a recently described NKG2H-specific monoclonal antibody (mAb, we have characterized the expression and function of lymphocytes that express this receptor. NKG2H is expressed at the cell surface of a small percentage of peripheral blood mononuclear cell (PBMC and is found more frequently on T cells, rather than NK cells. Moreover, although NKG2H is likely to trigger activation, co-cross-linking of this receptor with an NKG2H-specific mAb led to decreased T cell activation and proliferation in polyclonal PBMC cultures stimulated by anti-CD3 mAbs. This negative regulatory activity was seen only after cross-linking with NKG2H, but not NKG2A- or NKG2C-specific monoclonal antibodies. The mechanism underlying this negative effect is as yet unclear, but did not depend on the release of soluble factors or recognition of MHC class I molecules. These observations raise the intriguing possibility that NKG2H may be a novel marker for T cells able to negatively regulate T cell responses.

  1. Regulation of non-classical immune parameters in immune thrombocytopenic purpura mice by a spleen-invigorating, qi-replenishing and blood-containing formula

    Directory of Open Access Journals (Sweden)

    Tiantian Li

    2015-04-01

    Conclusions: The SQBF had a similar effect to prednisone with regards to enhancing peripheral blood platelet counts in ITP mice. Furthermore, it decreased β-EP levels and increased VIP and SIgA, and protected the thymus. This shows that, on base of the brain-gut axis functions, some non-classical immune vascular active factors or neurotransmitters are also involved in immune responses, and also have relationship with the onset of ITP and bleeding and/or hemostasis. It needs further study to determine whether a change in these active factors is related to immediate hemostasis.

  2. Genome-wide miRNA screening reveals miR-310 family members negatively regulate the immune response in Drosophila melanogaster via co-targeting Drosomycin.

    Science.gov (United States)

    Li, Yao; Li, Shengjie; Li, Ruimin; Xu, Jiao; Jin, Ping; Chen, Liming; Ma, Fei

    2017-03-01

    Although innate immunity mediated by Toll signaling has been extensively studied in Drosophila melanogaster, the role of miRNAs in regulating the Toll-mediated immune response remains largely unknown. In this study, following Gram-positive bacterial challenge, we identified 93 differentially expressed miRNAs via genome-wide miRNA screening. These miRNAs were regarded as immune response related (IRR). Eight miRNAs were confirmed to be involved in the Toll-mediated immune response upon Gram-positive bacterial infection through genetic screening of 41 UAS-miRNA lines covering 60 miRNAs of the 93 IRR miRNAs. Interestingly, four out of these eight miRNAs, miR-310, miR-311, miR-312 and miR-313, are clustered miRNAs and belong to the miR-310 family. These miR-310 family members were shown to target and regulate the expression of Drosomycin, an antimicrobial peptide produced by Toll signaling. Taken together, our study implies important regulatory roles of miRNAs in the Toll-mediated innate immune response of Drosophila upon Gram-positive bacterial infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Genome-wide RNAi screen reveals a new role of a WNT/CTNNB1 signaling pathway as negative regulator of virus-induced innate immune responses.

    Science.gov (United States)

    Baril, Martin; Es-Saad, Salwa; Chatel-Chaix, Laurent; Fink, Karin; Pham, Tram; Raymond, Valérie-Ann; Audette, Karine; Guenier, Anne-Sophie; Duchaine, Jean; Servant, Marc; Bilodeau, Marc; Cohen, Eric; Grandvaux, Nathalie; Lamarre, Daniel

    2013-01-01

    To identify new regulators of antiviral innate immunity, we completed the first genome-wide gene silencing screen assessing the transcriptional response at the interferon-β (IFNB1) promoter following Sendai virus (SeV) infection. We now report a novel link between WNT signaling pathway and the modulation of retinoic acid-inducible gene I (RIG-I)-like receptor (RLR)-dependent innate immune responses. Here we show that secretion of WNT2B and WNT9B and stabilization of β-catenin (CTNNB1) upon virus infection negatively regulate expression of representative inducible genes IFNB1, IFIT1 and TNF in a CTNNB1-dependent effector mechanism. The antiviral response is drastically reduced by glycogen synthase kinase 3 (GSK3) inhibitors but restored in CTNNB1 knockdown cells. The findings confirm a novel regulation of antiviral innate immunity by a canonical-like WNT/CTNNB1 signaling pathway. The study identifies novel avenues for broad-spectrum antiviral targets and preventing immune-mediated diseases upon viral infection.

  4. Genome-wide RNAi screen reveals a new role of a WNT/CTNNB1 signaling pathway as negative regulator of virus-induced innate immune responses.

    Directory of Open Access Journals (Sweden)

    Martin Baril

    Full Text Available To identify new regulators of antiviral innate immunity, we completed the first genome-wide gene silencing screen assessing the transcriptional response at the interferon-β (IFNB1 promoter following Sendai virus (SeV infection. We now report a novel link between WNT signaling pathway and the modulation of retinoic acid-inducible gene I (RIG-I-like receptor (RLR-dependent innate immune responses. Here we show that secretion of WNT2B and WNT9B and stabilization of β-catenin (CTNNB1 upon virus infection negatively regulate expression of representative inducible genes IFNB1, IFIT1 and TNF in a CTNNB1-dependent effector mechanism. The antiviral response is drastically reduced by glycogen synthase kinase 3 (GSK3 inhibitors but restored in CTNNB1 knockdown cells. The findings confirm a novel regulation of antiviral innate immunity by a canonical-like WNT/CTNNB1 signaling pathway. The study identifies novel avenues for broad-spectrum antiviral targets and preventing immune-mediated diseases upon viral infection.

  5. The potential impact of low dose ionizing γ-radiation on immune response activity up-regulated by Ikaros in IM-9 B lymphocytes

    International Nuclear Information System (INIS)

    Kim Sung Jn; Jang, Seon A; Yang, Kwang Hee; Kim, Ji Young; Kim, Cha Soon; Nam, Seon Young; Jeong, Mee Seon; Jin, Young Woo

    2011-01-01

    The biological effects of low dose ionizing radiation (LDIR) remain insufficiently understood. We examined for the scientific evidence to show the biological effects of LDIR using radiation-sensitive immune cells. We found that Ikaros protein was responded to low dose-dependent effects of gamma radiation in IM-9 B lymphocytes. Ikaros encodes zinc finger transcription factors that is important regulators of a hematopoietic stem cells (HSCs) progression to the B lymphoid lineage development, differentiation and proliferation. In this study, we observed that cell proliferation was enhanced from 10% to 20% by LDIR (0.05 Gy) in IM-9 B lymphocytes. The Ikaros protein was phosphorylated in its serine/threonine (S/T) region and decreased its DNA binding activity in the cells exposed to LDIR. We found that Ikaros phosphorylation was up-regulated by CK2/AKT pathway and the residues of ser-304 and ser-306 in Ikaros was phosphorylated by LDIR. We also observed that Ikaros protein was localized from the nucleus to the cytoplasm after LDIR and bound with Autotaxin (ENPP2, ATX) protein, stimulating proliferation, migration and survival of immune cells. In addition, we found that the lysoPLD activity of ATX was dependent on Ikaros-ATX binding activity. These results indicate that the Ikaros is an important regulator of immune activation. Therefore, we suggest that low dose ionizing radiation can be considered as a beneficial effects, stimulating the activation of immune cells.

  6. Early gene Broad complex plays a key role in regulating the immune response triggered by ecdysone in the Malpighian tubules of Drosophila melanogaster.

    Science.gov (United States)

    Verma, Puja; Tapadia, Madhu G

    2015-08-01

    In insects, humoral response to injury is accomplished by the production of antimicrobial peptides (AMPs) which are secreted in the hemolymph to eliminate the pathogen. Drosophila Malpighian tubules (MTs), however, are unique immune organs that show constitutive expression of AMPs even in unchallenged conditions and the onset of immune response is developmental stage dependent. Earlier reports have shown ecdysone positively regulates immune response after pathogenic challenge however, a robust response requires prior potentiation by the hormone. Here we provide evidence to show that MTs do not require prior potentiation with ecdysone hormone for expression of AMPs and they respond to ecdysone very fast even without immune challenge, although the different AMPs Diptericin, Cecropin, Attacin, Drosocin show differential expression in response to ecdysone. We show that early gene Broad complex (BR-C) could be regulating the IMD pathway by activating Relish and physically interacting with it to activate AMPs expression. BR-C depletion from Malpighian tubules renders the flies susceptible to infection. We also show that in MTs ecdysone signaling is transduced by EcR-B1 and B2. In the absence of ecdysone signaling the IMD pathway associated genes are down regulated and activation and translocation of transcription factor Relish is also affected. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. The Role of Non-specific and Specific Immune Systems in Poultry against Newcastle Disease

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2015-09-01

    Full Text Available Newcastle disease (ND is caused by avian paramyxovirus-1 which belong to Avulavirus genus and Paramyxoviridae family. The birds have abnormalities in humoral (bursa fabricius and cellular (thymus and spleen lymphoid organs. Lesions decrease the immune system. Immune system consists of non-specific and specific immune systems. The main components of non-specific immunity are physical and chemical barrier (feather and skin or mucosa, phagocytic cells (macrophages and natural killer, protein complement and the mediator of inflammation and cytokines. Interferons (IFNs belong to a group of cytokines that play a major role in the nonspecific or innate (natural immunity. The virulent ND virus encodes protein of V gene can be suppressed IFN type I. This leads to non-specific immune system fail to respond to the virulent strains resulting in severe pathogenicity. The defense mechanism of the host is replaced by specific immunity (adaptive immunity when natural immunity fails to overcome the infection. The specific immune system consists of humoral mediated immunity (HMI and cell-mediated immunity (CMI. The cells of immune system that react specifically with the antigen are B lymphocytes producing the antibodies, T lymphocytes that regulate the synthesis of antibodies and T cells as effector or the direct cytotoxic cells. Both non-specific and specific immunities are complementary against the invasion of ND virus in the birds. The objective of this article is to discuss the role of non specific and specific immune system in ND.

  8. MicroRNA-mediated down-regulation of NKG2D ligands contributes to glioma immune escape.

    Science.gov (United States)

    Codo, Paula; Weller, Michael; Meister, Gunter; Szabo, Emese; Steinle, Alexander; Wolter, Marietta; Reifenberger, Guido; Roth, Patrick

    2014-09-15

    Malignant gliomas are intrinsic brain tumors with a dismal prognosis. They are well-adapted to hypoxic conditions and poorly immunogenic. NKG2D is one of the major activating receptors of natural killer (NK) cells and binds to several ligands (NKG2DL). Here we evaluated the impact of miRNA on the expression of NKG2DL in glioma cells including stem-like glioma cells. Three of the candidate miRNA predicted to target NKG2DL were expressed in various glioma cell lines as well as in glioblastomas in vivo: miR-20a, miR-93 and miR-106b. LNA inhibitor-mediated miRNA silencing up-regulated cell surface NKG2DL expression, which translated into increased susceptibility to NK cell-mediated lysis. This effect was reversed by neutralizing NKG2D antibodies, confirming that enhanced lysis upon miRNA silencing was mediated through the NKG2D system. Hypoxia, a hallmark of glioblastomas in vivo, down-regulated the expression of NKG2DL on glioma cells, associated with reduced susceptibility to NK cell-mediated lysis. This process, however, was not mediated through any of the examined miRNA. Accordingly, both hypoxia and the expression of miRNA targeting NKG2DL may contribute to the immune evasion of glioma cells at the level of the NKG2D recognition pathway. Targeting miRNA may therefore represent a novel approach to increase the immunogenicity of glioblastoma.

  9. The immune checkpoint regulator PD-L1 is a specific target for naturally occurring CD4(+) T cells

    DEFF Research Database (Denmark)

    Munir, Shamaila; Andersen, Gitte Holmen; Svane, Inge Marie

    2013-01-01

    Programmed cell death 1 ligand 1 (PD-L1) is an important regulator of T-cell responses and may consequently limit anticancer immunity. We have recently identified PD-L1-specific, cytotoxic CD8(+) T cells. In the present study, we develop these findings and report that CD4(+) helper T cells...... spontaneously recognize PD-L1. We examined the locality of a previously identified HLA-A*0201-restricted PD-L1-epitope for the presence of possible CD4(+) T-cell epitopes. Thus, we identified naturally occurring PD-L1-specific CD4(+) T cells among the peripheral blood lymphocytes of cancer patients...... and - to lesser extents - healthy donors, by means of ELISPOT assays. PD-L1-specific CD4(+) T cells appeared to be TH17 cells exhibiting an effector T-cell cytokine profile. Hence, PD-L1-specific CD4(+) T cells released interferon γ (IFNγ), tumor necrosis factor α (TNFα) and interleukin-17 (IL-17) in response...

