WorldWideScience

Sample records for regulates barrier immunity

  1. Xenobiotic Receptor-Mediated Regulation of Intestinal Barrier Function and Innate Immunity

    Directory of Open Access Journals (Sweden)

    Harmit S. Ranhotra

    2016-07-01

    Full Text Available The molecular basis for the regulation of the intestinal barrier is a very fertile research area. A growing body of knowledge supports the targeting of various components of intestinal barrier function as means to treat a variety of diseases, including the inflammatory bowel diseases. Herein, we will summarize the current state of knowledge of key xenobiotic receptor regulators of barrier function, highlighting recent advances, such that the field and its future are succinctly reviewed. We posit that these receptors confer an additional dimension of host-microbe interaction in the gut, by sensing and responding to metabolites released from the symbiotic microbiota, in innate immunity and also in host drug metabolism. The scientific evidence for involvement of the receptors and its molecular basis for the control of barrier function and innate immunity regulation would serve as a rationale towards development of non-toxic probes and ligands as drugs.

  2. Trypanosome infection establishment in the tsetse fly gut is influenced by microbiome-regulated host immune barriers.

    Directory of Open Access Journals (Sweden)

    Brian L Weiss

    Full Text Available Tsetse flies (Glossina spp. vector pathogenic African trypanosomes, which cause sleeping sickness in humans and nagana in domesticated animals. Additionally, tsetse harbors 3 maternally transmitted endosymbiotic bacteria that modulate their host's physiology. Tsetse is highly resistant to infection with trypanosomes, and this phenotype depends on multiple physiological factors at the time of challenge. These factors include host age, density of maternally-derived trypanolytic effector molecules present in the gut, and symbiont status during development. In this study, we investigated the molecular mechanisms that result in tsetse's resistance to trypanosomes. We found that following parasite challenge, young susceptible tsetse present a highly attenuated immune response. In contrast, mature refractory flies express higher levels of genes associated with humoral (attacin and pgrp-lb and epithelial (inducible nitric oxide synthase and dual oxidase immunity. Additionally, we discovered that tsetse must harbor its endogenous microbiome during intrauterine larval development in order to present a parasite refractory phenotype during adulthood. Interestingly, mature aposymbiotic flies (Gmm(Apo present a strong immune response earlier in the infection process than do WT flies that harbor symbiotic bacteria throughout their entire lifecycle. However, this early response fails to confer significant resistance to trypanosomes. Gmm(Apo adults present a structurally compromised peritrophic matrix (PM, which lines the fly midgut and serves as a physical barrier that separates luminal contents from immune responsive epithelial cells. We propose that the early immune response we observe in Gmm(Apo flies following parasite challenge results from the premature exposure of gut epithelia to parasite-derived immunogens in the absence of a robust PM. Thus, tsetse's PM appears to regulate the timing of host immune induction following parasite challenge. Our results

  3. Barriers to Immunizations and Strategies to Enhance Immunization Rates in Adults with Autoimmune Inflammatory Diseases.

    Science.gov (United States)

    Kirchner, Elizabeth; Ruffing, Victoria

    2017-02-01

    For as long as there have been immunizations, there have been barriers to them. Immunization rates in the United States are below target. Rheumatologists and rheumatology practitioners need to understand the issues of immunizations in patients with autoimmune inflammatory disease to identify and overcome barriers to immunization. Several strategies for overcoming these barriers are discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Microbial-immune cross-talk and regulation of the immune system.

    Science.gov (United States)

    Cahenzli, Julia; Balmer, Maria L; McCoy, Kathy D

    2013-01-01

    We are all born germ-free. Following birth we enter into a lifelong relationship with microbes residing on our body's surfaces. The lower intestine is home to the highest microbial density in our body, which is also the highest microbial density known on Earth (up to 10(12) /g of luminal contents). With our indigenous microbial cells outnumbering our human cells by an order of magnitude our body is more microbial than human. Numerous immune adaptations confine these microbes within the mucosa, enabling most of us to live in peaceful homeostasis with our intestinal symbionts. Intestinal epithelial cells not only form a physical barrier between the bacteria-laden lumen and the rest of the body but also function as multi-tasking immune cells that sense the prevailing microbial (apical) and immune (basolateral) milieus, instruct the underlying immune cells, and adapt functionally. In the constant effort to ensure intestinal homeostasis, the immune system becomes educated to respond appropriately and in turn immune status can shape the microbial consortia. Here we review how the dynamic immune-microbial dialogue underlies maturation and regulation of the immune system and discuss recent findings on the impact of diet on both microbial ecology and immune function. © 2012 The Authors. Immunology © 2012 Blackwell Publishing Ltd.

  5. Beneficial autoimmunity at body surfaces - immune surveillance and rapid type 2 immunity regulate tissue homeostasis and cancer.

    Science.gov (United States)

    Dalessandri, Tim; Strid, Jessica

    2014-01-01

    Epithelial cells (ECs) line body surface tissues and provide a physicochemical barrier to the external environment. Frequent microbial and non-microbial challenges such as those imposed by mechanical disruption, injury or exposure to noxious environmental substances including chemicals, carcinogens, ultraviolet-irradiation, or toxins cause activation of ECs with release of cytokines and chemokines as well as alterations in the expression of cell-surface ligands. Such display of epithelial stress is rapidly sensed by tissue-resident immunocytes, which can directly interact with self-moieties on ECs and initiate both local and systemic immune responses. ECs are thus key drivers of immune surveillance at body surface tissues. However, ECs have a propensity to drive type 2 immunity (rather than type 1) upon non-invasive challenge or stress - a type of immunity whose regulation and function still remain enigmatic. Here, we review the induction and possible role of type 2 immunity in epithelial tissues and propose that rapid immune surveillance and type 2 immunity are key regulators of tissue homeostasis and carcinogenesis.

  6. Beneficial Autoimmunity at Body Surfaces – Immune Surveillance and Rapid Type 2 Immunity Regulate Tissue Homeostasis and Cancer

    Science.gov (United States)

    Dalessandri, Tim; Strid, Jessica

    2014-01-01

    Epithelial cells (ECs) line body surface tissues and provide a physicochemical barrier to the external environment. Frequent microbial and non-microbial challenges such as those imposed by mechanical disruption, injury or exposure to noxious environmental substances including chemicals, carcinogens, ultraviolet-irradiation, or toxins cause activation of ECs with release of cytokines and chemokines as well as alterations in the expression of cell-surface ligands. Such display of epithelial stress is rapidly sensed by tissue-resident immunocytes, which can directly interact with self-moieties on ECs and initiate both local and systemic immune responses. ECs are thus key drivers of immune surveillance at body surface tissues. However, ECs have a propensity to drive type 2 immunity (rather than type 1) upon non-invasive challenge or stress – a type of immunity whose regulation and function still remain enigmatic. Here, we review the induction and possible role of type 2 immunity in epithelial tissues and propose that rapid immune surveillance and type 2 immunity are key regulators of tissue homeostasis and carcinogenesis. PMID:25101088

  7. Mucosal innate immune cells regulate both gut homeostasis and intestinal inflammation.

    Science.gov (United States)

    Kurashima, Yosuke; Goto, Yoshiyuki; Kiyono, Hiroshi

    2013-12-01

    Continuous exposure of intestinal mucosal surfaces to diverse microorganisms and their metabolites reflects the biological necessity for a multifaceted, integrated epithelial and immune cell-mediated regulatory system. The development and function of the host cells responsible for the barrier function of the intestinal surface (e.g., M cells, Paneth cells, goblet cells, and columnar epithelial cells) are strictly regulated through both positive and negative stimulation by the luminal microbiota. Stimulation by damage-associated molecular patterns and commensal bacteria-derived microbe-associated molecular patterns provokes the assembly of inflammasomes, which are involved in maintaining the integrity of the intestinal epithelium. Mucosal immune cells located beneath the epithelium play critical roles in regulating both the mucosal barrier and the relative composition of the luminal microbiota. Innate lymphoid cells and mast cells, in particular, orchestrate the mucosal regulatory system to create a mutually beneficial environment for both the host and the microbiota. Disruption of mucosal homeostasis causes intestinal inflammation such as that seen in inflammatory bowel disease. Here, we review the recent research on the biological interplay among the luminal microbiota, epithelial cells, and mucosal innate immune cells in both healthy and pathological conditions. © 2013 WILEY‐VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Effects of Dietary Bacillus licheniformis on Gut Physical Barrier, Immunity, and Reproductive Hormones of Laying Hens.

    Science.gov (United States)

    Wang, Yang; Du, Wei; Lei, Kai; Wang, Baikui; Wang, Yuanyuan; Zhou, Yingshan; Li, Weifen

    2017-09-01

    Previous study showed that dietary Bacillus licheniformis (B. licheniformis) administration contributes to the improvement of laying performance and egg quality in laying hens. In this study, we aimed to further evaluate its underlying mechanisms. Three hundred sixty Hy-Line Variety W-36 hens (28 weeks of age) were randomized into four groups, each group with six replications (n = 15). The control group received the basal diet and the treatment groups received the same basal diets supplemented with 0.01, 0.03, and 0.06% B. licheniformis powder (2 × 10 10  cfu/g) for an 8-week trial. The results demonstrate that B. licheniformis significantly enhance the intestinal barrier functions via decreasing gut permeability, promoting mucin-2 transcription, and regulating inflammatory cytokines. The systemic immunity of layers in B. licheniformis treatment groups is improved through modulating the specific and non-specific immunity. In addition, gene expressions of hormone receptors, including estrogen receptor α, estrogen receptor β, and follicle-stimulating hormone receptor, are also regulated by B. licheniformis. Meanwhile, compared with the control, B. licheniformis significantly increase gonadotropin-releasing hormone level, but markedly reduce ghrelin and inhibin secretions. Overall, our data suggest that dietary inclusion of B. licheniformis can improve the intestinal barrier function and systemic immunity and regulate reproductive hormone secretions, which contribute to better laying performance and egg quality of hens.

  9. Immune regulation by microbiome metabolites.

    Science.gov (United States)

    Kim, Chang H

    2018-03-22

    Commensal microbes and the host immune system have been co-evolved for mutual regulation. Microbes regulate the host immune system, in part, by producing metabolites. A mounting body of evidence indicates that diverse microbial metabolites profoundly regulate the immune system via host receptors and other target molecules. Immune cells express metabolite-specific receptors such as P2X 7 , GPR41, GPR43, GPR109A, aryl hydrocarbon receptor precursor (AhR), pregnane X receptor (PXR), farnesoid X receptor (FXR), TGR5 and other molecular targets. Microbial metabolites and their receptors form an extensive array of signals to respond to changes in nutrition, health and immunological status. As a consequence, microbial metabolite signals contribute to nutrient harvest from diet, and regulate host metabolism and the immune system. Importantly, microbial metabolites bidirectionally function to promote both tolerance and immunity to effectively fight infection without developing inflammatory diseases. In pathogenic conditions, adverse effects of microbial metabolites have been observed as well. Key immune-regulatory functions of the metabolites, generated from carbohydrates, proteins and bile acids, are reviewed in this article. © 2018 John Wiley & Sons Ltd.

  10. Assessing Pharmacists' Attitudes and Barriers Involved with Immunizations

    Directory of Open Access Journals (Sweden)

    Sarah Aldrich

    2014-01-01

    Full Text Available Pharmacists are considered the most accessible health care professional. Immunizations create an opportunity for the profession to grow and develop toward direct patient care. Between 1995 and 2004 programs involving immunizations led to a national initiative to train pharmacists that became a significant leap toward pharmacist's involvement in direct patient care. Although immunizations can be considered a catalyst to change the pharmacist's role, little was known about pharmacist's attitudes and the barriers involved with immunizing. Few studies have assessed barriers, attitudes, and practice issues experienced by immunizing pharmacists. The objective of this study was to determine pharmacists' attitudes toward immunizations and more specifically to assess possible barriers involved with this practice. Five hundred pharmacists were randomly selected for inclusion in the study from the State of Ohio Board of Pharmacy Database, of which 137 (27.4% completed the survey. A 37- item questionnaire was administered via an e-mail invitation to take an online survey using Qualtrics software with a Likert-type scale, where 1 = strongly disagree and 7 = strongly agree. Several topics were assessed regarding immunizations including time constraints, workflow constraints, adequacy of training, technician support, worksite conditions and space, immunization processes, reimbursement issues, safety issues, documentation issues, and the future direction of immunizations. Demographics included gender, age, degree, number of years practicing, practice site, and number of years immunizing. Seventy-three percent of pharmacists believed that immunizing could lead to prescription filling errors (mean=4.45, SD=1.79. Pharmacists strongly agreed that having more technicians on staff would make providing immunizations easier (mean=5.80, SD=1.39 and that they play a vital role in keeping the process running smoothly (mean=6.08, SD=1.16. Also, pharmacists strongly agreed

  11. The Immune System Bridges the Gut Microbiota with Systemic Energy Homeostasis: Focus on TLRs, Mucosal Barrier, and SCFAs.

    Science.gov (United States)

    Spiljar, Martina; Merkler, Doron; Trajkovski, Mirko

    2017-01-01

    The gut microbiota is essential for the development and regulation of the immune system and the metabolism of the host. Germ-free animals have altered immunity with increased susceptibility to immunologic diseases and show metabolic alterations. Here, we focus on two of the major immune-mediated microbiota-influenced components that signal far beyond their local environment. First, the activation or suppression of the toll-like receptors (TLRs) by microbial signals can dictate the tone of the immune response, and they are implicated in regulation of the energy homeostasis. Second, we discuss the intestinal mucosal surface is an immunologic component that protects the host from pathogenic invasion, is tightly regulated with regard to its permeability and can influence the systemic energy balance. The short chain fatty acids are a group of molecules that can both modulate the intestinal barrier and escape the gut to influence systemic health. As modulators of the immune response, the microbiota-derived signals influence functions of distant organs and can change susceptibility to metabolic diseases.

  12. Immune regulation and CNS autoimmune disease

    DEFF Research Database (Denmark)

    Antel, J P; Owens, T

    1999-01-01

    The central nervous system is a demonstrated target of both clinical and experimental immune mediated disorders. Immune regulatory mechanisms operative at the levels of the systemic immune system, the blood brain barrier, and within the CNS parenchyma are important determinants of the intensity...... and duration of the tissue directed injury. Convergence of research, involving direct manipulation of specific cells and molecular mediators in animal models and in vitro analysis of human immune and neural cells and tissues, is providing increasing insight into the role of these immune regulatory functions...

  13. Immune barriers of Ebola virus infection.

    Science.gov (United States)

    McElroy, Anita K; Mühlberger, Elke; Muñoz-Fontela, César

    2018-02-01

    Since its initial emergence in 1976 in northern Democratic Republic of Congo (DRC), Ebola virus (EBOV) has been a global health concern due to its virulence in humans, the mystery surrounding the identity of its host reservoir and the unpredictable nature of Ebola virus disease (EVD) outbreaks. Early after the first clinical descriptions of a disease resembling a 'septic-shock-like syndrome', with coagulation abnormalities and multi-system organ failure, researchers began to evaluate the role of the host immune response in EVD pathophysiology. In this review, we summarize how data gathered during the last 40 years in the laboratory as well as in the field have provided insight into EBOV immunity. From molecular mechanisms involved in EBOV recognition in infected cells, to antigen processing and adaptive immune responses, we discuss current knowledge on the main immune barriers of infection as well as outstanding research questions. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Barriers to the use of reminder/recall interventions for immunizations: a systematic review

    Directory of Open Access Journals (Sweden)

    Pereira Jennifer A

    2012-12-01

    Full Text Available Abstract Background Although many studies have demonstrated the benefits of reminder/recall (RR measures to address patient under-immunization and improve immunization coverage, they are not widely implemented by healthcare providers. We identified providers’ perceived barriers to their use from existing literature. Methods We conducted a systematic review of relevant articles published in English between January 1990 and July 2011 that examined the perceptions of healthcare providers regarding barriers to tracking patient immunization history and implementing RR interventions. We searched MEDLINE, PubMed, EMBASE, Cumulative Index to Nursing and Allied Health Literature, Academic Search Premier, and PsychINFO. Additional strategies included hand-searching the references of pertinent articles and related reviews, and searching keywords in Google Scholar and Google. Results Ten articles were included; all described populations in the United States, and examined perceptions of family physicians, pediatricians, and other immunization staff. All articles were of moderate-high methodological quality; the majority (n=7 employed survey methodology. The most frequently described barriers involved the perceived human and financial resources associated with implementing an RR intervention, as well as low confidence in the accuracy of patient immunization records, given the lack of data sharing between multiple immunization providers. Changes to staff workflow, lack of appropriate electronic patient-tracking functionalities, and uncertainty regarding the success of RR interventions were also viewed as barriers to their adoption. Conclusions Although transitioning to electronic immunization records and registries should facilitate the implementation of RR interventions, numerous perceived barriers must still be overcome before the full benefits of these methods can be realized.

  15. Mechanisms regulating skin immunity and inflammation.

    Science.gov (United States)

    Pasparakis, Manolis; Haase, Ingo; Nestle, Frank O

    2014-05-01

    Immune responses in the skin are important for host defence against pathogenic microorganisms. However, dysregulated immune reactions can cause chronic inflammatory skin diseases. Extensive crosstalk between the different cellular and microbial components of the skin regulates local immune responses to ensure efficient host defence, to maintain and restore homeostasis, and to prevent chronic disease. In this Review, we discuss recent findings that highlight the complex regulatory networks that control skin immunity, and we provide new paradigms for the mechanisms that regulate skin immune responses in host defence and in chronic inflammation.

  16. Muslim Scholars' Knowledge, Attitudes and Perceived Barriers Towards Polio Immunization in Pakistan.

    Science.gov (United States)

    Khan, Muhammad Umair; Ahmad, Akram; Salman, Saad; Ayub, Maria; Aqeel, Talieha; Haq, Noman-Ul; Saleem, Fahad; Khan, Muhammad Ubaid

    2017-04-01

    Pakistan is one of the two countries where polio remains endemic. Among multiple reasons of polio prevalence, false religious beliefs are accounted as major barriers towards polio immunization in Pakistan. Within this context, religious scholars are now engaged in polio immunization campaigns to dismantle the myths and battle the resurgence of polio in Pakistan. The objective of this study was to assess knowledge, attitudes and perceived barriers of Muslim scholars towards polio immunization in Pakistan. A descriptive, cross-sectional survey of Muslim scholars was conducted in Quetta and Peshawar divisions of Pakistan. From October to December 2015, a convenience sample of 770 Muslim scholars was recruited from the local mosques and religious institutions to participate in this study. Knowledge, attitudes, and perceived barriers were assessed by using self-administered, anonymous and pretested questionnaire. Descriptive and regression analyses were used to express the results with p polio with a mean score of 7.16 ± 2.12 (based on 14 questions). Knowledge gaps were identified about the transmission (32.6 %) and consequences of poliovirus (39.9 %). Overall, 527 (68.4 %) participants showed positive attitudes towards polio immunization with a mean attitude score of 27.35 ± 2.68 (based on nine statements). The majority of participants agreed on the need of depoliticizing polio immunization issues (87.1 %), while reservations were noted about their willingness to participate in future polio immunization programs (44.6 %). Security (75.8 %) and vaccine management issues (64 %) were reported by the participants as the major barriers towards polio immunization in Pakistan. The findings showed poor knowledge of Muslim scholars towards polio; however, their attitudes were positive towards polio immunization. More studies are required to assess the knowledge and attitudes of Muslim scholars at the national level to validate the findings of this study.

  17. Understanding the main barriers to immunization in Colombia to better tailor communication strategies.

    Science.gov (United States)

    García L, Diego Alejandro; Velandia-González, Martha; Trumbo, Silas Pierson; Pedreira, M Cristina; Bravo-Alcántara, Pamela; Danovaro-Holliday, M Carolina

    2014-06-30

    The Expanded Program on Immunization (EPI) in Colombia has made great advances since its inception in 1979; however, by 2010 vaccination coverage rates had been declining. In 2010, the EPI commissioned a nationwide study on practices on immunization, attitudes and knowledge, perceived service quality, and barriers to childhood immunization in order to tailor EPI communication strategies. Colombia's 32 geographical departments were divided into 10 regions. Interviewers from an independent polling company administered a survey to 4802 parents and guardians of children aged communication preferences, and parental attitudes on vaccination. Although all respondents indicated that vaccines have health benefits, and 4738 (98.7%) possessed vaccination cards for their children, attitudes and knowledge were not always favorable to immunization. Six groups of immunization barriers were identified: 1) factors related to caregivers (24.4%), 2) vaccinators (19.7%), 3) health centers (18.0%), 4) the health system (13.4%), 5) concerns about adverse events (13.1%), and 6) cultural and religious beliefs (11.4%); groups 1, 5 and 6 together represented almost half (48.9%) of users, indicating problems related to the demand for vaccines as the primary barriers to immunization. Differences in demographics, communication preferences, and reported service quality were found among participants in the six groups and among participants in the 10 regions. Additionally, differences between how participants reported receiving information on vaccination and how they believed such information should be communicated were observed. Better understanding immunization barriers and the users of the EPI can help tailor communication strategies to increase demand for immunization services. Results of the study have been used by Colombia's EPI to inform the design of new communication strategies.

  18. Role of Osmolytes in Regulating Immune System.

    Science.gov (United States)

    Kumar, Tarun; Yadav, Manisha; Singh, Laishram Rajendrakumar

    2016-01-01

    The immune system has evolved to protect the host organism from diverse range of pathogenic microbes that are themselves constantly evolving. It is a complex network of cells, humoral factors, chemokines and cytokines. Dysregulation of immune system results in various kinds of immunological disorders. There are several external agents which govern the regulation of immune system. Recent studies have indicated the role of osmolytes in regulation of various immunological processes such as Ag-Ab interaction, Ig assembly, Ag presentation etc. In this present review, we have systematically discussed the role of osmolytes involved in regulation of several key immunological processes. Osmolytes are involved in the regulation of several key immunological processes such as immunoglobulin assembly and folding, immune cells proliferation, regulation of immune cells function, Ag-Ab interaction, antigen presentation, inflammatory response and protection against photo-immunosuppression. Hence, osmolytes and their transporters might be used as potential drug and drug targets respectively. This review is therefore designed to help clinicians in development of osmolyte based therapeutic strategies in the treatment of various immunological disorders. Appropriate future perspectives have also been included.

  19. RAC1 in keratinocytes regulates crosstalk to immune cells by Arp2/3-dependent control of STAT1

    DEFF Research Database (Denmark)

    Pedersen, Esben Ditlev Kølle; Wang, Zhipeng; Stanley, Alanna

    2012-01-01

    Crosstalk between keratinocytes and immune cells is crucial for the immunological barrier function of the skin, and aberrant crosstalk contributes to inflammatory skin diseases. Using mice with a keratinocyte-restricted deletion of the RAC1 gene we found that RAC1 in keratinocytes plays...... hypersensitive to inflammatory stimuli both in vitro and in vivo, suggesting a major role for RAC1 in regulating the crosstalk between the epidermis and the immune system....

  20. Approaches Mediating Oxytocin Regulation of the Immune System.

    Science.gov (United States)

    Li, Tong; Wang, Ping; Wang, Stephani C; Wang, Yu-Feng

    2016-01-01

    The hypothalamic neuroendocrine system is mainly composed of the neural structures regulating hormone secretion from the pituitary gland and has been considered as the higher regulatory center of the immune system. Recently, the hypothalamo-neurohypophysial system (HNS) emerged as an important component of neuroendocrine-immune network, wherein the oxytocin (OT)-secreting system (OSS) plays an essential role. The OSS, consisting of OT neurons in the supraoptic nucleus, paraventricular nucleus, their several accessory nuclei and associated structures, can integrate neural, endocrine, metabolic, and immune information and plays a pivotal role in the development and functions of the immune system. The OSS can promote the development of thymus and bone marrow, perform immune surveillance, strengthen immune defense, and maintain immune homeostasis. Correspondingly, OT can inhibit inflammation, exert antibiotic-like effect, promote wound healing and regeneration, and suppress stress-associated immune disorders. In this process, the OSS can release OT to act on immune system directly by activating OT receptors or through modulating activities of other hypothalamic-pituitary-immune axes and autonomic nervous system indirectly. However, our understandings of the role of the OSS in neuroendocrine regulation of immune system are largely incomplete, particularly its relationship with other hypothalamic-pituitary-immune axes and the vasopressin-secreting system that coexists with the OSS in the HNS. In addition, it remains unclear about the relationship between the OSS and peripherally produced OT in immune regulation, particularly intrathymic OT that is known to elicit central immunological self-tolerance of T-cells to hypophysial hormones. In this work, we provide a brief review of current knowledge of the features of OSS regulation of the immune system and of potential approaches that mediate OSS coordination of the activities of entire neuroendocrine-immune network.

  1. Intestinal barrier: A gentlemen's agreement between microbiota and immunity.

    Science.gov (United States)

    Caricilli, Andrea Moro; Castoldi, Angela; Câmara, Niels Olsen Saraiva

    2014-02-15

    Our body is colonized by more than a hundred trillion commensals, represented by viruses, bacteria and fungi. This complex interaction has shown that the microbiome system contributes to the host's adaptation to its environment, providing genes and functionality that give flexibility of diet and modulate the immune system in order not to reject these symbionts. In the intestine, specifically, the microbiota helps developing organ structures, participates of the metabolism of nutrients and induces immunity. Certain components of the microbiota have been shown to trigger inflammatory responses, whereas others, anti-inflammatory responses. The diversity and the composition of the microbiota, thus, play a key role in the maintenance of intestinal homeostasis and explain partially the link between intestinal microbiota changes and gut-related disorders in humans. Tight junction proteins are key molecules for determination of the paracellular permeability. In the context of intestinal inflammatory diseases, the intestinal barrier is compromised, and decreased expression and differential distribution of tight junction proteins is observed. It is still unclear what is the nature of the luminal or mucosal factors that affect the tight junction proteins function, but the modulation of the immune cells found in the intestinal lamina propria is hypothesized as having a role in this modulation. In this review, we provide an overview of the current understanding of the interaction of the gut microbiota with the immune system in the development and maintenance of the intestinal barrier.

  2. Immune responses at brain barriers and implications for brain development and neurological function in later life

    Directory of Open Access Journals (Sweden)

    Helen B. Stolp

    2013-08-01

    Full Text Available For a long time the brain has been considered an immune-privileged site due to a muted inflammatory response and the presence of protective brain barriers. It is now recognised that neuroinflammation may play an important role in almost all neurological disorders and that the brain barriers may be contributing through either normal immune signalling, or disruption of their basic physiological mechanisms. The distinction between normal function and dysfunction at the barriers is difficult to dissect, partly due to a lack of understanding of normal barrier function and partly because of physiological changes that occur as part of normal development and ageing. Brain barriers consist of a number of interacting structural and physiological elements including tight junctions between adjacent barrier cells and an array of influx and efflux transporters. Despite these protective mechanisms, the capacity for immune-surveillance of the brain is maintained, and there is evidence of inflammatory signalling at the brain barriers that may be an important part of the body’s response to damage or infection. This signalling system appears to change both with normal ageing, and during disease. Changes may affect diapedesis of immune cells and active molecular transfer, or cause rearrangement of the tight junctions and an increase in passive permeability across barrier interfaces. Here we review the many elements that contribute to brain barrier functions and how they respond to inflammation, particularly during development and aging. The implications of inflammation–induced barrier dysfunction for brain development and subsequent neurological function are also discussed.

  3. Adaptation of innate lymphoid cells to nutrient deprivation promotes type 2 barrier immunity

    Science.gov (United States)

    Survival of the host relies on the establishment of site-specific barrier defense tailored to constrain pressures imposed by commensal and parasitic exposures. The host is confronted with the additional challenge of maintaining barrier immunity in fluctuating states of dietary availability, yet how ...

  4. Regulation of intestinal homeostasis by innate immune cells.

    Science.gov (United States)

    Kayama, Hisako; Nishimura, Junichi; Takeda, Kiyoshi

    2013-12-01

    The intestinal immune system has an ability to distinguish between the microbiota and pathogenic bacteria, and then activate pro-inflammatory pathways against pathogens for host defense while remaining unresponsive to the microbiota and dietary antigens. In the intestine, abnormal activation of innate immunity causes development of several inflammatory disorders such as inflammatory bowel diseases (IBD). Thus, activity of innate immunity is finely regulated in the intestine. To date, multiple innate immune cells have been shown to maintain gut homeostasis by preventing inadequate adaptive immune responses in the murine intestine. Additionally, several innate immune subsets, which promote Th1 and Th17 responses and are implicated in the pathogenesis of IBD, have recently been identified in the human intestinal mucosa. The demonstration of both murine and human intestinal innate immune subsets contributing to regulation of adaptive immunity emphasizes the conserved innate immune functions across species and might promote development of the intestinal innate immunity-based clinical therapy.

  5. Nutritional components regulate the gut immune system and its association with intestinal immune disease development.

    Science.gov (United States)

    Lamichhane, Aayam; Kiyono, Hiroshi; Kunisawa, Jun

    2013-12-01

    The gut is equipped with a unique immune system for maintaining immunological homeostasis, and its functional immune disruption can result in the development of immune diseases such as food allergy and intestinal inflammation. Accumulating evidence has demonstrated that nutritional components play an important role in the regulation of gut immune responses and also in the development of intestinal immune diseases. In this review, we focus on the immunological functions of lipids, vitamins, and nucleotides in the regulation of the intestinal immune system and as potential targets for the control of intestinal immune diseases. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  6. FOXO-dependent regulation of innate immune homeostasis.

    Science.gov (United States)

    Becker, Thomas; Loch, Gerrit; Beyer, Marc; Zinke, Ingo; Aschenbrenner, Anna C; Carrera, Pilar; Inhester, Therese; Schultze, Joachim L; Hoch, Michael

    2010-01-21

    The innate immune system represents an ancient host defence mechanism that protects against invading microorganisms. An important class of immune effector molecules to fight pathogen infections are antimicrobial peptides (AMPs) that are produced in plants and animals. In Drosophila, the induction of AMPs in response to infection is regulated through the activation of the evolutionarily conserved Toll and immune deficiency (IMD) pathways. Here we show that AMP activation can be achieved independently of these immunoregulatory pathways by the transcription factor FOXO, a key regulator of stress resistance, metabolism and ageing. In non-infected animals, AMP genes are activated in response to nuclear FOXO activity when induced by starvation, using insulin signalling mutants, or by applying small molecule inhibitors. AMP induction is lost in foxo null mutants but enhanced when FOXO is overexpressed. Expression of AMP genes in response to FOXO activity can also be triggered in animals unable to respond to immune challenges due to defects in both the Toll and IMD pathways. Molecular experiments at the Drosomycin promoter indicate that FOXO directly binds to its regulatory region, thereby inducing its transcription. In vivo studies in Drosophila, but also studies in human lung, gut, kidney and skin cells indicate that a FOXO-dependent regulation of AMPs is evolutionarily conserved. Our results indicate a new mechanism of cross-regulation of metabolism and innate immunity by which AMP genes can be activated under normal physiological conditions in response to the oscillating energy status of cells and tissues. This regulation seems to be independent of the pathogen-responsive innate immunity pathways whose activation is often associated with tissue damage and repair. The sparse production of AMPs in epithelial tissues in response to FOXO may help modulating the defence reaction without harming the host tissues, in particular when animals are suffering from energy shortage

  7. Atopic dermatitis: immune deviation, barrier dysfunction, IgE autoreactivity and new therapies

    Directory of Open Access Journals (Sweden)

    Masutaka Furue

    2017-07-01

    Full Text Available Atopic dermatitis (AD is a chronic or chronically relapsing, eczematous, severely pruritic skin disorder mostly associated with IgE elevation and skin barrier dysfunction due to decreased filaggrin expression. The lesional skin of AD exhibits Th2- and Th22-deviated immune reactions that are progressive during disease chronicity. Th2 and Th22 cytokines further deteriorate the skin barrier by inhibiting filaggrin expression. Some IgEs are reactive to self-antigens. The IgE autoreactivity may precipitate the chronicity of AD. Upon activation of the ORAI1 calcium channel, atopic epidermis releases large amounts of thymic stromal lymphopoietin (TSLP, which initiates the Th2 and Th22 immune response. Th2-derived interleukin-31 and TSLP induce an itch sensation. Taken together, TSLP/Th2/Th22 pathway is a promising target for developing new therapeutics for AD. Enhancing filaggrin expression using ligands for the aryl hydrocarbon receptor may also be an adjunctive measure to restore the disrupted barrier function specifically for AD.

  8. Planning and Implementing Immunization Billing Programs at State and Local Health Departments: Barriers and Possible Solutions.

    Science.gov (United States)

    Corriero, Rosemary; Redmon, Ginger

    Before participating in a project funded by the Centers for Disease Control and Prevention, most state and local health departments (LHDs) were not seeking reimbursement or being fully reimbursed by insurance plans for the cost of immunization services (including vaccine costs and administration fees) they provided to insured patients. Centers for Disease Control and Prevention's Billables Project was designed to enable state and LHDs to bill public and private insurance plans for immunization services provided to insured patients. Identify and describe key barriers state and LHDs may encounter while planning and implementing a billing program, as well as possible solutions for overcoming those barriers. This study used reports from Billables Project participants to explore barriers they encountered when planning and implementing a billing program and steps taken to address those barriers. Thirty-eight state immunization programs. Based on project participants' reports, barriers were noted in 7 categories: (1) funding and costs, (2) staff, (3) health department characteristics, (4) third-party payers and insurance plans, (5) software, (6) patient insurance status, and (7) other barriers. Possible solutions for overcoming those barriers included hiring or seeking external help, creating billing guides and training modules, streamlining workflows, and modifying existing software systems. Overcoming barriers during planning and implementation of a billing program can be challenging for state and LHDs, but the experiences and suggestions of past Billables Project participants can help guide future billing program efforts.

  9. Complement anaphylatoxins as immune regulators in cancer.

    Science.gov (United States)

    Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T

    2014-08-01

    The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediated suppression of immune effector cells responsible for immunosurveillance within the tumor microenvironment. This paradigm accords with models of immune dysregulation, such as autoimmunity and infectious disease, which have defined a pathophysiological role for abnormal complement signaling. Several types of immune cells express the cognate receptors for the complement anaphylatoxins, C3aR and C5aR, and demonstrate functional modulation in response to complement stimulation. In turn, impairment of antitumor immunity has been intimately tied to tumor progression in animal models of cancer. In this article, the literature was systematically reviewed to identify studies that have characterized the effects of the complement anaphylatoxins on the composition and function of immune cells within the tumor microenvironment. The search identified six studies based upon models of lymphoma and ovarian, cervical, lung, breast, and mammary cancer, which collectively support the paradigm of complement as an immune regulator in the tumor microenvironment. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  10. Epidermal Overexpression of Xenobiotic Receptor PXR Impairs the Epidermal Barrier and Triggers Th2 Immune Response.

    Science.gov (United States)

    Elentner, Andreas; Schmuth, Matthias; Yannoutsos, Nikolaos; Eichmann, Thomas O; Gruber, Robert; Radner, Franz P W; Hermann, Martin; Del Frari, Barbara; Dubrac, Sandrine

    2018-01-01

    The skin is in daily contact with environmental pollutants, but the long-term effects of such exposure remain underinvestigated. Many of these toxins bind and activate the pregnane X receptor (PXR), a ligand-activated transcription factor that regulates genes central to xenobiotic metabolism. The objective of this work was to investigate the effect of constitutive activation of PXR in the basal layer of the skin to mimic repeated skin exposure to noxious molecules. We designed a transgenic mouse model that overexpresses the human PXR gene linked to the herpes simplex VP16 domain under the control of the keratin 14 promoter. We show that transgenic mice display increased transepidermal water loss and elevated skin pH, abnormal stratum corneum lipids, focal epidermal hyperplasia, activated keratinocytes expressing more thymic stromal lymphopoietin, a T helper type 2/T helper type 17 skin immune response, and increased serum IgE. Furthermore, the cutaneous barrier dysfunction precedes development of the T helper type 2/T helper type 17 inflammation in transgenic mice, thereby mirroring the time course of atopic dermatitis development in humans. Moreover, further experiments suggest increased PXR signaling in the skin of patients with atopic dermatitis when compared with healthy skin. Thus, PXR activation by environmental pollutants may compromise epidermal barrier function and favor an immune response resembling atopic dermatitis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Zonulin and its regulation of intestinal barrier function: the biological door to inflammation, autoimmunity, and cancer.

    Science.gov (United States)

    Fasano, Alessio

    2011-01-01

    The primary functions of the gastrointestinal tract have traditionally been perceived to be limited to the digestion and absorption of nutrients and to electrolytes and water homeostasis. A more attentive analysis of the anatomic and functional arrangement of the gastrointestinal tract, however, suggests that another extremely important function of this organ is its ability to regulate the trafficking of macromolecules between the environment and the host through a barrier mechanism. Together with the gut-associated lymphoid tissue and the neuroendocrine network, the intestinal epithelial barrier, with its intercellular tight junctions, controls the equilibrium between tolerance and immunity to non-self antigens. Zonulin is the only physiological modulator of intercellular tight junctions described so far that is involved in trafficking of macromolecules and, therefore, in tolerance/immune response balance. When the finely tuned zonulin pathway is deregulated in genetically susceptible individuals, both intestinal and extraintestinal autoimmune, inflammatory, and neoplastic disorders can occur. This new paradigm subverts traditional theories underlying the development of these diseases and suggests that these processes can be arrested if the interplay between genes and environmental triggers is prevented by reestablishing the zonulin-dependent intestinal barrier function. This review is timely given the increased interest in the role of a "leaky gut" in the pathogenesis of several pathological conditions targeting both the intestine and extraintestinal organs.

  12. Mechanisms and pathways of innate immune activation and regulation in health and cancer.

    Science.gov (United States)

    Cui, Jun; Chen, Yongjun; Wang, Helen Y; Wang, Rong-Fu

    2014-01-01

    Research on innate immune signaling and regulation has recently focused on pathogen recognition receptors (PRRs) and their signaling pathways. Members of PRRs sense diverse microbial invasions or danger signals, and initiate innate immune signaling pathways, leading to proinflammatory cytokines production, which, in turn, instructs adaptive immune response development. Despite the diverse functions employed by innate immune signaling to respond to a variety of different pathogens, the innate immune response must be tightly regulated. Otherwise, aberrant, uncontrolled immune responses will lead to harmful, or even fatal, consequences. Therefore, it is essential to better discern innate immune signaling and many regulators, controlling various signaling pathways, have been identified. In this review, we focus on the recent advances in our understanding of the activation and regulation of innate immune signaling in the host response to pathogens and cancer.

  13. Dynamic Nature of Noncoding RNA Regulation of Adaptive Immune Response

    Directory of Open Access Journals (Sweden)

    Franca Citarella

    2013-08-01

    Full Text Available Immune response plays a fundamental role in protecting the organism from infections; however, dysregulation often occurs and can be detrimental for the organism, leading to a variety of immune-mediated diseases. Recently our understanding of the molecular and cellular networks regulating the immune response, and, in particular, adaptive immunity, has improved dramatically. For many years, much of the focus has been on the study of protein regulators; nevertheless, recent evidence points to a fundamental role for specific classes of noncoding RNAs (ncRNAs in regulating development, activation and homeostasis of the immune system. Although microRNAs (miRNAs are the most comprehensive and well-studied, a number of reports suggest the exciting possibility that long ncRNAs (lncRNAs could mediate host response and immune function. Finally, evidence is also accumulating that suggests a role for miRNAs and other small ncRNAs in autocrine, paracrine and exocrine signaling events, thus highlighting an elaborate network of regulatory interactions mediated by different classes of ncRNAs during immune response. This review will explore the multifaceted roles of ncRNAs in the adaptive immune response. In particular, we will focus on the well-established role of miRNAs and on the emerging role of lncRNAs and circulating ncRNAs, which all make indispensable contributions to the understanding of the multilayered modulation of the adaptive immune response.

  14. MicroRNA regulation of immune events at conception.

    Science.gov (United States)

    Robertson, Sarah A; Zhang, Bihong; Chan, Honyueng; Sharkey, David J; Barry, Simon C; Fullston, Tod; Schjenken, John E

    2017-09-01

    The reproductive tract environment at conception programs the developmental trajectory of the embryo, sets the course of pregnancy, and impacts offspring phenotype and health. Despite the fundamental importance of this stage of reproduction, the rate-limiting regulatory mechanisms operating locally to control fertility and fecundity are incompletely understood. Emerging studies highlight roles for microRNAs (miRNAs) in regulating reproductive and developmental processes and in modulating the quality and strength of the female immune response. Since endometrial receptivity and robust placentation require specific adaptation of the immune response, we hypothesize that miRNAs participate in establishing pregnancy through effects on key gene networks in immune cells. Our recent studies investigated miRNAs that are induced in the peri-conception environment, focusing on miRNAs that have immune-regulatory roles-particularly miR-223, miR-155, and miR-146a. Genetic mouse models deficient in individual miRNAs are proving informative in defining roles for these miRNAs in the generation and stabilization of regulatory T cells (Treg cells) that confer adaptive immune tolerance. Overlapping and redundant functions between miRNAs that target multiple genes, combined with multiple miRNAs targeting individual genes, indicate complex and sensitive regulatory networks. Although to date most data on miRNA regulation of reproductive events are from mice, conserved functions of miRNAs across species imply similar biological pathways operate in all mammals. Understanding the regulation and roles of miRNAs in the peri-conception immune response will advance our knowledge of how environmental determinants act at conception, and could have practical applications for animal breeding as well as human fertility. © 2017 Wiley Periodicals, Inc.

  15. Claudins, dietary milk proteins, and intestinal barrier regulation.

    Science.gov (United States)

    Kotler, Belinda M; Kerstetter, Jane E; Insogna, Karl L

    2013-01-01

    The family of claudin proteins plays an important role in regulating the intestinal barrier by modulating the permeability of tight junctions. The impact of dietary protein on claudin biology has not been studied extensively. Whey proteins have been reported to improve intestinal barrier function, but their mechanism of action is not clear. Recent studies, however, have demonstrated increased intestinal claudin expression in response to milk protein components. Reviewed here are new findings suggesting that whey-protein-derived transforming growth factor β transcriptionally upregulates claudin-4 expression via a Smad-4-dependent pathway. These and other data, including limited clinical studies, are summarized below and, in the aggregate, suggest a therapeutic role for whey protein in diseases of intestinal barrier dysfunction, perhaps, in part, by regulating claudin expression. © 2013 International Life Sciences Institute.

  16. Histone deacetylases as regulators of inflammation and immunity.

    Science.gov (United States)

    Shakespear, Melanie R; Halili, Maria A; Irvine, Katharine M; Fairlie, David P; Sweet, Matthew J

    2011-07-01

    Histone deacetylases (HDACs) remove an acetyl group from lysine residues of target proteins to regulate cellular processes. Small-molecule inhibitors of HDACs cause cellular growth arrest, differentiation and/or apoptosis, and some are used clinically as anticancer drugs. In animal models, HDAC inhibitors are therapeutic for several inflammatory diseases, but exacerbate atherosclerosis and compromise host defence. Loss of HDAC function has also been linked to chronic lung diseases in humans. These contrasting effects might reflect distinct roles for individual HDACs in immune responses. Here, we review the current understanding of innate and adaptive immune pathways that are regulated by classical HDAC enzymes. The objective is to provide a rationale for targeting (or not targeting) individual HDAC enzymes with inhibitors for future immune-related applications. Copyright © 2011 Elsevier Ltd. All rights reserved.

  17. IMMUNE REGULATING ES-PRODUCTS IN PARASITIC NEMATODES

    DEFF Research Database (Denmark)

    Bahlool, Qusay Zuhair Mohammad; Buchmann, Kurt; Kania, Per Walter

    work elucidates the effect of ES substances on the fish immune system by measuring immune gene expression in spleen and liver of rainbow trout (Oncorhynchus mykiss) injected intraperitoneally with ES products isolated from A. simplex third stage larvae. The overall gene expression profile of exposed...... fish showed a generalized down-regulation of the immune genes tested, suggesting a role of ES proteins in minimizing the immune reaction of rainbow trout against invading nematodes. We also tested the enzymatic activity of the ES proteins and found that lipase, esterase lipase, valine and cysteine...... arylamidases, naphthol-AS-BI-phosphohydrolase and a-galactosidase activities were present in the ES solution. This type of hydrolytic enzyme activity may play a role in nematode penetration of host tissue. Based on the notion that A. simplex ES-proteins may have an immune-depressive effect, it could also...

  18. Atopic dermatitis results in intrinsic barrier and immune abnormalities: Implications for contact dermatitis

    Science.gov (United States)

    Gittler, Julia K.; Krueger, James G.; Guttman-Yassky, Emma

    2014-01-01

    Atopic dermatitis (AD), as well as irritant contact dermatitis (ICD) and allergic contact dermatitis (ACD), are common skin diseases. These diseases are characterized by skin inflammation mediated by activated innate immunity or acquired immune mechanisms. Although AD, ICD, and ACD can be encountered in pure forms by allergists and dermatologists, patients with AD often present with increased frequency of ICD and ACD. Although a disturbed barrier alone could potentiate immune reactivity in patients with AD through increased antigen penetration, additional immune mechanisms might explain the increased susceptibility of atopic patients to ICD and ACD. This review discusses cellular pathways associated with increased skin inflammation in all 3 conditions and presents mechanisms that might contribute to the increased rate of ICD and ACD in patients with AD. PMID:22939651

  19. Mast cell activators as novel immune regulators.

    Science.gov (United States)

    Johnson-Weaver, Brandi; Choi, Hae Woong; Abraham, Soman N; Staats, Herman F

    2018-05-26

    Mast cells are an important cell type of the innate immune system that when activated, play a crucial role in generating protective innate host responses after bacterial and viral infection. Additionally, activated mast cells influence lymph node composition to regulate the induction of adaptive immune responses. The recognition that mast cells play a beneficial role in host responses to microbial infection and induction of adaptive immunity has provided the rationale to evaluate mast cell activators for use as antimicrobials or vaccine adjuvants. This review summarizes the role of mast cell activators in antimicrobial responses while also discussing the use of different classes of mast cell activators as potent vaccine adjuvants that enhance the induction of protective immune responses. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. NKT Cell Networks in the Regulation of Tumor Immunity

    Science.gov (United States)

    Robertson, Faith C.; Berzofsky, Jay A.; Terabe, Masaki

    2014-01-01

    CD1d-restricted natural killer T (NKT) cells lie at the interface between the innate and adaptive immune systems and are important mediators of immune responses and tumor immunosurveillance. These NKT cells uniquely recognize lipid antigens, and their rapid yet specific reactions influence both innate and adaptive immunity. In tumor immunity, two NKT subsets (type I and type II) have contrasting roles in which they not only cross-regulate one another, but also impact innate immune cell populations, including natural killer, dendritic, and myeloid lineage cells, as well as adaptive populations, especially CD8+ and CD4+ T cells. The extent to which NKT cells promote or suppress surrounding cells affects the host’s ability to prevent neoplasia and is consequently of great interest for therapeutic development. Data have shown the potential for therapeutic use of NKT cell agonists and synergy with immune response modifiers in both pre-clinical studies and preliminary clinical studies. However, there is room to improve treatment efficacy by further elucidating the biological mechanisms underlying NKT cell networks. Here, we discuss the progress made in understanding NKT cell networks, their consequent role in the regulation of tumor immunity, and the potential to exploit that knowledge in a clinical setting. PMID:25389427

  1. NKT cell networks in the regulation of tumor immunity.

    Science.gov (United States)

    Robertson, Faith C; Berzofsky, Jay A; Terabe, Masaki

    2014-01-01

    CD1d-restricted natural killer T (NKT) cells lie at the interface between the innate and adaptive immune systems and are important mediators of immune responses and tumor immunosurveillance. These NKT cells uniquely recognize lipid antigens, and their rapid yet specific reactions influence both innate and adaptive immunity. In tumor immunity, two NKT subsets (type I and type II) have contrasting roles in which they not only cross-regulate one another, but also impact innate immune cell populations, including natural killer, dendritic, and myeloid lineage cells, as well as adaptive populations, especially CD8(+) and CD4(+) T cells. The extent to which NKT cells promote or suppress surrounding cells affects the host's ability to prevent neoplasia and is consequently of great interest for therapeutic development. Data have shown the potential for therapeutic use of NKT cell agonists and synergy with immune response modifiers in both pre-clinical studies and preliminary clinical studies. However, there is room to improve treatment efficacy by further elucidating the biological mechanisms underlying NKT cell networks. Here, we discuss the progress made in understanding NKT cell networks, their consequent role in the regulation of tumor immunity, and the potential to exploit that knowledge in a clinical setting.

  2. NKT cell networks in the regulation of tumor immunity

    Directory of Open Access Journals (Sweden)

    Faith C Robertson

    2014-10-01

    Full Text Available CD1d-restricted natural killer T (NKT cells lie at the interface between the innate and adaptive immune systems and are important mediators of immune responses and tumor immunosurveillance. These NKT cells uniquely recognize lipid antigens, and their rapid yet specific reactions influence both innate and adaptive immunity. In tumor immunity, two NKT subsets (type I and type II have contrasting roles in which they not only cross-regulate one another, but also impact innate immune cell populations, including natural killer, dendritic and myeloid lineage cells, as well as adaptive populations, especially CD8+ and CD4+ T cells. The extent to which NKT cells promote or suppress surrounding cells affects the host’s ability to prevent neoplasia and is consequently of great interest for therapeutic development. Data have shown the potential for therapeutic use of NKT cell agonists and synergy with immune response modifiers in both pre-clinical studies and preliminary clinical studies. However, there is room to improve treatment efficacy by further elucidating the biological mechanisms underlying NKT cell networks. Here, we discuss the progress made in understanding NKT cell networks, their consequent role in the regulation of tumor immunity, and the potential to exploit that knowledge in a clinical setting.

  3. HIV enteropathy and aging: gastrointestinal immunity, mucosal epithelial barrier, and microbial translocation.

    Science.gov (United States)

    Wang, Hongyin; Kotler, Donald P

    2014-07-01

    Despite decreases in morbidity and mortality as a result of antiretroviral therapy, gastrointestinal dysfunction remains common in HIV infection. Treated patients are at risk for complications of 'premature' aging, such as cardiovascular disease, osteopenia, neurocognitive decline, malignancies, and frailty. This review summarizes recent observations in this field. Mucosal CD4 lymphocytes, especially Th17 cells, are depleted in acute HIV and simian immune deficiency virus (SIV) infections, although other cell types also are affected. Reconstitution during therapy often is incomplete, especially in mucosa. Mucosal barrier function is affected by both HIV infection and aging and includes paracellular transport via tight junctions and uptake through areas of apoptosis; other factors may affect systemic antigen exposure. The resultant microbial translocation is associated with systemic immune activation in HIV and SIV infections. There is evidence of immune activation and microbial translocation in the elderly. The immune phenotypes of immunosenescence in HIV infection and aging appear similar. There are several targets for intervention; blockage of residual mucosal virus replication, preventing antigen uptake, modulating the microbiome, improving T cell recovery, combining therapies aimed at mucosal integrity, augmenting mucosal immunity, and managing traditional risk factors for premature aging in the general population. Aging may interact with HIV enteropathy to enhance microbial translocation and immune activation.

  4. Zonulin, a regulator of epithelial and endothelial barrier functions, and its involvement in chronic inflammatory diseases.

    Science.gov (United States)

    Sturgeon, Craig; Fasano, Alessio

    2016-01-01

    Beside digesting nutrients and absorbing solutes and electrolytes, the intestinal epithelium with its barrier function is in charge of a tightly controlled antigen trafficking from the intestinal lumen to the submucosa. This trafficking dictates the delicate balance between tolerance and immune response causing inflammation. Loss of barrier function secondary to upregulation of zonulin, the only known physiological modulator of intercellular tight junctions, leads to uncontrolled influx of dietary and microbial antigens. Additional insights on zonulin mechanism of action and the recent appreciation of the role that altered intestinal permeability can play in the development and progression of chronic inflammatory disorders has increased interest of both basic scientists and clinicians on the potential role of zonulin in the pathogenesis of these diseases. This review focuses on the recent research implicating zonulin as a master regulator of intestinal permeability linked to the development of several chronic inflammatory disorders.

  5. DMPD: Innate immune recognition of, and regulation by, DNA. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16979939 Innate immune recognition of, and regulation by, DNA. Ishii KJ, Akira S. T...rends Immunol. 2006 Nov;27(11):525-32. Epub 2006 Sep 18. (.png) (.svg) (.html) (.csml) Show Innate immune recognition... of, and regulation by, DNA. PubmedID 16979939 Title Innate immune recognition of, and regulation b

  6. Regulation of vitamin D homeostasis: implications for the immune system.

    Science.gov (United States)

    van Etten, Evelyne; Stoffels, Katinka; Gysemans, Conny; Mathieu, Chantal; Overbergh, Lut

    2008-10-01

    Vitamin D homeostasis in the immune system is the focus of this review. The production of both the activating (25- and 1alpha-hydroxylase) and the metabolizing (24-hydroxylase) enzymes by cells of the immune system itself, indicates that 1,25(OH)(2)D(3) can be produced locally in immune reaction sites. Moreover, the strict regulation of these enzymes by immune signals is highly suggestive for an autocrine/paracrine role in the immune system, and opens new treatment possibilities.

  7. [Immune regulation activity and mechanism of Tibetan Kefir exopolysaccharide fractions].

    Science.gov (United States)

    Meng, Li; Zhang, Lanwei

    2009-12-01

    To investigate the effects and mechanism on immune regulation activity in mice of two Tibetan Kefir exoploysaccharides (EPS) with different molecular weight of 0.1 x 10(5) - 3 x 10(5) (fraction 1) and 1.8 x 10(3) (fraction 2). The immune regulation activity experiment was carried out in vitro based on the Functional Assessment Procedure and Test Methods of Health Food, which was issued by Ministry of Health of China. First, we treated mice subjects with EPS at doses of 40 mg/kg, 80 mg/kg, 120 mg/kg through ig. Then we detected the index of immune organs, the ability of antibody production (tested by HC50), activity of NK cell, delayed type hypersensitivity (DTH) and phagocytosis of macrophage in mice. Finally, we examined the expression of Erk protein in Macrophages by Western Blot assay. Fraction 1 could promote HC50, activity of NK cell and DTH in mice which low dose showed better. Fraction 2 could promote DTH, phagocytosis of macrophage which high dose showed better. The expression of Erk and COX-2 had the same trend with Phagocytic index. We verified the two fractions of Tibetan Kefir EPS could enhance immune functions in mice. Fraction 1 regulated immune function through NK cell and B cell while fraction 2 through macrophage cell and T cell. The effects to macrophage of Tibetan Kefir EPS in mice may realize through extra cellular signal-regulated kinase Erk pathway.

  8. DMPD: The SAP family of adaptors in immune regulation. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 15541655 The SAP family of adaptors in immune regulation. Latour S, Veillette A. Se...min Immunol. 2004 Dec;16(6):409-19. (.png) (.svg) (.html) (.csml) Show The SAP family of adaptors in immune ...regulation. PubmedID 15541655 Title The SAP family of adaptors in immune regulation. Authors Latour S, Veill

  9. Control of creatine metabolism by HIF is an endogenous mechanism of barrier regulation in colitis.

    Science.gov (United States)

    Glover, Louise E; Bowers, Brittelle E; Saeedi, Bejan; Ehrentraut, Stefan F; Campbell, Eric L; Bayless, Amanda J; Dobrinskikh, Evgenia; Kendrick, Agnieszka A; Kelly, Caleb J; Burgess, Adrianne; Miller, Lauren; Kominsky, Douglas J; Jedlicka, Paul; Colgan, Sean P

    2013-12-03

    Mucosal surfaces of the lower gastrointestinal tract are subject to frequent, pronounced fluctuations in oxygen tension, particularly during inflammation. Adaptive responses to hypoxia are orchestrated largely by the hypoxia-inducible transcription factors (HIFs). As HIF-1α and HIF-2α are coexpressed in mucosal epithelia that constitute the barrier between the lumen and the underlying immune milieu, we sought to define the discrete contribution of HIF-1 and HIF-2 transactivation pathways to intestinal epithelial cell homeostasis. The present study identifies creatine kinases (CKs), key metabolic enzymes for rapid ATP generation via the phosphocreatine-creatine kinase (PCr/CK) system, as a unique gene family that is coordinately regulated by HIF. Cytosolic CKs are expressed in a HIF-2-dependent manner in vitro and localize to apical intestinal epithelial cell adherens junctions, where they are critical for junction assembly and epithelial integrity. Supplementation with dietary creatine markedly ameliorated both disease severity and inflammatory responses in colitis models. Further, enzymes of the PCr/CK metabolic shuttle demonstrate dysregulated mucosal expression in a subset of ulcerative colitis and Crohn disease patients. These findings establish a role for HIF-regulated CK in epithelial homeostasis and reveal a fundamental link between cellular bioenergetics and mucosal barrier.

  10. Complement anaphylatoxins as immune regulators in cancer

    OpenAIRE

    Sayegh, Eli T; Bloch, Orin; Parsa, Andrew T

    2014-01-01

    The role of the complement system in innate immunity is well characterized. However, a recent body of research implicates the complement anaphylatoxins C3a and C5a as insidious propagators of tumor growth and progression. It is now recognized that certain tumors elaborate C3a and C5a and that complement, as a mediator of chronic inflammation and regulator of immune function, may in fact foster rather than defend against tumor growth. A putative mechanism for this function is complement-mediat...

  11. Regulation of stem-cell mediated host immunity by the sphingolipid ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Regulation of stem-cell mediated host immunity by the sphingolipid pathway ... in the generation of mature immune cells and the functioning of the surrounding ... methods with human cells and genetically engineered mice to examine how the ...

  12. Self-regulation of turbulence bursts and transport barriers

    International Nuclear Information System (INIS)

    Floriani, E; Ciraolo, G; Ghendrih, Ph; Sarazin, Y; Lima, R

    2013-01-01

    The interplay between turbulent bursts and transport barriers is analyzed with a simplified model of interchange turbulence in magnetically confined plasmas. The turbulent bursts spread into the transport barriers and, depending on the competing magnitude of the burst and stopping capability of the barrier, can burn through. Simulations of two models of transport barriers are presented: a hard barrier where interchange turbulence modes are stable in a prescribed region and a soft barrier with external plasma biasing. The response of the transport barriers to the non-linear perturbations of the turbulent bursts, addressed in a predator–prey approach, indicates that the barriers monitor an amplification factor of the turbulent bursts, with amplification smaller than one for most bursts and, in some cases, amplification factors that can significantly exceed unity. The weak barriers in corrugated profiles and magnetic structures, as well as the standard barriers, are characterized by these transmission properties, which then regulate the turbulent burst transport properties. The interplays of barriers and turbulent bursts are modeled as competing stochastic processes. For different classes of the probability density function (PDF) of these processes, one can predict the heavy tail properties of the bursts downstream from the barrier, either exponential for a leaky barrier, or with power laws for a tight barrier. The intrinsic probing of the transport barriers by the turbulent bursts thus gives access to the properties of the barriers. The main stochastic variables are the barrier width and the spreading distance of the turbulent bursts within the barrier, together with their level of correlation. One finds that in the case of a barrier with volumetric losses, such as radiation or particle losses as addressed in our present simulations, the stochastic model predicts a leaky behavior with an exponential PDF of escaping turbulent bursts in agreement with the simulation

  13. The placental barrier in allogenic immune conflict in spontaneous early abortions: immunohistochemical and morphological study.

    Science.gov (United States)

    Gurevich, Pavel; Elhayany, Asher; Milovanov, Andrey P; Halperin, Reuvit; Kaganovsky, Ella; Zusman, Itzhak; Ben-Hur, Herzel

    2007-11-01

    Morphologic changes in the placental barrier in spontaneous early abortions under the maternal-embryonic immune conflict, and the role of maternal immunoglobulins (Igs) in these changes. We examined chorionic villi and other tissues obtained from 54 aborts between weeks 3.5 and 8 of pregnancy. Material was divided into two groups. Group 1 (control) contained 15 medically recommended and spontaneous early aborts with no signs of inflammations or pathologic immune processes. Group 2 contained 39 spontaneous early aborts with acute chorionic villitis. Immunohistochemical and morphometric methods were used to study the Igs, different types of immunocompetent cells, and apoptosis-related components of the placental barrier. Acute villitis was found to be characterized by the destruction of all components of the chorionic villi, thrombovasculitis with apoptosis of the endothelium of capillaries and erythroblasts, mucous swelling of the basal membrane, and coagulation of the blood proteins. Due to destruction of the capillaries, the number of avasculate villi increased, and the average number of capillaries per villus decreased. The extremely high number of phagolysosomes with IgG and IgA in the villous monocytes in the group 2 indicates an increase in the phagocytic activity of monocytes against maternal Igs and may reflect the presence of mother-embryo immune conflict. Apoptosis of monocytes and a high number of promonocytes were seen accompanied by a high concentration of p53 protein. A large disturbance in the trophoblast occurred with disappearance of bcl-2 and the appearance of Fas ligand. Massive destruction of maternal Igs in embryonic monocytes and acute villitis in the placental barrier are manifested during the mother-embryo immune conflict, and this may be one of the reasons of spontaneous early abortions.

  14. DMPD: Innate immune responses: crosstalk of signaling and regulation of genetranscription. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 16753195 Innate immune responses: crosstalk of signaling and regulation of genetran...l) (.csml) Show Innate immune responses: crosstalk of signaling and regulation of genetranscription. PubmedI...D 16753195 Title Innate immune responses: crosstalk of signaling and regulation o

  15. Mechanisms Underlying the Regulation of Innate and Adaptive Immunity by Vitamin D.

    Science.gov (United States)

    Wei, Ran; Christakos, Sylvia

    2015-09-24

    Non-classical actions of vitamin D were first suggested over 30 years ago when receptors for the active form of vitamin D, 1,25-dihydroxyvitamin D3 (1,25(OH)2D3), were detected in various tissues and cells that are not associated with the regulation of calcium homeostasis, including activated human inflammatory cells. The question that remained was the biological significance of the presence of vitamin D receptors in the different tissues and cells and, with regard to the immune system, whether or not vitamin D plays a role in the normal immune response and in modifying immune mediated diseases. In this article findings indicating that vitamin D is a key factor regulating both innate and adaptive immunity are reviewed with a focus on the molecular mechanisms involved. In addition, the physiological significance of vitamin D action, as suggested by in vivo studies in mouse models is discussed. Together, the findings indicate the importance of 1,25(OH)2D3 as a regulator of key components of the immune system. An understanding of the mechanisms involved will lead to potential therapeutic applications for the treatment of immune mediated diseases.

  16. Sphingosine 1-phosphate receptor 5 mediates the immune quiescence of the human brain endothelial barrier

    Directory of Open Access Journals (Sweden)

    van Doorn Ruben

    2012-06-01

    Full Text Available Abstract Background The sphingosine 1-phosphate (S1P receptor modulator FTY720P (Gilenya® potently reduces relapse rate and lesion activity in the neuroinflammatory disorder multiple sclerosis. Although most of its efficacy has been shown to be related to immunosuppression through the induction of lymphopenia, it has been suggested that a number of its beneficial effects are related to altered endothelial and blood–brain barrier (BBB functionality. However, to date it remains unknown whether brain endothelial S1P receptors are involved in the maintenance of the function of the BBB thereby mediating immune quiescence of the brain. Here we demonstrate that the brain endothelial receptor S1P5 largely contributes to the maintenance of brain endothelial barrier function. Methods We analyzed the expression of S1P5 in human post-mortem tissues using immunohistochemistry. The function of S1P5 at the BBB was assessed in cultured human brain endothelial cells (ECs using agonists and lentivirus-mediated knockdown of S1P5. Subsequent analyses of different aspects of the brain EC barrier included the formation of a tight barrier, the expression of BBB proteins and markers of inflammation and monocyte transmigration. Results We show that activation of S1P5 on cultured human brain ECs by a selective agonist elicits enhanced barrier integrity and reduced transendothelial migration of monocytes in vitro. These results were corroborated by genetically silencing S1P5 in brain ECs. Interestingly, functional studies with these cells revealed that S1P5 strongly contributes to brain EC barrier function and underlies the expression of specific BBB endothelial characteristics such as tight junctions and permeability. In addition, S1P5 maintains the immunoquiescent state of brain ECs with low expression levels of leukocyte adhesion molecules and inflammatory chemokines and cytokines through lowering the activation of the transcription factor NFκB. Conclusion Our

  17. Effect of skin barrier disruption on immune responses to topically applied cross-reacting material, CRM(197), of diphtheria toxin.

    Science.gov (United States)

    Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D

    2005-08-01

    The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.

  18. TIPE2, a negative regulator of innate and adaptive immunity that maintains immune homeostasis.

    Science.gov (United States)

    Sun, Honghong; Gong, Shunyou; Carmody, Ruaidhri J; Hilliard, Anja; Li, Li; Sun, Jing; Kong, Li; Xu, Lingyun; Hilliard, Brendan; Hu, Shimin; Shen, Hao; Yang, Xiaolu; Chen, Youhai H

    2008-05-02

    Immune homeostasis is essential for the normal functioning of the immune system, and its breakdown leads to fatal inflammatory diseases. We report here the identification of a member of the tumor necrosis factor-alpha-induced protein-8 (TNFAIP8) family, designated TIPE2, that is required for maintaining immune homeostasis. TIPE2 is preferentially expressed in lymphoid tissues, and its deletion in mice leads to multiorgan inflammation, splenomegaly, and premature death. TIPE2-deficient animals are hypersensitive to septic shock, and TIPE2-deficient cells are hyper-responsive to Toll-like receptor (TLR) and T cell receptor (TCR) activation. Importantly, TIPE2 binds to caspase-8 and inhibits activating protein-1 and nuclear factor-kappaB activation while promoting Fas-induced apoptosis. Inhibiting caspase-8 significantly blocks the hyper-responsiveness of TIPE2-deficient cells. These results establish that TIPE2 is an essential negative regulator of TLR and TCR function, and its selective expression in the immune system prevents hyperresponsiveness and maintains immune homeostasis.

  19. Delicate regulation of the cGAS-MITA-mediated innate immune response.

    Science.gov (United States)

    Luo, Wei-Wei; Shu, Hong-Bing

    2018-02-19

    Although it has long been demonstrated that cytosolic DNA is a potent immune stimulant, it is only in recent years that the molecular mechanisms of DNA-stimulated innate immune responses have emerged. Studies have established critical roles for the DNA sensor cyclic GMP-AMP synthase (cGAS) and the adapter protein MITA/STING in the innate immune response to cytosolic DNA or DNA viruses. Although the regulation of cGAS-MITA/STING-mediated signaling remains to be fully investigated, understanding the processes involved may help to explain the mechanisms of innate immune signaling events and perhaps autoinflammatory diseases and to provide potential therapeutic targets for drug intervention. In this review, we summarize recent progress on the regulation of the cGAS-MITA/STING-mediated innate immune response to DNA viruses at the organelle-trafficking, post-translational and transcriptional levels.Cellular & Molecular Immunology advance online publication, 19 February 2018; doi:10.1038/cmi.2016.51.

  20. Innate lymphoid cells as regulators of immunity, inflammation and tissue homeostasis.

    Science.gov (United States)

    Klose, Christoph S N; Artis, David

    2016-06-21

    Research over the last 7 years has led to the formal identification of innate lymphoid cells (ILCs), increased the understanding of their tissue distribution and has established essential functions of ILCs in diverse physiological processes. These include resistance to pathogens, the regulation of autoimmune inflammation, tissue remodeling, cancer and metabolic homeostasis. Notably, many ILC functions appear to be regulated by mechanisms distinct from those of other innate and adaptive immune cells. In this Review, we focus on how group 2 ILC (ILC2) and group 3 ILC (ILC3) responses are regulated and how these cells interact with other immune and non-immune cells to mediate their functions. We highlight experimental evidence from mouse models and patient-based studies that have elucidated the effects of ILCs on the maintenance of tissue homeostasis and the consequences for health and disease.

  1. Exosomes and their roles in immune regulation and cancer.

    Science.gov (United States)

    Greening, David W; Gopal, Shashi K; Xu, Rong; Simpson, Richard J; Chen, Weisan

    2015-04-01

    Exosomes, a subset of extracellular vesicles (EVs), function as a mode of intercellular communication and molecular transfer. Exosomes facilitate the direct extracellular transfer of proteins, lipids, and miRNA/mRNA/DNAs between cells in vitro and in vivo. The immunological activities of exosomes affect immunoregulation mechanisms including modulating antigen presentation, immune activation, immune suppression, immune surveillance, and intercellular communication. Besides immune cells, cancer cells secrete immunologically active exosomes that influence both physiological and pathological processes. The observation that exosomes isolated from immune cells such as dendritic cells (DCs) modulate the immune response has enforced the way these membranous vesicles are being considered as potential immunotherapeutic reagents. Indeed, tumour- and immune cell-derived exosomes have been shown to carry tumour antigens and promote immunity, leading to eradication of established tumours by CD8(+) T cells and CD4(+) T cells, as well as directly suppressing tumour growth and resistance to malignant tumour development. Further understanding of these areas of exosome biology, and especially of molecular mechanisms involved in immune cell targeting, interaction and manipulation, is likely to provide significant insights into immunorecognition and therapeutic intervention. Here, we review the emerging roles of exosomes in immune regulation and the therapeutic potential in cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Therapeutic potential of helminths in autoimmune diseases: helminth-derived immune-regulators and immune balance.

    Science.gov (United States)

    Wang, Meng; Wu, Linxiang; Weng, Rennan; Zheng, Weihong; Wu, Zhongdao; Lv, Zhiyue

    2017-08-01

    Helminths have accompanied human throughout history by releasing immune-evasion molecules that could counteract an aberrant immune response within the host. In the past decades, helminth infections are becoming less prevalent possibly due to the developed sanitation. Meanwhile, the incidence of autoimmune diseases is increasing, which cannot be exclusively explained by the changes of susceptibility genes. While the hygiene hypothesis casts light on the problem. The infections of helminths are believed to interact with and regulate human immunity with the byproduct of suppressing the autoimmune diseases. Thus, helminths are potential to treat or cure the autoimmune diseases. The therapeutic progresses and possible immune suppression mechanisms are illustrated in the review. The helminths that are studied most intensively include Heligmosomoides polygyrus, Hymenolepis diminuta, Schistosoma mansoni, Trichinella spiralis, and Trichuris suis. Special attentions are paid on the booming animal models and clinical trials that are to detect the efficiency of immune-modulating helminth-derived molecules on autoimmune diseases. These trials provide us with a prosperous clinical perspective, but the precise mechanism of the down-regulatory immune response remains to be clarified. More efforts are needed to be dedicated until these parasite-derived immune modulators could be used in clinic to treat or cure the autoimmune diseases under a standard management.

  3. Regulation of TGFβ in the immune system: an emerging role for integrins and dendritic cells.

    Science.gov (United States)

    Worthington, John J; Fenton, Thomas M; Czajkowska, Beata I; Klementowicz, Joanna E; Travis, Mark A

    2012-12-01

    Regulation of an immune response requires complex crosstalk between cells of the innate and adaptive immune systems, via both cell-cell contact and secretion of cytokines. An important cytokine with a broad regulatory role in the immune system is transforming growth factor-β (TGF-β). TGF-β is produced by and has effects on many different cells of the immune system, and plays fundamental roles in the regulation of immune responses during homeostasis, infection and disease. Although many cells can produce TGFβ, it is always produced as an inactive complex that must be activated to bind to the TGFβ receptor complex and promote downstream signalling. Thus, regulation of TGFβ activation is a crucial step in controlling TGFβ function. This review will discuss how TGFβ controls diverse immune responses and how TGFβ function is regulated, with a focus on recent work highlighting a critical role for the integrin αvβ8 expressed by dendritic cells in activating TGFβ. Copyright © 2012 Elsevier GmbH. All rights reserved.

  4. Regulation of TGFβ in the immune system: An emerging role for integrins and dendritic cells

    OpenAIRE

    Worthington, John J.; Fenton, Thomas M.; Czajkowska, Beata I.; Klementowicz, Joanna E.; Travis, Mark A.

    2012-01-01

    Regulation of an immune response requires complex crosstalk between cells of the innate and adaptive immune systems, via both cell?cell contact and secretion of cytokines. An important cytokine with a broad regulatory role in the immune system is transforming growth factor-? (TGF-?). TGF-? is produced by and has effects on many different cells of the immune system, and plays fundamental roles in the regulation of immune responses during homeostasis, infection and disease. Although many cells ...

  5. Arkansas community pharmacists' opinions on providing immunizations.

    Science.gov (United States)

    Pace, Anne C; Flowers, Schwanda K; Hastings, Jan K

    2010-10-01

    To determine community pharmacists' attitudes and knowledge on providing immunizations including perceived barriers to immunizing. The study also examined the percentage of Arkansas pharmacists providing immunizations and the utilization of student pharmacists. Survey. Arkansas community pharmacies from February to March 2009. Community pharmacists. Mailed survey. Perceived barriers to providing immunizations, pharmacists' attitudes regarding immunizations, number of immunization-certified pharmacists, immunization administration rates within the last year, and senior student pharmacists utilization. A total of 350 surveys were mailed, and 129 were returned. In all, 79% of the respondents believed administering immunizations has advanced or significantly advanced the profession. Being certified and attitude toward providing immunizations were correlated; 37% of the respondents held certification to immunize, of which 77% reported immunizing within the last year. Commonly reported barriers included time (76%) followed by reimbursement and legal liability. Only half the respondents realized fourth year student pharmacists could immunize and only 33% of certified pharmacists utilized student pharmacists to immunize. Pharmacists perceive many barriers to providing immunizations. Training student pharmacists to give immunizations may not result in them providing immunizations upon graduation. Additional education on overcoming potential barriers and using senior student pharmacists to administer immunizations is needed.

  6. Neonatal immune challenge does not affect body weight regulation in rats.

    Science.gov (United States)

    Spencer, Sarah J; Mouihate, Abdeslam; Galic, Michael A; Ellis, Shaun L; Pittman, Quentin J

    2007-08-01

    The perinatal environment plays a crucial role in programming many aspects of adult physiology. Myriad stressors during pregnancy, from maternal immune challenge to nutritional deficiency, can alter long-term body weight set points of the offspring. In light of the increasing concern over body weight issues, such as obesity and anorexia, in modern societies and accumulating evidence that developmental stressors have long-lasting effects on other aspects of physiology (e.g., fever, pain), we explored the role of immune system activation during neonatal development and its impact on body weight regulation in adulthood. Here we present a thorough evaluation of the effects of immune system activation (LPS, 100 microg/kg ip) at postnatal days 3, 7, or 14 on long-term body weight, adiposity, and body weight regulation after a further LPS injection (50 microg/kg ip) or fasting and basal and LPS-induced circulating levels of the appetite-regulating proinflammatory cytokine leptin. We show that neonatal exposure to LPS at various times during the neonatal period has no long-term effects on growth, body weight, or adiposity. We also observed no effects on body weight regulation in response to a short fasting period or a further exposure to LPS. Despite reductions in circulating leptin levels in response to LPS during the neonatal period, no long-term effects on leptin were seen. These results convincingly demonstrate that adult body weight and weight regulation are, unlike many other aspects of adult physiology, resistant to programming by a febrile-dose neonatal immune challenge.

  7. DMPD: Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 18406369 Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins...svg) (.html) (.csml) Show Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins. ...PubmedID 18406369 Title Regulation of innate immunity by suppressor of cytokine signaling (SOCS)proteins

  8. Antimicrobial peptides in the female reproductive tract: a critical component of the mucosal immune barrier with physiological and clinical implications.

    Science.gov (United States)

    Yarbrough, Victoria L; Winkle, Sean; Herbst-Kralovetz, Melissa M

    2015-01-01

    At the interface of the external environment and the mucosal surface of the female reproductive tract (FRT) lies a first-line defense against pathogen invasion that includes antimicrobial peptides (AMP). Comprised of a unique class of multifunctional, amphipathic molecules, AMP employ a wide range of functions to limit microbial invasion and replication within host cells as well as independently modulate the immune system, dampen inflammation and maintain tissue homeostasis. The role of AMP in barrier defense at the level of the skin and gut has received much attention as of late. Given the far reaching implications for women's health, maternal and fetal morbidity and mortality, and sexually transmissible and polymicrobial diseases, we herein review the distribution and function of key AMP throughout the female reproductive mucosa and assess their role as an essential immunological barrier to microbial invasion throughout the reproductive cycle of a woman's lifetime. A comprehensive search in PubMed/Medline was conducted related to AMP general structure, function, signaling, expression, distribution and barrier function of AMP in the FRT, hormone regulation of AMP, the microbiome of the FRT, and AMP in relation to implantation, pregnancy, fertility, pelvic inflammatory disease, complications of pregnancy and assisted reproductive technology. AMP are amphipathic peptides that target microbes for destruction and have been conserved throughout all living organisms. In the FRT, several major classes of AMP are expressed constitutively and others are inducible at the mucosal epithelium and by immune cells. AMP expression is also under the influence of sex hormones, varying throughout the menstrual cycle, and dependent on the vaginal microbiome. AMP can prevent infection with sexually transmissible and opportunistic pathogens of the female reproductive tissues, although emerging understanding of vaginal dysbiosis suggests induction of a unique AMP profile with increased

  9. The short isoform of the CEACAM1 receptor in intestinal T cells regulates mucosal immunity and homeostasis via Tfh cell induction.

    Science.gov (United States)

    Chen, Lanfen; Chen, Zhangguo; Baker, Kristi; Halvorsen, Elizabeth M; da Cunha, Andre Pires; Flak, Magdalena B; Gerber, Georg; Huang, Yu-Hwa; Hosomi, Shuhei; Arthur, Janelle C; Dery, Ken J; Nagaishi, Takashi; Beauchemin, Nicole; Holmes, Kathryn V; Ho, Joshua W K; Shively, John E; Jobin, Christian; Onderdonk, Andrew B; Bry, Lynn; Weiner, Howard L; Higgins, Darren E; Blumberg, Richard S

    2012-11-16

    Carcinoembryonic antigen cell adhesion molecule like I (CEACAM1) is expressed on activated T cells and signals through either a long (L) cytoplasmic tail containing immune receptor tyrosine based inhibitory motifs, which provide inhibitory function, or a short (S) cytoplasmic tail with an unknown role. Previous studies on peripheral T cells show that CEACAM1-L isoforms predominate with little to no detectable CEACAM1-S isoforms in mouse and human. We show here that this was not the case in tissue resident T cells of intestines and gut associated lymphoid tissues, which demonstrated predominant expression of CEACAM1-S isoforms relative to CEACAM1-L isoforms in human and mouse. This tissue resident predominance of CEACAM1-S expression was determined by the intestinal environment where it served a stimulatory function leading to the regulation of T cell subsets associated with the generation of secretory IgA immunity, the regulation of mucosal commensalism, and defense of the barrier against enteropathogens. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Probiotics and the Gut Immune System: Indirect Regulation.

    Science.gov (United States)

    La Fata, Giorgio; Weber, Peter; Mohajeri, M Hasan

    2018-03-01

    The gastrointestinal tract (GIT) represents the largest interface between the human organism and the external environment. In the lumen and upper part of the mucus layer, this organ hosts an enormous number of microorganisms whose composition affects the functions of the epithelial barrier and the gut immune system. Consequentially, the microorganisms in the GIT influence the health status of the organism. Probiotics are living microorganisms which, in specific conditions, confer a health benefit to the host. Among others, probiotics have immunomodulatory properties that usually act directly by (a) increasing the activity of macrophages or natural killer cells, (b) modulating the secretion of immunoglobulins or cytokines, or indirectly by (c) enhancing the gut epithelial barrier, (d) altering the mucus secretion, and (e) competitive exclusion of other (pathogenic) bacteria. This review focuses on specific bacteria strains with indirect immunomodulatory properties. Particularly, we describe here the mechanisms through which specific probiotics enhance the gut epithelial barrier and modulate mucus production. Moreover, we describe the antimicrobial properties of specific bacteria strains. Recent data suggest that multiple pathologies are associated with an unbalanced gut microflora (dysbiosis). Although the cause-effect relationship between pathology and gut microflora is not yet well established, consumption of specific probiotics may represent a powerful tool to re-establish gut homeostasis and promote gut health.

  11. Microbial Invasion vs. Tick Immune Regulation.

    Science.gov (United States)

    Sonenshine, Daniel E; Macaluso, Kevin R

    2017-01-01

    Ticks transmit a greater variety of pathogenic agents that cause disease in humans and animals than any other haematophagous arthropod, including Lyme disease, Rocky Mountain spotted fever, human granulocytic anaplasmosis, babesiosis, tick-borne encephalitis, Crimean Congo haemorhagic fever, and many others (Gulia-Nuss et al., 2016). Although diverse explanations have been proposed to explain their remarkable vectorial capacity, among the most important are their blood feeding habit, their long term off-host survival, the diverse array of bioactive molecules that disrupt the host's natural hemostatic mechanisms, facilitate blood flow, pain inhibitors, and minimize inflammation to prevent immune rejection (Hajdušek et al., 2013). Moreover, the tick's unique intracellular digestive processes allow the midgut to provide a relatively permissive microenvironment for survival of invading microbes. Although tick-host-pathogen interactions have evolved over more than 300 million years (Barker and Murrell, 2008), few microbes have been able to overcome the tick's innate immune system, comprising both humoral and cellular processes that reject them. Similar to most eukaryotes, the signaling pathways that regulate the innate immune response, i.e., the Toll, IMD (Immunodeficiency) and JAK-STAT (Janus Kinase/ Signal Transducers and Activators of Transcription) also occur in ticks (Gulia-Nuss et al., 2016). Recognition of pathogen-associated molecular patterns (PAMPs) on the microbial surface triggers one or the other of these pathways. Consequently, ticks are able to mount an impressive array of humoral and cellular responses to microbial challenge, including anti-microbial peptides (AMPs), e.g., defensins, lysozymes, microplusins, etc., that directly kill, entrap or inhibit the invaders. Equally important are cellular processes, primarily phagocytosis, that capture, ingest, or encapsulate invading microbes, regulated by a primordial system of thioester-containing proteins

  12. Microbial Invasion vs. Tick Immune Regulation

    Directory of Open Access Journals (Sweden)

    Daniel E. Sonenshine

    2017-09-01

    Full Text Available Ticks transmit a greater variety of pathogenic agents that cause disease in humans and animals than any other haematophagous arthropod, including Lyme disease, Rocky Mountain spotted fever, human granulocytic anaplasmosis, babesiosis, tick-borne encephalitis, Crimean Congo haemorhagic fever, and many others (Gulia-Nuss et al., 2016. Although diverse explanations have been proposed to explain their remarkable vectorial capacity, among the most important are their blood feeding habit, their long term off-host survival, the diverse array of bioactive molecules that disrupt the host's natural hemostatic mechanisms, facilitate blood flow, pain inhibitors, and minimize inflammation to prevent immune rejection (Hajdušek et al., 2013. Moreover, the tick's unique intracellular digestive processes allow the midgut to provide a relatively permissive microenvironment for survival of invading microbes. Although tick-host-pathogen interactions have evolved over more than 300 million years (Barker and Murrell, 2008, few microbes have been able to overcome the tick's innate immune system, comprising both humoral and cellular processes that reject them. Similar to most eukaryotes, the signaling pathways that regulate the innate immune response, i.e., the Toll, IMD (Immunodeficiency and JAK-STAT (Janus Kinase/ Signal Transducers and Activators of Transcription also occur in ticks (Gulia-Nuss et al., 2016. Recognition of pathogen-associated molecular patterns (PAMPs on the microbial surface triggers one or the other of these pathways. Consequently, ticks are able to mount an impressive array of humoral and cellular responses to microbial challenge, including anti-microbial peptides (AMPs, e.g., defensins, lysozymes, microplusins, etc., that directly kill, entrap or inhibit the invaders. Equally important are cellular processes, primarily phagocytosis, that capture, ingest, or encapsulate invading microbes, regulated by a primordial system of thioester

  13. A chitinase from pacific white shrimp Litopenaeus vannamei involved in immune regulation.

    Science.gov (United States)

    Niu, Shengwen; Yang, Linwei; Zuo, Hongliang; Zheng, Jiefu; Weng, Shaoping; He, Jianguo; Xu, Xiaopeng

    2018-08-01

    Chitinases are a group of hydrolytic enzymes that hydrolyze chitin and widely exist in organisms. Studies in mammals have demonstrated that chitinases play important roles in regulation of humoral and cellular immune responses. In arthropods, although it is well known that chitinases are involved in growth, molting and development, the current knowledge on the role of chitinases in immunity, especially in immune regulation, remains largely unknown. In this study, a chitinase (LvChi5) from Litopenaeus vannamei was representatively selected for studying its immune function. The start codon of LvChi5 was corrected by 5'RACE analysis and its protein sequence was reanalyzed. LvChi5 contains a catalytic domain and a chitin binding domain and shows no inhibitory effect on growth of bacteria in vitro. However, in vivo experiments demonstrated that silencing of LvChi5 increased the mortality of shrimp infected with white spot syndrome virus (WSSV) and Vibro parahaemolyticus and significantly upregulated the load of pathogens in tissues. The expression of various immune related genes, including transcription factors, antimicrobial peptides and other functional proteins with antibacterial and antiviral activities, was widely changed in LvChi5 silencing shrimp. Moreover, the recombinant LvChi5 protein could enhance the phagocytic activity of hemocytes against bacteria. These suggested that shrimp chitinase could play a role in regulation of both humoral and cellular immune responses in shrimp. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Group 3 Innate Lymphoid Cells: Communications Hubs of the Intestinal Immune System.

    Science.gov (United States)

    Withers, David R; Hepworth, Matthew R

    2017-01-01

    The maintenance of mammalian health requires the generation of appropriate immune responses against a broad range of environmental and microbial challenges, which are continually encountered at barrier tissue sites including the skin, lung, and gastrointestinal tract. Dysregulated barrier immune responses result in inflammation, both locally and systemically in peripheral organs. Group 3 innate lymphoid cells (ILC3) are constitutively present at barrier sites and appear to be highly specialized in their ability to sense a range of environmental and host-derived signals. Under homeostatic conditions, ILC3 respond to local cues to maintain tissue homeostasis and restrict inflammatory responses. In contrast, perturbations in the tissue microenvironment resulting from disease, infection, or tissue damage can drive dysregulated pro-inflammatory ILC3 responses and contribute to immunopathology. The tone of the ILC3 response is dictated by a balance of "exogenous" signals, such as dietary metabolites and commensal microbes, and "endogenous" host-derived signals from stromal cells, immune cells, and the nervous system. ILC3 must therefore have the capacity to simultaneously integrate a wide array of complex and dynamic inputs in order to regulate barrier function and tissue health. In this review, we discuss the concept of ILC3 as a "communications hub" in the intestinal tract and associated lymphoid tissues and address the variety of signals, derived from multiple biological systems, which are interpreted by ILC3 to modulate the release of downstream effector molecules and regulate cell-cell crosstalk. Successful integration of environmental cues by ILC3 and downstream propagation to the broader immune system is required to maintain a tolerogenic and anti-inflammatory tone and reinforce barrier function, whereas dysregulation of ILC3 responses can contribute to the onset or progression of clinically relevant chronic inflammatory diseases.

  15. Group 3 Innate Lymphoid Cells: Communications Hubs of the Intestinal Immune System

    Directory of Open Access Journals (Sweden)

    David R. Withers

    2017-10-01

    Full Text Available The maintenance of mammalian health requires the generation of appropriate immune responses against a broad range of environmental and microbial challenges, which are continually encountered at barrier tissue sites including the skin, lung, and gastrointestinal tract. Dysregulated barrier immune responses result in inflammation, both locally and systemically in peripheral organs. Group 3 innate lymphoid cells (ILC3 are constitutively present at barrier sites and appear to be highly specialized in their ability to sense a range of environmental and host-derived signals. Under homeostatic conditions, ILC3 respond to local cues to maintain tissue homeostasis and restrict inflammatory responses. In contrast, perturbations in the tissue microenvironment resulting from disease, infection, or tissue damage can drive dysregulated pro-inflammatory ILC3 responses and contribute to immunopathology. The tone of the ILC3 response is dictated by a balance of “exogenous” signals, such as dietary metabolites and commensal microbes, and “endogenous” host-derived signals from stromal cells, immune cells, and the nervous system. ILC3 must therefore have the capacity to simultaneously integrate a wide array of complex and dynamic inputs in order to regulate barrier function and tissue health. In this review, we discuss the concept of ILC3 as a “communications hub” in the intestinal tract and associated lymphoid tissues and address the variety of signals, derived from multiple biological systems, which are interpreted by ILC3 to modulate the release of downstream effector molecules and regulate cell–cell crosstalk. Successful integration of environmental cues by ILC3 and downstream propagation to the broader immune system is required to maintain a tolerogenic and anti-inflammatory tone and reinforce barrier function, whereas dysregulation of ILC3 responses can contribute to the onset or progression of clinically relevant chronic inflammatory diseases.

  16. Group 3 Innate Lymphoid Cells: Communications Hubs of the Intestinal Immune System

    Science.gov (United States)

    Withers, David R.; Hepworth, Matthew R.

    2017-01-01

    The maintenance of mammalian health requires the generation of appropriate immune responses against a broad range of environmental and microbial challenges, which are continually encountered at barrier tissue sites including the skin, lung, and gastrointestinal tract. Dysregulated barrier immune responses result in inflammation, both locally and systemically in peripheral organs. Group 3 innate lymphoid cells (ILC3) are constitutively present at barrier sites and appear to be highly specialized in their ability to sense a range of environmental and host-derived signals. Under homeostatic conditions, ILC3 respond to local cues to maintain tissue homeostasis and restrict inflammatory responses. In contrast, perturbations in the tissue microenvironment resulting from disease, infection, or tissue damage can drive dysregulated pro-inflammatory ILC3 responses and contribute to immunopathology. The tone of the ILC3 response is dictated by a balance of “exogenous” signals, such as dietary metabolites and commensal microbes, and “endogenous” host-derived signals from stromal cells, immune cells, and the nervous system. ILC3 must therefore have the capacity to simultaneously integrate a wide array of complex and dynamic inputs in order to regulate barrier function and tissue health. In this review, we discuss the concept of ILC3 as a “communications hub” in the intestinal tract and associated lymphoid tissues and address the variety of signals, derived from multiple biological systems, which are interpreted by ILC3 to modulate the release of downstream effector molecules and regulate cell–cell crosstalk. Successful integration of environmental cues by ILC3 and downstream propagation to the broader immune system is required to maintain a tolerogenic and anti-inflammatory tone and reinforce barrier function, whereas dysregulation of ILC3 responses can contribute to the onset or progression of clinically relevant chronic inflammatory diseases. PMID:29085366

  17. Protein kinase C-dependent signaling controls the midgut epithelial barrier to malaria parasite infection in anopheline mosquitoes.

    Directory of Open Access Journals (Sweden)

    Nazzy Pakpour

    Full Text Available Anopheline mosquitoes are the primary vectors of parasites in the genus Plasmodium, the causative agents of malaria. Malaria parasites undergo a series of complex transformations upon ingestion by the mosquito host. During this process, the physical barrier of the midgut epithelium, along with innate immune defenses, functionally restrict parasite development. Although these defenses have been studied for some time, the regulatory factors that control them are poorly understood. The protein kinase C (PKC gene family consists of serine/threonine kinases that serve as central signaling molecules and regulators of a broad spectrum of cellular processes including epithelial barrier function and immunity. Indeed, PKCs are highly conserved, ranging from 7 isoforms in Drosophila to 16 isoforms in mammals, yet none have been identified in mosquitoes. Despite conservation of the PKC gene family and their potential as targets for transmission-blocking strategies for malaria, no direct connections between PKCs, the mosquito immune response or epithelial barrier integrity are known. Here, we identify and characterize six PKC gene family members--PKCδ, PKCε, PKCζ, PKD, PKN, and an indeterminate conventional PKC--in Anopheles gambiae and Anopheles stephensi. Sequence and phylogenetic analyses of the anopheline PKCs support most subfamily assignments. All six PKCs are expressed in the midgut epithelia of A. gambiae and A. stephensi post-blood feeding, indicating availability for signaling in a tissue that is critical for malaria parasite development. Although inhibition of PKC enzymatic activity decreased NF-κB-regulated anti-microbial peptide expression in mosquito cells in vitro, PKC inhibition had no effect on expression of a panel of immune genes in the midgut epithelium in vivo. PKC inhibition did, however, significantly increase midgut barrier integrity and decrease development of P. falciparum oocysts in A. stephensi, suggesting that PKC

  18. An update: Epstein-Barr virus and immune evasion via microRNA regulation.

    Science.gov (United States)

    Zuo, Lielian; Yue, Wenxin; Du, Shujuan; Xin, Shuyu; Zhang, Jing; Liu, Lingzhi; Li, Guiyuan; Lu, Jianhong

    2017-06-01

    Epstein-Barr virus (EBV) is an oncogenic virus that ubiquitously establishes life-long persistence in humans. To ensure its survival and maintain its B cell transformation function, EBV has developed powerful strategies to evade host immune responses. Emerging evidence has shown that microRNAs (miRNAs) are powerful regulators of the maintenance of cellular homeostasis. In this review, we summarize current progress on how EBV utilizes miRNAs for immune evasion. EBV encodes miRNAs targeting both viral and host genes involved in the immune response. The miRNAs are found in two gene clusters, and recent studies have demonstrated that lack of these clusters increases the CD4 + and CD8 + T cell response of infected cells. These reports strongly indicate that EBV miRNAs are critical for immune evasion. In addition, EBV is able to dysregulate the expression of a variety of host miRNAs, which influence multiple immune-related molecules and signaling pathways. The transport via exosomes of EBV-regulated miRNAs and viral proteins contributes to the construction and modification of the inflammatory tumor microenvironment. During EBV immune evasion, viral proteins, immune cells, chemokines, pro-inflammatory cytokines, and pro-apoptosis molecules are involved. Our increasing knowledge of the role of miRNAs in immune evasion will improve the understanding of EBV persistence and help to develop new treatments for EBV-associated cancers and other diseases.

  19. The Mucosal Immune System and Its Regulation by Autophagy.

    Science.gov (United States)

    Kabat, Agnieszka M; Pott, Johanna; Maloy, Kevin J

    2016-01-01

    The gastrointestinal tract presents a unique challenge to the mucosal immune system, which has to constantly monitor the vast surface for the presence of pathogens, while at the same time maintaining tolerance to beneficial or innocuous antigens. In the intestinal mucosa, specialized innate and adaptive immune components participate in directing appropriate immune responses toward these diverse challenges. Recent studies provide compelling evidence that the process of autophagy influences several aspects of mucosal immune responses. Initially described as a "self-eating" survival pathway that enables nutrient recycling during starvation, autophagy has now been connected to multiple cellular responses, including several aspects of immunity. Initial links between autophagy and host immunity came from the observations that autophagy can target intracellular bacteria for degradation. However, subsequent studies indicated that autophagy plays a much broader role in immune responses, as it can impact antigen processing, thymic selection, lymphocyte homeostasis, and the regulation of immunoglobulin and cytokine secretion. In this review, we provide a comprehensive overview of mucosal immune cells and discuss how autophagy influences many aspects of their physiology and function. We focus on cell type-specific roles of autophagy in the gut, with a particular emphasis on the effects of autophagy on the intestinal T cell compartment. We also provide a perspective on how manipulation of autophagy may potentially be used to treat mucosal inflammatory disorders.

  20. Tumor-associated fibrosis as a regulator of tumor immunity and response to immunotherapy.

    Science.gov (United States)

    Jiang, Hong; Hegde, Samarth; DeNardo, David G

    2017-08-01

    Tumor-associated fibrosis is characterized by unchecked pro-fibrotic and pro-inflammatory signaling. The components of fibrosis including significant numbers of cancer-associated fibroblasts, dense collagen deposition, and extracellular matrix stiffness, are well appreciated regulators of tumor progression but may also be critical regulators of immune surveillance. While this suggests that the efficacy of immunotherapy may be limited in highly fibrotic cancers like pancreas, it also suggests a therapeutic opportunity to target fibrosis in these tumor types to reawaken anti-tumor immunity. This review discusses the mechanisms by which fibrosis might subvert tumor immunity and how to overcome these mechanisms.

  1. Immune Regulator MCPIP1 Modulates TET Expression during Early Neocortical Development

    Directory of Open Access Journals (Sweden)

    Huihui Jiang

    2016-09-01

    Full Text Available MCPIP1 is a recently identified immune regulator that plays critical roles in preventing immune disorders, and is also present in the brain. Currently an unresolved question remains as to how MCPIP1 performs its non-immune functions in normal brain development. Here, we report that MCPIP1 is abundant in neural progenitor cells (NPCs and newborn neurons during the early stages of neurogenesis. The suppression of MCPIP1 expression impairs normal neuronal differentiation, cell-cycle exit, and concomitant NPC proliferation. MCPIP1 is important for maintenance of the NPC pool. Notably, we demonstrate that MCPIP1 reduces TET (TET1/TET2/TET3 levels and then decreases 5-hydroxymethylcytosine levels. Furthermore, the MCPIP1 interaction with TETs is involved in neurogenesis and in establishing the proper number of NPCs in vivo. Collectively, our findings not only demonstrate that MCPIP1 plays an important role in early cortical neurogenesis but also reveal an unexpected link between neocortical development, immune regulators, and epigenetic modification.

  2. Barriers to Construction Health and Safety Self-regulation: A Scoping Case of Nigeria

    Directory of Open Access Journals (Sweden)

    Umeokafor Nnedinma

    2017-03-01

    Full Text Available This scoping study builds on the recent uncovering that in terms of health and safety (H&S, the Nigerian construction industry is self-regulated in various forms, not unregulated and that the size of company can further explain H&S self-regulation. Consequently, the barriers identified through literature review were assessed using questionnaires. Analysis of the data collected from construction practitioners in Nigeria shows that ‘economic factors’ mostly explains the barriers to construction H&S self-regulation. This is followed by the ‘ability to self-regulate’ and ‘lack of awareness’. Furthermore, the results show significant differences among small, medium and large construction contractors on seven factors of which include ‘normative case’ factors, ‘H&S is a duty’, ‘H&S is the right thing’ and ‘unfair H&S standards or legislation’. Although a scoping study, the study draws attention to the barriers to construction H&S self-regulation in Nigeria and demonstrates an alternative to state regulation of H&S.

  3. Immune Homeostasis in Epithelial Cells: Evidence and Role of Inflammasome Signaling Reviewed.

    Science.gov (United States)

    Peeters, Paul M; Wouters, Emiel F; Reynaert, Niki L

    2015-01-01

    The epithelium regulates the interaction between the noxious xenogenous, as well as the microbial environment and the immune system, not only by providing a barrier but also by expressing a number of immunoregulatory membrane receptors, and intracellular danger sensors and their downstream effectors. Amongst these are a number of inflammasome sensor subtypes, which have been initially characterized in myeloid cells and described to be activated upon assembly into multiprotein complexes by microbial and environmental triggers. This review compiles a vast amount of literature that supports a pivotal role for inflammasomes in the various epithelial barriers of the human body as essential factors maintaining immune signaling and homeostasis.

  4. Cytokine regulation of immune tolerance

    OpenAIRE

    Wu, Jie; Xie, Aini; Chen, Wenhao

    2014-01-01

    The immune system provides defenses against invading pathogens while maintaining immune tolerance to self-antigens. This immune homeostasis is harmonized by the direct interactions between immune cells and the cytokine environment in which immune cells develop and function. Herein, we discuss three non-redundant paradigms by which cytokines maintain or break immune tolerance. We firstly describe how anti-inflammatory cytokines exert direct inhibitory effects on immune cells to enforce immune ...

  5. IRAK-M regulation and function in host defense and immune homeostasis

    Directory of Open Access Journals (Sweden)

    Leah L.N. Hubbard

    2010-06-01

    Full Text Available Antigen presenting cells (APCs of the innate immune system sense a wide range of pathogens via pattern recognition receptors (PRRs. Engagement of certain PRRs can induce production of pro-inflammatory mediators that facilitate effective clearance of pathogen. Toll-like receptors (TLRs are a well described group of PRRs that belong to the TLR/Interleukin-1 receptor (IL-1R superfamily. However, TLR/IL-1R induction of pro-inflammatory mediators must be regulated to prevent excessive inflammation and tissue damage. One molecule of recent interest that is known to inhibit TLR/IL-1R signaling is interleukin-1 receptor associated kinase (IRAK-M, also known as IRAK-3. IRAK-M is expressed in a number of immune and epithelial cells types, and through its inhibition of pro-inflammatory cytokine production, IRAK-M can regulate immune homeostasis and tolerance in a number of infectious and non-infectious diseases. Furthermore, use of IRAK-M deficient animals has increased our understanding of the importance of IRAK-M in regulating immune responsiveness to a variety of pathogens. Although IRAK-M expression is typically induced through TLR signaling, IRAK-M can also be expressed in response to various endogenous and exogenous soluble factors as well as cell surface and intracellular signaling molecules. This review will focus on clinical scenarios in which expression of IRAK-M is beneficial (as in early sepsis and those situations where IRAK-M expression is harmful to the host (as in cancer and following bone marrow transplant. There is strong rationale for therapeutic targeting of IRAK-M for clinical benefit. However, effective targeting will require a greater understanding of the transcriptional regulation of this gene.

  6. Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells.

    Science.gov (United States)

    Bandoła, Joanna; Richter, Cornelia; Ryser, Martin; Jamal, Arshad; Ashton, Michelle P; von Bonin, Malte; Kuhn, Matthias; Dorschner, Benjamin; Alexopoulou, Dimitra; Navratiel, Katrin; Roeder, Ingo; Dahl, Andreas; Hedrich, Christian M; Bonifacio, Ezio; Brenner, Sebastian; Thieme, Sebastian

    2017-01-01

    Plasmacytoid dendritic cells (pDCs) regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR) by the antigen-presenting pDCs, mediated by toll-like receptor (TLR) 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.

  7. Neurotrophin Receptor p75NTR Regulates Immune Function of Plasmacytoid Dendritic Cells

    Directory of Open Access Journals (Sweden)

    Joanna Bandoła

    2017-08-01

    Full Text Available Plasmacytoid dendritic cells (pDCs regulate innate and adaptive immunity. Neurotrophins and their receptors control the function of neuronal tissue. In addition, they have been demonstrated to be part of the immune response but little is known about the effector immune cells involved. We report, for the first time, the expression and immune-regulatory function of the low affinity neurotrophin receptor p75 neurotrophin receptor (p75NTR by the antigen-presenting pDCs, mediated by toll-like receptor (TLR 9 activation and differential phosphorylation of interferon regulatory factor 3 and 7. The modulation of p75NTR on pDCs significantly influences disease progression of asthma in an ovalbumin-induced mouse model mediated by the TLR9 signaling pathway. p75NTR activation of pDCs from patients with asthma increased allergen-specific T cell proliferation and cytokine secretion in nerve growth factor concentration-dependent manner. Further, p75NTR activation of pDCs delayed the onset of autoimmune diabetes in RIP-CD80GP mice and aggravated graft-versus-host disease in a xenotransplantation model. Thus, p75NTR signaling on pDCs constitutes a new and critical mechanism connecting neurotrophin signaling and immune response regulation with great therapeutic potential for a variety of immune disorders.

  8. Facilitators and barriers for RhD-immunized women to become and remain anti-D donors.

    Science.gov (United States)

    Slootweg, Yolentha Maria; Koelewijn, Johanna Maria; de Kort, Wim L; de Haas, Masja; Merz, Eva-Maria

    2018-04-01

    The successful introduction of prophylaxis with anti-RhD immunoglobulin has resulted in a significant decline of pregnancy-related RhD immunizations but also has decreased the availability of naturally immunized women as (new) anti-D donors. An influx of new donors is necessary to maintain a sufficient pool of anti-D donors. We investigated motivators, barriers, and predictors for anti-D donorship in RhD-immunized women. A mixed-methods design was applied, including focus group discussions and questionnaires. Two focus groups (including 11 women) served as input for the questionnaire. In total, 47.6% of 750 anti-D donors and potential donors completed the questionnaire (50.4% donors; 38% nondonors; 11.6% former donors). Almost 70% of the nondonors would have become donors if they had known about the possibility. Travel time investment was reported as a disadvantage; one-half of donors mentioned no disadvantages. Motivators for anti-D donorship were "doing something in return" (31.2%) and "preventing others having a sick child or losing a child" (33.9%). In multivariable analysis, living single (odds ratio, 5.8; p = 0.02) and living partnered without resident children (odds ratio, 7.9; p = 0.03), compared with living partnered with children, were predictors for anti-D donorship. Not being registered as an organ donor (odds ratio, 0.25; p anti-D donor. The main barrier for anti-D donorship was a lack of knowledge. Positive predictors of anti-D donorship were living without resident children, altruism, and being registered as an organ donor. A blood bank should develop targeted recruitment strategies with a focus on spreading knowledge about anti-D donorship among RhD-immunized women. © 2018 AABB.

  9. MicroRNA-mediated networks underlie immune response regulation in papillary thyroid carcinoma

    Science.gov (United States)

    Huang, Chen-Tsung; Oyang, Yen-Jen; Huang, Hsuan-Cheng; Juan, Hsueh-Fen

    2014-09-01

    Papillary thyroid carcinoma (PTC) is a common endocrine malignancy with low death rate but increased incidence and recurrence in recent years. MicroRNAs (miRNAs) are small non-coding RNAs with diverse regulatory capacities in eukaryotes and have been frequently implied in human cancer. Despite current progress, however, a panoramic overview concerning miRNA regulatory networks in PTC is still lacking. Here, we analyzed the expression datasets of PTC from The Cancer Genome Atlas (TCGA) Data Portal and demonstrate for the first time that immune responses are significantly enriched and under specific regulation in the direct miRNA-target network among distinctive PTC variants to different extents. Additionally, considering the unconventional properties of miRNAs, we explore the protein-coding competing endogenous RNA (ceRNA) and the modulatory networks in PTC and unexpectedly disclose concerted regulation of immune responses from these networks. Interestingly, miRNAs from these conventional and unconventional networks share general similarities and differences but tend to be disparate as regulatory activities increase, coordinately tuning the immune responses that in part account for PTC tumor biology. Together, our systematic results uncover the intensive regulation of immune responses underlain by miRNA-mediated networks in PTC, opening up new avenues in the management of thyroid cancer.

  10. Government regulation of business in a changing institutional barrier

    Directory of Open Access Journals (Sweden)

    Novikova I.

    2013-02-01

    Full Text Available The article examines the domestic experience in government regulation of business in a changing institutional barrier.Compared the degree of economic freedom in Ukraine. The emphasis is on the need to develop a national strategy of institutional development of domestic entrepreneurship.

  11. The Potential Role of circRNA in Tumor Immunity Regulation and Immunotherapy

    OpenAIRE

    Xu, Zihao; Li, Peiyao; Fan, Li; Wu, Minghua

    2018-01-01

    Non-coding RNAs (ncRNAs) can be divided into circular non-coding RNAs (circRNAs) and linear ncRNAs. ncRNAs exist in different cell types, including normal cells, tumor cells and immunocytes. Linear ncRNAs, such as long ncRNAs and microRNAs, have been found to play important roles in the regulation of tumor immunity and immunotherapy; however, the functions of circRNAs in tumor immunity and immunotherapy are less known. Here, we review the current status of ncRNAs in the regulation of tumor im...

  12. NLRC5: a key regulator of MHC class I-dependent immune responses.

    Science.gov (United States)

    Kobayashi, Koichi S; van den Elsen, Peter J

    2012-12-01

    The expression of MHC class I molecules is crucial for the initiation and regulation of adaptive immune responses against pathogens. NOD-, LRR- and CARD-containing 5 (NLRC5) was recently identified as a specific transactivator of MHC class I genes (CITA). NLRC5 and the master regulator for MHC class II genes, class II transactivator (CIITA), interact with similar MHC promoter-bound factors. Here, we provide a broad overview of the molecular mechanisms behind MHC class I transcription and the role of the class I transactivator NLRC5 in MHC class I-dependent immune responses.

  13. The cutaneous citadel: a holistic view of skin and immunity.

    Science.gov (United States)

    Spellberg, B

    2000-06-23

    Human skin has 4 major functions: endogenous homeostasis (e.g. regulation of body temperature and fluid balance), metabolism (e.g. Vitamin D synthesis), sensory input, and to serve as a barrier to external threats (e.g. infection, mechanical injury, ultraviolet light). It is the latter function which concerns this review, for the skin's remarkable success in protecting the human body from the outside world is a major component of our immune system. The eminent pathologist, Virchow, whose work in the mid 19th century revolutionized many aspects of medical understanding, viewed the skin as an effective but inanimate barrier (1). However, recent technologies have elucidated a highly complex, dynamic interplay between the skin and other members of the immune system.

  14. Sorting Tubules Regulate Blood-Brain Barrier Transcytosis

    Directory of Open Access Journals (Sweden)

    Roberto Villaseñor

    2017-12-01

    Full Text Available Transcytosis across the blood-brain barrier (BBB regulates key processes of the brain, but the intracellular sorting mechanisms that determine successful receptor-mediated transcytosis in brain endothelial cells (BECs remain unidentified. Here, we used Transferrin receptor-based Brain Shuttle constructs to investigate intracellular transport in BECs, and we uncovered a pathway for the regulation of receptor-mediated transcytosis. By combining live-cell imaging and mathematical modeling in vitro with super-resolution microscopy of the BBB, we show that intracellular tubules promote transcytosis across the BBB. A monovalent construct (sFab sorted for transcytosis was localized to intracellular tubules, whereas a bivalent construct (dFab sorted for degradation formed clusters with impaired transport along tubules. Manipulating tubule biogenesis by overexpressing the small GTPase Rab17 increased dFab transport into tubules and induced its transcytosis in BECs. We propose that sorting tubules regulate transcytosis in BECs and may be a general mechanism for receptor-mediated transport across the BBB.

  15. Molecular mechanisms of aging and immune system regulation in Drosophila.

    Science.gov (United States)

    Eleftherianos, Ioannis; Castillo, Julio Cesar

    2012-01-01

    Aging is a complex process that involves the accumulation of deleterious changes resulting in overall decline in several vital functions, leading to the progressive deterioration in physiological condition of the organism and eventually causing disease and death. The immune system is the most important host-defense mechanism in humans and is also highly conserved in insects. Extensive research in vertebrates has concluded that aging of the immune function results in increased susceptibility to infectious disease and chronic inflammation. Over the years, interest has grown in studying the molecular interaction between aging and the immune response to pathogenic infections. The fruit fly Drosophila melanogaster is an excellent model system for dissecting the genetic and genomic basis of important biological processes, such as aging and the innate immune system, and deciphering parallel mechanisms in vertebrate animals. Here, we review the recent advances in the identification of key players modulating the relationship between molecular aging networks and immune signal transduction pathways in the fly. Understanding the details of the molecular events involved in aging and immune system regulation will potentially lead to the development of strategies for decreasing the impact of age-related diseases, thus improving human health and life span.

  16. Regulation of immune responses and tolerance: the microRNA perspective

    Science.gov (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

    2013-01-01

    Summary Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/ or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. PMID:23550642

  17. Regulation of immune responses and tolerance: the microRNA perspective.

    Science.gov (United States)

    Chen, Chang-Zheng; Schaffert, Steven; Fragoso, Rita; Loh, Christina

    2013-05-01

    Much has been learned about the molecular and cellular components critical for the control of immune responses and tolerance. It remains a challenge, however, to control the immune response and tolerance at the system level without causing significant toxicity to normal tissues. Recent studies suggest that microRNA (miRNA) genes, an abundant class of non-coding RNA genes that produce characteristic approximately 22 nucleotides small RNAs, play important roles in immune cells. In this article, we discuss emerging knowledge regarding the functions of miRNA genes in the immune system. We delve into the roles of miRNAs in regulating signaling strength and threshold, homeostasis, and the dynamics of the immune response and tolerance during normal and pathogenic immunological conditions. We also present observations based on analyzes of miR-181 family genes that indicate the potential functions of primary and/or precursor miRNAs in target recognition and explore the impact of these findings on target identification. Finally, we illustrate that despite the subtle effects of miRNAs on gene expression, miRNAs have the potential to influence the outcomes of normal and pathogenic immune responses by controlling the quantitative and dynamic aspects of immune responses. Tuning miRNA functions in immune cells, through gain- and loss-of-function approaches in mice, may reveal novel approach to restore immune equilibrium from pathogenic conditions, such as autoimmune disease and leukemia, without significant toxicity. © 2013 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  18. Mucosal Immune Regulation in Intestinal Disease. The role of bacterial products, food components and drugs

    NARCIS (Netherlands)

    Bol-Schoenmakers, M.

    2009-01-01

    The challenge of the mucosal gut associated immune system is to remain unresponsive to food products and commensal microbiota, while mounting an appropriate immune response towards pathogens. This implicates the necessity of tight immune regulation within the gut associated lymphoid tissue (GALT).

  19. [The role of gut microbiota in the regulation of the immune response].

    Science.gov (United States)

    Alarcón, Pedro; González, Margarita; Castro, Érica

    2016-07-01

    The gastrointestinal tract hosts around 10(14) bacterial microorganisms, in a constantly growing density from the stomach to the distal colon. This microbiota is composed by more than 500 species of bacteria, which are quickly acquired after birth, fairly stable during the host’s life, and essential for human homeostasis. These bacteria have important functions, such as stimulating the immune system, protecting the host from invading bacteria and viruses, and improving digestion, especially of complex carbohydrates. Also, the gut microbiota interacts directly with the immune system. However, the interaction of the intestinal epithelium and its microbiota with the immune system has yet to be fully understood. Secretory immunoglobulin A, produced by the plasma cells in Peyer’s patches and in the lamina propria, maintains non-invasive commensal bacteria and neutralize invasive pathogens. Dendritic cells migrate from the lamina propria of the secondary lymphoid organs to regulate gut immunity. They also have a key role maintaining luminal IgA and inducing the growth of regulatory T cells. Dendritic cells supervise the gut microenvironment too, keeping an immunological equilibrium and tolerance. The importance of the gut microbiota in regulating the immune system lies mostly in the homeostasis-or positive equilibrium. Thus, many diseases are a consequence of poor interactions or a loss of this equilibrium.

  20. NKp46 clusters at the immune synapse and regulates NK cell polarization

    Directory of Open Access Journals (Sweden)

    Uzi eHadad

    2015-09-01

    Full Text Available Natural killer cells play an important role in first-line defense against tumor and virus-infected cells. The activity of NK cells is tightly regulated by a repertoire of cell-surface expressed inhibitory and activating receptors. NKp46 is a major NK cell activating receptor that is involved in the elimination of target cells. NK cells form different types of synapses that result in distinct functional outcomes: cytotoxic, inhibitory, and regulatory. Recent studies revealed that complex integration of NK receptor signaling controls cytoskeletal rearrangement and other immune synapse-related events. However the distinct nature by which NKp46 participates in NK immunological synapse formation and function remains unknown. In this study we determined that NKp46 forms microclusters structures at the immune synapse between NK cells and target cells. Over-expression of human NKp46 is correlated with increased accumulation of F-actin mesh at the immune synapse. Concordantly, knock-down of NKp46 in primary human NK cells decreased recruitment of F-actin to the synapse. Live cell imaging experiments showed a linear correlation between NKp46 expression and lytic granules polarization to the immune synapse. Taken together, our data suggest that NKp46 signaling directly regulates the NK lytic immune synapse from early formation to late function.

  1. Neuroimmune interaction and the regulation of intestinal immune homeostasis.

    Science.gov (United States)

    Verheijden, Simon; Boeckxstaens, Guy E

    2018-01-01

    Many essential gastrointestinal functions, including motility, secretion, and blood flow, are regulated by the autonomic nervous system (ANS), both through intrinsic enteric neurons and extrinsic (sympathetic and parasympathetic) innervation. Recently identified neuroimmune mechanisms, in particular the interplay between enteric neurons and muscularis macrophages, are now considered to be essential for fine-tuning peristalsis. These findings shed new light on how intestinal immune cells can support enteric nervous function. In addition, both intrinsic and extrinsic neural mechanisms control intestinal immune homeostasis in different layers of the intestine, mainly by affecting macrophage activation through neurotransmitter release. In this mini-review, we discuss recent insights on immunomodulation by intrinsic enteric neurons and extrinsic innervation, with a particular focus on intestinal macrophages. In addition, we discuss the relevance of these novel mechanisms for intestinal immune homeostasis in physiological and pathological conditions, mainly focusing on motility disorders (gastroparesis and postoperative ileus) and inflammatory disorders (colitis).

  2. [Barriers and opportunities for the regulation of food and beverage advertising to children in Mexico].

    Science.gov (United States)

    Théodore, Florence; Juárez-Ramírez, Clara; Cahuana-Hurtado, Lucero; Blanco, Ilian; Tolentino-Mayo, Lizbeth; Bonvecchio, Anabelle

    2014-01-01

    To identify barriers and opportunities for the regulation of food and beverage advertising to children. A qualitative study. Fourteen key informants from the congress, private sector, officials from the ministry of health and academics involved in the issue of regulation of advertising were interviewed. Barriers identified: conception of obesity as an individual problem, minimization of the negative effects on health, definition of the vulnerability of children bounded to their cognitive development. Facilitators support from various sectors of society regulation, extensive scientific discussion on the subject, successful experience and its lessons on tabacco industry. Mexico has key elements for achieving effective regulation on advertising.

  3. Could tight junctions regulate the barrier function of the aged skin?

    Science.gov (United States)

    Svoboda, Marek; Bílková, Zuzana; Muthný, Tomáš

    2016-03-01

    The skin is known to be the largest organ in human organism creating interface with outer environment. The skin provides protective barrier against pathogens, physical and chemical insults, and against uncontrolled loss of water. The barrier function was primarily attributed to the stratum corneum (SC) but recent studies confirmed that epidermal tight junctions (TJs) also play important role in maintaining barrier properties of the skin. Independent observations indicate that barrier function and its recovery is impaired in aged skin. However, trans-epidermal water loss (TEWL) values remains rather unchanged in elderly population. UV radiation as major factor of photoageing impairs TJ proteins, but TJs have great self-regenerative potential. Since it may be possible that TJs can compensate TEWL in elderly due to its regenerative and compensatory capabilities, important question remains to be answered: how are TJs regulated during skin ageing? This review provides an insight into TJs functioning as epidermal barrier and summarizes current knowledge about the impact of ageing on the barrier function of the skin and epidermal TJs. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  4. Evasion of host immune defenses by human papillomavirus.

    Science.gov (United States)

    Westrich, Joseph A; Warren, Cody J; Pyeon, Dohun

    2017-03-02

    A majority of human papillomavirus (HPV) infections are asymptomatic and self-resolving in the absence of medical interventions. Various innate and adaptive immune responses, as well as physical barriers, have been implicated in controlling early HPV infections. However, if HPV overcomes these host immune defenses and establishes persistence in basal keratinocytes, it becomes very difficult for the host to eliminate the infection. The HPV oncoproteins E5, E6, and E7 are important in regulating host immune responses. These oncoproteins dysregulate gene expression, protein-protein interactions, posttranslational modifications, and cellular trafficking of critical host immune modulators. In addition to the HPV oncoproteins, sequence variation and dinucleotide depletion in papillomavirus genomes has been suggested as an alternative strategy for evasion of host immune defenses. Since anti-HPV host immune responses are also considered to be important for antitumor immunity, immune dysregulation by HPV during virus persistence may contribute to immune suppression essential for HPV-associated cancer progression. Here, we discuss cellular pathways dysregulated by HPV that allow the virus to evade various host immune defenses. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  5. Free Total Rhubarb Anthraquinones Protect Intestinal Injury via Regulation of the Intestinal Immune Response in a Rat Model of Severe Acute Pancreatitis

    Directory of Open Access Journals (Sweden)

    Yuxia Xiong

    2018-02-01

    Full Text Available Intestinal mucosal immune barrier dysfunction plays a key role in the pathogenesis of severe acute pancreatitis (SAP. Rhubarb is a commonly used traditional Chinese medicine as a laxative in China. It markedly protects pancreatic acinar cells from trypsin-induced injury in rats. Free total rhubarb anthraquinones (FTRAs isolated and extracted from rhubarb display the beneficial effects of antibacteria, anti-inflammation, antivirus, and anticancer. The principal aim of the present study was to investigate the effects of FTRAs on the protection of intestinal injury and modification of the intestinal barrier function through regulation of intestinal immune function in rats with SAP. We established a rat model of SAP by injecting 3.5% sodium taurocholate (STC, 350 mg/kg into the biliopancreatic duct via retrograde injection and treated the rats with FTRAs (36 or 72 mg/kg or normal saline (control immediately and 12 h after STC injection. Then, we evaluated the protective effect of FTRAs on intestinal injury by pathological analysis and determined the levels of endotoxin (ET, interleukin 1β (IL-1β, tumor necrosis factor α (TNF-α, nitric oxide (NO, myeloperoxidase (MPO, capillary permeability, nucleotide-binding oligomerization domain-like receptors 3 (NLRP3, apoptosis-associated speck-like protein containing a CARD domain (ASC, casepase-1, secretary immunoglobulin A (SIgA, regulatory T cells (Tregs, and the ratio of Th1/Th2 in the blood and/or small intestinal tissues or mesenteric lymph node (MLN cells. Moreover, the chemical profile of FTRAs was analyzed by HPLC-UV chromatogram. The results showed that FTRAs significantly protected intestinal damage and decreased the levels of ET, IL-1β, TNF-α, and NO in the blood and TNF-α, IL-1β, and protein extravasation in the intestinal tissues in SAP rats. Furthermore, FTRAs significantly decreased the expressions of NLRP3, ASC, and caspase-1, the number of Tregs and the ratio of Th1/Th2, while

  6. CBL-interacting protein kinase 6 negatively regulates immune response to Pseudomonas syringae in Arabidopsis.

    Science.gov (United States)

    Sardar, Atish; Nandi, Ashis Kumar; Chattopadhyay, Debasis

    2017-06-15

    Cytosolic calcium ion (Ca2+) is an essential mediator of the plant innate immune response. Here, we report that a calcium-regulated protein kinase Calcineurin B-like protein (CBL)-interacting protein kinase 6 (CIPK6) functions as a negative regulator of immunity against the bacterial pathogen Pseudomonas syringae in Arabidopsis thaliana. Arabidopsis lines with compromised expression of CIPK6 exhibited enhanced disease resistance to the bacterial pathogen and to P. syringae harboring certain but not all avirulent effectors, while restoration of CIPK6 expression resulted in abolition of resistance. Plants overexpressing CIPK6 were more susceptible to P. syringae. Enhanced resistance in the absence of CIPK6 was accompanied by increased accumulation of salicylic acid and elevated expression of defense marker genes. Salicylic acid accumulation was essential for improved immunity in the absence of CIPK6. CIPK6 negatively regulated the oxidative burst associated with perception of pathogen-associated microbial patterns (PAMPs) and bacterial effectors. Accelerated and enhanced activation of the mitogen-activated protein kinase cascade in response to bacterial and fungal elicitors was observed in the absence of CIPK6. The results of this study suggested that CIPK6 negatively regulates effector-triggered and PAMP-triggered immunity in Arabidopsis. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  7. Immune Regulation by Self-Recognition

    DEFF Research Database (Denmark)

    Andersen, Mads Hald

    2015-01-01

    Circulating T cells that specifically target normal self-proteins expressed by regulatory immune cells were first described in patients with cancer, but can also be detected in healthy individuals. The adaptive immune system is distinguished for its ability to differentiate between self......-antigens and foreign antigens. Thus, it was remarkable to discover T cells that apparently lacked tolerance to important self-proteins, eg, IDO, PD-L1, and FoxP3, expressed in regulatory immune cells. The ability of self-reactive T cells to react to and eliminate regulatory immune cells can influence general immune...... reactions. This suggests that they may be involved in immune homeostasis. It is here proposed that these T cells should be termed antiregulatory T cells (anti-Tregs). The role of anti-Tregs in immune-regulatory networks may be diverse. For example, pro-inflammatory self-reactive T cells that react...

  8. Specific inulin-type fructan fibers protect against autoimmune diabetes by modulating gut immunity, barrier function, and microbiota homeostasis.

    Science.gov (United States)

    Chen, Kang; Chen, Hao; Faas, Marijke M; de Haan, Bart J; Li, Jiahong; Xiao, Ping; Zhang, Hao; Diana, Julien; de Vos, Paul; Sun, Jia

    2017-08-01

    Dietary fibers capable of modifying gut barrier and microbiota homeostasis affect the progression of type 1 diabetes (T1D). Here, we aim to compare modulatory effects of inulin-type fructans (ITFs), natural soluble dietary fibers with different degrees of fermentability from chicory root, on T1D development in nonobese diabetic mice. Female nonobese diabetic mice were weaned to long- and short-chain ITFs [ITF(l) and ITF(s), 5%] supplemented diet up to 24 weeks. T1D incidence, pancreatic-gut immune responses, gut barrier function, and microbiota composition were analyzed. ITF(l) but not ITF(s) supplementation dampened the incidence of T1D. ITF(l) promoted modulatory T-cell responses, as evidenced by increased CD25 + Foxp3 + CD4 + regulatory T cells, decreased IL17A + CD4 + Th17 cells, and modulated cytokine production profile in the pancreas, spleen, and colon. Furthermore, ITF(l) suppressed NOD like receptor protein 3 caspase-1-p20-IL-1β inflammasome in the colon. Expression of barrier reinforcing tight junction proteins occludin and claudin-2, antimicrobial peptides β-defensin-1, and cathelicidin-related antimicrobial peptide as well as short-chain fatty acid production were enhanced by ITF(l). Next-generation sequencing analysis revealed that ITF(l) enhanced Firmicutes/Bacteroidetes ratio to an antidiabetogenic balance and enriched modulatory Ruminococcaceae and Lactobacilli. Our data demonstrate that ITF(l) but not ITF(s) delays the development of T1D via modulation of gut-pancreatic immunity, barrier function, and microbiota homeostasis. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Cystatin F as a regulator of immune cell cytotoxicity.

    Science.gov (United States)

    Kos, Janko; Nanut, Milica Perišić; Prunk, Mateja; Sabotič, Jerica; Dautović, Esmeralda; Jewett, Anahid

    2018-05-10

    Cysteine cathepsins are lysosomal peptidases involved in the regulation of innate and adaptive immune responses. Among the diverse processes, regulation of granule-dependent cytotoxicity of cytotoxic T-lymphocytes (CTLs) and natural killer (NK) cells during cancer progression has recently gained significant attention. The function of cysteine cathepsins is regulated by endogenous cysteine protease inhibitors-cystatins. Whereas other cystatins are generally cytosolic or extracellular proteins, cystatin F is present in endosomes and lysosomes and is thus able to regulate the activity of its target directly. It is delivered to endosomal/lysosomal vesicles as an inactive, disulphide-linked dimer. Proteolytic cleavage of its N-terminal part leads to the monomer, the only form that is a potent inhibitor of cathepsins C, H and L, involved in the activation of granzymes and perforin. In NK cells and CTLs the levels of active cathepsin C and of granzyme B are dependent on the concentration of monomeric, active cystatin F. In tumour microenvironment, inactive dimeric cystatin F can be secreted from tumour cells or immune cells and further taken up by the cytotoxic cells. Subsequent monomerization and inhibition of cysteine cathepsins within the endosomal/lysosomal vesicles impairs granzyme and perforin activation, and provokes cell anergy. Further, the glycosylation pattern has been shown to be important in controlling secretion of cystatin F from target cells, as well as internalization by cytotoxic cells and trafficking to endosomal/lysosomal vesicles. Cystatin F is therefore an important mediator used by bystander cells to reduce NK and T-cell cytotoxicity.

  10. Adopted orphans as regulators of inflammation, immunity and skeletal homeostasis.

    Science.gov (United States)

    Ipseiz, Natacha; Scholtysek, Carina; Culemann, Stephan; Krönke, Gerhard

    2014-01-01

    Adopted orphan nuclear receptors, such as peroxisome proliferator-activated receptors (PPARs) and liver X receptors (LXRs), have emerged as key regulators of inflammation and immunity and likewise control skeletal homeostasis. These properties render them attractive targets for the therapy of various inflammatory and autoimmune diseases affecting the musculoskeletal system. This review summarises the current knowledge on the role of these families of receptors during innate and adaptive immunity as well as during the control of bone turnover and discuss the potential use of targeting these molecules during the treatment of chronic diseases such as osteoarthritis, rheumatoid arthritis and osteoporosis.

  11. Cholinergic Modulation of Type 2 Immune Responses

    Directory of Open Access Journals (Sweden)

    Goele Bosmans

    2017-12-01

    Full Text Available In recent years, the bidirectional relationship between the nervous and immune system has become increasingly clear, and its role in both homeostasis and inflammation has been well documented over the years. Since the introduction of the cholinergic anti-inflammatory pathway, there has been an increased interest in parasympathetic regulation of both innate and adaptive immune responses, including T helper 2 responses. Increasing evidence has been emerging suggesting a role for the parasympathetic nervous system in the pathophysiology of allergic diseases, including allergic rhinitis, asthma, food allergy, and atopic dermatitis. In this review, we will highlight the role of cholinergic modulation by both nicotinic and muscarinic receptors in several key aspects of the allergic inflammatory response, including barrier function, innate and adaptive immune responses, and effector cells responses. A better understanding of these cholinergic processes mediating key aspects of type 2 immune disorders might lead to novel therapeutic approaches to treat allergic diseases.

  12. Skin barrier homeostasis in atopic dermatitis: feedback regulation of kallikrein activity.

    Directory of Open Access Journals (Sweden)

    Reiko J Tanaka

    Full Text Available Atopic dermatitis (AD is a widely spread cutaneous chronic disease characterised by sensitive reactions (eg. eczema to normally innocuous elements. Although relatively little is understood about its underlying mechanisms due to its complexity, skin barrier dysfunction has been recognised as a key factor in the development of AD. Skin barrier homeostasis requires tight control of the activity of proteases, called kallikreins (KLKs, whose activity is regulated by a complex network of protein interactions that remains poorly understood despite its pathological importance. Characteristic symptoms of AD include the outbreak of inflammation triggered by external (eg. mechanical and chemical stimulus and the persistence and aggravation of inflammation even if the initial stimulus disappears. These characteristic symptoms, together with some experimental data, suggest the presence of positive feedback regulation for KLK activity by inflammatory signals. We developed simple mathematical models for the KLK activation system to study the effects of feedback loops and carried out bifurcation analysis to investigate the model behaviours corresponding to inflammation caused by external stimulus. The model analysis confirmed that the hypothesised core model mechanisms capture the essence of inflammation outbreak by a defective skin barrier. Our models predicted the outbreaks of inflammation at weaker stimulus and its longer persistence in AD patients compared to healthy control. We also proposed a novel quantitative indicator for inflammation level by applying principal component analysis to microarray data. The model analysis reproduced qualitative AD characteristics revealed by this indicator. Our results strongly implicate the presence and importance of feedback mechanisms in KLK activity regulation. We further proposed future experiments that may provide informative data to enhance the system-level understanding on the regulatory mechanisms of skin barrier

  13. Pretreatment antigen-specific immunity and regulation - association with subsequent immune response to anti-tumor DNA vaccination.

    Science.gov (United States)

    Johnson, Laura E; Olson, Brian M; McNeel, Douglas G

    2017-07-18

    Immunotherapies have demonstrated clinical benefit for many types of cancers, however many patients do not respond, and treatment-related adverse effects can be severe. Hence many efforts are underway to identify treatment predictive biomarkers. We have reported the results of two phase I trials using a DNA vaccine encoding prostatic acid phosphatase (PAP) in patients with biochemically recurrent prostate cancer. In both trials, persistent PAP-specific Th1 immunity developed in some patients, and this was associated with favorable changes in serum PSA kinetics. In the current study, we sought to determine if measures of antigen-specific or antigen non-specific immunity were present prior to treatment, and associated with subsequent immune response, to identify possible predictive immune biomarkers. Patients who developed persistent PAP-specific, IFNγ-secreting immune responses were defined as immune "responders." The frequency of peripheral T cell and B cell lymphocytes, natural killer cells, monocytes, dendritic cells, myeloid derived suppressor cells, and regulatory T cells were assessed by flow cytometry and clinical laboratory values. PAP-specific immune responses were evaluated by cytokine secretion in vitro, and by antigen-specific suppression of delayed-type hypersensitivity to a recall antigen in an in vivo SCID mouse model. The frequency of peripheral blood cell types did not differ between the immune responder and non-responder groups. Non-responder patients tended to have higher PAP-specific IL-10 production pre-vaccination (p = 0.09). Responder patients had greater preexisting PAP-specific bystander regulatory responses that suppressed DTH to a recall antigen (p = 0.016). While our study population was small (n = 38), these results suggest that different measures of antigen-specific tolerance or regulation might help predict immunological outcome from DNA vaccination. These will be prospectively evaluated in an ongoing randomized, phase II trial.

  14. Drosophila as a Model for Human Diseases-Focus on Innate Immunity in Barrier Epithelia.

    Science.gov (United States)

    Bergman, P; Seyedoleslami Esfahani, S; Engström, Y

    2017-01-01

    Epithelial immunity protects the host from harmful microbial invaders but also controls the beneficial microbiota on epithelial surfaces. When this delicate balance between pathogen and symbiont is disturbed, clinical disease often occurs, such as in inflammatory bowel disease, cystic fibrosis, or atopic dermatitis, which all can be in part linked to impairment of barrier epithelia. Many innate immune receptors, signaling pathways, and effector molecules are evolutionarily conserved between human and Drosophila. This review describes the current knowledge on Drosophila as a model for human diseases, with a special focus on innate immune-related disorders of the gut, lung, and skin. The discovery of antimicrobial peptides, the crucial role of Toll and Toll-like receptors, and the evolutionary conservation of signaling to the immune systems of both human and Drosophila are described in a historical perspective. Similarities and differences between human and Drosophila are discussed; current knowledge on receptors, signaling pathways, and effectors are reviewed, including antimicrobial peptides, reactive oxygen species, as well as autophagy. We also give examples of human diseases for which Drosophila appears to be a useful model. In addition, the limitations of the Drosophila model are mentioned. Finally, we propose areas for future research, which include using the Drosophila model for drug screening, as a validation tool for novel genetic mutations in humans and for exploratory research of microbiota-host interactions, with relevance for infection, wound healing, and cancer. © 2017 Elsevier Inc. All rights reserved.

  15. MicroRNAs (MiRs) Precisely Regulate Immune System Development and Function in Immunosenescence Process.

    Science.gov (United States)

    Aalaei-Andabili, Seyed Hossein; Rezaei, Nima

    2016-01-01

    Human aging is a complex process with pivotal changes in gene expression of biological pathways. Immune system dysfunction has been recognized as one of the most important abnormalities induced by senescent names immunosenescence. Emerging evidences suggest miR role in immunosenescence. We aimed to systemically review all relevant reports to clearly state miR effects on immunosenescence process. Sensitive electronic searches carried out. Quality assessment has been performed. Since majority of the included studies were laboratory works, and therefore heterogen, we discussed miR effects on immunological aging process nonstatically. Forty-six articles were found in the initial search. After exclusion of 34 articles, 12 studies enrolled to the final stage. We found that miRs have crucial roles in exact function of immune system. MiRs are involved in the regulation of the aging process in the immune system components and target certain genes, promoting or inhibiting immune system reaction to invasion. Also, miRs control life span of the immune system members by regulation of the genes involved in the apoptosis. Interestingly, we found that immunosenescence is controllable by proper manipulation of the various miRs expression. DNA methylation and histone acetylation have been discovered as novel strategies, altering NF-κB binding ability to the miR promoter sites. Effect of miRs on impairment of immune system function due to the aging is emerging. Although it has been accepted that miRs have determinant roles in the regulation of the immunosenescence; however, most of the reports are concluded from animal/laboratory works, suggesting the necessity of more investigations in human.

  16. Chemokine-mediated immune responses in the female genital tract mucosa.

    Science.gov (United States)

    Deruaz, Maud; Luster, Andrew D

    2015-04-01

    The genital tract mucosa is the site where sexually transmitted infections gain entry to the host. The immune response at this site is thus critical to provide innate protection against pathogens that are seen for the very first time as well as provide long-term pathogen-specific immunity, which would be required for an effective vaccine against sexually transmitted infection. A finely regulated immune response is therefore required to provide an effective barrier against pathogens without compromising the capacity of the genital tract to allow for successful conception and fetal development. We review recent developments in our understanding of the immune response in the female genital tract to infectious pathogens, using herpes simplex virus-2, human immunodeficiency virus-1 and Chlamydia trachomatis as examples, with a particular focus on the role of chemokines in orchestrating immune cell migration necessary to achieve effective innate and adaptive immune responses in the female genital tract.

  17. Abl family kinases regulate endothelial barrier function in vitro and in mice.

    Directory of Open Access Journals (Sweden)

    Elizabeth M Chislock

    Full Text Available The maintenance of endothelial barrier function is essential for normal physiology, and increased vascular permeability is a feature of a wide variety of pathological conditions, leading to complications including edema and tissue damage. Use of the pharmacological inhibitor imatinib, which targets the Abl family of non-receptor tyrosine kinases (Abl and Arg, as well as other tyrosine kinases including the platelet-derived growth factor receptor (PDGFR, Kit, colony stimulating factor 1 receptor (CSF1R, and discoidin domain receptors, has shown protective effects in animal models of inflammation, sepsis, and other pathologies characterized by enhanced vascular permeability. However, the imatinib targets involved in modulation of vascular permeability have not been well-characterized, as imatinib inhibits multiple tyrosine kinases not only in endothelial cells and pericytes but also immune cells important for disorders associated with pathological inflammation and abnormal vascular permeability. In this work we employ endothelial Abl knockout mice to show for the first time a direct role for Abl in the regulation of vascular permeability in vivo. Using both Abl/Arg-specific pharmacological inhibition and endothelial Abl knockout mice, we demonstrate a requirement for Abl kinase activity in the induction of endothelial permeability by vascular endothelial growth factor both in vitro and in vivo. Notably, Abl kinase inhibition also impaired endothelial permeability in response to the inflammatory mediators thrombin and histamine. Mechanistically, we show that loss of Abl kinase activity was accompanied by activation of the barrier-stabilizing GTPases Rac1 and Rap1, as well as inhibition of agonist-induced Ca(2+ mobilization and generation of acto-myosin contractility. In all, these findings suggest that pharmacological targeting of the Abl kinases may be capable of inhibiting endothelial permeability induced by a broad range of agonists and that use

  18. Forkhead, a new cross regulator of metabolism and innate immunity downstream of TOR in Drosophila.

    Science.gov (United States)

    Varma, Disha; Bülow, Margret H; Pesch, Yanina-Yasmin; Loch, Gerrit; Hoch, Michael

    2014-10-01

    Antimicrobial peptides (AMPs) are conserved cationic peptides which act both as defense molecules of the host immune system and as regulators of the commensal microbiome. Expression of AMPs is induced in response to infection by the Toll and Imd pathway. Under non-infected conditions, the transcription factor dFOXO directly regulates a set of AMP expression at low levels when nutrients are limited. Here we have analyzed whether target of rapamycin (TOR), another major regulator of growth and metabolism, also modulates AMP responses in Drosophila. We found that downregulation of TOR by feeding the drug rapamycin or by overexpressing the negative TOR regulators TSC1/TSC2, resulted in a specific induction of the AMPs Diptericin (Dpt) and Metchnikowin (Mtk). In contrast, overexpression of Rheb, which positively regulates TOR led to a repression of the two AMPs. Genetic and pharmacological experiments indicate that Dpt and Mtk activation is controlled by the transcription factor Forkhead (FKH), the founding member of the FoxO family. Shuttling of FKH from the cytoplasm to the nucleus is induced in the fat body and in the posterior midgut in response to TOR downregulation. The FKH-dependent induction of Dpt and Mtk can be triggered in dFOXO null mutants and in immune-compromised Toll and IMD pathway mutants indicating that FKH acts in parallel to these regulators. Together, we have discovered that FKH is the second conserved member of the FoxO family cross-regulating metabolism and innate immunity. dFOXO and FKH, which are activated upon downregulation of insulin or TOR activities, respectively, act in parallel to induce different sets of AMPs, thereby modulating the immune status of metabolic tissues such as the fat body or the gut in response to the oscillating energy status of the organism. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Immune Evasion, Immunopathology and the Regulation of the Immune System

    Directory of Open Access Journals (Sweden)

    Bruno Faivre

    2013-02-01

    Full Text Available Costs and benefits of the immune response have attracted considerable attention in the last years among evolutionary biologists. Given the cost of parasitism, natural selection should favor individuals with the most effective immune defenses. Nevertheless, there exists huge variation in the expression of immune effectors among individuals. To explain this apparent paradox, it has been suggested that an over-reactive immune system might be too costly, both in terms of metabolic resources and risks of immune-mediated diseases, setting a limit to the investment into immune defenses. Here, we argue that this view neglects one important aspect of the interaction: the role played by evolving pathogens. We suggest that taking into account the co-evolutionary interactions between the host immune system and the parasitic strategies to overcome the immune response might provide a better picture of the selective pressures that shape the evolution of immune functioning. Integrating parasitic strategies of host exploitation can also contribute to understand the seemingly contradictory results that infection can enhance, but also protect from, autoimmune diseases. In the last decades, the incidence of autoimmune disorders has dramatically increased in wealthy countries of the northern hemisphere with a concomitant decrease of most parasitic infections. Experimental work on model organisms has shown that this pattern may be due to the protective role of certain parasites (i.e., helminths that rely on the immunosuppression of hosts for their persistence. Interestingly, although parasite-induced immunosuppression can protect against autoimmunity, it can obviously favor the spread of other infections. Therefore, we need to think about the evolution of the immune system using a multidimensional trade-off involving immunoprotection, immunopathology and the parasitic strategies to escape the immune response.

  20. Innate Immune Cytokines, Fibroblast Phenotypes, and Regulation of Extracellular Matrix in Lung.

    Science.gov (United States)

    Richards, Carl D

    2017-02-01

    Chronic inflammation can be caused by adaptive immune responses in autoimmune and allergic conditions, driven by a T lymphocyte subset balance (TH1, TH2, Th17, Th22, and/or Treg) and skewed cellular profiles in an antigen-specific manner. However, several chronic inflammatory diseases have no clearly defined adaptive immune mechanisms that drive chronicity. These conditions include those that affect the lung such as nonatopic asthma or idiopathic pulmonary fibrosis comprising significant health problems. The remodeling of extracellular matrix (ECM) causes organ dysfunction, and it is largely generated by fibroblasts as the major cell controlling net ECM. As such, these are potential targets of treatment approaches in the context of ECM pathology. Fibroblast phenotypes contribute to ECM and inflammatory cell accumulation, and they are integrated into chronic disease mechanisms including cancer. Evidence suggests that innate cytokine responses may be critical in nonallergic/nonautoimmune disease, and they enable environmental agent exposure mechanisms that are independent of adaptive immunity. Innate immune cytokines derived from macrophage subsets (M1/M2) and innate lymphoid cell (ILC) subsets can directly regulate fibroblast function. We also suggest that STAT3-activating gp130 cytokines can sensitize fibroblasts to the innate cytokine milieu to drive phenotypes and exacerbate existing adaptive responses. Here, we review evidence exploring innate cytokine regulation of fibroblast behavior.