  10. Nitric oxide–mediated regulation of ferroportin-1 controls macrophage iron homeostasis and immune function in Salmonella infection

    Science.gov (United States)

    Nairz, Manfred; Schleicher, Ulrike; Schroll, Andrea; Sonnweber, Thomas; Theurl, Igor; Ludwiczek, Susanne; Talasz, Heribert; Brandacher, Gerald; Moser, Patrizia L.; Muckenthaler, Martina U.; Fang, Ferric C.; Bogdan, Christian

    2013-01-01

    Nitric oxide (NO) generated by inducible NO synthase 2 (NOS2) affects cellular iron homeostasis, but the underlying molecular mechanisms and implications for NOS2-dependent pathogen control are incompletely understood. In this study, we found that NO up-regulated the expression of ferroportin-1 (Fpn1), the major cellular iron exporter, in mouse and human cells. Nos2−/− macrophages displayed increased iron content due to reduced Fpn1 expression and allowed for an enhanced iron acquisition by the intracellular bacterium Salmonella typhimurium. Nos2 gene disruption or inhibition of NOS2 activity led to an accumulation of iron in the spleen and splenic macrophages. Lack of NO formation resulted in impaired nuclear factor erythroid 2-related factor-2 (Nrf2) expression, resulting in reduced Fpn1 transcription and diminished cellular iron egress. After infection of Nos2−/− macrophages or mice with S. typhimurium, the increased iron accumulation was paralleled by a reduced cytokine (TNF, IL-12, and IFN-γ) expression and impaired pathogen control, all of which were restored upon administration of the iron chelator deferasirox or hyperexpression of Fpn1 or Nrf2. Thus, the accumulation of iron in Nos2−/− macrophages counteracts a proinflammatory host immune response, and the protective effect of NO appears to partially result from its ability to prevent iron overload in macrophages PMID:23630227

  11. Chemical characterization, antioxidant, immune-regulating and anticancer activities of a novel bioactive polysaccharide from Chenopodium quinoa seeds.

    Science.gov (United States)

    Hu, Yichen; Zhang, Jinming; Zou, Liang; Fu, Chaomei; Li, Peng; Zhao, Gang

    2017-06-01

    Chenopodium quinoa, a promising nutraceutical cereal, has attracted increasing research interest, yet its polysaccharides remains to get few systematic studies. In this study, we employed orthogonal experimental design to optimize the ultrasound-assisted extraction process for highest yield of C. quinoa polysaccharides. A novel C. quinoa polysaccharide (CQP) fraction with high content and low molecular weight (8852Da) was subsequently purified by column chromatography, constituted by galacturonic acid and glucose monosaccharides. The purified CQP exhibited significantly antioxidant effect against DPPH + and ABTS + , with even higher efficiency than some other reported polysaccharides. Moreover, CQP could promote the RAW264.7 macrophage proliferation, while suppress the nitri oxide production on inflammatory RAW264.7 macrophage in a dose- and time-dependent manner. In view of the pathological correlation of free radical, inflammation and carcinogenesis, the anticancer effect of CQP was further investigated on human liver cancer SMMC 7721 and breast cancer MCF-7 cells. Interestingly, CQP displayed cytotoxicity against cancer cells, while none proliferation inhibition on normal cells. These results suggest that the bioactive polysaccharide from C. quinoa provided the promising potential as a natural antioxidant, immune-regulating and anticancer candidate for food and even drug application. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Early VEGF inhibition attenuates blood-brain barrier disruption in ischemic rat brains by regulating the expression of MMPs.

    Science.gov (United States)

    Zhang, Hai-Tao; Zhang, Ping; Gao, Yi; Li, Chen-Long; Wang, Hong-Jun; Chen, Ling-Chao; Feng, Yan; Li, Rui-Yan; Li, Yong-Li; Jiang, Chuan-Lu

    2017-01-01

    Vascular endothelial growth factor (VEGF) inhibition has been demonstrated to be an effective strategy in preserving the integrity of the blood-brain barrier (BBB) in patients with acute ischemic stroke. Loss of the BBB is the key event associated with morbidity and mortality in these patients. However, the underlying mechanisms remain poorly understood. In the present study, the effects of VEGF inhibition and the possible mechanism that underlies acute cerebral ischemia in rats was investigated. Following the induction of transient middle cerebral artery occlusion for a 90‑min period, either an anti‑VEGF neutralizing antibody (RB‑222; 5 or 10 µg), or IgG (control), was administered by intracerebroventricular injection at 1 h following reperfusion. Functional outcomes, BBB leakage, brain edema, microvessel numbers and the relative protein levels of VEGF, matrix metalloproteinase (MMP)-2, MMP-9, occludin and collagen-IV were then determined using neurological assessments, Evans Blue staining, brain water content, CD31 staining and western blotting. Treatment with RB‑222 at a dose of 5 and 10 µg significantly improved neurological functional outcomes and diminished infarct size, BBB leakage and brain edema compared with the MCAO and IgG groups at 24 h following reperfusion; 10 µg RB‑222 was more effective than a 5 µg dose of the antibody. In addition, RB‑222 reduced the number of immature microvessels, which subsequently attenuated BBB permeability. RB‑222 significantly repressed VEGF expression as well as decreased MMP‑2 and MMP‑9 expression. However, it enhanced occludin and collagen‑IV levels in the ischemic rat brain compared with the MCAO and IgG groups. Taken together, the results indicate that early inhibition of VEGF may have significant potential against cerebral ischemia, partly by regulating the expression of MMPs.

  13. Late regulation of immune genes and microRNAs in circulating leukocytes in a pig model of influenza A (H1N2) infection.

    Science.gov (United States)

    Brogaard, Louise; Heegaard, Peter M H; Larsen, Lars E; Mortensen, Shila; Schlegel, Michael; Dürrwald, Ralf; Skovgaard, Kerstin

    2016-02-19

    MicroRNAs (miRNAs) are a class of short regulatory RNA molecules which are implicated in modulating gene expression. Levels of circulating, cell-associated miRNAs in response to influenza A virus (IAV) infection has received limited attention so far. To further understand the temporal dynamics and biological implications of miRNA regulation in circulating leukocytes, we collected blood samples before and after (1, 3, and 14 days) IAV challenge of pigs. Differential expression of miRNAs and innate immune factor mRNA transcripts was analysed using RT-qPCR. A total of 20 miRNAs were regulated after IAV challenge, with the highest number of regulated miRNAs seen on day 14 after infection at which time the infection was cleared. Targets of the regulated miRNAs included genes involved in apoptosis and cell cycle regulation. Significant regulation of both miRNAs and mRNA transcripts at 14 days after challenge points to a protracted effect of IAV infection, potentially affecting the host's ability to respond to secondary infections. In conclusion, experimental IAV infection of pigs demonstrated the dynamic nature of miRNA and mRNA regulation in circulating leukocytes during and after infection, and revealed the need for further investigation of the potential immunosuppressing effect of miRNA and innate immune signaling after IAV infection.

  14. Immune-Specific Expression and Estrogenic Regulation of the Four Estrogen Receptor Isoforms in Female Rainbow Trout (Oncorhynchus mykiss

    Directory of Open Access Journals (Sweden)

    Ayako Casanova-Nakayama

    2018-03-01

    Full Text Available Genomic actions of estrogens in vertebrates are exerted via two intracellular estrogen receptor (ER subtypes, ERα and ERβ, which show cell- and tissue-specific expression profiles. Mammalian immune cells express ERs and are responsive to estrogens. More recently, evidence became available that ERs are also present in the immune organs and cells of teleost fish, suggesting that the immunomodulatory function of estrogens has been conserved throughout vertebrate evolution. For a better understanding of the sensitivity and the responsiveness of the fish immune system to estrogens, more insight is needed on the abundance of ERs in the fish immune system, the cellular ratios of the ER subtypes, and their autoregulation by estrogens. Consequently, the aims of the present study were (i to determine the absolute mRNA copy numbers of the four ER isoforms in the immune organs and cells of rainbow trout, Oncorhynchus mykiss, and to compare them to the hepatic ER numbers; (ii to analyse the ER mRNA isoform ratios in the immune system; and, (iii finally, to examine the alterations of immune ER mRNA expression levels in sexually immature trout exposed to 17β-estradiol (E2, as well as the alterations of immune ER mRNA expression levels in sexually mature trout during the reproductive cycle. All four ER isoforms were present in immune organs—head kidney, spleen-and immune cells from head kidney and blood of rainbow trout, but their mRNA levels were substantially lower than in the liver. The ER isoform ratios were tissue- and cell-specific, both within the immune system, but also between the immune system and the liver. Short-term administration of E2 to juvenile female trout altered the ER mRNA levels in the liver, but the ERs of the immune organs and cells were not responsive. Changes of ER gene transcript numbers in immune organs and cells occurred during the reproductive cycle of mature female trout, but the changes in the immune ER profiles differed

  15. Genes Linked to Endometriosis by GWAS Are Integral to Cytoskeleton Regulation and Suggests That Mesothelial Barrier Homeostasis Is a Factor in the Pathogenesis of Endometriosis.

    Science.gov (United States)

    Albertsen, Hans M; Ward, Kenneth

    2017-06-01

    Endometriosis, defined by the presence of ectopic endometrial lesions, is a common disease in reproductive-age women that profoundly affects patients' quality of life. Various pathogenic models have been proposed, but the origin of endometriosis remains elusive. In this article, we propose that the mesothelial barrier, which protects the underlying stroma from endometrial transplants present in retrograde menstrual fluid, can be compromised by activation of the epithelial to mesenchymal transition (EMT) repair mechanism that lead to temporary loss of barrier integrity. Absent of the mesothelial barrier, endometrial cells can more readily adhere to the underlying peritoneal stroma and establish endometrial lesions. The hypothesis is based on the clinical and experimental observations that correlate the location of endometrial lesions with areas of mesothelial damage, together with genetic evidence that 4 genes associated with endometriosis are direct regulators of the actin-cytoskeleton, which coordinates mesothelial barrier integrity. It supports past observations that implicate the peritoneum in the pathogenesis of endometriosis and unifies previously disparate theories that endometriosis may be triggered by infection, mechanical damage, and inflammation since each of these mechanisms can induce EMT in the mesothelium. If the hypothesis is correct, inhibition of EMT in the mesothelial barrier provides a novel paradigm for the prevention and treatment of endometriosis.

  16. Regulation of T cell immunity in atopic dermatitis by microbes: The Yin and Yang of cutaneous inflammation

    Directory of Open Access Journals (Sweden)

    Tilo eBiedermann

    2015-07-01

    Full Text Available Atopic dermatitis (AD is a chronic inflammatory skin disease predominantly mediated by T helper cells. While numerous adaptive immune mechanisms in AD pathophysiology have been elucidated in detail, deciphering the impact of innate immunity in AD pathogenesis has made substantial progress in recent years and is currently a fast evolving field. As innate and adaptive immunity are intimately linked cross-talks between these two branches of the immune system are critically influencing the resulting immune response and disease. Innate immune recognition of the cutaneous microbiota was identified to substantially contribute to immune homeostasis and shaping of protective adaptive immunity in the absence of inflammation. Disturbances in the composition of the skin microbiome with reduced microbial diversity and overabundance of Staphylococcus spp. have been shown to be associated with AD inflammation. Distinct S. aureus associated microbial associated molecular patterns (MAMPs binding to TLR2 heterodimers could be identified to initiate long lasting cutaneous inflammation driven by T helper cells and consecutively local immune suppression by induction of myeloid derived suppressor cells (MDSC further favoring secondary skin infections as often seen in AD patients. Moreover dissecting cellular and molecular mechanisms in cutaneous innate immune sensing in AD pathogenesis paved the way for exploiting regulatory and anti-inflammatory pathways to attenuate skin inflammation. Activation of the innate immune system by MAMPs of non-pathogenic bacteria on AD skin alleviated cutaneous inflammation. The induction of tolerogenic dendritic cells, Interleukin-10 expression and regulatory Tr1 cells were shown to mediate this beneficial effect. Thus, activation of innate immunity by MAMPs of non-pathogenic bacteria for induction of regulatory T cell phenotypes seems to be a promising strategy for treatment of inflammatory skin disorders as atopic dermatitis. These

  17. MiR-155–regulated molecular network orchestrates cell fate in the innate and adaptive immune response to Mycobacterium tuberculosis

    Science.gov (United States)

    Rothchild, Alissa C.; Sissons, James R.; Shafiani, Shahin; Plaisier, Christopher; Min, Deborah; Mai, Dat; Gilchrist, Mark; Peschon, Jacques; Larson, Ryan P.; Bergthaler, Andreas; Baliga, Nitin S.; Urdahl, Kevin B.; Aderem, Alan