  1. Immunological regulation of metabolism--a novel quintessential role for the immune system in health and disease.

    Science.gov (United States)

    Schaefer, Jeremy S; Klein, John R

    2011-01-01

    The hypothalamus-pituitary-thyroid (HPT) axis is an integrated hormone network that is essential for maintaining metabolic homeostasis. It has long been known that thyroid stimulating hormone (TSH), a central component of the HPT axis, can be made by cells of the immune system; however, the role of immune system TSH remains enigmatic and most studies have viewed it as a cytokine used to regulate immune function. Recent studies now indicate that immune system-derived TSH, in particular, a splice variant of TSHβ that is preferentially made by cells of the immune system, is produced by a subset of hematopoietic cells that traffic to the thyroid. On the basis of these and other findings, we propose the novel hypothesis that the immune system is an active participant in the regulation of basal metabolism. We further speculate that this process plays a critical role during acute and chronic infections and that it contributes to a wide range of chronic inflammatory conditions with links to thyroid dysregulation. This hypothesis, which is amenable to empirical analysis, defines a previously unknown role for the immune system in health and disease, and it provides a dynamic connection between immune-endocrine interactions at the organismic level.

  2. Studying brain-regulation of immunity with optogenetics and chemogenetics; A new experimental platform.

    Science.gov (United States)

    Ben-Shaanan, Tamar; Schiller, Maya; Rolls, Asya

    2017-10-01

    The interactions between the brain and the immune system are bidirectional. Nevertheless, we have far greater understanding of how the immune system affects the brain than how the brain affects immunity. New technological developments such as optogenetics and chemogenetics (using DREADDs; Designer Receptors Exclusively Activated by Designer Drugs) can bridge this gap in our understanding, as they enable an unprecedented mechanistic and systemic analysis of the communication between the brain and the immune system. In this review, we discuss new experimental approaches for revealing neuronal circuits that can participate in regulation of immunity. In addition, we discuss methods, specifically optogenetics and chemogenetics, that enable targeted neuronal manipulation to reveal how different brain regions affect immunity. We describe how these techniques can be used as an experimental platform to address fundamental questions in psychoneuroimmunology and to understand how neuronal circuits associate with different psychological states can affect physiology. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Endogenous ligands for C-type lectin receptors: the true regulators of immune homeostasis.

    Science.gov (United States)

    García-Vallejo, Juan J; van Kooyk, Yvette

    2009-07-01

    C-type lectin receptors (CLRs) have long been known as pattern-recognition receptors implicated in the recognition of pathogens by the innate immune system. However, evidence is accumulating that many CLRs are also able to recognize endogenous 'self' ligands and that this recognition event often plays an important role in immune homeostasis. In the present review, we focus on the human and mouse CLRs for which endogenous ligands have been described. Special attention is given to the signaling events initiated upon recognition of the self ligand and the regulation of glycosylation as a switch modulating CLR recognition, and therefore, immune homeostasis.

  4. The kinase TBK1 functions in dendritic cells to regulate T cell homeostasis, autoimmunity, and antitumor immunity.

    Science.gov (United States)

    Xiao, Yichuan; Zou, Qiang; Xie, Xiaoping; Liu, Ting; Li, Haiyan S; Jie, Zuliang; Jin, Jin; Hu, Hongbo; Manyam, Ganiraju; Zhang, Li; Cheng, Xuhong; Wang, Hui; Marie, Isabelle; Levy, David E; Watowich, Stephanie S; Sun, Shao-Cong

    2017-05-01

    Dendritic cells (DCs) are crucial for mediating immune responses but, when deregulated, also contribute to immunological disorders, such as autoimmunity. The molecular mechanism underlying the function of DCs is incompletely understood. In this study, we have identified TANK-binding kinase 1 (TBK1), a master innate immune kinase, as an important regulator of DC function. DC-specific deletion of Tbk1 causes T cell activation and autoimmune symptoms and also enhances antitumor immunity in animal models of cancer immunotherapy. The TBK1-deficient DCs have up-regulated expression of co-stimulatory molecules and increased T cell-priming activity. We further demonstrate that TBK1 negatively regulates the induction of a subset of genes by type I interferon receptor (IFNAR). Deletion of IFNAR1 could largely prevent aberrant T cell activation and autoimmunity in DC-conditional Tbk1 knockout mice. These findings identify a DC-specific function of TBK1 in the maintenance of immune homeostasis and tolerance. © 2017 Xiao et al.

  5. Vitamin B5 Reduces Bacterial Growth via Regulating Innate Immunity and Adaptive Immunity in Mice Infected with Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Wenting He

    2018-02-01

    Full Text Available The mechanisms by which vitamins regulate immunity and their effect as an adjuvant treatment for tuberculosis have gradually become very important research topics. Studies have found that vitamin B5 (VB5 can promote epithelial cells to express inflammatory cytokines. We aimed to examine the proinflammatory and antibacterial effect of VB5 in macrophages infected with Mycobacterium tuberculosis (MTB strain H37Rv and the therapeutic potential of VB5 in vivo with tuberculosis. We investigated the activation of inflammatory signal molecules (NF-κB, AKT, JNK, ERK, and p38, the expression of two primary inflammatory cytokines (tumor necrosis factor and interleukin-6 and the bacterial burdens in H37Rv-infected macrophages stimulated with VB5 to explore the effect of VB5 on the inflammatory and antibacterial responses of macrophages. We further treated the H37Rv-infected mice with VB5 to explore VB5’s promotion of the clearance of H37Rv in the lungs and the effect of VB5 on regulating the percentage of inflammatory cells. Our data showed that VB5 enhanced the phagocytosis and inflammatory response in macrophages infected with H37Rv. Oral administration of VB5 decreased the number of colony-forming units of H37Rv in lungs of mice at 1, 2, and 4 weeks after infection. In addition, VB5 regulated the percentage of macrophages and promoted CD4+ T cells to express interferon-γ and interleukin-17; however, it had no effect on the percentage of polymorphonuclear neutrophils, CD4+ and CD8+ T cells. In conclusion, VB5 significantly inhibits the growth of MTB by regulating innate immunity and adaptive immunity.

  6. Exercise protects from cancer through regulation of immune function and inflammation

    DEFF Research Database (Denmark)

    Hojman, Pernille

    2017-01-01

    Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection are...... regulation of immune and inflammatory functions, and exercise may be pursued as anticancer treatment through incorporation into standard oncological therapy to the benefit of the cancer patients.......Exercise training has been extensively studied in cancer settings as part of prevention or rehabilitation strategies, yet emerging evidence suggests that exercise training can also directly affect tumor-specific outcomes. The underlying mechanisms for this exercise-dependent cancer protection...... are just starting to be elucidated. To this end, evasion of immune surveillance and tumor-associated inflammation are established as hallmarks of cancer, and exercise may target cancer incidence and progression through regulation of these mechanisms. Here, I review the role of exercise in protection from...

  7. The immune-regulating effect of Xiao'er Qixingcha in constipated mice induced by high-heat and high-protein diet.

    Science.gov (United States)

    Qu, Chang; Yang, Guang-Hua; Zheng, Rong-Bo; Yu, Xiu-Ting; Peng, Shao-Zhong; Xie, Jian-Hui; Chen, Jian-Nan; Wang, Xiu-Fen; Su, Zi-Ren; Zhang, Xiao-Jun

    2017-03-31

    both models. EXQ exhibited prominent laxative activity and effectively protected the colonic mucosal barrier in two models of constipated mice, of which the mechanism might be closely associated with its propulsive and immune-regulating properties. The current results not only validated the rationale for the clinical application of EXQ in pediatric constipation related symptoms, but also threw new light on the immune-inflammatory responses accompanied with chronic constipation pathology.

  8. The skin microbiome: impact of modern environments on skin ecology, barrier integrity, and systemic immune programming.

    Science.gov (United States)

    Prescott, Susan L; Larcombe, Danica-Lea; Logan, Alan C; West, Christina; Burks, Wesley; Caraballo, Luis; Levin, Michael; Etten, Eddie Van; Horwitz, Pierre; Kozyrskyj, Anita; Campbell, Dianne E

    2017-01-01

    Skin barrier structure and function is essential to human health. Hitherto unrecognized functions of epidermal keratinocytes show that the skin plays an important role in adapting whole-body physiology to changing environments, including the capacity to produce a wide variety of hormones, neurotransmitters and cytokine that can potentially influence whole-body states, and quite possibly, even emotions. Skin microbiota play an integral role in the maturation and homeostatic regulation of keratinocytes and host immune networks with systemic implications. As our primary interface with the external environment, the biodiversity of skin habitats is heavily influenced by the biodiversity of the ecosystems in which we reside. Thus, factors which alter the establishment and health of the skin microbiome have the potential to predispose to not only cutaneous disease, but also other inflammatory non-communicable diseases (NCDs). Indeed, disturbances of the stratum corneum have been noted in allergic diseases (eczema and food allergy), psoriasis, rosacea, acne vulgaris and with the skin aging process. The built environment, global biodiversity losses and declining nature relatedness are contributing to erosion of diversity at a micro-ecological level, including our own microbial habitats. This emphasises the importance of ecological perspectives in overcoming the factors that drive dysbiosis and the risk of inflammatory diseases across the life course.

  9. Metabolite-Sensing G Protein-Coupled Receptors-Facilitators of Diet-Related Immune Regulation.

    Science.gov (United States)

    Tan, Jian K; McKenzie, Craig; Mariño, Eliana; Macia, Laurence; Mackay, Charles R

    2017-04-26

    Nutrition and the gut microbiome regulate many systems, including the immune, metabolic, and nervous systems. We propose that the host responds to deficiency (or sufficiency) of dietary and bacterial metabolites in a dynamic way, to optimize responses and survival. A family of G protein-coupled receptors (GPCRs) termed the metabolite-sensing GPCRs bind to various metabolites and transmit signals that are important for proper immune and metabolic functions. Members of this family include GPR43, GPR41, GPR109A, GPR120, GPR40, GPR84, GPR35, and GPR91. In addition, bile acid receptors such as GPR131 (TGR5) and proton-sensing receptors such as GPR65 show similar features. A consistent feature of this family of GPCRs is that they provide anti-inflammatory signals; many also regulate metabolism and gut homeostasis. These receptors represent one of the main mechanisms whereby the gut microbiome affects vertebrate physiology, and they also provide a link between the immune and metabolic systems. Insufficient signaling through one or more of these metabolite-sensing GPCRs likely contributes to human diseases such as asthma, food allergies, type 1 and type 2 diabetes, hepatic steatosis, cardiovascular disease, and inflammatory bowel diseases.

  10. Bacteria in the vaginal microbiome alter the innate immune response and barrier properties of the human vaginal epithelia in a species-specific manner.

    Science.gov (United States)

    Doerflinger, Sylvie Y; Throop, Andrea L; Herbst-Kralovetz, Melissa M

    2014-06-15

    Bacterial vaginosis increases the susceptibility to sexually transmitted infections and negatively affects women's reproductive health. To investigate host-vaginal microbiota interactions and the impact on immune barrier function, we colonized 3-dimensional (3-D) human vaginal epithelial cells with 2 predominant species of vaginal microbiota (Lactobacillus iners and Lactobacillus crispatus) or 2 prevalent bacteria associated with bacterial vaginosis (Atopobium vaginae and Prevotella bivia). Colonization of 3-D vaginal epithelial cell aggregates with vaginal microbiota was observed with direct attachment to host cell surface with no cytotoxicity. A. vaginae infection yielded increased expression membrane-associated mucins and evoked a robust proinflammatory, immune response in 3-D vaginal epithelial cells (ie, expression of CCL20, hBD-2, interleukin 1β, interleukin 6, interleukin 8, and tumor necrosis factor α) that can negatively affect barrier function. However, P. bivia and L. crispatus did not significantly upregulate pattern-recognition receptor-signaling, mucin expression, antimicrobial peptides/defensins, or proinflammatory cytokines in 3-D vaginal epithelial cell aggregates. Notably, L. iners induced pattern-recognition receptor-signaling activity, but no change was observed in mucin expression or secretion of interleukin 6 and interleukin 8. We identified unique species-specific immune signatures from vaginal epithelial cells elicited by colonization with commensal and bacterial vaginosis-associated bacteria. A. vaginae elicited a signature that is consistent with significant disruption of immune barrier properties, potentially resulting in enhanced susceptibility to sexually transmitted infections during bacterial vaginosis. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. Interactions between host metabolism, immune regulation, and the gut microbiota in diet-associated obesity and metabolic dysfunction

    DEFF Research Database (Denmark)

    Andersen, Daniel

    The increase in the prevalence of obesity and obesity-associated complications such as the metabolic syndrome is becoming a global challenge. Dietary habits and nutrient consumption modulates host homeostasis, which manifests in various diet-induced complications marked by changes in host...... metabolism and immune regulation, which are intricately linked. In addition, diet effectively shapes the gut microbiota composition and activity, which in turn interacts with the host to modulate host metabolism and immune regulation. In the three studies included in this PhD thesis, we have explored...... the impact of specific dietary components on host metabolic function, immune regulation and gut microbiota composition and activity. In the first study, we have characterized the effect of a combined high-fat and gliadin-rich diet, since dietary gliadin has been reported to be associated with intestinal...

  12. Dynamic Fungal Cell Wall Architecture in Stress Adaptation and Immune Evasion.

    Science.gov (United States)

    Hopke, Alex; Brown, Alistair J P; Hall, Rebecca A; Wheeler, Robert T

    2018-04-01

    Deadly infections from opportunistic fungi have risen in frequency, largely because of the at-risk immunocompromised population created by advances in modern medicine and the HIV/AIDS pandemic. This review focuses on dynamics of the fungal polysaccharide cell wall, which plays an outsized role in fungal pathogenesis and therapy because it acts as both an environmental barrier and as the major interface with the host immune system. Human fungal pathogens use architectural strategies to mask epitopes from the host and prevent immune surveillance, and recent work elucidates how biotic and abiotic stresses present during infection can either block or enhance masking. The signaling components implicated in regulating fungal immune recognition can teach us how cell wall dynamics are controlled, and represent potential targets for interventions designed to boost or dampen immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Transcriptome analysis of the ependymal barrier during murine neurocysticercosis

    Directory of Open Access Journals (Sweden)

    Mishra Pramod

    2012-06-01

    Full Text Available Abstract Background Central nervous system (CNS barriers play a pivotal role in the protection and homeostasis of the CNS by enabling the exchange of metabolites while restricting the entry of xenobiotics, blood cells and blood-borne macromolecules. While the blood–brain barrier and blood-cerebrospinal fluid barrier (CSF control the interface between the blood and CNS, the ependyma acts as a barrier between the CSF and parenchyma, and regulates hydrocephalic pressure and metabolic toxicity. Neurocysticercosis (NCC is an infection of the CNS caused by the metacestode (larva of Taenia solium and a major cause of acquired epilepsy worldwide. The common clinical manifestations of NCC are seizures, hydrocephalus and symptoms due to increased intracranial pressure. The majority of the associated pathogenesis is attributed to the immune response against the parasite. The properties of the CNS barriers, including the ependyma, are affected during infection, resulting in disrupted homeostasis and infiltration of leukocytes, which correlates with the pathology and disease symptoms of NCC patients. Results In order to characterize the role of the ependymal barrier in the immunopathogenesis of NCC, we isolated ependymal cells using laser capture microdissection from mice infected or mock-infected with the closely related parasite Mesocestoides corti, and analyzed the genes that were differentially expressed using microarray analysis. The expression of 382 genes was altered. Immune response-related genes were verified by real-time RT-PCR. Ingenuity Pathway Analysis (IPA software was used to analyze the biological significance of the differentially expressed genes, and revealed that genes known to participate in innate immune responses, antigen presentation and leukocyte infiltration were affected along with the genes involved in carbohydrate, lipid and small molecule biochemistry. Further, MHC class II molecules and chemokines, including CCL12, were found

  14. Skin innate immune system

    Directory of Open Access Journals (Sweden)

    Berna Aksoy

    2013-06-01

    Full Text Available All multicellular organisms protect themselves from external universe and microorganisms by innate immune sytem that is constitutively present. Skin innate immune system has several different components composed of epithelial barriers, humoral factors and cellular part. In this review information about skin innate immune system and its components are presented to the reader. Innate immunity, which wasn’t adequately interested in previously, is proven to provide a powerfull early protection system, control many infections before the acquired immunity starts and directs acquired immunity to develop optimally

  15. Physiological, Pathological, and Therapeutic Implications of Zonulin-Mediated Intestinal Barrier Modulation

    Science.gov (United States)

    Fasano, Alessio

    2008-01-01

    The anatomical and functional arrangement of the gastrointestinal tract suggests that this organ, beside its digestive and absorptive functions, regulates the trafficking of macromolecules between the environment and the host through a barrier mechanism. Under physiological circumstances, this trafficking is safeguarded by the competency of intercellular tight junctions, structures whose physiological modulation is mediated by, among others, the recently described protein zonulin. To prevent harm and minimize inflammation, the same paracellular pathway, in concert with the gut-associated lymphoid tissue and the neuroendocrine network, controls the equilibrium between tolerance and immunity to nonself antigens. The zonulin pathway has been exploited to deliver drugs, macromolecules, or vaccines that normally would not be absorbed through the gastrointestinal mucosal barrier. However, if the tightly regulated trafficking of macromolecules is jeopardized secondary to prolonged zonulin up-regulation, the excessive flow of nonself antigens in the intestinal submucosa can cause both intestinal and extraintestinal autoimmune disorders in genetically susceptible individuals. This new paradigm subverts traditional theories underlying the development of autoimmunity, which are based on molecular mimicry and/or the bystander effect, and suggests that the autoimmune process can be arrested if the interplay between genes and environmental triggers is prevented by re-establishing intestinal barrier competency. Understanding the role of zonulin-dependent intestinal barrier dysfunction in the pathogenesis of autoimmune diseases is an area of translational research that encompasses many fields. PMID:18832585

  16. dOCRL maintains immune cell quiescence by regulating endosomal traffic.

    Directory of Open Access Journals (Sweden)

    Steven J Del Signore

    2017-10-01

    Full Text Available Lowe Syndrome is a developmental disorder characterized by eye, kidney, and neurological pathologies, and is caused by mutations in the phosphatidylinositol-5-phosphatase OCRL. OCRL plays diverse roles in endocytic and endolysosomal trafficking, cytokinesis, and ciliogenesis, but it is unclear which of these cellular functions underlie specific patient symptoms. Here, we show that mutation of Drosophila OCRL causes cell-autonomous activation of hemocytes, which are macrophage-like cells of the innate immune system. Among many cell biological defects that we identified in docrl mutant hemocytes, we pinpointed the cause of innate immune cell activation to reduced Rab11-dependent recycling traffic and concomitantly increased Rab7-dependent late endosome traffic. Loss of docrl amplifies multiple immune-relevant signals, including Toll, Jun kinase, and STAT, and leads to Rab11-sensitive mis-sorting and excessive secretion of the Toll ligand Spåtzle. Thus, docrl regulation of endosomal traffic maintains hemocytes in a poised, but quiescent state, suggesting mechanisms by which endosomal misregulation of signaling may contribute to symptoms of Lowe syndrome.

  17. Importins and Exportins Regulating Allergic Immune Responses

    Directory of Open Access Journals (Sweden)

    Ankita Aggarwal

    2014-01-01

    Full Text Available Nucleocytoplasmic shuttling of macromolecules is a well-controlled process involving importins and exportins. These karyopherins recognize and bind to receptor-mediated intracellular signals through specific signal sequences that are present on cargo proteins and transport into and out of the nucleus through nuclear pore complexes. Nuclear localization signals (NLS present on cargo molecules to be imported while nuclear export signals (NES on the molecules to be exported are recognized by importins and exportins, respectively. The classical NLS are found on many transcription factors and molecules that are involved in the pathogenesis of allergic diseases. In addition, several immune modulators, including corticosteroids and vitamin D, elicit their cellular responses by regulating the expression and activity of importin molecules. In this review article, we provide a comprehensive list of importin and exportin molecules and their specific cargo that shuttled between cytoplasm and the nucleus. We also critically review the role and regulation of specific importin and exportin involved in the transport of activated transcription factors in allergic diseases, the underlying molecular mechanisms, and the potential target sites for developing better therapeutic approaches.

  18. The role of innate immunity in the regulation of brown and beige adipogenesis.

    Science.gov (United States)

    Alexaki, Vasileia Ismini; Chavakis, Triantafyllos

    2016-03-01

    The adipose tissue (AT) is multifunctional, acting as an endocrine tissue and participating in the regulation of the organism's homeostasis. Metabolic, endocrine and inflammatory mechanisms are tightly intertwined within the AT, regulating its function. Disruption of the equilibrium among these mechanisms leads to pathologies, the most common being obesity-related insulin resistance. Two types of AT exist, the white and the brown AT. Traditionally the white AT (WAT) was thought to store energy in the form of lipids, while the brown AT (BAT) was known to mediate heat generation. Recently, the 'brite' or 'beige' AT was identified, which is localized predominantly in subcutaneous WAT, but shares functional features with the BAT and is capable of heat production. The major stimulus triggering beige and brown adipogenesis is cold exposure and catecholamine signalling. However, several further signals and mechanisms exist, which can orchestrate and fine-tune beige and brown AT function. Immune cells and inflammation have emerged as regulators of beige and brown AT function. The present review will focus on the recently identified crosstalk between innate immunity and the regulation of beige and brown adipogenesis.

  19. Hypoxia, innate immunity and infection in the lung.

    LENUS (Irish Health Repository)

    Schaible, Bettina

    2012-02-01

    The mucosal surface of the lung is the key interface between the external atmosphere and the bloodstream. Normally, this well oxygenated tissue is maintained in state of sterility by a number of innate immune processes. These include a physical and dynamic mucus barrier, the production of microbiocidal peptides and the expression of specific pattern recognition receptors on alveolar epithelial cells and resident macrophages and dendritic cells which recognise microbial structures and initiate innate immune responses which promote the clearance of potentially infectious agents. In a range of diseases, the mucosal surface of the lung experiences decreased oxygen tension leading to localised areas of prominent hypoxia which can impact upon innate immune and subsequent infectious and inflammatory processes. Under these conditions, the lung is generally more susceptible to infection and subsequent inflammation. In the current review, we will discuss recent data pertaining to the role of hypoxia in regulating both host and pathogen in the lung during pulmonary disease and how this contributes to innate immunity, infection and inflammation.

  20. The neonicotinoid insecticide Clothianidin adversely affects immune signaling in a human cell line.

    Science.gov (United States)

    Di Prisco, Gennaro; Iannaccone, Marco; Ianniello, Flora; Ferrara, Rosalba; Caprio, Emilio; Pennacchio, Francesco; Capparelli, Rosanna

    2017-10-18

    Clothianidin is a widely used neonicotinoid insecticide, which is a potent agonist of the nicotinic acetylcholine receptor in insects. This neurotoxic compound has a negative impact on insect immunity, as it down-regulates the activation of the transcription factor NF-κB. Given the evolutionary conserved role of NF-κB in the modulation of the immune response in the animal kingdom, here we want to assess any effect of Clothianidin on vertebrate defense barriers. In presence of this neonicotinoid insecticide, a pro-inflammatory challenge with LPS on the human monocytic cell line THP-1 results both in a reduced production of the cytokine TNF-α and in a down-regulation of a reporter gene under control of NF-κB promoter. This finding is corroborated by a significant impact of Clothianidin on the transcription levels of different immune genes, characterized by a core disruption of TRAF4 and TRAF6 that negatively influences NF-κB signaling. Moreover, exposure to Clothianidin concurrently induces a remarkable up-regulation of NGFR, which supports the occurrence of functional ties between the immune and nervous systems. These results suggest a potential risk of immunotoxicity that neonicotinoids may have on vertebrates, which needs to be carefully assessed at the organism level.

  1. GDSL LIPASE1 Modulates Plant Immunity through Feedback Regulation of Ethylene Signaling1[W

    Science.gov (United States)

    Kim, Hye Gi; Kwon, Sun Jae; Jang, Young Jin; Nam, Myung Hee; Chung, Joo Hee; Na, Yun-Cheol; Guo, Hongwei; Park, Ohkmae K.

    2013-01-01

    Ethylene is a key signal in the regulation of plant defense responses. It is required for the expression and function of GDSL LIPASE1 (GLIP1) in Arabidopsis (Arabidopsis thaliana), which plays an important role in plant immunity. Here, we explore molecular mechanisms underlying the relationship between GLIP1 and ethylene signaling by an epistatic analysis of ethylene response mutants and GLIP1-overexpressing (35S:GLIP1) plants. We show that GLIP1 expression is regulated by ethylene signaling components and, further, that GLIP1 expression or application of petiole exudates from 35S:GLIP1 plants affects ethylene signaling both positively and negatively, leading to ETHYLENE RESPONSE FACTOR1 activation and ETHYLENE INSENSITIVE3 (EIN3) down-regulation, respectively. Additionally, 35S:GLIP1 plants or their exudates increase the expression of the salicylic acid biosynthesis gene SALICYLIC ACID INDUCTION-DEFICIENT2, known to be inhibited by EIN3 and EIN3-LIKE1. These results suggest that GLIP1 regulates plant immunity through positive and negative feedback regulation of ethylene signaling, and this is mediated by its activity to accumulate a systemic signal(s) in the phloem. We propose a model explaining how GLIP1 regulates the fine-tuning of ethylene signaling and ethylene-salicylic acid cross talk. PMID:24170202

  2. Role of ion channels in regulating Ca²⁺ homeostasis during the interplay between immune and cancer cells.

    Science.gov (United States)

    Bose, T; Cieślar-Pobuda, A; Wiechec, E

    2015-02-19

    Ion channels are abundantly expressed in both excitable and non-excitable cells, thereby regulating the Ca(2+) influx and downstream signaling pathways of physiological processes. The immune system is specialized in the process of cancer cell recognition and elimination, and is regulated by different ion channels. In comparison with the immune cells, ion channels behave differently in cancer cells by making the tumor cells more hyperpolarized and influence cancer cell proliferation and metastasis. Therefore, ion channels comprise an important therapeutic target in anti-cancer treatment. In this review, we discuss the implication of ion channels in regulation of Ca(2+) homeostasis during the crosstalk between immune and cancer cell as well as their role in cancer progression.

  3. Leptin and zinc relation : In regulation of food intake and immunity

    Directory of Open Access Journals (Sweden)

    Abdulkerim Kasim Baltaci

    2012-01-01

    Full Text Available Leptin is synthesized and released by the adipose tissue. Leptin, which carries the information about energy reserves of the body to the brain, controls food intake by acting on neuropeptide Y (NPY, which exercises a food-intake-increasing effect through relevant receptors in the hypothalamus. Zinc deficiency is claimed to result in anorexia, weight loss, poor food efficiency, and growth impairment. The fact that obese individuals have low zinc and high leptin levels suggests that there is a relation between zinc and nutrition, and consequently also between zinc and leptin. Leptin deficiency increases the predisposition to infections and this increase is associated with the impairments in the production of cytokines. Zinc has a key role in the sustenance of immune resistance against infections. Dietary zinc deficiency negatively affects CD +4 cells, Th functions, and consequently, cell-mediated immunity by causing a decrease in the production of IL-2, IF-γ, and TNF-α, which are Th1 products. The relation between zinc and the concerned cytokines in particular, and the fact that leptin has a part in the immune responses mediated by these cytokines demonstrate that an interaction among cellular immunity, leptin and zinc is inevitable. An overall evaluation of the information presented above suggests that there are complex relations among food intake, leptin and zinc on one hand and among cellular immunity, leptin and zinc on the other. The aim of the present review was to draw attention to the possible relation between zinc and leptin in dietary regulation and cellular immunity.

  4. Immune regulation in gut and cord : opportunities for directing the immune system

    NARCIS (Netherlands)

    de Roock, S.

    2012-01-01

    The gut is an important organ for the immune system. Microbes and immune cells interact directly or via epithelial cells. Both TH17 and Treg cells mature in this environment. The composition of the microbiota has an important influence on the immune homeostasis. Influencing the immune system via the

  5. DNA Tumor Virus Regulation of Host DNA Methylation and Its Implications for Immune Evasion and Oncogenesis.

    Science.gov (United States)

    Kuss-Duerkop, Sharon K; Westrich, Joseph A; Pyeon, Dohun

    2018-02-13

    Viruses have evolved various mechanisms to evade host immunity and ensure efficient viral replication and persistence. Several DNA tumor viruses modulate host DNA methyltransferases for epigenetic dysregulation of immune-related gene expression in host cells. The host immune responses suppressed by virus-induced aberrant DNA methylation are also frequently involved in antitumor immune responses. Here, we describe viral mechanisms and virus-host interactions by which DNA tumor viruses regulate host DNA methylation to evade antiviral immunity, which may contribute to the generation of an immunosuppressive microenvironment during cancer development. Recent trials of immunotherapies have shown promising results to treat multiple cancers; however, a significant number of non-responders necessitate identifying additional targets for cancer immunotherapies. Thus, understanding immune evasion mechanisms of cancer-causing viruses may provide great insights for reversing immune suppression to prevent and treat associated cancers.

  6. DNA Tumor Virus Regulation of Host DNA Methylation and Its Implications for Immune Evasion and Oncogenesis

    Directory of Open Access Journals (Sweden)

    Sharon K. Kuss-Duerkop

    2018-02-01

    Full Text Available Viruses have evolved various mechanisms to evade host immunity and ensure efficient viral replication and persistence. Several DNA tumor viruses modulate host DNA methyltransferases for epigenetic dysregulation of immune-related gene expression in host cells. The host immune responses suppressed by virus-induced aberrant DNA methylation are also frequently involved in antitumor immune responses. Here, we describe viral mechanisms and virus–host interactions by which DNA tumor viruses regulate host DNA methylation to evade antiviral immunity, which may contribute to the generation of an immunosuppressive microenvironment during cancer development. Recent trials of immunotherapies have shown promising results to treat multiple cancers; however, a significant number of non-responders necessitate identifying additional targets for cancer immunotherapies. Thus, understanding immune evasion mechanisms of cancer-causing viruses may provide great insights for reversing immune suppression to prevent and treat associated cancers.

  7. Three Pairs of Protease-Serpin Complexes Cooperatively Regulate the Insect Innate Immune Responses*

    OpenAIRE

    Jiang, Rui; Kim, Eun-Hye; Gong, Ji-Hee; Kwon, Hyun-Mi; Kim, Chan-Hee; Ryu, Kyoung-Hwa; Park, Ji-Won; Kurokawa, Kenji; Zhang, Jinghai; Gubb, David; Lee, Bok-Luel

    2009-01-01

    Serpins are known to be necessary for the regulation of several serine protease cascades. However, the mechanisms of how serpins regulate the innate immune responses of invertebrates are not well understood due to the uncertainty of the identity of the serine proteases targeted by the serpins. We recently reported the molecular activation mechanisms of three serine protease-mediated Toll and melanin synthesis cascades in a large beetle, Tenebrio molitor. Here, we purified three novel serpins ...

  8. Parent Attitudes Toward Pain Management for Childhood Immunizations.

    Science.gov (United States)

    Connelly, Mark; Wallace, Dustin P; Williams, Kristi; Parker, JoLynn; Schurman, Jennifer V

    2016-08-01

    Evidence-based pain-limiting strategies for pediatric immunizations remain underutilized, with barriers identified to date mostly pertaining to health care providers and systems of care. The present study sought to quantify and investigate parent attitudes toward pain management as another potential barrier to the routine use of pain-mitigating strategies during immunizations. Questionnaires measuring parent attitudes, willingness to pay, and perceived barriers for using pain management for immunizations were completed by 259 parent/guardians of children ages 0 to 5 years attending appointments at an urban primary care clinic in the Midwestern United States. Parent attitudes toward pain management for immunization were relatively normally distributed and varied from strongly positive to negative, with 33% of parents disagreeing that they were concerned about the pain their child may experience and 50% agreeing that there are no lasting negative effects from immunization pain. Negative parent attitudes were associated with willingness to spend less in money or time for pain management and with greater perceived significance of cost, time, and other barriers for using pain-mitigating strategies. Some parents perceive limited value in trying to reduce pain during immunizations such that they may be hesitant to invest much time or effort in interventions. Greater success of translating evidence-based pain management into practice therefore may require accounting for differences in parent attitudes by tailoring educational efforts and pain management options accordingly.

  9. The Regulation of Immunological Processes by Peripheral Neurons in Homeostasis and Disease.

    Science.gov (United States)

    Ordovas-Montanes, Jose; Rakoff-Nahoum, Seth; Huang, Siyi; Riol-Blanco, Lorena; Barreiro, Olga; von Andrian, Ulrich H

    2015-10-01

    The nervous system and the immune system are the principal sensory interfaces between the internal and external environment. They are responsible for recognizing, integrating, and responding to varied stimuli, and have the capacity to form memories of these encounters leading to learned or 'adaptive' future responses. We review current understanding of the cross-regulation between these systems. The autonomic and somatosensory nervous systems regulate both the development and deployment of immune cells, with broad functions that impact on hematopoiesis as well as on priming, migration, and cytokine production. In turn, specific immune cell subsets contribute to homeostatic neural circuits such as those controlling metabolism, hypertension, and the inflammatory reflex. We examine the contribution of the somatosensory system to autoimmune, autoinflammatory, allergic, and infectious processes in barrier tissues and, in this context, discuss opportunities for therapeutic manipulation of neuro-immune interactions. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Elsevier Trophoblast Research Award Lecture: Unique properties of decidual T cells and their role in immune regulation during human pregnancy.

    Science.gov (United States)

    Tilburgs, T; Claas, F H J; Scherjon, S A

    2010-03-01

    Maternal lymphocytes at the fetal-maternal interface play a key role in the immune acceptance of the allogeneic fetus. Most studies focus on decidual NK cells and their interaction with fetal trophoblasts, whereas limited data are available on the mechanisms of fetus specific immune recognition and immune regulation by decidual T cells at the fetal-maternal interface. The aim of this review is to describe the phenotypic characteristics of decidual T cell subsets present at the fetal-maternal interface, their interaction with HLA-C expressed by fetal trophoblasts and their role in immune recognition and regulation at the fetal-maternal interface during human pregnancy. Copyright 2010 Elsevier Ltd. All rights reserved.

  11. Endothelial Regulator of Calcineurin 1 Promotes Barrier Integrity and Modulates Histamine-Induced Barrier Dysfunction in Anaphylaxis

    Directory of Open Access Journals (Sweden)

    Constanza Ballesteros-Martinez

    2017-10-01

    Full Text Available Anaphylaxis, the most serious and life-threatening allergic reaction, produces the release of inflammatory mediators by mast cells and basophils. Regulator of calcineurin 1 (Rcan1 is a negative regulator of mast-cell degranulation. The action of mediators leads to vasodilation and an increase in vascular permeability, causing great loss of intravascular volume in a short time. Nevertheless, the molecular basis remains unexplored on the vascular level. We investigated Rcan1 expression induced by histamine, platelet-activating factor (PAF, and epinephrine in primary human vein (HV-/artery (HA-derived endothelial cells (ECs and human dermal microvascular ECs (HMVEC-D. Vascular permeability was analyzed in vitro in human ECs with forced Rcan1 expression using Transwell migration assays and in vivo using Rcan1 knockout mice. Histamine, but neither PAF nor epinephrine, induced Rcan1-4 mRNA and protein expression in primary HV-ECs, HA-ECs, and HMVEC-D through histamine receptor 1 (H1R. These effects were prevented by pharmacological inhibition of calcineurin with cyclosporine A. Moreover, intravenous histamine administration increased Rcan1 expression in lung tissues of mice undergoing experimental anaphylaxis. Functional in vitro assays showed that overexpression of Rcan1 promotes barrier integrity, suggesting a role played by this molecule in vascular permeability. Consistent with these findings, in vivo models of subcutaneous and intravenous histamine-mediated fluid extravasation showed increased response in skin, aorta, and lungs of Rcan1-deficient mice compared with wild-type animals. These findings reveal that endothelial Rcan1 is synthesized in response to histamine through a calcineurin-sensitive pathway and may reduce barrier breakdown, thus contributing to the strengthening of the endothelium and resistance to anaphylaxis. These new insights underscore its potential role as a regulator of sensitivity to anaphylaxis in humans.

  12. Psoriasis, vitamin D and the importance of the cutaneous barrier's integrity: An update.

    Science.gov (United States)

    Mattozzi, Carlo; Paolino, Giovanni; Richetta, Antonio Giovanni; Calvieri, Stefano

    2016-05-01

    Psoriasis is a common, inflammatory, chronic, relapsing skin disease. Despite several hypotheses having been postulated to explain the pathogenesis of this disorder, nowadays it is considered as a T-cell-mediated disease; in this context an important role is played by vitamin D. The role of this micronutrient is important for many reasons: it is able to modulate the immune system; it is implicated in keratinocyte turnover; and it is involved in the integrity of the cutaneous barrier. In psoriasis, this molecule plays an important role due to its ability in the modulation of innate and adaptive immunity and by its antiproliferative and pro-differentiative effects on keratinocytes. Alteration of the metabolism of vitamin D may alter the cutaneous barrier integrity and favor an infective and inflammatory condition. The importance of vitamin D in the pathogenesis of psoriasis is not a mere mental exercise but may open further perspectives in the treatment of this disorder just preventing alterations of immune homeostasis, modulating the proliferation of keratinocyte, regulating the microbial flora and the response of the host to infective diseases. © 2016 Japanese Dermatological Association.

  13. Intestinal barrier dysfunction develops at the onset of experimental autoimmune encephalomyelitis, and can be induced by adoptive transfer of auto-reactive T cells.

    Directory of Open Access Journals (Sweden)

    Mehrnaz Nouri

    Full Text Available Multiple sclerosis (MS is a chronic inflammatory demyelinating disease of the central nervous system with a pathogenesis involving a dysfunctional blood-brain barrier and myelin-specific, autoreactive T cells. Although the commensal microbiota seems to affect its pathogenesis, regulation of the interactions between luminal antigens and mucosal immune elements remains unclear. Herein, we investigated whether the intestinal mucosal barrier is also targeted in this disease. Experimental autoimmune encephalomyelitis (EAE, the prototypic animal model of MS, was induced either by active immunization or by adoptive transfer of autoreactive T cells isolated from these mice. We show increased intestinal permeability, overexpression of the tight junction protein zonulin and alterations in intestinal morphology (increased crypt depth and thickness of the submucosa and muscularis layers. These intestinal manifestations were seen at 7 days (i.e., preceding the onset of neurological symptoms and at 14 days (i.e., at the stage of paralysis after immunization. We also demonstrate an increased infiltration of proinflammatory Th1/Th17 cells and a reduced regulatory T cell number in the gut lamina propria, Peyer's patches and mesenteric lymph nodes. Adoptive transfer to healthy mice of encephalitogenic T cells, isolated from EAE-diseased animals, led to intestinal changes similar to those resulting from the immunization procedure. Our findings show that disruption of intestinal homeostasis is an early and immune-mediated event in EAE. We propose that this intestinal dysfunction may act to support disease progression, and thus represent a potential therapeutic target in MS. In particular, an increased understanding of the regulation of tight junctions at the blood-brain barrier and in the intestinal wall may be crucial for design of future innovative therapies.

  14. Intestinal Barrier Dysfunction Develops at the Onset of Experimental Autoimmune Encephalomyelitis, and Can Be Induced by Adoptive Transfer of Auto-Reactive T Cells

    Science.gov (United States)

    Nouri, Mehrnaz; Bredberg, Anders; Weström, Björn; Lavasani, Shahram

    2014-01-01

    Multiple sclerosis (MS) is a chronic inflammatory demyelinating disease of the central nervous system with a pathogenesis involving a dysfunctional blood-brain barrier and myelin-specific, autoreactive T cells. Although the commensal microbiota seems to affect its pathogenesis, regulation of the interactions between luminal antigens and mucosal immune elements remains unclear. Herein, we investigated whether the intestinal mucosal barrier is also targeted in this disease. Experimental autoimmune encephalomyelitis (EAE), the prototypic animal model of MS, was induced either by active immunization or by adoptive transfer of autoreactive T cells isolated from these mice. We show increased intestinal permeability, overexpression of the tight junction protein zonulin and alterations in intestinal morphology (increased crypt depth and thickness of the submucosa and muscularis layers). These intestinal manifestations were seen at 7 days (i.e., preceding the onset of neurological symptoms) and at 14 days (i.e., at the stage of paralysis) after immunization. We also demonstrate an increased infiltration of proinflammatory Th1/Th17 cells and a reduced regulatory T cell number in the gut lamina propria, Peyer's patches and mesenteric lymph nodes. Adoptive transfer to healthy mice of encephalitogenic T cells, isolated from EAE-diseased animals, led to intestinal changes similar to those resulting from the immunization procedure. Our findings show that disruption of intestinal homeostasis is an early and immune-mediated event in EAE. We propose that this intestinal dysfunction may act to support disease progression, and thus represent a potential therapeutic target in MS. In particular, an increased understanding of the regulation of tight junctions at the blood-brain barrier and in the intestinal wall may be crucial for design of future innovative therapies. PMID:25184418

  15. The Arabidopsis homolog of human G3BP1 is a key regulator of stomatal and apoplastic immunity

    KAUST Repository

    Abulfaraj, Aala A.; Mariappan, Kiruthiga; Bigeard, Jean; Manickam, Prabhu; Blilou, Ikram; Guo, Xiujie; Al-Babili, Salim; Pflieger, Delphine; Hirt, Heribert; Rayapuram, Naganand

    2018-01-01

    Mammalian Ras-GTPase–activating protein SH3-domain–binding proteins (G3BPs) are a highly conserved family of RNA-binding proteins that link kinase receptor-mediated signaling to RNA metabolism. Mammalian G3BP1 is a multifunctional protein that functions in viral immunity. Here, we show that the Arabidopsis thaliana homolog of human G3BP1 negatively regulates plant immunity. Arabidopsis g3bp1 mutants showed enhanced resistance to the virulent bacterial pathogen Pseudomonas syringae pv. tomato. Pathogen resistance was mediated in Atg3bp1 mutants by altered stomatal and apoplastic immunity. Atg3bp1 mutants restricted pathogen entry into stomates showing insensitivity to bacterial coronatine–mediated stomatal reopening. AtG3BP1 was identified as a negative regulator of defense responses, which correlated with moderate up-regulation of salicylic acid biosynthesis and signaling without growth penalty.

  16. The Arabidopsis homolog of human G3BP1 is a key regulator of stomatal and apoplastic immunity

    KAUST Repository

    Abulfaraj, Aala Abdulaziz Hussien

    2018-05-31

    Mammalian Ras-GTPase–activating protein SH3-domain–binding proteins (G3BPs) are a highly conserved family of RNA-binding proteins that link kinase receptor-mediated signaling to RNA metabolism. Mammalian G3BP1 is a multifunctional protein that functions in viral immunity. Here, we show that the Arabidopsis thaliana homolog of human G3BP1 negatively regulates plant immunity. Arabidopsis g3bp1 mutants showed enhanced resistance to the virulent bacterial pathogen Pseudomonas syringae pv. tomato. Pathogen resistance was mediated in Atg3bp1 mutants by altered stomatal and apoplastic immunity. Atg3bp1 mutants restricted pathogen entry into stomates showing insensitivity to bacterial coronatine–mediated stomatal reopening. AtG3BP1 was identified as a negative regulator of defense responses, which correlated with moderate up-regulation of salicylic acid biosynthesis and signaling without growth penalty.

  17. HIC1 links retinoic acid signalling to group 3 innate lymphoid cell-dependent regulation of intestinal immunity and homeostasis

    Science.gov (United States)

    Antignano, Frann; Korinek, Vladimir; Underhill, T. Michael

    2018-01-01

    The intestinal immune system must be able to respond to a wide variety of infectious organisms while maintaining tolerance to non-pathogenic microbes and food antigens. The Vitamin A metabolite all-trans-retinoic acid (atRA) has been implicated in the regulation of this balance, partially by regulating innate lymphoid cell (ILC) responses in the intestine. However, the molecular mechanisms of atRA-dependent intestinal immunity and homeostasis remain elusive. Here we define a role for the transcriptional repressor Hypermethylated in cancer 1 (HIC1, ZBTB29) in the regulation of ILC responses in the intestine. Intestinal ILCs express HIC1 in a vitamin A-dependent manner. In the absence of HIC1, group 3 ILCs (ILC3s) that produce IL-22 are lost, resulting in increased susceptibility to infection with the bacterial pathogen Citrobacter rodentium. Thus, atRA-dependent expression of HIC1 in ILC3s regulates intestinal homeostasis and protective immunity. PMID:29470558

  18. Hydrogen sulfide metabolism regulates endothelial solute barrier function

    Directory of Open Access Journals (Sweden)

    Shuai Yuan

    2016-10-01

    Full Text Available Hydrogen sulfide (H2S is an important gaseous signaling molecule in the cardiovascular system. In addition to free H2S, H2S can be oxidized to polysulfide which can be biologically active. Since the impact of H2S on endothelial solute barrier function is not known, we sought to determine whether H2S and its various metabolites affect endothelial permeability. In vitro permeability was evaluated using albumin flux and transendothelial electrical resistance. Different H2S donors were used to examine the effects of exogenous H2S. To evaluate the role of endogenous H2S, mouse aortic endothelial cells (MAECs were isolated from wild type mice and mice lacking cystathionine γ-lyase (CSE, a predominant source of H2S in endothelial cells. In vivo permeability was evaluated using the Miles assay. We observed that polysulfide donors induced rapid albumin flux across endothelium. Comparatively, free sulfide donors increased permeability only with higher concentrations and at later time points. Increased solute permeability was associated with disruption of endothelial junction proteins claudin 5 and VE-cadherin, along with enhanced actin stress fiber formation. Importantly, sulfide donors that increase permeability elicited a preferential increase in polysulfide levels within endothelium. Similarly, CSE deficient MAECs showed enhanced solute barrier function along with reduced endogenous bound sulfane sulfur. CSE siRNA knockdown also enhanced endothelial junction structures with increased claudin 5 protein expression. In vivo, CSE genetic deficiency significantly blunted VEGF induced hyperpermeability revealing an important role of the enzyme for barrier function. In summary, endothelial solute permeability is critically regulated via exogenous and endogenous sulfide bioavailability with a prominent role of polysulfides.

  19. Mesenchymal Stromal Cells Can Regulate the Immune Response in the Tumor Microenvironment

    Directory of Open Access Journals (Sweden)

    Alessandro Poggi

    2016-11-01

    Full Text Available The tumor microenvironment is a good target for therapy in solid tumors and hematological malignancies. Indeed, solid tumor cells’ growth and expansion can influence neighboring cells’ behavior, leading to a modulation of mesenchymal stromal cell (MSC activities and remodeling of extracellular matrix components. This leads to an altered microenvironment, where reparative mechanisms, in the presence of sub-acute inflammation, are not able to reconstitute healthy tissue. Carcinoma cells can undergo epithelial mesenchymal transition (EMT, a key step to generate metastasis; these mesenchymal-like cells display the functional behavior of MSC. Furthermore, MSC can support the survival and growth of leukemic cells within bone marrow participating in the leukemic cell niche. Notably, MSC can inhibit the anti-tumor immune response through either carcinoma-associated fibroblasts or bone marrow stromal cells. Experimental data have indicated their relevance in regulating cytolytic effector lymphocytes of the innate and adaptive arms of the immune system. Herein, we will discuss some of the evidence in hematological malignancies and solid tumors. In particular, we will focus our attention on the means by which it is conceivable to inhibit MSC-mediated immune suppression and trigger anti-tumor innate immunity.

  20. Regulation of the NADPH Oxidase RBOHD During Plant Immunity.

    Science.gov (United States)

    Kadota, Yasuhiro; Shirasu, Ken; Zipfel, Cyril

    2015-08-01

    Pathogen recognition induces the production of reactive oxygen species (ROS) by NADPH oxidases in both plants and animals. ROS have direct antimicrobial properties, but also serve as signaling molecules to activate further immune outputs. However, ROS production has to be tightly controlled to avoid detrimental effects on host cells, but yet must be produced in the right amount, at the right place and at the right time upon pathogen perception. Plant NADPH oxidases belong to the respiratory burst oxidase homolog (RBOH) family, which contains 10 members in the model plant Arabidopsis thaliana. The perception of pathogen-associated molecular patterns (PAMPs) by pattern recognition receptors (PRRs) leads to a rapid, specific and strong production of ROS, which is dependent on RBOHD. RBOHD is mainly controlled by Ca(2+) via direct binding to EF-hand motifs and phosphorylation by Ca(2+)-dependent protein kinases. Recent studies have, however, revealed a critical role for a Ca(2+)-independent regulation of RBOHD. The plasma membrane-associated cytoplasmic kinase BIK1 (BOTRYTIS-INDUCED KINASE1), which is a direct substrate of the PRR complex, directly interacts with and phosphorylates RBOHD upon PAMP perception. Impairment of these phosphorylation events completely abolishes the function of RBOHD in immunity. These results suggest that RBOHD activity is tightly controlled by multilayered regulations. In this review, we summarize recent advances in our understanding of the regulatory mechanisms controlling RBOHD activation. © The Author 2015. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  1. Urea uptake enhances barrier function and antimicrobial defense in humans by regulating epidermal gene expression

    Science.gov (United States)

    Grether-Beck, Susanne; Felsner, Ingo; Brenden, Heidi; Kohne, Zippora; Majora, Marc; Marini, Alessandra; Jaenicke, Thomas; Rodriguez-Martin, Marina; Trullas, Carles; Hupe, Melanie; Elias, Peter M.; Krutmann, Jean

    2012-01-01

    Urea is an endogenous metabolite, known to enhance stratum corneum hydration. Yet, topical urea anecdotally also improves permeability barrier function, and it appears to exhibit antimicrobial activity. Hence, we hypothesized that urea is not merely a passive metabolite, but a small-molecule regulator of epidermal structure and function. In 21 human volunteers, topical urea improved barrier function in parallel with enhanced antimicrobial peptide (LL-37 and β-defensin-2) expression. Urea both stimulates expression of, and is transported into keratinocytes by two urea transporters, UT-A1 and UT-A2, and by aquaporin 3, 7 and 9. Inhibitors of these urea transporters block the downstream biological effects of urea, which include increased mRNA and protein levels for: (i) transglutaminase-1, involucrin, loricrin and filaggrin; (ii) epidermal lipid synthetic enzymes, and (iii) cathelicidin/LL-37 and β-defensin-2. Finally, we explored the potential clinical utility of urea, showing that topical urea applications normalized both barrier function and antimicrobial peptide expression in a murine model of atopic dermatitis (AD). Together, these results show that urea is a small-molecule regulator of epidermal permeability barrier function and antimicrobial peptide expression after transporter uptake, followed by gene regulatory activity in normal epidermis, with potential therapeutic applications in diseased skin. PMID:22418868

  2. Ectopic expression of X-linked lymphocyte-regulated protein pM1 renders tumor cells resistant to antitumor immunity.

    Science.gov (United States)

    Kang, Tae Heung; Noh, Kyung Hee; Kim, Jin Hee; Bae, Hyun Cheol; Lin, Ken Y; Monie, Archana; Pai, Sara I; Hung, Chien-Fu; Wu, T-C; Kim, Tae Woo

    2010-04-15

    Tumor immune escape is a major obstacle in cancer immunotherapy, but the mechanisms involved remain poorly understood. We have previously developed an immune evasion tumor model using an in vivo immune selection strategy and revealed Akt-mediated immune resistance to antitumor immunity induced by various cancer immunotherapeutic agents. In the current study, we used microarray gene analysis to identify an Akt-activating candidate molecule overexpressed in immune-resistant tumors compared with parental tumors. X-linked lymphocyte-regulated protein pM1 (XLR) gene was the most upregulated in immune-resistant tumors compared with parental tumor cells. Furthermore, the retroviral transduction of XLR in parental tumor cells led to activation of Akt, resulting in upregulation of antiapoptotic proteins and the induction of immune resistance phenotype in parental tumor cells. In addition, we found that transduction of parental tumor cells with other homologous genes from the mouse XLR family, such as synaptonemal complex protein 3 (SCP3) and XLR-related, meiosis-regulated protein (XMR) and its human counterpart of SCP3 (hSCP3), also led to activation of Akt, resulting in the upregulation of antiapoptotic proteins and induction of immune resistance phenotype. Importantly, characterization of a panel of human cervical cancers revealed relatively higher expression levels of hSCP3 in human cervical cancer tissue compared with normal cervical tissue. Thus, our data indicate that ectopic expression of XLR and its homologues in tumor cells represents a potentially important mechanism for tumor immune evasion and serves as a promising molecular target for cancer immunotherapy. (c) 2010 AACR.

  3. IL-35, a hallmark of immune-regulation in cancer progression, chronic infections and inflammatory diseases.

    Science.gov (United States)

    Teymouri, Manouchehr; Pirro, Matteo; Fallarino, Francesca; Gargaro, Marco; Sahebkar, Amirhosein

    2018-03-25

    Cytokine members of the IL-12 family have attracted enormous attention in the last few years, with IL-35 being the one of the most attractive-suppressive cytokine. IL-35 is an important mediator of regulatory T cell function. Regulatory T cells play key roles in restoring immune homeostasis after facing challenges such as infection by specific pathogens. Moreover, a crucial role for regulatory T cell populations has been demonstrated in several physiological processes, including establishment of fetal-maternal tolerance, maintenance of self-tolerance and prevention of autoimmune diseases. However, a deleterious involvement of immune regulatory T cells has been documented in specific inhibition of immune responses against tumor cells, promotion of chronic infections and establishment of chronic inflammatory disorders. In this review, we attempt to shed light on the concept of immune-homoeostasis on the aforementioned issues, taking IL-35 as the hallmark of regulatory responses. The dilemma between immune-mediated cancer treatment and inflammation is discussed. Histopathological indications of chronic vs. acute infections are elaborated. Moreover, the evidence that IL-35 requires additional immune-regulatory cytokines, such as IL-10 and TGF-β, to induce effective and maximal anti-inflammatory effects suggest that immune-regulation requires multi-factorial analysis of many immune playmakers rather than a specific immune target. © 2018 UICC.

  4. Immunity by equilibrium.

    Science.gov (United States)

    Eberl, Gérard

    2016-08-01

    The classical model of immunity posits that the immune system reacts to pathogens and injury and restores homeostasis. Indeed, a century of research has uncovered the means and mechanisms by which the immune system recognizes danger and regulates its own activity. However, this classical model does not fully explain complex phenomena, such as tolerance, allergy, the increased prevalence of inflammatory pathologies in industrialized nations and immunity to multiple infections. In this Essay, I propose a model of immunity that is based on equilibrium, in which the healthy immune system is always active and in a state of dynamic equilibrium between antagonistic types of response. This equilibrium is regulated both by the internal milieu and by the microbial environment. As a result, alteration of the internal milieu or microbial environment leads to immune disequilibrium, which determines tolerance, protective immunity and inflammatory pathology.

  5. Interplay among gut microbiota, intestinal mucosal barrier and enteric neuro-immune system: a common path to neurodegenerative diseases?

    Science.gov (United States)

    Pellegrini, Carolina; Antonioli, Luca; Colucci, Rocchina; Blandizzi, Corrado; Fornai, Matteo

    2018-05-24

    Neurological diseases, such as Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis (ALS) and multiple sclerosis, are often associated with functional gastrointestinal disorders. These gastrointestinal disturbances may occur at all stages of the neurodegenerative diseases, to such an extent that they are now considered an integral part of their clinical picture. Several lines of evidence support the contention that, in central neurodegenerative diseases, changes in gut microbiota and enteric neuro-immune system alterations could contribute to gastrointesinal dysfunctions as well as initiation and upward spreading of the neurologic disorder. The present review has been intended to provide a comprehensive overview of the available knowledge on the role played by enteric microbiota, mucosal immune system and enteric nervous system, considered as an integrated network, in the pathophysiology of the main neurological diseases known to be associated with intestinal disturbances. In addition, based on current human and pre-clinical evidence, our intent was to critically discuss whether changes in the dynamic interplay between gut microbiota, intestinal epithelial barrier and enteric neuro-immune system are a consequence of the central neurodegeneration or might represent the starting point of the neurodegenerative process. Special attention has been paid also to discuss whether alterations of the enteric bacterial-neuro-immune network could represent a common path driving the onset of the main neurodegenerative diseases, even though each disease displays its own distinct clinical features.

  6. Duox2-induced innate immune responses in the respiratory epithelium and intranasal delivery of Duox2 DNA using polymer that mediates immunization.

    Science.gov (United States)

    Jeon, Yung Jin; Kim, Hyun Jik

    2018-05-01

    Respiratory mucosa especially nasal epithelium is well known as the first-line barrier of air-borne pathogens. High levels of reactive oxygen species (ROS) are detected in in vitro cultured human epithelial cells and in vivo lung. With identification of NADPH oxidase (Nox) system of respiratory epithelium, the antimicrobial role of ROS has been studied. Duox2 is the most abundant Nox isoform and produces the regulated amount of ROS in respiratory epithelium. Duox2-derived ROS are involved in antiviral innate immune responses but more studies are needed to verify the mechanism. In respiratory epithelium, Duox2-derived ROS is critical for recognition of virus through families retinoic acid-inducible gene-I (RIG-I) and melanoma differentiation-associated protein 5 (MDA5) at the early stage of antiviral innate immune responses. Various secreted interferons (IFNs) play essential roles for antiviral host defense by downstream cell signaling, and transcription of IFN-stimulated genes is started to suppress viral replication. Type I and type III IFNs are verified more responsible for influenza A virus (IAV) infection in respiratory epithelium and Duox2 is required to regulate IFN-related immune responses. Transient overexpression of Duox2 using cationic polymer polyethylenimine (PEI) induces secretion of type I and type III IFNs and significantly attenuated IAV replication in respiratory epithelium. Here, we discuss Duox2-mediated antiviral innate immune responses and the role of Duox2 as a mucosal vaccine to resist respiratory viral infection.

  7. The TAM family receptor tyrosine kinase TYRO3 is a negative regulator of type 2 immunity

    Science.gov (United States)

    Chan, Pamela Y.; Carrera Silva, Eugenio A.; De Kouchkovsky, Dimitri; Joannas, Leonel D.; Hao, Liming; Hu, Donglei; Huntsman, Scott; Eng, Celeste; Licona-Limón, Paula; Weinstein, Jason S.; Herbert, De’Broski R.; Craft, Joseph E.; Flavell, Richard A.; Repetto, Silvia; Correale, Jorge; Burchard, Esteban G.; Torgerson, Dara G.; Ghosh, Sourav; Rothlin, Carla V.

    2016-01-01

    Host responses against metazoan parasites or an array of environmental substances elicit type 2 immunity. Despite its protective function, type 2 immunity also drives allergic diseases. The mechanisms that regulate the magnitude of the type 2 response remain largely unknown. Here, we show that genetic ablation of a receptor tyrosine kinase encoded by Tyro3 in mice or the functional neutralization of its ortholog in human dendritic cells resulted in enhanced type 2 immunity. Furthermore, the TYRO3 agonist PROS1 was induced in T cells by the quintessential type 2 cytokine, interleukin-4. T cell–specific Pros1 knockouts phenocopied the loss of Tyro3. Thus, a PROS1-mediated feedback from adaptive immunity engages a rheostat, TYRO3, on innate immune cells to limit the intensity of type 2 responses. PMID:27034374

  8. Intestinal permeability and its regulation by zonulin: diagnostic and therapeutic implications.

    Science.gov (United States)

    Fasano, Alessio

    2012-10-01

    One of the most important and overlooked functions of the gastrointestinal tract is to provide a dynamic barrier to tightly controlled antigen trafficking through both the transcellular and paracellular pathways. Intercellular tight junctions (TJ) are the key structures regulating paracellular trafficking of macromolecules. Although steady progress has been made in understanding TJ ultrastructure, relatively little is known about their pathophysiological regulation. Our discovery of zonulin, the only known physiological modulator of intercellular TJ described so far, increased understanding of the intricate mechanisms that regulate gut permeability and led us to appreciate that its up-regulation in genetically susceptible individuals may lead to immune-mediated diseases. This information has translational implications, because the zonulin pathway is currently exploited to develop both diagnostic and therapeutic applications pertinent to a variety of immune-mediated diseases. Copyright © 2012 AGA Institute. Published by Elsevier Inc. All rights reserved.

  9. Hello from the Other Side: How Autoantibodies Circumvent the Blood–Brain Barrier in Autoimmune Encephalitis

    Directory of Open Access Journals (Sweden)

    Tyler Cutforth

    2017-04-01

    Full Text Available Antibodies against neuronal receptors and synaptic proteins are associated with autoimmune encephalitides (AE that produce movement and psychiatric disorders. In order to exert their pathological effects on neural circuits, autoantibodies against central nervous system (CNS targets must gain access to the brain and spinal cord by crossing the blood–brain barrier (BBB, a tightly regulated gateway formed by endothelial cells lining CNS blood vessels. To date, the pathogenic mechanisms that underlie autoantibody-triggered encephalitic syndromes are poorly understood, and how autoantibodies breach the barrier remains obscure for almost all AE syndromes. The relative importance of cellular versus humoral immune mechanisms for disease pathogenesis also remains largely unexplored. Here, we review the proposed triggers for various autoimmune encephalopathies and their animal models, as well as basic structural features of the BBB and how they differ among various CNS regions, a feature that likely underlies some regional aspects of autoimmune encephalitis pathogenesis. We then discuss the routes that antibodies and immune cells employ to enter the CNS and their implications for AE. Finally, we explore future therapeutic strategies that may either preserve or restore barrier function and thereby limit immune cell and autoantibody infiltration into the CNS. Recent mechanistic insights into CNS autoantibody entry indicate promising future directions for therapeutic intervention beyond current, short-lived therapies that eliminate circulating autoantibodies.

  10. Hello from the Other Side: How Autoantibodies Circumvent the Blood-Brain Barrier in Autoimmune Encephalitis.

    Science.gov (United States)

    Platt, Maryann P; Agalliu, Dritan; Cutforth, Tyler

    2017-01-01

    Antibodies against neuronal receptors and synaptic proteins are associated with autoimmune encephalitides (AE) that produce movement and psychiatric disorders. In order to exert their pathological effects on neural circuits, autoantibodies against central nervous system (CNS) targets must gain access to the brain and spinal cord by crossing the blood-brain barrier (BBB), a tightly regulated gateway formed by endothelial cells lining CNS blood vessels. To date, the pathogenic mechanisms that underlie autoantibody-triggered encephalitic syndromes are poorly understood, and how autoantibodies breach the barrier remains obscure for almost all AE syndromes. The relative importance of cellular versus humoral immune mechanisms for disease pathogenesis also remains largely unexplored. Here, we review the proposed triggers for various autoimmune encephalopathies and their animal models, as well as basic structural features of the BBB and how they differ among various CNS regions, a feature that likely underlies some regional aspects of autoimmune encephalitis pathogenesis. We then discuss the routes that antibodies and immune cells employ to enter the CNS and their implications for AE. Finally, we explore future therapeutic strategies that may either preserve or restore barrier function and thereby limit immune cell and autoantibody infiltration into the CNS. Recent mechanistic insights into CNS autoantibody entry indicate promising future directions for therapeutic intervention beyond current, short-lived therapies that eliminate circulating autoantibodies.

  11. Flg22-Triggered Immunity Negatively Regulates Key BR Biosynthetic Genes.

    Science.gov (United States)

    Jiménez-Góngora, Tamara; Kim, Seong-Ki; Lozano-Durán, Rosa; Zipfel, Cyril

    2015-01-01

    In plants, activation of growth and activation of immunity are opposing processes that define a trade-off. In the past few years, the growth-promoting hormones brassinosteroids (BR) have emerged as negative regulators of pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI), promoting growth at the expense of defense. The crosstalk between BR and PTI signaling was described as negative and unidirectional, since activation of PTI does not affect several analyzed steps in the BR signaling pathway. In this work, we describe that activation of PTI by the bacterial PAMP flg22 results in the reduced expression of BR biosynthetic genes. This effect does not require BR perception or signaling, and occurs within 15 min of flg22 treatment. Since the described PTI-induced repression of gene expression may result in a reduction in BR biosynthesis, the crosstalk between PTI and BR could actually be negative and bidirectional, a possibility that should be taken into account when considering the interaction between these two pathways.

  12. Regulation of anti-Plasmodium immunity by a LITAF-like transcription factor in the malaria vector Anopheles gambiae.

    Directory of Open Access Journals (Sweden)

    Ryan C Smith

    Full Text Available The mosquito is the obligate vector for malaria transmission. To complete its development within the mosquito, the malaria parasite Plasmodium must overcome the protective action of the mosquito innate immune system. Here we report on the involvement of the Anopheles gambiae orthologue of a conserved component of the vertebrate immune system, LPS-induced TNFα transcription factor (LITAF, and its role in mosquito anti-Plasmodium immunity. An. gambiae LITAF-like 3 (LL3 expression is up-regulated in response to midgut invasion by both rodent and human malaria parasites. Silencing of LL3 expression greatly increases parasite survival, indicating that LL3 is part of an anti-Plasmodium defense mechanism. Electrophoretic mobility shift assays identified specific LL3 DNA-binding motifs within the promoter of SRPN6, a gene that also mediates mosquito defense against Plasmodium. Further experiments indicated that these motifs play a direct role in LL3 regulation of SRPN6 expression. We conclude that LL3 is a transcription factor capable of modulating SRPN6 expression as part of the mosquito anti-Plasmodium immune response.

  13. Air pollution and children: neural and tight junction antibodies and combustion metals, the role of barrier breakdown and brain immunity in neurodegeneration.

    Science.gov (United States)

    Calderón-Garcidueñas, Lilian; Vojdani, Aristo; Blaurock-Busch, Eleonore; Busch, Yvette; Friedle, Albrecht; Franco-Lira, Maricela; Sarathi-Mukherjee, Partha; Martínez-Aguirre, Xavier; Park, Su-Bin; Torres-Jardón, Ricardo; D'Angiulli, Amedeo

    2015-01-01

    Millions of children are exposed to concentrations of air pollutants, including fine particulate matter (PM2.5), above safety standards. In the Mexico City Metropolitan Area (MCMA) megacity, children show an early brain imbalance in oxidative stress, inflammation, innate and adaptive immune response-associated genes, and blood-brain barrier breakdown. We investigated serum and cerebrospinal fluid (CSF) antibodies to neural and tight junction proteins and environmental pollutants in 139 children ages 11.91 ± 4.2 y with high versus low air pollution exposures. We also measured metals in serum and CSF. MCMA children showed significantly higher serum actin IgG, occludin/zonulin 1 IgA, IgG, myelin oligodendrocyte glycoprotein IgG and IgM (p < 0.01), myelin basic protein IgA and IgG, S-100 IgG and IgM, and cerebellar IgG (p < 0.001). Serum IgG antibodies to formaldehyde, benzene, and bisphenol A, and concentrations of Ni and Cd were significantly higher in exposed children (p < 0.001). CSF MBP antibodies and nickel concentrations were higher in MCMA children (p = 0.03). Air pollution exposure damages epithelial and endothelial barriers and is a robust trigger of tight junction and neural antibodies. Cryptic 'self' tight junction antigens can trigger an autoimmune response potentially contributing to the neuroinflammatory and Alzheimer and Parkinson's pathology hallmarks present in megacity children. The major factor determining the impact of neural antibodies is the integrity of the blood-brain barrier. Defining the air pollution linkage of the brain/immune system interactions and damage to physical and immunological barriers with short and long term neural detrimental effects to children's brains ought to be of pressing importance for public health.

  14. The Role of Sphingolipids on Innate Immunity to Intestinal Salmonella Infection.

    Science.gov (United States)

    Huang, Fu-Chen

    2017-08-07

    Salmonella spp. remains a major public health problem for the whole world. To reduce the use of antimicrobial agents and drug-resistant Salmonella , a better strategy is to explore alternative therapy rather than to discover another antibiotic. Sphingolipid- and cholesterol-enriched lipid microdomains attract signaling proteins and orchestrate them toward cell signaling and membrane trafficking pathways. Recent studies have highlighted the crucial role of sphingolipids in the innate immunity against infecting pathogens. It is therefore mandatory to exploit the role of the membrane sphingolipids in the innate immunity of intestinal epithelia infected by this pathogen. In the present review, we focus on the role of sphingolipids in the innate immunity of intestinal epithelia against Salmonella infection, including adhesion, autophagy, bactericidal effect, barrier function, membrane trafficking, cytokine and antimicrobial peptide expression. The intervention of sphingolipid-enhanced foods to make our life healthy or pharmacological agents regulating sphingolipids is provided at the end.

  15. MiR-155-regulated molecular network orchestrates cell fate in the innate and adaptive immune response to Mycobacterium tuberculosis.

    Science.gov (United States)

    Rothchild, Alissa C; Sissons, James R; Shafiani, Shahin; Plaisier, Christopher; Min, Deborah; Mai, Dat; Gilchrist, Mark; Peschon, Jacques; Larson, Ryan P; Bergthaler, Andreas; Baliga, Nitin S; Urdahl, Kevin B; Aderem, Alan

    2016-10-11

    The regulation of host-pathogen interactions during Mycobacterium tuberculosis (Mtb) infection remains unresolved. MicroRNAs (miRNAs) are important regulators of the immune system, and so we used a systems biology approach to construct an miRNA regulatory network activated in macrophages during Mtb infection. Our network comprises 77 putative miRNAs that are associated with temporal gene expression signatures in macrophages early after Mtb infection. In this study, we demonstrate a dual role for one of these regulators, miR-155. On the one hand, miR-155 maintains the survival of Mtb-infected macrophages, thereby providing a niche favoring bacterial replication; on the other hand, miR-155 promotes the survival and function of Mtb-specific T cells, enabling an effective adaptive immune response. MiR-155-induced cell survival is mediated through the SH2 domain-containing inositol 5-phosphatase 1 (SHIP1)/protein kinase B (Akt) pathway. Thus, dual regulation of the same cell survival pathway in innate and adaptive immune cells leads to vastly different outcomes with respect to bacterial containment.

  16. Regulation of Tight Junctions in Upper Airway Epithelium

    Directory of Open Access Journals (Sweden)

    Takashi Kojima

    2013-01-01

    Full Text Available The mucosal barrier of the upper respiratory tract including the nasal cavity, which is the first site of exposure to inhaled antigens, plays an important role in host defense in terms of innate immunity and is regulated in large part by tight junctions of epithelial cells. Tight junction molecules are expressed in both M cells and dendritic cells as well as epithelial cells of upper airway. Various antigens are sampled, transported, and released to lymphocytes through the cells in nasal mucosa while they maintain the integrity of the barrier. Expression of tight junction molecules and the barrier function in normal human nasal epithelial cells (HNECs are affected by various stimuli including growth factor, TLR ligand, and cytokine. In addition, epithelial-derived thymic stromal lymphopoietin (TSLP, which is a master switch for allergic inflammatory diseases including allergic rhinitis, enhances the barrier function together with an increase of tight junction molecules in HNECs. Furthermore, respiratory syncytial virus infection in HNECs in vitro induces expression of tight junction molecules and the barrier function together with proinflammatory cytokine release. This paper summarizes the recent progress in our understanding of the regulation of tight junctions in the upper airway epithelium under normal, allergic, and RSV-infected conditions.

  17. Desmoglein 2 regulates the intestinal epithelial barrier via p38 mitogen-activated protein kinase.

    Science.gov (United States)

    Ungewiß, Hanna; Vielmuth, Franziska; Suzuki, Shintaro T; Maiser, Andreas; Harz, Hartmann; Leonhardt, Heinrich; Kugelmann, Daniela; Schlegel, Nicolas; Waschke, Jens

    2017-07-24

    Intestinal epithelial barrier properties are maintained by a junctional complex consisting of tight junctions (TJ), adherens junctions (AJ) and desmosomes. Desmoglein 2 (Dsg2), an adhesion molecule of desmosomes and the only Dsg isoform expressed in enterocytes, is required for epithelial barrier properties and may contribute to barrier defects in Crohn's disease. Here, we identified extradesmosomal Dsg2 on the surface of polarized enterocytes by Triton extraction, confocal microscopy, SIM and STED. Atomic force microscopy (AFM) revealed Dsg2-specific binding events along the cell border on the surface of enterocytes with a mean unbinding force of around 30pN. Binding events were blocked by an inhibitory antibody targeting Dsg2 which under same conditions activated p38MAPK but did not reduce cell cohesion. In enterocytes deficient for Dsg2, p38MAPK activity was reduced and both barrier integrity and reformation were impaired. Dsc2 rescue did not restore p38MAPK activity indicating that Dsg2 is required. Accordingly, direct activation of p38MAPK in Dsg2-deficient cells enhanced barrier reformation demonstrating that Dsg2-mediated activation of p38MAPK is crucial for barrier function. Collectively, our data show that Dsg2, beside its adhesion function, regulates intestinal barrier function via p38MAPK signalling. This is in contrast to keratinocytes and points towards tissue-specific signalling functions of desmosomal cadherins.

  18. Immune-regulating effects of exercise on cigarette smoke-induced inflammation

    Science.gov (United States)

    Madani, Ashkan; Alack, Katharina; Richter, Manuel Jonas; Krüger, Karsten

    2018-01-01

    Long-term cigarette smoking (LTCS) represents an important risk factor for cardiac infarction and stroke and the central risk factor for the development of a bronchial carcinoma, smoking-associated interstitial lung fibrosis, and chronic obstructive pulmonary disease. The pathophysiologic development of these diseases is suggested to be promoted by chronic and progressive inflammation. Cigarette smoking induces repetitive inflammatory insults followed by a chronic and progressive activation of the immune system. In the pulmonary system of cigarette smokers, oxidative stress, cellular damage, and a chronic activation of pattern recognition receptors are described which are followed by the translocation of the NF-kB, the release of pro-inflammatory cytokines, chemokines, matrix metalloproteases, and damage-associated molecular patterns. In parallel, smoke pollutants cross directly through the alveolus–capillary interface and spread through the systemic bloodstream targeting different organs. Consequently, LTCS induces a systemic low-grade inflammation and increased oxidative stress in the vascular system. In blood, these processes promote an increased coagulation and endothelial dysfunction. In muscle tissue, inflammatory processes activate catabolic signaling pathways followed by muscle wasting and sarcopenia. In brain, several characteristics of neuroinflammation were described. Regular exercise training has been shown to be an effective nonpharmacological treatment strategy in smoke-induced pulmonary diseases. It is well established that exercise training exerts immune-regulating effects by activating anti-inflammatory signaling pathways. In this regard, the release of myokines from contracting skeletal muscle, the elevations of cortisol and adrenalin, the reduced expression of Toll-like receptors, and the increased mobilization of immune-regulating leukocyte subtypes might be of vital importance. Exercise training also increases the local and systemic

  19. Insight into the mechanisms regulating immune homeostasis in health and disease.

    Science.gov (United States)

    Sirisinha, Stitaya

    2011-03-01

    Innate and adaptive immune systems consist of cells and molecules that work together in concert to fight against microbial infection and maintain homeostasis. Hosts encounter microbes / exogenous pathogen-associated molecular patterns (PAMPs) and endogenous damage-associated molecular patterns (DAMPs) all the time and they must have proper mechanisms to counteract the danger such that appropriate responses (e.g., degree of inflammation and types of mediators induced) can be mounted in different scenarios. Increasing numbers of endogenous danger signals of host origin are being identified including, for example, uric acid and cholesterol crystals, high mobility group box1 (HMGB1) protein, oxidized LDL, vesicans, heat shock proteins (HSPs) and self DNA. Many of these endogenous ligands have been shown to be associated with inflammation-related diseases like atherosclerosis, gout and type 2 diabetes. Several DAMPs appear to have the ability to interact with more than one receptor. We are now beginning to understand how the immune system can distinguish infection from endogenous ligands elaborated following cellular insults and tissue damage. Appropriate responses to maintain the homeostatic state in health and disease depend largely on the recognition and response to these stimuli by germline encoded pattern-recognition receptors (PRRs) present on both immune and non-immune cells. These receptors are, for example, Toll-like receptors (TLRs), C-type lectin receptors (CLRs) and cytosolic receptors (e.g., RLRs, NLRs and some intracellular DNA sensors). Atypical PRR "danger" receptors, like the receptor for advanced glycation end products (RAGE) and their ligands have been identified. A proper response to maintain homeostasis relies on specific negative regulators and regulatory pathways to dampen its response to tissue injury while maintaining the capacity to eliminate infection and induce proper tissue repair. Moreover, some PRRs (e.g., TLR2,TLR4 and NLRP3) and atypical

  20. Serotonergic Chemosensory Neurons Modify the C. elegans Immune Response by Regulating G-Protein Signaling in Epithelial Cells

    Science.gov (United States)

    Anderson, Alexandra; Laurenson-Schafer, Henry; Partridge, Frederick A.; Hodgkin, Jonathan; McMullan, Rachel

    2013-01-01

    The nervous and immune systems influence each other, allowing animals to rapidly protect themselves from changes in their internal and external environment. However, the complex nature of these systems in mammals makes it difficult to determine how neuronal signaling influences the immune response. Here we show that serotonin, synthesized in Caenorhabditis elegans chemosensory neurons, modulates the immune response. Serotonin released from these cells acts, directly or indirectly, to regulate G-protein signaling in epithelial cells. Signaling in these cells is required for the immune response to infection by the natural pathogen Microbacterium nematophilum. Here we show that serotonin signaling suppresses the innate immune response and limits the rate of pathogen clearance. We show that C. elegans uses classical neurotransmitters to alter the immune response. Serotonin released from sensory neurons may function to modify the immune system in response to changes in the animal's external environment such as the availability, or quality, of food. PMID:24348250

  1. Parent opinions about use of text messaging for immunization reminders.

    Science.gov (United States)

    Ahlers-Schmidt, Carolyn Rose; Chesser, Amy K; Paschal, Angelia M; Hart, Traci A; Williams, Katherine S; Yaghmai, Beryl; Shah-Haque, Sapna

    2012-06-06

    Adherence to childhood immunization schedules is a function of various factors. Given the increased use of technology as a strategy to increase immunization coverage, it is important to investigate how parents perceive different forms of communication, including traditional means and text-message reminders. To examine current forms of communication about immunization information, parents' satisfaction levels with these communication modes, perceived barriers and benefits to using text messaging, and the ideal content of text messages for immunization reminders. Structured interviews were developed and approved by two Institutional Review Boards. A convenience sample of 50 parents was recruited from two local pediatric clinics. The study included a demographics questionnaire, the shortened form of the Test of Functional Health Literacy for Adults (S-TOFHLA), questions regarding benefits and barriers of text communication from immunization providers, and preferred content for immunization reminders. Content analyses were performed on responses to barriers, benefits, and preferred content (all Cohen's kappas > 0.70). Respondents were mostly female (45/50, 90%), white non-Hispanic (31/50, 62%), between 20-41 years (mean = 29, SD 5), with one or two children (range 1-9). Nearly all (48/50, 96%) had an S-TOFHLA score in the "adequate" range. All parents (50/50, 100%) engaged in face-to-face contact with their child's physician at appointments, 74% (37/50) had contact via telephone, and none of the parents (0/50, 0%) used email or text messages. Most parents were satisfied with the face-to-face (48/50, 96%) and telephone (28/50, 75%) communication. Forty-nine of the 50 participants (98%) were interested in receiving immunization reminders by text message, and all parents (50/50, 100%) were willing to receive general appointment reminders by text message. Parents made 200 comments regarding text-message reminders. Benefits accounted for 63.5% of comments (127/200). The

  2. CD8(+)NKT-like cells regulate the immune response by killing antigen-bearing DCs.

    Science.gov (United States)

    Wang, Chao; Liu, Xi; Li, Zhengyuan; Chai, Yijie; Jiang, Yunfeng; Wang, Qian; Ji, Yewei; Zhu, Zhongli; Wan, Ying; Yuan, Zhenglong; Chang, Zhijie; Zhang, Minghui

    2015-09-15

    CD1d-dependent NKT cells have been extensively studied; however, the function of CD8(+)NKT-like cells, which are CD1d-independent T cells with NK markers, remains unknown. Here, we report that CD1d-independent CD8(+)NKT-like cells, which express both T cell markers (TCRβ and CD3) and NK cell receptors (NK1.1, CD49b and NKG2D), are activated and significantly expanded in mice immunized with GFP-expressing dendritic cells. Distinct from CD1d-dependent NKT cells, CD8(+)NKT-like cells possess a diverse repertoire of TCRs and secrete high levels of IFN-gamma but not IL-4. CD8(+)NKT-like cell development is normal in CD1d(-/-) mice, which suggests that CD8(+)NKT-like cells undergo a unique development pathway that differs from iNKT cells. Further functional analyses show that CD8(+)NKT-like cells suppress T-cell responses through elimination of dendritic cells in an antigen-specific manner. Adoptive transfer of antigen-specific CD8(+)NKT-like cells into RIP-OVA mice prevented subsequent development of diabetes in the animals induced by activated OT-I CD8 T cells. Our study suggests that CD8(+)NKT-like cells can function as antigen-specific suppressive cells to regulate the immune response through killing antigen-bearing DCs. Antigen-specific down regulation may provide an active and precise method for constraining an excessive immune response and avoiding bypass suppression of necessary immune responses to other antigens.

  3. CD8+NKT-like cells regulate the immune response by killing antigen-bearing DCs

    Science.gov (United States)

    Wang, Chao; Liu, Xi; Li, Zhengyuan; Chai, Yijie; Jiang, Yunfeng; Wang, Qian; Ji, Yewei; Zhu, Zhongli; Wan, Ying; Yuan, Zhenglong; Chang, Zhijie; Zhang, Minghui

    2015-01-01

    CD1d-dependent NKT cells have been extensively studied; however, the function of CD8+NKT-like cells, which are CD1d-independent T cells with NK markers, remains unknown. Here, we report that CD1d-independent CD8+NKT-like cells, which express both T cell markers (TCRβ and CD3) and NK cell receptors (NK1.1, CD49b and NKG2D), are activated and significantly expanded in mice immunized with GFP-expressing dendritic cells. Distinct from CD1d-dependent NKT cells, CD8+NKT-like cells possess a diverse repertoire of TCRs and secrete high levels of IFN-gamma but not IL-4. CD8+NKT-like cell development is normal in CD1d−/− mice, which suggests that CD8+NKT-like cells undergo a unique development pathway that differs from iNKT cells. Further functional analyses show that CD8+NKT-like cells suppress T-cell responses through elimination of dendritic cells in an antigen-specific manner. Adoptive transfer of antigen-specific CD8+NKT-like cells into RIP-OVA mice prevented subsequent development of diabetes in the animals induced by activated OT-I CD8 T cells. Our study suggests that CD8+NKT-like cells can function as antigen-specific suppressive cells to regulate the immune response through killing antigen-bearing DCs. Antigen-specific down regulation may provide an active and precise method for constraining an excessive immune response and avoiding bypass suppression of necessary immune responses to other antigens. PMID:26369936

  4. Trauma-Induced Heterotopic Ossification Regulates the Blood-Nerve Barrier

    Directory of Open Access Journals (Sweden)

    Zbigniew Gugala

    2018-06-01

    Full Text Available De novo bone formation can occur in soft tissues as a result of traumatic injury. This process, known as heterotopic ossification (HO, has recently been linked to the peripheral nervous system. Studies suggest that HO may resemble neural crest-derived bone formation and is activated through the release of key bone matrix proteins leading to opening of the blood-nerve barrier (BNB. One of the first steps in this process is the activation of a neuro-inflammatory cascade, which results in migration of chondro-osseous progenitors, and other cells from both the endoneurial and perineurial regions of the peripheral nerves. The perineurial cells undergo brown adipogenesis, to form essential support cells, which regulate expression and activation of matrix metallopeptidase 9 (MMP9 an essential regulatory protein involved in opening the BNB. However, recent studies suggest that, in mice, a key bone matrix protein, bone morphogenetic protein 2 (BMP2 is able to immediately cross the BNB to activate signaling in specific cells within the endoneurial compartment. BMP signaling correlates with bone formation and appears critical for the induction of HO. Surprisingly, several other bone matrix proteins have also been reported to regulate the BNB, leading us to question whether these matrix proteins are important in regulating the BNB. However, this temporary regulation of the BNB does not appear to result in degeneration of the peripheral nerve, but rather may represent one of the first steps in innervation of the newly forming bone.

  5. The essential role of G protein-coupled receptor (GPCR) signaling in regulating T cell immunity.

    Science.gov (United States)

    Wang, Dashan

    2018-06-01

    The aim of this paper is to clarify the critical role of GPCR signaling in T cell immunity. The G protein-coupled receptors (GPCRs) are the most common targets in current pharmaceutical industry, and represent the largest and most versatile family of cell surface communicating molecules. GPCRs can be activated by a diverse array of ligands including neurotransmitters, chemokines as well as sensory stimuli. Therefore, GPCRs are involved in many key cellular and physiological processes, such as sense of light, taste and smell, neurotransmission, metabolism, endocrine and exocrine secretion. In recent years, GPCRs have been found to play an important role in immune system. T cell is an important type of immune cell, which plays a central role in cell-mediated immunity. A variety of GPCRs and their signaling mediators (RGS proteins, GRKs and β-arrestin) have been found to express in T cells and involved T cell-mediated immunity. We will summarize the role of GPCR signaling and their regulatory molecules in T cell activation, homeostasis and function in this article. GPCR signaling plays an important role in T cell activation, homeostasis and function. GPCR signaling is critical in regulating T cell immunity.

  6. Functional analysis of PGRP-LA in Drosophila immunity.

    Directory of Open Access Journals (Sweden)

    Mathilde Gendrin

    Full Text Available PeptidoGlycan Recognition Proteins (PGRPs are key regulators of the insect innate antibacterial response. Even if they have been intensively studied, some of them have yet unknown functions. Here, we present a functional analysis of PGRP-LA, an as yet uncharacterized Drosophila PGRP. The PGRP-LA gene is located in cluster with PGRP-LC and PGRP-LF, which encode a receptor and a negative regulator of the Imd pathway, respectively. Structure predictions indicate that PGRP-LA would not bind to peptidoglycan, pointing to a regulatory role of this PGRP. PGRP-LA expression was enriched in barrier epithelia, but low in the fat body. Use of a newly generated PGRP-LA deficient mutant indicates that PGRP-LA is not required for the production of antimicrobial peptides by the fat body in response to a systemic infection. Focusing on the respiratory tract, where PGRP-LA is strongly expressed, we conducted a genome-wide microarray analysis of the tracheal immune response of wild-type, Relish, and PGRP-LA mutant larvae. Comparing our data to previous microarray studies, we report that a majority of genes regulated in the trachea upon infection differ from those induced in the gut or the fat body. Importantly, antimicrobial peptide gene expression was reduced in the tracheae of larvae and in the adult gut of PGRP-LA-deficient Drosophila upon oral bacterial infection. Together, our results suggest that PGRP-LA positively regulates the Imd pathway in barrier epithelia.

  7. RFX Transcription Factor DAF-19 Regulates 5-HT and Innate Immune Responses to Pathogenic Bacteria in Caenorhabditis elegans

    Science.gov (United States)

    Choi, Sunju; Xu, Lu; Sze, Ji Ying

    2013-01-01

    In Caenorhabditis elegans the Toll-interleukin receptor domain adaptor protein TIR-1 via a conserved mitogen-activated protein kinase (MAPK) signaling cascade induces innate immunity and upregulates serotonin (5-HT) biosynthesis gene tph-1 in a pair of ADF chemosensory neurons in response to infection. Here, we identify transcription factors downstream of the TIR-1 signaling pathway. We show that common transcription factors control the innate immunity and 5-HT biosynthesis. We demonstrate that a cysteine to tyrosine substitution in an ARM motif of the HEAT/Arm repeat region of the TIR-1 protein confers TIR-1 hyperactivation, leading to constitutive tph-1 upregulation in the ADF neurons, increased expression of intestinal antimicrobial genes, and enhanced resistance to killing by the human opportunistic pathogen Pseudomonas aeruginosa PA14. A forward genetic screen for suppressors of the hyperactive TIR-1 led to the identification of DAF-19, an ortholog of regulatory factor X (RFX) transcription factors that are required for human adaptive immunity. We show that DAF-19 concerts with ATF-7, a member of the activating transcription factor (ATF)/cAMP response element-binding B (CREB) family of transcription factors, to regulate tph-1 and antimicrobial genes, reminiscent of RFX-CREB interaction in human immune cells. daf-19 mutants display heightened susceptibility to killing by PA14. Remarkably, whereas the TIR-1-MAPK-DAF-19/ATF-7 pathway in the intestinal immunity is regulated by DKF-2/protein kinase D, we found that the regulation of tph-1 expression is independent of DKF-2 but requires UNC-43/Ca2+/calmodulin-dependent protein kinase (CaMK) II. Our results suggest that pathogenic cues trigger a common core-signaling pathway via tissue-specific mechanisms and demonstrate a novel role for RFX factors in neuronal and innate immune responses to infection. PMID:23505381

  8. Induced ER-chaperones regulate a novel receptor-like kinase to mediate a viral innate immune response

    Science.gov (United States)

    Caplan, Jeffrey L.; Zhu, Xiaohong; Mamillapalli, Padmavathi; Marathe, Rajendra; Anandalakshmi, Radhamani; Dinesh-Kumar, S. P.

    2009-01-01

    Summary The plant innate immune response requires a rapid, global reprogramming of cellular processes. Here we employed two complementary proteomic methods, two-dimensional differential in-gel electrophoresis (2D-DIGE) and iTRAQ, to identify differentially regulated proteins early during a defense response. Besides defense-related proteins, the constituents of the largest category of up-regulated proteins were cytoplasmic- and endoplasmic reticulum (ER)-residing molecular chaperones. Silencing of ER-resident protein disulfide isomerases, NbERp57 and NbP5, and the calreticulins, NbCRT2 and NbCRT3, lead to a partial loss of N immune receptor-mediated defense against Tobacco mosaic virus (TMV). Furthermore, NbCRT2 and NbCRT3 are required for the expression of a novel induced receptor-like kinase (IRK). IRK is a plasma membrane-localized protein required for the N-mediated hypersensitive response programmed cell death (HR-PCD) and resistance to TMV. These data support a model in which ER-resident chaperones are required for the accumulation of membrane bound or secreted proteins that are necessary for innate immunity. PMID:19917500

  9. Impact of exogenous lipase supplementation on growth, intestinal function, mucosal immune and physical barrier, and related signaling molecules mRNA expression of young grass carp (Ctenopharyngodon idella).

    Science.gov (United States)

    Liu, Sen; Feng, Lin; Jiang, Wei-Dan; Liu, Yang; Jiang, Jun; Wu, Pei; Zeng, Yun-Yun; Xu, Shu-De; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Zhou, Xiao-Qiu

    2016-08-01

    This study investigated the effects of exogenous lipase supplementation on the growth performance, intestinal growth and function, immune response and physical barrier function, and related signaling molecules mRNA expression of young grass carp (Ctenopharyngodon idella). A total of 450 grass carp (255.02 ± 0.34 g) were fed five diets for 60 days. There were 5 dietary treatments that included a normal protein and lipid diet containing 30% crude protein (CP) with 5% ether extract (EE), and the low-protein and high-lipid diets (28% CP, 6% EE) supplemented with graded levels of exogenous lipase supplementation activity at 0, 1193, 2560 and 3730 U/kg diet. The results indicated that compared with a normal protein and lipid diet (30% CP, 5% EE), a low-protein and high-lipid diet (28% CP, 6% EE) (un-supplemented lipase) improved lysozyme activities and complement component 3 contents in the distal intestine (DI), interleukin 10 mRNA expression in the proximal intestine (PI), and glutathione S-transferases activity and glutathione content in the intestine of young grass carp. In addition, in low-protein and high-lipid diets, optimal exogenous lipase supplementation significantly increased acid phosphatase (ACP) activities and complement component 3 (C3) contents (P exogenous lipase supplementation significantly decreased reactive oxygen species (ROS), malondialdehyde (MDA) and protein carbonyl (PC) contents (P exogenous lipase supplementation significantly elevated the mRNA levels of tight junction proteins (Occludin, zonula occludens 1, Claudin b, Claudin c and Claudin 3) (P exogenous lipase supplementation improved growth, intestinal growth and function, intestinal immunity, physical barrier, and regulated the mRNA expression of related signal molecules of fish. The optimal level of exogenous lipase supplementation in young grass carp (255-771 g) was estimated to be 1193 U kg(-1) diet. Copyright © 2016. Published by Elsevier Ltd.

  10. Functional analysis of Arabidopsis immune-related MAPKs uncovers a role for MPK3 as negative regulator of inducible defences

    KAUST Repository

    Frei dit Frey, Nicolas

    2014-06-30

    Background Mitogen-activated protein kinases (MAPKs) are key regulators of immune responses in animals and plants. In Arabidopsis, perception of microbe-associated molecular patterns (MAMPs) activates the MAPKs MPK3, MPK4 and MPK6. Increasing information depicts the molecular events activated by MAMPs in plants, but the specific and cooperative contributions of the MAPKs in these signalling events are largely unclear. Results In this work, we analyse the behaviour of MPK3, MPK4 and MPK6 mutants in early and late immune responses triggered by the MAMP flg22 from bacterial flagellin. A genome-wide transcriptome analysis reveals that 36% of the flg22-upregulated genes and 68% of the flg22-downregulated genes are affected in at least one MAPK mutant. So far MPK4 was considered as a negative regulator of immunity, whereas MPK3 and MPK6 were believed to play partially redundant positive functions in defence. Our work reveals that MPK4 is required for the regulation of approximately 50% of flg22-induced genes and we identify a negative role for MPK3 in regulating defence gene expression, flg22-induced salicylic acid accumulation and disease resistance to Pseudomonas syringae. Among the MAPK-dependent genes, 27% of flg22-upregulated genes and 76% of flg22-downregulated genes require two or three MAPKs for their regulation. The flg22-induced MAPK activities are differentially regulated in MPK3 and MPK6 mutants, both in amplitude and duration, revealing a highly interdependent network. Conclusions These data reveal a new set of distinct functions for MPK3, MPK4 and MPK6 and indicate that the plant immune signalling network is choreographed through the interplay of these three interwoven MAPK pathways.

  11. C/EBPβ Promotes Immunity to Oral Candidiasis through Regulation of β-Defensins.

    Science.gov (United States)

    Simpson-Abelson, Michelle R; Childs, Erin E; Ferreira, M Carolina; Bishu, Shrinivas; Conti, Heather R; Gaffen, Sarah L

    2015-01-01

    Humans or mice subjected to immunosuppression, such as corticosteroids or anti-cytokine biologic therapies, are susceptible to mucosal infections by the commensal fungus Candida albicans. Recently it has become evident that the Th17/IL-17 axis is essential for immunity to candidiasis, but the downstream events that control immunity to this fungus are poorly understood. The CCAAT/Enhancer Binding Protein-β (C/EBPβ) transcription factor is important for signaling by multiple inflammatory stimuli, including IL-17. C/EBPβ is regulated in a variety of ways by IL-17, and controls several downstream IL-17 target genes. However, the role of C/EBPβ in vivo is poorly understood, in part because C/EBPβ-deficient mice are challenging to breed and work with. In this study, we sought to understand the role of C/EBPβ in the context of an IL-17-dependent immune response, using C. albicans infection as a model system. Confirming prior findings, we found that C/EBPβ is required for immunity to systemic candidiasis. In contrast, C/EBPβ(-/-) mice were resistant to oropharyngeal candidiasis (OPC), in a manner indistinguishable from immunocompetent WT mice. However, C/EBPβ(-/-) mice experienced more severe OPC than WT mice in the context of cortisone-induced immunosuppression. Expression of the antimicrobial peptide β-defensin (BD)-3 correlated strongly with susceptibility in C/EBPβ(-/-) mice, but no other IL-17-dependent genes were associated with susceptibility. Therefore, C/EBPβ contributes to immunity to mucosal candidiasis during cortisone immunosuppression in a manner linked to β-defensin 3 expression, but is apparently dispensable for the IL-17-dependent response.

  12. Alternatives to conventional vaccines--mediators of innate immunity.

    Science.gov (United States)

    Eisen, D P; Liley, H G; Minchinton, R M

    2004-01-01

    Vaccines have been described as "weapons of mass protection". The eradication of many diseases is testament to their utility and effectiveness. Nevertheless, many vaccine preventable diseases remain prevalent because of political and economic barriers. Additionally, the effects of immaturity and old age, therapies that incapacitate the adaptive immune system and the multitude of strategies evolved by pathogens to evade immediate or sustained recognition by the mammalian immune system are barriers to the effectiveness of existing vaccines or development of new vaccines. In the front line of defence against the pervasiness of infection are the elements of the innate immune system. Innate immunity is under studied and poorly appreciated. However, in the first days after entry of a pathogen into the body, our entire protective response is dependant upon the various elements of our innate immune repertoire. In spite of its place as our initial defence against infection, attention is only now turning to strategies which enhance or supplement innate immunity. This review examines the need for and potential of innate immune therapies.

  13. MiR-155–regulated molecular network orchestrates cell fate in the innate and adaptive immune response to Mycobacterium tuberculosis

    Science.gov (United States)

    Rothchild, Alissa C.; Sissons, James R.; Shafiani, Shahin; Plaisier, Christopher; Min, Deborah; Mai, Dat; Gilchrist, Mark; Peschon, Jacques; Larson, Ryan P.; Bergthaler, Andreas; Baliga, Nitin S.; Urdahl, Kevin B.; Aderem, Alan

    2016-01-01

    The regulation of host–pathogen interactions during Mycobacterium tuberculosis (Mtb) infection remains unresolved. MicroRNAs (miRNAs) are important regulators of the immune system, and so we used a systems biology approach to construct an miRNA regulatory network activated in macrophages during Mtb infection. Our network comprises 77 putative miRNAs that are associated with temporal gene expression signatures in macrophages early after Mtb infection. In this study, we demonstrate a dual role for one of these regulators, miR-155. On the one hand, miR-155 maintains the survival of Mtb-infected macrophages, thereby providing a niche favoring bacterial replication; on the other hand, miR-155 promotes the survival and function of Mtb-specific T cells, enabling an effective adaptive immune response. MiR-155–induced cell survival is mediated through the SH2 domain-containing inositol 5-phosphatase 1 (SHIP1)/protein kinase B (Akt) pathway. Thus, dual regulation of the same cell survival pathway in innate and adaptive immune cells leads to vastly different outcomes with respect to bacterial containment. PMID:27681624

  14. Tribbles ortholog NIPI-3 and bZIP transcription factor CEBP-1 regulate a Caenorhabditis elegans intestinal immune surveillance pathway.

    Science.gov (United States)

    McEwan, Deborah L; Feinbaum, Rhonda L; Stroustrup, Nicholas; Haas, Wilhelm; Conery, Annie L; Anselmo, Anthony; Sadreyev, Ruslan; Ausubel, Frederick M

    2016-12-07

    Many pathogens secrete toxins that target key host processes resulting in the activation of immune pathways. The secreted Pseudomonas aeruginosa toxin Exotoxin A (ToxA) disrupts intestinal protein synthesis, which triggers the induction of a subset of P. aeruginosa-response genes in the nematode Caenorhabditis elegans. We show here that one ToxA-induced C. elegans gene, the Tribbles pseudokinase ortholog nipi-3, is essential for host survival following exposure to P. aeruginosa or ToxA. We find that NIPI-3 mediates the post-developmental expression of intestinal immune genes and proteins and primarily functions in parallel to known immune pathways, including p38 MAPK signaling. Through mutagenesis screening, we identify mutants of the bZIP C/EBP transcription factor cebp-1 that suppress the hypersusceptibility defects of nipi-3 mutants. NIPI-3 is a negative regulator of CEBP-1, which in turn negatively regulates protective immune mechanisms. This pathway represents a previously unknown innate immune signaling pathway in intestinal epithelial cells that is involved in the surveillance of cellular homeostasis. Because NIPI-3 and CEBP-1 are also essential for C. elegans development, NIPI-3 is analogous to other key innate immune signaling molecules such as the Toll receptors in Drosophila that have an independent role during development.

  15. Notch1 Signaling Regulates the Th17/Treg Immune Imbalance in Patients with Psoriasis Vulgaris.

    Science.gov (United States)

    Ma, Lei; Xue, HaiBo; Gao, Tianqin; Gao, MeiLan; Zhang, YuJie

    2018-01-01

    To evaluate the regulating effect of Notch1 signaling on Th17/Treg immune imbalance in psoriasis vulgaris (PV). Notch1, Hes-1, ROR γ t, Foxp3, IL-17, and IL-10 mRNA expression, as well as Th17 and Treg cell percentages in peripheral CD4 + T cells, were detected by real-time quantitative RT-PCR and flow cytometry, and serum concentrations of IL-17 and IL-10 were detected by ELISA in 36 PV patients and 32 healthy controls. Additionally, CD4 + T cells from 12 PV patients were treated with γ -secretase inhibitor DAPT, and the above indexes were measured. PV patients presented distinct Th17/Treg immune imbalance and highly expressed Notch1 and Hes-1 mRNA levels, which were positively correlated with psoriasis area and severity index (PASI) and the ratios of Th17/Treg and ROR γ t/Foxp3. DAPT treatment resulted in the obvious downregulation of Th17 cell percentage in cocultured CD4 + T cells, ROR γ t and IL-17 mRNA levels, and IL-17 concentration in cell-free supernatant from cocultured CD4 + T cells of PV patients in a dose-dependent manner, while there was no significant influence on Treg cell percentage, Foxp3, and IL-10 expression, therefore leading to the recovery of Th17/Treg immune imbalance. Notch1 signaling may contribute to the pathogenesis of PV by regulating Th17/Treg immune imbalance.

  16. Consequences of bisphenol a perinatal exposure on immune responses and gut barrier function in mice.

    Science.gov (United States)

    Malaisé, Yann; Ménard, Sandrine; Cartier, Christel; Lencina, Corinne; Sommer, Caroline; Gaultier, Eric; Houdeau, Eric; Guzylack-Piriou, Laurence

    2018-01-01

    The potent immunomodulatory effect of the endocrine disruptor bisphenol A during development and consequences during life span are of increasing concern. Particular interests have been raised from animal studies regarding the risk of developing food intolerance and infection. We aimed to identify immune disorders in mice triggered by perinatal exposure to bisphenol A. Gravid mice were orally exposed to bisphenol (50 μg/kg body weight/day) from day 15 of pregnancy until weaning. Gut barrier function, local and systemic immunity were assessed in adult female offspring. Mice perinatally exposed to bisphenol showed a decrease in ileal lysozyme expression and a fall of fecal antimicrobial activity. In offspring mice exposed to bisphenol, an increase in colonic permeability was observed associated with an increase in interferon-γ level and a drop of colonic IgA + cells and fecal IgA production. Interestingly, altered frequency of innate lymphoid cells type 3 occurred in the small intestine, with an increase in IgG response against commensal bacteria in sera. These effects were related to a defect in dendritic cell maturation in the lamina propria and spleen. Activated and regulatory T cells were decreased in the lamina propria. Furthermore, perinatal exposure to bisphenol promoted a sharp increase in interferon-γ and interleukin-17 production in the intestine and elicited a T helper 17 profile in the spleen. To conclude, perinatal exposure to bisphenol weakens protective and regulatory immune functions in the intestine and at systemic level in adult offspring. The increased susceptibility to inflammatory response is an interesting lead supporting bisphenol-mediated adverse consequences on food reactions and infections.

  17. Arabidopsis AtERF15 positively regulates immunity against Pseudomonas syringae pv. tomato DC3000 and Botrytis cinerea

    Directory of Open Access Journals (Sweden)

    Huijuan eZhang

    2015-09-01

    Full Text Available Upon pathogen infection, activation of immune response requires effective transcriptional reprogramming that regulates inducible expression of a large set of defense genes. A number of ethylene-responsive factor transcription factors have been shown to play critical roles in regulating immune responses in plants. In the present study, we explored the functions of Arabidopsis AtERF15 in immune responses against Pseudomonas syringae pv. tomato (Pst DC3000, a (hemibiotrophic bacterial pathogen, and Botrytis cinerea, a necrotrophic fungal pathogen. Expression of AtERF15 was induced by infection of Pst DC3000 and B. cinerea and by treatments with salicylic acid (SA and methyl jasmonate. Biochemical assays demonstrated that AtERF15 is a nucleus-localized transcription activator. The AtERF15-overexpressing (AtERF15-OE plants displayed enhanced resistance while the AtERF15-RNAi plants exhibited decreased resistance against Pst DC3000 and B. cinerea. Meanwhile, Pst DC3000- or B. cinerea-induced expression of defense genes was upregulated in AtERF15-OE plants but downregulated in AtERF15-RNAi plants, as compared to the expression in wild type plants. In response to infection with B. cinerea, the AtERF15-OE plants accumulated less reactive oxygen species (ROS while the AtERF15-RNAi plants accumulated more ROS. The flg22- and chitin-induced oxidative burst was abolished and expression levels of the pattern-triggered immunity-responsive genes AtFRK1 and AtWRKY53 were suppressed in AtER15-RNAi plants upon treatment with flg22 or chitin. Furthermore, SA-induced defense response was also partially impaired in the AtERF15-RNAi plants. These data demonstrate that AtERF15 is a positive regulator of multiple layers of the immune responses in Arabidopsis.

  18. Exercise and the Regulation of Immune Functions.

    Science.gov (United States)

    Simpson, Richard J; Kunz, Hawley; Agha, Nadia; Graff, Rachel

    2015-01-01

    Exercise has a profound effect on the normal functioning of the immune system. It is generally accepted that prolonged periods of intensive exercise training can depress immunity, while regular moderate intensity exercise is beneficial. Single bouts of exercise evoke a striking leukocytosis and a redistribution of effector cells between the blood compartment and the lymphoid and peripheral tissues, a response that is mediated by increased hemodynamics and the release of catecholamines and glucocorticoids following the activation of the sympathetic nervous system and the hypothalamic-pituitary-adrenal axis. Single bouts of prolonged exercise may impair T-cell, NK-cell, and neutrophil function, alter the Type I and Type II cytokine balance, and blunt immune responses to primary and recall antigens in vivo. Elite athletes frequently report symptoms associated with upper respiratory tract infections (URTI) during periods of heavy training and competition that may be due to alterations in mucosal immunity, particularly reductions in secretory immunoglobulin A. In contrast, single bouts of moderate intensity exercise are "immuno-enhancing" and have been used to effectively increase vaccine responses in "at-risk" patients. Improvements in immunity due to regular exercise of moderate intensity may be due to reductions in inflammation, maintenance of thymic mass, alterations in the composition of "older" and "younger" immune cells, enhanced immunosurveillance, and/or the amelioration of psychological stress. Indeed, exercise is a powerful behavioral intervention that has the potential to improve immune and health outcomes in the elderly, the obese, and patients living with cancer and chronic viral infections such as HIV. © 2015 Elsevier Inc. All rights reserved.

  19. Genotype-Specific Regulation of Oral Innate Immunity by T2R38 Taste Receptor

    Science.gov (United States)

    Gil, Sucheol; Coldwell, Susan; Drury, Jeanie L.; Arroyo, Fabiola; Phi, Tran; Saadat, Sanaz; Kwong, Danny; Chung, Whasun Oh

    2015-01-01

    The bitter taste receptor T2R38 has been shown to regulate mucosal innate immune responses in the upper airway epithelium. Furthermore, SNPs in T2R38 influence the sensitivity to 6-n-propylthiouracil (PROP) and are associated with caries risk/protection. However, no study has been reported on the role of T2R38 in the innate immune responses to oral bacteria. We hypothesize that T2R38 regulates oral innate immunity and that this regulation is genotype-specific. Primary gingival epithelial cells carrying three common genotypes, PAV/PAV (PROP super-taster), AVI/PAV (intermediate) and AVI/AVI (non-taster) were stimulated with cariogenic bacteria Streptococcus mutans, periodontal pathogen Porphyromonas gingivalis or non-pathogen Fusobacterium nucleatum. QRT-PCR analyzed T2R38 mRNA, and T2R38-specific siRNA and ELISA were utilized to evaluate induction of hBD-2 (antimicrobial peptide), IL-1α and IL-8 in various donor-lines. Experiments were set up in duplicate and repeated three times. T2R38 mRNA induction in response to S. mutans was highest in PAV/PAV (4.3-fold above the unstimulated controls; p<0.05), while lowest in AVI/AVI (1.2-fold). In PAV/PAV, hBD-2 secretion in response to S. mutans was decreased by 77% when T2R38 was silenced. IL-1α secretion was higher in PAV/PAV compared to AVI/PAV or AVI/AVI with S. mutans stimulation, but it was reduced by half when T2R38 was silenced (p<0.05). In response to P. gingivalis, AVI/AVI showed 4.4-fold increase (p<0.05) in T2R38 expression, whereas the levels in PAV/PAV and AVI/PAV remained close to that of the controls. Secretion levels of IL-1α and IL-8 decreased in AVI/AVI in response to P. gingivalis when T2R38 was silenced (p<0.05), while the changes were not significant in PAV/PAV. Our data suggest that the regulation of gingival innate immunity by T2R38 is genotype-dependent and that the ability to induce a high level of hBD-2 by PAV/PAV carriers may be a reason for protection against caries in this group. PMID

  20. SMAD regulatory networks construct a balanced immune system.

    Science.gov (United States)

    Malhotra, Nidhi; Kang, Joonsoo

    2013-05-01

    A balanced immune response requires combating infectious assaults while striving to maintain quiescence towards the self. One of the central players in this process is the pleiotropic cytokine transforming growth factor-β (TGF-β), whose deficiency results in spontaneous systemic autoimmunity in mice. The dominant function of TGF-β is to regulate the peripheral immune homeostasis, particularly in the microbe-rich and antigen-rich environment of the gut. To maintain intestinal integrity, the epithelial cells, myeloid cells and lymphocytes that inhabit the gut secrete TGF-β, which acts in both paracrine and autocrine fashions to activate its signal transducers, the SMAD transcription factors. The SMAD pathway regulates the production of IgA by B cells, maintains the protective mucosal barrier and promotes the balanced differentiation of CD4(+) T cells into inflammatory T helper type 17 cells and suppressive FOXP3(+) T regulatory cells. While encounters with pathogenic microbes activate SMAD proteins to evoke a protective inflammatory immune response, SMAD activation and synergism with immunoregulatory factors such as the vitamin A metabolite retinoic acid enforce immunosuppression toward commensal microbes and innocuous food antigens. Such complementary context-dependent functions of TGF-β are achieved by the co-operation of SMAD proteins with distinct dominant transcription activators and accessory chromatin modifiers. This review highlights recent advances in unravelling the molecular basis for the multi-faceted functions of TGF-β in the gut that are dictacted by fluid orchestrations of SMADs and their myriad partners. © 2013 Blackwell Publishing Ltd.

  1. Gut TFH and IgA: key players for regulation of bacterial communities and immune homeostasis.

    Science.gov (United States)

    Kato, Lucia M; Kawamoto, Shimpei; Maruya, Mikako; Fagarasan, Sidonia

    2014-01-01

    The main function of the immune system is to protect the host against pathogens. However, unlike the systemic immune system, the gut immune system does not eliminate, but instead nourishes complex bacterial communities and establishes advanced symbiotic relationships. Immunoglobulin A (IgA) is the most abundant antibody isotype in mammals, produced mainly in the gut. The primary function of IgA is to maintain homeostasis at mucosal surfaces, and studies in mice have demonstrated that IgA diversification has an essential role in the regulation of gut microbiota. Dynamic diversification and constant adaptation of IgA responses to local microbiota require expression of activation-induced cytidine deaminase by B cells and control from T follicular helper and Foxp3(+) T cells in germinal centers (GCs). We discuss the finely tuned regulatory mechanisms for IgA synthesis in GCs of Peyer's patches and emphasize the roles of CD4(+) T cells for IgA selection and the maintenance of appropriate gut microbial communities required for immune homeostasis.

  2. Immunization delivery in British Columbia

    Science.gov (United States)

    Omura, John; Buxton, Jane; Kaczorowski, Janusz; Catterson, Jason; Li, Jane; Derban, Andrea; Hasselback, Paul; Machin, Shelagh; Linekin, Michelle; Morgana, Tamsin; O’Briain, Barra; Scheifele, David; Dawar, Meena

    2014-01-01

    Abstract Objective To explore the experiences of family physicians and pediatricians delivering immunizations, including perceived barriers and supports. Design Qualitative study using focus groups. Setting Ten cities throughout British Columbia. Participants A total of 46 family physicians or general practitioners, 10 pediatricians, and 2 residents. Methods A semistructured dialogue guide was used by a trained facilitator to explore participants’ experiences and views related to immunization delivery in British Columbia. Verbatim transcriptions were independently coded by 2 researchers. Key themes were analyzed and identified in an iterative manner using interpretive description. Main findings Physicians highly valued vaccine delivery. Factors facilitating physician-delivered immunizations included strong beliefs in the value of vaccines and having adequate information. Identified barriers included the large time commitment and insufficient communication about program changes, new vaccines, and the adult immunization program in general. Some physicians reported good relationships with local public health, while others reported the opposite experience, and this varied by geographic location. Conclusion These findings suggest that physicians are supportive of delivering vaccines. However, there are opportunities to improve the sustainability of physician-delivered immunizations. While compensation schemes remain under the purview of the provincial governments, local public health authorities can address the information needs of physicians. PMID:24627403

  3. The cell-mediated immunity of Drosophila melanogaster: hemocyte lineages, immune compartments, microanatomy and regulation.

    Science.gov (United States)

    Honti, Viktor; Csordás, Gábor; Kurucz, Éva; Márkus, Róbert; Andó, István

    2014-01-01

    In the animal kingdom, innate immunity is the first line of defense against invading pathogens. The dangers of microbial and parasitic attacks are countered by similar mechanisms, involving the prototypes of the cell-mediated immune responses, the phagocytosis and encapsulation. Work on Drosophila has played an important role in promoting an understanding of the basic mechanisms of phylogenetically conserved modules of innate immunity. The aim of this review is to survey the developments in the identification and functional definition of immune cell types and the immunological compartments of Drosophila melanogaster. We focus on the molecular and developmental aspects of the blood cell types and compartments, as well as the dynamics of blood cell development and the immune response. Further advances in the characterization of the innate immune mechanisms in Drosophila will provide basic clues to the understanding of the importance of the evolutionary conserved mechanisms of innate immune defenses in the animal kingdom. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Rab GTPases in Immunity and Inflammation.

    Science.gov (United States)

    Prashar, Akriti; Schnettger, Laura; Bernard, Elliott M; Gutierrez, Maximiliano G

    2017-01-01

    Strict spatiotemporal control of trafficking events between organelles is critical for maintaining homeostasis and directing cellular responses. This regulation is particularly important in immune cells for mounting specialized immune defenses. By controlling the formation, transport and fusion of intracellular organelles, Rab GTPases serve as master regulators of membrane trafficking. In this review, we discuss the cellular and molecular mechanisms by which Rab GTPases regulate immunity and inflammation.

  5. Enteric Virome Sensing—Its Role in Intestinal Homeostasis and Immunity

    Directory of Open Access Journals (Sweden)

    Rebecca N. Metzger

    2018-03-01

    Full Text Available Pattern recognition receptors (PRRs sensing commensal microorganisms in the intestine induce tightly controlled tonic signaling in the intestinal mucosa, which is required to maintain intestinal barrier integrity and immune homeostasis. At the same time, PRR signaling pathways rapidly trigger the innate immune defense against invasive pathogens in the intestine. Intestinal epithelial cells and mononuclear phagocytes in the intestine and the gut-associated lymphoid tissues are critically involved in sensing components of the microbiome and regulating immune responses in the intestine to sustain immune tolerance against harmless antigens and to prevent inflammation. These processes have been mostly investigated in the context of the bacterial components of the microbiome so far. The impact of viruses residing in the intestine and the virus sensors, which are activated by these enteric viruses, on intestinal homeostasis and inflammation is just beginning to be unraveled. In this review, we will summarize recent findings indicating an important role of the enteric virome for intestinal homeostasis as well as pathology when the immune system fails to control the enteric virome. We will provide an overview of the virus sensors and signaling pathways, operative in the intestine and the mononuclear phagocyte subsets, which can sense viruses and shape the intestinal immune response. We will discuss how these might interact with resident enteric viruses directly or in context with the bacterial microbiome to affect intestinal homeostasis.

  6. Enteric Virome Sensing-Its Role in Intestinal Homeostasis and Immunity.

    Science.gov (United States)

    Metzger, Rebecca N; Krug, Anne B; Eisenächer, Katharina

    2018-03-23

    Pattern recognition receptors (PRRs) sensing commensal microorganisms in the intestine induce tightly controlled tonic signaling in the intestinal mucosa, which is required to maintain intestinal barrier integrity and immune homeostasis. At the same time, PRR signaling pathways rapidly trigger the innate immune defense against invasive pathogens in the intestine. Intestinal epithelial cells and mononuclear phagocytes in the intestine and the gut-associated lymphoid tissues are critically involved in sensing components of the microbiome and regulating immune responses in the intestine to sustain immune tolerance against harmless antigens and to prevent inflammation. These processes have been mostly investigated in the context of the bacterial components of the microbiome so far. The impact of viruses residing in the intestine and the virus sensors, which are activated by these enteric viruses, on intestinal homeostasis and inflammation is just beginning to be unraveled. In this review, we will summarize recent findings indicating an important role of the enteric virome for intestinal homeostasis as well as pathology when the immune system fails to control the enteric virome. We will provide an overview of the virus sensors and signaling pathways, operative in the intestine and the mononuclear phagocyte subsets, which can sense viruses and shape the intestinal immune response. We will discuss how these might interact with resident enteric viruses directly or in context with the bacterial microbiome to affect intestinal homeostasis.

  7. Regulation of intestinal immune responses through TLR activation: implications for pro- and prebiotics

    Directory of Open Access Journals (Sweden)

    Sander eDe Kivit

    2014-02-01

    Full Text Available The intestinal mucosa is constantly facing a high load of antigens including bacterial antigens derived from the microbiota and food. Despite this, the immune cells present in the gastrointestinal tract do not initiate a pro-inflammatory immune response. Toll-like receptors (TLRs are pattern recognition receptors expressed by various cells in the gastrointestinal tract, including intestinal epithelial cells (IEC and resident immune cells in the lamina propria. Many diseases, including chronic intestinal inflammation (e.g. inflammatory bowel disease, irritable bowel syndrome (IBS, allergic gastroenteritis (e.g. eosinophilic gastroenteritis and allergic IBS and infections are nowadays associated with a deregulated microbiota. The microbiota may directly interact with TLR. In addition, differences in intestinal TLR expression in health and disease may suggest that TLR play an essential role in disease pathogenesis and may be novel targets for therapy. TLR signaling in the gut is involved in either maintaining intestinal homeostasis or the induction of an inflammatory response. This mini review provides an overview of the current knowledge regarding the contribution of intestinal epithelial TLR signaling in both tolerance induction or promoting intestinal inflammation, with a focus on food allergy. We will also highlight a potential role of the microbiota in regulating gut immune responses, especially through TLR activation.

  8. Understanding how commensal obligate anaerobic bacteria regulate immune functions in the large intestine.

    Science.gov (United States)

    Maier, Eva; Anderson, Rachel C; Roy, Nicole C

    2014-12-24

    The human gastrointestinal tract is colonised by trillions of commensal bacteria, most of which are obligate anaerobes residing in the large intestine. Appropriate bacterial colonisation is generally known to be critical for human health. In particular, the development and function of the immune system depends on microbial colonisation, and a regulated cross-talk between commensal bacteria, intestinal epithelial cells and immune cells is required to maintain mucosal immune homeostasis. This homeostasis is disturbed in various inflammatory disorders, such as inflammatory bowel diseases. Several in vitro and in vivo studies indicate a role for Faecalibacterium prausnitzii, Bacteroides thetaiotaomicron, Bacteroides fragilis, Akkermansia muciniphila and segmented filamentous bacteria in maintaining intestinal immune homeostasis. These obligate anaerobes are abundant in the healthy intestine but reduced in several inflammatory diseases, suggesting an association with protective effects on human health. However, knowledge of the mechanisms underlying the effects of obligate anaerobic intestinal bacteria remains limited, in part due to the difficulty of co-culturing obligate anaerobes together with oxygen-requiring human epithelial cells. By using novel dual-environment co-culture models, it will be possible to investigate the effects of the unstudied majority of intestinal microorganisms on the human epithelia. This knowledge will provide opportunities for improving human health and reducing the risk of inflammatory diseases.

  9. Understanding How Commensal Obligate Anaerobic Bacteria Regulate Immune Functions in the Large Intestine

    Science.gov (United States)

    Maier, Eva; Anderson, Rachel C.; Roy, Nicole C.

    2014-01-01

    The human gastrointestinal tract is colonised by trillions of commensal bacteria, most of which are obligate anaerobes residing in the large intestine. Appropriate bacterial colonisation is generally known to be critical for human health. In particular, the development and function of the immune system depends on microbial colonisation, and a regulated cross-talk between commensal bacteria, intestinal epithelial cells and immune cells is required to maintain mucosal immune homeostasis. This homeostasis is disturbed in various inflammatory disorders, such as inflammatory bowel diseases. Several in vitro and in vivo studies indicate a role for Faecalibacterium prausnitzii, Bacteroides thetaiotaomicron, Bacteroides fragilis, Akkermansia muciniphila and segmented filamentous bacteria in maintaining intestinal immune homeostasis. These obligate anaerobes are abundant in the healthy intestine but reduced in several inflammatory diseases, suggesting an association with protective effects on human health. However, knowledge of the mechanisms underlying the effects of obligate anaerobic intestinal bacteria remains limited, in part due to the difficulty of co-culturing obligate anaerobes together with oxygen-requiring human epithelial cells. By using novel dual-environment co-culture models, it will be possible to investigate the effects of the unstudied majority of intestinal microorganisms on the human epithelia. This knowledge will provide opportunities for improving human health and reducing the risk of inflammatory diseases. PMID:25545102

  10. Global Immunizations: Health Promotion and Disease Prevention Worldwide.

    Science.gov (United States)

    Macintosh, Janelle L B; Eden, Lacey M; Luthy, Karlen E; Schouten, Aimee E

    Immunizations are one of the most important health interventions of the 20th century, yet people in many areas of the world do not receive adequate immunizations. Approximately 3 million people worldwide die every year from vaccine-preventable diseases; about half of these deaths are young children and infants. Global travel is more common; diseases that were once localized now can be found in communities around the world. Multiple barriers to immunizations have been identified. Healthcare access, cost, and perceptions of safety and trust in healthcare are factors that have depressed global immunization rates. Several global organizations have focused on addressing these barriers as part of their efforts to increase immunization rates. The Bill and Melinda Gates Foundation, The World Health Organization, and the United Nations Children's Emergency Fund each have a part of their organization that is concentrated on immunizations. Maternal child nurses worldwide can assist in increasing immunization rates. Nurses can participate in outreach programs to ease the burden of patients and families in accessing immunizations. Nurses can work with local and global organizations to make immunizations more affordable. Nurses can improve trust and knowledge about immunizations in their local communities. Nurses are a powerful influence in the struggle to increase immunization rates, which is a vital aspect of global health promotion and disease prevention.

  11. Endocannabinoid system acts as a regulator of immune homeostasis in the gut.

    Science.gov (United States)

    Acharya, Nandini; Penukonda, Sasi; Shcheglova, Tatiana; Hagymasi, Adam T; Basu, Sreyashi; Srivastava, Pramod K

    2017-05-09

    Endogenous cannabinoids (endocannabinoids) are small molecules biosynthesized from membrane glycerophospholipid. Anandamide (AEA) is an endogenous intestinal cannabinoid that controls appetite and energy balance by engagement of the enteric nervous system through cannabinoid receptors. Here, we uncover a role for AEA and its receptor, cannabinoid receptor 2 (CB2), in the regulation of immune tolerance in the gut and the pancreas. This work demonstrates a major immunological role for an endocannabinoid. The pungent molecule capsaicin (CP) has a similar effect as AEA; however, CP acts by engagement of the vanilloid receptor TRPV1, causing local production of AEA, which acts through CB2. We show that the engagement of the cannabinoid/vanilloid receptors augments the number and immune suppressive function of the regulatory CX3CR1 hi macrophages (Mϕ), which express the highest levels of such receptors among the gut immune cells. Additionally, TRPV1 -/- or CB2 -/- mice have fewer CX3CR1 hi Mϕ in the gut. Treatment of mice with CP also leads to differentiation of a regulatory subset of CD4 + cells, the Tr1 cells, in an IL-27-dependent manner in vitro and in vivo. In a functional demonstration, tolerance elicited by engagement of TRPV1 can be transferred to naïve nonobese diabetic (NOD) mice [model of type 1 diabetes (T1D)] by transfer of CD4 + T cells. Further, oral administration of AEA to NOD mice provides protection from T1D. Our study unveils a role for the endocannabinoid system in maintaining immune homeostasis in the gut/pancreas and reveals a conversation between the nervous and immune systems using distinct receptors.

  12. Shrimp miRNAs regulate innate immune response against white spot syndrome virus infection.

    Science.gov (United States)

    Kaewkascholkul, Napol; Somboonviwat, Kulwadee; Asakawa, Shuichi; Hirono, Ikuo; Tassanakajon, Anchalee; Somboonwiwat, Kunlaya

    2016-07-01

    MicroRNAs are short noncoding RNAs of RNA interference pathways that regulate gene expression through partial complementary base-pairing to target mRNAs. In this study, miRNAs that are expressed in white spot syndrome virus (WSSV)-infected Penaeus monodon, were identified using next generation sequencing. Forty-six miRNA homologs were identified from WSSV-infected shrimp hemocyte. Stem-loop real-time RT-PCR analysis showed that 11 out of 16 selected miRNAs were differentially expressed upon WSSV infection. Of those, pmo-miR-315 and pmo-miR-750 were highly responsive miRNAs. miRNA target prediction revealed that the miRNAs were targeted at 5'UTR, ORF, and 3'UTR of several immune-related genes such as genes encoding antimicrobial peptides, signaling transduction proteins, heat shock proteins, oxidative stress proteins, proteinases or proteinase inhibitors, proteins in blood clotting system, apoptosis-related proteins, proteins in prophenoloxidase system, pattern recognition proteins and other immune molecules. The highly conserved miRNA homolog, pmo-bantam, was characterized for its function in shrimp. The pmo-bantam was predicted to target the 3'UTR of Kunitz-type serine protease inhibitor (KuSPI). Binding of pmo-bantam to the target sequence of KuSPI gene was analyzed by luciferase reporter assay. Correlation of pmo-bantam and KuSPI expression was observed in lymphoid organ of WSSV-infected shrimp. These results implied that miRNAs might play roles as immune gene regulators in shrimp antiviral response. Copyright © 2016. Published by Elsevier Ltd.

  13. The Role of Non-specific and Specific Immune Systems in Poultry against Newcastle Disease

    Directory of Open Access Journals (Sweden)

    Dyah Ayu Hewajuli

    2015-09-01

    Full Text Available Newcastle disease (ND is caused by avian paramyxovirus-1 which belong to Avulavirus genus and Paramyxoviridae family. The birds have abnormalities in humoral (bursa fabricius and cellular (thymus and spleen lymphoid organs. Lesions decrease the immune system. Immune system consists of non-specific and specific immune systems. The main components of non-specific immunity are physical and chemical barrier (feather and skin or mucosa, phagocytic cells (macrophages and natural killer, protein complement and the mediator of inflammation and cytokines. Interferons (IFNs belong to a group of cytokines that play a major role in the nonspecific or innate (natural immunity. The virulent ND virus encodes protein of V gene can be suppressed IFN type I. This leads to non-specific immune system fail to respond to the virulent strains resulting in severe pathogenicity. The defense mechanism of the host is replaced by specific immunity (adaptive immunity when natural immunity fails to overcome the infection. The specific immune system consists of humoral mediated immunity (HMI and cell-mediated immunity (CMI. The cells of immune system that react specifically with the antigen are B lymphocytes producing the antibodies, T lymphocytes that regulate the synthesis of antibodies and T cells as effector or the direct cytotoxic cells. Both non-specific and specific immunities are complementary against the invasion of ND virus in the birds. The objective of this article is to discuss the role of non specific and specific immune system in ND.

  14. Reducing financial barriers to vaccinating children and adolescents in the USA.

    Science.gov (United States)

    Bednarczyk, Robert A; Birkhead, Guthrie S

    2011-02-01

    To increase awareness of the financial barriers to childhood and adolescent vaccination, recent steps taken to mitigate these barriers, and remaining gaps following passage of Federal healthcare reform legislation. Financial barriers to vaccination remain, even with the safety net of the Vaccines for Children Program. Newly recommended vaccines have substantially increased the cost to fully vaccinate a child up to age 18 years, and the combination of these cost burdens and inadequate reimbursement, in both the private and public sectors, has led some physicians to seriously consider stopping vaccination services. Up to 20% of privately insured children or adolescents have coverage that does not fully cover all costs of immunization, potentially leading to fragmented and inadequate preventive care. Federal healthcare reform legislation, as currently constituted, may not fully address all financing gaps, and the extent to which financial barriers to immunization services remain will need to be evaluated as the legislation is implemented. Recent National Vaccine Advisory Committee recommendations need to be considered to address financial barriers to immunization.

  15. Regulation of Mucosal Immune Responses – The Missing Link in IBD?

    Directory of Open Access Journals (Sweden)

    Charles O Elson

    1996-01-01

    Full Text Available Although the etiology of inflammatory bowel disease (IBD remains unknown, a major working hypothesis is that it represents a dysregulated immune response to common enteric bacterial antigens. Until recently there has been a relative dearth of experimental models to study this hypothesis. However, exciting developments in experimental models of colitis, including spontaneous, transgenic and knockout mice, now allow this and other hypotheses to be tested. The regulation of mucosal immune responses is not well understood in the normal animal, much less in those with chronic intestinal inflammation. Clearly the CD4 Th1 and Th2 pathways are important in the host response to microbial pathogens, and recent data indicate that the intestinal mucosa seems to be a site of preferential Th2 responses toward exogenous antigens. Deletion of certain cytokine genes involved in maintaining this Th1/Th2 balance (interleukin [IL]-2, IL-10 resulted in colitis, although deletion of others (IL-4, interferon-gamma that are also involved did not. Whether these cytokine gene deletions cause a dysregulation of the mucosal immune response has yet to be shown. However, the importance of regulation can be demonstrated in a model in which a normal CD4+ T cell subset (CD45Rbhigh is transferred into syngeneic severe combined immunodeficiency syndrome recipients. This results in a striking colitis over the ensuing weeks with chronic diarrhea and wasting of the animals. If the reciprocal CD4+ subset (CD45Rblow is co-transferred or if whole CD4+ T cells are transferred no colitis ensues. Therefore, T cells capable of causing colitis are present in normal animals but are prevented from doing so by immunoregulatory mechanisms. The antigens that drive the colitis in several of these models (IL-2 knockout mouse, human leukocyte antigen B27/β2M transgenic rat appear to be those of the normal enteric bacterial flora because germ-free animals do not get the disease. Spontaneously

  16. Rab GTPases in Immunity and Inflammation

    Directory of Open Access Journals (Sweden)

    Akriti Prashar

    2017-09-01

    Full Text Available Strict spatiotemporal control of trafficking events between organelles is critical for maintaining homeostasis and directing cellular responses. This regulation is particularly important in immune cells for mounting specialized immune defenses. By controlling the formation, transport and fusion of intracellular organelles, Rab GTPases serve as master regulators of membrane trafficking. In this review, we discuss the cellular and molecular mechanisms by which Rab GTPases regulate immunity and inflammation.

  17. Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function

    Directory of Open Access Journals (Sweden)

    Kathryn M. Lenz

    2018-04-01

    Full Text Available Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer’s disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.

  18. Microglia and Beyond: Innate Immune Cells As Regulators of Brain Development and Behavioral Function.

    Science.gov (United States)

    Lenz, Kathryn M; Nelson, Lars H

    2018-01-01

    Innate immune cells play a well-documented role in the etiology and disease course of many brain-based conditions, including multiple sclerosis, Alzheimer's disease, traumatic brain and spinal cord injury, and brain cancers. In contrast, it is only recently becoming clear that innate immune cells, primarily brain resident macrophages called microglia, are also key regulators of brain development. This review summarizes the current state of knowledge regarding microglia in brain development, with particular emphasis on how microglia during development are distinct from microglia later in life. We also summarize the effects of early life perturbations on microglia function in the developing brain, the role that biological sex plays in microglia function, and the potential role that microglia may play in developmental brain disorders. Finally, given how new the field of developmental neuroimmunology is, we highlight what has yet to be learned about how innate immune cells shape the development of brain and behavior.

  19. Single-walled carbon nanotubes disturbed the immune and metabolic regulation function 13-weeks after a single intratracheal instillation

    Energy Technology Data Exchange (ETDEWEB)

    Park, Eun-Jung, E-mail: pejtoxic@hanmail.net [Myunggok Eye Research Institute, Konyang University, Daejeon 302-718 (Korea, Republic of); Hong, Young-Shick [Division of Food and Nutrition, Chonnam National University, Yongbong-Ro, Buk-Gu, Gwangju 500-757 (Korea, Republic of); Lee, Byoung-Seok [Toxicologic Pathology Center, Korea Institute of Toxicology, Daejeon (Korea, Republic of); Yoon, Cheolho [Seoul Center, Korea Basic Science Institute, Seoul 126-16 (Korea, Republic of); Jeong, Uiseok; Kim, Younghun [Department of Chemical Engineering, Kwangwoon University, Seoul 139-701 (Korea, Republic of)

    2016-07-15

    Due to their unique physicochemical properties, the potential health effects of single-walled carbon nanotubes (SWCNTs) have attracted continuous attention together with their extensive application. In this study, we aimed to identify local and systemic health effects following pulmonary persistence of SWCNTs. As expected, SWCNTs remained in the lung for 13 weeks after a single intratracheal instillation (50, 100, and 200 μg/kg). In the lung, the total number of cells and the percentages of lymphocytes and neutrophils significantly increased at 200 μg/kg compared to the control, and the Th1-polarized immune response was induced accompanying enhanced expression of tissue damage-related genes and increased release of chemokines. Additionally, SWCNTs enhanced the expression of antigen presentation-related proteins on the surface of antigen-presenting cells, however, maturation of dendritic cells was inhibited by their persistence. As compared to the control, a significant increase in the percentage of neutrophils and a remarkable decrease of BUN and potassium level were observed in the blood of mice treated with the highest dose. This was accompanied by the down-regulation of the expression of antigen presentation-related proteins on splenocytes. Moreover, protein and glucose metabolism were disturbed with an up-regulation of fatty acid β-oxidation. Taken together, we conclude that SWCNTs may induce adverse health effects by disturbing immune and metabolic regulation functions in the body. Therefore, careful application of SWCNTs is necessary for the enforcement of safety in nano-industries. - Highlights: • We evaluated local and systemic health effects following persistence of SWCNTs. • SWCNTs remained in the lung for 13 weeks after a single intratracheal instillation. • Th1-polarized immune response was induced in the lung. • The expression of antigen presentation-related proteins was altered. • Immune and metabolic regulation function were disturbed.

  20. The University Immune System: Overcoming Resistance to Change

    Science.gov (United States)

    Gilley, Ann; Godek, Marisha; Gilley, Jerry W.

    2009-01-01

    A university, similar to any other organization, has an immune system that erects a powerful barrier against change. This article discusses the university immune system and what can be done to counteract its negative effects and thereby allow change to occur.

  1. Commensal Lactobacillus Controls Immune Tolerance during Acute Liver Injury in Mice

    Directory of Open Access Journals (Sweden)

    Nobuhiro Nakamoto

    2017-10-01

    Full Text Available Summary: Gut-derived microbial antigens trigger the innate immune system during acute liver injury. During recovery, regulatory immunity plays a role in suppressing inflammation; however, the precise mechanism underlying this process remains obscure. Here, we find that recruitment of immune-regulatory classical dendritic cells (cDCs is crucial for liver tolerance in concanavalin A-induced acute liver injury. Acute liver injury resulted in enrichment of commensal Lactobacillus in the gut. Notably, Lactobacillus activated IL-22 production by gut innate lymphoid cells and raised systemic IL-22 levels. Gut-derived IL-22 enhanced mucosal barrier function and promoted the recruitment of regulatory cDCs to the liver. These cDCs produced IL-10 and TGF-β through TLR9 activation, preventing further liver inflammation. Collectively, our results indicate that beneficial gut microbes influence tolerogenic immune responses in the liver. Therefore, modulation of the gut microbiota might be a potential option to regulate liver tolerance. : Nakamoto et.al. find that Lactobacillus accumulates in the gut and activates IL-22 production by innate lymphoid cells during acute liver injury. Gut-derived IL-22 contributes to liver tolerance via induction of regulatory DCs. Keywords: immune tolerance, dendritic cell, innate lymphoid cell, acute liver injury, interleukin-10, interleukin-22, microbiota, dysbiosis

  2. Altered Immune Regulation in Type 1 Diabetes

    Science.gov (United States)

    Zóka, András; Műzes, Györgyi; Somogyi, Anikó; Varga, Tímea; Szémán, Barbara; Al-Aissa, Zahra; Hadarits, Orsolya; Firneisz, Gábor

    2013-01-01

    Research in genetics and immunology was going on separate strands for a long time. Type 1 diabetes mellitus might not be characterized with a single pathogenetic factor. It develops when a susceptible individual is exposed to potential triggers in a given sequence and timeframe that eventually disarranges the fine-tuned immune mechanisms that keep autoimmunity under control in health. Genomewide association studies have helped to understand the congenital susceptibility, and hand-in-hand with the immunological research novel paths of immune dysregulation were described in central tolerance, apoptotic pathways, or peripheral tolerance mediated by regulatory T-cells. Epigenetic factors are contributing to the immune dysregulation. The interplay between genetic susceptibility and potential triggers is likely to play a role at a very early age and gradually results in the loss of balanced autotolerance and subsequently in the development of the clinical disease. Genetic susceptibility, the impaired elimination of apoptotic β-cell remnants, altered immune regulatory functions, and environmental factors such as viral infections determine the outcome. Autoreactivity might exist under physiologic conditions and when the integrity of the complex regulatory process is damaged the disease might develop. We summarized the immune regulatory mechanisms that might have a crucial role in disease pathology and development. PMID:24285974

  3. Altered Immune Regulation in Type 1 Diabetes

    Directory of Open Access Journals (Sweden)

    András Zóka

    2013-01-01

    Full Text Available Research in genetics and immunology was going on separate strands for a long time. Type 1 diabetes mellitus might not be characterized with a single pathogenetic factor. It develops when a susceptible individual is exposed to potential triggers in a given sequence and timeframe that eventually disarranges the fine-tuned immune mechanisms that keep autoimmunity under control in health. Genomewide association studies have helped to understand the congenital susceptibility, and hand-in-hand with the immunological research novel paths of immune dysregulation were described in central tolerance, apoptotic pathways, or peripheral tolerance mediated by regulatory T-cells. Epigenetic factors are contributing to the immune dysregulation. The interplay between genetic susceptibility and potential triggers is likely to play a role at a very early age and gradually results in the loss of balanced autotolerance and subsequently in the development of the clinical disease. Genetic susceptibility, the impaired elimination of apoptotic β-cell remnants, altered immune regulatory functions, and environmental factors such as viral infections determine the outcome. Autoreactivity might exist under physiologic conditions and when the integrity of the complex regulatory process is damaged the disease might develop. We summarized the immune regulatory mechanisms that might have a crucial role in disease pathology and development.

  4. The Bile Acid Receptor GPBAR-1 (TGR5) Modulates Integrity of Intestinal Barrier and Immune Response to Experimental Colitis

    Science.gov (United States)

    Cipriani, Sabrina; Mencarelli, Andrea; Chini, Maria Giovanna; Distrutti, Eleonora; Renga, Barbara; Bifulco, Giuseppe; Baldelli, Franco; Donini, Annibale; Fiorucci, Stefano

    2011-01-01

    Background GP-BAR1, a member G protein coupled receptor superfamily, is a cell surface bile acid-activated receptor highly expressed in the ileum and colon. In monocytes, ligation of GP-BAR1 by secondary bile acids results in a cAMP-dependent attenuation of cytokine generation. Aims To investigate the role GP-BAR1 in regulating intestinal homeostasis and inflammation-driven immune dysfunction in rodent models of colitis. Methods Colitis was induced in wild type and GP-BAR1−/− mice by DSS and TNBS administration. Potential GP-BAR1 agonists were identified by in silico screening and computational docking studies. Results GP-BAR1−/− mice develop an abnormal morphology of colonic mucous cells and an altered molecular architecture of epithelial tight junctions with increased expression and abnormal subcellular distribution of zonulin 1 resulting in increased intestinal permeability and susceptibility to develop severe colitis in response to DSS at early stage of life. By in silico screening and docking studies we identified ciprofloxacin as a GP-BAR1 ligand. In monocytes, ciprofloxacin increases cAMP concentrations and attenuates TNFα release induced by TLR4 ligation in a GP-BAR1 dependent manner. Treating mice rendered colitic by TNBS with ciprofloxacin and oleanolic acid, a well characterized GP-BAR1 ligand, abrogates signs and symptoms of colitis. Colonic expression of GP-BAR1 mRNA increases in rodent models of colitis and tissues from Crohn's disease patients. Flow cytometry analysis demonstrates that ≈90% of CD14+ cells isolated from the lamina propria of TNBS-treated mice stained positively for GP-BAR1. Conclusions GP-BAR1 regulates intestinal barrier structure. Its expression increases in rodent models of colitis and Crohn's disease. Ciprofloxacin is a GP-BAR1 ligand. PMID:22046243

  5. The bile acid receptor GPBAR-1 (TGR5 modulates integrity of intestinal barrier and immune response to experimental colitis.