    2016-01-01

    The regulation of host–pathogen interactions during Mycobacterium tuberculosis (Mtb) infection remains unresolved. MicroRNAs (miRNAs) are important regulators of the immune system, and so we used a systems biology approach to construct an miRNA regulatory network activated in macrophages during Mtb infection. Our network comprises 77 putative miRNAs that are associated with temporal gene expression signatures in macrophages early after Mtb infection. In this study, we demonstrate a dual role for one of these regulators, miR-155. On the one hand, miR-155 maintains the survival of Mtb-infected macrophages, thereby providing a niche favoring bacterial replication; on the other hand, miR-155 promotes the survival and function of Mtb-specific T cells, enabling an effective adaptive immune response. MiR-155–induced cell survival is mediated through the SH2 domain-containing inositol 5-phosphatase 1 (SHIP1)/protein kinase B (Akt) pathway. Thus, dual regulation of the same cell survival pathway in innate and adaptive immune cells leads to vastly different outcomes with respect to bacterial containment. PMID:27681624

  18. Nogo-B Facilitates LPS-Mediated Immune Responses by Up-Regulation of TLR4-Signaling in Macrophage RAW264.7

    Directory of Open Access Journals (Sweden)

    Ying Zhu

    2017-01-01

    Full Text Available Background/Aims: Nogo-B, a member of the reticulon family of proteins, is mainly located in the endoplasmic reticulum (ER. Here, we investigate the function and mechanism of Nogo-B in the regulation of TLR4-associated immune responses in the macrophage cell line of RAW264.7. Methods: Nogo-B was up- and down-regulated through the use of appropriate adenoviral vectors or siRNA, and the effects of Nogo-B on macrophages under liposaccharide (LPS stimulation were evaluated via western blotting, immunofluorescence, enzyme-linked immunosorbent assay (ELISA, flow cytometric analysis, and transwell assay. Results: Our data indicates that the protein of Nogo-B was down-regulated in a time- and dose-dependent manner following LPS administration in the macrophage. Nogo-B overexpression increased the production of inflammatory cytokines (MCP-1, TNF-α, IL-1β, and TGF-β, enhanced macrophage migration activities, activated major histocompatibility complex II (MHC II, and elevated the expression of macrophage scavenger receptor 1(MSR1, all of which suggest that Nogo-B is necessary for immune responses and plays an important role in regulating macrophage recruitment. Mechanistically, Nogo-B may enhance TLR4 expression in macrophage surfaces, activate mitogen-activated protein kinase (MAPK pathways, and initiate inflammatory responses. Conclusion: These findings illustrate the key regulatory functions of Nogo-B in facilitating LPS-mediated immune responses through promoting the phosphorylation of MAP kinase.

  19. Neurotransmitter system of immune regulation as a marker of immunological disorders in pupils in the conditions of increased entry of strontium with drinking water

    Directory of Open Access Journals (Sweden)

    О.V. Dolgikh

    2015-09-01

    Full Text Available The evaluation of immunological markers in schoolchildren exposed to strontium is performed. It is shown that under the conditions of increased administration of strontium with drinking water the indication of spontaneous and induced levels of neurotransmitters in vitro allows to detect early functional disorders of the immune system. It was found that the following markers of specific hypersensitivity and mediators of intercellular immune regulation (IgG specific to strontium, cytokines IL-6, IL-10, IL-12, IL-17, α-TNF, GM-CSF, spontaneous and specifically stimulated, RANKL, OPG( may be proposed for the identification of health risk as early markers of immune disorders in school children living in areas of strontium geochemical provinces.

  20. Viral DNA Sensors IFI16 and Cyclic GMP-AMP Synthase Possess Distinct Functions in Regulating Viral Gene Expression, Immune Defenses, and Apoptotic Responses during Herpesvirus Infection.

    Science.gov (United States)

    Diner, Benjamin A; Lum, Krystal K; Toettcher, Jared E; Cristea, Ileana M

    2016-11-15

    The human interferon-inducible protein IFI16 is an important antiviral factor that binds nuclear viral DNA and promotes antiviral responses. Here, we define IFI16 dynamics in space and time and its distinct functions from the DNA sensor cyclic dinucleotide GMP-AMP synthase (cGAS). Live-cell imaging reveals a multiphasic IFI16 redistribution, first to viral entry sites at the nuclear periphery and then to nucleoplasmic puncta upon herpes simplex virus 1 (HSV-1) and human cytomegalovirus (HCMV) infections. Optogenetics and live-cell microscopy establish the IFI16 pyrin domain as required for nuclear periphery localization and oligomerization. Furthermore, using proteomics, we define the signature protein interactions of the IFI16 pyrin and HIN200 domains and demonstrate the necessity of pyrin for IFI16 interactions with antiviral proteins PML and cGAS. We probe signaling pathways engaged by IFI16, cGAS, and PML using clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated knockouts in primary fibroblasts. While IFI16 induces cytokines, only cGAS activates STING/TBK-1/IRF3 and apoptotic responses upon HSV-1 and HCMV infections. cGAS-dependent apoptosis upon DNA stimulation requires both the enzymatic production of cyclic dinucleotides and STING. We show that IFI16, not cGAS or PML, represses HSV-1 gene expression, reducing virus titers. This indicates that regulation of viral gene expression may function as a greater barrier to viral replication than the induction of antiviral cytokines. Altogether, our findings establish coordinated and distinct antiviral functions for IFI16 and cGAS against herpesviruses. How mammalian cells detect and respond to DNA viruses that replicate in the nucleus is poorly understood. Here, we decipher the distinct functions of two viral DNA sensors, IFI16 and cGAS, during active immune signaling upon infection with two herpesviruses, herpes simplex virus 1 (HSV-1) and human cytomegalovirus (HCMV). We show that IFI16

  1. Down regulation of the TCR complex CD3 ζ-chain on CD3+ T cells: a potential mechanism for helminth mediated immune modulation

    Directory of Open Access Journals (Sweden)

    Laura Jane Appleby

    2015-02-01

    Full Text Available The CD3ζ forms part of the T cell receptor (TCR where it plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways leading to T cell effector functions. Down regulation of CD3ζ leads to impairment of immune responses including reduced cell proliferation and cytokine production. In experimental models helminth parasites have been shown to modulate immune responses directed against them and unrelated antigens, so called bystander antigens, but there is a lack of studies validating these observations in humans. This study focused on investigated the relationship between expression levels of the TCR CD3ζ chain with lymphocyte cell proliferation during human infection with the helminth parasite, Schistosoma haematobium which causes uro-genital schistosomiasis. Using flow cytometry, peripheral blood mononuclear cells (PBMCs from individuals naturally exposed to S. haematobium in rural Zimbabwe were phenotyped, and expression levels of CD3ζ on T cells were related to intensity of infection. In this population, parasite infection intensity was inversely related to CD3ζ expression levels (p<0.05, consistent with down-regulation of CD3ζ expression during helminth infection. Furthermore, PBMC proliferation was positively related to expression levels of CD3ζ (p<0.05 after allowing for confounding variables (host age, sex, infection level. CD3ζ expression levels had a differing relationship between immune correlates of susceptibility and immunity, measured by antibody responses, indicating a complex relationship between immune activation status and immunity. The relationships between the CD3ζ chain of the TCR and schistosome infection, PBMC proliferation and schistosome-specific antibody responses have not previously been reported, and these results may indicate a mechanism for the impaired T cell proliferative responses observed during human schistosome infection.

  2. Clonorchis sinensis adult-derived proteins elicit Th2 immune responses by regulating dendritic cells via mannose receptor.

    Directory of Open Access Journals (Sweden)

    Lu Zhao

    2018-03-01

    Full Text Available Clonorchis sinensis (C. sinensis is the most widespread human liver fluke in East Asia including China and Korea. Clonorchiasis as a neglected tropical zoonosis, leads to serious economic and public health burden in China. There are considerable evidences for an etiological relation between chronic clonorchiasis and liver fibrosis in human beings. Liver fibrosis is a highly conserved and over-protected response to hepatic tissue injury. Immune cells including CD4+ T cell as well as dendritic cell (DC, and pro-fibrogenic cytokines like interleukin 4 (IL-4, IL-13 have been identified as vital manipulators in liver fibrogenesis. Our previous studies had a mere glimpse of T helper type 2 (Th2 dominant immune responses as key players in liver fibrosis induced by C. sinensis infection, but little is known about the involved mechanisms in this pathological process.By flow cytometry (FACS, adult-derived total proteins of C. sinensis (CsTPs down-regulated the expression of surface markers CD80, CD86 and major histocompatibility complex class II (MHC-II on lipopolysaccharide (LPS induced DC. ELISA results demonstrated that CsTPs inhibited IL-12p70 release from LPS-treated bone marrow-derived dendritic cells (BMDC. IL-10 level increased in a time-dependent manner in LPS-treated BMDCs after incubation with CsTPs. CD4+ T cells incubated with LPS-treated BMDCs plus CsTPs could significantly elevate IL-4 level by ELISA. Meanwhile, elevated expression of pro-fibrogenic mediators including IL-13 and IL-4 were detected in a co-culture system of LPS-activated BMDCs and naive T cells containing CsTPs. In vivo, CsTPs-immunized mice enhanced expression of type 2 cytokines IL-13, IL-10 and IL-4 in both splenocytes and hepatic tissue. Exposure of BMDCs to CsTPs activated expression of mannose receptor (MR but not toll like receptor 2 (TLR2, TLR4, C-type lectin receptor DC-SIGN and Dectin-2 on the cell surface by RT-PCR and FACS. Blockade of MR almost completely

  3. The intracellular immune receptor Rx1 regulates the DNA-binding activity of a Golden2-like transcription factor

    NARCIS (Netherlands)

    Townsend, Philip D.; Dixon, Christopher H.; Slootweg, Erik J.; Sukarta, Octavina C.A.; Yang, Ally W.H.; Hughes, Timothy R.; Sharples, Gary J.; Palsson, Lars-Olof; Takken, Frank L.W.; Goverse, Aska; Cann, Martin J.

    2018-01-01

    Plant NLR proteins enable the immune system to recognise and respond to pathogen attack. An early consequence of immune activation is transcriptional reprogramming and some NLRs have been shown to act in the nucleus and interact with transcription factors. The Rx1 NLR protein of potato is further

  4. Arkansas community pharmacists' opinions on providing immunizations.

    Science.gov (United States)

    Pace, Anne C; Flowers, Schwanda K; Hastings, Jan K

    2010-10-01

    To determine community pharmacists' attitudes and knowledge on providing immunizations including perceived barriers to immunizing. The study also examined the percentage of Arkansas pharmacists providing immunizations and the utilization of student pharmacists. Survey. Arkansas community pharmacies from February to March 2009. Community pharmacists. Mailed survey. Perceived barriers to providing immunizations, pharmacists' attitudes regarding immunizations, number of immunization-certified pharmacists, immunization administration rates within the last year, and senior student pharmacists utilization. A total of 350 surveys were mailed, and 129 were returned. In all, 79% of the respondents believed administering immunizations has advanced or significantly advanced the profession. Being certified and attitude toward providing immunizations were correlated; 37% of the respondents held certification to immunize, of which 77% reported immunizing within the last year. Commonly reported barriers included time (76%) followed by reimbursement and legal liability. Only half the respondents realized fourth year student pharmacists could immunize and only 33% of certified pharmacists utilized student pharmacists to immunize. Pharmacists perceive many barriers to providing immunizations. Training student pharmacists to give immunizations may not result in them providing immunizations upon graduation. Additional education on overcoming potential barriers and using senior student pharmacists to administer immunizations is needed.