    Directory of Open Access Journals (Sweden)

    Sabrina Cipriani

    Full Text Available BACKGROUND: GP-BAR1, a member G protein coupled receptor superfamily, is a cell surface bile acid-activated receptor highly expressed in the ileum and colon. In monocytes, ligation of GP-BAR1 by secondary bile acids results in a cAMP-dependent attenuation of cytokine generation. AIMS: To investigate the role GP-BAR1 in regulating intestinal homeostasis and inflammation-driven immune dysfunction in rodent models of colitis. METHODS: Colitis was induced in wild type and GP-BAR1(-/- mice by DSS and TNBS administration. Potential GP-BAR1 agonists were identified by in silico screening and computational docking studies. RESULTS: GP-BAR1(-/- mice develop an abnormal morphology of colonic mucous cells and an altered molecular architecture of epithelial tight junctions with increased expression and abnormal subcellular distribution of zonulin 1 resulting in increased intestinal permeability and susceptibility to develop severe colitis in response to DSS at early stage of life. By in silico screening and docking studies we identified ciprofloxacin as a GP-BAR1 ligand. In monocytes, ciprofloxacin increases cAMP concentrations and attenuates TNFα release induced by TLR4 ligation in a GP-BAR1 dependent manner. Treating mice rendered colitic by TNBS with ciprofloxacin and oleanolic acid, a well characterized GP-BAR1 ligand, abrogates signs and symptoms of colitis. Colonic expression of GP-BAR1 mRNA increases in rodent models of colitis and tissues from Crohn's disease patients. Flow cytometry analysis demonstrates that ≈90% of CD14+ cells isolated from the lamina propria of TNBS-treated mice stained positively for GP-BAR1. CONCLUSIONS: GP-BAR1 regulates intestinal barrier structure. Its expression increases in rodent models of colitis and Crohn's disease. Ciprofloxacin is a GP-BAR1 ligand.

  6. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  7. Immune regulation by pericytes: modulating innate and adaptive immunity

    DEFF Research Database (Denmark)

    Navarro, Rocio; Compte, Marta; Álvarez-Vallina, Luis

    2016-01-01

    Pericytes (PC) are mural cells that surround endothelial cells (EC) in small blood vessels. PC have traditionally been endowed with structural functions, being essential for vessel maturation and stabilization. However, accumulating evidence suggest that PC also display immune properties. They ca...

  8. T Lymphocyte-Endothelial Interactions: Emerging Understanding of Trafficking and Antigen-Specific Immunity

    Directory of Open Access Journals (Sweden)

    Christopher Vincent Carman

    2015-11-01

    Full Text Available Antigen-specific immunity requires regulated trafficking of T cells in and out of diverse tissues in order to orchestrate lymphocyte development, immune surveillance, responses and memory. The endothelium serves as a unique barrier, as well as a sentinel, between the blood and the tissues and as such it plays an essential locally tuned role in regulating T cell migration and information exchange. While it is well established that chemoattractants and adhesion molecules are major determinants of T cell trafficking, emerging studies have now enumerated a large number of molecular players as well as a range of discrete cellular remodeling activities (e.g. transmigratory cups and invadosome-like protrusions, IPLs that participate in directed migration and pathfinding by T cells. In addition to providing trafficking cues, intimate cell-cell interaction between lymphocytes and endothelial cells provide instruction to T cells that influence their activation and differentiation states. Perhaps the most intriguing and underappreciated of these ‘sentinel’ roles is the ability of the endothelium to act as a non-hematopoietic ‘semi-professional’ antigen-presenting cell. Close contacts between circulating T cells and antigen-presenting endothelium may play unique non-redundant roles in shaping adaptive immune responses within the periphery. A better understanding of the mechanisms directing T cell trafficking and the antigen-presenting role of the endothelium may not only increase our knowledge of the adaptive immune response but also empower the utility of emerging immunomodulatory therapeutics.

  9. "Letting the leaders pass": barriers to using traditional ecological knowledge in comanagement as the basis of formal hunting regulations

    Directory of Open Access Journals (Sweden)

    Elisabeth Padilla

    2014-06-01

    Full Text Available We studied a case of failure in applying traditional ecological knowledge (TEK in comanagement as the basis for formal hunting regulations. We based the study on the Porcupine Caribou (Rangifer tarandus Herd "let the leaders pass" policy, established for the Dempster Highway of the Western Canadian Arctic, and identified conditions creating barriers in the successful application of TEK through comanagement. Stated as propositions, identified barriers include: (1 the context-specific nature of TEK limits its application in resource management regulations; (2 changes in traditional authority systems, hunting technology, and the social organization of harvesting caribou affect the effectiveness of TEK approaches in a contemporary social setting; (3 indigenous efforts toward self-government and political autonomy limit regional comanagement consensus in a heterogeneous cultural landscape; (4 the mismatch of agency enforcement of hunting regulations and TEK-based education is problematic. We analyzed the case through four historical phases of caribou management, complementing the study with a literature review of TEK and wildlife comanagement to explain why TEK integration of caribou leaders in regulatory resource management fell short of success. Identifying and understanding the social dynamics related to these barriers make apparent solutions for transforming the comanagement process.

  10. Influence of the gut microbiota on transcriptional regulation of genes involved in early life development of the intestinal mucus layer

    DEFF Research Database (Denmark)

    Bergström, Anders; Kristensen, Matilde Bylov; Metzdorff, Stine Broeng

    2010-01-01

    The interplay between the gut microbiota and the intestinal mucus layer is important both in the maintenance of the epithelial barrier as part of the innate immune defense, and in the conservation of gut homeostasis. Little is known about how the microbiota regulates mucin proteins, which protect...

  11. Influence of the gut microbiota on transcriptional regulation of genes involved in early life development of the intestinal mucus layer

    DEFF Research Database (Denmark)

    Bergström, Anders; Kristensen, Matilde Bylov; Metzdorff, Stine Broeng

    The interplay between the gut microbiota and the intestinal mucus layer is important both in the maintenance of the epithelial barrier as part of the innate immune defense, and in the conservation of gut homeostasis. Little is known about how the microbiota regulates mucin proteins, which protect...

  12. Neural circuitry and immunity

    Science.gov (United States)

    Pavlov, Valentin A.; Tracey, Kevin J.

    2015-01-01

    Research during the last decade has significantly advanced our understanding of the molecular mechanisms at the interface between the nervous system and the immune system. Insight into bidirectional neuroimmune communication has characterized the nervous system as an important partner of the immune system in the regulation of inflammation. Neuronal pathways, including the vagus nerve-based inflammatory reflex are physiological regulators of immune function and inflammation. In parallel, neuronal function is altered in conditions characterized by immune dysregulation and inflammation. Here, we review these regulatory mechanisms and describe the neural circuitry modulating immunity. Understanding these mechanisms reveals possibilities to use targeted neuromodulation as a therapeutic approach for inflammatory and autoimmune disorders. These findings and current clinical exploration of neuromodulation in the treatment of inflammatory diseases defines the emerging field of Bioelectronic Medicine. PMID:26512000

  13. Hydrogel elasticity and microarchitecture regulate dental-derived mesenchymal stem cell-host immune system cross-talk.

    Science.gov (United States)

    Ansari, Sahar; Chen, Chider; Hasani-Sadrabadi, Mohammad Mahdi; Yu, Bo; Zadeh, Homayoun H; Wu, Benjamin M; Moshaverinia, Alireza

    2017-09-15

    The host immune system (T-lymphocytes and their pro-inflammatory cytokines) has been shown to compromise bone regeneration ability of mesenchymal stem cells (MSCs). We have recently shown that hydrogel, used as an encapsulating biomaterial affects the cross-talk among host immune cells and MSCs. However, the role of hydrogel elasticity and porosity in regulation of cross-talk between dental-derived MSCs and immune cells is unclear. In this study, we demonstrate that the modulus of elasticity and porosity of the scaffold influence T-lymphocyte-dental MSC interplay by regulating the penetration of inflammatory T cells and their cytokines. Moreover, we demonstrated that alginate hydrogels with different elasticity and microporous structure can regulate the viability and determine the fate of the encapsulated MSCs through modulation of NF-kB pathway. Our in vivo data show that alginate hydrogels with smaller pores and higher elasticity could prevent pro-inflammatory cytokine-induced MSC apoptosis by down-regulating the Caspase-3- and 8- associated proapoptotic cascades, leading to higher amounts of ectopic bone regeneration. Additionally, dental-derived MSCs encapsulated in hydrogel with higher elasticity exhibited lower expression levels of NF-kB p65 and Cox-2 in vivo. Taken together, our findings demonstrate that the mechanical characteristics and microarchitecture of the microenvironment encapsulating MSCs, in addition to presence of T-lymphocytes and their pro-inflammatory cytokines, affect the fate of encapsulated dental-derived MSCs. In this study, we demonstrate that alginate hydrogel regulates the viability and the fate of the encapsulated dental-derived MSCs through modulation of NF-kB pathway. Alginate hydrogels with smaller pores and higher elasticity prevent pro-inflammatory cytokine-induced MSC apoptosis by down-regulating the Caspase-3- and 8- associated proapoptotic cascade, leading to higher amounts of ectopic bone regeneration. MSCs encapsulated in

  14. Regulation of the Immune Response to α-Gal and Vector-borne Diseases.

    Science.gov (United States)

    Cabezas-Cruz, Alejandro; Mateos-Hernández, Lourdes; Pérez-Cruz, Magdiel; Valdés, James J; Mera, Isabel G Fernández de; Villar, Margarita; de la Fuente, José

    2015-10-01

    Vector-borne diseases (VBD) challenge our understanding of emerging diseases. Recently, arthropod vectors have been involved in emerging anaphylactic diseases. In particular, the immunoglobulin E (IgE) antibody response to the carbohydrate Galα1-3Galβ1-(3)4GlcNAc-R (α-gal) following a tick bite was associated with allergies to red meat, cetuximab, and gelatin. By contrast, an anti-α-gal IgM antibody response was shown to protect against mosquito-borne malaria. Herein, we highlight the interplay between the gut microbiota, vectors, transmitted pathogens, and the regulation of the immune response as a model to understand the protective or allergic effect of α-gal. Establishing the source of α-gal in arthropod vectors and the immune response to vector bites and transmitted pathogens will be essential for diagnosing, treating, and ultimately preventing these emerging anaphylactic and other vector-borne diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Genome-wide RNAi screen reveals a new role of a WNT/CTNNB1 signaling pathway as negative regulator of virus-induced innate immune responses.

    Science.gov (United States)

    Baril, Martin; Es-Saad, Salwa; Chatel-Chaix, Laurent; Fink, Karin; Pham, Tram; Raymond, Valérie-Ann; Audette, Karine; Guenier, Anne-Sophie; Duchaine, Jean; Servant, Marc; Bilodeau, Marc; Cohen, Eric; Grandvaux, Nathalie; Lamarre, Daniel

    2013-01-01

    To identify new regulators of antiviral innate immunity, we completed the first genome-wide gene silencing screen assessing the transcriptional response at the interferon-β (IFNB1) promoter following Sendai virus (SeV) infection. We now report a novel link between WNT signaling pathway and the modulation of retinoic acid-inducible gene I (RIG-I)-like receptor (RLR)-dependent innate immune responses. Here we show that secretion of WNT2B and WNT9B and stabilization of β-catenin (CTNNB1) upon virus infection negatively regulate expression of representative inducible genes IFNB1, IFIT1 and TNF in a CTNNB1-dependent effector mechanism. The antiviral response is drastically reduced by glycogen synthase kinase 3 (GSK3) inhibitors but restored in CTNNB1 knockdown cells. The findings confirm a novel regulation of antiviral innate immunity by a canonical-like WNT/CTNNB1 signaling pathway. The study identifies novel avenues for broad-spectrum antiviral targets and preventing immune-mediated diseases upon viral infection.

  16. Genome-wide RNAi screen reveals a new role of a WNT/CTNNB1 signaling pathway as negative regulator of virus-induced innate immune responses.

    Directory of Open Access Journals (Sweden)

    Martin Baril

    Full Text Available To identify new regulators of antiviral innate immunity, we completed the first genome-wide gene silencing screen assessing the transcriptional response at the interferon-β (IFNB1 promoter following Sendai virus (SeV infection. We now report a novel link between WNT signaling pathway and the modulation of retinoic acid-inducible gene I (RIG-I-like receptor (RLR-dependent innate immune responses. Here we show that secretion of WNT2B and WNT9B and stabilization of β-catenin (CTNNB1 upon virus infection negatively regulate expression of representative inducible genes IFNB1, IFIT1 and TNF in a CTNNB1-dependent effector mechanism. The antiviral response is drastically reduced by glycogen synthase kinase 3 (GSK3 inhibitors but restored in CTNNB1 knockdown cells. The findings confirm a novel regulation of antiviral innate immunity by a canonical-like WNT/CTNNB1 signaling pathway. The study identifies novel avenues for broad-spectrum antiviral targets and preventing immune-mediated diseases upon viral infection.

  17. Peripheral Tumor Necrosis Factor-Alpha (TNF-α) Modulates Amyloid Pathology by Regulating Blood-Derived Immune Cells and Glial Response in the Brain of AD/TNF Transgenic Mice.

    Science.gov (United States)

    Paouri, Evi; Tzara, Ourania; Kartalou, Georgia-Ioanna; Zenelak, Sofia; Georgopoulos, Spiros

    2017-05-17

    Increasing evidence has suggested that systemic inflammation along with local brain inflammation can play a significant role in Alzheimer's disease (AD) pathogenesis. Identifying key molecules that regulate the crosstalk between the immune and the CNS can provide potential therapeutic targets. TNF-α is a proinflammatory cytokine implicated in the pathogenesis of systemic inflammatory and neurodegenerative diseases, such as rheumatoid arthritis (RA) and AD. Recent studies have reported that anti-TNF-α therapy or RA itself can modulate AD pathology, although the underlying mechanism is unclear. To investigate the role of peripheral TNF-α as a mediator of RA in the pathogenesis of AD, we generated double-transgenic 5XFAD/Tg197 AD/TNF mice that develop amyloid deposits and inflammatory arthritis induced by human TNF-α (huTNF-α) expression. We found that 5XFAD/Tg197 mice display decreased amyloid deposition, compromised neuronal integrity, and robust brain inflammation characterized by extensive gliosis and elevated blood-derived immune cell populations, including phagocytic macrophages and microglia. To evaluate the contribution of peripheral huTNF-α in the observed brain phenotype, we treated 5XFAD/Tg197 mice systemically with infliximab, an anti-huTNF-α antibody that does not penetrate the blood-brain barrier and prevents arthritis. Peripheral inhibition of huTNF-α increases amyloid deposition, rescues neuronal impairment, and suppresses gliosis and recruitment of blood-derived immune cells, without affecting brain huTNF-α levels. Our data report, for the first time, a distinctive role for peripheral TNF-α in the modulation of the amyloid phenotype in mice by regulating blood-derived and local brain inflammatory cell populations involved in β-amyloid clearance. SIGNIFICANCE STATEMENT Mounting evidence supports the active involvement of systemic inflammation, in addition to local brain inflammation, in Alzheimer's disease (AD) progression. TNF-α is a

  18. Physiological, pathological, and therapeutic implications of zonulin-mediated intestinal barrier modulation: living life on the edge of the wall.

    Science.gov (United States)

    Fasano, Alessio

    2008-11-01

    The anatomical and functional arrangement of the gastrointestinal tract suggests that this organ, beside its digestive and absorptive functions, regulates the trafficking of macromolecules between the environment and the host through a barrier mechanism. Under physiological circumstances, this trafficking is safeguarded by the competency of intercellular tight junctions, structures whose physiological modulation is mediated by, among others, the recently described protein zonulin. To prevent harm and minimize inflammation, the same paracellular pathway, in concert with the gut-associated lymphoid tissue and the neuroendocrine network, controls the equilibrium between tolerance and immunity to nonself antigens. The zonulin pathway has been exploited to deliver drugs, macromolecules, or vaccines that normally would not be absorbed through the gastrointestinal mucosal barrier. However, if the tightly regulated trafficking of macromolecules is jeopardized secondary to prolonged zonulin up-regulation, the excessive flow of nonself antigens in the intestinal submucosa can cause both intestinal and extraintestinal autoimmune disorders in genetically susceptible individuals. This new paradigm subverts traditional theories underlying the development of autoimmunity, which are based on molecular mimicry and/or the bystander effect, and suggests that the autoimmune process can be arrested if the interplay between genes and environmental triggers is prevented by re-establishing intestinal barrier competency. Understanding the role of zonulin-dependent intestinal barrier dysfunction in the pathogenesis of autoimmune diseases is an area of translational research that encompasses many fields.

  19. Positive regulation of humoral and innate immune responses induced by inactivated Avian Influenza Virus vaccine in broiler chickens.

    Science.gov (United States)

    Abdallah, Fatma; Hassanin, Ola

    2015-12-01

    Avian Influenza (AI) vaccines are widely used for mammals and birds in a trial to eliminate the Avian Influenza virus (AIV) infection from the world. However and up till now the virus is still existed via modulation of its antigenic structure to evade the pressure of host immune responses. For a complete understanding of the immune responses following AI vaccination in chickens, the modulations of the chickens humoral immune responses and interferon-alpha signaling pathway, as a fundamental part of the innate immune responses, were investigated. In our study, we measured the humoral immune response using hemagglutination-inhibition (HI) and enzyme-linked immunosorbent assay (ELISA) tests. In addition, chicken interferon-alpha pathway components was measured at RNA levels using Quantitative Real-time PCR (qRT-PCR) following one dose of inactivated H5N1 influenza vaccine at 14 days of age. In this study, the protective levels of humoral antibody responses were observed at 14, 21 and 28 days following immunization with inactivated (Re-1/H5N1) AI vaccine. In the chicken spleen cells, up regulation in the chicken interferon-alpha pathway components (MX1 & IRF7) was existed as early as 48 h post vaccination and remained until 28 days post vaccination at the endogenous state. However, after the recall with ex-vivo stimulation, the up regulation was more pronounced in the transcriptional factor (IRF7) compared to the antiviral gene (MX1) at 28 days post vaccination. So far, from our results it appears that the inactivated H5N1 vaccine can trigger the chicken interferon-alpha signaling pathway as well as it can elicit protective humoral antibody responses.

  20. Intestinal dendritic cells in the regulation of mucosal immunity

    DEFF Research Database (Denmark)

    Bekiaris, Vasileios; Persson, Emma K.; Agace, William Winston

    2014-01-01

    immune cells within the mucosa must suitably respond to maintain intestinal integrity, while also providing the ability to mount effective immune responses to potential pathogens. Dendritic cells (DCs) are sentinel immune cells that play a central role in the initiation and differentiation of adaptive....... The recognition that dietary nutrients and microbial communities in the intestine influence both mucosal and systemic immune cell development and function as well as immune-mediated disease has led to an explosion of literature in mucosal immunology in recent years and a growing interest in the functionality...

  1. Live cell imaging techniques to study T cell trafficking across the blood-brain barrier in vitro and in vivo

    Directory of Open Access Journals (Sweden)

    Coisne Caroline

    2013-01-01

    Full Text Available Abstract Background The central nervous system (CNS is an immunologically privileged site to which access for circulating immune cells is tightly controlled by the endothelial blood–brain barrier (BBB located in CNS microvessels. Under physiological conditions immune cell migration across the BBB is low. However, in neuroinflammatory diseases such as multiple sclerosis, many immune cells can cross the BBB and cause neurological symptoms. Extravasation of circulating immune cells is a multi-step process that is regulated by the sequential interaction of different adhesion and signaling molecules on the immune cells and on the endothelium. The specialized barrier characteristics of the BBB, therefore, imply the existence of unique mechanisms for immune cell migration across the BBB. Methods and design An in vitro mouse BBB model maintaining physiological barrier characteristics in a flow chamber and combined with high magnification live cell imaging, has been established. This model enables the molecular mechanisms involved in the multi-step extravasation of T cells across the in vitro BBB, to be defined with high-throughput analyses. Subsequently these mechanisms have been verified in vivo using a limited number of experimental animals and a spinal cord window surgical technique. The window enables live observation of the dynamic interaction between T cells and spinal cord microvessels under physiological and pathological conditions using real time epifluorescence intravital imaging. These in vitro and in vivo live cell imaging methods have shown that the BBB endothelium possesses unique and specialized mechanisms involved in the multi-step T cell migration across this endothelial barrier under physiological flow. The initial T cell interaction with the endothelium is either mediated by T cell capture or by T cell rolling. Arrest follows, and then T cells polarize and especially CD4+ T cells crawl over long distances against the direction of

  2. Gap junctions in cells of the immune system: structure, regulation and possible functional roles

    Directory of Open Access Journals (Sweden)

    J.C. Sáez

    2000-04-01

    Full Text Available Gap junction channels are sites of cytoplasmic communication between contacting cells. In vertebrates, they consist of protein subunits denoted connexins (Cxs which are encoded by a gene family. According to their Cx composition, gap junction channels show different gating and permeability properties that define which ions and small molecules permeate them. Differences in Cx primary sequences suggest that channels composed of different Cxs are regulated differentially by intracellular pathways under specific physiological conditions. Functional roles of gap junction channels could be defined by the relative importance of permeant substances, resulting in coordination of electrical and/or metabolic cellular responses. Cells of the native and specific immune systems establish transient homo- and heterocellular contacts at various steps of the immune response. Morphological and functional studies reported during the last three decades have revealed that many intercellular contacts between cells in the immune response present gap junctions or "gap junction-like" structures. Partial characterization of the molecular composition of some of these plasma membrane structures and regulatory mechanisms that control them have been published recently. Studies designed to elucidate their physiological roles suggest that they might permit coordination of cellular events which favor the effective and timely response of the immune system.

  3. Regulation of Thrombin-Induced Lung Endothelial Cell Barrier Disruption by Protein Kinase C Delta.

    Directory of Open Access Journals (Sweden)

    Lishi Xie

    Full Text Available Protein Kinase C (PKC plays a significant role in thrombin-induced loss of endothelial cell (EC barrier integrity; however, the existence of more than 10 isozymes of PKC and tissue-specific isoform expression has limited our understanding of this important second messenger in vascular homeostasis. In this study, we show that PKCδ isoform promotes thrombin-induced loss of human pulmonary artery EC barrier integrity, findings substantiated by PKCδ inhibitory studies (rottlerin, dominant negative PKCδ construct and PKCδ silencing (siRNA. In addition, we identified PKCδ as a signaling mediator upstream of both thrombin-induced MLC phosphorylation and Rho GTPase activation affecting stress fiber formation, cell contraction and loss of EC barrier integrity. Our inhibitor-based studies indicate that thrombin-induced PKCδ activation exerts a positive feedback on Rho GTPase activation and contributes to Rac1 GTPase inhibition. Moreover, PKD (or PKCμ and CPI-17, two known PKCδ targets, were found to be activated by PKCδ in EC and served as modulators of cytoskeleton rearrangement. These studies clarify the role of PKCδ in EC cytoskeleton regulation, and highlight PKCδ as a therapeutic target in inflammatory lung disorders, characterized by the loss of barrier integrity, such as acute lung injury and sepsis.

  4. IAPs Regulate Distinct Innate Immune Pathways to Co-ordinate the Response to Bacterial Peptidoglycans.

    Science.gov (United States)

    Stafford, Che A; Lawlor, Kate E; Heim, Valentin J; Bankovacki, Aleksandra; Bernardini, Jonathan P; Silke, John; Nachbur, Ueli

    2018-02-06

    Inhibitors of apoptosis (IAPs) proteins are critical regulators of innate immune signaling pathways and therefore have potential as drug targets. X-linked IAP (XIAP) and cellular IAP1 and IAP2 (cIAP1 and cIAP2) are E3 ligases that have been shown to be required for signaling downstream of NOD2, an intracellular receptor for bacterial peptidoglycan. We used genetic and biochemical approaches to compare the responses of IAP-deficient mice and cells to NOD2 stimulation. In all cell types tested, XIAP is the only IAP required for signaling immediately downstream of NOD2, while cIAP1 and cIAP2 are dispensable for NOD2-induced nuclear factor κB (NF-κB) and mitogen-activated protein kinase (MAPK) activation. However, mice lacking cIAP1 or TNFR1 have a blunted cytokine response to NOD2 stimulation. We conclude that cIAPs regulate NOD2-dependent autocrine TNF signaling in vivo and highlight the importance of physiological context in the interplay of innate immune signaling pathways. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  5. Deficiency of autoimmune regulator impairs the immune tolerance effect of bone marrow-derived dendritic cells in mice.

    Science.gov (United States)

    Huo, Feifei; Li, Dongbei; Zhao, Bo; Luo, Yadong; Zhao, Bingjie; Zou, Xueyang; Li, Yi; Yang, Wei

    2018-02-01

    As a transcription factor, autoimmune regulator (Aire) participates in thymic negative selection and maintains immune tolerance mainly by regulating the ectopic expression of tissue-restricted antigens (TRAs) in medullary thymic epithelial cells (mTECs). Aire is also expressed in dendritic cells (DCs). DCs are professional antigen-presenting cells (APCs) that affect the differentiation of T cells toward distinct subpopulations and participate in the immune response and tolerance, thereby playing an important role in maintaining homeostasis. To determine the role of Aire in maintaining immune tolerance by bone marrow-derived dendritic cells (BMDCs), in the present study we utilized Aire-knockout mice to examine the changes of maturation status and TRAs expression on BMDCs, additionally investigate the differentiation of CD4 + T cells. The results showed that expression of costimulatory molecule and major histocompatibility complex class II (MHC-II) molecule was increased and expression of various TRAs was decreased in BMDCs from Aire-knockout mice. Aire deficiency reduced the differentiation of naïve CD4 + T cells into type 2T helper (Th2) cells and regulatory T cells (Tregs) but enhanced the differentiation of naïve CD4 + T cells into Th1 cells, Th17 cells, and follicular helper T (Tfh) cells. The results demonstrate that Aire expressed by BMDCs plays an important role in the maintenance of homeostasis by regulating TRA expression and the differentiation of T cell subsets.

  6. Regulation of defensive function on gingival epithelial cells can prevent periodontal disease.

    Science.gov (United States)

    Fujita, Tsuyoshi; Yoshimoto, Tetsuya; Kajiya, Mikihito; Ouhara, Kazuhisa; Matsuda, Shinji; Takemura, Tasuku; Akutagawa, Keiichi; Takeda, Katsuhiro; Mizuno, Noriyoshi; Kurihara, Hidemi

    2018-05-01

    Periodontal disease is a bacterial biofilm-associated inflammatory disease that has been implicated in many systemic diseases. A new preventive method for periodontal disease needs to be developed in order to promote the health of the elderly in a super-aged society. The gingival epithelium plays an important role as a mechanical barrier against bacterial invasion and a part of the innate immune response to infectious inflammation in periodontal tissue. The disorganization of cell-cell interactions and subsequent inflammation contribute to the initiation of periodontal disease. These make us consider that regulation of host defensive functions, epithelial barrier and neutrophil activity, may become novel preventive methods for periodontal inflammation. Based on this concept, we have found that several agents regulate the barrier function of gingival epithelial cells and suppress the accumulation of neutrophils in the gingival epithelium. We herein introduce the actions of irsogladine maleate, azithromycin, amphotericin B, and Houttuynia cordata (dokudami in Japanese), which is commonly used in traditional medicine, on the epithelial barrier and neutrophil migration in gingival epithelial cells in vivo and in vitro , in order to provide support for the clinical application of these agents to the prevention of periodontal inflammation.

  7. Glucose Transporters at the Blood-Brain Barrier: Function, Regulation and Gateways for Drug Delivery.

    Science.gov (United States)

    Patching, Simon G

    2017-03-01

    Glucose transporters (GLUTs) at the blood-brain barrier maintain the continuous high glucose and energy demands of the brain. They also act as therapeutic targets and provide routes of entry for drug delivery to the brain and central nervous system for treatment of neurological and neurovascular conditions and brain tumours. This article first describes the distribution, function and regulation of glucose transporters at the blood-brain barrier, the major ones being the sodium-independent facilitative transporters GLUT1 and GLUT3. Other GLUTs and sodium-dependent transporters (SGLTs) have also been identified at lower levels and under various physiological conditions. It then considers the effects on glucose transporter expression and distribution of hypoglycemia and hyperglycemia associated with diabetes and oxygen/glucose deprivation associated with cerebral ischemia. A reduction in glucose transporters at the blood-brain barrier that occurs before the onset of the main pathophysiological changes and symptoms of Alzheimer's disease is a potential causative effect in the vascular hypothesis of the disease. Mutations in glucose transporters, notably those identified in GLUT1 deficiency syndrome, and some recreational drug compounds also alter the expression and/or activity of glucose transporters at the blood-brain barrier. Approaches for drug delivery across the blood-brain barrier include the pro-drug strategy whereby drug molecules are conjugated to glucose transporter substrates or encapsulated in nano-enabled delivery systems (e.g. liposomes, micelles, nanoparticles) that are functionalised to target glucose transporters. Finally, the continuous development of blood-brain barrier in vitro models is important for studying glucose transporter function, effects of disease conditions and interactions with drugs and xenobiotics.

  8. The barrier within: endothelial transport of hormones.

    Science.gov (United States)

    Kolka, Cathryn M; Bergman, Richard N

    2012-08-01

    Hormones are involved in a plethora of processes including development and growth, metabolism, mood, and immune responses. These essential functions are dependent on the ability of the hormone to access its target tissue. In the case of endocrine hormones that are transported through the blood, this often means that the endothelium must be crossed. Many studies have shown that the concentrations of hormones and nutrients in blood can be very different from those surrounding the cells on the tissue side of the blood vessel endothelium, suggesting that transport across this barrier can be rate limiting for hormone action. This transport can be regulated by altering the surface area of the blood vessel available for diffusion through to the underlying tissue or by the permeability of the endothelium. Many hormones are known to directly or indirectly affect the endothelial barrier, thus affecting their own distribution to their target tissues. Dysfunction of the endothelial barrier is found in many diseases, particularly those associated with the metabolic syndrome. The interrelatedness of hormones may help to explain why the cluster of diseases in the metabolic syndrome occur together so frequently and suggests that treating the endothelium may ameliorate defects in more than one disease. Here, we review the structure and function of the endothelium, its contribution to the function of hormones, and its involvement in disease.

  9. Overcoming Challenges to Childhood Immunizations Status.

    Science.gov (United States)

    Sabnis, Svapna S; Conway, James H

    2015-10-01

    Vaccines are one of the greatest public health achievements, preventing both mortality and morbidity. However, overall immunization rates are still below the 90% target for Healthy People 2020. There remain significant disparities in immunization rates between children of different racial/ethnic groups, as well as among economically disadvantaged populations. There are systemic issues and challenges in providing access to immunization opportunities. In addition, vaccine hesitancy contributes to underimmunization. Multiple strategies are needed to improve immunization rates, including improving access to vaccines and minimizing financial barriers to families. Vaccine status should be assessed and vaccines given at all possible opportunities. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Nogo-B Facilitates LPS-Mediated Immune Responses by Up-Regulation of TLR4-Signaling in Macrophage RAW264.7

    Directory of Open Access Journals (Sweden)

    Ying Zhu

    2017-01-01

    Full Text Available Background/Aims: Nogo-B, a member of the reticulon family of proteins, is mainly located in the endoplasmic reticulum (ER. Here, we investigate the function and mechanism of Nogo-B in the regulation of TLR4-associated immune responses in the macrophage cell line of RAW264.7. Methods: Nogo-B was up- and down-regulated through the use of appropriate adenoviral vectors or siRNA, and the effects of Nogo-B on macrophages under liposaccharide (LPS stimulation were evaluated via western blotting, immunofluorescence, enzyme-linked immunosorbent assay (ELISA, flow cytometric analysis, and transwell assay. Results: Our data indicates that the protein of Nogo-B was down-regulated in a time- and dose-dependent manner following LPS administration in the macrophage. Nogo-B overexpression increased the production of inflammatory cytokines (MCP-1, TNF-α, IL-1β, and TGF-β, enhanced macrophage migration activities, activated major histocompatibility complex II (MHC II, and elevated the expression of macrophage scavenger receptor 1(MSR1, all of which suggest that Nogo-B is necessary for immune responses and plays an important role in regulating macrophage recruitment. Mechanistically, Nogo-B may enhance TLR4 expression in macrophage surfaces, activate mitogen-activated protein kinase (MAPK pathways, and initiate inflammatory responses. Conclusion: These findings illustrate the key regulatory functions of Nogo-B in facilitating LPS-mediated immune responses through promoting the phosphorylation of MAP kinase.

  11. The intestinal barrier function and its involvement in digestive disease

    Directory of Open Access Journals (Sweden)

    Eloísa Salvo-Romero

    2015-11-01

    Full Text Available The gastrointestinal mucosal surface is lined with epithelial cells representing an effective barrier made up with intercellular junctions that separate the inner and the outer environments, and block the passage of potentially harmful substances. However, epithelial cells are also responsible for the absorption of nutrients and electrolytes, hence a semipermeable barrier is required that selectively allows a number of substances in while keeping others out. To this end, the intestine developed the "intestinal barrier function", a defensive system involving various elements, both intra- and extracellular, that work in a coordinated way to impede the passage of antigens, toxins, and microbial byproducts, and simultaneously preserves the correct development of the epithelial barrier, the immune system, and the acquisition of tolerance against dietary antigens and the intestinal microbiota. Disturbances in the mechanisms of the barrier function favor the development of exaggerated immune responses; while exact implications remain unknown, changes in intestinal barrier function have been associated with the development of inflammatory conditions in the gastrointestinal tract. This review details de various elements of the intestinal barrier function, and the key molecular and cellular changes described for gastrointestinal diseases associated with dysfunction in this defensive mechanism.

  12. Inhalable Andrographolide-β-cyclodextrin Inclusion Complexes for Treatment of Staphylococcus aureus Pneumonia by Regulating Immune Responses.

    Science.gov (United States)

    Zhang, Tongtong; Zhu, Lifei; Li, Miao; Hu, Yuzhen; Zhang, Erfeng; Jiang, Qingcheng; Han, Guang; Jin, Yiguang

    2017-05-01

    Bacterial pneumonia is a serious disease with high mortality if no appropriate and immediate therapy is available. Andrographolide (AG) is an anti-inflammatory agent extracted from a traditional Chinese herb andrographis paniculata. Oral AG tablets and pills are clinically applied for treatment of upper respiratory tract infections. However, the low solubility and bioavailability of AG lead to high doses and long-term therapy. Here we developed an andrographolide-β-cyclodextrin inclusion complex (AG-β-CD) for inhalation therapy of Staphylococcus aureus pneumonia. AG-β-CD was identified with X-ray diffraction and FT-IR. Surprisingly, both AG-β-CD and AG showed little in vitro anti-S. aureus activity. However, pulmonary delivery of AG, AG-β-CD, or penicillin had significant anti-S. aureus pneumonia effects. Leukocytes, neutrophils, white blood cells, total proteins, TNF-α, IL-6, NF-κB p65 expression, and bacterial colonies in the bronchoalveolar lavage fluids were detected. Pulmonary delivery of AG and AG-β-CD led to bacterial inhibition and inflammation alleviation by regulating immune responses, while penicillin only killed bacteria without significant immune regulation. Moreover, the antipneumonia activity of AG-β-CD was much higher than that of AG, probably resulting from locally accelerated AG dissolution due to β-CD inclusion. The aerodynamic diameter of AG-β-CD powders was 2.03 μm, suitable for pulmonary delivery. Inhalable AG-β-CD is a promising antibacterial and anti-inflammatory medicine for the treatment of S. aureus pneumonia by regulating immune responses, and the effect is enhanced by β-CD inclusion. AG and its formulations might be potent weapons against the resistant bacterial pneumonia due to their specific mechanism in the future.

  13. Innate immunity and effector and regulatory mechanisms involved in allergic contact dermatitis.

    Science.gov (United States)

    Silvestre, Marilene Chaves; Sato, Maria Notomi; Reis, Vitor Manoel Silva Dos

    2018-03-01

    Skin's innate immunity is the initial activator of immune response mechanisms, influencing the development of adaptive immunity. Some contact allergens are detected by Toll-like receptors (TLRs) and inflammasome NLR3. Keratinocytes participate in innate immunity and, in addition to functioning as an anatomical barrier, secrete cytokines, such as TNF, IL-1β, and IL-18, contributing to the development of Allergic Contact Dermatitis. Dendritic cells recognize and process antigenic peptides into T cells. Neutrophils cause pro-inflammatory reactions, mast cells induce migration/maturation of skin DCs, the natural killer cells have natural cytotoxic capacity, the γδ T cells favor contact with hapten during the sensitization phase, and the innate lymphoid cells act in the early stages by secreting cytokines, as well as act in inflammation and tissue homeostasis. The antigen-specific inflammation is mediated by T cells, and each subtype of T cells (Th1/Tc1, Th2/Tc2, and Th17/Tc17) activates resident skin cells, thus contributing to inflammation. Skin's regulatory T cells have a strong ability to inhibit the proliferation of hapten-specific T cells, acting at the end of the Allergic Contact Dermatitis response and in the control of systemic immune responses. In this review, we report how cutaneous innate immunity is the first line of defense and focus its role in the activation of the adaptive immune response, with effector response induction and its regulation.

  14. Innate immunity and effector and regulatory mechanisms involved in allergic contact dermatitis*

    Science.gov (United States)

    Silvestre, Marilene Chaves; Sato, Maria Notomi; dos Reis, Vitor Manoel Silva

    2018-01-01

    Skin's innate immunity is the initial activator of immune response mechanisms, influencing the development of adaptive immunity. Some contact allergens are detected by Toll-like receptors (TLRs) and inflammasome NLR3. Keratinocytes participate in innate immunity and, in addition to functioning as an anatomical barrier, secrete cytokines, such as TNF, IL-1β, and IL-18, contributing to the development of Allergic Contact Dermatitis. Dendritic cells recognize and process antigenic peptides into T cells. Neutrophils cause pro-inflammatory reactions, mast cells induce migration/maturation of skin DCs, the natural killer cells have natural cytotoxic capacity, the γδ T cells favor contact with hapten during the sensitization phase, and the innate lymphoid cells act in the early stages by secreting cytokines, as well as act in inflammation and tissue homeostasis. The antigen-specific inflammation is mediated by T cells, and each subtype of T cells (Th1/Tc1, Th2/Tc2, and Th17/Tc17) activates resident skin cells, thus contributing to inflammation. Skin's regulatory T cells have a strong ability to inhibit the proliferation of hapten-specific T cells, acting at the end of the Allergic Contact Dermatitis response and in the control of systemic immune responses. In this review, we report how cutaneous innate immunity is the first line of defense and focus its role in the activation of the adaptive immune response, with effector response induction and its regulation. PMID:29723367

  15. Poliovirus intrahost evolution is required to overcome tissue-specific innate immune responses.

    Science.gov (United States)

    Xiao, Yinghong; Dolan, Patrick Timothy; Goldstein, Elizabeth Faul; Li, Min; Farkov, Mikhail; Brodsky, Leonid; Andino, Raul

    2017-08-29

    RNA viruses, such as poliovirus, have a great evolutionary capacity, allowing them to quickly adapt and overcome challenges encountered during infection. Here we show that poliovirus infection in immune-competent mice requires adaptation to tissue-specific innate immune microenvironments. The ability of the virus to establish robust infection and virulence correlates with its evolutionary capacity. We further identify a region in the multi-functional poliovirus protein 2B as a hotspot for the accumulation of minor alleles that facilitate a more effective suppression of the interferon response. We propose that population genetic dynamics enables poliovirus spread between tissues through optimization of the genetic composition of low frequency variants, which together cooperate to circumvent tissue-specific challenges. Thus, intrahost virus evolution determines pathogenesis, allowing a dynamic regulation of viral functions required to overcome barriers to infection.RNA viruses, such as polioviruses, have a great evolutionary capacity and can adapt quickly during infection. Here, the authors show that poliovirus infection in mice requires adaptation to innate immune microenvironments encountered in different tissues.

  16. XAP5 CIRCADIAN TIMEKEEPER Positively Regulates RESISTANCE TO POWDERY MILDEW8.1–Mediated Immunity in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Yong-Ju Xu

    2017-11-01

    Full Text Available Ectopic expression of the Arabidopsis RESISTANCE TO POWDERY MILDEW8.1 (RPW8.1 boosts pattern-triggered immunity leading to enhanced resistance to different pathogens in Arabidopsis and rice. However, the underlying regulatory mechanism remains largely elusive. Here, we report that XAP5 CIRCADIAN TIMEKEEPER (XCT, At2g21150 positively regulates RPW8.1-mediated cell death and disease resistance. Forward genetic screen identified the b3-17 mutant that exhibited less cell death and susceptibility to powdery mildew and bacterial pathogens. Map-based cloning identified a G-to-A point mutation at the 3′ splice site of the 8th intron, which resulted in splice shift to 8-bp down-stream of the original splice site of XCT in b3-17, and introduced into a stop codon after two codons leading to a truncated XCT. XCT has previously been identified as a circadian clock gene required for small RNA biogenesis and acting down-stream of ETHYLENE-INSENSITIVE3 (EIN3 in the ethylene-signaling pathway. Here we further showed that mutation or down-regulation of XCT by artificial microRNA reduced RPW8.1-mediated immunity in R1Y4, a transgenic line expressing RPW8.1-YFP from the RPW8.1 native promoter. On the contrary, overexpression of XCT in R1Y4 background enhanced RPW8.1-mediated cell death, H2O2 production and resistance against powdery mildew. Consistently, the expression of RPW8.1 was down- and up-regulated in xct mutant and XCT overexpression lines, respectively. Taken together, these results indicate that XCT positively regulates RPW8.1-mediated cell death and disease resistance, and provide new insight into the regulatory mechanism of RPW8.1-mediated immunity.

  17. Rupture, Invasion and Inflammatory Destruction of the Intestinal Barrier by Shigella: The Yin and Yang of Innate Immunity

    Directory of Open Access Journals (Sweden)

    Philippe J Sansonetti

    2006-01-01

    Full Text Available Shigella is a Gram-negative bacterial species of the family Enterobacteriaceae that causes bacillary dysentery in humans. This acute colitis reflects the capacity of the microorganism to disrupt, invade and cause the inflammatory destruction of the intestinal epithelium. The pathogenesis of the Shigella infection can be seen as a disruption of the homeostatic balance that protects the gut against inflammation in the presence of its commensal flora. This provides the unified view that enteroinvasive pathogens allow for the identification of key signalling molecules and pathways involved in the regulation of intestinal inflammation, and more generally, in the regulation of the innate and adaptive immune response.

  18. Human Leukocyte Antigen (HLA and Immune Regulation: How Do Classical and Non-Classical HLA Alleles Modulate Immune Response to Human Immunodeficiency Virus and Hepatitis C Virus Infections?

    Directory of Open Access Journals (Sweden)

    Nicole B. Crux

    2017-07-01

    Full Text Available The genetic factors associated with susceptibility or resistance to viral infections are likely to involve a sophisticated array of immune response. These genetic elements may modulate other biological factors that account for significant influence on the gene expression and/or protein function in the host. Among them, the role of the major histocompatibility complex in viral pathogenesis in particular human immunodeficiency virus (HIV and hepatitis C virus (HCV, is very well documented. We, recently, added a novel insight into the field by identifying the molecular mechanism associated with the protective role of human leukocyte antigen (HLA-B27/B57 CD8+ T cells in the context of HIV-1 infection and why these alleles act as a double-edged sword protecting against viral infections but predisposing the host to autoimmune diseases. The focus of this review will be reexamining the role of classical and non-classical HLA alleles, including class Ia (HLA-A, -B, -C, class Ib (HLA-E, -F, -G, -H, and class II (HLA-DR, -DQ, -DM, and -DP in immune regulation and viral pathogenesis (e.g., HIV and HCV. To our knowledge, this is the very first review of its kind to comprehensively analyze the role of these molecules in immune regulation associated with chronic viral infections.

  19. The known two types of transglutaminases regulate immune and stress responses in white shrimp, Litopenaeus vannamei.

    Science.gov (United States)

    Chang, Chin-Chyuan; Chang, Hao-Che; Liu, Kuan-Fu; Cheng, Winton

    2016-06-01

    Transglutaminases (TGs) play critical roles in blood coagulation, immune responses, and other biochemical functions, which undergo post-translational remodeling such as acetylation, phosphorylation and fatty acylation. Two types of TG have been identified in white shrimp, Litopenaeus vannamei, and further investigation on their potential function was conducted by gene silencing in the present study. Total haemocyte count (THC), differential haemocyte count (DHC), phenoloxidase activity, respiratory bursts (release of superoxide anion), superoxide dismutase activity, transglutaminase (TG) activity, haemolymph clotting time, and phagocytic activity and clearance efficiency to the pathogen Vibrio alginolyticus were measured when shrimps were individually injected with diethyl pyrocarbonate-water (DEPC-H2O) or TG dsRNAs. In addition, haemolymph glucose and lactate, and haemocytes crustin, lysozyme, crustacean hyperglycemic hormone (CHH), transglutaminaseI (TGI), transglutaminaseII (TGII) and clotting protein (CP) mRNA expression were determined in the dsRNA injected shrimp under hypothermal stress. Results showed that TG activity, phagocytic activity and clearance efficiency were significantly decreased, but THC, hyaline cells (HCs) and haemolymph clotting time were significantly increased in the shrimp which received LvTGI dsRNA and LvTGI + LvTGII dsRNA after 3 days. However, respiratory burst per haemocyte was significantly decreased in only LvTGI + LvTGII silenced shrimp. In hypothermal stress studies, elevation of haemolymph glucose and lactate was observed in all treated groups, and were advanced in LvTGI and LvTGI + LvTGII silenced shrimp following exposure to 22 °C. LvCHH mRNA expression was significantly up-regulated, but crustin and lysozyme mRNA expressions were significantly down-regulated in LvTGI and LvTGI + LvTGII silenced shrimp; moreover, LvTGII was significantly increased, but LvTGI was significantly decreased in LvTGI silenced shrimp

  20. Differential Regulation of Two-Tiered Plant Immunity and Sexual Reproduction by ANXUR Receptor-Like Kinases.

    Science.gov (United States)

    Mang, Hyunggon; Feng, Baomin; Hu, Zhangjian; Boisson-Dernier, Aurélien; Franck, Christina M; Meng, Xiangzong; Huang, Yanyan; Zhou, Jinggeng; Xu, Guangyuan; Wang, Taotao; Shan, Libo; He, Ping

    2017-12-01

    Plants have evolved two tiers of immune receptors to detect infections: cell surface-resident pattern recognition receptors (PRRs) that sense microbial signatures and intracellular nucleotide binding domain leucine-rich repeat (NLR) proteins that recognize pathogen effectors. How PRRs and NLRs interconnect and activate the specific and overlapping plant immune responses remains elusive. A genetic screen for components controlling plant immunity identified ANXUR1 (ANX1), a malectin-like domain-containing receptor-like kinase, together with its homolog ANX2, as important negative regulators of both PRR- and NLR-mediated immunity in Arabidopsis thaliana ANX1 constitutively associates with the bacterial flagellin receptor FLAGELLIN-SENSING2 (FLS2) and its coreceptor BRI1-ASSOCIATED RECEPTOR KINASE1 (BAK1). Perception of flagellin by FLS2 promotes ANX1 association with BAK1, thereby interfering with FLS2-BAK1 complex formation to attenuate PRR signaling. In addition, ANX1 complexes with the NLR proteins RESISTANT TO PSEUDOMONAS SYRINGAE2 (RPS2) and RESISTANCE TO P. SYRINGAE PV MACULICOLA1. ANX1 promotes RPS2 degradation and attenuates RPS2-mediated cell death. Surprisingly, a mutation that affects ANX1 function in plant immunity does not disrupt its function in controlling pollen tube growth during fertilization. Our study thus reveals a molecular link between PRR and NLR protein complexes that both associate with cell surface-resident ANX1 and uncovers uncoupled functions of ANX1 and ANX2 during plant immunity and sexual reproduction. © 2017 American Society of Plant Biologists. All rights reserved.

  1. Regulator-dependent mechanisms of C3b processing by factor i allow differentiation of immune responses

    NARCIS (Netherlands)

    Xue, Xiaoguang|info:eu-repo/dai/nl/413576841; Wu, Jin|info:eu-repo/dai/nl/304829552; Ricklin, Daniel; Forneris, Federico|info:eu-repo/dai/nl/341358622; Di Crescenzio, Patrizia; Schmidt, Christoph Q.; Granneman, Joke|info:eu-repo/dai/nl/304839396; Sharp, Thomas H; Lambris, John D; Gros, Piet|info:eu-repo/dai/nl/075243016

    2017-01-01

    The complement system labels microbes and host debris for clearance. Degradation of surface-bound C3b is pivotal to direct immune responses and protect host cells. How the serine protease factor I (FI), assisted by regulators, cleaves either two or three distant peptide bonds in the CUB domain of

  2. Pharmacists as immunizers: a survey of community pharmacists' willingness to administer adult immunizations.

    Science.gov (United States)

    Edwards, Nicholas; Gorman Corsten, Erin; Kiberd, Mathew; Bowles, Susan; Isenor, Jennifer; Slayter, Kathryn; McNeil, Shelly

    2015-04-01

    Adult immunization rates worldwide fall below desired targets. Pharmacists are highly accessible healthcare providers with the potential to increase immunization rates among adults by administering vaccines in their practice setting. To determine the attitudes of community-based Canadian pharmacists with respect to expanding their scope of practice to include administration of immunizations. An internet-based survey was emailed to community pharmacists across Canada. The survey was piloted through focus groups for qualitative feedback, tested for content validity, and test-retest reliability prior to dissemination. There were 495 responses to the survey. The majority (88 %) agreed that pharmacists as immunizers would increase public access, improve rates (84 %), and be acceptable to the public (72 %). However, only 68 % agreed that pharmacists should be permitted to immunize. The majority of respondents (90 %) agreed that certification in vaccine administration should be required for pharmacists to administer vaccines. Pharmacists identified education, reimbursement, and negative interactions with other providers as barriers to pharmacists administering vaccines. Canadian pharmacists are willing to expand their scope of practice to include immunization. However, implementation requires professional development and certification in vaccine administration.

  3. Innate immunity in vertebrates: an overview.

    Science.gov (United States)

    Riera Romo, Mario; Pérez-Martínez, Dayana; Castillo Ferrer, Camila

    2016-06-01

    Innate immunity is a semi-specific and widely distributed form of immunity, which represents the first line of defence against pathogens. This type of immunity is critical to maintain homeostasis and prevent microbe invasion, eliminating a great variety of pathogens and contributing with the activation of the adaptive immune response. The components of innate immunity include physical and chemical barriers, humoral and cell-mediated components, which are present in all jawed vertebrates. The understanding of innate defence mechanisms in non-mammalian vertebrates is the key to comprehend the general picture of vertebrate innate immunity and its evolutionary history. This is also essential for the identification of new molecules with applications in immunopharmacology and immunotherapy. In this review, we describe and discuss the main elements of vertebrate innate immunity, presenting core findings in this field and identifying areas that need further investigation. © 2016 John Wiley & Sons Ltd.

  4. Sick and tired: how molecular regulators of human sleep schedules and duration impact immune function.

    Science.gov (United States)

    Kurien, Philip A; Chong, S Y Christin; Ptáček, Louis J; Fu, Ying-Hui

    2013-10-01

    Why do we need to sleep? What regulates when we sleep? And what dictates the number of hours we require? These are often viewed as three separate biological questions. Here, we propose they share molecular etiologies, whereby regulators of sleep schedules and sleep duration also govern the physiological purposes of sleep. To support our hypothesis, we review Mendelian human genetic variants sufficient to advance sleep-wake onset (PER2) and shorten sleep length (DEC2), and evaluate their emerging roles in immune responses that may rely on a sound night of slumber. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Understanding regulation of the host-mediated gut symbiont population and the symbiont-mediated host immunity in the Riptortus-Burkholderia symbiosis system.

    Science.gov (United States)

    Kim, Jiyeun Kate; Lee, Jun Beom; Jang, Ho Am; Han, Yeon Soo; Fukatsu, Takema; Lee, Bok Luel

    2016-11-01

    Valuable insect models have tremendously contributed to our understanding of innate immunity and symbiosis. Bean bug, Riptortus pedestris, is a useful insect symbiosis model due to harboring cultivable monospecific gut symbiont, genus Burkholderia. Bean bug is a hemimetabolous insect whose immunity is not well-understood. However, we recently identified three major antimicrobial peptides of Riptortus and examined the relationship between gut symbiosis and host immunity. We found that the presence of Burkholderia gut symbiont positively affects Riptortus immunity. From studying host regulation mechanisms of symbiont population, we revealed that the symbiotic Burkholderia cells are much more susceptible to Riptortus immune responses than the cultured cells. We further elucidated that the immune-susceptibility of the Burkholderia gut symbionts is due to the drastic change of bacterial cell envelope. Finally, we show that the immune-susceptible Burkholderia symbionts are able to prosper in host owing to the suppression of immune responses of the symbiotic midgut. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Expression of GIMAP1, a GTPase of the immunity-associated protein family, is not up-regulated in malaria

    Directory of Open Access Journals (Sweden)

    Carter Christine

    2009-04-01

    Full Text Available Abstract Background GIMAP (GTPase of the immunity-associated protein family proteins are a family of putative GTPases believed to be regulators of cell death in lymphomyeloid cells. GIMAP1 was the first reported member of this gene family, identified as a gene up-regulated at the RNA level in the spleens of mice infected with the malarial parasite, Plasmodium chabaudi. Methods A monoclonal antibody against mouse GIMAP1 was developed and was used to analyse the expression of the endogenous protein in tissues of normal mice and in defined sub-populations of cells prepared from lymphoid tissues using flow cytometry. It was also used to assess the expression of GIMAP1 protein after infection and/or immunization of mice with P. chabaudi. Real-time PCR analysis was employed to measure the expression of GIMAP1 for comparison with the protein level analysis. Results GIMAP1 protein expression was detected in all lineages of lymphocytes (T, B, NK, in F4/80+ splenic macrophages and in some lymphoid cell lines. Additional evidence is presented suggesting that the strong expression by mature B cells of GIMAP1 and other GIMAP genes and proteins seen in mice may be a species-dependent characteristic. Unexpectedly, no increase was found in the expression of GIMAP1 in P. chabaudi infected mice at either the mRNA or protein level, and this remained so despite applying a number of variations to the protocol. Conclusion The model of up-regulation of GIMAP1 in response to infection/immunization with P. chabaudi is not a robustly reproducible experimental system. The GIMAP1 protein is widely expressed in lymphoid cells, with an interesting increase in expression in the later stages of B cell development. Alternative approaches will be required to define the functional role of this GTPase in immune cells.

  7. Barriers to access to opioid medicines for patients with opioid dependence: a review of legislation and regulations in eleven central and eastern European countries.

    Science.gov (United States)

    Vranken, Marjolein J M; Mantel-Teeuwisse, Aukje K; Jünger, Saskia; Radbruch, Lukas; Scholten, Willem; Lisman, John A; Subataite, Marija; Schutjens, Marie-Hélène D B

    2017-06-01

    Barriers linked to drug control systems are considered to contribute to inequitable access to controlled medicines, leaving millions of people in pain and suffering. Most studies focus on access to opioids for the treatment of severe (cancer) pain. This study aims to identify specific access barriers for patients with opioid dependence in legislation and regulations of 11 central and eastern European countries. This study builds on a previous analysis of legislation and regulations as part of the EU 7th Framework Access To Opioid Medication in Europe (ATOME) project. An in-depth analysis was undertaken to determine specific barriers for patients with opioid dependence in need of opioid analgesics or opioid agonist therapy (OAT). For each country, the number and nature of specific potential barriers for these patients were assessed according to eight categories: prescribing; dispensing; manufacturing; usage; trade and distribution; affordability; penalties; and other. An additional keyword search was conducted to minimize the omission of barriers. Barriers in an additional category, language, were recorded qualitatively. Countries included Bulgaria, Cyprus, Estonia, Greece, Hungary, Latvia, Lithuania, Serbia, Slovakia, Slovenia and Turkey. Ten of the 11 countries (all except Estonia) showed specific potential barriers in their legislation and regulations. The total number of barriers varied from two (Slovenia) to 46 (Lithuania); the number of categories varied from one (Slovenia) to five (Lithuania). Most specific potential barriers were shown in the categories 'prescribing', 'usage' and 'other'. The total number in a single category varied from one to 18 (Lithuania, prescribing). Individual differences between countries in the same specific potential barrier were shown; for example, variation in minimum age criteria for admission to OAT ranging from 15 (Lithuania, in special cases) to 20 years (Greece). All countries had stigmatizing language in their legislation

  8. The joint power of sex and stress to modulate brain-gut-microbiota axis and intestinal barrier homeostasis: implications for irritable bowel syndrome.

    Science.gov (United States)

    Pigrau, M; Rodiño-Janeiro, B K; Casado-Bedmar, M; Lobo, B; Vicario, M; Santos, J; Alonso-Cotoner, C

    2016-04-01

    Intestinal homeostasis is a dynamic process that takes place at the interface between the lumen and the mucosa of the gastrointestinal tract, where a constant scrutiny for antigens and toxins derived from food and microorganisms is carried out by the vast gut-associated immune system. Intestinal homeostasis is preserved by the ability of the mucus layer and the mucosal barrier to keep the passage of small-sized and antigenic molecules across the epithelium highly selective. When combined and preserved, immune surveillance and barrier's selective permeability, the host capacity of preventing the development of intestinal inflammation is optimized, and viceversa. In addition, the brain-gut-microbiome axis, a multidirectional communication system that integrates distant and local regulatory networks through neural, immunological, metabolic, and hormonal signaling pathways, also regulates intestinal function. Dysfunction of the brain-gut-microbiome axis may induce the loss of gut mucosal homeostasis, leading to uncontrolled permeation of toxins and immunogenic particles, increasing the risk of appearance of intestinal inflammation, mucosal damage, and gut disorders. Irritable bowel syndrome is prevalent stress-sensitive gastrointestinal disorder that shows a female predominance. Interestingly, the role of stress, sex and gonadal hormones in the regulation of intestinal mucosal and the brain-gut-microbiome axis functioning is being increasingly recognized. We aim to critically review the evidence linking sex, and stress to intestinal barrier and brain-gut-microbiome axis dysfunction and the implications for irritable bowel syndrome. © 2015 John Wiley & Sons Ltd.

  9. Driving forces and barriers for environmental technology development; Drivkrefter og barrierer for utvikling av miljoeteknologi

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2005-07-01

    Driving forces and barriers behind development and usage of environmental technology is discussed, and also whether there are certain characteristics related to environmental innovations compared to other innovations in general. The development of environmental technology is in principle dominated by the same drivers and barriers as any other technology, but the order and strength of the various factors may be different. This examination as well as other empirical studies shows that regulations play a greater part for environmental technology than 'pure market forces'. To many participants it is important to be one step ahead of the regulations, i.e. the expected regulations are equally important as the factual ones in driving the technology development. Players in the business community express that it is important that the authorities cooperate with them when introducing new regulations. This will increase acceptance for the regulations and facilitate the necessary adjustments. The most important barrier in the development and use of the technologies studied is probably the lack of demand.

  10. Vascular, glial, and lymphatic immune gateways of the central nervous system

    NARCIS (Netherlands)

    Engelhardt, Britta; Carare, Roxana O.; Bechmann, Ingo; Fluegel, Alexander; Laman, Jon D.; Weller, Roy O.

    Immune privilege of the central nervous system (CNS) has been ascribed to the presence of a blood-brain barrier and the lack of lymphatic vessels within the CNS parenchyma. However, immune reactions occur within the CNS and it is clear that the CNS has a unique relationship with the immune system.

  11. The Roles of RNase-L in Antimicrobial Immunity and the Cytoskeleton-Associated Innate Response.

    Science.gov (United States)

    Ezelle, Heather J; Malathi, Krishnamurthy; Hassel, Bret A

    2016-01-08

    The interferon (IFN)-regulated endoribonuclease RNase-L is involved in multiple aspects of the antimicrobial innate immune response. It is the terminal component of an RNA cleavage pathway in which dsRNA induces the production of RNase-L-activating 2-5A by the 2'-5'-oligoadenylate synthetase. The active nuclease then cleaves ssRNAs, both cellular and viral, leading to downregulation of their expression and the generation of small RNAs capable of activating retinoic acid-inducible gene-I (RIG-I)-like receptors or the nucleotide-binding oligomerization domain-like receptor 3 (NLRP3) inflammasome. This leads to IFNβ expression and IL-1β activation respectively, in addition to broader effects on immune cell function. RNase-L is also one of a growing number of innate immune components that interact with the cell cytoskeleton. It can bind to several cytoskeletal proteins, including filamin A, an actin-binding protein that collaborates with RNase-L to maintain the cellular barrier to viral entry. This antiviral activity is independent of catalytic function, a unique mechanism for RNase-L. We also describe here the interaction of RNase-L with the E3 ubiquitin ligase and scaffolding protein, ligand of nump protein X (LNX), a regulator of tight junction proteins. In order to better understand the significance and context of these novel binding partners in the antimicrobial response, other innate immune protein interactions with the cytoskeleton are also discussed.

  12. Immune-regulating effects of exercise on cigarette smoke-induced inflammation

    Directory of Open Access Journals (Sweden)

    Madani A

    2018-04-01

    . It is well established that exercise training exerts immune-regulating effects by activating anti-inflammatory signaling pathways. In this regard, the release of myokines from contracting skeletal muscle, the elevations of cortisol and adrenalin, the reduced expression of Toll-like receptors, and the increased mobilization of immune-regulating leukocyte subtypes might be of vital importance. Exercise training also increases the local and systemic antioxidative capacity and several compensatory mechanisms in tissues such as an increased anabolic signaling in muscle or an increased compliance of the vascular system. Accordingly, regular exercise training seems to protect long-term smokers against some important negative local and systemic consequences of smoking. Data suggest that it seems to be important to start exercise training as early as possible. Keywords: physical activity, pulmonary system, muscle wasting, lymphocytes, tobacco, airway epithelial cells

  13. Curating the innate immunity interactome.

    LENUS (Irish Health Repository)

    Lynn, David J

    2010-01-01

    The innate immune response is the first line of defence against invading pathogens and is regulated by complex signalling and transcriptional networks. Systems biology approaches promise to shed new light on the regulation of innate immunity through the analysis and modelling of these networks. A key initial step in this process is the contextual cataloguing of the components of this system and the molecular interactions that comprise these networks. InnateDB (http:\\/\\/www.innatedb.com) is a molecular interaction and pathway database developed to facilitate systems-level analyses of innate immunity.

  14. Weaning stress and gastrointestinal barrier development: Implications for lifelong gut health in pigs

    Directory of Open Access Journals (Sweden)

    Adam J. Moeser

    2017-12-01

    Full Text Available The gastrointestinal (GI barrier serves a critical role in survival and overall health of animals and humans. Several layers of barrier defense mechanisms are provided by the epithelial, immune and enteric nervous systems. Together they act in concert to control normal gut functions (e.g., digestion, absorption, secretion, immunity, etc. whereas at the same time provide a barrier from the hostile conditions in the luminal environment. Breakdown of these critical GI functions is a central pathophysiological mechanism in the most serious GI disorders in pigs. This review will focus on the development and functional properties of the GI barrier in pigs and how common early life production stressors, such as weaning, can alter immediate and long-term barrier function and disease susceptibility. Specific stress-related pathophysiological mechanisms responsible for driving GI barrier dysfunction induced by weaning and the implications to animal health and performance will be discussed.

  15. Regulation of NO synthesis, local inflammation, and innate immunity to pathogens by BET family proteins.

    Science.gov (United States)

    Wienerroither, Sebastian; Rauch, Isabella; Rosebrock, Felix; Jamieson, Amanda M; Bradner, James; Muhar, Matthias; Zuber, Johannes; Müller, Mathias; Decker, Thomas

    2014-02-01

    Transcriptional activation of the Nos2 gene, encoding inducible nitric oxide synthase (iNOS), during infection or inflammation requires coordinate assembly of an initiation complex by the transcription factors NF-κB and type I interferon-activated ISGF3. Here we show that infection of macrophages with the intracellular bacterial pathogen Listeria monocytogenes caused binding of the BET proteins Brd2, Brd3, and, most prominently, Brd4 to the Nos2 promoter and that a profound reduction of Nos2 expression occurred in the presence of the BET inhibitor JQ1. RNA polymerase activity at the Nos2 gene was regulated through Brd-mediated C-terminal domain (CTD) phosphorylation at serine 5. Underscoring the critical importance of Brd for the regulation of immune responses, application of JQ1 reduced NO production in mice infected with L. monocytogenes, as well as innate resistance to L. monocytogenes and influenza virus. In a murine model of inflammatory disease, JQ1 treatment increased the colitogenic activity of dextran sodium sulfate (DSS). The data presented in our study suggest that BET protein inhibition in a clinical setting poses the risk of altering the innate immune response to infectious or inflammatory challenge.

  16. Characterization of a RacGTPase up-regulated in the large yellow croaker Pseudosciaena crocea immunity.

    Science.gov (United States)

    Han, Fang; Wang, Xiaoqing; Yang, Qilian; Cai, Mingyi; Wang, Zhi Yong

    2011-02-01

    The Rac proteins are members of the Rho family of small G proteins and are implicated in the regulation of several pathways, including those leading to cytoskeleton reorganization, gene expression, cell proliferation, cell adhesion and cell migration and survival. In this investigation, a Rac gene (named as LycRac gene) was obtained from the large yellow croaker and it was expressed in Escherichia coli and purified. Subsequently the specific antibody was raised using the purified fusion protein (GST-LycRac). Moreover, the GTP-binding assay showed that the LycRac protein had GTP-binding activity. The LycRac gene was ubiquitously transcribed and expressed in 9 tissues. Quantitative real-time RT-PCR and Western blot analysis revealed the highest expression in gill and the weakest expression in spleen. Time-course analysis revealed that LycRac expression was obviously up-regulated in blood, spleen and liver after immunization with polyinosinic polycytidynic acid (poly I:C), formalin-inactive Gram-negative bacterium Vibrio parahemolyticus and bacterial lipopolysaccharides (LPS). These results suggested that LycRac protein might play an important role in the immune response against microorganisms in large yellow croaker. Crown Copyright © 2010. Published by Elsevier Ltd. All rights reserved.

  17. Disturbance of ion environment and immune regulation following biodistribution of magnetic iron oxide nanoparticles injected intravenously.

    Science.gov (United States)

    Park, Eun-Jung; Kim, Sang-Wook; Yoon, Cheolho; Kim, Younghun; Kim, Jong Sung

    2016-01-22

    Although it is expected that accumulation of metal oxide nanoparticles that can induce redox reaction in the biological system may influence ion homeostasis and immune regulation through generation of free radicals, the relationship is still unclear. In this study, mice received magnetic iron oxide nanoparticles (M-FeNPs, 2 and 4 mg/kg) a single via the tail vein, and their distribution in tissues was investigated over time (1, 4, and 13 weeks). In addition, we evaluated the effects on homeostasis of redox reaction-related elements, the ion environment and immune regulation. The iron level in tissues reached at the maximum on 4 weeks after injection and M-FeNPs the most distributed in the spleen at 13 weeks. Additionally, levels of redox reaction-related elements in tissues were notably altered since 1 week post-injection. While levels of K(+) and Na(+) in tissue tended to decrease with time, Ca(2+) levels reached to the maximum at 4 weeks post-injection. On 13 weeks post-injection, the increased percentages of neutrophils and eosinophils, the enhanced release of LDH, and the elevated secretion of IL-8 and IL-6 were clearly observed in the blood of M-FeNP-treated mice compared to the control. While expression of antigen presentation related-proteins and the maturation of dendritic cells were markedly inhibited following distribution of M-FeNPs, the expression of several chemokines, including CXCR2, CCR5, and CD123, was enhanced on the splenocytes of the treated groups. Taken together, we suggest that accumulation of M-FeNPs may induce adverse health effects by disturbing homeostasis of the immune regulation and ion environment. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  18. CYLD Limits Lys63- and Met1-Linked Ubiquitin at Receptor Complexes to Regulate Innate Immune Signaling

    Directory of Open Access Journals (Sweden)

    Matous Hrdinka

    2016-03-01

    Full Text Available Innate immune signaling relies on the deposition of non-degradative polyubiquitin at receptor-signaling complexes, but how these ubiquitin modifications are regulated by deubiquitinases remains incompletely understood. Met1-linked ubiquitin (Met1-Ub is assembled by the linear ubiquitin assembly complex (LUBAC, and this is counteracted by the Met1-Ub-specific deubiquitinase OTULIN, which binds to the catalytic LUBAC subunit HOIP. In this study, we report that HOIP also interacts with the deubiquitinase CYLD but that CYLD does not regulate ubiquitination of LUBAC components. Instead, CYLD limits extension of Lys63-Ub and Met1-Ub conjugated to RIPK2 to restrict signaling and cytokine production. Accordingly, Met1-Ub and Lys63-Ub were individually required for productive NOD2 signaling. Our study thus suggests that LUBAC, through its associated deubiquitinases, coordinates the deposition of not only Met1-Ub but also Lys63-Ub to ensure an appropriate response to innate immune receptor activation.

  19. Bim: guardian of tissue homeostasis and critical regulator of the immune system, tumorigenesis and bone biology.

    Science.gov (United States)

    Akiyama, Toru; Tanaka, Sakae

    2011-08-01

    One of the most important roles of apoptosis is the maintenance of tissue homeostasis. Impairment of apoptosis leads to a number of pathological conditions. In response to apoptotic signals, various proteins are activated in a pathway and signal-specific manner. Recently, the pro-apoptotic molecule Bim has attracted increasing attention as a pivotal regulator of tissue homeostasis. The Bim expression level is strictly controlled in both transcriptional and post-transcriptional levels. This control is dependent on cell, tissue and apoptotic stimuli. The phenotype of Bim-deficient mice is a systemic lupus erythematosus-like autoimmune disease with an abnormal accumulation of hematopoietic cells. Bim is thus a critical regulator of hematopoietic cells and immune system. Further studies have revealed the critical roles of Bim in various normal and pathological conditions, including bone homeostasis and tumorigenesis. The current understanding of Bim signaling and roles in the maintenance of tissue homeostasis is reviewed in this paper, focusing on the immune system, bone biology and tumorigenesis to illustrate the diversified role of Bim.

  20. Metallothioneins: Emerging Modulators in Immunity and Infection

    Directory of Open Access Journals (Sweden)

    Kavitha Subramanian Vignesh

    2017-10-01

    Full Text Available Metallothioneins (MTs are a family of metal-binding proteins virtually expressed in all organisms including prokaryotes, lower eukaryotes, invertebrates and mammals. These proteins regulate homeostasis of zinc (Zn and copper (Cu, mitigate heavy metal poisoning, and alleviate superoxide stress. In recent years, MTs have emerged as an important, yet largely underappreciated, component of the immune system. Innate and adaptive immune cells regulate MTs in response to stress stimuli, cytokine signals and microbial challenge. Modulation of MTs in these cells in turn regulates metal ion release, transport and distribution, cellular redox status, enzyme function and cell signaling. While it is well established that the host strictly regulates availability of metal ions during microbial pathogenesis, we are only recently beginning to unravel the interplay between metal-regulatory pathways and immunological defenses. In this perspective, investigation of mechanisms that leverage the potential of MTs to orchestrate inflammatory responses and antimicrobial defenses has gained momentum. The purpose of this review, therefore, is to illumine the role of MTs in immune regulation. We discuss the mechanisms of MT induction and signaling in immune cells and explore the therapeutic potential of the MT-Zn axis in bolstering immune defenses against pathogens.

  1. Regulation of intestinal homeostasis and immunity with probiotic lactobacilli.

    Science.gov (United States)

    van Baarlen, Peter; Wells, Jerry M; Kleerebezem, Michiel

    2013-05-01

    The gut microbiota provide important stimuli to the human innate and adaptive immune system and co-mediate metabolic and immune homeostasis. Probiotic bacteria can be regarded as part of the natural human microbiota, and have been associated with improving homeostasis, albeit with different levels of success. Composition of microbiota, probiotic strain identity, and host genetic differences may account for differential modulation of immune responses by probiotics. Here, we review the mechanisms of immunomodulating capacities of specific probiotic strains, the responses they can induce in the host, and how microbiota and genetic differences between individuals may co-influence host responses and immune homeostasis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Connecting the immune system, systemic chronic inflammation and the gut microbiome: The role of sex.

    Science.gov (United States)

    Rizzetto, Lisa; Fava, Francesca; Tuohy, Kieran M; Selmi, Carlo

    2018-05-31

    Unresolved low grade systemic inflammation represents the underlying pathological mechanism driving immune and metabolic pathways involved in autoimmune diseases (AID). Mechanistic studies in animal models of AID and observational studies in patients have found alterations in gut microbiota communities and their metabolites, suggesting a microbial contribution to the onset or progression of AID. The gut microbiota and its metabolites have been shown to influence immune functions and immune homeostasis both within the gut and systematically. Microbial derived-short chain fatty acid (SCFA) and bio-transformed bile acid (BA) have been shown to influence the immune system acting as ligands specific cell signaling receptors like GPRCs, TGR5 and FXR, or via epigenetic processes. Similarly, intestinal permeability (leaky gut) and bacterial translocation are important contributors to chronic systemic inflammation and, without repair of the intestinal barrier, might represent a continuous inflammatory stimulus capable of triggering autoimmune processes. Recent studies indicate gender-specific differences in immunity, with the gut microbiota shaping and being concomitantly shaped by the hormonal milieu governing differences between the sexes. A bi-directional cross-talk between microbiota and the endocrine system is emerging with bacteria being able to produce hormones (e.g. serotonin, dopamine and somatostatine), respond to host hormones (e.g. estrogens) and regulate host hormones' homeostasis (e.g by inhibiting gene prolactin transcription or converting glucocorticoids to androgens). We review herein how gut microbiota and its metabolites regulate immune function, intestinal permeability and possibly AID pathological processes. Further, we describe the dysbiosis within the gut microbiota observed in different AID and speculate how restoring gut microbiota composition and its regulatory metabolites by dietary intervention including prebiotics and probiotics could help in

  3. Autoimmunity in Arabidopsis acd11 is mediated by epigenetic regulation of an immune receptor.

    Directory of Open Access Journals (Sweden)

    Kristoffer Palma

    Full Text Available Certain pathogens deliver effectors into plant cells to modify host protein targets and thereby suppress immunity. These target modifications can be detected by intracellular immune receptors, or Resistance (R proteins, that trigger strong immune responses including localized host cell death. The accelerated cell death 11 (acd11 "lesion mimic" mutant of Arabidopsis thaliana exhibits autoimmune phenotypes such as constitutive defense responses and cell death without pathogen perception. ACD11 encodes a putative sphingosine transfer protein, but its precise role during these processes is unknown. In a screen for lazarus (laz mutants that suppress acd11 death we identified two genes, LAZ2 and LAZ5. LAZ2 encodes the histone lysine methyltransferase SDG8, previously shown to epigenetically regulate flowering time via modification of histone 3 (H3. LAZ5 encodes an RPS4-like R-protein, defined by several dominant negative alleles. Microarray and chromatin immunoprecipitation analyses showed that LAZ2/SDG8 is required for LAZ5 expression and H3 lysine 36 trimethylation at LAZ5 chromatin to maintain a transcriptionally active state. We hypothesize that LAZ5 triggers cell death in the absence of ACD11, and that cell death in other lesion mimic mutants may also be caused by inappropriate activation of R genes. Moreover, SDG8 is required for basal and R protein-mediated pathogen resistance in Arabidopsis, revealing the importance of chromatin remodeling as a key process in plant innate immunity.

  4. Early gene Broad complex plays a key role in regulating the immune response triggered by ecdysone in the Malpighian tubules of Drosophila melanogaster.

    Science.gov (United States)

    Verma, Puja; Tapadia, Madhu G

    2015-08-01

    In insects, humoral response to injury is accomplished by the production of antimicrobial peptides (AMPs) which are secreted in the hemolymph to eliminate the pathogen. Drosophila Malpighian tubules (MTs), however, are unique immune organs that show constitutive expression of AMPs even in unchallenged conditions and the onset of immune response is developmental stage dependent. Earlier reports have shown ecdysone positively regulates immune response after pathogenic challenge however, a robust response requires prior potentiation by the hormone. Here we provide evidence to show that MTs do not require prior potentiation with ecdysone hormone for expression of AMPs and they respond to ecdysone very fast even without immune challenge, although the different AMPs Diptericin, Cecropin, Attacin, Drosocin show differential expression in response to ecdysone. We show that early gene Broad complex (BR-C) could be regulating the IMD pathway by activating Relish and physically interacting with it to activate AMPs expression. BR-C depletion from Malpighian tubules renders the flies susceptible to infection. We also show that in MTs ecdysone signaling is transduced by EcR-B1 and B2. In the absence of ecdysone signaling the IMD pathway associated genes are down regulated and activation and translocation of transcription factor Relish is also affected. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Molecular and Functional Neuroscience in Immunity.

    Science.gov (United States)

    Pavlov, Valentin A; Chavan, Sangeeta S; Tracey, Kevin J

    2018-04-26

    The nervous system regulates immunity and inflammation. The molecular detection of pathogen fragments, cytokines, and other immune molecules by sensory neurons generates immunoregulatory responses through efferent autonomic neuron signaling. The functional organization of this neural control is based on principles of reflex regulation. Reflexes involving the vagus nerve and other nerves have been therapeutically explored in models of inflammatory and autoimmune conditions, and recently in clinical settings. The brain integrates neuro-immune communication, and brain function is altered in diseases characterized by peripheral immune dysregulation and inflammation. Here we review the anatomical and molecular basis of the neural interface with immunity, focusing on peripheral neural control of immune functions and the role of the brain in the model of the immunological homunculus. Clinical advances stemming from this knowledge within the framework of bioelectronic medicine are also briefly outlined.

  6. Postulated Role of Vasoactive Neuropeptide-Related Immunopathology of the Blood Brain Barrier and Virchow-Robin Spaces in the Aetiology of Neurological-Related Conditions

    Directory of Open Access Journals (Sweden)

    D. R. Staines

    2008-01-01

    Full Text Available Vasoactive neuropeptides (VNs such as pituitary adenylate cyclase-activating polypeptide (PACAP and vasoactive intestinal peptide (VIP have critical roles as neurotransmitters, vasodilators including perfusion and hypoxia regulators, as well as immune and nociception modulators. They have key roles in blood vessels in the central nervous system (CNS including maintaining functional integrity of the blood brain barrier (BBB and blood spinal barrier (BSB. VNs are potent activators of adenylate cyclase and thus also have a key role in cyclic AMP production affecting regulatory T cell and other immune functions. Virchow-Robin spaces (VRSs are perivascular compartments surrounding small vessels within the CNS and contain VNs. Autoimmunity of VNs or VN receptors may affect BBB and VRS function and, therefore, may contribute to the aetiology of neurological-related conditions including multiple sclerosis, Parkinson's disease, and amyotrophic lateral sclerosis. VN autoimmunity will likely affect CNS and immunological homeostasis. Various pharmacological and immunological treatments including phosphodiesterase inhibitors and plasmapheresis may be indicated.

  7. Balancing immune protection and immune pathology by CD8+ T cell responses to influenza infection

    Directory of Open Access Journals (Sweden)

    Susu eDuan

    2016-02-01

    Full Text Available Influenza A virus (IAV is a significant human pathogen causing annual epidemics and periodic pandemics. CD8+ cytotoxic T lymphocyte (CTL-mediated immunity contributes to clearance of virus-infected cells; CTL immunity targeting the conserved internal proteins of IAVs is a key protection mechanism when neutralizing antibodies are absent during heterosubtypic IAV infection. However, CTL infiltration into the airways, their cytotoxicity, and the effects of produced pro-inflammatory cytokines can cause severe lung tissue injury, thereby contributing to immunopathology. Studies have discovered complicated and exquisite stimulatory and inhibitory mechanisms that regulate CTL magnitude and effector activities during IAV infection. Here, we review the state of knowledge on the roles of IAV-specific CTLs in immune protection and immunopathology during IAV infection in animal models, highlighting the key findings of various requirements and constraints regulating the balance of immune protection and pathology involved in CTL immunity. We also discuss the evidence of cross-reactive CTL immunity as a positive correlate of cross-subtype protection during secondary IAV infection in both animal and human studies. We argue that the effects of CTL immunity on protection and immunopathology depend on multiple layers of host and viral factors, including complex host mechanisms to regulate CTL magnitude and effector activity, the pathogenic nature of the IAV, the innate response milieu, and the host historical immune context of influenza infection. Future efforts are needed to further understand these key host and viral factors, especially to differentiate those that constrain optimally effective CTL anti-viral immunity from those necessary to restrain CTL-mediated nonspecific immunopathology in the various contexts of IAV infection, in order to develop better vaccination and therapeutic strategies for modifying protective CTL immunity.

  8. Diversity and dialogue in immunity to helminths.

    Science.gov (United States)

    Allen, Judith E; Maizels, Rick M

    2011-06-01

    The vertebrate immune system has evolved in concert with a broad range of infectious agents, including ubiquitous helminth (worm) parasites. The constant pressure of helminth infections has been a powerful force in shaping not only how immunity is initiated and maintained, but also how the body self-regulates and controls untoward immune responses to minimize overall harm. In this Review, we discuss recent advances in defining the immune cell types and molecules that are mobilized in response to helminth infection. Finally, we more broadly consider how these immunological players are blended and regulated in order to accommodate persistent infection or to mount a vigorous protective response and achieve sterile immunity.

  9. E-cadherin Is Critical for Collective Sheet Migration and Is Regulated by the Chemokine CXCL12 Protein During Restitution*

    Science.gov (United States)

    Hwang, Soonyean; Zimmerman, Noah P.; Agle, Kimberle A.; Turner, Jerrold R.; Kumar, Suresh N.; Dwinell, Michael B.

    2012-01-01

    Chemokines and other immune mediators enhance epithelial barrier repair. The intestinal barrier is established by highly regulated cell-cell contacts between epithelial cells. The goal of these studies was to define the role for the chemokine CXCL12 in regulating E-cadherin during collective sheet migration during epithelial restitution. Mechanisms regulating E-cadherin were investigated using Caco2BBE and IEC-6 model epithelia. Genetic knockdown confirmed a critical role for E-cadherin in in vitro restitution and in vivo wound repair. During restitution, both CXCL12 and TGF-β1 tightened the monolayer by decreasing the paracellular space between migrating epithelial cells. However, CXCL12 differed from TGF-β1 by stimulating the significant increase in E-cadherin membrane localization during restitution. Chemokine-stimulated relocalization of E-cadherin was paralleled by an increase in barrier integrity of polarized epithelium during restitution. CXCL12 activation of its cognate receptor CXCR4 stimulated E-cadherin localization and monolayer tightening through Rho-associated protein kinase activation and F-actin reorganization. These data demonstrate a key role for E-cadherin in intestinal epithelial restitution. PMID:22549778

  10. Genome-wide miRNA screening reveals miR-310 family members negatively regulate the immune response in Drosophila melanogaster via co-targeting Drosomycin.

    Science.gov (United States)

    Li, Yao; Li, Shengjie; Li, Ruimin; Xu, Jiao; Jin, Ping; Chen, Liming; Ma, Fei

    2017-03-01

    Although innate immunity mediated by Toll signaling has been extensively studied in Drosophila melanogaster, the role of miRNAs in regulating the Toll-mediated immune response remains largely unknown. In this study, following Gram-positive bacterial challenge, we identified 93 differentially expressed miRNAs via genome-wide miRNA screening. These miRNAs were regarded as immune response related (IRR). Eight miRNAs were confirmed to be involved in the Toll-mediated immune response upon Gram-positive bacterial infection through genetic screening of 41 UAS-miRNA lines covering 60 miRNAs of the 93 IRR miRNAs. Interestingly, four out of these eight miRNAs, miR-310, miR-311, miR-312 and miR-313, are clustered miRNAs and belong to the miR-310 family. These miR-310 family members were shown to target and regulate the expression of Drosomycin, an antimicrobial peptide produced by Toll signaling. Taken together, our study implies important regulatory roles of miRNAs in the Toll-mediated innate immune response of Drosophila upon Gram-positive bacterial infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Listeria monocytogenes Induces a Virulence-Dependent microRNA Signature That Regulates the Immune Response in Galleria mellonella

    Directory of Open Access Journals (Sweden)

    Gopala K. Mannala

    2017-12-01

    Full Text Available microRNAs (miRNAs coordinate several physiological and pathological processes by regulating the fate of mRNAs. Studies conducted in vitro indicate a role of microRNAs in the control of host-microbe interactions. However, there is limited understanding of miRNA functions in in vivo models of bacterial infections. In this study, we systematically explored changes in miRNA expression levels of Galleria mellonella larvae (greater-wax moth, a model system that recapitulates the vertebrate innate immunity, following infection with L. monocytogenes. Using an insect-specific miRNA microarray with more than 2000 probes, we found differential expression of 90 miRNAs (39 upregulated and 51 downregulated in response to infection with L. monocytogenes. We validated the expression of a subset of miRNAs which have mammalian homologs of known or predicted function. In contrast, non-pathogenic L. innocua failed to induce these miRNAs, indicating a virulence-dependent miRNA deregulation. To predict miRNA targets using established algorithms, we generated a publically available G. mellonella transcriptome database. We identified miRNA targets involved in innate immunity, signal transduction and autophagy, including spätzle, MAP kinase, and optineurin, respectively, which exhibited a virulence-specific differential expression. Finally, in silico estimation of minimum free energy of miRNA-mRNA duplexes of validated microRNAs and target transcripts revealed a regulatory network of the host immune response to L. monocytogenes. In conclusion, this study provides evidence for a role of miRNAs in the regulation of the innate immune response following bacterial infection in a simple, rapid and scalable in vivo model that may predict host-microbe interactions in higher vertebrates.

  12. Senescence-related functional nuclear barrier by down-regulation of nucleo-cytoplasmic trafficking gene expression

    International Nuclear Information System (INIS)

    Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae; Park, Sang Chul

    2010-01-01

    One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin α, karyopherin β, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.

  13. Senescence-related functional nuclear barrier by down-regulation of nucleo-cytoplasmic trafficking gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Sung Young; Ryu, Sung Jin; Ahn, Hong Ju; Choi, Hae Ri; Kang, Hyun Tae [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of); Park, Sang Chul, E-mail: scpark@snu.ac.kr [Department of Biochemistry and Molecular Biology, Aging and Apoptosis Research Center, Institute on Aging, Seoul National University College of Medicine, Seoul 110-799 (Korea, Republic of)

    2010-01-01

    One of the characteristic natures of senescent cells is the hypo- or irresponsiveness not only to growth factors but also to apoptotic stress. In the present study, we confirmed the inhibition of nuclear translocation of activated p-ERK1/2 and NF-kB p50 in response to growth stimuli or LPS in the senescent human diploid fibroblasts. In order to elucidate the underlying mechanism for the senescence-associated hypo-responsiveness, we carried out the comparison study for gene expression profiles through microarray analysis. In consequence, we observed the vast reduction in expression of nucleo-cytoplasmic trafficking genes in senescent cells, when compared with those in young cells. Expression levels of several nucleoporins, karyopherin {alpha}, karyopherin {beta}, Ran, and Ran-regulating factors were confirmed to be down-regulated in senescent HDFs by using RT-PCR and Western blot methods. Taken together, these data suggest the operation of certain senescence-associated functional nuclear barriers by down-regulation of the nucleo-cytoplasmic trafficking genes in the senescent cells.

  14. Distinct temporal roles for the promyelocytic leukaemia (PML protein in the sequential regulation of intracellular host immunity to HSV-1 infection.

    Directory of Open Access Journals (Sweden)

    Thamir Alandijany

    2018-01-01

    Full Text Available Detection of viral nucleic acids plays a critical role in the induction of intracellular host immune defences. However, the temporal recruitment of immune regulators to infecting viral genomes remains poorly defined due to the technical difficulties associated with low genome copy-number detection. Here we utilize 5-Ethynyl-2'-deoxyuridine (EdU labelling of herpes simplex virus 1 (HSV-1 DNA in combination with click chemistry to examine the sequential recruitment of host immune regulators to infecting viral genomes under low multiplicity of infection conditions. Following viral genome entry into the nucleus, PML-nuclear bodies (PML-NBs rapidly entrapped viral DNA (vDNA leading to a block in viral replication in the absence of the viral PML-NB antagonist ICP0. This pre-existing intrinsic host defence to infection occurred independently of the vDNA pathogen sensor IFI16 (Interferon Gamma Inducible Protein 16 and the induction of interferon stimulated gene (ISG expression, demonstrating that vDNA entry into the nucleus alone is not sufficient to induce a robust innate immune response. Saturation of this pre-existing intrinsic host defence during HSV-1 ICP0-null mutant infection led to the stable recruitment of PML and IFI16 into vDNA complexes associated with ICP4, and led to the induction of ISG expression. This induced innate immune response occurred in a PML-, IFI16-, and Janus-Associated Kinase (JAK-dependent manner and was restricted by phosphonoacetic acid, demonstrating that vDNA polymerase activity is required for the robust induction of ISG expression during HSV-1 infection. Our data identifies dual roles for PML in the sequential regulation of intrinsic and innate immunity to HSV-1 infection that are dependent on viral genome delivery to the nucleus and the onset of vDNA replication, respectively. These intracellular host defences are counteracted by ICP0, which targets PML for degradation from the outset of nuclear infection to promote v

  15. Adrenaline influence on the immune response. II

    International Nuclear Information System (INIS)

    Depelchin, A.; Letesson, J.J.

    1981-01-01

    Experiments were carried out to specify the adrenaline target among the immunocompetent cells. Adrenaline administered for some hours exerted opposite effects on the natural PFC and RFC: the first were enhanced and the second significantly reduced. These paradoxical results were interpreted as a consequence of the inhibition of the suppressor T-cells in the resting status. Adrenaline appeared to act on the sensitive cells through beta- rather than through alpha-receptors. Further experiments on the adrenaline influence on the syngeneic barrier phenomenon and on the cellular balance at its termination seemed to indicate that adrenaline was directly inhibitory for the Ts but not for their precursors. These results are discussed in the light of the cellular networks regulating the immune response. Irradiated mice were compared with non-irradiated mice as described in the previous article. (Auth.)

  16. Extracellular membrane vesicles and immune regulation in the brain

    Directory of Open Access Journals (Sweden)

    Stefano ePluchino

    2012-05-01

    Full Text Available The brain is characterized by a complex and integrated network of interacting cells in which cell-to-cell communication is critical for proper development and function. Initially considered as an immune privileged site, the brain is now regarded as an immune specialized system. Accumulating evidence reveals the presence of immune components in the brain, as well as extensive bidirectional communication that takes place between the nervous and the immune system both under homeostatic and pathological conditions. In recent years the secretion of extracellular membrane vesicles (EMVs has been described as a new and evolutionary well-conserved mechanism of cell-to-cell communication, with EMVs influencing the microenvironment through the traffic of bioactive molecules that include proteins and nucleic acids, such as DNA, protein coding and non coding RNAs. Increasing evidence suggests that EMVs are a promising candidate to study cross-boundary cell-to-cell communication pathways. Herein we review the role of EMVs secreted by neural cells in modulating the immune response(s within the brain under physiological and pathological circumstances.

  17. Innate immune responses: Crosstalk of signaling and regulation of gene transcription

    International Nuclear Information System (INIS)

    Zhong Bo; Tien Po; Shu Hongbing

    2006-01-01

    Innate immune responses to pathogens such as bacteria and viruses are triggered by recognition of specific structures of invading pathogens called pathogen-associated molecular patterns (PAMPs) by cellular pattern recognition receptors (PRRs) that are located at plasma membrane or inside cells. Stimulation of different PAMPs activates Toll-like receptor (TLR)-dependent and -independent signaling pathways that lead to activation of transcription factors nuclear factor-κB (NF-κB), interferon regulatory factor 3/7 (IRF3/7) and/or activator protein-1 (AP-1), which collaborate to induce transcription of a large number of downstream genes. This review focuses on the rapid progress that has recently improved our understanding of the crosstalk among the pathways and the precise regulation of transcription of the downstream genes

  18. Transcutaneous immunization using microneedles and cubosomes

    DEFF Research Database (Denmark)

    Rattanapak, Teerawan; Birchall, James; Young, Katherine

    2013-01-01

    Transcutaneous (TCI) immunization is a novel vaccination approach that provides many advantages over traditional parenteral vaccination. However, a major barrier to TCI is mediating penetration of vaccine antigens through the stratum corneum (SC) to the deeper tissue layers. Many approaches have...

  19. Vitamin C and Immune Function

    Directory of Open Access Journals (Sweden)

    Anitra C. Carr

    2017-11-01

    Full Text Available Vitamin C is an essential micronutrient for humans, with pleiotropic functions related to its ability to donate electrons. It is a potent antioxidant and a cofactor for a family of biosynthetic and gene regulatory enzymes. Vitamin C contributes to immune defense by supporting various cellular functions of both the innate and adaptive immune system. Vitamin C supports epithelial barrier function against pathogens and promotes the oxidant scavenging activity of the skin, thereby potentially protecting against environmental oxidative stress. Vitamin C accumulates in phagocytic cells, such as neutrophils, and can enhance chemotaxis, phagocytosis, generation of reactive oxygen species, and ultimately microbial killing. It is also needed for apoptosis and clearance of the spent neutrophils from sites of infection by macrophages, thereby decreasing necrosis/NETosis and potential tissue damage. The role of vitamin C in lymphocytes is less clear, but it has been shown to enhance differentiation and proliferation of B- and T-cells, likely due to its gene regulating effects. Vitamin C deficiency results in impaired immunity and higher susceptibility to infections. In turn, infections significantly impact on vitamin C levels due to enhanced inflammation and metabolic requirements. Furthermore, supplementation with vitamin C appears to be able to both prevent and treat respiratory and systemic infections. Prophylactic prevention of infection requires dietary vitamin C intakes that provide at least adequate, if not saturating plasma levels (i.e., 100–200 mg/day, which optimize cell and tissue levels. In contrast, treatment of established infections requires significantly higher (gram doses of the vitamin to compensate for the increased inflammatory response and metabolic demand.

  20. Conserved microRNA miR-8 in fat body regulates innate immune homeostasis in Drosophila.

    Science.gov (United States)

    Choi, In Kyou; Hyun, Seogang

    2012-05-01

    Antimicrobial peptides (AMPs) constitute a major arm of the innate immune system across diverse organisms. In Drosophila, septic injury by microbial pathogens rapidly induces the production of the AMPs in fat body via well elucidated pathways such as Toll and IMD. However, several epithelial tissues were reported to locally express AMPs without septic injury via poorly characterized ways. Here, we report that microRNA miR-8 regulates the levels of AMPs basally expressed in Drosophila. The levels of AMPs such as Drosomycin and Diptericin are significantly increased in miR-8 null animals in non-pathogen stimulated conditions. Analysis of various larval tissues revealed that the increase of Drosomycin is fat body specific. Supporting this observation, re-introduction of miR-8 only in the fat body restored the altered AMP expression in miR-8 null flies. Although loss of miR-8 impedes PI3K in the fat body, inhibition of PI3K does not phenocopy the AMP expression of miR-8 null flies, indicating that miR-8 regulates AMP independently of PI3K. Together, our findings suggest a role of miR-8 in systemic immune homeostasis in generally non-pathogenic conditions in flies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  1. Molecular signaling networks in regulation of immunity and disease

    DEFF Research Database (Denmark)

    Laursen, Janne Marie; Jensen, Stina Rikke; Sørensen, Morten

    and dynamic microbial communities with the immune cell compartment in the gut, and therefore the interaction between components from different gut bacteria can efficiently shape the phenotype of the immune response. A specialized antigenpresenting cell present at mucosal surfaces, the dendritic cell (DC......), plays a crucial role in shaping the nature of the adaptive/memorybased immune response after encountering inflammatory compounds. In the gut, the DC is continuously exposed to microbial and dietary components that are recognized by its innate pattern recognition receptors, and the phenotype developed...... in the DC during activation is of profound importance for the state of immune response and thereby also affects the inflammatory and metabolic status in tissues. We have shown that specific fermentation products from gut bacteria have distinct immunoregulatory effects that effectively inhibit...

  2. A TNF-Regulated Recombinatorial Macrophage Immune Receptor Implicated in Granuloma Formation in Tuberculosis

    Science.gov (United States)

    Streich, Roswita; Breysach, Caroline; Raddatz, Dirk; Oniga, Septimia; Peccerella, Teresa; Findeisen, Peter; Kzhyshkowska, Julia; Gratchev, Alexei; Schweyer, Stefan; Saunders, Bernadette; Wessels, Johannes T.; Möbius, Wiebke; Keane, Joseph; Becker, Heinz; Ganser, Arnold; Neumaier, Michael; Kaminski, Wolfgang E.

    2011-01-01

    Macrophages play a central role in host defense against mycobacterial infection and anti- TNF therapy is associated with granuloma disorganization and reactivation of tuberculosis in humans. Here, we provide evidence for the presence of a T cell receptor (TCR) αβ based recombinatorial immune receptor in subpopulations of human and mouse monocytes and macrophages. In vitro, we find that the macrophage-TCRαβ induces the release of CCL2 and modulates phagocytosis. TNF blockade suppresses macrophage-TCRαβ expression. Infection of macrophages from healthy individuals with mycobacteria triggers formation of clusters that express restricted TCR Vβ repertoires. In vivo, TCRαβ bearing macrophages abundantly accumulate at the inner host-pathogen contact zone of caseous granulomas from patients with lung tuberculosis. In chimeric mouse models, deletion of the variable macrophage-TCRαβ or TNF is associated with structurally compromised granulomas of pulmonary tuberculosis even in the presence of intact T cells. These results uncover a TNF-regulated recombinatorial immune receptor in monocytes/macrophages and demonstrate its implication in granuloma formation in tuberculosis. PMID:22114556

  3. A TNF-regulated recombinatorial macrophage immune receptor implicated in granuloma formation in tuberculosis.

    Directory of Open Access Journals (Sweden)

    Alexander W Beham

    2011-11-01

    Full Text Available Macrophages play a central role in host defense against mycobacterial infection and anti- TNF therapy is associated with granuloma disorganization and reactivation of tuberculosis in humans. Here, we provide evidence for the presence of a T cell receptor (TCR αβ based recombinatorial immune receptor in subpopulations of human and mouse monocytes and macrophages. In vitro, we find that the macrophage-TCRαβ induces the release of CCL2 and modulates phagocytosis. TNF blockade suppresses macrophage-TCRαβ expression. Infection of macrophages from healthy individuals with mycobacteria triggers formation of clusters that express restricted TCR Vβ repertoires. In vivo, TCRαβ bearing macrophages abundantly accumulate at the inner host-pathogen contact zone of caseous granulomas from patients with lung tuberculosis. In chimeric mouse models, deletion of the variable macrophage-TCRαβ or TNF is associated with structurally compromised granulomas of pulmonary tuberculosis even in the presence of intact T cells. These results uncover a TNF-regulated recombinatorial immune receptor in monocytes/macrophages and demonstrate its implication in granuloma formation in tuberculosis.

  4. The potential impact of low dose ionizing γ-radiation on immune response activity up-regulated by Ikaros in IM-9 B lymphocytes

    International Nuclear Information System (INIS)

    Kim Sung Jn; Jang, Seon A; Yang, Kwang Hee; Kim, Ji Young; Kim, Cha Soon; Nam, Seon Young; Jeong, Mee Seon; Jin, Young Woo

    2011-01-01

    The biological effects of low dose ionizing radiation (LDIR) remain insufficiently understood. We examined for the scientific evidence to show the biological effects of LDIR using radiation-sensitive immune cells. We found that Ikaros protein was responded to low dose-dependent effects of gamma radiation in IM-9 B lymphocytes. Ikaros encodes zinc finger transcription factors that is important regulators of a hematopoietic stem cells (HSCs) progression to the B lymphoid lineage development, differentiation and proliferation. In this study, we observed that cell proliferation was enhanced from 10% to 20% by LDIR (0.05 Gy) in IM-9 B lymphocytes. The Ikaros protein was phosphorylated in its serine/threonine (S/T) region and decreased its DNA binding activity in the cells exposed to LDIR. We found that Ikaros phosphorylation was up-regulated by CK2/AKT pathway and the residues of ser-304 and ser-306 in Ikaros was phosphorylated by LDIR. We also observed that Ikaros protein was localized from the nucleus to the cytoplasm after LDIR and bound with Autotaxin (ENPP2, ATX) protein, stimulating proliferation, migration and survival of immune cells. In addition, we found that the lysoPLD activity of ATX was dependent on Ikaros-ATX binding activity. These results indicate that the Ikaros is an important regulator of immune activation. Therefore, we suggest that low dose ionizing radiation can be considered as a beneficial effects, stimulating the activation of immune cells.

  5. A systems biology approach reveals that tissue tropism to West Nile virus is regulated by antiviral genes and innate immune cellular processes.

    Directory of Open Access Journals (Sweden)

    Mehul S Suthar

    2013-02-01

    Full Text Available The actions of the RIG-I like receptor (RLR and type I interferon (IFN signaling pathways are essential for a protective innate immune response against the emerging flavivirus West Nile virus (WNV. In mice lacking RLR or IFN signaling pathways, WNV exhibits enhanced tissue tropism, indicating that specific host factors of innate immune defense restrict WNV infection and dissemination in peripheral tissues. However, the immune mechanisms by which the RLR and IFN pathways coordinate and function to impart restriction of WNV infection are not well defined. Using a systems biology approach, we defined the host innate immune response signature and actions that restrict WNV tissue tropism. Transcriptional profiling and pathway modeling to compare WNV-infected permissive (spleen and nonpermissive (liver tissues showed high enrichment for inflammatory responses, including pattern recognition receptors and IFN signaling pathways, that define restriction of WNV replication in the liver. Assessment of infected livers from Mavs(-/- × Ifnar(-/- mice revealed the loss of expression of several key components within the natural killer (NK cell signaling pathway, including genes associated with NK cell activation, inflammatory cytokine production, and NK cell receptor signaling. In vivo analysis of hepatic immune cell infiltrates from WT mice demonstrated that WNV infection leads to an increase in NK cell numbers with enhanced proliferation, maturation, and effector action. In contrast, livers from Mavs(-/- × Ifnar(-/- infected mice displayed reduced immune cell infiltration, including a significant reduction in NK cell numbers. Analysis of cocultures of dendritic and NK cells revealed both cell-intrinsic and -extrinsic roles for the RLR and IFN signaling pathways to regulate NK cell effector activity. Taken together, these observations reveal a complex innate immune signaling network, regulated by the RLR and IFN signaling pathways, that drives tissue

  6. Focal exposure of limited lung volumes to high-dose irradiation down-regulated organ development-related functions and up-regulated the immune response in mouse pulmonary tissues.

    Science.gov (United States)

    Kim, Bu-Yeo; Jin, Hee; Lee, Yoon-Jin; Kang, Ga-Young; Cho, Jaeho; Lee, Yun-Sil

    2016-01-27

    Despite the emergence of stereotactic body radiotherapy (SBRT) for treatment of medically inoperable early-stage non-small-cell lung cancer patients, the molecular effects of focal exposure of limited lung volumes to high-dose radiation have not been fully characterized. This study was designed to identify molecular changes induced by focal high-dose irradiation using a mouse model of SBRT. Central areas of the mouse left lung were focally-irradiated (3 mm in diameter) with a single high-dose of radiation (90 Gy). Temporal changes in gene expression in the irradiated and non-irradiated neighboring lung regions were analyzed by microarray. For comparison, the long-term effect (12 months) of 20 Gy radiation on a diffuse region of lung was also measured. The majority of genes were down-regulated in the focally-irradiated lung areas at 2 to 3 weeks after irradiation. This pattern of gene expression was clearly different than gene expression in the diffuse region of lungs exposed to low-dose radiation. Ontological and pathway analyses indicated these down-regulated genes were mainly associated with organ development. Although the number was small, genes that were up-regulated after focal irradiation were associated with immune-related functions. The temporal patterns of gene expression and the associated biological functions were also similar in non-irradiated neighboring lung regions, although statistical significance was greatly reduced when compared with those from focally-irradiated areas of the lung. From network analysis of temporally regulated genes, we identified inter-related modules associated with diverse functions, including organ development and the immune response, in both the focally-irradiated regions and non-irradiated neighboring lung regions. Focal exposure of lung tissue to high-dose radiation induced expression of genes associated with organ development and the immune response. This pattern of gene expression was also observed in non

  7. Vitamin D signaling in intestinal innate immunity and homeostasis.

    Science.gov (United States)

    Dimitrov, Vassil; White, John H

    2017-09-15

    The lumen of the gut hosts a plethora of microorganisms that participate in food assimilation, inactivation of harmful particles and in vitamin synthesis. On the other hand, enteric flora, a number of food antigens, and toxins are capable of triggering immune responses causing inflammation, which, when unresolved, may lead to chronic conditions such as inflammatory bowel disease (IBD). It is important, therefore, to contain the gut bacteria within the lumen, control microbial load and composition, as well as ensure adequate innate and adaptive immune responses to pathogenic threats. There is growing evidence that vitamin D signaling has impacts on all these aspects of intestinal physiology, contributing to healthy enteric homeostasis. VD was first discovered as the curative agent for nutritional rickets, and its classical actions are associated with calcium absorption and bone health. However, vitamin D exhibits a number of extra-skeletal effects, particularly in innate immunity. Notably, it stimulates production of pattern recognition receptors, anti-microbial peptides, and cytokines, which are at the forefront of innate immune responses. They play a role in sensing the microbiota, in preventing excessive bacterial overgrowth, and complement the actions of vitamin D signaling in enhancing intestinal barrier function. Vitamin D also favours tolerogenic rather than inflammogenic T cell differentiation and function. Compromised innate immune function and overactive adaptive immunity, as well as defective intestinal barrier function, have been associated with IBD. Importantly, observational and intervention studies support a beneficial role of vitamin D supplementation in patients with Crohn's disease, a form of IBD. This review summarizes the effects of vitamin D signaling on barrier integrity and innate and adaptive immunity in the gut, as well as on microbial load and composition. Collectively, studies to date reveal that vitamin D signaling has widespread effects

  8. Homeostatic NF-κB Signaling in Steady-State Migratory Dendritic Cells Regulates Immune Homeostasis and Tolerance.

    Science.gov (United States)

    Baratin, Myriam; Foray, Chloe; Demaria, Olivier; Habbeddine, Mohamed; Pollet, Emeline; Maurizio, Julien; Verthuy, Christophe; Davanture, Suzel; Azukizawa, Hiroaki; Flores-Langarica, Adriana; Dalod, Marc; Lawrence, Toby

    2015-04-21

    Migratory non-lymphoid tissue dendritic cells (NLT-DCs) transport antigens to lymph nodes (LNs) and are required for protective immune responses in the context of inflammation and to promote tolerance to self-antigens in steady-state. However, the molecular mechanisms that elicit steady-state NLT-DC maturation and migration are unknown. By comparing the transcriptome of NLT-DCs in the skin with their migratory counterparts in draining LNs, we have identified a novel NF-κB-regulated gene network specific to migratory DCs. We show that targeted deletion of IKKβ in DCs, a major activator of NF-κB, prevents NLT-DC accumulation in LNs and compromises regulatory T cell conversion in vivo. This was associated with impaired tolerance and autoimmunity. NF-κB is generally considered the prototypical pro-inflammatory transcription factor, but this study describes a role for NF-κB signaling in DCs for immune homeostasis and tolerance that could have implications in autoimmune diseases and immunity. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Evidence of a Redox-Dependent Regulation of Immune Responses to Exercise-Induced Inflammation

    Directory of Open Access Journals (Sweden)

    Alexandra Sakelliou

    2016-01-01

    Full Text Available We used thiol-based antioxidant supplementation (n-acetylcysteine, NAC to determine whether immune mobilisation following skeletal muscle microtrauma induced by exercise is redox-sensitive in healthy humans. According to a two-trial, double-blind, crossover, repeated measures design, 10 young men received either placebo or NAC (20 mg/kg/day immediately after a muscle-damaging exercise protocol (300 eccentric contractions and for eight consecutive days. Blood sampling and performance assessments were performed before exercise, after exercise, and daily throughout recovery. NAC reduced the decline of reduced glutathione in erythrocytes and the increase of plasma protein carbonyls, serum TAC and erythrocyte oxidized glutathione, and TBARS and catalase activity during recovery thereby altering postexercise redox status. The rise of muscle damage and inflammatory markers (muscle strength, creatine kinase activity, CRP, proinflammatory cytokines, and adhesion molecules was less pronounced in NAC during the first phase of recovery. The rise of leukocyte and neutrophil count was decreased by NAC after exercise. Results on immune cell subpopulations obtained by flow cytometry indicated that NAC ingestion reduced the exercise-induced rise of total macrophages, HLA+ macrophages, and 11B+ macrophages and abolished the exercise-induced upregulation of B lymphocytes. Natural killer cells declined only in PLA immediately after exercise. These results indicate that thiol-based antioxidant supplementation blunts immune cell mobilisation in response to exercise-induced inflammation suggesting that leukocyte mobilization may be under redox-dependent regulation.

  10. The nuclear IκB family of proteins controls gene regulation and immune homeostasis.

    Science.gov (United States)

    MaruYama, Takashi

    2015-10-01

    The inhibitory IκB family of proteins is subdivided into two groups based on protein localization in the cytoplasm or in the nucleus. These proteins interact with NF-κB, a major transcription factor regulating the expression of many inflammatory cytokines, by modulating its transcriptional activity. However, nuclear IκB family proteins not only interact with NF-κB to change its transcriptional activity, but they also bind to chromatin and control gene expression. This review provides an overview of nuclear IκB family proteins and their role in immune homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Spatio-temporal regulation of Hsp90-ligand complex leads to immune activation.

    Directory of Open Access Journals (Sweden)

    Yasuaki eTamura

    2016-05-01

    Full Text Available Hsp90 is the most abundant cytosolic HSP and is known to act as a molecular chaperone. We found that an Hsp90-cancer antigen peptide complex was efficiently cross-presented by human monocyte-derived dendritic cells and induced peptide-specific cytotoxic T lymphocytes. Furthermore, we observed that the internalized Hsp90-peptide complex was strictly sorted to the Rab5+, EEA1+ static early endosome and the Hsp90-chaperoned peptide was processed and bound to MHC class I molecules through a endosome-recycling pathway. We also found that extracellular Hsp90 complexed with CpG-A or self-DNA stimulates production of a large amount of IFN-α from pDCs via static early endosome targeting. Thus, extracellular Hsp90 can target the antigen or nucleic acid to a static early endosome by spatio-temporal regulation. Moreover, we showed that Hsp90 associates with and delivers TLR7/9 from the ER to early endosomes for ligand recognition. Hsp90 inhibitor, geldanamycin derivative inhibited the Hsp90 association with TLR7/9, resulting in inhibition IFN-α production, leading to improvement of SLE symptoms. Interstingly, we observed that serum Hsp90 is clearly increased in patients with active SLE compared with that in patients with inactive disease. Serum Hsp90 detected in SLE patients binds to self-DNA and/or anti-DNA Ab, thus leading to stimulation of pDCs to produce IFN-α. Thus, Hsp90 plays a crucial role in the pathogenesis of SLE and that an Hsp90 inhibitor will therefore provide a new therapeutic approach to SLE and other nucleic acid-related autoimmune diseases. We will discuss how spatio-temporal regulation of Hsp90-ligand complexes within antigen-presenting cells affects the innate immunity and adaptive immunity.

  12. PPAR-α, a lipid-sensing transcription factor, regulates blood-brain barrier efflux transporter expression.

    Science.gov (United States)

    More, Vijay R; Campos, Christopher R; Evans, Rebecca A; Oliver, Keith D; Chan, Gary Ny; Miller, David S; Cannon, Ronald E

    2017-04-01

    Lipid sensor peroxisome proliferator-activated receptor alpha (PPAR- α) is the master regulator of lipid metabolism. Dietary release of endogenous free fatty acids, fibrates, and certain persistent environmental pollutants, e.g. perfluoroalkyl fire-fighting foam components, are peroxisome proliferator-activated receptor alpha ligands. Here, we define a role for peroxisome proliferator-activated receptor alpha in regulating the expression of three ATP-driven drug efflux transporters at the rat and mouse blood-brain barriers: P-glycoprotein (Abcb1), breast cancer resistance protein (Bcrp/Abcg2), and multidrug resistance-associated protein 2 (Mrp2/Abcc2). Exposing isolated rat brain capillaries to linoleic acid, clofibrate, or PKAs increased the transport activity and protein expression of the three ABC transporters. These effects were blocked by the PPAR- α antagonist, GW6471. Dosing rats with 20 mg/kg or 200 mg/kg of clofibrate decreased the brain accumulation of the P-glycoprotein substrate, verapamil, by 50% (in situ brain perfusion; effects blocked by GW6471) and increased P-glycoprotein expression and activity in capillaries ex vivo. Fasting C57Bl/6 wild-type mice for 24 h increased both serum lipids and brain capillary P-glycoprotein transport activity. Fasting did not alter P-glycoprotein activity in PPAR- α knockout mice. These results indicate that hyperlipidemia, lipid-lowering fibrates and exposure to certain fire-fighting foam components activate blood-brain barrier peroxisome proliferator-activated receptor alpha, increase drug efflux transporter expression and reduce drug delivery to the brain.

  13. A novel role for adiponectin in regulating the immune responses in chronic hepatitis C virus infection.

    Science.gov (United States)

    Palmer, Clovis; Hampartzoumian, Taline; Lloyd, Andrew; Zekry, Amany

    2008-08-01

    Adipose tissue releases pro-inflammatory and anti-inflammatory mediators, including adiponectin, which elicit a broad range of metabolic and immunological effects. The study aim was to determine in subjects infected with chronic hepatitis C virus (HCV) the effects of total adiponectin and its high-molecular-weight (HMW) and low-molecular-weight isoforms on HCV-specific immune responses. Serum levels of total adiponectin and its isoforms were determined by immunoassay. The ex vivo effect of adiponectin on the HCV-specific T-cell response was examined by interferon gamma (IFN-gamma) enzyme-linked immunosorbent spot and enzyme-linked immunosorbent assay cytokine assays. The role of the mitogen-activated protein kinase (MAPK) signaling pathway in mediating the adiponectin effect on T cells was also evaluated. We found that serum levels of total and HMW adiponectin were significantly decreased in subjects with chronic HCV and increased body mass index (BMI) compared with HCV-infected lean subjects. The presence of an anti-HCV specific immune response was strongly associated with lower BMI (P = 0.004) and higher serum total (P = 0.01) and HMW (P = 0.02) adiponectin. In ex vivo assays, total adiponectin and the HMW adiponectin isoform enhanced HCV-specific IFN-gamma production (P = 0.02 and 0.03, respectively). Adiponectin-R1 receptors were expressed on T cells and monocytes. In depletion experiments, the IFN-gamma response to adiponectin was entirely dependent on the simultaneous presence of both CD4 and CD8 T cells, and to a lesser extent, natural killer cells. Selective inhibition of p38MAPK activity by SB203580 abrogated the IFN-gamma response to adiponectin, whereas extracellular signal-regulated kinase 1/2 inhibition by PD98059 did not affect the response. In chronic HCV, a reciprocal association exists between BMI, adiponectin, and the anti-HCV immune responses, emphasizing the important role played by adiposity in regulating the immune response in HCV infection.

  14. Regulation of dendritic cell development by GM-CSF: molecular control and implications for immune homeostasis and therapy.

    Science.gov (United States)

    van de Laar, Lianne; Coffer, Paul J; Woltman, Andrea M

    2012-04-12

    Dendritic cells (DCs) represent a small and heterogeneous fraction of the hematopoietic system, specialized in antigen capture, processing, and presentation. The different DC subsets act as sentinels throughout the body and perform a key role in the induction of immunogenic as well as tolerogenic immune responses. Because of their limited lifespan, continuous replenishment of DC is required. Whereas the importance of GM-CSF in regulating DC homeostasis has long been underestimated, this cytokine is currently considered a critical factor for DC development under both steady-state and inflammatory conditions. Regulation of cellular actions by GM-CSF depends on the activation of intracellular signaling modules, including JAK/STAT, MAPK, PI3K, and canonical NF-κB. By directing the activity of transcription factors and other cellular effector proteins, these pathways influence differentiation, survival and/or proliferation of uncommitted hematopoietic progenitors, and DC subset-specific precursors, thereby contributing to specific aspects of DC subset development. The specific intracellular events resulting from GM-CSF-induced signaling provide a molecular explanation for GM-CSF-dependent subset distribution as well as clues to the specific characteristics and functions of GM-CSF-differentiated DCs compared with DCs generated by fms-related tyrosine kinase 3 ligand. This knowledge can be used to identify therapeutic targets to improve GM-CSF-dependent DC-based strategies to regulate immunity.

  15. Convergent and Divergent Signaling in PAMP-Triggered Immunity and Effector-Triggered Immunity.

    Science.gov (United States)

    Peng, Yujun; van Wersch, Rowan; Zhang, Yuelin

    2018-04-01

    Plants use diverse immune receptors to sense pathogen attacks. Recognition of pathogen-associated molecular patterns (PAMPs) by pattern recognition receptors localized on the plasma membrane leads to PAMP-triggered immunity (PTI). Detection of pathogen effectors by intracellular or plasma membrane-localized immune receptors results in effector-triggered immunity (ETI). Despite the large variations in the magnitude and duration of immune responses triggered by different PAMPs or pathogen effectors during PTI and ETI, plasma membrane-localized immune receptors activate similar downstream molecular events such as mitogen-activated protein kinase activation, oxidative burst, ion influx, and increased biosynthesis of plant defense hormones, indicating that defense signals initiated at the plasma membrane converge at later points. On the other hand, activation of ETI by immune receptors localized to the nucleus appears to be more directly associated with transcriptional regulation of defense gene expression. Here, we review recent progress in signal transductions downstream of different groups of plant immune receptors, highlighting the converging and diverging molecular events.

  16. Leptin as immune mediator: Interaction between neuroendocrine and immune system.

    Science.gov (United States)

    Procaccini, Claudio; La Rocca, Claudia; Carbone, Fortunata; De Rosa, Veronica; Galgani, Mario; Matarese, Giuseppe

    2017-01-01

    Leptin is an adipocyte-derived hormone/cytokine that links nutritional status with neuroendocrine and immune functions. Initially described as an anti-obesity hormone, leptin has subsequently been shown to exert pleiotropic effects, being also able to influence haematopoiesis, thermogenesis, reproduction, angiogenesis, and more importantly immune homeostasis. As a cytokine, leptin can affect both innate and adaptive immunity, by inducing a pro-inflammatory response and thus playing a key role in the regulation of the pathogenesis of several autoimmune/inflammatory diseases. In this review, we discuss the most recent advances on the role of leptin as immune-modulator in mammals and we also provide an overview on its main functions in non-mammalian vertebrates. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Regulation of intestinal homeostasis and immunity with probiotic lactobacilli

    NARCIS (Netherlands)

    Baarlen, van P.; Wells, J.; Kleerebezem, M.

    2013-01-01

    The gut microbiota provide important stimuli to the human innate and adaptive immune system and co-mediate metabolic and immune homeostasis. Probiotic bacteria can be regarded as part of the natural human microbiota, and have been associated with improving homeostasis, albeit with different levels

  18. Immune-Modulating Perspectives for Low Frequency Electromagnetic Fields in Innate Immunity

    Directory of Open Access Journals (Sweden)

    Maria Manuela Rosado

    2018-03-01

    Full Text Available In recent years, the effects of electromagnetic fields (EMFs on the immune system have received a considerable interest, not only to investigate possible negative health impact but also to explore the possibility to favorably modulate immune responses. To generate beneficial responses, the immune system should eradicate pathogens while “respecting” the organism and tolerating irrelevant antigens. According to the current view, damage-associated molecules released by infected or injured cells, or secreted by innate immune cells generate danger signals activating an immune response. These signals are also relevant to the subsequent activation of homeostatic mechanisms that control the immune response in pro- or anti-inflammatory reactions, a feature that allows modulation by therapeutic treatments. In the present review, we describe and discuss the effects of extremely low frequency (ELF-EMF and pulsed EMF on cell signals and factors relevant to the activation of danger signals and innate immunity cells. By discussing the EMF modulating effects on cell functions, we envisage the use of EMF as a therapeutic agent to regulate immune responses associated with wound healing.

  19. Regulation of innate and adaptive immunity by the commensal microbiota

    OpenAIRE

    Jarchum, Irene; Pamer, Eric G.

    2011-01-01

    The microbial communities that inhabit the intestinal tract are essential for mammalian health. Communication between the microbiota and the host establishes and maintains immune homeostasis, enabling protective immune responses against pathogens while preventing adverse inflammatory responses to harmless commensal microbes. Specific bacteria, such as segmented filamentous bacteria, Clostridium species, and Bacteroides fragilis, are key contributors to immune homeostasis in the gut. The cellu...

  20. The Gateway Reflex, a Novel Neuro-Immune Interaction for the Regulation of Regional Vessels

    Directory of Open Access Journals (Sweden)

    Yuki Tanaka

    2017-10-01

    Full Text Available The gateway reflex is a new phenomenon that explains how immune cells bypass the blood–brain barrier to infiltrate the central nervous system (CNS and trigger neuroinflammation. To date, four examples of gateway reflexes have been discovered, each described by the stimulus that evokes the reflex. Gravity, electricity, pain, and stress have all been found to create gateways at specific regions of the CNS. The gateway reflex, the most recently discovered of the four, has also been shown to upset the homeostasis of organs in the periphery through its action on the CNS. These reflexes provide novel therapeutic targets for the control of local neuroinflammation and organ function. Each gateway reflex is activated by different neural activations and induces inflmammation at different regions in the CNS. Therefore, it is theoretically possible to manipulate each independently, providing a novel therapeutic strategy to control local neuroinflammation and peripheral organ homeostasis.

  1. Solute Carrier NTCP Regulates Innate Antiviral Immune Responses Targeting Hepatitis C Virus Infection of Hepatocytes

    Directory of Open Access Journals (Sweden)

    Eloi R. Verrier

    2016-10-01

    Full Text Available Chronic hepatitis B, C, and D virus (HBV, HCV, and HDV infections are the leading causes of liver disease and cancer worldwide. Recently, the solute carrier and sodium taurocholate co-transporter NTCP has been identified as a receptor for HBV and HDV. Here, we uncover NTCP as a host factor regulating HCV infection. Using gain- and loss-of-function studies, we show that NTCP mediates HCV infection of hepatocytes and is relevant for cell-to-cell transmission. NTCP regulates HCV infection by augmenting the bile-acid-mediated repression of interferon-stimulated genes (ISGs, including IFITM3. In conclusion, our results uncover NTCP as a mediator of innate antiviral immune responses in the liver, and they establish a role for NTCP in the infection process of multiple viruses via distinct mechanisms. Collectively, our findings suggest a role for solute carriers in the regulation of innate antiviral responses, and they have potential implications for virus-host interactions and antiviral therapies.

  2. The tomato Fni3 lysine-63-specific ubiquitin-conjugating enzyme and suv ubiquitin E2 variant positively regulate plant immunity.

    Science.gov (United States)

    Mural, Ravi V; Liu, Yao; Rosebrock, Tracy R; Brady, Jennifer J; Hamera, Sadia; Connor, Richard A; Martin, Gregory B; Zeng, Lirong

    2013-09-01

    The activation of an immune response in tomato (Solanum lycopersicum) against Pseudomonas syringae relies on the recognition of E3 ligase-deficient forms of AvrPtoB by the host protein kinase, Fen. To investigate the mechanisms by which Fen-mediated immunity is regulated, we characterize in this study a Fen-interacting protein, Fni3, and its cofactor, S. lycoperiscum Uev (Suv). Fni3 encodes a homolog of the Ubc13-type ubiquitin-conjugating enzyme that catalyzes exclusively Lys-63-linked ubiquitination, whereas Suv is a ubiquitin-conjugating enzyme variant. The C-terminal region of Fen was necessary for interaction with Fni3, and this interaction was required for cell death triggered by overexpression of Fen in Nicotiana benthamiana leaves. Fni3 was shown to be an active E2 enzyme, but Suv displayed no ubiquitin-conjugating activity; Fni3 and Suv together directed Lys-63-linked ubiquitination. Decreased expression of Fni3, another tomato Ubc13 homolog, Sl-Ubc13-2, or Suv in N. benthamiana leaves diminished cell death associated with Fen-mediated immunity and cell death elicited by several other resistance (R) proteins and their cognate effectors. We also discovered that coexpression of Fen and other R proteins/effectors with a Fni3 mutant that is compromised for ubiquitin-conjugating activity diminished the cell death. These results suggest that Fni3/Sl-Ubc13-2 and Suv regulate the immune response mediated by Fen and other R proteins through Lys-63-linked ubiquitination.

  3. Zonulin, regulation of tight junctions, and autoimmune diseases.

    Science.gov (United States)

    Fasano, Alessio

    2012-07-01

    Recent studies indicate that besides digestion and absorption of nutrients and water and electrolytes homeostasis, another key function of the intestine is to regulate the trafficking of environmental antigens across the host mucosal barrier. Intestinal tight junctions (TJs) create gradients for the optimal absorption and transport of nutrients and control the balance between tolerance and immunity to nonself antigens. To meet diverse physiological challenges, intestinal epithelial TJs must be modified rapidly and in a coordinated fashion by regulatory systems that orchestrate the state of assembly of the TJ multiprotein network. While considerable knowledge exists about TJ ultrastructure, relatively little is known about their physiological and pathophysiological regulation. Our discovery of zonulin, the only known physiologic modulator of intercellular TJs described so far, has increased our understanding of the intricate mechanisms that regulate the intestinal epithelial paracellular pathway and has led us to appreciate that its upregulation in genetically susceptible individuals leads to autoimmune diseases. © 2012 New York Academy of Sciences.

  4. Immune escape strategies of malaria parasites

    Directory of Open Access Journals (Sweden)

    Pollyanna Stephanie Gomes

    2016-10-01

    Full Text Available Malaria is one of the most life-threatening infectious diseases worldwide. Immunity to malaria is slow and short-lived despite the repeated parasite exposure in endemic areas. Malaria parasites have evolved refined machinery to evade the immune system based on a range of genetic changes that include allelic variation, biomolecular exposure of proteins and intracellular replication. All of these features increase the probability of survival in both mosquitoes and the vertebrate host. Plasmodium species escape from the first immunological trap in its invertebrate vector host, the Anopheles mosquitoes. The parasites have to pass through various immunological barriers within the mosquito such as anti-microbial molecules and the mosquito microbiota in order to achieve successful transmission to the vertebrate host. Within these hosts, Plasmodium species employ various immune evasion strategies during different life cycle stages. Parasite persistence against the vertebrate immune response depends on the balance among virulence factors, pathology, metabolic cost of the host immune response, and the parasites ability to evade the immune response. In this review we discuss the strategies that Plasmodium parasites use to avoid the vertebrate host immune system and how they promote successful infection and transmission.

  5. RNA-Binding Proteins in Plant Immunity

    Directory of Open Access Journals (Sweden)

    Virginia Woloshen

    2011-01-01

    Full Text Available Plant defence responses against pathogen infection are crucial to plant survival. The high degree of regulation of plant immunity occurs both transcriptionally and posttranscriptionally. Once transcribed, target gene RNA must be processed prior to translation. This includes polyadenylation, 5′capping, editing, splicing, and mRNA export. RNA-binding proteins (RBPs have been implicated at each level of RNA processing. Previous research has primarily focused on structural RNA-binding proteins of yeast and mammals; however, more recent work has characterized a number of plant RBPs and revealed their roles in plant immune responses. This paper provides an update on the known functions of RBPs in plant immune response regulation. Future in-depth analysis of RBPs and other related players will unveil the sophisticated regulatory mechanisms of RNA processing during plant immune responses.

  6. The role of the adaptive immune system in regulation of gut microbiota.

    Science.gov (United States)

    Kato, Lucia M; Kawamoto, Shimpei; Maruya, Mikako; Fagarasan, Sidonia

    2014-07-01

    The gut nourishes rich bacterial communities that affect profoundly the functions of the immune system. The relationship between gut microbiota and the immune system is one of reciprocity. The microbiota contributes to nutrient processing and the development, maturation, and function of the immune system. Conversely, the immune system, particularly the adaptive immune system, plays a key role in shaping the repertoire of gut microbiota. The fitness of host immune system is reflected in the gut microbiota, and deficiencies in either innate or adaptive immunity impact on diversity and structures of bacterial communities in the gut. Here, we discuss the mechanisms that underlie this reciprocity and emphasize how the adaptive immune system via immunoglobulins (i.e. IgA) contributes to diversification and balance of gut microbiota required for immune homeostasis. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. Barrier performance researches for the safety evaluation

    International Nuclear Information System (INIS)

    Niibori, Yuichi

    2004-01-01

    So far, many researches were conducted to propose a scientific evidence (a safety case) for the realization of geological disposal in Japan. In order to regulate the geological disposal system of radioactive wastes, on the other hand, we need also a holistic approach to integrate various data related for the performance evaluations of the engineered barrier system and the natural barrier system. However, the scientific bases are not sufficient to establish the safety regulation for such a natural system. For example, we often apply the specific probability density function (PDF) to the uncertainty of barrier system due to the essential heterogeneity. However, the applicability is not clear in the regulation point of view. A viewpoint to understand such an applicability of PDFs has been presented. (author)

  8. Epidermal Growth Factor and Intestinal Barrier Function

    Directory of Open Access Journals (Sweden)

    Xiaopeng Tang

    2016-01-01

    Full Text Available Epidermal growth factor (EGF is a 53-amino acid peptide that plays an important role in regulating cell growth, survival, migration, apoptosis, proliferation, and differentiation. In addition, EGF has been established to be an effective intestinal regulator helping to protect intestinal barrier integrity, which was essential for the absorption of nutrients and health in humans and animals. Several researches have demonstrated that EGF via binding to the EGF receptor and subsequent activation of Ras/MAPK, PI3K/AKT, PLC-γ/PKC, and STATS signal pathways regulates intestinal barrier function. In this review, the relationship between epidermal growth factor and intestinal development and intestinal barrier is described, to provide a better understanding of the effects of EGF on intestine development and health.

  9. Commensal–dendritic-cell interaction specifies a unique protective skin immune signature

    Science.gov (United States)

    Naik, Shruti; Bouladoux, Nicolas; Linehan, Jonathan L.; Han, Seong-Ji; Harrison, Oliver J.; Wilhelm, Christoph; Conlan, Sean; Himmelfarb, Sarah; Byrd, Allyson L.; Deming, Clayton; Quinones, Mariam; Brenchley, Jason M.; Kong, Heidi H.; Tussiwand, Roxanne; Murphy, Kenneth M.; Merad, Miriam; Segre, Julia A; Belkaid, Yasmine

    2015-01-01

    The skin represents the primary interface between the host and the environment. This organ is also home to trillions of microorganisms that play an important role in tissue homeostasis and local immunity1–4. Skin microbial communities are highly diverse and can be remodelled over time or in response to environmental challenges5–7. How, in the context of this complexity, individual commensal microorganisms may differentially modulate skin immunity and the consequences of these responses for tissue physiology remains unclear. Here we show that defined commensals dominantly affect skin immunity and identify the cellular mediators involved in this specification. In particular, colonization with Staphylococcus epidermidis induces IL-17A+ CD8+ T cells that home to the epidermis, enhance innate barrier immunity and limit pathogen invasion. Commensal-specific T-cell responses result from the coordinated action of skin-resident dendritic cell subsets and are not associated with inflammation, revealing that tissue-resident cells are poised to sense and respond to alterations in microbial communities. This interaction may represent an evolutionary means by which the skin immune system uses fluctuating commensal signals to calibrate barrier immunity and provide heterologous protection against invasive pathogens. These findings reveal that the skin immune landscape is a highly dynamic environment that can be rapidly and specifically remodelled by encounters with defined commensals, findings that have profound implications for our understanding of tissue-specific immunity and pathologies. PMID:25539086

  10. Foxp3(+) T cells regulate immunoglobulin a selection and facilitate diversification of bacterial species responsible for immune homeostasis.

    Science.gov (United States)

    Kawamoto, Shimpei; Maruya, Mikako; Kato, Lucia M; Suda, Wataru; Atarashi, Koji; Doi, Yasuko; Tsutsui, Yumi; Qin, Hongyan; Honda, Kenya; Okada, Takaharu; Hattori, Masahira; Fagarasan, Sidonia

    2014-07-17

    Foxp3(+) T cells play a critical role for the maintenance of immune tolerance. Here we show that in mice, Foxp3(+) T cells contributed to diversification of gut microbiota, particularly of species belonging to Firmicutes. The control of indigenous bacteria by Foxp3(+) T cells involved regulatory functions both outside and inside germinal centers (GCs), consisting of suppression of inflammation and regulation of immunoglobulin A (IgA) selection in Peyer's patches, respectively. Diversified and selected IgAs contributed to maintenance of diversified and balanced microbiota, which in turn facilitated the expansion of Foxp3(+) T cells, induction of GCs, and IgA responses in the gut through a symbiotic regulatory loop. Thus, the adaptive immune system, through cellular and molecular components that are required for immune tolerance and through the diversification as well as selection of antibody repertoire, mediates host-microbial symbiosis by controlling the richness and balance of bacterial communities required for homeostasis. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Interchromosomal Transfer of Immune Regulation During Infection of Barley with the Powdery Mildew Pathogen

    Science.gov (United States)

    Surana, Priyanka; Xu, Ruo; Fuerst, Gregory; Chapman, Antony V. E.; Nettleton, Dan; Wise, Roger P.

    2017-01-01

    Powdery mildew pathogens colonize over 9500 plant species, causing critical yield loss. The Ascomycete fungus, Blumeria graminis f. sp. hordei (Bgh), causes powdery mildew disease in barley (Hordeum vulgare L.). Successful infection begins with penetration of host epidermal cells, culminating in haustorial feeding structures, facilitating delivery of fungal effectors to the plant and exchange of nutrients from host to pathogen. We used expression Quantitative Trait Locus (eQTL) analysis to dissect the temporal control of immunity-associated gene expression in a doubled haploid barley population challenged with Bgh. Two highly significant regions possessing trans eQTL were identified near the telomeric ends of chromosomes (Chr) 2HL and 1HS. Within these regions reside diverse resistance loci derived from barley landrace H. laevigatum (MlLa) and H. vulgare cv. Algerian (Mla1), which associate with the altered expression of 961 and 3296 genes during fungal penetration of the host and haustorial development, respectively. Regulatory control of transcript levels for 299 of the 961 genes is reprioritized from MlLa on 2HL to Mla1 on 1HS as infection progresses, with 292 of the 299 alternating the allele responsible for higher expression, including Adaptin Protein-2 subunit μ AP2M and Vesicle Associated Membrane Protein VAMP72 subfamily members VAMP721/722. AP2M mediates effector-triggered immunity (ETI) via endocytosis of plasma membrane receptor components. VAMP721/722 and SNAP33 form a Soluble N-ethylmaleimide-sensitive factor Attachment Protein REceptor (SNARE) complex with SYP121 (PEN1), which is engaged in pathogen associated molecular pattern (PAMP)-triggered immunity via exocytosis. We postulate that genes regulated by alternate chromosomal positions are repurposed as part of a conserved immune complex to respond to different pathogen attack scenarios. PMID:28790145

  12. Interchromosomal Transfer of Immune Regulation During Infection of Barley with the Powdery Mildew Pathogen

    Directory of Open Access Journals (Sweden)

    Priyanka Surana

    2017-10-01

    Full Text Available Powdery mildew pathogens colonize over 9500 plant species, causing critical yield loss. The Ascomycete fungus, Blumeria graminis f. sp. hordei (Bgh, causes powdery mildew disease in barley (Hordeum vulgare L.. Successful infection begins with penetration of host epidermal cells, culminating in haustorial feeding structures, facilitating delivery of fungal effectors to the plant and exchange of nutrients from host to pathogen. We used expression Quantitative Trait Locus (eQTL analysis to dissect the temporal control of immunity-associated gene expression in a doubled haploid barley population challenged with Bgh. Two highly significant regions possessing trans eQTL were identified near the telomeric ends of chromosomes (Chr 2HL and 1HS. Within these regions reside diverse resistance loci derived from barley landrace H. laevigatum (MlLa and H. vulgare cv. Algerian (Mla1, which associate with the altered expression of 961 and 3296 genes during fungal penetration of the host and haustorial development, respectively. Regulatory control of transcript levels for 299 of the 961 genes is reprioritized from MlLa on 2HL to Mla1 on 1HS as infection progresses, with 292 of the 299 alternating the allele responsible for higher expression, including Adaptin Protein-2 subunit μ AP2M and Vesicle Associated Membrane Protein VAMP72 subfamily members VAMP721/722. AP2M mediates effector-triggered immunity (ETI via endocytosis of plasma membrane receptor components. VAMP721/722 and SNAP33 form a Soluble N-ethylmaleimide-sensitive factor Attachment Protein REceptor (SNARE complex with SYP121 (PEN1, which is engaged in pathogen associated molecular pattern (PAMP-triggered immunity via exocytosis. We postulate that genes regulated by alternate chromosomal positions are repurposed as part of a conserved immune complex to respond to different pathogen attack scenarios.

  13. The Th17 Lineage: From Barrier Surfaces Homeostasis to Autoimmunity, Cancer, and HIV-1 Pathogenesis.

    Science.gov (United States)

    Wacleche, Vanessa Sue; Landay, Alan; Routy, Jean-Pierre; Ancuta, Petronela

    2017-10-19

    The T helper 17 (Th17) cells represent a subset of CD4+ T-cells with unique effector functions, developmental plasticity, and stem-cell features. Th17 cells bridge innate and adaptive immunity against fungal and bacterial infections at skin and mucosal barrier surfaces. Although Th17 cells have been extensively studied in the context of autoimmunity, their role in various other pathologies is underexplored and remains an area of open investigation. This review summarizes the history of Th17 cell discovery and the current knowledge relative to the beneficial role of Th17 cells in maintaining mucosal immunity homeostasis. We further discuss the concept of Th17 pathogenicity in the context of autoimmunity, cancer, and HIV infection, and we review the most recent discoveries on molecular mechanisms regulating HIV replication/persistence in pathogenic Th17 cells. Finally, we stress the need for novel fundamental research discovery-based Th17-specific therapeutic interventions to treat pathogenic conditions associated with Th17 abnormalities, including HIV infection.

  14. Mucosal immunity and B cells in teleosts: effect of vaccination and stress.

    Directory of Open Access Journals (Sweden)

    David eParra

    2015-07-01

    Full Text Available Fish are subjected to several insults from the environment, which may endanger animal survival. Mucosal surfaces are the first line of defense against those threats and they act as a physical barrier to protect the animal but also function as immunologically active tissues. Thus, four mucosal-associated lymphoid tissues have been described in fish, which lead the immune responses in gut, skin, gills and nose. Humoral and cellular immunity, as well as its regulation and the factors that influence the response in these mucosal lymphoid tissues is still not well known in most of fish species. Mucosal B-lymphocytes and immunoglobulins (Igs are one of the key players in the immune response after vaccination. Recent findings about IgT in trout have delimited the compartmentalization of immune response in systemic and mucosal. The existence of IgT as a specialized mucosa Ig gives us the opportunity of measuring mucosal specific responses after vaccination, a fact that was not possible until recently in most of the fish species. Vaccination process is influenced by several factors, being stress one of the main stimuli determining the success of the vaccine. Thus, one of the major goals in a vaccination process is to avoid possible situations of stress, which might interfere with fish immune performance. However, the interaction between immune and neuroendocrine systems at mucosal tissues is still unknown. In this review we will summarized the latest findings about B-lymphocytes and immunoglobulins in mucosal immunity and the effect of stress and vaccines on B cell response at mucosal sites. It is important to point out that a small number of studies have been published regarding mucosal stress and very few about the influence of stress over mucosal B-lymphocytes.

  15. Roles of Zinc Signaling in the Immune System.

    Science.gov (United States)

    Hojyo, Shintaro; Fukada, Toshiyuki

    2016-01-01

    Zinc (Zn) is an essential micronutrient for basic cell activities such as cell growth, differentiation, and survival. Zn deficiency depresses both innate and adaptive immune responses. However, the precise physiological mechanisms of the Zn-mediated regulation of the immune system have been largely unclear. Zn homeostasis is tightly controlled by the coordinated activity of Zn transporters and metallothioneins, which regulate the transport, distribution, and storage of Zn. There is growing evidence that Zn behaves like a signaling molecule, facilitating the transduction of a variety of signaling cascades in response to extracellular stimuli. In this review, we highlight the emerging functional roles of Zn and Zn transporters in immunity, focusing on how crosstalk between Zn and immune-related signaling guides the normal development and function of immune cells.

  16. Immune regulation by CD40-CD40-l interactions - 2; Y2K update.

    Science.gov (United States)

    van Kooten, C

    2000-11-01

    CD40 is a cell surface receptor, which belongs to the TNF-R family, and which was first identified and functionally characterized on B lymphocytes. However, in recent years it has become clear that CD40 is expressed much broader, including expression on monocytes, dendritic cells, endothelial cells and epithelial cells. Therefore it is now thought that CD40 plays a more general role in immune regulation. The present paper reviews recent developments in this field of research, with main emphasis on CD40 signal transduction and on in vivo functions of CD40/CD40-L interactions.

  17. INDOLEAMINE 2,3-DIOXYGENASE (IDO AND IMMUNE TOLERANCE

    Directory of Open Access Journals (Sweden)

    Coma-del-Corral MJ

    2013-09-01

    Full Text Available SUMMARY: Indoleamine 2,3-dioxygenase (IDO is an intracellular and extrahepatic enzyme predominantly found in many cells, especially macrophages. Tryptophan degradation generates kynurenine, and this pathway of tryptophan metabolism is an effective mechanism for modulating the immune response. The IDO facilitates immune tolerance and is one of the main actors involved in the inhibition of cell proliferation, including activated T cells. IDO induces production of reactive oxygen species (ROS and nitric oxide (NO radicals. Several pathways involved in the regulation of immune response are regulated by redox mechanisms. Reactive oxygen and nitrogen species (ROS-RNS and other redox active molecules play key roles in immunity.

  18. Different faces of regulatory DCs in homeostasis and immunity

    NARCIS (Netherlands)

    Smits, Hermelijn H.; de Jong, Esther C.; Wierenga, Eddy A.; Kapsenberg, Martien L.

    2005-01-01

    Adaptive immunity protects against infection and cancer but is also a potential threat to the host because of the risk of excessive inflammation or the development of autoimmunity and allergy. Therefore, immune responses are subject to negative regulation. An important aspect of negative regulation

  19. Regulation of intestinal homeostasis by innate and adaptive immunity.

    Science.gov (United States)

    Kayama, Hisako; Takeda, Kiyoshi

    2012-11-01

    The intestine is a unique tissue where an elaborate balance is maintained between tolerance and immune responses against a variety of environmental factors such as food and the microflora. In a healthy individual, the microflora stimulates innate and adaptive immune systems to maintain gut homeostasis. However, the interaction of environmental factors with particular genetic backgrounds can lead to dramatic changes in the composition of the microflora (i.e. dysbiosis). Many of the specific commensal-bacterial products and the signaling pathways they trigger have been characterized. The role of T(h)1, T(h)2 and T(h)17 cells in inflammatory bowel disease has been widely investigated, as has the contribution of epithelial cells and subsets of dendritic cells and macrophages. To date, multiple regulatory cells in adaptive immunity, such as regulatory T cells and regulatory B cells, have been shown to maintain gut homeostasis by preventing inappropriate innate and adaptive immune responses to commensal bacteria. Additionally, regulatory myeloid cells have recently been identified that prevent intestinal inflammation by inhibiting T-cell proliferation. An increasing body of evidence has shown that multiple regulatory mechanisms contribute to the maintenance of gut homeostasis.