  5. Evasion of host immune defenses by human papillomavirus.

    Science.gov (United States)

    Westrich, Joseph A; Warren, Cody J; Pyeon, Dohun

    2017-03-02

    A majority of human papillomavirus (HPV) infections are asymptomatic and self-resolving in the absence of medical interventions. Various innate and adaptive immune responses, as well as physical barriers, have been implicated in controlling early HPV infections. However, if HPV overcomes these host immune defenses and establishes persistence in basal keratinocytes, it becomes very difficult for the host to eliminate the infection. The HPV oncoproteins E5, E6, and E7 are important in regulating host immune responses. These oncoproteins dysregulate gene expression, protein-protein interactions, posttranslational modifications, and cellular trafficking of critical host immune modulators. In addition to the HPV oncoproteins, sequence variation and dinucleotide depletion in papillomavirus genomes has been suggested as an alternative strategy for evasion of host immune defenses. Since anti-HPV host immune responses are also considered to be important for antitumor immunity, immune dysregulation by HPV during virus persistence may contribute to immune suppression essential for HPV-associated cancer progression. Here, we discuss cellular pathways dysregulated by HPV that allow the virus to evade various host immune defenses. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Differences in innate immune response gene regulation in the middle ear of children who are otitis prone and in those not otitis prone

    Science.gov (United States)

    Casey, Janet; Pichichero, Michael

    2016-01-01

    Objective: Acute otitis media (AOM) causes an inflammatory response in the middle ear. We assessed differences in innate immune responses involved in bacterial defense at onset of AOM in children who were stringently defined as otitis prone (sOP) and children not otitis prone (NOP). Study Design: Innate immune genes analysis from middle ear fluid (MEF) samples of children. Methods: Genes of toll-like receptors (TLR), nod-like and retinoic acid-inducible gene-I-like receptors, downstream effectors important for inflammation and apoptosis, including cytokines and chemokines, were studied from MEF samples by using a real-time polymerase chain reaction array. Protein levels of differentially regulated genes were measured by Luminex. Results: Gene expression in MEF among children who were sOP was significantly different in upregulation of interleukin 8, secretory leukocyte peptidase inhibitor, and chemokine (C-C motif) ligand 3, and in downregulation of interferon regulatory factor 7 and its related signaling molecules interferon alpha, Toll-like receptor adaptor molecule 2, chemokine (C-C motif) ligand 5, and mitogen-activated protein kinase 8 compared with children who were NOP. Differences in innate gene regulation were similar when AOM was caused by Streptococcus pneumoniae or nontypeable Haemophilus influenzae. Conclusion: Innate-immune response genes are differentially regulated in children who were sOP compared with children with NOP. PMID:28124644

  7. Immunity by equilibrium.

    Science.gov (United States)

    Eberl, Gérard

    2016-08-01

    The classical model of immunity posits that the immune system reacts to pathogens and injury and restores homeostasis. Indeed, a century of research has uncovered the means and mechanisms by which the immune system recognizes danger and regulates its own activity. However, this classical model does not fully explain complex phenomena, such as tolerance, allergy, the increased prevalence of inflammatory pathologies in industrialized nations and immunity to multiple infections. In this Essay, I propose a model of immunity that is based on equilibrium, in which the healthy immune system is always active and in a state of dynamic equilibrium between antagonistic types of response. This equilibrium is regulated both by the internal milieu and by the microbial environment. As a result, alteration of the internal milieu or microbial environment leads to immune disequilibrium, which determines tolerance, protective immunity and inflammatory pathology.

  8. An analysis of potential barriers and enablers to regulating the television marketing of unhealthy foods to children at the state government level in Australia.

    Science.gov (United States)

    Chung, Alexandra; Shill, Jane; Swinburn, Boyd; Mavoa, Helen; Lawrence, Mark; Loff, Bebe; Crammond, Bradley; Sacks, Gary; Allender, Steven; Peeters, Anna

    2012-12-28

    In Australia there have been many calls for government action to halt the effects of unhealthy food marketing on children's health, yet implementation has not occurred. The attitudes of those involved in the policy-making process towards regulatory intervention governing unhealthy food marketing are not well understood. The objective of this research was to understand the perceptions of senior representatives from Australian state and territory governments, statutory authorities and non-government organisations regarding the feasibility of state-level government regulation of television marketing of unhealthy food to children in Australia. Data from in-depth semi-structured interviews with senior representatives from state and territory government departments, statutory authorities and non-government organisations (n=22) were analysed to determine participants' views about regulation of television marketing of unhealthy food to children at the state government level. Data were analysed using content and thematic analyses. Regulation of television marketing of unhealthy food to children was supported as a strategy for obesity prevention. Barriers to implementing regulation at the state level were: the perception that regulation of television advertising is a Commonwealth, not state/territory, responsibility; the power of the food industry and; the need for clear evidence that demonstrates the effectiveness of regulation. Evidence of community support for regulation was also cited as an important factor in determining feasibility. The regulation of unhealthy food marketing to children is perceived to be a feasible strategy for obesity prevention however barriers to implementation at the state level exist. Those involved in state-level policy making generally indicated a preference for Commonwealth-led regulation. This research suggests that implementation of regulation of the television marketing of unhealthy food to children should ideally occur under the direction

  9. An analysis of potential barriers and enablers to regulating the television marketing of unhealthy foods to children at the state government level in Australia

    Directory of Open Access Journals (Sweden)

    Chung Alexandra

    2012-12-01

    Full Text Available Abstract Background In Australia there have been many calls for government action to halt the effects of unhealthy food marketing on children's health, yet implementation has not occurred. The attitudes of those involved in the policy-making process towards regulatory intervention governing unhealthy food marketing are not well understood. The objective of this research was to understand the perceptions of senior representatives from Australian state and territory governments, statutory authorities and non-government organisations regarding the feasibility of state-level government regulation of television marketing of unhealthy food to children in Australia. Method Data from in-depth semi-structured interviews with senior representatives from state and territory government departments, statutory authorities and non-government organisations (n=22 were analysed to determine participants' views about regulation of television marketing of unhealthy food to children at the state government level. Data were analysed using content and thematic analyses. Results Regulation of television marketing of unhealthy food to children was supported as a strategy for obesity prevention. Barriers to implementing regulation at the state level were: the perception that regulation of television advertising is a Commonwealth, not state/territory, responsibility; the power of the food industry and; the need for clear evidence that demonstrates the effectiveness of regulation. Evidence of community support for regulation was also cited as an important factor in determining feasibility. Conclusions The regulation of unhealthy food marketing to children is perceived to be a feasible strategy for obesity prevention however barriers to implementation at the state level exist. Those involved in state-level policy making generally indicated a preference for Commonwealth-led regulation. This research suggests that implementation of regulation of the television marketing of

  10. HLA-G mediated immune regulation is impaired by a single amino acid exchange in the alpha 2 domain.

    Science.gov (United States)

    Celik, Alexander A; Simper, Gwendolin S; Huyton, Trevor; Blasczyk, Rainer; Bade-Döding, Christina

    2018-06-01

    The trade-off from HLA class I expression to HLA-G expression support the immune evasion of malignant cells. The essential role of the virtually invariant HLA-G in immune tolerance, tumor immunology and its expression frequency in immune privileged tissues is known; however the specific importance of allelic subtypes in immune responses is still not well understood. HLA-G ∗ 01:01, ∗ 01:03 and ∗ 01:04 are the most prevalent allelic variants differing at residues 31 and 110, respectively. In cytotoxicity assays applying K562 cells transduced with the HLA-G variants as targets and NK cells as effectors the differential protective potential of HLA-G variants was analyzed. Their peptide profiles were determined utilizing soluble HLA technology. An increased protective potential of HLA-G ∗ 01:04 could be observed. All variants exhibit a unique peptide repertoire with marginal overlap, while G ∗ 01:04 differs in its peptide anchor profile substantially. The functional differences between HLA-G subtypes could be explained by the constraint of the bound peptides, modifying the pHLA-G accessible surface. For the first time a contribution of amino acid alterations within the HLA-G heavy chain for peptide selection and NK cell recognition could be observed. These results will be a step towards understanding immune tolerance and will guide towards personalized immune therapeutic strategies. Copyright © 2018. Published by Elsevier Inc.

  11. Toll-like Receptor 4: Innate Immune Regulator of Neuroimmune and Neuroendocrine interactions in Stress and Major Depressive Disorder

    Directory of Open Access Journals (Sweden)

    Jiajun eLiu

    2014-09-01

    Full Text Available Major depressive disorder (MDD poses one of the highest disease burdens worldwide. Yet, current treatments targeting serotonergic and noradrenaline reuptake systems are insufficient to provide long-term relief from depressive symptoms in most patients, indicating the need for new treatment targets. Having the ability to influence behaviour similar to depressive symptoms, as well as communicate with neuronal and neuroendocrine systems, the innate immune system is a strong candidate for MDD treatments. Given the complex nature of immune signalling, the main question becomes: What is the role of the innate immune system in MDD?The current review presents evidence that toll-like receptor 4 (TLR4, via driving both peripheral and central immune responses, can interact with serotonergic neurotransmission and cause neuroendocrine disturbances, thus integrating with widely observed hallmarks of MDD. Additionally, through describing the multi-directional communication between immune, neural and endocrine systems in stress, TLR4 – related mechanisms can mediate stress-induced adaptations, which are necessary for the development of MDD. Therefore, apart from exogenous pathogenic mechanisms, TLR4 is involved in immune changes as a result of endogenous stress signals, playing an integral part in the pathophysiology, and could be a potential target for pharmacological treatments to improve current interventions for MDD.

  12. Distinct temporal roles for the promyelocytic leukaemia (PML protein in the sequential regulation of intracellular host immunity to HSV-1 infection.

    Directory of Open Access Journals (Sweden)

    Thamir Alandijany

    2018-01-01

    Full Text Available Detection of viral nucleic acids plays a critical role in the induction of intracellular host immune defences. However, the temporal recruitment of immune regulators to infecting viral genomes remains poorly defined due to the technical difficulties associated with low genome copy-number detection. Here we utilize 5-Ethynyl-2'-deoxyuridine (EdU labelling of herpes simplex virus 1 (HSV-1 DNA in combination with click chemistry to examine the sequential recruitment of host immune regulators to infecting viral genomes under low multiplicity of infection conditions. Following viral genome entry into the nucleus, PML-nuclear bodies (PML-NBs rapidly entrapped viral DNA (vDNA leading to a block in viral replication in the absence of the viral PML-NB antagonist ICP0. This pre-existing intrinsic host defence to infection occurred independently of the vDNA pathogen sensor IFI16 (Interferon Gamma Inducible Protein 16 and the induction of interferon stimulated gene (ISG expression, demonstrating that vDNA entry into the nucleus alone is not sufficient to induce a robust innate immune response. Saturation of this pre-existing intrinsic host defence during HSV-1 ICP0-null mutant infection led to the stable recruitment of PML and IFI16 into vDNA complexes associated with ICP4, and led to the induction of ISG expression. This induced innate immune response occurred in a PML-, IFI16-, and Janus-Associated Kinase (JAK-dependent manner and was restricted by phosphonoacetic acid, demonstrating that vDNA polymerase activity is required for the robust induction of ISG expression during HSV-1 infection. Our data identifies dual roles for PML in the sequential regulation of intrinsic and innate immunity to HSV-1 infection that are dependent on viral genome delivery to the nucleus and the onset of vDNA replication, respectively. These intracellular host defences are counteracted by ICP0, which targets PML for degradation from the outset of nuclear infection to promote v

  13. Coagulin-L ameliorates TLR4 induced oxidative damage and immune response by regulating mitochondria and NOX-derived ROS

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, Sukka Santosh [Pharmacology Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Chauhan, Parul [Medicinal and Process Chemistry Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Maurya, Preeti [Pharmacology Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Academy of Scientific and Innovative Research, New Delhi 110025 (India); Saini, Deepika [Medicinal and Process Chemistry Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Yadav, Prem Prakash, E-mail: pp_yadav@cdri.res.in [Medicinal and Process Chemistry Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India); Barthwal, Manoj Kumar, E-mail: manojbarthwal@cdri.res.in [Pharmacology Division, CSIR-Central Drug Research Institute, Lucknow 226031 (India)

    2016-10-15

    Withanolides possess diverse biological and pharmacological activity but their immunomodulatory function is less realized. Hence, coagulin-L, a withanolide isolated from Withania coagulans Dunal has been studied for such an effect in human and murine cells, and mice model. Coagulin-L (1, 3, 10 μM) exhibited immunomodulatory effect by suppressing TLR4 induced immune mediators such as cytokines (GMCSF, IFNα, IFNγ, IL-1α, IL-1Rα, IL-1β, IL-2, IL-2R, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12 (p40/p70), IL-13, IL-15, IL-17), chemokines (IL-8/CXCL8, MIG/CXCL9, IP-10/CXCL10, KC, MCP-1/CCL2, MIP-1α/CCL3, MIP-1β/CCL4, RANTES/CCL5, eotaxin/CCL11), growth factors (FGF-basic, VEGF), nitric oxide and intracellular superoxide. Mechanistically, coagulin-L abrogated LPS induced total and mitochondrial ROS generation, NOX2, NOX4 mRNA expression, IRAK and MAPK (p38, JNK, ERK) activation. Coagulin-L also attenuated IκBα degradation, which prevented NFκB downstream iNOS expression and pro-inflammatory cytokine release. Furthermore, coagulin-L (10, 25, 50 mg/kg, p.o.), undermined the LPS (10 mg/kg, i.p.) induced endotoxemia response in mice as evinced from diminished cytokine release, nitric oxide, aortic p38 MAPK activation and endothelial tissue impairment besides suppressing NOX2 and NOX4 expression in liver and aorta. Moreover, coagulin-L also alleviated the ROS mediated oxidative damage which was assessed through protein carbonyl, lipid hydroperoxide, 8-isoprostane and 8-hydroxy-2-deoxyguanosine quantification. To extend, coagulin-L also suppressed carrageenan-induced paw edema and thioglycollate-induced peritonitis in mice. Therefore, coagulin-L can be of therapeutic importance in pathological conditions induced by oxidative damage. - Highlights: • Coagulin-L demonstrates immunomodulatory effects in vivo and in vitro by modulating ROS. • Coagulin-L modulates TH1/TH2/TH17 immunokines. • Coagulin-L exerts immunomodulatory effect by regulating TLR4-IRAK- ROS

  14. The Arabidopsis Cysteine-Rich Receptor-Like Kinase CRK36 Regulates Immunity through Interaction with the Cytoplasmic Kinase BIK1

    Directory of Open Access Journals (Sweden)

    Dong Sook Lee

    2017-10-01

    Full Text Available Receptor-like kinases are important signaling components that regulate a variety of cellular processes. In this study, an Arabidopsis cDNA microarray analysis led to the identification of the cysteine-rich receptor-like kinase CRK36 responsive to the necrotrophic fungal pathogen, Alternaria brassicicola. To determine the function of CRK36 in plant immunity, T-DNA-insertion knockdown (crk36 and overexpressing (CRK36OE plants were prepared. CRK36OE plants exhibited increased hypersensitive cell death and ROS burst in response to avirulent pathogens. Treatment with a typical pathogen-associated molecular pattern, flg22, markedly induced pattern-triggered immune responses, notably stomatal defense, in CRK36OE plants. The immune responses were weakened in crk36 plants. Protein-protein interaction assays revealed the in vivo association of CRK36, FLS2, and BIK1. CRK36 enhanced flg22-triggered BIK1 phosphorylation, which showed defects with Cys mutations in the DUF26 motifs of CRK36. Disruption of BIK1 and RbohD/RbohF genes further impaired CRK36-mediated stomatal defense. We propose that CRK36, together with BIK1 and NADPH oxidases, may form a positive activation loop that enhances ROS burst and leads to the promotion of stomatal immunity.