  20. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    International Nuclear Information System (INIS)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A.; Nusrat, Asma

    2010-01-01

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  1. Glycogen Synthase Kinase 3 (GSK-3) influences epithelial barrier function by regulating Occludin, Claudin-1 and E-cadherin expression

    Energy Technology Data Exchange (ETDEWEB)

    Severson, Eric A.; Kwon, Mike; Hilgarth, Roland S.; Parkos, Charles A. [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States); Nusrat, Asma, E-mail: anusrat@emory.edu [Epithelial Pathobiology Research Unit, Dept. of Pathology, Emory University, Atlanta, GA 30322 (United States)

    2010-07-02

    The Apical Junctional Complex (AJC) encompassing the tight junction (TJ) and adherens junction (AJ) plays a pivotal role in regulating epithelial barrier function and epithelial cell proliferative processes through signaling events that remain poorly characterized. A potential regulator of AJC protein expression is Glycogen Synthase Kinase-3 (GSK-3). GSK-3 is a constitutively active kinase that is repressed during epithelial-mesenchymal transition (EMT). In the present study, we report that GSK-3 activity regulates the structure and function of the AJC in polarized model intestinal (SK-CO15) and kidney (Madin-Darby Canine Kidney (MDCK)) epithelial cells. Reduction of GSK-3 activity, either by small molecule inhibitors or siRNA targeting GSK-3 alpha and beta mRNA, resulted in increased permeability to both ions and bulk solutes. Immunofluorescence labeling and immunoblot analyses revealed that the barrier defects correlated with decreased protein expression of AJC transmembrane proteins Occludin, Claudin-1 and E-cadherin without influencing other TJ proteins, Zonula Occludens-1 (ZO-1) and Junctional Adhesion Molecule A (JAM-A). The decrease in Occludin and E-cadherin protein expression correlated with downregulation of the corresponding mRNA levels for these respective proteins following GSK-3 inhibition. These observations implicate an important role of GSK-3 in the regulation of the structure and function of the AJC that is mediated by differential modulation of mRNA transcription of key AJC proteins, Occludin, Claudin-1 and E-cadherin.

  2. Immune regulation in chronic hepatitis C virus infection

    DEFF Research Database (Denmark)

    Hartling, Hans Jakob; Ballegaard, Vibe Cecilie; Nielsen, Nick Schou

    2016-01-01

    The immunological result of infection with Hepatitis C virus (HCV) depends on the delicate balance between a vigorous immune response that may clear the infection, but with a risk of unspecific inflammation and, or a less inflammatory response that leads to chronic infection. In general, exhaustion...... and impairment of cytotoxic function of HCV-specific T cells and NK cells are found in patients with chronic HCV infection. In contrast, an increase in immune regulatory functions is found primarily in form of increased IL-10 production possibly due to increased level and function of anti-inflammatory Tregs...

  3. The Danish Barriers Questionnaire-II: preliminary validation in cancer pain patients

    DEFF Research Database (Denmark)

    Jacobsen, Ramune; Møldrup, Claus; Christrup, Lona Louring

    2009-01-01

    OBJECTIVE: The objective of this study was to examine the psychometric properties of the Danish version of the Barriers Questionnaire-II (DBQ-II). METHODS: The validated Norwegian version of the DBQ-II was translated into Danish. Cancer patients for the study were recruited from specialized pain...... cancer pain management. Scale two, Immune System, consisted of three items addressing the belief that pain medications harm the immune system. Scale three, Monitor, consisted of three items addressing the fear that pain medicine masks changes in one's body. Scale four, Communication, consisted of five......: The DBQ-II seems to be a reliable and valid measure of the barriers to pain management among Danish cancer patients....

  4. Late regulation of immune genes and microRNAs in circulating leukocytes in a pig model of influenza A (H1N2) infection.

    Science.gov (United States)

    Brogaard, Louise; Heegaard, Peter M H; Larsen, Lars E; Mortensen, Shila; Schlegel, Michael; Dürrwald, Ralf; Skovgaard, Kerstin

    2016-02-19

    MicroRNAs (miRNAs) are a class of short regulatory RNA molecules which are implicated in modulating gene expression. Levels of circulating, cell-associated miRNAs in response to influenza A virus (IAV) infection has received limited attention so far. To further understand the temporal dynamics and biological implications of miRNA regulation in circulating leukocytes, we collected blood samples before and after (1, 3, and 14 days) IAV challenge of pigs. Differential expression of miRNAs and innate immune factor mRNA transcripts was analysed using RT-qPCR. A total of 20 miRNAs were regulated after IAV challenge, with the highest number of regulated miRNAs seen on day 14 after infection at which time the infection was cleared. Targets of the regulated miRNAs included genes involved in apoptosis and cell cycle regulation. Significant regulation of both miRNAs and mRNA transcripts at 14 days after challenge points to a protracted effect of IAV infection, potentially affecting the host's ability to respond to secondary infections. In conclusion, experimental IAV infection of pigs demonstrated the dynamic nature of miRNA and mRNA regulation in circulating leukocytes during and after infection, and revealed the need for further investigation of the potential immunosuppressing effect of miRNA and innate immune signaling after IAV infection.

  5. The Mannose Receptor in Regulation of Helminth-Mediated Host Immunity

    Directory of Open Access Journals (Sweden)

    Irma van Die

    2017-11-01

    Full Text Available Infection with parasitic helminths affects humanity and animal welfare. Parasitic helminths have the capacity to modulate host immune responses to promote their survival in infected hosts, often for a long time leading to chronic infections. In contrast to many infectious microbes, however, the helminths are able to induce immune responses that show positive bystander effects such as the protection to several immune disorders, including multiple sclerosis, inflammatory bowel disease, and allergies. They generally promote the generation of a tolerogenic immune microenvironment including the induction of type 2 (Th2 responses and a sub-population of alternatively activated macrophages. It is proposed that this anti-inflammatory response enables helminths to survive in their hosts and protects the host from excessive pathology arising from infection with these large pathogens. In any case, there is an urgent need to enhance understanding of how helminths beneficially modulate inflammatory reactions, to identify the molecules involved and to promote approaches to exploit this knowledge for future therapeutic interventions. Evidence is increasing that C-type lectins play an important role in driving helminth-mediated immune responses. C-type lectins belong to a large family of calcium-dependent receptors with broad glycan specificity. They are abundantly present on immune cells, such as dendritic cells and macrophages, which are essential in shaping host immune responses. Here, we will focus on the role of the C-type lectin macrophage mannose receptor (MR in helminth–host interactions, which is a critically understudied area in the field of helminth immunobiology. We give an overview of the structural aspects of the MR including its glycan specificity, and the functional implications of the MR in helminth–host interactions focusing on a few selected helminth species.

  6. Driving forces and barriers for environmental technology development

    International Nuclear Information System (INIS)

    2005-01-01

    Driving forces and barriers behind development and usage of environmental technology is discussed, and also whether there are certain characteristics related to environmental innovations compared to other innovations in general. The development of environmental technology is in principle dominated by the same drivers and barriers as any other technology, but the order and strength of the various factors may be different. This examination as well as other empirical studies shows that regulations play a greater part for environmental technology than 'pure market forces'. To many participants it is important to be one step ahead of the regulations, i.e. the expected regulations are equally important as the factual ones in driving the technology development. Players in the business community express that it is important that the authorities cooperate with them when introducing new regulations. This will increase acceptance for the regulations and facilitate the necessary adjustments. The most important barrier in the development and use of the technologies studied is probably the lack of demand

  7. Porcine models for the study of local and systemic regulation of innate immune factors in obesity

    DEFF Research Database (Denmark)

    Højbøge, Tina Rødgaard

    state of low-grade inflammation in the adipose tissues, which involves several factors of the innate immune response having a range of systemic effects and which has been implicated in the development of the metabolic syndrome. To investigate the impact of obesity and obesity-related diseases good...... translational animal models are needed, and as such pigs have been proposed as relevant models for human obesity-induced inflammation as pigs share many genetic, anatomical and physiological features with humans. In this project the up- and downregulation of genes and proteins involved in the innate immune...... the number of animals to be used in a trial to obtain statistical power. For the gene regulation analysis, two platforms for quantitative real-time PCR (qPCR) were employed: The Rotor-Gene Q instrument and the microfluidics-based high-throughput Bio-Mark. For the serum protein concentrations analysis several...

  8. Subversion of Immunity by Leishmania amazonensis Parasites: Possible Role of Phosphatidylserine as a Main Regulator

    Directory of Open Access Journals (Sweden)

    Joao Luiz Mendes Wanderley

    2012-01-01

    Full Text Available Leishmania amazonensis parasites cause progressive disease in most inbred mouse strains and are associated with the development of diffuse cutaneous leishmaniasis in humans. The poor activation of an effective cellular response is correlated with the ability of these parasites to infect mononuclear phagocytic cells without triggering their activation or actively suppressing innate responses of these cells. Here we discuss the possible role of phosphatidylserine exposure by these parasites as a main regulator of the mechanism underlying subversion of the immune system at different steps during the infection.

  9. Host-selected mutations converging on a global regulator drive an adaptive leap towards symbiosis in bacteria

    Science.gov (United States)

    Sabrina Pankey, M; Foxall, Randi L; Ster, Ian M; Perry, Lauren A; Schuster, Brian M; Donner, Rachel A; Coyle, Matthew; Cooper, Vaughn S; Whistler, Cheryl A

    2017-01-01

    Host immune and physical barriers protect against pathogens but also impede the establishment of essential symbiotic partnerships. To reveal mechanisms by which beneficial organisms adapt to circumvent host defenses, we experimentally evolved ecologically distinct bioluminescent Vibrio fischeri by colonization and growth within the light organs of the squid Euprymna scolopes. Serial squid passaging of bacteria produced eight distinct mutations in the binK sensor kinase gene, which conferred an exceptional selective advantage that could be demonstrated through both empirical and theoretical analysis. Squid-adaptive binK alleles promoted colonization and immune evasion that were mediated by cell-associated matrices including symbiotic polysaccharide (Syp) and cellulose. binK variation also altered quorum sensing, raising the threshold for luminescence induction. Preexisting coordinated regulation of symbiosis traits by BinK presented an efficient solution where altered BinK function was the key to unlock multiple colonization barriers. These results identify a genetic basis for microbial adaptability and underscore the importance of hosts as selective agents that shape emergent symbiont populations. DOI: http://dx.doi.org/10.7554/eLife.24414.001 PMID:28447935

  10. Viral immune surveillance: Toward a TH17/TH9 gate to the central nervous system.

    Science.gov (United States)

    Barkhordarian, Andre; Thames, April D; Du, Angela M; Jan, Allison L; Nahcivan, Melissa; Nguyen, Mia T; Sama, Nateli; Chiappelli, Francesco

    2015-01-01

    Viral cellular immune surveillance is a dynamic and fluid system that is driven by finely regulated cellular processes including cytokines and other factors locally in the microenvironment and systemically throughout the body. It is questionable as to what extent the central nervous system (CNS) is an immune-privileged organ protected by the blood-brain barrier (BBB). Recent evidence suggests converging pathways through which viral infection, and its associated immune surveillance processes, may alter the integrity of the blood-brain barrier, and lead to inflammation, swelling of the brain parenchyma and associated neurological syndromes. Here, we expand upon the recent "gateway theory", by which viral infection and other immune activation states may disrupt the specialized tight junctions of the BBB endothelium making it permeable to immune cells and factors. The model we outline here builds upon the proposition that this process may actually be initiated by cytokines of the IL-17 family, and recognizing the intimate balance between TH17 and TH9 cytokine profiles systemically. We argue that immune surveillance events, in response to viruses such as the Human Immunodeficiency Virus (HIV), cause a TH17/TH9 induced gateway through blood brain barrier, and thus lead to characteristic neuroimmune pathology. It is possible and even probable that the novel TH17/TH9 induced gateway, which we describe here, opens as a consequence of any state of immune activation and sustained chronic inflammation, whether associated with viral infection or any other cause of peripheral or central neuroinflammation. This view could lead to new, timely and critical patient-centered therapies for patients with neuroimmune pathologies across a variety of etiologies. BBB - blood brain barrier, BDV - Borna disease virus, CARD - caspase activation and recruitment domains, CD - clusters of differentiation, CNS - central nervous system, DAMP - damage-associated molecular patterns, DENV - Dengue

  11. Solute Carrier NTCP Regulates Innate Antiviral Immune Responses Targeting Hepatitis C Virus Infection of Hepatocytes.

    Science.gov (United States)

    Verrier, Eloi R; Colpitts, Che C; Bach, Charlotte; Heydmann, Laura; Zona, Laetitia; Xiao, Fei; Thumann, Christine; Crouchet, Emilie; Gaudin, Raphaël; Sureau, Camille; Cosset, François-Loïc; McKeating, Jane A; Pessaux, Patrick; Hoshida, Yujin; Schuster, Catherine; Zeisel, Mirjam B; Baumert, Thomas F

    2016-10-25

    Chronic hepatitis B, C, and D virus (HBV, HCV, and HDV) infections are the leading causes of liver disease and cancer worldwide. Recently, the solute carrier and sodium taurocholate co-transporter NTCP has been identified as a receptor for HBV and HDV. Here, we uncover NTCP as a host factor regulating HCV infection. Using gain- and loss-of-function studies, we show that NTCP mediates HCV infection of hepatocytes and is relevant for cell-to-cell transmission. NTCP regulates HCV infection by augmenting the bile-acid-mediated repression of interferon-stimulated genes (ISGs), including IFITM3. In conclusion, our results uncover NTCP as a mediator of innate antiviral immune responses in the liver, and they establish a role for NTCP in the infection process of multiple viruses via distinct mechanisms. Collectively, our findings suggest a role for solute carriers in the regulation of innate antiviral responses, and they have potential implications for virus-host interactions and antiviral therapies. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  12. Circadian transcription factor BMAL1 regulates innate immunity against select RNA viruses.

    Science.gov (United States)

    Majumdar, Tanmay; Dhar, Jayeeta; Patel, Sonal; Kondratov, Roman; Barik, Sailen

    2017-02-01

    BMAL1 (brain and muscle ARNT-like protein 1, also known as MOP3 or ARNT3) belongs to the family of the basic helix-loop-helix (bHLH)-PAS domain-containing transcription factors, and is a key component of the molecular oscillator that generates circadian rhythms. Here, we report that BMAL1-deficient cells are significantly more susceptible to infection by two major respiratory viruses of the Paramyxoviridae family, namely RSV and PIV3. Embryonic fibroblasts from Bmal1 -/- mice produced nearly 10-fold more progeny virus than their wild type controls. These results were supported by animal studies whereby pulmonary infection of RSV produced a more severe disease and morbidity in Bmal1 -/- mice. These results show that BMAL1 can regulate cellular innate immunity against specific RNA viruses.

  13. Roquin--a multifunctional regulator of immune homeostasis.

    Science.gov (United States)

    Schaefer, J S; Klein, J R

    2016-03-01

    Roquin-1 (Rc3h1) is an E3 ubiquitin ligase originally discovered in a mutational screen for genetic factors contributory to systemic lupus erythematosus-like symptoms in mice. A single base-pair mutation in the Rc3h1 gene resulted in the manifestation of autoantibody production and sustained immunological inflammation characterized by excessive T follicular helper cell activation and formation of germinal centers. Subsequent studies have uncovered a multifactorial process by which Roquin-1 contributes to the maintenance of immune homeostasis. Through its interactions with partner proteins, Roquin-1 targets mRNAs for decay with inducible costimulator being a primary target. In this review, we discuss newly discovered functions of Roquin-1 in the immune system and inflammation, and in disease manifestation, and discuss avenues of further research. A model is presented for the role of Roquin in health and disease.

  14. Melatonin: Buffering the Immune System

    Directory of Open Access Journals (Sweden)

    Juan M. Guerrero

    2013-04-01

    Full Text Available Melatonin modulates a wide range of physiological functions with pleiotropic effects on the immune system. Despite the large number of reports implicating melatonin as an immunomodulatory compound, it still remains unclear how melatonin regulates immunity. While some authors argue that melatonin is an immunostimulant, many studies have also described anti-inflammatory properties. The data reviewed in this paper support the idea of melatonin as an immune buffer, acting as a stimulant under basal or immunosuppressive conditions or as an anti-inflammatory compound in the presence of exacerbated immune responses, such as acute inflammation. The clinical relevance of the multiple functions of melatonin under different immune conditions, such as infection, autoimmunity, vaccination and immunosenescence, is also reviewed.

  15. Melatonin: Buffering the Immune System

    Science.gov (United States)

    Carrillo-Vico, Antonio; Lardone, Patricia J.; Álvarez-Sánchez, Nuria; Rodríguez-Rodríguez, Ana; Guerrero, Juan M.

    2013-01-01

    Melatonin modulates a wide range of physiological functions with pleiotropic effects on the immune system. Despite the large number of reports implicating melatonin as an immunomodulatory compound, it still remains unclear how melatonin regulates immunity. While some authors argue that melatonin is an immunostimulant, many studies have also described anti-inflammatory properties. The data reviewed in this paper support the idea of melatonin as an immune buffer, acting as a stimulant under basal or immunosuppressive conditions or as an anti-inflammatory compound in the presence of exacerbated immune responses, such as acute inflammation. The clinical relevance of the multiple functions of melatonin under different immune conditions, such as infection, autoimmunity, vaccination and immunosenescence, is also reviewed. PMID:23609496

  16. Overcoming immunological barriers in regenerative medicine.

    Science.gov (United States)

    Zakrzewski, Johannes L; van den Brink, Marcel R M; Hubbell, Jeffrey A

    2014-08-01

    Regenerative therapies that use allogeneic cells are likely to encounter immunological barriers similar to those that occur with transplantation of solid organs and allogeneic hematopoietic stem cells (HSCs). Decades of experience in clinical transplantation hold valuable lessons for regenerative medicine, offering approaches for developing tolerance-induction treatments relevant to cell therapies. Outside the field of solid-organ and allogeneic HSC transplantation, new strategies are emerging for controlling the immune response, such as methods based on biomaterials or mimicry of antigen-specific peripheral tolerance. Novel biomaterials can alter the behavior of cells in tissue-engineered constructs and can blunt host immune responses to cells and biomaterial scaffolds. Approaches to suppress autoreactive immune cells may also be useful in regenerative medicine. The most innovative solutions will be developed through closer collaboration among stem cell biologists, transplantation immunologists and materials scientists.

  17. An extracellular subtilase switch for immune priming in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Vicente Ramírez

    Full Text Available In higher eukaryotes, induced resistance associates with acquisition of a priming state of the cells for a more effective activation of innate immunity; however, the nature of the components for mounting this type of immunological memory is not well known. We identified an extracellular subtilase from Arabidopsis, SBT3.3, the overexpression of which enhances innate immune responses while the loss of function compromises them. SBT3.3 expression initiates a durable autoinduction mechanism that promotes chromatin remodeling and activates a salicylic acid(SA-dependent mechanism of priming of defense genes for amplified response. Moreover, SBT3.3 expression-sensitized plants for enhanced expression of the OXI1 kinase gene and activation of MAP kinases following pathogen attack, providing additional clues for the regulation of immune priming by SBT3.3. Conversely, in sbt3.3 mutant plants pathogen-mediated induction of SA-related defense gene expression is drastically reduced and activation of MAP kinases inhibited. Moreover, chromatin remodeling of defense-related genes normally associated with activation of an immune priming response appear inhibited in sbt3.3 plants, further indicating the importance of the extracellular SBT3.3 subtilase in the establishment of immune priming. Our results also point to an epigenetic control in the regulation of plant immunity, since SBT3.3 is up-regulated and priming activated when epigenetic control is impeded. SBT3.3 represents a new regulator of primed immunity.

  18. Microneedle arrays for the transcutaneous immunization of diphtheria and influenza in BALB/c mice

    NARCIS (Netherlands)

    Ding, Z.; Verbaan, F. J.; Bivas-Benita, M.; Bungener, L.; Huckriede, A.; van den Berg, D. J.; Kersten, G.; Bouwstra, J. A.

    2009-01-01

    Transcutaneous immunization (TCI) is limited by poor permeation of macromolecules across the skin. Microneedle arrays form transient conduits and enhance the transport of vaccine molecules across the skin barrier without pain sensation. Here we investigated in mouse the immune responses after TO

  19. Immune evasion strategies of ranaviruses and innate immune responses to these emerging pathogens.

    Science.gov (United States)

    Grayfer, Leon; Andino, Francisco De Jesús; Chen, Guangchun; Chinchar, Gregory V; Robert, Jacques

    2012-07-01

    Ranaviruses (RV, Iridoviridae) are large double-stranded DNA viruses that infect fish, amphibians and reptiles. For ecological and commercial reasons, considerable attention has been drawn to the increasing prevalence of ranaviral infections of wild populations and in aquacultural settings. Importantly, RVs appear to be capable of crossing species barriers of numerous poikilotherms, suggesting that these pathogens possess a broad host range and potent immune evasion mechanisms. Indeed, while some of the 95-100 predicted ranavirus genes encode putative evasion proteins (e.g., vIFα, vCARD), roughly two-thirds of them do not share significant sequence identity with known viral or eukaryotic genes. Accordingly, the investigation of ranaviral virulence and immune evasion strategies is promising for elucidating potential antiviral targets. In this regard, recombination-based technologies are being employed to knock out gene candidates in the best-characterized RV member, Frog Virus (FV3). Concurrently, by using animal infection models with extensively characterized immune systems, such as the African clawed frog, Xenopus laevis, it is becoming evident that components of innate immunity are at the forefront of virus-host interactions. For example, cells of the macrophage lineage represent important combatants of RV infections while themselves serving as targets for viral infection, maintenance and possibly dissemination. This review focuses on the recent advances in the understanding of the RV immune evasion strategies with emphasis on the roles of the innate immune system in ranaviral infections.

  20. Intestinal bacteria and the regulation of immune cell homeostasis.

    Science.gov (United States)

    Hill, David A; Artis, David

    2010-01-01

    The human intestine is colonized by an estimated 100 trillion bacteria. Some of these bacteria are essential for normal physiology, whereas others have been implicated in the pathogenesis of multiple inflammatory diseases including IBD and asthma. This review examines the influence of signals from intestinal bacteria on the homeostasis of the mammalian immune system in the context of health and disease. We review the bacterial composition of the mammalian intestine, known bacterial-derived immunoregulatory molecules, and the mammalian innate immune receptors that recognize them. We discuss the influence of bacterial-derived signals on immune cell function and the mechanisms by which these signals modulate the development and progression of inflammatory disease. We conclude with an examination of successes and future challenges in using bacterial communities or their products in the prevention or treatment of human disease.

  1. β-Glucan Size Controls Dectin-1-Mediated Immune Responses in Human Dendritic Cells by Regulating IL-1β Production

    Directory of Open Access Journals (Sweden)

    Matthew J. Elder

    2017-07-01

    Full Text Available Dectin-1/CLEC7A is a pattern recognition receptor that recognizes β-1,3 glucans, and its stimulation initiates signaling events characterized by the production of inflammatory cytokines from human dendritic cells (DCs required for antifungal immunity. β-glucans differ greatly in size, structure, and ability to activate effector immune responses from DC; as such, small particulate β-glucans are thought to be poor activators of innate immunity. We show that β-glucan particle size is a critical factor contributing to the secretion of cytokines from human DC; large β-glucan-stimulated DC generate significantly more IL-1β, IL-6, and IL-23 compared to those stimulated with the smaller β-glucans. In marked contrast, the secretion of TSLP and CCL22 were found to be insensitive to β-glucan particle size. Furthermore, we show that the capacity to induce phagocytosis, and the relative IL-1β production determined by β-glucan size, regulates the composition of the cytokine milieu generated from DC. This suggests that β-glucan particle size is critically important in orchestrating the nature of the immune response to fungi.

  2. Regulation of Innate Lymphoid Cells by Aryl Hydrocarbon Receptor

    Science.gov (United States)

    Li, Shiyang; Bostick, John W.; Zhou, Liang

    2018-01-01

    With striking similarity to their adaptive T helper cell counterparts, innate lymphoid cells (ILCs) represent an emerging family of cell types that express signature transcription factors, including T-bet+ Eomes+ natural killer cells, T-bet+ Eomes− group 1 ILCs, GATA3+ group 2 ILCs, RORγt+ group 3 ILCs, and newly identified Id3+ regulatory ILC. ILCs are abundantly present in barrier tissues of the host (e.g., the lung, gut, and skin) at the interface of host–environment interactions. Active research has been conducted to elucidate molecular mechanisms underlying the development and function of ILCs. The aryl hydrocarbon receptor (Ahr) is a ligand-dependent transcription factor, best known to mediate the effects of xenobiotic environmental toxins and endogenous microbial and dietary metabolites. Here, we review recent progresses regarding Ahr function in ILCs. We focus on the Ahr-mediated cross talk between ILCs and other immune/non-immune cells in host tissues especially in the gut. We discuss the molecular mechanisms of the action of Ahr expression and activity in regulation of ILCs in immunity and inflammation, and the interaction between Ahr and other pathways/transcription factors in ILC development and function with their implication in disease. PMID:29354125

  3. Genetic association analyses implicate aberrant regulation of innate and adaptive immunity genes in the pathogenesis of systemic lupus erythematosus

    Science.gov (United States)

    Graham, Deborah S Cunninghame; Pinder, Christopher L; Tombleson, Philip; Behrens, Timothy W; Martín, Javier; Fairfax, Benjamin P; Knight, Julian C; Chen, Lingyan; Replogle, Joseph; Syvänen, Ann-Christine; Rönnblom, Lars; Graham, Robert R; Wither, Joan E; Rioux, John D; Alarcón-Riquelme, Marta E; Vyse, Timothy J

    2015-01-01

    Systemic lupus erythematosus (SLE; OMIM 152700) is a genetically complex autoimmune disease characterized by loss of immune tolerance to nuclear and cell surface antigens. Previous genome-wide association studies (GWAS) had modest sample sizes, reducing their scope and reliability. Our study comprised 7,219 cases and 15,991 controls of European ancestry: a new GWAS, meta-analysis with a published GWAS and a replication study. We have mapped 43 susceptibility loci, including 10 novel associations. Assisted by dense genome coverage, imputation provided evidence for missense variants underpinning associations in eight genes. Other likely causal genes were established by examining associated alleles for cis-acting eQTL effects in a range of ex vivo immune cells. We found an over-representation (n=16) of transcription factors among SLE susceptibility genes. This supports the view that aberrantly regulated gene expression networks in multiple cell types in both the innate and adaptive immune response contribute to the risk of developing SLE. PMID:26502338

  4. Semaphorin7A and its receptors: pleiotropic regulators of immune cell function, bone homeostasis, and neural development.

    Science.gov (United States)

    Jongbloets, Bart C; Ramakers, Geert M J; Pasterkamp, R Jeroen

    2013-03-01

    Semaphorins form a large, evolutionary conserved family of cellular guidance signals. The semaphorin family contains several secreted and transmembrane proteins, but only one GPI-anchored member, Semaphorin7A (Sema7A). Although originally identified in immune cells, as CDw108, Sema7A displays widespread expression outside the immune system. It is therefore not surprising that accumulating evidence supports roles for this protein in a wide variety of biological processes in different organ systems and in disease. Well-characterized biological effects of Sema7A include those during bone and immune cell regulation, neuron migration and neurite growth. These effects are mediated by two receptors, plexinC1 and integrins. However, most of what is known today about Sema7A signaling concerns Sema7A-integrin interactions. Here, we review our current knowledge of Sema7A function and signaling in different organ systems, highlighting commonalities between the cellular effects and signaling pathways activated by Sema7A in different cell types. Furthermore, we discuss a potential role for Sema7A in disease and provide directions for further research. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. MicroRNA-147b regulates vascular endothelial barrier function by targeting ADAM15 expression.

    Directory of Open Access Journals (Sweden)

    Victor Chatterjee

    Full Text Available A disintegrin and metalloproteinase15 (ADAM15 has been shown to be upregulated and mediate endothelial hyperpermeability during inflammation and sepsis. This molecule contains multiple functional domains with the ability to modulate diverse cellular processes including cell adhesion, extracellular matrix degradation, and ectodomain shedding of transmembrane proteins. These characteristics make ADAM15 an attractive therapeutic target in various diseases. The lack of pharmacological inhibitors specific to ADAM15 prompted our efforts to identify biological or molecular tools to alter its expression for further studying its function and therapeutic implications. The goal of this study was to determine if ADAM15-targeting microRNAs altered ADAM15-induced endothelial barrier dysfunction during septic challenge by bacterial lipopolysaccharide (LPS. An in silico analysis followed by luciferase reporter assay in human vascular endothelial cells identified miR-147b with the ability to target the 3' UTR of ADAM15. Transfection with a miR-147b mimic led to decreased total, as well as cell surface expression of ADAM15 in endothelial cells, while miR-147b antagomir produced an opposite effect. Functionally, LPS-induced endothelial barrier dysfunction, evidenced by a reduction in transendothelial electric resistance and increase in albumin flux across endothelial monolayers, was attenuated in cells treated with miR-147b mimics. In contrast, miR-147b antagomir exerted a permeability-increasing effect in vascular endothelial cells similar to that caused by LPS. Taken together, these data suggest the potential role of miR147b in regulating endothelial barrier function by targeting ADAM15 expression.

  6. Immune inhibitory receptors in viral infection and cancer

    NARCIS (Netherlands)

    Karnam, G.

    2014-01-01

    We are protected from external and internal dangers by our immune system. Immune responses need to be balanced to prevent uncontrolled inflammation and/or autoimmunity. Cell growth inhibition, apoptosis, and down regulation of receptor signals are all part of the inhibitory tools used by the immune

  7. TAM Receptor Signaling in Immune Homeostasis

    Science.gov (United States)

    Rothlin, Carla V.; Carrera-Silva, Eugenio A.; Bosurgi, Lidia; Ghosh, Sourav

    2015-01-01

    The TAM receptor tyrosine kinases (RTKs)—TYRO3, AXL, and MERTK—together with their cognate agonists GAS6 and PROS1 play an essential role in the resolution of inflammation. Deficiencies in TAM signaling have been associated with chronic inflammatory and autoimmune diseases. Three processes regulated by TAM signaling may contribute, either independently or collectively, to immune homeostasis: the negative regulation of the innate immune response, the phagocytosis of apoptotic cells, and the restoration of vascular integrity. Recent studies have also revealed the function of TAMs in infectious diseases and cancer. Here, we review the important milestones in the discovery of these RTKs and their ligands and the studies that underscore the functional importance of this signaling pathway in physiological immune settings and disease. PMID:25594431

  8. Epicutaneous Immunization with Type II Collagen Inhibits both Onset and Progression of Chronic Collagen-Induced Arthritis

    OpenAIRE

    Strid, Jessica; Tan, Lee Aun; Strobel, Stephan; Londei, Marco; Callard, Robin

    2007-01-01

    Epicutaneous immunization is a potential non-invasive technique for antigen-specific immune-modulation. Topical application of protein antigens to barrier-disrupted skin induces potent antigen-specific immunity with a strong Th2-bias. In this study, we investigate whether the autoimmune inflammatory response of chronic collagen-induced arthritis (CCIA) in DBA/1-TCR-beta Tg mice can be modified by epicutaneous immunization. We show that epicutaneous immunization with type II collagen (CII) inh...

  9. Differences in innate immune response gene regulation in the middle ear of children who are otitis prone and in those not otitis prone

    Science.gov (United States)

    Casey, Janet; Pichichero, Michael

    2016-01-01

    Objective: Acute otitis media (AOM) causes an inflammatory response in the middle ear. We assessed differences in innate immune responses involved in bacterial defense at onset of AOM in children who were stringently defined as otitis prone (sOP) and children not otitis prone (NOP). Study Design: Innate immune genes analysis from middle ear fluid (MEF) samples of children. Methods: Genes of toll-like receptors (TLR), nod-like and retinoic acid-inducible gene-I-like receptors, downstream effectors important for inflammation and apoptosis, including cytokines and chemokines, were studied from MEF samples by using a real-time polymerase chain reaction array. Protein levels of differentially regulated genes were measured by Luminex. Results: Gene expression in MEF among children who were sOP was significantly different in upregulation of interleukin 8, secretory leukocyte peptidase inhibitor, and chemokine (C-C motif) ligand 3, and in downregulation of interferon regulatory factor 7 and its related signaling molecules interferon alpha, Toll-like receptor adaptor molecule 2, chemokine (C-C motif) ligand 5, and mitogen-activated protein kinase 8 compared with children who were NOP. Differences in innate gene regulation were similar when AOM was caused by Streptococcus pneumoniae or nontypeable Haemophilus influenzae. Conclusion: Innate-immune response genes are differentially regulated in children who were sOP compared with children with NOP. PMID:28124644

  10. The Role of MicroRNAs in Bovine Infection and Immunity

    Directory of Open Access Journals (Sweden)

    Nathan eLawless

    2014-11-01

    Full Text Available MicroRNAs (miRNAs are a class of small, non-coding RNAs that are recognised as critical regulators of immune gene expression during infection. Many immunologically significant human miRNAs have been found to be conserved in agriculturally important species, including cattle. Discovering how bovine miRNAs mediate the immune defence during infection is critical to understanding the aetiology of the most prevalent bovine diseases. Here, we review current knowledge of miRNAs in the bovine genome, and discuss the advances in understanding of miRNAs as regulators of immune cell function, and bovine immune response activation, regulation, and resolution. Finally, we consider the future perspectives on miRNAs in bovine viral disease, their role as potential biomarkers and in therapy.

  11. [The role of the innate immune system in atopic dermatitis].

    Science.gov (United States)

    Volz, T; Kaesler, S; Skabytska, Y; Biedermann, T

    2015-02-01

    The mechanisms how the innate immune system detects microbes and mounts a rapid immune response have been more and more elucidated in the past years. Subsequently it has been shown that innate immunity also shapes adaptive immune responses and determines their quality that can be either inflammatory or tolerogenic. As atopic dermatitis is characterized by disturbances of innate and adaptive immune responses, colonization with pathogens and defects in skin barrier function, insight into mechanisms of innate immunity has helped to understand the vicious circle of ongoing skin inflammation seen in atopic dermatitis patients. Elucidating general mechanisms of the innate immune system and its functions in atopic dermatitis paves the way for developing new therapies. Especially the novel insights into the human microbiome and potential functional consequences make the innate immune system a very fundamental and promising target. As a result atopic dermatitis manifestations can be attenuated or even resolved. These currently developed strategies will be introduced in the current review.

  12. Cysteine-dependent immune regulation by TRX and MIF/GIF family proteins.

    Science.gov (United States)

    Kondo, Norihiko; Ishii, Yasuyuki; Son, Aoi; Sakakura-Nishiyama, Junko; Kwon, Yong-Won; Tanito, Masaki; Nishinaka, Yumiko; Matsuo, Yoshiyuki; Nakayama, Toshinori; Taniguchi, Masaru; Yodoi, Junji

    2004-03-29

    Thioredoxin (TRX) superfamily proteins that contain a conserved redox-active site -Cys-Xa.a.-Xa.a.-Cys- includes proinflammatory cytokine, macrophage migration inhibiting factor (MIF) and the immune regulatory cytokine, glycosylation inhibiting factor (GIF) in which Cys-60 is cysteinylated. In this report, we have analyzed the functional interaction between TRX and MIF/GIF. The stable Jurkat T cell line transfected with human TRX gene (TRX-transfectant) was highly resistant to hydrogen peroxide-induced apoptosis, but not the cell line transfected with vector (mock-transfectant). The expression level of MIF/GIF protein of TRX-transfectant was lower than that of mock-transfectant. Conversely, the expression level of intracellular TRX protein in CD4(+)-T cells derived from MIF -/- mice were significantly higher than that from background BALB/c mice. These findings collectively suggest that oxidative stress-induced apoptosis on T lymphocytes might be protected by the reciprocal regulation of TRX and MIF/GIF expression.

  13. A novel role for inhibitor of apoptosis (IAP) proteins as regulators of endothelial barrier function by mediating RhoA activation.

    Science.gov (United States)

    Hornburger, Michael C; Mayer, Bettina A; Leonhardt, Stefanie; Willer, Elisabeth A; Zahler, Stefan; Beyerle, Andrea; Rajalingam, Krishnaraj; Vollmar, Angelika M; Fürst, Robert

    2014-04-01

    Inhibitor of apoptosis (IAP) proteins, such as XIAP or cIAP1/2, are important regulators of apoptosis in cancer cells, and IAP antagonists are currently evaluated as antitumor agents. Beyond their function in cancer cells, this study demonstrates a novel role of IAPs as regulators of vascular endothelial permeability. Two structurally different IAP antagonists, ABT and Smac085, as well as silencing of IAPs, reduced the thrombin receptor-activating peptide (TRAP)-induced barrier dysfunction in human endothelial cells as assessed by measuring macromolecular permeability or transendothelial electrical resistance. ABT diminished thrombin-evoked stress fiber formation, activation of myosin light chain 2, and disassembly of adherens junctions independent of calcium signaling, protein kinase C, and mitogen-activated protein kinases. Interestingly, ABT and silencing of IAPs, in particular XIAP, reduced the TRAP-evoked RhoA activation, whereas Rac1 was not affected. XIAP and, to a lesser extent, cIAP1 were found to directly interact with RhoA independently of the RhoA activation status. Under cell-free conditions, XIAP did not induce an ubiquitination of RhoA. In summary, our work discloses IAPs as crucial regulators of endothelial permeability and suggests IAP inhibition as interesting approach for the prevention of endothelial barrier dysfunction.

  14. Breaking down the barriers: the gut microbiome, intestinal permeability and stress-related psychiatric disorders

    Science.gov (United States)

    Kelly, John R.; Kennedy, Paul J.; Cryan, John F.; Dinan, Timothy G.; Clarke, Gerard; Hyland, Niall P.

    2015-01-01

    The emerging links between our gut microbiome and the central nervous system (CNS) are regarded as a paradigm shift in neuroscience with possible implications for not only understanding the pathophysiology of stress-related psychiatric disorders, but also their treatment. Thus the gut microbiome and its influence on host barrier function is positioned to be a critical node within the brain-gut axis. Mounting preclinical evidence broadly suggests that the gut microbiota can modulate brain development, function and behavior by immune, endocrine and neural pathways of the brain-gut-microbiota axis. Detailed mechanistic insights explaining these specific interactions are currently underdeveloped. However, the concept that a “leaky gut” may facilitate communication between the microbiota and these key signaling pathways has gained traction. Deficits in intestinal permeability may underpin the chronic low-grade inflammation observed in disorders such as depression and the gut microbiome plays a critical role in regulating intestinal permeability. In this review we will discuss the possible role played by the gut microbiota in maintaining intestinal barrier function and the CNS consequences when it becomes disrupted. We will draw on both clinical and preclinical evidence to support this concept as well as the key features of the gut microbiota which are necessary for normal intestinal barrier function. PMID:26528128

  15. Kidney and innate immunity.

    Science.gov (United States)

    Wang, Ying-Hui; Zhang, Yu-Gen

    2017-03-01

    Innate immune system is an important modulator of the inflammatory response during infection and tissue injury/repair. The kidney as a vital organ with high energy demand plays a key role in regulating the disease related metabolic process. Increasing research interest has focused on the immune pathogenesis of many kidney diseases. However, innate immune cells such as dendritic cells, macrophages, NK cells and a few innate lymphocytes, as well as the complement system are essential for renal immune homeostasis and ensure a coordinated balance between tissue injury and regeneration. The innate immune response provides the first line of host defense initiated by several classes of pattern recognition receptors (PRRs), such as membrane-bound Toll-like receptors (TLRs) and nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs), together with inflammasomes responsible for early innate immune response. Although the innate immune system is well studied, the research on the detailed relationship between innate immunity and kidney is still very limited. In this review, we will focus on the innate immune sensing system in renal immune homeostasis, as well as the corresponding pathogenesis of many kidney diseases. The pivotal roles of innate immunity in renal injury and regeneration with special emphasis on kidney disease related immunoregulatory mechanism are also discussed. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  16. Meningeal mast cells affect early T cell central nervous system infiltration and blood-brain barrier integrity through TNF: a role for neutrophil recruitment?

    Science.gov (United States)

    Sayed, Blayne A; Christy, Alison L; Walker, Margaret E; Brown, Melissa A

    2010-06-15

    Mast cells contribute to the pathogenesis of experimental autoimmune encephalomyelitis, a rodent model of the human demyelinating disease multiple sclerosis. Yet their site and mode of action is unknown. In both diseases, myelin-specific T cells are initially activated in peripheral lymphoid organs. However, for disease to occur, these cells must enter the immunologically privileged CNS through a breach in the relatively impermeable blood-brain barrier. In this study, we demonstrate that a dense population of resident mast cells in the meninges, structures surrounding the brain and spinal cord, regulate basal CNS barrier function, facilitating initial T cell CNS entry. Through the expression of TNF, mast cells recruit an early wave of neutrophils to the CNS. We propose that neutrophils in turn promote the blood-brain barrier breach and together with T cells lead to further inflammatory cell influx and myelin damage. These findings provide specific targets for intervention in multiple sclerosis as well as other immune-mediated CNS diseases.

  17. Down regulation of the TCR complex CD3 ζ-chain on CD3+ T cells: a potential mechanism for helminth mediated immune modulation

    Directory of Open Access Journals (Sweden)

    Laura Jane Appleby

    2015-02-01

    Full Text Available The CD3ζ forms part of the T cell receptor (TCR where it plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways leading to T cell effector functions. Down regulation of CD3ζ leads to impairment of immune responses including reduced cell proliferation and cytokine production. In experimental models helminth parasites have been shown to modulate immune responses directed against them and unrelated antigens, so called bystander antigens, but there is a lack of studies validating these observations in humans. This study focused on investigated the relationship between expression levels of the TCR CD3ζ chain with lymphocyte cell proliferation during human infection with the helminth parasite, Schistosoma haematobium which causes uro-genital schistosomiasis. Using flow cytometry, peripheral blood mononuclear cells (PBMCs from individuals naturally exposed to S. haematobium in rural Zimbabwe were phenotyped, and expression levels of CD3ζ on T cells were related to intensity of infection. In this population, parasite infection intensity was inversely related to CD3ζ expression levels (p<0.05, consistent with down-regulation of CD3ζ expression during helminth infection. Furthermore, PBMC proliferation was positively related to expression levels of CD3ζ (p<0.05 after allowing for confounding variables (host age, sex, infection level. CD3ζ expression levels had a differing relationship between immune correlates of susceptibility and immunity, measured by antibody responses, indicating a complex relationship between immune activation status and immunity. The relationships between the CD3ζ chain of the TCR and schistosome infection, PBMC proliferation and schistosome-specific antibody responses have not previously been reported, and these results may indicate a mechanism for the impaired T cell proliferative responses observed during human schistosome infection.

  18. Activating Transcription Factor 3 Regulates Immune and Metabolic Homeostasis

    Science.gov (United States)

    Rynes, Jan; Donohoe, Colin D.; Frommolt, Peter; Brodesser, Susanne; Jindra, Marek

    2012-01-01

    Integration of metabolic and immune responses during animal development ensures energy balance, permitting both growth and defense. Disturbed homeostasis causes organ failure, growth retardation, and metabolic disorders. Here, we show that the Drosophila melanogaster activating transcription factor 3 (Atf3) safeguards metabolic and immune system homeostasis. Loss of Atf3 results in chronic inflammation and starvation responses mounted primarily by the larval gut epithelium, while the fat body suffers lipid overload, causing energy imbalance and death. Hyperactive proinflammatory and stress signaling through NF-κB/Relish, Jun N-terminal kinase, and FOXO in atf3 mutants deregulates genes important for immune defense, digestion, and lipid metabolism. Reducing the dose of either FOXO or Relish normalizes both lipid metabolism and gene expression in atf3 mutants. The function of Atf3 is conserved, as human ATF3 averts some of the Drosophila mutant phenotypes, improving their survival. The single Drosophila Atf3 may incorporate the diversified roles of two related mammalian proteins. PMID:22851689

  19. Activating transcription factor 3 regulates immune and metabolic homeostasis.

    Science.gov (United States)

    Rynes, Jan; Donohoe, Colin D; Frommolt, Peter; Brodesser, Susanne; Jindra, Marek; Uhlirova, Mirka

    2012-10-01

    Integration of metabolic and immune responses during animal development ensures energy balance, permitting both growth and defense. Disturbed homeostasis causes organ failure, growth retardation, and metabolic disorders. Here, we show that the Drosophila melanogaster activating transcription factor 3 (Atf3) safeguards metabolic and immune system homeostasis. Loss of Atf3 results in chronic inflammation and starvation responses mounted primarily by the larval gut epithelium, while the fat body suffers lipid overload, causing energy imbalance and death. Hyperactive proinflammatory and stress signaling through NF-κB/Relish, Jun N-terminal kinase, and FOXO in atf3 mutants deregulates genes important for immune defense, digestion, and lipid metabolism. Reducing the dose of either FOXO or Relish normalizes both lipid metabolism and gene expression in atf3 mutants. The function of Atf3 is conserved, as human ATF3 averts some of the Drosophila mutant phenotypes, improving their survival. The single Drosophila Atf3 may incorporate the diversified roles of two related mammalian proteins.

  20. Research progress in neuro-immune interactions in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Jin-ling CAI

    2012-09-01

    Full Text Available The innate immune response may be activated quickly once the organism is invaded by exotic pathogens. An excessive immune response may result in inflammation and tissue damage, whereas an insufficient immune response may result in infection. Nervous system may regulate the intensity of innate immune responses by releasing neurotransmitters, neuropeptides and hormones. Compared with the complicated neuro-immune system in mammals, it is much simpler in Caenorhabditis elegans. Besides, C. elegans is accessible to genetic, molecular biology and behavioral analyses, so it has been used in studies on neuro-immune interactions. It has been revealed recently in the studies with C. elegans that the neuronal pathways regulating innate immune responses primarily include a transforming growth factor-β (TGF-β pathway, an insulin/insulin-like growth factor receptor (IGF pathway and dopaminergic neurotransmission. Since these pathways are evolutionally conservative, so it might be able to provide some new ideas for the research on neuro-immune interactions at molecular levels. The recent progress in this field has been reviewed in present paper.

  1. The role of CD103+ Dendritic cells in the intestinal mucosal immune system.

    Directory of Open Access Journals (Sweden)

    Darren Thomas Ruane

    2011-07-01

    Full Text Available While dendritic cells (DC are central to the induction and regulation of adaptive immunity, these cells are very heterogenous and specific subsets can be characterized based on the expression of cell surface markers and functional properties. Intestinal CD103+ DCs are the subject of particular interest due to their role in regulating mucosal immunity. Since the epithelial surfaces are constantly exposed to a high antigenic load, tight regulation of innate and adaptive intestinal immune responses is vital as intestinal inflammation can have detrimental consequences for the host. Strategically positioned within the lamina propria, CD103+ DCs play an important role in maintaining intestinal immune homeostasis. These cells are required for the induction of tolerogenic immune responses and imprinting gut homing phenotypic changes on antigen-specific T cells. Recent insights into their development and regulatory properties have revealed additional immunoregulatory roles and further highlighted their importance for intestinal immunity. In this review we discuss the nature of the intestinal CD103+ DC population and the emerging roles of these cells in the regulation of mucosal immunity.

  2. Defence mechanisms and immune evasion in the interplay between the humane immune system and Plasmodium falciparum

    DEFF Research Database (Denmark)

    Theander, T G

    1992-01-01

    Immunity to P. falciparum malaria is developed as a result of long term exposure to the parasite and depends on immunological memory. The key directors in immune recognition and regulation of the immunological responses are the T-cells. It seems reasonable to propose that immunity is acquired when...... with development of immunity. Several mechanisms seem to be operating. 1) Induction of the immune response to some macromolecules is avoided because the parasites are living inside host cells during part of their life cycle, and the reaction to other molecules is apparently avoided by mimicry of host molecules. 2...

  3. Macrophage-derived insulin-like growth factor-1 affects influenza vaccine efficacy through the regulation of immune cell homeostasis.

    Science.gov (United States)

    Yoon, Il-Sub; Park, Hyelim; Kwak, Hye-Won; Woo Jung, Yong; Nam, Jae-Hwan

    2017-08-24

    The level of antibody production induced by a vaccine involves a variety of host factors. One of these, insulin-like growth factor-1 (IGF-1), plays an important role in lymphocyte maturation and antibody expression. Here, we investigated the role of macrophage-derived IGF-1 in the induction of influenza vaccine-specific antibodies using macrophage-derived IGF-1 gene knockout (MIKO) mice. The titers of vaccine-specific total immunoglobulin G (IgG) and IgG1 after immunization were about two- to fourfold lower in MIKO mice than in WT mice. Moreover, MIKO mice showed a relatively weak booster effect of repeated immunization. In contrast, antigen-nonspecific total IgG was about threefold higher in MIKO mice than in WT mice. After viral challenge, the viral titer and the pathological damage in lungs of MIKO mice were higher than those in WT mice despite vaccination. Interestingly, the proportions of proinflammatory immune cells including M1 macrophages, Th1 and Th17 cells was higher in unvaccinated MIKO mice than in unvaccinated WT mice. This suggests that nonspecific activation of immune cells may paradoxically impair the response to the vaccine. In addition, although the proportions of T follicular helper (Tfh) cells and GL-7 + germinal center (GC) B cells were higher in MIKO mice than in WT mice, the population of CD138 + B220 + antibody-secreting plasmablasts was lower in MIKO mice, which may be a cause of the low influenza-specific antibody titer in MIKO mice. Taken together, these results suggest that macrophage-derived IGF-1 might play an important role in the vaccine-triggered immune response by regulating immune cell homeostasis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Immune regulation in T1D and T2D: prospective role of Foxp3+ Treg cells in disease pathogenesis and treatment

    Directory of Open Access Journals (Sweden)

    Mara eKornete

    2013-06-01

    Full Text Available There is increasing evidence that dysregulated immune responses play key roles in the pathogenesis and complications of type 1 but also type 2 diabetes. Indeed, chronic inflammation and autoimmunity, which are salient features of type 1 diabetes, are now believed to actively contribute to the pathogenesis of type 2 diabetes. The accumulation of activated innate and adaptive immune cells in various metabolic tissues results in the release of inflammatory mediators, which promote insulin resistance and β-cell damage. Moreover, these dysregulated immune responses can also mutually influence the prevalence of both type 1 and 2 diabetes. In this review article, we discuss the central role of immune responses in the patho-physiology and complications of type 1 and 2 diabetes, and provide evidence that regulation of these responses, particularly through the action of regulatory T cells, may be a possible therapeutic avenue for the treatment of these disease and their respective complications.

  5. Incomplete immune recovery in HIV infection

    DEFF Research Database (Denmark)

    Gaardbo, Julie C; Hartling, Hans J; Gerstoft, Jan

    2012-01-01

    -infected patients do not achieve optimal immune reconstitution despite suppression of viral replication. These patients are referred to as immunological nonresponders (INRs). INRs present with severely altered immunological functions, including malfunction and diminished production of cells within lymphopoetic...... tissue, perturbed frequencies of immune regulators such as regulatory T cells and Th17 cells, and increased immune activation, immunosenescence, and apoptosis. Importantly, INRs have an increased risk of morbidity and mortality compared to HIV-infected patients with an optimal immune reconstitution....... Additional treatment to HAART that may improve immune reconstitution has been investigated, but results thus far have proved disappointing. The reason for immunological nonresponse is incompletely understood. This paper summarizes the known and unknown factors regarding the incomplete immune reconstitution...

  6. Roles of Mucosal Immunity against Mycobacterium tuberculosis Infection

    Directory of Open Access Journals (Sweden)

    Wu Li

    2012-01-01

    Full Text Available Mycobacterium tuberculosis (Mtb, the causative agent of tuberculosis (TB, is one of the world's leading infectious causes of morbidity and mortality. As a mucosal-transmitted pathogen, Mtb infects humans and animals mainly through the mucosal tissue of the respiratory tract. Apart from providing a physical barrier against the invasion of pathogen, the major function of the respiratory mucosa may be to serve as the inductive sites to initiate mucosal immune responses and sequentially provide the first line of defense for the host to defend against this pathogen. A large body of studies in the animals and humans have demonstrated that the mucosal immune system, rather than the systemic immune system, plays fundamental roles in the host’s defense against Mtb infection. Therefore, the development of new vaccines and novel delivery routes capable of directly inducing respiratory mucosal immunity is emphasized for achieving enhanced protection from Mtb infection. In this paper, we outline the current state of knowledge regarding the mucosal immunity against Mtb infection, including the development of TB vaccines, and respiratory delivery routes to enhance mucosal immunity are discussed.

  7. Trichomoniasis immunity and the involvement of the purinergic signaling

    Directory of Open Access Journals (Sweden)

    Camila Braz Menezes

    2016-08-01

    Full Text Available Innate and adaptive immunity play a significant role in trichomoniasis, the most common non-viral sexually transmitted disease worldwide. In the urogenital tract, innate immunity is accomplished by a defense physical barrier constituted by epithelial cells, mucus, and acidic pH. During infection, immune cells, antimicrobial peptides, cytokines, chemokines, and adaptive immunity evolve in the reproductive tract, and a proinflammatory response is generated to eliminate the invading extracellular pathogen Trichomonas vaginalis. However, the parasite has developed complex evolutionary mechanisms to evade the host immune response through cysteine proteases, phenotypic variation, and molecular mimicry. The purinergic system constitutes a signaling cellular net where nucleotides and nucleosides, enzymes, purinoceptors and transporters are involved in almost all cells and tissues signaling pathways, especially in central and autonomic nervous systems, endocrine, respiratory, cardiac, reproductive, and immune systems, during physiological as well as pathological processes. The involvement of the purinergic system in T. vaginalis biology and infection has been demonstrated and this review highlights the participation of this signaling pathway in the parasite immune evasion strategies. Keywords: Trichomoniasis, Innate immune response, Adaptive immune response, Evasion mechanisms, Purinergic signaling

  8. Organizational culture influences health care workers' influenza immunization behavior.

    Science.gov (United States)

    Isaacson, Nicole; Roemheld-Hamm, Beatrix; Crosson, Jesse C; Dicicco-Bloom, Barbara; Winston, Carla A

    2009-03-01

    Low rates of influenza immunization among health care workers (HCWs) pose a potential health risk to patients in primary care practices. Despite previous educational efforts and programs to reduce financial barriers, HCW influenza immunization rates remain low. Variation in practice-level organizational culture may affect immunization rates. To explore this relationship, we examined organizational cultures and HCWs' influenza immunization behaviors in three family medicine practices. We used a multi-method comparative case study. A field researcher used participant observation, in-depth interviews, and key informant interviews to collect data in each practice in November-December 2003. A diverse team used grounded theory to analyze text data. Organizational culture varied among practices and differing HCW immunization rates were observed. The most structured and business-like practice achieved immunization of all HCWs, while the other two practices exhibited greater variation in HCW immunization rates. Physicians in the practices characterized as chaotic/disorganized or divided were immunized at higher rates than other members of the practices. In these practices, organizational culture was associated with varying rates of influenza immunization for HCWs, especially among nonphysicians. Addressing elements of organizational culture such as beliefs regarding influenza immunization and office policies may facilitate the immunization of all staff members.

  9. Immune responses to metastases

    International Nuclear Information System (INIS)

    Herberman, R.B.; Wiltrout, R.H.; Gorelik, E.

    1987-01-01

    The authors present the changes in the immune system in tumor-bearing hosts that may influence the development of progression of metastases. Included are mononuclear cell infiltration of metastases; alterations in natural resistance mediated by natural killer cells and macrophages; development of specific immunity mediated by T-lymphocytes or antibodies; modulation of tumor-associated antigen expression; and the down-regulation of the immune response to the tumor by several suppressor mechanisms; the augmentation of the immune response and its potential for therapeutic application; includes the prophylaxis of metastases formation by NK cells; the therapy of metastases by augmentation NK-, macrophage-, or T-lymphocyte-mediated responses by biological response modifiers; and the transfer of anticancer activity by cytoxic T-lymphocytes or immunoconjugates of monoclonal antibodies with specificity for tumors

  10. The Arabidopsis Cysteine-Rich Receptor-Like Kinase CRK36 Regulates Immunity through Interaction with the Cytoplasmic Kinase BIK1

    Directory of Open Access Journals (Sweden)

    Dong Sook Lee

    2017-10-01

    Full Text Available Receptor-like kinases are important signaling components that regulate a variety of cellular processes. In this study, an Arabidopsis cDNA microarray analysis led to the identification of the cysteine-rich receptor-like kinase CRK36 responsive to the necrotrophic fungal pathogen, Alternaria brassicicola. To determine the function of CRK36 in plant immunity, T-DNA-insertion knockdown (crk36 and overexpressing (CRK36OE plants were prepared. CRK36OE plants exhibited increased hypersensitive cell death and ROS burst in response to avirulent pathogens. Treatment with a typical pathogen-associated molecular pattern, flg22, markedly induced pattern-triggered immune responses, notably stomatal defense, in CRK36OE plants. The immune responses were weakened in crk36 plants. Protein-protein interaction assays revealed the in vivo association of CRK36, FLS2, and BIK1. CRK36 enhanced flg22-triggered BIK1 phosphorylation, which showed defects with Cys mutations in the DUF26 motifs of CRK36. Disruption of BIK1 and RbohD/RbohF genes further impaired CRK36-mediated stomatal defense. We propose that CRK36, together with BIK1 and NADPH oxidases, may form a positive activation loop that enhances ROS burst and leads to the promotion of stomatal immunity.

  11. A Quantitative RNAi Screen for JNK Modifiers Identifies Pvr as a Novel Regulator of Drosophila Immune Signaling

    Science.gov (United States)

    Bond, David; Foley, Edan

    2009-01-01

    Drosophila melanogaster responds to gram-negative bacterial challenges through the IMD pathway, a signal transduction cassette that is driven by the coordinated activities of JNK, NF-κB and caspase modules. While many modifiers of NF-κB activity were identified in cell culture and in vivo assays, the regulatory apparatus that determines JNK inputs into the IMD pathway is relatively unexplored. In this manuscript, we present the first quantitative screen of the entire genome of Drosophila for novel regulators of JNK activity in the IMD pathway. We identified a large number of gene products that negatively or positively impact on JNK activation in the IMD pathway. In particular, we identified the Pvr receptor tyrosine kinase as a potent inhibitor of JNK activation. In a series of in vivo and cell culture assays, we demonstrated that activation of the IMD pathway drives JNK-dependent expression of the Pvr ligands, Pvf2 and Pvf3, which in turn act through the Pvr/ERK MAP kinase pathway to attenuate the JNK and NF-κB arms of the IMD pathway. Our data illuminate a poorly understood arm of a critical and evolutionarily conserved innate immune response. Furthermore, given the pleiotropic involvement of JNK in eukaryotic cell biology, we believe that many of the novel regulators identified in this screen are of interest beyond immune signaling. PMID:19893628

  12. Expression and potential roles of IL-33/ST2 in the immune regulation during Clonorchis sinensis infection.

    Science.gov (United States)

    Yu, Qian; Li, Xiang-Yang; Cheng, Xiao-Dan; Shen, Li-Ping; Fang, Fan; Zhang, Bo; Hua, Hui; Yan, Chao; Tang, Ren-Xian; Zheng, Kui-Yang

    2016-06-01

    During clonorchiasis, immune responses of hosts are responsible for the removal of the worms and also are involved in the progress of the pathological damage caused by Clonorchis sinensis. Interleukin-33 (IL-33), a recently described cytokine signaling through the ST2 receptor, has emerged as a potent inducer to bile duct proliferation and fibrosis; however, little is known of this signaling in the pathogen-caused periductal inflammation and fibrosis. In the present study, using immunohistochemistry, real-time PCR, enzyme-linked immunosorbent assay (ELISA), and flow cytometry, we studied the expression of IL-33/ST2 during C. sinensis infection, as well as their potential roles in C. sinensis-induced host immune responses. The results showed that a higher level of IL-33 was detected in the sera of patients of clonorchiasis (n = 45), compared with in those of healthy donors (n = 16). Similarly, in FVB mice experimentally infected with C. sinensis, a higher level of IL-33 was detected at latent stage both in the serum and in the liver, as well as the up-regulated expression of ST2 receptor on the inflammatory cells, especially on CD4(+) T cells in the liver of infected mice. Our results, for the first time, indicated that the increased IL-33/ST2 may be involved in the regulation of immunopathology induced by C. sinensis.

  13. Learning from the Messengers: Innate Sensing of Viruses and Cytokine Regulation of Immunity — Clues for Treatments and Vaccines

    Directory of Open Access Journals (Sweden)

    Jesper Melchjorsen

    2013-01-01

    Full Text Available Virus infections are a major global public health concern, and only via substantial knowledge of virus pathogenesis and antiviral immune responses can we develop and improve medical treatments, and preventive and therapeutic vaccines. Innate immunity and the shaping of efficient early immune responses are essential for control of viral infections. In order to trigger an efficient antiviral defense, the host senses the invading microbe via pattern recognition receptors (PRRs, recognizing distinct conserved pathogen-associated molecular patterns (PAMPs. The innate sensing of the invading virus results in intracellular signal transduction and subsequent production of interferons (IFNs and proinflammatory cytokines. Cytokines, including IFNs and chemokines, are vital molecules of antiviral defense regulating cell activation, differentiation of cells, and, not least, exerting direct antiviral effects. Cytokines shape and modulate the immune response and IFNs are principle antiviral mediators initiating antiviral response through induction of antiviral proteins. In the present review, I describe and discuss the current knowledge on early virus–host interactions, focusing on early recognition of virus infection and the resulting expression of type I and type III IFNs, proinflammatory cytokines, and intracellular antiviral mediators. In addition, the review elucidates how targeted stimulation of innate sensors, such as toll-like receptors (TLRs and intracellular RNA and DNA sensors, may be used therapeutically. Moreover, I present and discuss data showing how current antimicrobial therapies, including antibiotics and antiviral medication, may interfere with, or improve, immune response.

  14. The Rab GTPase Rab8 as a shared regulator of ciliogenesis and immune synapse assembly: From a conserved pathway to diverse cellular structures.

    Science.gov (United States)

    Patrussi, Laura; Baldari, Cosima T

    2016-01-01

    Rab GTPases, which form the largest branch of the Ras GTPase superfamily, regulate almost every step of vesicle-mediated trafficking. Among them, Rab8 is an essential participant in primary cilium formation. In a report recently published in the Journal of Cell Science, Finetti and colleagues identify Rab8 as a novel player in vesicular traffic in the non-ciliated T lymphocytes, which contributes to the assembly of the specialized signaling platform known as the immune synapse. By interacting with the v-SNARE VAMP-3, Rab8 is indeed responsible for the final docking/fusion step in T cell receptor (TCR) recycling to the immune synapse. A second important take-home message which comes to light from this work is that VAMP-3 also interacts with Rab8 at the base of the cilium in NIH-3T3 cells, where it regulates ciliary growth and targeting of Smoothened at the plasma membrane. Hence the data presented in this report, in addition to identifying Rab8 as a novel player in vesicular traffic to the immune synapse, reveal how both ciliated and non-ciliated cells take advantage of a conserved pathway to build highly specific cellular structures.

  15. Immunopathophysiology of inflammatory bowel disease: how genetics link barrier dysfunction and innate immunity to inflammation.

    Science.gov (United States)

    Mehta, Minesh; Ahmed, Shifat; Dryden, Gerald

    2017-08-01

    Inflammatory bowel diseases (IBD) comprise a distinct set of clinical symptoms resulting from chronic or relapsing immune activation and corresponding inflammation within the gastrointestinal (GI) tract. Diverse genetic mutations, encoding important aspects of innate immunity and mucosal homeostasis, combine with environmental triggers to create inappropriate, sustained inflammatory responses. Recently, significant advances have been made in understanding the interplay of the intestinal epithelium, mucosal immune system, and commensal bacteria as a foundation of the pathogenesis of inflammatory bowel disease. Complex interactions between specialized intestinal epithelial cells and mucosal immune cells determine different outcomes based on the environmental input: the development of tolerance in the presence of commensal bacterial or the promotion of inflammation upon recognition of pathogenic organisms. This article reviews key genetic abnormalities involved in inflammatory and homeostatic pathways that enhance susceptibility to immune dysregulation and combine with environmental triggers to trigger the development of chronic intestinal inflammation and IBD.

  16. Insect Immunity: The Post-Genomic Era

    OpenAIRE

    Bangham, Jenny; Jiggins, Frank; Lemaitre, Bruno

    2006-01-01

    Insects have a complex and effective immune system, many components of which are conserved in mammals. But only in the last decade have the molecular mechanisms that regulate the insect immune response--and their relevance to general biology and human immunology--become fully appreciated. A meeting supported by the Centre National de la Récherche Scientifique (France) was held to bring together the whole spectrum of researchers working on insect immunity. The meeting addressed diverse aspects...

  17. Respiratory Syncytial Virus-Infected Mesenchymal Stem Cells Regulate Immunity via Interferon Beta and Indoleamine-2,3-Dioxygenase.

    Directory of Open Access Journals (Sweden)

    Michael B Cheung

    Full Text Available Respiratory syncytial virus (RSV has been reported to infect human mesenchymal stem cells (MSCs but the consequences are poorly understood. MSCs are present in nearly every organ including the nasal mucosa and the lung and play a role in regulating immune responses and mediating tissue repair. We sought to determine whether RSV infection of MSCs enhances their immune regulatory functions and contributes to RSV-associated lung disease. RSV was shown to replicate in human MSCs by fluorescence microscopy, plaque assay, and expression of RSV transcripts. RSV-infected MSCs showed differentially altered expression of cytokines and chemokines such as IL-1β, IL6, IL-8 and SDF-1 compared to epithelial cells. Notably, RSV-infected MSCs exhibited significantly increased expression of IFN-β (~100-fold and indoleamine-2,3-dioxygenase (IDO (~70-fold than in mock-infected MSCs. IDO was identified in cytosolic protein of infected cells by Western blots and enzymatic activity was detected by tryptophan catabolism assay. Treatment of PBMCs with culture supernatants from RSV-infected MSCs reduced their proliferation in a dose dependent manner. This effect on PBMC activation was reversed by treatment of MSCs with the IDO inhibitors 1-methyltryptophan and vitamin K3 during RSV infection, a result we confirmed by CRISPR/Cas9-mediated knockout of IDO in MSCs. Neutralizing IFN-β prevented IDO expression and activity. Treatment of MSCs with an endosomal TLR inhibitor, as well as a specific inhibitor of the TLR3/dsRNA complex, prevented IFN-β and IDO expression. Together, these results suggest that RSV infection of MSCs alters their immune regulatory function by upregulating IFN-β and IDO, affecting immune cell proliferation, which may account for the lack of protective RSV immunity and for chronicity of RSV-associated lung diseases such as asthma and COPD.

  18. Systemic activation of the immune system in HIV infection: The role of the immune complexes (hypothesis).

    Science.gov (United States)

    Korolevskaya, Larisa B; Shmagel, Konstantin V; Shmagel, Nadezhda G; Saidakova, Evgeniya V

    2016-03-01

    Currently, immune activation is proven to be the basis for the HIV infection pathogenesis and a strong predictor of the disease progression. Among the causes of systemic immune activation the virus and its products, related infectious agents, pro-inflammatory cytokines, and regulatory CD4+ T cells' decrease are considered. Recently microbial translocation (bacterial products yield into the bloodstream as a result of the gastrointestinal tract mucosal barrier integrity damage) became the most popular hypothesis. Previously, we have found an association between immune complexes present in the bloodstream of HIV infected patients and the T cell activation. On this basis, we propose a significantly modified hypothesis of immune activation in HIV infection. It is based on the immune complexes' participation in the immunocompetent cells' activation. Immune complexes are continuously formed in the chronic phase of the infection. Together with TLR-ligands (viral antigens, bacterial products coming from the damaged gut) present in the bloodstream they interact with macrophages. As a result macrophages are transformed into the type II activated forms. These macrophages block IL-12 production and start synthesizing IL-10. High level of this cytokine slows down the development of the full-scale Th1-response. The anti-viral reactions are shifted towards the serogenesis. Newly synthesized antibodies' binding to viral antigens leads to continuous formation of the immune complexes capable of interacting with antigen-presenting cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Alternative Pre-mRNA Splicing in Mammals and Teleost Fish: A Effective Strategy for the Regulation of Immune Responses Against Pathogen Infection.

    Science.gov (United States)

    Chang, Ming Xian; Zhang, Jie

    2017-07-15

    Pre-mRNA splicing is the process by which introns are removed and the protein coding elements assembled into mature mRNAs. Alternative pre-mRNA splicing provides an important source of transcriptome and proteome complexity through selectively joining different coding elements to form mRNAs, which encode proteins with similar or distinct functions. In mammals, previous studies have shown the role of alternative splicing in regulating the function of the immune system, especially in the regulation of T-cell activation and function. As lower vertebrates, teleost fish mainly rely on a large family of pattern recognition receptors (PRRs) to recognize pathogen-associated molecular patterns (PAMPs) from various invading pathogens. In this review, we summarize recent advances in our understanding of alternative splicing of piscine PRRs including peptidoglycan recognition proteins (PGRPs), nucleotide binding and oligomerization domain (NOD)-like receptors (NLRs), retinoic acid-inducible gene-I (RIG-I)-like receptors (RLRs) and their downstream signaling molecules, compared to splicing in mammals. We also discuss what is known and unknown about the function of splicing isoforms in the innate immune responses against pathogens infection in mammals and teleost fish. Finally, we highlight the consequences of alternative splicing in the innate immune system and give our view of important directions for future studies.

  20. The Th17 Lineage: From Barrier Surfaces Homeostasis to Autoimmunity, Cancer, and HIV-1 Pathogenesis

    Directory of Open Access Journals (Sweden)

    Vanessa Sue Wacleche

    2017-10-01

    Full Text Available The T helper 17 (Th17 cells represent a subset of CD4+ T-cells with unique effector functions, developmental plasticity, and stem-cell features. Th17 cells bridge innate and adaptive immunity against fungal and bacterial infections at skin and mucosal barrier surfaces. Although Th17 cells have been extensively studied in the context of autoimmunity, their role in various other pathologies is underexplored and remains an area of open investigation. This review summarizes the history of Th17 cell discovery and the current knowledge relative to the beneficial role of Th17 cells in maintaining mucosal immunity homeostasis. We further discuss the concept of Th17 pathogenicity in the context of autoimmunity, cancer, and HIV infection, and we review the most recent discoveries on molecular mechanisms regulating HIV replication/persistence in pathogenic Th17 cells. Finally, we stress the need for novel fundamental research discovery-based Th17-specific therapeutic interventions to treat pathogenic conditions associated with Th17 abnormalities, including HIV infection.

  1. Extra-adrenal glucocorticoid synthesis: immune regulation and aspects on local organ homeostasis.

    Science.gov (United States)

    Talabér, Gergely; Jondal, Mikael; Okret, Sam

    2013-11-05

    Systemic glucocorticoids (GCs) mainly originate from de novo synthesis in the adrenal cortex under the control of the hypothalamus-pituitary-adrenal (HPA)-axis. However, research during the last 1-2 decades has revealed that additional organs express the necessary enzymes and have the capacity for de novo synthesis of biologically active GCs. This includes the thymus, intestine, skin and the brain. Recent research has also revealed that locally synthesized GCs most likely act in a paracrine or autocrine manner and have significant physiological roles in local homeostasis, cell development and immune cell activation. In this review, we summarize the nature, regulation and known physiological roles of extra-adrenal GC synthesis. We specifically focus on the thymus in which GC production (by both developing thymocytes and epithelial cells) has a role in the maintenance of proper immunological function. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  2. Functions of innate immune cells and commensal bacteria in gut homeostasis.