  15. A novel role for inhibitor of apoptosis (IAP) proteins as regulators of endothelial barrier function by mediating RhoA activation.

    Science.gov (United States)

    Hornburger, Michael C; Mayer, Bettina A; Leonhardt, Stefanie; Willer, Elisabeth A; Zahler, Stefan; Beyerle, Andrea; Rajalingam, Krishnaraj; Vollmar, Angelika M; Fürst, Robert

    2014-04-01

    Inhibitor of apoptosis (IAP) proteins, such as XIAP or cIAP1/2, are important regulators of apoptosis in cancer cells, and IAP antagonists are currently evaluated as antitumor agents. Beyond their function in cancer cells, this study demonstrates a novel role of IAPs as regulators of vascular endothelial permeability. Two structurally different IAP antagonists, ABT and Smac085, as well as silencing of IAPs, reduced the thrombin receptor-activating peptide (TRAP)-induced barrier dysfunction in human endothelial cells as assessed by measuring macromolecular permeability or transendothelial electrical resistance. ABT diminished thrombin-evoked stress fiber formation, activation of myosin light chain 2, and disassembly of adherens junctions independent of calcium signaling, protein kinase C, and mitogen-activated protein kinases. Interestingly, ABT and silencing of IAPs, in particular XIAP, reduced the TRAP-evoked RhoA activation, whereas Rac1 was not affected. XIAP and, to a lesser extent, cIAP1 were found to directly interact with RhoA independently of the RhoA activation status. Under cell-free conditions, XIAP did not induce an ubiquitination of RhoA. In summary, our work discloses IAPs as crucial regulators of endothelial permeability and suggests IAP inhibition as interesting approach for the prevention of endothelial barrier dysfunction.

  16. The Rab GTPase Rab8 as a shared regulator of ciliogenesis and immune synapse assembly: From a conserved pathway to diverse cellular structures.

    Science.gov (United States)

    Patrussi, Laura; Baldari, Cosima T

    2016-01-01

    Rab GTPases, which form the largest branch of the Ras GTPase superfamily, regulate almost every step of vesicle-mediated trafficking. Among them, Rab8 is an essential participant in primary cilium formation. In a report recently published in the Journal of Cell Science, Finetti and colleagues identify Rab8 as a novel player in vesicular traffic in the non-ciliated T lymphocytes, which contributes to the assembly of the specialized signaling platform known as the immune synapse. By interacting with the v-SNARE VAMP-3, Rab8 is indeed responsible for the final docking/fusion step in T cell receptor (TCR) recycling to the immune synapse. A second important take-home message which comes to light from this work is that VAMP-3 also interacts with Rab8 at the base of the cilium in NIH-3T3 cells, where it regulates ciliary growth and targeting of Smoothened at the plasma membrane. Hence the data presented in this report, in addition to identifying Rab8 as a novel player in vesicular traffic to the immune synapse, reveal how both ciliated and non-ciliated cells take advantage of a conserved pathway to build highly specific cellular structures.

  17. Alternative Pre-mRNA Splicing in Mammals and Teleost Fish: A Effective Strategy for the Regulation of Immune Responses Against Pathogen Infection.

    Science.gov (United States)

    Chang, Ming Xian; Zhang, Jie

    2017-07-15

    Pre-mRNA splicing is the process by which introns are removed and the protein coding elements assembled into mature mRNAs. Alternative pre-mRNA splicing provides an important source of transcriptome and proteome complexity through selectively joining different coding elements to form mRNAs, which encode proteins with similar or distinct functions. In mammals, previous studies have shown the role of alternative splicing in regulating the function of the immune system, especially in the regulation of T-cell activation and function. As lower vertebrates, teleost fish mainly rely on a large family of pattern recognition receptors (PRRs) to recognize pathogen-associated molecular patterns (PAMPs) from various invading pathogens. In this review, we summarize recent advances in our understanding of alternative splicing of piscine PRRs including peptidoglycan recognition proteins (PGRPs), nucleotide binding and oligomerization domain (NOD)-like receptors (NLRs), retinoic acid-inducible gene-I (RIG-I)-like receptors (RLRs) and their downstream signaling molecules, compared to splicing in mammals. We also discuss what is known and unknown about the function of splicing isoforms in the innate immune responses against pathogens infection in mammals and teleost fish. Finally, we highlight the consequences of alternative splicing in the innate immune system and give our view of important directions for future studies.

  18. The tomato Fni3 lysine-63-specific ubiquitin-conjugating enzyme and suv ubiquitin E2 variant positively regulate plant immunity.

    Science.gov (United States)

    Mural, Ravi V; Liu, Yao; Rosebrock, Tracy R; Brady, Jennifer J; Hamera, Sadia; Connor, Richard A; Martin, Gregory B; Zeng, Lirong

    2013-09-01

    The activation of an immune response in tomato (Solanum lycopersicum) against Pseudomonas syringae relies on the recognition of E3 ligase-deficient forms of AvrPtoB by the host protein kinase, Fen. To investigate the mechanisms by which Fen-mediated immunity is regulated, we characterize in this study a Fen-interacting protein, Fni3, and its cofactor, S. lycoperiscum Uev (Suv). Fni3 encodes a homolog of the Ubc13-type ubiquitin-conjugating enzyme that catalyzes exclusively Lys-63-linked ubiquitination, whereas Suv is a ubiquitin-conjugating enzyme variant. The C-terminal region of Fen was necessary for interaction with Fni3, and this interaction was required for cell death triggered by overexpression of Fen in Nicotiana benthamiana leaves. Fni3 was shown to be an active E2 enzyme, but Suv displayed no ubiquitin-conjugating activity; Fni3 and Suv together directed Lys-63-linked ubiquitination. Decreased expression of Fni3, another tomato Ubc13 homolog, Sl-Ubc13-2, or Suv in N. benthamiana leaves diminished cell death associated with Fen-mediated immunity and cell death elicited by several other resistance (R) proteins and their cognate effectors. We also discovered that coexpression of Fen and other R proteins/effectors with a Fni3 mutant that is compromised for ubiquitin-conjugating activity diminished the cell death. These results suggest that Fni3/Sl-Ubc13-2 and Suv regulate the immune response mediated by Fen and other R proteins through Lys-63-linked ubiquitination.

  19. The Tomato Fni3 Lysine-63–Specific Ubiquitin-Conjugating Enzyme and Suv Ubiquitin E2 Variant Positively Regulate Plant Immunity[C][W

    Science.gov (United States)

    Mural, Ravi V.; Liu, Yao; Rosebrock, Tracy R.; Brady, Jennifer J.; Hamera, Sadia; Connor, Richard A.; Martin, Gregory B.; Zeng, Lirong

    2013-01-01

    The activation of an immune response in tomato (Solanum lycopersicum) against Pseudomonas syringae relies on the recognition of E3 ligase–deficient forms of AvrPtoB by the host protein kinase, Fen. To investigate the mechanisms by which Fen-mediated immunity is regulated, we characterize in this study a Fen-interacting protein, Fni3, and its cofactor, S. lycoperiscum Uev (Suv). Fni3 encodes a homolog of the Ubc13-type ubiquitin-conjugating enzyme that catalyzes exclusively Lys-63–linked ubiquitination, whereas Suv is a ubiquitin-conjugating enzyme variant. The C-terminal region of Fen was necessary for interaction with Fni3, and this interaction was required for cell death triggered by overexpression of Fen in Nicotiana benthamiana leaves. Fni3 was shown to be an active E2 enzyme, but Suv displayed no ubiquitin-conjugating activity; Fni3 and Suv together directed Lys-63–linked ubiquitination. Decreased expression of Fni3, another tomato Ubc13 homolog, Sl-Ubc13-2, or Suv in N. benthamiana leaves diminished cell death associated with Fen-mediated immunity and cell death elicited by several other resistance (R) proteins and their cognate effectors. We also discovered that coexpression of Fen and other R proteins/effectors with a Fni3 mutant that is compromised for ubiquitin-conjugating activity diminished the cell death. These results suggest that Fni3/Sl-Ubc13-2 and Suv regulate the immune response mediated by Fen and other R proteins through Lys-63–linked ubiquitination. PMID:24076975

  20. Predicting the Role of IL-10 in the Regulation of the Adaptive Immune Responses in Mycobacterium avium Subsp. paratuberculosis Infections Using Mathematical Models

    Science.gov (United States)

    Magombedze, Gesham; Eda, Shigetoshi; Stabel, Judy

    2015-01-01

    Mycobacterium avium subsp. paratuberculosis (MAP) is an intracellular bacterial pathogen that causes Johne’s disease (JD) in cattle and other animals. The hallmark of MAP infection in the early stages is a strong protective cell-mediated immune response (Th1-type), characterized by antigen-specific γ-interferon (IFN-γ). The Th1 response wanes with disease progression and is supplanted by a non-protective humoral immune response (Th2-type). Interleukin-10 (IL-10) is believed to play a critical role in the regulation of host immune responses to MAP infection and potentially orchestrate the reversal of Th1/Th2 immune dominance during disease progression. However, how its role correlates with MAP infection remains to be completely deciphered. We developed mathematical models to explain probable mechanisms for IL-10 involvement in MAP infection. We tested our models with IL-4, IL-10, IFN-γ, and MAP fecal shedding data collected from calves that were experimentally infected and followed over a period of 360 days in the study of Stabel and Robbe-Austerman (2011). Our models predicted that IL-10 can have different roles during MAP infection, (i) it can suppress the Th1 expression, (ii) can enhance Th2 (IL-4) expression, and (iii) can suppress the Th1 expression in synergy with IL-4. In these predicted roles, suppression of Th1 responses was correlated with increased number of MAP. We also predicted that Th1-mediated responses (IFN-γ) can lead to high expression of IL-10 and that infection burden regulates Th2 suppression by the Th1 response. Our models highlight areas where more experimental data is required to refine our model assumptions, and further test and investigate the role of IL-10 in MAP infection. PMID:26619346

  1. Predicting the Role of IL-10 in the Regulation of the Adaptive Immune Responses in Mycobacterium avium Subsp. paratuberculosis Infections Using Mathematical Models.

    Directory of Open Access Journals (Sweden)

    Gesham Magombedze

    Full Text Available Mycobacterium avium subsp. paratuberculosis (MAP is an intracellular bacterial pathogen that causes Johne's disease (JD in cattle and other animals. The hallmark of MAP infection in the early stages is a strong protective cell-mediated immune response (Th1-type, characterized by antigen-specific γ-interferon (IFN-γ. The Th1 response wanes with disease progression and is supplanted by a non-protective humoral immune response (Th2-type. Interleukin-10 (IL-10 is believed to play a critical role in the regulation of host immune responses to MAP infection and potentially orchestrate the reversal of Th1/Th2 immune dominance during disease progression. However, how its role correlates with MAP infection remains to be completely deciphered. We developed mathematical models to explain probable mechanisms for IL-10 involvement in MAP infection. We tested our models with IL-4, IL-10, IFN-γ, and MAP fecal shedding data collected from calves that were experimentally infected and followed over a period of 360 days in the study of Stabel and Robbe-Austerman (2011. Our models predicted that IL-10 can have different roles during MAP infection, (i it can suppress the Th1 expression, (ii can enhance Th2 (IL-4 expression, and (iii can suppress the Th1 expression in synergy with IL-4. In these predicted roles, suppression of Th1 responses was correlated with increased number of MAP. We also predicted that Th1-mediated responses (IFN-γ can lead to high expression of IL-10 and that infection burden regulates Th2 suppression by the Th1 response. Our models highlight areas where more experimental data is required to refine our model assumptions, and further test and investigate the role of IL-10 in MAP infection.

  2. Immune Homeostasis in Epithelial Cells: Evidence and Role of Inflammasome Signaling Reviewed.

    Science.gov (United States)

    Peeters, Paul M; Wouters, Emiel F; Reynaert, Niki L

    2015-01-01

    The epithelium regulates the interaction between the noxious xenogenous, as well as the microbial environment and the immune system, not only by providing a barrier but also by expressing a number of immunoregulatory membrane receptors, and intracellular danger sensors and their downstream effectors. Amongst these are a number of inflammasome sensor subtypes, which have been initially characterized in myeloid cells and described to be activated upon assembly into multiprotein complexes by microbial and environmental triggers. This review compiles a vast amount of literature that supports a pivotal role for inflammasomes in the various epithelial barriers of the human body as essential factors maintaining immune signaling and homeostasis.

  3. Immunoprophylaxis of infectious diseases in children: achievements and problems. Anti-vaccine movement as a barrier factor in immunization of the population

    Directory of Open Access Journals (Sweden)

    V.I. Dmytruk

    2017-09-01

    Full Text Available The article presents data on the state of immunization against major vaccine-controlled infections in international and regional subnational aspects. Some factors of worsening the epidemiological situation in Ukraine and the role of vaccination in the surveillance for infections that are controlled by means of specific immunoprophylaxis are identified. The features and causes of the anti-vaccine movement and possible ways of counteracting it are highlighted.

  4. Regulation of the human cathelicidin antimicrobial peptide gene by 1α,25-dihydroxyvitamin D3 in primary immune cells

    DEFF Research Database (Denmark)

    Lowry, Malcolm B; Guo, Chunxiao; Borregaard, Niels

    2014-01-01

    and osteoclasts. We also tested whether treatment with parathyroid hormone in combination with 1,25D3 would enhance hCAP18 induction as has been reported in skin cells, but we did not find enhancement in any immune cells tested. Our results indicate that hCAP18 is expressed at different levels according to cell...

  5. Interleukin-17 receptor A (IL-17RA) as a central regulator of the protective immune response against Giardia

    NARCIS (Netherlands)

    Paerewijck, O. (Oonagh); Maertens, B. (Brecht); L. Dreesen (Leentje); Van Meulder, F. (Frederik); Peelaers, I. (Iris); Ratman, D. (Dariusz); Li, R.W. (Robert W.); E.W. Lubberts (Erik); K. De Bosscher; P. Geldhof (Peter)

    2017-01-01

    textabstractThe protozoan parasite Giardia is a highly prevalent intestinal pathogen with a wide host range. Data obtained in mice, cattle and humans revealed the importance of IL-17A in the development of a protective immune response against Giardia. The aim of this study was to further unravel the

  6. Chemokine-mediated immune responses in the female genital tract mucosa.

    Science.gov (United States)

    Deruaz, Maud; Luster, Andrew D

    2015-04-01

    The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.

  7. Down-regulation of selected Blood-brain Barrier Specific Genes from Capillaries to Bovine In Vitro Models

    DEFF Research Database (Denmark)

    Goldeman, Charlotte; Saaby, Lasse; Brodin, Birger

    Cultures of primary bovine brain endothelial cells (BECs) grown, often together with astrocytes, on permeable supports in two-compartment culture systems are commonly used as an in vitro model of the blood-brain barrier (BBB). While trans-endothelial electrical resistance, restriction...... the in vivo gene expression of brain capillary endothelial cells. Primary bovine endothelial cells and rat astrocytes were cultured in different culture configurations and the mRNA expression of selected genes (vWF, Glut-1, P-gp, claudin-1,-5, occludin, JAM-1, LAT-1, SLC16A1, MRP-1,-4, BCRP, ZO-1, AP, TPA...

  8. A Cross-Talk Between Microbiota-Derived Short-Chain Fatty Acids and the Host Mucosal Immune System Regulates Intestinal Homeostasis and Inflammatory Bowel Disease.

    Science.gov (United States)

    Gonçalves, Pedro; Araújo, João Ricardo; Di Santo, James P

    2018-02-15

    Gut microbiota has a fundamental role in the energy homeostasis of the host and is essential for proper "education" of the immune system. Intestinal microbial communities are able to ferment dietary fiber releasing short-chain fatty acids (SCFAs). The SCFAs, particularly butyrate (BT), regulate innate and adaptive immune cell generation, trafficing, and function. For example, BT has an anti-inflammatory effect by inhibiting the recruitment and proinflammatory activity of neutrophils, macrophages, dendritic cells, and effector T cells and by increasing the number and activity of regulatory T cells. Gut microbial dysbiosis, ie, a microbial community imbalance, has been suggested to play a role in the development of inflammatory bowel disease (IBD). The relationship between dysbiosis and IBD has been difficult to prove, especially in humans, and is probably complex and dynamic, rather than one of a simple cause and effect relationship. However, IBD patients have dysbiosis with reduced numbers of SCFAs-producing bacteria and reduced BT concentration that is linked to a marked increase in the number of proinflammatory immune cells in the gut mucosa of these patients. Thus, microbial dysbiosis and reduced BT concentration may be a factor in the emergence and severity of IBD. Understanding the relationship between microbial dysbiosis and reduced BT concentration to IBD may lead to novel therapeutic interventions.

  9. Prostate tumor-derived exosomes down-regulate NKG2D expression on natural killer cells and CD8+ T cells: mechanism of immune evasion.

    Directory of Open Access Journals (Sweden)

    Marie Lundholm

    Full Text Available Tumor-derived exosomes, which are nanometer-sized extracellular vesicles of endosomal origin, have emerged as promoters of tumor immune evasion but their role in prostate cancer (PC progression is poorly understood. In this study, we investigated the ability of prostate tumor-derived exosomes to downregulate NKG2D expression on natural killer (NK and CD8+ T cells. NKG2D is an activating cytotoxicity receptor whose aberrant loss in cancer plays an important role in immune suppression. Using flow cytometry, we found that exosomes produced by human PC cells express ligands for NKG2D on their surface. The NKG2D ligand-expressing prostate tumor-derived exosomes selectively induced downregulation of NKG2D on NK and CD8+ T cells in a dose-dependent manner, leading to impaired cytotoxic function in vitro. Consistent with these findings, patients with castration-resistant PC (CRPC showed a significant decrease in surface NKG2D expression on circulating NK and CD8+ T cells compared to healthy individuals. Tumor-derived exosomes are likely involved in this NKG2D downregulation, since incubation of healthy lymphocytes with exosomes isolated from serum or plasma of CRPC patients triggered downregulation of NKG2D expression in effector lymphocytes. These data suggest prostate tumor-derived exosomes as down-regulators of the NKG2D-mediated cytotoxic response in PC patients, thus promoting immune suppression and tumor escape.

  10. The role of the local microenvironment in regulating susceptibility and immune responses to sexually transmitted viruses in the female genital tract.

    Science.gov (United States)

    Kaushic, Charu

    2009-12-01

    Sexually transmitted viruses cause chronic infections that have serious long-term health consequences. Based on the evidence from clinical and epidemiological studies, women carry a disproportionately higher burden of sexually transmitted diseases. The reasons for this are not well understood and possibly relate to a variety of social, behavioral and economic factors. In addition to these factors there are biological reasons that contribute to the higher prevalence in women. In this context it is critical to focus on and understand the local microenvironment of the female genital tract, since the majority of viral infections in women occur by heterosexual transmission. The genital tract is also the target site for initiation and maintenance of protective immune responses that could prevent or eliminate viral infections. The epithelial cells of the genital tract provide the first line of defense against viral entry. The interactions between each sexually transmitted virus and the genital epithelium are distinct and determine the outcome of exposure. They are also influenced by a number of factors in the local genital milieu. Among these factors are the female sex hormones that regulate both the susceptibility as well as immune responses to viral infections in the genital tract. Better understanding of the interactions of viruses with the local environment in the female genital tract will lead to development of novel methods to prevent sexually transmitted infections as well as to enhance innate and adaptive immunity.

  11. XMEN disease: a new primary immunodeficiency affecting Mg2+ regulation of immunity against Epstein-Barr virus.

    Science.gov (United States)

    Li, Feng-Yen; Chaigne-Delalande, Benjamin; Su, Helen; Uzel, Gulbu; Matthews, Helen; Lenardo, Michael J

    2014-04-03

    Epstein-Barr virus (EBV) is an oncogenic gammaherpesvirus that infects and persists in 95% of adults worldwide and has the potential to cause fatal disease, especially lymphoma, in immunocompromised hosts. Primary immunodeficiencies (PIDs) that predispose to EBV-associated malignancies have provided novel insights into the molecular mechanisms of immune defense against EBV. We have recently characterized a novel PID now named "X-linked immunodeficiency with magnesium defect, EBV infection, and neoplasia" (XMEN) disease characterized by loss-of-function mutations in the gene encoding magnesium transporter 1 (MAGT1), chronic high-level EBV with increased EBV-infected B cells, and heightened susceptibility to EBV-associated lymphomas. The genetic etiology of XMEN disease has revealed an unexpected quantitative role for intracellular free magnesium in immune functions and has led to novel diagnostic and therapeutic strategies. Here, we review the clinical presentation, genetic mutation spectrum, molecular mechanisms of pathogenesis, and diagnostic and therapeutic considerations for this previously unrecognized disease.

  12. Neuronal Goα and CAPS regulate behavioral and immune responses to bacterial pore-forming toxins.

    Directory of Open Access Journals (Sweden)

    Ferdinand C O Los

    Full Text Available Pore-forming toxins (PFTs are abundant bacterial virulence factors that attack host cell plasma membranes. Host defense mechanisms against PFTs described to date all function in the host tissue that is directly attacked by the PFT. Here we characterize a rapid and fully penetrant cessation of feeding of Caenorhabditis elegans in response to PFT attack. We demonstrate via analyses of C. elegans mutants that inhibition of feeding by PFT requires the neuronal G protein Goα subunit goa-1, and that maintenance of this response requires neuronally expressed calcium activator for protein secretion (CAPS homolog unc-31. Independently from their role in feeding cessation, we find that goa-1 and unc-31 are additionally required for immune protection against PFTs. We thus demonstrate that the behavioral and immune responses to bacterial PFT attack involve the cross-talk between the nervous system and the cells directly under attack.

  13. The intracellular immune receptor Rx1 regulates the DNA-binding activity of a Golden2-like transcription factor.

    Science.gov (United States)

    Townsend, Philip D; Dixon, Christopher H; Slootweg, Erik J; Sukarta, Octavina C A; Yang, Ally W H; Hughes, Timothy R; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Goverse, Aska; Cann, Martin J

    2018-03-02

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable the immune system to recognize and respond to pathogen attack. An early consequence of immune activation is transcriptional reprogramming, and some NLRs have been shown to act in the nucleus and interact with transcription factors. The Rx1 NLR protein of potato is further able to bind and distort double-stranded DNA. However, Rx1 host targets that support a role for Rx1 in transcriptional reprogramming at DNA are unknown. Here, we report a functional interaction between Rx1 and Nb Glk1, a Golden2-like transcription factor. Rx1 binds to Nb Glk1 in vitro and in planta. Nb Glk1 binds to known Golden2-like consensus DNA sequences. Rx1 reduces the binding affinity of Nb Glk1 for DNA in vitro. Nb Glk1 activates cellular responses to potato virus X, whereas Rx1 associates with Nb Glk1 and prevents its assembly on DNA in planta unless activated by PVX. This study provides new mechanistic insight into how an NLR can coordinate an immune signaling response at DNA following pathogen perceptions. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Effect of Forsythia suspensa extract and chito-oligosaccharide alone or in combination on performance, intestinal barrier function, antioxidant capacity and immune characteristics of weaned piglets.

    Science.gov (United States)

    Zhao, Panfeng; Piao, Xiangshu; Zeng, Zhikai; Li, Ping; Xu, Xiao; Wang, Hongliang

    2017-06-01

    We investigated the effects of Forsythia suspensa extract (FSE) and chito-oligosaccharide (COS), alone or together, on performance and health status of weaned piglets. The treatments included a basal diet and three diets with 160 mg/kg COS, 100 mg/kg FSE, or 100 mg/kg FSE and 160 mg/kg COS. Supplementation with COS or FSE alone improved (P antioxidant capacity and glutathione peroxidase activities and lower serum endotoxin (P concentrations, generated higher (P concentration, peripheral blood lymphocyte proliferation and serum-specific ovalbumin antibody level than the basal diet. No differences in oxidative injury and immunity indices were detected on day 28. The combined FSE and COS produced similar results compared with FSE or COS when given alone. These data indicate FSE or COS can increase performance by modulating intestinal permeability, antioxidant status and immune function in younger pigs. There appears to be similar advantage in feeding the additives in combination over those obtained from feeding them separately. © 2016 Japanese Society of Animal Science.

  15. Regulation to create environments conducive to physical activity: understanding the barriers and facilitators at the Australian state government level.

    Science.gov (United States)

    Shill, Jane; Mavoa, Helen; Crammond, Brad; Loff, Bebe; Peeters, Anna; Lawrence, Mark; Allender, Steven; Sacks, Gary; Swinburn, Boyd A

    2012-01-01

    Policy and regulatory interventions aimed at creating environments more conducive to physical activity (PA) are an important component of strategies to improve population levels of PA. However, many potentially effective policies are not being broadly implemented. This study sought to identify potential policy/regulatory interventions targeting PA environments, and barriers/facilitators to their implementation at the Australian state/territory government level. In-depth interviews were conducted with senior representatives from state/territory governments, statutory authorities and non-government organisations (n = 40) to examine participants': 1) suggestions for regulatory interventions to create environments more conducive to PA; 2) support for preselected regulatory interventions derived from a literature review. Thematic and constant comparative analyses were conducted. POLICY INTERVENTIONS MOST COMMONLY SUGGESTED BY PARTICIPANTS FELL INTO TWO AREAS: 1) urban planning and provision of infrastructure to promote active travel; 2) discouraging the use of private motorised vehicles. Of the eleven preselected interventions presented to participants, interventions relating to walkability/cycling and PA facilities received greatest support. Interventions involving subsidisation (of public transport, PA-equipment) and the provision of more public transport infrastructure received least support. These were perceived as not economically viable or unlikely to increase PA levels. Dominant barriers were: the powerful 'road lobby', weaknesses in the planning system and the cost of potential interventions. Facilitators were: the provision of evidence, collaboration across sectors, and synergies with climate change/environment agendas. This study points to how difficult it will be to achieve policy change when there is a powerful 'road lobby' and government investment prioritises road infrastructure over PA-promoting infrastructure. It highlights the pivotal role of the

  16. Cell- and virus-mediated regulation of the barrier-to-autointegration factor's phosphorylation state controls its DNA binding, dimerization, subcellular localization, and antipoxviral activity.

    Science.gov (United States)

    Jamin, Augusta; Wicklund, April; Wiebe, Matthew S

    2014-05-01

    Barrier-to-autointegration factor (BAF) is a DNA binding protein with multiple cellular functions, including the ability to act as a potent defense against vaccinia virus infection. This antiviral function involves BAF's ability to condense double-stranded DNA and subsequently prevent viral DNA replication. In recent years, it has become increasingly evident that dynamic phosphorylation involving the vaccinia virus B1 kinase and cellular enzymes is likely a key regulator of multiple BAF functions; however, the precise mechanisms are poorly understood. Here we analyzed how phosphorylation impacts BAF's DNA binding, subcellular localization, dimerization, and antipoxviral activity through the characterization of BAF phosphomimetic and unphosphorylatable mutants. Our studies demonstrate that increased phosphorylation enhances BAF's mobilization from the nucleus to the cytosol, while dephosphorylation restricts BAF to the nucleus. Phosphorylation also impairs both BAF's dimerization and its DNA binding activity. Furthermore, our studies of BAF's antiviral activity revealed that hyperphosphorylated BAF is unable to suppress viral DNA replication or virus production. Interestingly, the unphosphorylatable BAF mutant, which is capable of binding DNA but localizes predominantly to the nucleus, was also incapable of suppressing viral replication. Thus, both DNA binding and localization are important determinants of BAF's antiviral function. Finally, our examination of how phosphatases are involved in regulating BAF revealed that PP2A dephosphorylates BAF during vaccinia infection, thus counterbalancing the activity of the B1 kinase. Altogether, these data demonstrate that phosphoregulation of BAF by viral and cellular enzymes modulates this protein at multiple molecular levels, thus determining its effectiveness as an antiviral factor and likely other functions as well. The barrier-to-autointegration factor (BAF) contributes to cellular genomic integrity in multiple ways

  17. Honey Bee Antiviral Immune Barriers as Affected by Multiple Stress Factors: A Novel Paradigm to Interpret Colony Health Decline and Collapse

    Directory of Open Access Journals (Sweden)

    Francesco Nazzi

    2018-03-01

    Full Text Available Any attempt to outline a logical framework in which to interpret the honey bee health decline and its contribution to elevated colony losses should recognize the importance of the multifactorial nature of the responsible syndrome and provide a functional model as a basis for defining and testing working hypotheses. We propose that covert infections by deformed wing virus (DWV represent a sword of Damocles permanently threatening the survival of honey bee colonies and suggest that any factor affecting the honey bee’s antiviral defenses can turn this pathogen into a killer. Here we discuss the available experimental evidence in the framework of a model based on honey bee immune competence as affected by multiple stress factors that is proposed as a conceptual tool for analyzing bee mortality and its underlying mechanisms.

  18. Transient receptor potential melastatin subfamily member 2 cation channel regulates detrimental immune cell invasion in ischemic stroke.

    Science.gov (United States)

    Gelderblom, Mathias; Melzer, Nico; Schattling, Benjamin; Göb, Eva; Hicking, Gordon; Arunachalam, Priyadharshini; Bittner, Stefan; Ufer, Friederike; Herrmann, Alexander M; Bernreuther, Christian; Glatzel, Markus; Gerloff, Christian; Kleinschnitz, Christoph; Meuth, Sven G; Friese, Manuel A; Magnus, Tim

    2014-11-01

    Brain injury during stroke results in oxidative stress and the release of factors that include extracellular Ca(2+), hydrogen peroxide, adenosine diphosphate ribose, and nicotinic acid adenine dinucleotide phosphate. These alterations of the extracellular milieu change the activity of transient receptor potential melastatin subfamily member 2 (TRPM2), a nonselective cation channel expressed in the central nervous system and the immune system. Our goal was to evaluate the contribution of TRPM2 to the tissue damage after stroke. In accordance with current quality guidelines, we independently characterized Trpm2 in a murine ischemic stroke model in 2 different laboratories. Gene deficiency of Trpm2 resulted in significantly improved neurological outcome and decreased infarct size. Besides an already known moderate neuroprotective effect of Trpm2 deficiency in vitro, ischemic brain invasion by neutrophils and macrophages was particularly reduced in Trpm2-deficient mice. Bone marrow chimeric mice revealed that Trpm2 deficiency in the peripheral immune system is responsible for the protective phenotype. Furthermore, experiments with mixed bone marrow chimeras demonstrated that Trpm2 is essential for the migration of neutrophils and, to a lesser extent, also of macrophages into ischemic hemispheres. Notably, the pharmacological TRPM2 inhibitor, N-(p-amylcinnamoyl)anthranilic acid, was equally protective in the stroke model. Although a neuroprotective effect of TRPM2 in vitro is well known, we can show for the first time that the detrimental role of TRPM2 in stroke primarily depends on its role in activating peripheral immune cells. Targeting TRPM2 systemically represents a promising therapeutic approach for ischemic stroke. © 2014 American Heart Association, Inc.

  19. The bifunctional plant receptor, OsCERK1, regulates both chitin-triggered immunity and arbuscular mycorrhizal symbiosis in rice.

    Science.gov (United States)

    Miyata, Kana; Kozaki, Toshinori; Kouzai, Yusuke; Ozawa, Kenjirou; Ishii, Kazuo; Asamizu, Erika; Okabe, Yoshihiro; Umehara, Yosuke; Miyamoto, Ayano; Kobae, Yoshihiro; Akiyama, Kohki; Kaku, Hanae; Nishizawa, Yoko; Shibuya, Naoto; Nakagawa, Tomomi

    2014-11-01

    Plants are constantly exposed to threats from pathogenic microbes and thus developed an innate immune system to protect themselves. On the other hand, many plants also have the ability to establish endosymbiosis with beneficial microbes such as arbuscular mycorrhizal (AM) fungi or rhizobial bacteria, which improves the growth of host plants. How plants evolved these systems managing such opposite plant-microbe interactions is unclear. We show here that knockout (KO) mutants of OsCERK1, a rice receptor kinase essential for chitin signaling, were impaired not only for chitin-triggered defense responses but also for AM symbiosis, indicating the bifunctionality of OsCERK1 in defense and symbiosis. On the other hand, a KO mutant of OsCEBiP, which forms a receptor complex with OsCERK1 and is essential for chitin-triggered immunity, established mycorrhizal symbiosis normally. Therefore, OsCERK1 but not chitin-triggered immunity is required for AM symbiosis. Furthermore, experiments with chimeric receptors showed that the kinase domains of OsCERK1 and homologs from non-leguminous, mycorrhizal plants could trigger nodulation signaling in legume-rhizobium interactions as the kinase domain of Nod factor receptor1 (NFR1), which is essential for triggering the nodulation program in leguminous plants, did. Because leguminous plants are believed to have developed the rhizobial symbiosis on the basis of AM symbiosis, our results suggest that the symbiotic function of ancestral CERK1 in AM symbiosis enabled the molecular evolution to leguminous NFR1 and resulted in the establishment of legume-rhizobia symbiosis. These results also suggest that OsCERK1 and homologs serve as a molecular switch that activates defense or symbiotic responses depending on the infecting microbes. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  20. Temporal anomaly detection: an artificial immune approach based on T cell activation, clonal size regulation and homeostasis.

    Science.gov (United States)

    Antunes, Mário J; Correia, Manuel E

    2010-01-01

    This paper presents an artificial immune system (AIS) based on Grossman's tunable activation threshold (TAT) for temporal anomaly detection. We describe the generic AIS framework and the TAT model adopted for simulating T Cells behaviour, emphasizing two novel important features: the temporal dynamic adjustment of T Cells clonal size and its associated homeostasis mechanism. We also present some promising results obtained with artificially generated data sets, aiming to test the appropriateness of using TAT in dynamic changing environments, to distinguish new unseen patterns as part of what should be detected as normal or as anomalous. We conclude by discussing results obtained thus far with artificially generated data sets.

  1. Potential Role of Vδ2+ γδ T Cells in Regulation of Immune Activation in Primary HIV Infection

    Directory of Open Access Journals (Sweden)

    Nupur Bhatnagar

    2017-09-01

    Full Text Available Although conventional regulatory T cells (Tregs are sufficient in controlling low residual T-cell activation in ART-treated patients, they are not efficient in controlling exaggerated immune activation associated with high levels of HIV replication in primary HIV infection (PHI. Our previous data suggested that double negative (DN T cells including mainly γδ DN T cells play a role in the control of immune activation in PHI. Since γδ T cells are capable of exerting regulatory functions, we investigated their implication as Tregs in PHI as well as chronic HIV infection (CHI. In a cross-sectional study of 58 HIV-infected patients, in the primary and the chronic phase either ART-treated or untreated (UT, we analyzed phenotype and cytokine production of γδ T cells using flow cytometry. Cytokine production was assessed following in vitro stimulation with isopentenyl pyrophosphate or plate-bound anti-CD3/anti-CD28 monoclonal antibodies. We found that the proportion of γδ T cells negatively correlated with CD8 T-cell activation in PHI patients. Furthermore, we found that in these patients, the Vδ2 receptor bearing (Vδ2+ γδ T cells were strongly activated, exhibited low terminal differentiation, and produced the anti-inflammatory cytokine, TGF-β. In contrast, in UT-CHI, we observed a remarkable expansion of γδ T cells, where the Vδ2+ γδ T cells comprised of an elevated proportion of terminally differentiated cells producing high levels of IFN-γ but very low levels of TGF-β. We also found that this loss of regulatory feature of γδ T cells in CHI was a lasting impairment as we did not find recovery of TGF-β production even in ART-CHI patients successfully treated for more than 5 years. Our data therefore suggest that during the primary HIV infection, Vδ2+ γδ T cells may act as Tregs controlling immune activation through production of TGF-β. However, in CHI, γδ T cells transform from an anti-inflammatory into pro

  2. Glycogen synthase kinase-3 (GSK3) regulates TNF production and haemocyte phagocytosis in the immune response of Chinese mitten crab Eriocheir sinensis.

    Science.gov (United States)

    Li, Xiaowei; Jia, Zhihao; Wang, Weilin; Wang, Lingling; Liu, Zhaoqun; Yang, Bin; Jia, Yunke; Song, Xiaorui; Yi, Qilin; Qiu, Limei; Song, Linsheng

    2017-08-01

    Glycogen synthase kinase-3 (GSK3) is a serine/threonine protein kinase firstly identified as a regulator of glycogen synthesis. Recently, it has been proved to be a key regulator of the immune reaction. In the present study, a GSK3 homolog gene (designated as EsGSK3) was cloned from Chinese mitten crab, Eriocheir sinensis. The open reading frame (ORF) was 1824 bp, which encoded a predicted polypeptide of 607 amino acids. There was a conserved Serine/Threonine Kinase domain and a DNA binding domain found in EsGSK3. Phylogenetic analysis showed that EsGSK3 was firstly clustered with GSK3-β from oriental river prawn Macrobrachium nipponense in the invertebrate branch, while GSK3s from vertebrates formed the other distinct branch. EsGSK3 mRNA transcripts could be detected in all tested tissues of the crab including haepatopancreas, eyestalk, muscle, gonad, haemocytes and haematopoietic tissue with the highest expression level in haepatopancreas. And EsGSK3 protein was mostly detected in the cytoplasm of haemocyte by immunofluorescence analysis. The expression levels of EsGSK3 mRNA increased significantly at 6 h after Aeromonas hydrophila challenge (p level at 48 h (p > 0.05). The mRNA expression of lipopolysaccharide-induced tumor necrosis factor (TNF)-α factor (EsLITAF) was also induced by A. hydrophila challenge. However, the mRNA expression of EsLITAF and TNF-α production was significantly suppressed after EsGSK3 was blocked in vivo with specific inhibitor lithium, while the phagocytosis of crab haemocytes was significantly promoted. These results collectively demonstrated that EsGSK3 could regulate the innate immune responses of E. sinensis by promoting TNF-α production and inhibiting haemocyte phagocytosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Regular Exercise Enhances the Immune Response Against Microbial Antigens Through Up-Regulation of Toll-like Receptor Signaling Pathways

    Directory of Open Access Journals (Sweden)

    Qishi Zheng

    2015-09-01

    Full Text Available Background/Aims: Regular physical exercise can enhance resistance to many microbial infections. However, little is known about the mechanism underlying the changes in the immune system induced by regular exercise. Methods: We recruited members of a university badminton club as the regular exercise (RE group and healthy sedentary students as the sedentary control (SC group. We investigated the distribution of peripheral blood mononuclear cell (PBMC subsets and functions in the two groups. Results: There were no significant differences in plasma cytokine levels between the RE and SC groups in the true resting state. However, enhanced levels of IFN-γ, TNF-α, IL-6, IFN-α and IL-12 were secreted by PBMCs in the RE group following microbial antigen stimulation, when compared to the SC group. In contrast, the levels of TNF-α and IL-6 secreted by PBMC in the RE group were suppressed compared with those in SC group following non-microbial antigen stimulation (concanavalin A or α-galactosylceramide. Furthermore, PBMC expression of TLR2, TLR7 and MyD88 was significantly increased in the RE group in response to microbial antigen stimulation. Conclusion: Regular exercise enhances immune cell activation in response to pathogenic stimulation leading to enhanced cytokine production mediated via the TLR signaling pathways.

  4. Regulation of respiration and the oxygen diffusion barrier in soybean protect symbiotic nitrogen fixation from chilling-induced inhibition and shoots from premature senescence.

    Science.gov (United States)

    van Heerden, Philippus D R; Kiddle, Guy; Pellny, Till K; Mokwala, Phatlane W; Jordaan, Anine; Strauss, Abram J; de Beer, Misha; Schlüter, Urte; Kunert, Karl J; Foyer, Christine H

    2008-09-01

    Symbiotic nitrogen fixation is sensitive to dark chilling (7 degrees C-15 degrees C)-induced inhibition in soybean (Glycine max). To characterize the mechanisms that cause the stress-induced loss of nodule function, we examined nodule structure, carbon-nitrogen interactions, and respiration in two soybean genotypes that differ in chilling sensitivity: PAN809 (PAN), which is chilling sensitive, and Highveld Top (HT), which is more chilling resistant. Nodule numbers were unaffected by dark chilling, as was the abundance of the nitrogenase and leghemoglobin proteins. However, dark chilling decreased nodule respiration rates, nitrogenase activities, and NifH and NifK mRNAs and increased nodule starch, sucrose, and glucose in both genotypes. Ureide and fructose contents decreased only in PAN nodules. While the chilling-induced decreases in nodule respiration persisted in PAN even after return to optimal temperatures, respiration started to recover in HT by the end of the chilling period. The area of the intercellular spaces in the nodule cortex and infected zone was greatly decreased in HT after three nights of chilling, an acclimatory response that was absent from PAN. These data show that HT nodules are able to regulate both respiration and the area of the intercellular spaces during chilling and in this way control the oxygen diffusion barrier, which is a key component of the nodule stress response. We conclude that chilling-induced loss of symbiotic nitrogen fixation in PAN is caused by the inhibition of respiration coupled to the failure to regulate the oxygen diffusion barrier effectively. The resultant limitations on nitrogen availability contribute to the greater chilling-induced inhibition of photosynthesis in PAN than in HT.

  5. Lipid rafts regulate PCB153-induced disruption of occludin and brain endothelial barrier function through protein phosphatase 2A and matrix metalloproteinase-2

    Energy Technology Data Exchange (ETDEWEB)

    Eum, Sung Yong, E-mail: seum@miami.edu; Jaraki, Dima; András, Ibolya E.; Toborek, Michal

    2015-09-15

    Occludin is an essential integral transmembrane protein regulating tight junction (TJ) integrity in brain endothelial cells. Phosphorylation of occludin is associated with its localization to TJ sites and incorporation into intact TJ assembly. The present study is focused on the role of lipid rafts in polychlorinated biphenyl (PCB)-induced disruption of occludin and endothelial barrier function. Exposure of human brain endothelial cells to 2,2′,4,4′,5,5′-hexachlorobiphenyl (PCB153) induced dephosphorylation of threonine residues of occludin and displacement of occludin from detergent-resistant membrane (DRM)/lipid raft fractions within 1 h. Moreover, lipid rafts modulated the reduction of occludin level through activation of matrix metalloproteinase 2 (MMP-2) after 24 h PCB153 treatment. Inhibition of protein phosphatase 2A (PP2A) activity by okadaic acid or fostriecin markedly protected against PCB153-induced displacement of occludin and increased permeability of endothelial cells. The implication of lipid rafts and PP2A signaling in these processes was further defined by co-immunoprecipitation of occludin with PP2A and caveolin-1, a marker protein of lipid rafts. Indeed, a significant MMP-2 activity was observed in lipid rafts and was increased by exposure to PCB153. The pretreatment of MMP-2 inhibitors protected against PCB153-induced loss of occludin and disruption of lipid raft structure prevented the increase of endothelial permeability. Overall, these results indicate that lipid raft-associated processes, such as PP2A and MMP-2 activation, participate in PCB153-induced disruption of occludin function in brain endothelial barrier. This study contributes to a better understanding of the mechanisms leading to brain endothelial barrier dysfunction in response to exposure to environmental pollutants, such as ortho-substituted PCBs. - Highlights: • PCB153 disturbed human brain endothelial barrier through disruption of occludin. • Lipid raft-associated PP

  6. Corticotropin-releasing hormone and mast cells in the regulation of mucosal barrier function in the human colon.

    Science.gov (United States)

    Wallon, Conny; Söderholm, Johan D

    2009-05-01

    Corticotropin-releasing hormone (CRH) is an important neuro-endocrine mediator of the stress response. Local effects of CRH in the intestinal mucosa have become evident in recent years. We showed that CRH activates CRH receptor subtypes R1 and R2 on subepithelial mast cells, thereby inducing increased transcellular uptake of protein antigens in human colonic biopsies in Ussing chambers. Ongoing studies also implicate local cholinergic signaling in regulation of macromolecular permeability in the human colon. Since increased uptake of antigenic molecules is associated with mucosal inflammation, our findings may have implications for understanding stress-related intestinal disorders.

  7. Glutamylation of the DNA sensor cGAS regulates its binding and synthase activity in antiviral immunity.

    Science.gov (United States)

    Xia, Pengyan; Ye, Buqing; Wang, Shuo; Zhu, Xiaoxiao; Du, Ying; Xiong, Zhen; Tian, Yong; Fan, Zusen

    2016-04-01

    Cyclic GMP-AMP synthase (cGAS) senses cytosolic DNA during viral infection and catalyzes synthesis of the dinucleotide cGAMP, which activates the adaptor STING to initiate antiviral responses. Here we found that deficiency in the carboxypeptidase CCP5 or CCP6 led to susceptibility to DNA viruses. CCP5 and CCP6 were required for activation of the transcription factor IRF3 and interferons. Polyglutamylation of cGAS by the enzyme TTLL6 impeded its DNA-binding ability, whereas TTLL4-mediated monoglutamylation of cGAS blocked its synthase activity. Conversely, CCP6 removed the polyglutamylation of cGAS, whereas CCP5 hydrolyzed the monoglutamylation of cGAS, which together led to the activation of cGAS. Therefore, glutamylation and deglutamylation of cGAS tightly modulate immune responses to infection with DNA viruses.

  8. Multiple garlic (Allium sativum L.) microRNAs regulate the immunity against the basal rot fungus Fusarium oxysporum f. sp. Cepae.

    Science.gov (United States)

    Chand, Subodh Kumar; Nanda, Satyabrata; Mishra, Rukmini; Joshi, Raj Kumar

    2017-04-01

    The basal plate rot fungus, Fusarium oxysporum f. sp. cepae (FOC), is the most devastating pathogen posing a serious threat to garlic (Allium sativum L.) production worldwide. MicroRNAs (miRNAs) are key modulators of gene expression related to development and defense responses in eukaryotes. However, the miRNA species associated with garlic immunity against FOC are yet to be explored. In the present study, a small RNA library developed from FOC infected resistant garlic line was sequenced to identify immune responsive miRNAs. Forty-five miRNAs representing 39 conserved and six novel sequences responsive to FOC were detected. qRT-PCR analyses further classified them into three classes based on their expression patterns in susceptible line CBT-As11 and in the resistant line CBT-As153. North-blot analyses of six selective miRNAs confirmed the qRT-PCR results. Expression studies on a selective set of target genes revealed a negative correlation with the complementary miRNAs. Furthermore, transgenic garlic plant overexpresing miR164a, miR168a and miR393 showed enhanced resistance to FOC, as revealed by decreased fungal growth and up-regulated expression of defense-responsive genes. These results indicate that multiple miRNAs are involved in garlic immunity against FOC and that the overexpression of miR164a, miR168a and miR393 can augment garlic resistance to Fusarium basal rot infection. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Impact of Nosema ceranae and Nosema apis on individual worker bees of the two host species (Apis cerana and Apis mellifera) and regulation of host immune response.

    Science.gov (United States)

    Sinpoo, Chainarong; Paxton, Robert J; Disayathanoowat, Terd; Krongdang, Sasiprapa; Chantawannakul, Panuwan

    Nosema apis and Nosema ceranae are obligate intracellular microsporidian parasites infecting midgut epithelial cells of host adult honey bees, originally Apis mellifera and Apis cerana respectively. Each microsporidia cross-infects the other host and both microsporidia nowadays have a worldwide distribution. In this study, cross-infection experiments using both N. apis and N. ceranae in both A. mellifera and A. cerana were carried out to compare pathogen proliferation and impact on hosts, including host immune response. Infection by N. ceranae led to higher spore loads than by N. apis in both host species, and there was greater proliferation of microsporidia in A. mellifera compared to A. cerana. Both N. apis and N. ceranae were pathogenic in both host Apis species. N. ceranae induced subtly, though not significantly, higher mortality than N. apis in both host species, yet survival of A. cerana was no different to that of A. mellifera in response to N. apis or N. ceranae. Infections of both host species with N. apis and N. ceranae caused significant up-regulation of AMP genes and cellular mediated immune genes but did not greatly alter apoptosis-related gene expression. In this study, A. cerana enlisted a higher immune response and displayed lower loads of N. apis and N. ceranae spores than A. mellifera, suggesting it may be better able to defend itself against microsporidia infection. We caution against over-interpretation of our results, though, because differences between host and parasite species in survival were insignificant and because size differences between microsporidia species and between host Apis species may alternatively explain the differential proliferation of N. ceranae in A. mellifera. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. A Novel Regulator of Activation-Induced Cytidine Deaminase/APOBECs in Immunity and Cancer: Schrödinger’s CATalytic Pocket

    Directory of Open Access Journ