    Science.gov (United States)

    Kayama, Hisako; Takeda, Kiyoshi

    2016-02-01

    The intestinal immune system remains unresponsive to beneficial microbes and dietary antigens while activating pro-inflammatory responses against pathogens for host defence. In intestinal mucosa, abnormal activation of innate immunity, which directs adaptive immune responses, causes the onset and/or progression of inflammatory bowel diseases. Thus, innate immunity is finely regulated in the gut. Multiple innate immune cell subsets have been identified in both murine and human intestinal lamina propria. Some innate immune cells play a key role in the maintenance of gut homeostasis by preventing inappropriate adaptive immune responses while others are associated with the pathogenesis of intestinal inflammation through development of Th1 and Th17 cells. In addition, intestinal microbiota and their metabolites contribute to the regulation of innate/adaptive immune responses. Accordingly, perturbation of microbiota composition can trigger intestinal inflammation by driving inappropriate immune responses. © The Authors 2015. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  3. The Scaffold Immune Microenvironment: Biomaterial-Mediated Immune Polarization in Traumatic and Nontraumatic Applications.

    Science.gov (United States)

    Sadtler, Kaitlyn; Allen, Brian W; Estrellas, Kenneth; Housseau, Franck; Pardoll, Drew M; Elisseeff, Jennifer H

    2017-10-01

    The immune system mediates tissue growth and homeostasis and is the first responder to injury or biomaterial implantation. Recently, it has been appreciated that immune cells play a critical role in wound healing and tissue repair and should thus be considered potentially beneficial, particularly in the context of scaffolds for regenerative medicine. In this study, we present a flow cytometric analysis of cellular recruitment to tissue-derived extracellular matrix scaffolds, where we quantitatively describe the infiltration and polarization of several immune subtypes, including macrophages, dendritic cells, neutrophils, monocytes, T cells, and B cells. We define a specific scaffold-associated macrophage (SAM) that expresses CD11b + F4/80 + CD11c +/- CD206 hi CD86 + MHCII + that are characteristic of an M2-like cell (CD206 hi ) with high antigen presentation capabilities (MHCII + ). Adaptive immune cells tightly regulate the phenotype of a mature SAM. These studies provide a foundation for detailed characterization of the scaffold immune microenvironment of a given biomaterial scaffold to determine the effect of scaffold changes on immune response and subsequent therapeutic outcome of that material.

  4. Stress Hyperglycemia, Insulin Treatment, and Innate Immune Cells

    Directory of Open Access Journals (Sweden)

    Fangming Xiu

    2014-01-01

    Full Text Available Hyperglycemia (HG and insulin resistance are the hallmarks of a profoundly altered metabolism in critical illness resulting from the release of cortisol, catecholamines, and cytokines, as well as glucagon and growth hormone. Recent studies have proposed a fundamental role of the immune system towards the development of insulin resistance in traumatic patients. A comprehensive review of published literatures on the effects of hyperglycemia and insulin on innate immunity in critical illness was conducted. This review explored the interaction between the innate immune system and trauma-induced hypermetabolism, while providing greater insight into unraveling the relationship between innate immune cells and hyperglycemia. Critical illness substantially disturbs glucose metabolism resulting in a state of hyperglycemia. Alterations in glucose and insulin regulation affect the immune function of cellular components comprising the innate immunity system. Innate immune system dysfunction via hyperglycemia is associated with a higher morbidity and mortality in critical illness. Along with others, we hypothesize that reduction in morbidity and mortality observed in patients receiving insulin treatment is partially due to its effect on the attenuation of the immune response. However, there still remains substantial controversy regarding moderate versus intensive insulin treatment. Future studies need to determine the integrated effects of HG and insulin on the regulation of innate immunity in order to provide more effective insulin treatment regimen for these patients.

  5. Role of microRNAs in the immune system, inflammation and cancer.

    Science.gov (United States)

    Raisch, Jennifer; Darfeuille-Michaud, Arlette; Nguyen, Hang Thi Thu

    2013-05-28

    MicroRNAs, a key class of gene expression regulators, have emerged as crucial players in various biological processes such as cellular proliferation and differentiation, development and apoptosis. In addition, microRNAs are coming to light as crucial regulators of innate and adaptive immune responses, and their abnormal expression and/or function in the immune system have been linked to multiple human diseases including inflammatory disorders, such as inflammatory bowel disease, and cancers. In this review, we discuss our current understanding of microRNAs with a focus on their role and mode of action in regulating the immune system during inflammation and carcinogenesis.

  6. Endogenous egg immune defenses in the yellow mealworm beetle (Tenebrio molitor).

    Science.gov (United States)

    Jacobs, Chris G C; Gallagher, Joe D; Evison, Sophie E F; Heckel, David G; Vilcinskas, Andreas; Vogel, Heiko

    2017-05-01

    In order to survive microbe encounters, insects rely on both physical barriers as well as local and systemic immune responses. Most research focusses on adult or larval defenses however, whereas insect eggs are also in need of protection. Lately, the defense of eggs against microbes has received an increasing amount of attention, be it through endogenous egg defenses, trans-generational immune priming (TGIP) or parental investment. Here we studied the endogenous immune response in eggs and adults of Tenebrio molitor. We show that many immune genes are induced in both adults and eggs. Furthermore, we show that eggs reach comparable levels of immune gene expression as adults. These findings show that the eggs of Tenebrio are capable of an impressive endogenous immune response, and indicate that such inducible egg defenses are likely common in insects. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. The Blood-Brain Barrier: An Engineering Perspective

    Directory of Open Access Journals (Sweden)

    Andrew eWong

    2013-08-01

    Full Text Available It has been more than 100 years since Paul Ehrlich reported that various water-soluble dyes injected into the circulation did not enter the brain. Since Ehrlich’s first experiments, only a small number of molecules, such as alcohol and caffeine have been found to cross the blood-brain barrier, and it remains the major roadblock to treatment of many central nervous system diseases. At the same time, many central nervous system diseases are associated with disruption of the blood-brain barrier that can lead to changes in permeability, modulation of immune cell transport, and trafficking of pathogens into the brain. Therefore advances in our understanding of the structure and function of the blood-brain barrier are key to advances in treatment of a wide range of central nervous system diseases. Over the past 10 years it has become recognized that the blood-brain barrier is a complex dynamic system that involves biomechanical and biochemical signaling between the vascular system and the brain. Here we reconstruct the structure, function, and transport properties of the blood-brain barrier from an engineering perspective. New insight into the physics of the blood-brain barrier could ultimately lead to clinical advances in the treatment of central nervous system diseases.

  8. Neuroendocrine-immune interaction: regulation of inflammation via G-protein coupled receptors

    NARCIS (Netherlands)

    Verburg-van Kemenade, B.M.L.; Aa, van der L.M.; Chadzinska, M.K.

    2013-01-01

    Neuroendocrine- and immune systems interact in a bi-directional fashion to communicate the status of pathogen recognition to the brain and the immune response is influenced by physiological changes. The network of ligands and their receptors involved includes cytokines and chemokines,

  9. Neurotransmitter system of immune regulation as a marker of immunological disorders in pupils in the conditions of increased entry of strontium with drinking water

    Directory of Open Access Journals (Sweden)

    О.V. Dolgikh

    2015-09-01

    Full Text Available The evaluation of immunological markers in schoolchildren exposed to strontium is performed. It is shown that under the conditions of increased administration of strontium with drinking water the indication of spontaneous and induced levels of neurotransmitters in vitro allows to detect early functional disorders of the immune system. It was found that the following markers of specific hypersensitivity and mediators of intercellular immune regulation (IgG specific to strontium, cytokines IL-6, IL-10, IL-12, IL-17, α-TNF, GM-CSF, spontaneous and specifically stimulated, RANKL, OPG( may be proposed for the identification of health risk as early markers of immune disorders in school children living in areas of strontium geochemical provinces.

  10. Effect of glutamine-enriched nutritional support on intestinal mucosal barrier function, MMP-2, MMP-9 and immune function in patients with advanced gastric cancer during perioperative chemotherapy.

    Science.gov (United States)

    Wang, Juan; Li, Yanfen; Qi, Yuanling

    2017-09-01

    We studied the effects of glutamine-enriched nutritional support on intestinal mucosal barrier, matrix metalloproteinase (MMP)-2, MMP-9 and immune function during perioperative chemotherapy in patients with advanced gastric cancer. The study was conducted on 94 patients with advanced gastric cancer admitted from April 2015 to March 2016. They were randomly divided into observation and control groups, n=47. Control group was given basic nutritional support whereas glutamine-enriched nutritional support was given to patients in observation group. High-performance liquid chromatography was used to measure lactulose and mannitol ratio in urine (L/M) and ELISA was used to measure D-lactate levels before chemotherapy and in the 1st, 2nd and 3rd cycle of chemotherapy. Immunoglobulin level was detected by immune turbidimetry assay, T lymphocyte subsets were determined by flow cytometry after 3 cycles of chemotherapy, MMP-2 and MMP-9 of patients were compared between the two groups. The serious adverse reactions incidence (grade and IV) of patients were observed. To evaluate the life quality of patients, QLQ-C30 was used after 6 months. The levels of L/M and D-lactate in both groups after the first cycle of chemotherapy were significantly higher than that before chemotherapy; they began to decline after the second or third cycle, but were still significantly higher than the levels before chemotherapy (pgroups after 1st, 2nd, 3rd cycle after chemotherapy, L/M and D-lactate levels of patients in the observation group were significantly lower than in the control group (pgroup was significantly lower than control group (pgroup were significantly higher than control group (pnutritional support can effectively protect the intestinal mucosal barrier function in patients with advanced gastric cancer in their perioperative chemotherapy, improve the level of MMP-2 and MMP-9 in patients with advanced gastric cancer, enhance their immune function, reduce the incidence of adverse

  11. Epigenetic regulation of cancer biology and anti-tumor immunity by EZH2.

    Science.gov (United States)

    Christofides, Anthos; Karantanos, Theodoros; Bardhan, Kankana; Boussiotis, Vassiliki A

    2016-12-20

    Polycomb group proteins regulate chromatin structure and have an important regulatory role on gene expression in various cell types. Two polycomb group complexes (Polycomb repressive complex 1 (PRC1) and 2 (PRC2)) have been identified in mammalian cells. Both PRC1 and PRC2 compact chromatin, and also catalyze histone modifications. PRC1 mediates monoubiquitination of histone H2A, whereas PRC2 catalyzes methylation of histone H3 on lysine 27. These alterations of histones can lead to altered gene expression patterns by regulating chromatin structure. Numerous studies have highlighted the role of the PRC2 catalytic component enhancer of zeste homolog 2 (EZH2) in neoplastic development and progression, and EZH2 mutations have been identified in various malignancies. Through modulating the expression of critical genes, EZH2 is actively involved in fundamental cellular processes such as cell cycle progression, cell proliferation, differentiation and apoptosis. In addition to cancer cells, EZH2 also has a decisive role in the differentiation and function of T effector and T regulatory cells. In this review we summarize the recent progress regarding the role of EZH2 in human malignancies, highlight the molecular mechanisms by which EZH2 aberrations promote the pathogenesis of cancer, and discuss the anti-tumor effects of EZH2 targeting via activating direct anti-cancer mechanisms and anti-tumor immunity.

  12. Probiotic bacteria and the immune system: mechanistic insights and therapeutic implications

    NARCIS (Netherlands)

    Mariman, R.

    2013-01-01

    This thesis aimed to provide insight into the role of microbiota-host interactions in the regulation of mucosal and systemic immunity in the context of IBD. Regulation of microbiota composition (e.g. by probiotics and prebiotics) offers the possibility to modulate immune responses and contribute to

  13. Uncovering the Role of Erythrocyte-Derived Extracellular Vesicles in Malaria: From Immune Regulation to Cell Communication

    Directory of Open Access Journals (Sweden)

    Johan Ankarklev

    2014-05-01

    Full Text Available Investigation of the involvement of extracellular vesicles (EVs in parasite biology has burgeoned in recent years. Human infecting protozoan parasites, such as Trypanosoma cruzi, Lesihmania sp . and Trichomonas vaginalis , have all demonstrated the utilization of EVs as virulence factors in order to activate or hamper host immunity. Novel findings have provided evidence that the deployment of EVs by Plasmodium sp . has a major impact in disease outcomes and serves as an integral part in controlling stage switching in its life cycle. Clinical studies have highlighted elevated levels of EVs in patients with severe malaria disease and EVs have been linked to increased sequestration of infected red blood cells to the endothelium, causing obstruction of blood flow. It has also been found that EVs produced during malaria disease activate innate immunity. Intriguingly, recent discoveries indicate that Plasmodium sp . “highjack” the erythrocyte microvesiculation system in order to cross-communicate. Both the transfer of DNA and parasite density regulation has been suggested as key mechanisms of EVs in malaria biology.

  14. The evolutionarily conserved E3 ubiquitin ligase AtCHIP contributes to plant immunity

    Directory of Open Access Journals (Sweden)

    Xin eLi

    2016-03-01

    Full Text Available Plants possess a sophisticated immune system to recognize and respond to microbial threats in their environment. The level of immune signaling must be tightly regulated so that immune responses can be quickly activated in the presence of pathogens, while avoiding autoimmunity. HSP90s, along with their diverse array of co-chaperones, forms chaperone complexes that have been shown to play both positive and negative roles in regulating the accumulation of immune receptors and regulators. In this study, we examined the role of AtCHIP, an evolutionarily conserved E3 ligase that was known to interact with chaperones including HSP90s in multicellular organisms including fruit fly, C. elegans, plants and human. Atchip knockout mutants display enhanced disease susceptibility to a virulent oomycete pathogen, and overexpression of AtCHIP causes enhanced disease resistance at low temperature. Although CHIP was reported to target HSP90 for ubiquitination and degradation, accumulation of HSP90.3 was not affected in Atchip plants. In addition, protein accumulation of nucleotide-binding, leucine-rich repeat domain immune receptor (NLR SNC1 is not altered in Atchip mutant. Thus, while AtCHIP plays a role in immunity, it does not seem to regulate the turnover of HSP90 or SNC1. Further investigation is needed in order to determine the exact mechanism behind AtCHIP’s role in regulating plant immune responses.

  15. Negative regulation of humoral immunity due to interplay between the SLAMF1, SLAMF5, and SLAMF6 receptors

    Directory of Open Access Journals (Sweden)

    Ninghai eWang

    2015-04-01

    Full Text Available Whereas the SLAMF-associated protein (SAP is involved in differentiation of TFH cells and antibody responses, the precise requirements of SLAMF receptors in humoral immune responses are incompletely understood. By analyzing mice with targeted disruptions of the SLAMF1, SLAMF5 and SLAMF6 genes, we found that both T-dependent and T-independent antibody responses were twofold higher compared to those in single knockout mice. These data suggest a suppressive synergy of SLAMF1, SLAMF5 and SLAMF6 in humoral immunity, which contrasts the decreased antibody responses resulting from a defective GC reaction in the absence of the adapter SAP. In adoptive co-transfer assays, both [Slamf1+5+6]-/- B and T cells were capable of inducing enhanced antibody responses, but more pronounced enhancement was observed after adoptive transfer of [Slamf1+5+6]-/- B cells compared to that of [Slamf1+5+6]-/- T cells. In support of [Slamf1+5+6]-/- B cell intrinsic activity, [Slamf1+5+6]-/- mice also mounted significantly higher antibody responses to T-independent type 2 antigen. Furthermore, treatment of mice with anti-SLAMF6 monoclonal antibody results in severe inhibition of the development of TFH cells and GC B cells, confirming a suppressive effect of SLAMF6. Taken together, these results establish SLAMF1, SLAMF5 and SLAMF6 as important negative regulators of humoral immune response, consistent with the notion that SLAM family receptors have dual functions in immune responses.

  16. A drug-sensitive genetic network masks fungi from the immune system.

    Directory of Open Access Journals (Sweden)

    Robert T Wheeler

    2006-04-01

    Full Text Available Fungal pathogens can be recognized by the immune system via their beta-glucan, a potent proinflammatory molecule that is present at high levels but is predominantly buried beneath a mannoprotein coat and invisible to the host. To investigate the nature and significance of "masking" this molecule, we characterized the mechanism of masking and consequences of unmasking for immune recognition. We found that the underlying beta-glucan in the cell wall of Candida albicans is unmasked by subinhibitory doses of the antifungal drug caspofungin, causing the exposed fungi to elicit a stronger immune response. Using a library of bakers' yeast (Saccharomyces cerevisiae mutants, we uncovered a conserved genetic network that is required for concealing beta-glucan from the immune system and limiting the host response. Perturbation of parts of this network in the pathogen C. albicans caused unmasking of its beta-glucan, leading to increased beta-glucan receptor-dependent elicitation of key proinflammatory cytokines from primary mouse macrophages. By creating an anti-inflammatory barrier to mask beta-glucan, opportunistic fungi may promote commensal colonization and have an increased propensity for causing disease. Targeting the widely conserved gene network required for creating and maintaining this barrier may lead to novel broad-spectrum antimycotics.

  17. Enhanced Mucosal Defense and Reduced Tumor Burden in Mice with the Compromised Negative Regulator IRAK-M

    Directory of Open Access Journals (Sweden)

    Daniel E. Rothschild

    2017-02-01

    Full Text Available Aberrant inflammation is a hallmark of inflammatory bowel disease (IBD and colorectal cancer. IRAK-M is a critical negative regulator of TLR signaling and overzealous inflammation. Here we utilize data from human studies and Irak-m−/− mice to elucidate the role of IRAK-M in the modulation of gastrointestinal immune system homeostasis. In human patients, IRAK-M expression is up-regulated during IBD and colorectal cancer. Further functional studies in mice revealed that Irak-m−/− animals are protected against colitis and colitis associated tumorigenesis. Mechanistically, our data revealed that the gastrointestinal immune system of Irak-m−/− mice is highly efficient at eliminating microbial translocation following epithelial barrier damage. This attenuation of pathogenesis is associated with expanded areas of gastrointestinal associated lymphoid tissue (GALT, increased neutrophil migration, and enhanced T-cell recruitment. Further evaluation of Irak-m−/− mice revealed a splice variant that robustly activates NF-κB signaling. Together, these data identify IRAK-M as a potential target for future therapeutic intervention.

  18. TREM-1 Promotes Pancreatitis-Associated Intestinal Barrier Dysfunction

    Directory of Open Access Journals (Sweden)

    Shengchun Dang

    2012-01-01

    Full Text Available Severe acute pancreatitis (SAP can cause intestinal barrier dysfunction (IBD, which significantly increases the disease severity and risk of mortality. We hypothesized that the innate immunity- and inflammatory-related protein-triggering receptor expressed on myeloid cells-1 (TREM-1 contributes to this complication of SAP. Thus, we investigated the effect of TREM-1 pathway modulation on a rat model of pancreatitis-associated IBD. In this study we sought to clarify the role of TREM-1 in the pathophysiology of intestinal barrier dysfunction in SAP. Specifically, we evaluated levels of serum TREM-1 and membrane-bound TREM-1 in the intestine and pancreas from an animal model of experimentally induced SAP. TREM-1 pathway blockade by LP17 treatment may suppress pancreatitis-associated IBD and ameliorate the damage to the intestinal mucosa barrier.

  19. Atomistic modeling of the structural components of the blood-brain barrier

    Science.gov (United States)

    Glukhova, O. E.; Grishina, O. A.; Slepchenkov, M. M.

    2015-03-01

    Blood-brain barrier, which is a barrage system between the brain and blood vessels, plays a key role in the "isolation" of the brain of unnecessary information, and reduce the "noise" in the interneuron communication. It is known that the barrier function of the BBB strictly depends on the initial state of the organism and changes significantly with age and, especially in developing the "vascular accidents". Disclosure mechanisms of regulation of the barrier function will develop new ways to deliver neurotrophic drugs to the brain in the newborn. The aim of this work is the construction of atomistic models of structural components of the blood-brain barrier to reveal the mechanisms of regulation of the barrier function.

  20. Regulation of Innate Lymphoid Cells by Aryl Hydrocarbon Receptor

    Directory of Open Access Journals (Sweden)

    Shiyang Li

    2018-01-01

    Full Text Available With striking similarity to their adaptive T helper cell counterparts, innate lymphoid cells (ILCs represent an emerging family of cell types that express signature transcription factors, including T-bet+ Eomes+ natural killer cells, T-bet+ Eomes− group 1 ILCs, GATA3+ group 2 ILCs, RORγt+ group 3 ILCs, and newly identified Id3+ regulatory ILC. ILCs are abundantly present in barrier tissues of the host (e.g., the lung, gut, and skin at the interface of host–environment interactions. Active research has been conducted to elucidate molecular mechanisms underlying the development and function of ILCs. The aryl hydrocarbon receptor (Ahr is a ligand-dependent transcription factor, best known to mediate the effects of xenobiotic environmental toxins and endogenous microbial and dietary metabolites. Here, we review recent progresses regarding Ahr function in ILCs. We focus on the Ahr-mediated cross talk between ILCs and other immune/non-immune cells in host tissues especially in the gut. We discuss the molecular mechanisms of the action of Ahr expression and activity in regulation of ILCs in immunity and inflammation, and the interaction between Ahr and other pathways/transcription factors in ILC development and function with their implication in disease.

  1. Obesity, Fat Mass and Immune System: Role for Leptin

    Directory of Open Access Journals (Sweden)

    Vera Francisco

    2018-06-01

    Full Text Available Obesity is an epidemic disease characterized by chronic low-grade inflammation associated with a dysfunctional fat mass. Adipose tissue is now considered an extremely active endocrine organ that secretes cytokine-like hormones, called adipokines, either pro- or anti-inflammatory factors bridging metabolism to the immune system. Leptin is historically one of most relevant adipokines, with important physiological roles in the central control of energy metabolism and in the regulation of metabolism-immune system interplay, being a cornerstone of the emerging field of immunometabolism. Indeed, leptin receptor is expressed throughout the immune system and leptin has been shown to regulate both innate and adaptive immune responses. This review discusses the latest data regarding the role of leptin as a mediator of immune system and metabolism, with particular emphasis on its effects on obesity-associated metabolic disorders and autoimmune and/or inflammatory rheumatic diseases.

  2. Corruption of innate immunity by bacterial proteases.

    Science.gov (United States)

    Potempa, Jan; Pike, Robert N

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host's innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections.

  3. Contrasting invertebrate immune defense behaviors caused by a single gene, the Caenorhabditis elegans neuropeptide receptor gene npr-1

    NARCIS (Netherlands)

    Nakad, Rania; Snoek, L.B.; Yang, Wentao; Ellendt, S.; Schneider, Franziska; Mohr, T.G.; Rösingh, Lone; Masche, Anna C.; Rosenstiel, P.C.; Dierking, K.; Kammenga, J.E.; Schulenburg, Hinrich

    2016-01-01

    Background The invertebrate immune system comprises physiological mechanisms, physical barriers and also behavioral responses. It is generally related to the vertebrate innate immune system and widely believed to provide nonspecific defense against pathogens, whereby the response to different

  4. Contrasting invertebrate immune defense behaviors caused by a single gene, the Caenorhabditis elegans neuropeptide receptor gene npr-1

    NARCIS (Netherlands)

    Nakad, Rania; Snoek, L Basten; Yang, Wentao; Ellendt, Sunna; Schneider, Franziska; Mohr, Timm G; Rösingh, Lone; Masche, Anna C; Rosenstiel, Philip C; Dierking, Katja; Kammenga, Jan E; Schulenburg, Hinrich

    2016-01-01

    BACKGROUND: The invertebrate immune system comprises physiological mechanisms, physical barriers and also behavioral responses. It is generally related to the vertebrate innate immune system and widely believed to provide nonspecific defense against pathogens, whereby the response to different

  5. Tetraspanin CD9: A Key Regulator of Cell Adhesion in the Immune System

    Directory of Open Access Journals (Sweden)

    Raquel Reyes

    2018-04-01

    Full Text Available The tetraspanin CD9 is expressed by all the major subsets of leukocytes (B cells, CD4+ T cells, CD8+ T cells, natural killer cells, granulocytes, monocytes and macrophages, and immature and mature dendritic cells and also at a high level by endothelial cells. As a typical member of the tetraspanin superfamily, a prominent feature of CD9 is its propensity to engage in a multitude of interactions with other tetraspanins as well as with different transmembrane and intracellular proteins within the context of defined membranal domains termed tetraspanin-enriched microdomains (TEMs. Through these associations, CD9 influences many cellular activities in the different subtypes of leukocytes and in endothelial cells, including intracellular signaling, proliferation, activation, survival, migration, invasion, adhesion, and diapedesis. Several excellent reviews have already covered the topic of how tetraspanins, including CD9, regulate these cellular processes in the different cells of the immune system. In this mini-review, however, we will focus particularly on describing and discussing the regulatory effects exerted by CD9 on different adhesion molecules that play pivotal roles in the physiology of leukocytes and endothelial cells, with a particular emphasis in the regulation of adhesion molecules of the integrin and immunoglobulin superfamilies.

  6. Long noncoding RNA in hematopoiesis and immunity.

    Science.gov (United States)

    Satpathy, Ansuman T; Chang, Howard Y

    2015-05-19

    Dynamic gene expression during cellular differentiation is tightly coordinated by transcriptional and post-transcriptional mechanisms. An emerging theme is the central role of long noncoding RNAs (lncRNAs) in the regulation of this specificity. Recent advances demonstrate that lncRNAs are expressed in a lineage-specific manner and control the development of several cell types in the hematopoietic system. Moreover, specific lncRNAs are induced to modulate innate and adaptive immune responses. lncRNAs can function via RNA-DNA, RNA-RNA, and RNA-protein target interactions. As a result, they affect several stages of gene regulation, including chromatin modification, mRNA biogenesis, and protein signaling. We discuss recent advances, future prospects, and challenges in understanding the roles of lncRNAs in immunity and immune-mediated diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Shifts in Host Mucosal Innate Immune Function Are Associated with Ruminal Microbial Succession in Supplemental Feeding and Grazing Goats at Different Ages

    Directory of Open Access Journals (Sweden)

    Jinzhen Jiao

    2017-08-01

    Full Text Available Gastrointestinal microbiota may play an important role in regulating host mucosal innate immune function. This study was conducted to test the hypothesis that age (non-rumination, transition and rumination and feeding type [Supplemental feeding (S vs. Grazing (G] could alter ruminal microbial diversity and maturation of host mucosal innate immune system in goat kids. MiSeq sequencing was applied to investigate ruminal microbial composition and diversity, and RT-PCR was used to test expression of immune-related genes in ruminal mucosa. Results showed that higher (P < 0.05 relative abundances of Prevotella, Butyrivibrio, Pseudobutyrivibrio, Methanobrevibacter.gottschalkii, Neocallimastix, Anoplodinium–Diplodinium, and Polyplastron, and lower relative abundance of Methanosphaera (P = 0.042 were detected in the rumen of S kids when compared to those in G kids. The expression of genes encoding TLRs, IL1α, IL1β and TICAM2 was down-regulated (P < 0.01, while expression of genes encoding tight junction proteins was up-regulated (P < 0.05 in the ruminal mucosa of S kids when compared to that in G kids. Moreover, irrespective of feeding type, relative abundances of ruminal Prevotella, Fibrobacter, Ruminococcus, Butyrivibrio, Methanobrevibacter, Neocallimastix, and Entodinium increased with age. The expression of most genes encoding TLRs and cytokines increased (P < 0.05 from day 0 to 7, while expression of genes encoding tight junction proteins declined with age (P < 0.05. This study revealed that the composition of each microbial domain changed as animals grew, and these changes might be associated with variations in host mucosal innate immune function. Moreover, supplementing goat kids with concentrate could modulate ruminal microbial composition, enhance barrier function and decrease local inflammation. The findings provide useful information in interpreting microbiota and host interactions, and developing nutritional strategies to improve the

  8. Developmental Bisphenol A Exposure Modulates Immune-Related Diseases

    Science.gov (United States)

    Xu, Joella; Huang, Guannan; Guo, Tai L.

    2016-01-01

    Bisphenol A (BPA), used in polycarbonate plastics and epoxy resins, has a widespread exposure to humans. BPA is of concern for developmental exposure resulting in immunomodulation and disease development due to its ability to cross the placental barrier and presence in breast milk. BPA can use various mechanisms to modulate the immune system and affect diseases, including agonistic and antagonistic effects on many receptors (e.g., estrogen receptors), epigenetic modifications, acting on cell signaling pathways and, likely, the gut microbiome. Immune cell populations and function from the innate and adaptive immune system are altered by developmental BPA exposure, including decreased T regulatory (Treg) cells and upregulated pro- and anti-inflammatory cytokines and chemokines. Developmental BPA exposure can also contribute to the development of type 2 diabetes mellitus, allergy, asthma and mammary cancer disease by altering immune function. Multiple sclerosis and type 1 diabetes mellitus may also be exacerbated by BPA, although more research is needed. Additionally, BPA analogs, such as bisphenol S (BPS), have been increasing in use, and currently, little is known about their immune effects. Therefore, more studies should be conducted to determine if developmental exposure BPA and its analogs modulate immune responses and lead to immune-related diseases. PMID:29051427

  9. Developmental Bisphenol A Exposure Modulates Immune-Related Diseases

    Directory of Open Access Journals (Sweden)

    Joella Xu

    2016-09-01

    Full Text Available Bisphenol A (BPA, used in polycarbonate plastics and epoxy resins, has a widespread exposure to humans. BPA is of concern for developmental exposure resulting in immunomodulation and disease development due to its ability to cross the placental barrier and presence in breast milk. BPA can use various mechanisms to modulate the immune system and affect diseases, including agonistic and antagonistic effects on many receptors (e.g., estrogen receptors, epigenetic modifications, acting on cell signaling pathways and, likely, the gut microbiome. Immune cell populations and function from the innate and adaptive immune system are altered by developmental BPA exposure, including decreased T regulatory (Treg cells and upregulated pro- and anti-inflammatory cytokines and chemokines. Developmental BPA exposure can also contribute to the development of type 2 diabetes mellitus, allergy, asthma and mammary cancer disease by altering immune function. Multiple sclerosis and type 1 diabetes mellitus may also be exacerbated by BPA, although more research is needed. Additionally, BPA analogs, such as bisphenol S (BPS, have been increasing in use, and currently, little is known about their immune effects. Therefore, more studies should be conducted to determine if developmental exposure BPA and its analogs modulate immune responses and lead to immune-related diseases.

  10. Improving microphage innate immunity by modulating protein ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Diseases that result from an infection are most often resolved by cells that use an immune response to clear foreign agents. ... The authors hypothesize that certain PTPs favour the generation of the pro-inflammatory M1 macrophages, thereby regulating the functions leading to promoting immune surveillance and killing of ...

  11. The effect of probiotics on immune regulation, acne, and photoaging

    Directory of Open Access Journals (Sweden)

    Mary-Margaret Kober

    2015-06-01

    Full Text Available Probiotics are live micro-organisms that provide a health benefit to the host. The role of probiotics in the management of disease, as well as immune modification, has recently experienced a renewed interest in society, as probiotics can be found in products ranging from yogurt to facial creams. In this article, we discuss the role of probiotics in the development of the immune system, the treatment of acne and rosacea, and protection against aging and photodamage.

  12. Contrasting invertebrate immune defense behaviors caused by a single gene, the Caenorhabditis elegans neuropeptide receptor gene npr-1

    NARCIS (Netherlands)

    Nakad, Rania; Snoek, Basten; Yang, Wentao; Ellendt, S.; Schneider, Franziska; Mohr, T.G.; Rösingh, Lone; Masche, Anna C.; Rosenstiel, P.C.; Dierking, K.; Kammenga, Jan E.; Schulenburg, Hinrich

    2016-01-01

    Background: The invertebrate immune system comprises physiological mechanisms, physical barriers and also behavioral responses. It is generally related to the vertebrate innate immune system and widely believed to provide
    nonspecific defense against pathogens, whereby the response to different

  13. The function of the Mediator complex in plant immunity.

    Science.gov (United States)

    An, Chuanfu; Mou, Zhonglin

    2013-03-01

    Upon pathogen infection, plants undergo dramatic transcriptome reprogramming to shift from normal growth and development to immune response. During this rapid process, the multiprotein Mediator complex has been recognized as an important player to fine-tune gene-specific and pathway-specific transcriptional reprogramming by acting as an adaptor/coregulator between sequence-specific transcription factor and RNA polymerase II (RNAPII). Here, we review current understanding of the role of five functionally characterized Mediator subunits (MED8, MED15, MED16, MED21 and MED25) in plant immunity. All these Mediator subunits positively regulate resistance against leaf-infecting biotrophic bacteria or necrotrophic fungi. While MED21 appears to regulate defense against fungal pathogens via relaying signals from upstream regulators and chromatin modification to RNAPII, the other four Mediator subunits locate at different positions of the defense network to convey phytohormone signal(s). Fully understanding the role of Mediator in plant immunity needs to characterize more Mediator subunits in both Arabidopsis and other plant species. Identification of interacting proteins of Mediator subunits will further help to reveal their specific regulatory mechanisms in plant immunity.

  14. Inflammatory cytokines in the brain: does the CNS shape immune responses?

    Science.gov (United States)

    Owens, T; Renno, T; Taupin, V; Krakowski, M

    1994-12-01

    Immune responses in the central nervous system (CNS) have traditionally been regarded as representing the intrusion of an unruly, ill-behaved mob of leukocytes into the well-ordered and organized domain of thought and reason. However, results accumulated over the past few years suggest that, far from being an immunologically privileged organ, T lymphocytes may be regular and frequent visitors to the CNS, for purposes of immune surveillance. Here, Trevor Owens and colleagues propose that the brain itself can regulate or shape immune responses therein. Furthermore, given that the immune cells may be subverted to autoimmunity, they suggest that the study of inflammatory autoimmune disease in the brain may shed light on the ability of the local environment to regulate immune responses.

  15. The Tomato Fni3 Lysine-63–Specific Ubiquitin-Conjugating Enzyme and Suv Ubiquitin E2 Variant Positively Regulate Plant Immunity[C][W

    Science.gov (United States)

    Mural, Ravi V.; Liu, Yao; Rosebrock, Tracy R.; Brady, Jennifer J.; Hamera, Sadia; Connor, Richard A.; Martin, Gregory B.; Zeng, Lirong

    2013-01-01

    The activation of an immune response in tomato (Solanum lycopersicum) against Pseudomonas syringae relies on the recognition of E3 ligase–deficient forms of AvrPtoB by the host protein kinase, Fen. To investigate the mechanisms by which Fen-mediated immunity is regulated, we characterize in this study a Fen-interacting protein, Fni3, and its cofactor, S. lycoperiscum Uev (Suv). Fni3 encodes a homolog of the Ubc13-type ubiquitin-conjugating enzyme that catalyzes exclusively Lys-63–linked ubiquitination, whereas Suv is a ubiquitin-conjugating enzyme variant. The C-terminal region of Fen was necessary for interaction with Fni3, and this interaction was required for cell death triggered by overexpression of Fen in Nicotiana benthamiana leaves. Fni3 was shown to be an active E2 enzyme, but Suv displayed no ubiquitin-conjugating activity; Fni3 and Suv together directed Lys-63–linked ubiquitination. Decreased expression of Fni3, another tomato Ubc13 homolog, Sl-Ubc13-2, or Suv in N. benthamiana leaves diminished cell death associated with Fen-mediated immunity and cell death elicited by several other resistance (R) proteins and their cognate effectors. We also discovered that coexpression of Fen and other R proteins/effectors with a Fni3 mutant that is compromised for ubiquitin-conjugating activity diminished the cell death. These results suggest that Fni3/Sl-Ubc13-2 and Suv regulate the immune response mediated by Fen and other R proteins through Lys-63–linked ubiquitination. PMID:24076975

  16. Dietary zinc deficiency reduced growth performance, intestinal immune and physical barrier functions related to NF-κB, TOR, Nrf2, JNK and MLCK signaling pathway of young grass carp (Ctenopharyngodon idella).

    Science.gov (United States)

    Song, Zheng-Xing; Jiang, Wei-Dan; Liu, Yang; Wu, Pei; Jiang, Jun; Zhou, Xiao-Qiu; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Feng, Lin

    2017-07-01

    Our study investigated the effects of dietary zinc (Zn) deficiency on growth performance, intestinal immune and physical barrier functions of young grass carp (Ctenopharyngodon idella). A total of 630 grass carp (244.14 ± 0.40 g) were fed graded levels of zinc lactate (10.71, 30.21, 49.84, 72.31, 92.56, 110.78 mg Zn/kg diet) and one zinc sulfate group (56.9 mg Zn/kg diet) for 60 days. At the end of the feeding trial, fish were challenged with Aeromonas hydrophila for 14 days. These results indicated that compared with optimal dietary Zn level, dietary Zn deficiency (10.71 mg/kg diet) decreased the production of antibacterial compounds, up-regulated pro-inflammatory cytokines related to nuclear factor kappa B (NF-κB) and down-regulated anti-inflammatory cytokines related to target of rapamycin (TOR) in three intestinal segments of young grass carp (P zinc lactate as Zn source) based on percent weight gain (PWG), against enteritis morbidity, acid phosphatase (ACP) activity in the proximal intestine (PI) and malondialdehyde (MDA) content in the PI of young grass carp was estimated to be 61.2, 61.4, 69.2 and 69.5 mg/kg diet, respectively. Finally, based on specific growth rate (SGR), feed efficiency (FE) and against enteritis morbidity of young grass carp, the efficacy of zinc lactate relative to zinc sulfate were 132.59%, 135.27% and 154.04%, respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Unique aspects of the perinatal immune system.

    Science.gov (United States)

    Zhang, Xiaoming; Zhivaki, Dania; Lo-Man, Richard

    2017-08-01

    The early stages of life are associated with increased susceptibility to infection, which is in part due to an ineffective immune system. In the context of infection, the immune system must be stimulated to provide efficient protection while avoiding insufficient or excessive activation. Yet, in early life, age-dependent immune regulation at molecular and cellular levels contributes to a reduced immunological fitness in terms of pathogen clearance and response to vaccines. To enable microbial colonization to be tolerated at birth, epigenetic immune cell programming and early life-specific immune regulatory and effector mechanisms ensure that vital functions and organ development are supported and that tissue damage is avoided. Advancement in our understanding of age-related remodelling of immune networks and the consequent tuning of immune responsiveness will open up new possibilities for immune intervention and vaccine strategies that are designed specifically for early life.

  18. MiR-17-92 cluster and immunity.

    Science.gov (United States)

    Kuo, George; Wu, Chao-Yi; Yang, Huang-Yu

    2018-05-29

    MicroRNAs (MiR, MiRNA) are small single-stranded non-coding RNAs that play an important role in the regulation of gene expression. MircoRNAs exert their effect by binding to complementary nucleotide sequences of the targeted messenger RNA, thus forming an RNA-induced silencing complex. The mircoRNA-17-92 cluster encoded by the miR-17-92 host gene is first found in malignant B-cell lymphoma. Recent research identifies the miR-17-92 cluster as a crucial player in the development of the immune system, the heart, the lung, and oncogenic events. In light of the miR-17-92 cluster's increasing role in regulating the immune system, our review will discuss the latest knowledge regarding its involvement in cells of both innate and adaptive immunity, including B cells, subsets of T cells such as Th1, Th2, T follicular helper cells, regulatory T cells, monocytes/macrophages, NK cells, and dendritic cells, and the possible targets that are regulated by its members. Copyright © 2018. Published by Elsevier B.V.

  19. Promotion of Immunizations for Health Professionals in Europe: A Qualitative Study in Seven European Member States.

    Science.gov (United States)

    Dalma, Archontoula; Karnaki, Pania; Baka, Agoritsa; Raftopoulos, Vasilios; Zota, Dina; Veloudaki, Afroditi; Garrison, Amanda; Ellis Montalban, Paloma; Dhanani, Zainub; Linos, Athena

    2018-01-01

    Health Care Workers (HCWs) are a high-risk group for contracting Vaccine-Preventable Diseases who, despite legislation and guidance, remain undervaccinated. In order to understand their barriers and needs, focus groups were formed with 278 physicians, nurses, infection-control personnel, and policy-makers in 7 EU MS. Several implications for the development of promotional initiatives were identified including the need to overcome organizational barriers, to sensitize HCWs about the importance of immunization and to provide specific up-to-date information about vaccinations covering prevalence of diseases, protection years, side effects, administration times, antibody examinations, costs and immunization settings.

  20. Barriers for the introduction of bioenergy in the Netherlands

    International Nuclear Information System (INIS)

    Gerlagh, T.; Groenendaal, B.; Van Ree, R.; Dinkelbach, L.; Van Doorn, J.; Hemmes, K.

    2000-01-01

    The use of biomass for energy in the Netherlands is still limited despite the political incentives to make bio-energy a major source of renewable energy. The hesitation of many stake-holders is due to the limited insight into the potential of biomass in the Netherlands and the presence of numerous other barriers. Availability of biomass, emission regulation and waste treatment regulations are considered important barriers. Analyses of their current state show that these barriers are broadly recognised and possibilities to decrease their impact are present. Some barriers with a minor influence so far will be of increasing importance and could be a threat to the development of bio-energy in future. These are the fast liberalising of the energy market and sustainable energy market, the competition with other renewables and the unclear status of the current technology available. Future research should focus on the possibilities to overcome these new barriers. 5 refs

  1. The role of gut microbiota in immune homeostasis and autoimmunity.

    Science.gov (United States)

    Wu, Hsin-Jung; Wu, Eric

    2012-01-01

    Keeping a delicate balance in the immune system by eliminating invading pathogens, while still maintaining self-tolerance to avoid autoimmunity, is critical for the body's health. The gut microbiota that resides in the gastrointestinal tract provides essential health benefits to its host, particularly by regulating immune homeostasis. Moreover, it has recently become obvious that alterations of these gut microbial communities can cause immune dysregulation, leading to autoimmune disorders. Here we review the advances in our understanding of how the gut microbiota regulates innate and adaptive immune homeostasis, which in turn can affect the development of not only intestinal but also systemic autoimmune diseases. Exploring the interaction of gut microbes and the host immune system will not only allow us to understand the pathogenesis of autoimmune diseases but will also provide us new foundations for the design of novel immuno- or microbe-based therapies.

  2. Learning and Memory... and the Immune System

    Science.gov (United States)

    Marin, Ioana; Kipnis, Jonathan

    2013-01-01

    The nervous system and the immune system are two main regulators of homeostasis in the body. Communication between them ensures normal functioning of the organism. Immune cells and molecules are required for sculpting the circuitry and determining the activity of the nervous system. Within the parenchyma of the central nervous system (CNS),…

  3. NKT cell self-reactivity: evolutionary master key of immune homeostasis?

    DEFF Research Database (Denmark)

    Navikas, Shohreh

    2011-01-01

    Complex immune responses have evolved to protect multicellular organisms against the invasion of pathogens. This has exerted strong developmental pressure for specialized functions that can also limit damage to self-tissue. Two arms of immunity, the innate and adaptive immune system, have evolved...... through evolution by higher vertebrates could be related to their central function as master regulators of immune homeostasis that in part is shared with regulatory T cells. Hypothetical views on how self-reactive NKT cells secure such a central role will also be proposed.......Complex immune responses have evolved to protect multicellular organisms against the invasion of pathogens. This has exerted strong developmental pressure for specialized functions that can also limit damage to self-tissue. Two arms of immunity, the innate and adaptive immune system, have evolved....... The recent finding of self-peptide reactivity of NKT cells in the context of CD1d, with capacity to regulate multiple autoimmune and inflammatory conditions, motivates the current proposal that self-reactive NKT cells might be the ancestral link between present NK and T cells. Their parallel selection...

  4. Possible Immune Regulation of Natural Killer T Cells in a Murine Model of Metal Ion-Induced Allergic Contact Dermatitis

    Directory of Open Access Journals (Sweden)

    Kenichi Kumagai

    2016-01-01

    Full Text Available Metal often causes delayed-type hypersensitivity reactions, which are possibly mediated by accumulating T cells in the inflamed skin, called irritant or allergic contact dermatitis. However, accumulating T cells during development of a metal allergy are poorly characterized because a suitable animal model is unavailable. We have previously established novel murine models of metal allergy and found accumulation of both metal-specific T cells and natural killer (NK T cells in the inflamed skin. In our novel models of metal allergy, skin hypersensitivity responses were induced through repeated sensitizations by administration of metal chloride and lipopolysaccharide into the mouse groin followed by metal chloride challenge in the footpad. These models enabled us to investigate the precise mechanisms of the immune responses of metal allergy in the inflamed skin. In this review, we summarize the immune responses in several murine models of metal allergy and describe which antigen-specific responses occur in the inflamed skin during allergic contact dermatitis in terms of the T cell receptor. In addition, we consider the immune regulation of accumulated NK T cells in metal ion–induced allergic contact dermatitis.

  5. Tight junction proteins contribute to barrier properties in human pleura.

    Science.gov (United States)

    Markov, Alexander G; Voronkova, Maria A; Volgin, George N; Yablonsky, Piotr K; Fromm, Michael; Amasheh, Salah

    2011-03-15

    The permeability of pleural mesothelium helps to control the volume and composition of the liquid lubricating pleural surfaces. Information on pleural barrier function in health and disease, however, is scarce. Tissue specimens of human pleura were mounted in Ussing chambers for measurement of transmesothelial resistance. Expression of tight junction (TJ) proteins was studied by Western blots and immune fluorescence confocal microscopy. Both visceral and parietal pleura showed barrier properties represented by transmesothelial resistance. Occludin, claudin-1, -3, -5, and -7, were detected in visceral pleura. In parietal pleura, the same TJ proteins were detected, except claudin-7. In tissues from patients with pleural inflammation these tightening claudins were decreased and in visceral pleura claudin-2, a paracellular channel former, became apparent. We report that barrier function in human pleura coincides with expression of claudins known to be key determinants of epithelial barrier properties. In inflamed tissue, claudin expression indicates a reduced barrier function. Copyright © 2010 Elsevier B.V. All rights reserved.

  6. MenTORing Immunity: mTOR Signaling in the Development and Function of Tissue-Resident Immune Cells.

    Science.gov (United States)

    Jones, Russell G; Pearce, Edward J

    2017-05-16

    Tissue-resident immune cells must balance survival in peripheral tissues with the capacity to respond rapidly upon infection or tissue damage, and in turn couple these responses with intrinsic metabolic control and conditions in the tissue microenvironment. The serine/threonine kinase mammalian/mechanistic target of rapamycin (mTOR) is a central integrator of extracellular and intracellular growth signals and cellular metabolism and plays important roles in both innate and adaptive immune responses. This review discusses the function of mTOR signaling in the differentiation and function of tissue-resident immune cells, with focus on the role of mTOR as a metabolic sensor and its impact on metabolic regulation in innate and adaptive immune cells. We also discuss the impact of metabolic constraints in tissues on immune homeostasis and disease, and how manipulating mTOR activity with drugs such as rapamycin can modulate immunity in these contexts. Copyright © 2017. Published by Elsevier Inc.

  7. Barriers in EU retail financial markets

    OpenAIRE

    Micuda, Dan

    2007-01-01

    Looking at the retail financial markets and identifing a number of ‘‘natural’’ and ‘‘policy induced’’ obstacles to free trade. We use the term ‘‘natural’’ barriers to refer to those arising as a result of different cultures or consumer preferences, while different state tax policies or regulations are classified as ‘‘policy induced’’ barriers.

  8. Small and long regulatory RNAs in the immune system and immune diseases

    NARCIS (Netherlands)

    Stachurska, Anna; Zorro, Maria M.; van der Sijde, Marijke R.; Withoff, Sebo

    2014-01-01

    Cellular differentiation is regulated on the level of gene expression, and it is known that dysregulation of gene expression can lead to deficiencies in differentiation that contribute to a variety of diseases, particularly of the immune system. Until recently, it was thought that the dysregulation

  9. Non-classical mechanisms of transcriptional regulation by the vitamin D receptor: insights into calcium homeostasis, immune system regulation and cancer chemoprevention.

    Science.gov (United States)

    Dimitrov, Vassil; Salehi-Tabar, Reyhaneh; An, Beum-Soo; White, John H

    2014-10-01

    Hormonal 1,25-dihydroxyvitamin D [1,25(OH)2D] signals through the nuclear vitamin D receptor (VDR), a ligand-regulated transcription factor. Gene expression profiling studies have revealed that 1,25(OH)2D signaling through the VDR can lead to activation or repression of target gene transcription in roughly equal proportions. Classically, transcriptional regulation by the VDR, similar to other nuclear receptors, has been characterized by its capacity to recognize high affinity cognate vitamin D response elements (VDREs), located in the regulatory regions of target genes. Several biochemical studies revealed that the VDRE-bound receptor recruits a series of coregulatory proteins, leading to transactivation of adjacent target genes. However, genome-wide and other analyses of VDR binding have revealed that a subset of VDR binding sites does not contain VDREs, and that VDREs are not associated with transcriptionally repressed VDR target genes. Work over the last ∼20 years and in particular recent findings have revealed a diverse array of mechanisms by which VDR can form complexes with several other classes of transcriptional activators, leading to repression of gene transcription. Moreover, these efforts have led to several insights into the molecular basis for the physiological regulation of calcium homeostasis, immune system function and cancer chemoprevention by 1,25(OH)2D/VDR signaling. This article is part of a Special Issue entitled '16th Vitamin D Workshop'. Copyright © 2013 Elsevier Ltd. All rights reserved.

  10. Nubbin isoform antagonism governs Drosophila intestinal immune homeostasis.

    Directory of Open Access Journals (Sweden)

    Bo G Lindberg

    2018-03-01

    Full Text Available Gut immunity is regulated by intricate and dynamic mechanisms to ensure homeostasis despite a constantly changing microbial environment. Several regulatory factors have been described to participate in feedback responses to prevent aberrant immune activity. Little is, however, known about how transcriptional programs are directly tuned to efficiently adapt host gut tissues to the current microbiome. Here we show that the POU/Oct gene nubbin (nub encodes two transcription factor isoforms, Nub-PB and Nub-PD, which antagonistically regulate immune gene expression in Drosophila. Global transcriptional profiling of adult flies overexpressing Nub-PB in immunocompetent tissues revealed that this form is a strong transcriptional activator of a large set of immune genes. Further genetic analyses showed that Nub-PB is sufficient to drive expression both independently and in conjunction with nuclear factor kappa B (NF-κB, JNK and JAK/STAT pathways. Similar overexpression of Nub-PD did, conversely, repress expression of the same targets. Strikingly, isoform co-overexpression normalized immune gene transcription, suggesting antagonistic activities. RNAi-mediated knockdown of individual nub transcripts in enterocytes confirmed antagonistic regulation by the two isoforms and that both are necessary for normal immune gene transcription in the midgut. Furthermore, enterocyte-specific Nub-PB expression levels had a strong impact on gut bacterial load as well as host lifespan. Overexpression of Nub-PB enhanced bacterial clearance of ingested Erwinia carotovora carotovora 15. Nevertheless, flies quickly succumbed to the infection, suggesting a deleterious immune response. In line with this, prolonged overexpression promoted a proinflammatory signature in the gut with induction of JNK and JAK/STAT pathways, increased apoptosis and stem cell proliferation. These findings highlight a novel regulatory mechanism of host-microbe interactions mediated by antagonistic

  11. Oestrogen, an evolutionary conserved regulator of T cell differentiation and immune tolerance in jawed vertebrates?

    Science.gov (United States)

    Paiola, Matthieu; Knigge, Thomas; Duflot, Aurélie; Pinto, Patricia I S; Farcy, Emilie; Monsinjon, Tiphaine

    2018-07-01

    In teleosts, as in mammals, the immune system is tightly regulated by sexual steroid hormones, such as oestrogens. We investigated the effects of 17β-oestradiol on the expression of several genes related to T cell development and resulting T cell subpopulations in sea bass, Dicentrarchus labrax, for a primary lymphoid organ, the thymus, and two secondary lymphoid organs, the head-kidney and the spleen. In parallel, the oxidative burst capacity was assessed in leucocytes of the secondary lymphoid organs. Apoptosis- and proliferation-related genes, indicative of B and T cell clonal selection and lymphoid progenitor activity, were not affected by elevated oestrogen-levels. Sex-related oestrogen-responsiveness in T cell and antigen-presenting cell markers was observed, the expression of which was differentially induced by oestrogen-exposure in the three lymphoid organs. Remarkably, in the spleen, oestrogen increased regulatory T cell-related gene expression was associated with a decrease in oxidative burst capacity. To the best of our knowledge, this study indicates for the first time that physiological levels of oestrogen are likely to promote immune tolerance by modulating thymic function (i.e., T cell development and output) and peripheral T cells in teleosts, similar to previously reported oestrogenic effects in mammals. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Zinc Signals and Immunity.

    Science.gov (United States)

    Maywald, Martina; Wessels, Inga; Rink, Lothar

    2017-10-24

    Zinc homeostasis is crucial for an adequate function of the immune system. Zinc deficiency as well as zinc excess result in severe disturbances in immune cell numbers and activities, which can result in increased susceptibility to infections and development of especially inflammatory diseases. This review focuses on the role of zinc in regulating intracellular signaling pathways in innate as well as adaptive immune cells. Main underlying molecular mechanisms and targets affected by altered zinc homeostasis, including kinases, caspases, phosphatases, and phosphodiesterases, will be highlighted in this article. In addition, the interplay of zinc homeostasis and the redox metabolism in affecting intracellular signaling will be emphasized. Key signaling pathways will be described in detail for the different cell types of the immune system. In this, effects of fast zinc flux, taking place within a few seconds to minutes will be distinguish from slower types of zinc signals, also designated as "zinc waves", and late homeostatic zinc signals regarding prolonged changes in intracellular zinc.

  13. 31 CFR 357.23 - Judicial proceedings-sovereign immunity.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Judicial proceedings-sovereign immunity. 357.23 Section 357.23 Money and Finance: Treasury Regulations Relating to Money and Finance... Securities System (Legacy Treasury Direct) § 357.23 Judicial proceedings—sovereign immunity. (a) Department...

  14. Estradiol-induced vaginal mucus inhibits antigen penetration and CD8(+) T cell priming in response to intravaginal immunization.

    Science.gov (United States)

    Seavey, Matthew M; Mosmann, Tim R

    2009-04-14

    Although vaginal immunization has been explored as a strategy to induce mucosal immunity in the female reproductive tract, this site displays unique immunological features that probably evolved to inhibit anti-paternal T cell responses after insemination to allow successful pregnancy. We previously demonstrated that estradiol, which induces an estrus-like state, prevented CD8(+) T cell priming during intravaginal immunization of mice. We now show that estradiol prevented antigen loading of vaginal antigen presenting cells (APCs) after intravaginal immunization. Histological examination confirmed that estradiol prevented penetration of peptide antigen into the vaginal wall. Removal of the estradiol-induced mucus barrier by mucinase partially restored antigen loading of vaginal APC and CD8(+) T cell proliferation in vivo. The estradiol-induced mucus barrier may thus prevent exposure to antigens delivered intravaginally, supplementing additional estradiol-dependent mechanism(s) that inhibit CD8(+) T cell priming after insemination or vaginal vaccination.

  15. Estradiol-induced vaginal mucus inhibits antigen penetration and CD8+ T cell priming in response to intravaginal immunization

    Science.gov (United States)

    Seavey, Matthew M.; Mosmann, Tim R.

    2010-01-01

    Although vaginal immunization has been explored as a strategy to induce mucosal immunity in the female reproductive tract, this site displays unique immunological features that probably evolved to inhibit anti-paternal T cell responses after insemination to allow successful pregnancy. We previously demonstrated that estradiol, which induces an estrus-like state, prevented CD8+ T cell priming during intravaginal immunization of mice. We now show that estradiol prevented antigen loading of vaginal antigen presenting cells (APC) after intravaginal immunization. Histological examination confirmed that estradiol prevented penetration of peptide antigen into the vaginal wall. Removal of the estradiol-induced mucus barrier by mucinase partially restored antigen loading of vaginal APC and CD8+ T cell proliferation in vivo. The estradiol-induced mucus barrier may thus prevent exposure to antigens delivered intravaginally, supplementing additional estradiol-dependent mechanism(s) that inhibit CD8+ T cell priming after insemination or vaginal vaccination. PMID:19428849

  16. Childhood immunizations in China: disparities in health care access in children born to North Korean refugees.

    Science.gov (United States)

    Chung, Hyun Jung; Han, Seung Hyun; Kim, Hyerang; Finkelstein, Julia L

    2016-04-13

    Childhood immunization rates are at an all-time high globally, and national data for China suggests close to universal coverage. Refugees from North Korea and their children may have more limited health care access in China due to their legal status. However, there is no data on immunization rates or barriers to coverage in this population. This study was conducted to determine the rates and correlates of immunizations in children (≥1 year) born to North Korean refugees in Yanbien, China. Child immunization data was obtained from vaccination cards and caregiver self-report for 7 vaccines and 1:3:3:3:1 series. Age-appropriate vaccination rates of refugee children were compared to Chinese and migrant children using a goodness-of-fit test. Logistic regression was used to determine correlates of immunization coverage for each vaccine and the 1:3:3:3:1 series. Age-appropriate immunization coverage rates were significantly lower in children born to North Korean refugees (12.1-97.8 %), compared to Chinese (99 %) and migrant (95 %) children. Increased father's age and having a sibling predicted significantly lower vaccination rates. Children born to North Korean refugees had significantly lower immunization rates, compared to Chinese or migrant children. Further research is needed to examine barriers of health care access in this high-risk population.

  17. Influence of intestinal early enteral nutrition therapy on intestinal barrier function and immune response of patients with radiation enteritis

    International Nuclear Information System (INIS)

    Liu Guohui; Kang Xin; Chen Gong; Wang Guangyi

    2012-01-01

    Objective: To investigate the influence of early enteral nutrition therapy on the intestinal barrier function and immune response of the patients with radiation enteritis (ER) so as to find a relatively simple and effective method to treat RE. Methods: Fifty-six patients with radiation enteritis (RE) diagnosed by colonoscopy, X-rays, and pathology were randomly divided into 2 equal groups: experimental group undergoing enteral nutrition therapy, and control group undergoing conventional therapy only. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Five cases from the experimental group and 5 cases from the control group underwent second-time operation because of incomplete intestinal obstruction, intestinal stenosis, or recurrent tumor respectively. The biopsy specimens of the terminal ileum or distal descending colon taken during the first and second operations underwent pathological examination. Peripheral blood samples were collected 1, 11, and 21 days after admission. Plasma diamine oxidase (DAO), D-lactic acid, endotoxin, and lactulose/mannitol (L/M) ratio, and levels of IgG, IgM, and IgA, and CD4/CD8 ratio were examined. Results: There were no significant differences in the intestinal function and blood immunological indices between these 2 groups. The levels of DAO, D-lactic acid, and endotoxin,and the L/M ratio 11 days after admission of the experiment group were all significantly lower than those of the control group (t=2.568, 2.427, 2.143, 2.443, P<0.05), and all those indices 21 days after admission of the experiment group were all much more significantly lower in comparison with the control group (t=6.019, 12.834, 7.837, 7.997, P<0.01). The levels of IgG, IgM, and IgA, and CD4/CD8 ratio 11 days after admission of the experimental group were all significantly higher than

  18. Immunomodulator, immunosuppression of radiation and immune reconstruction

    International Nuclear Information System (INIS)

    Mao Jianping; Fang Jing; Zhou Ying; Cui Yufang; Jiang Zhujun; Du Li; Ma Qiong

    2010-01-01

    There is a refined and complicated regulatory network between immune cells, and between immune cells and secretory factors. The immune system is kept in a homeostasis and equilibrium by positive activation and negative inhibition. In recent years, the mechanisms of immunosuppression in depth for successful allograft transplantation were studied, and many immunosuppressants and immunosuppressive drugs have been developed for clinical use. Most of them are targeting T cell receptors and three kinds of singnal pathways. The receptors of the immunosuppression were either found highly expressed in immune cells after irradiation. To relieve the suppression by regulating the receptors could help the immune reconstruction out of radiation damage. Many new immunoenhancers have been discovered to improve the immune system function for radiation by Toll-like receptors. The search for new immunoenhancers and agents for relieving immunosuppression is of great importance to immune construction for radiation sickness. (authors)

  19. Mucosal pathobiology and molecular signature of epithelial barrier dysfunction in the small intestine in irritable bowel syndrome.

    Science.gov (United States)

    González-Castro, Ana M; Martínez, Cristina; Salvo-Romero, Eloísa; Fortea, Marina; Pardo-Camacho, Cristina; Pérez-Berezo, Teresa; Alonso-Cotoner, Carmen; Santos, Javier; Vicario, María

    2017-01-01

    Irritable bowel syndrome (IBS) is one of the most prevalent gastrointestinal disorders in developed countries. Its etiology remains unknown; however, a common finding, regardless of IBS subtype, is the presence of altered intestinal barrier. In fact, signaling and location of cell-to-cell adhesion proteins, in connection with increased immune activity, seem abnormal in the intestinal epithelium of IBS patients. Despite that most research is performed on distal segments of the intestine, altered permeability has been reported in both, the small and the large bowel of all IBS subtypes. The small intestine carries out digestion and nutrient absorption and is also the site where the majority of immune responses to luminal antigens takes place. In fact, the upper intestine is more exposed to environmental antigens than the colon and is also a site of symptom generation. Recent studies have revealed small intestinal structural alterations of the epithelial barrier and mucosal immune activation in association with intestinal dysfunction, suggesting the commitment of the intestine as a whole in the pathogenesis of IBS. This review summarizes the most recent findings on mucosal barrier alterations and its relationship to symptoms arising from the small intestine in IBS, including epithelial structural abnormalities, mucosal immune activation, and microbial dysbiosis, further supporting the hypothesis of an organic origin of IBS. © 2016 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

  20. Early Life Microbiota, Neonatal Immune Maturation and Hematopoiesis

    DEFF Research Database (Denmark)

    Kristensen, Matilde Bylov

    Emerging epidemiologic data supports the hypothesis that early life colonization is a key player in development of a balanced immune system. Events in early life, as birth mode and infant diet, are shown to influence development of immune related diseases, like asthma, diabetes and inflammatory...... bowl disease, later in life. The intestinal epithelium makes up a physical and biochemical barrier between the bacteria in the gut lumen and the immune cells in the submocusal tissue. This monolayer of intestinal epithelial cells (IEC) makes up an extremely large surface and is highly important...... for the synergistic coexistence between trillions of bacteria in the gastrointestinal tract and their mammalian hosts. The IEC actively communicate with the microbiota of the gut lumen and tolerance establishment in the intestine is induced as a result of a balanced and controlled communication between IEC...

  1. An analysis of potential barriers and enablers to regulating the television marketing of unhealthy foods to children at the state government level in Australia.

    Science.gov (United States)

    Chung, Alexandra; Shill, Jane; Swinburn, Boyd; Mavoa, Helen; Lawrence, Mark; Loff, Bebe; Crammond, Bradley; Sacks, Gary; Allender, Steven; Peeters, Anna

    2012-12-28

    In Australia there have been many calls for government action to halt the effects of unhealthy food marketing on children's health, yet implementation has not occurred. The attitudes of those involved in the policy-making process towards regulatory intervention governing unhealthy food marketing are not well understood. The objective of this research was to understand the perceptions of senior representatives from Australian state and territory governments, statutory authorities and non-government organisations regarding the feasibility of state-level government regulation of television marketing of unhealthy food to children in Australia. Data from in-depth semi-structured interviews with senior representatives from state and territory government departments, statutory authorities and non-government organisations (n=22) were analysed to determine participants' views about regulation of television marketing of unhealthy food to children at the state government level. Data were analysed using content and thematic analyses. Regulation of television marketing of unhealthy food to children was supported as a strategy for obesity prevention. Barriers to implementing regulation at the state level were: the perception that regulation of television advertising is a Commonwealth, not state/territory, responsibility; the power of the food industry and; the need for clear evidence that demonstrates the effectiveness of regulation. Evidence of community support for regulation was also cited as an important factor in determining feasibility. The regulation of unhealthy food marketing to children is perceived to be a feasible strategy for obesity prevention however barriers to implementation at the state level exist. Those involved in state-level policy making generally indicated a preference for Commonwealth-led regulation. This research suggests that implementation of regulation of the television marketing of unhealthy food to children should ideally occur under the direction

  2. An analysis of potential barriers and enablers to regulating the television marketing of unhealthy foods to children at the state government level in Australia

    Directory of Open Access Journals (Sweden)

    Chung Alexandra

    2012-12-01

    Full Text Available Abstract Background In Australia there have been many calls for government action to halt the effects of unhealthy food marketing on children's health, yet implementation has not occurred. The attitudes of those involved in the policy-making process towards regulatory intervention governing unhealthy food marketing are not well understood. The objective of this research was to understand the perceptions of senior representatives from Australian state and territory governments, statutory authorities and non-government organisations regarding the feasibility of state-level government regulation of television marketing of unhealthy food to children in Australia. Method Data from in-depth semi-structured interviews with senior representatives from state and territory government departments, statutory authorities and non-government organisations (n=22 were analysed to determine participants' views about regulation of television marketing of unhealthy food to children at the state government level. Data were analysed using content and thematic analyses. Results Regulation of television marketing of unhealthy food to children was supported as a strategy for obesity prevention. Barriers to implementing regulation at the state level were: the perception that regulation of television advertising is a Commonwealth, not state/territory, responsibility; the power of the food industry and; the need for clear evidence that demonstrates the effectiveness of regulation. Evidence of community support for regulation was also cited as an important factor in determining feasibility. Conclusions The regulation of unhealthy food marketing to children is perceived to be a feasible strategy for obesity prevention however barriers to implementation at the state level exist. Those involved in state-level policy making generally indicated a preference for Commonwealth-led regulation. This research suggests that implementation of regulation of the television marketing of

  3. RNase L Interacts with Filamin A To Regulate Actin Dynamics and Barrier Function for Viral Entry

    Science.gov (United States)

    Siddiqui, Mohammad Adnan; Dayal, Shubham; Naji, Merna; Ezelle, Heather J.; Zeng, Chun; Zhou, Aimin; Hassel, Bret A.

    2014-01-01

    ABSTRACT The actin cytoskeleton and its network of associated proteins constitute a physical barrier that viruses must circumvent to gain entry into cells for productive infection. The mechanisms by which the physical signals of infection are sensed by the host to activate an innate immune response are not well understood. The antiviral endoribonuclease RNase L is ubiquitously expressed in a latent form and activated upon binding 2-5A, a unique oligoadenylate produced during viral infections. We provide evidence that RNase L in its inactive form interacts with the actin-binding protein Filamin A to modulate the actin cytoskeleton and inhibit virus entry. Cells lacking either RNase L or Filamin A displayed increased virus entry which was exacerbated in cells lacking both proteins. RNase L deletion mutants that reduced Filamin A interaction displayed a compromised ability to restrict virus entry, supporting the idea of an important role for the RNase L-Filamin A complex in barrier function. Remarkably, both the wild type and a catalytically inactive RNase L mutant were competent to reduce virus entry when transfected into RNase L-deficient cells, indicating that this novel function of RNase L is independent of its enzymatic activity. Virus infection and RNase L activation disrupt its association with Filamin A and release RNase L to mediate its canonical nuclease-dependent antiviral activities. The dual functions of RNase L as a constitutive component of the actin cytoskeleton and as an induced mediator of antiviral signaling and effector functions provide insights into its mechanisms of antiviral activity and opportunities for the development of novel antiviral agents. PMID:25352621

  4. Honey constituents up-regulate detoxification and immunity genes in the western honey bee Apis mellifera.

    Science.gov (United States)

    Mao, Wenfu; Schuler, Mary A; Berenbaum, May R

    2013-05-28

    As a managed pollinator, the honey bee Apis mellifera is critical to the American agricultural enterprise. Recent colony losses have thus raised concerns; possible explanations for bee decline include nutritional deficiencies and exposures to pesticides and pathogens. We determined that constituents found in honey, including p-coumaric acid, pinocembrin, and pinobanksin 5-methyl ether, specifically induce detoxification genes. These inducers are primarily found not in nectar but in pollen in the case of p-coumaric acid (a monomer of sporopollenin, the principal constituent of pollen cell walls) and propolis, a resinous material gathered and processed by bees to line wax cells. RNA-seq analysis (massively parallel RNA sequencing) revealed that p-coumaric acid specifically up-regulates all classes of detoxification genes as well as select antimicrobial peptide genes. This up-regulation has functional significance in that that adding p-coumaric acid to a diet of sucrose increases midgut metabolism of coumaphos, a widely used in-hive acaricide, by ∼60%. As a major component of pollen grains, p-coumaric acid is ubiquitous in the natural diet of honey bees and may function as a nutraceutical regulating immune and detoxification processes. The widespread apicultural use of honey substitutes, including high-fructose corn syrup, may thus compromise the ability of honey bees to cope with pesticides and pathogens and contribute to colony losses.

  5. Linear ubiquitination in immunity.

    Science.gov (United States)

    Shimizu, Yutaka; Taraborrelli, Lucia; Walczak, Henning

    2015-07-01

    Linear ubiquitination is a post-translational protein modification recently discovered to be crucial for innate and adaptive immune signaling. The function of linear ubiquitin chains is regulated at multiple levels: generation, recognition, and removal. These chains are generated by the linear ubiquitin chain assembly complex (LUBAC), the only known ubiquitin E3 capable of forming the linear ubiquitin linkage de novo. LUBAC is not only relevant for activation of nuclear factor-κB (NF-κB) and mitogen-activated protein kinases (MAPKs) in various signaling pathways, but importantly, it also regulates cell death downstream of immune receptors capable of inducing this response. Recognition of the linear ubiquitin linkage is specifically mediated by certain ubiquitin receptors, which is crucial for translation into the intended signaling outputs. LUBAC deficiency results in attenuated gene activation and increased cell death, causing pathologic conditions in both, mice, and humans. Removal of ubiquitin chains is mediated by deubiquitinases (DUBs). Two of them, OTULIN and CYLD, are constitutively associated with LUBAC. Here, we review the current knowledge on linear ubiquitination in immune signaling pathways and the biochemical mechanisms as to how linear polyubiquitin exerts its functions distinctly from those of other ubiquitin linkage types. © 2015 The Authors. Immunological Reviews Published by John Wiley & Sons Ltd.

  6. Role of immune system in tumor progression and carcinogenesis.

    Science.gov (United States)

    Upadhyay, Shishir; Sharma, Nidhi; Gupta, Kunj Bihari; Dhiman, Monisha

    2018-01-12

    Tumor micro-environment has potential to customize the behavior of the immune cell according to their need. In immune-eliminating phase, immune cells eliminate transformed cells but after tumor establishment innate and adaptive immune cells synergistically provide shelter as well as fulfill their requirement that helps in progression. In between eliminating and establishment phase, equilibrium and escaping phase regulate the immune cells response. During immune-escaping, (1) the antigenic response generated is either inadequate, or focused entirely on tolerance, and (2) immune response generated is specific and effective, but the tumor skips immune recognition. In this review, we are discussing the critical role of immune cells and their cytokines before and after the establishment of tumor which might play a critical role during immunotherapy. © 2018 Wiley Periodicals, Inc.

  7. Natural killer cells enhance the immune surveillance of cancer

    African Journals Online (AJOL)

    Faisal Nouroz

    2015-09-11

    Sep 11, 2015 ... and lymphocytes, while AIR is comprised of T and B lymphocytes. All the cells of the .... through blood and physical barriers and both immunities cor- respond with each other .... Cancer stem cells (CSCs) retain the growth of tumor and resist .... kidney, liver, heart and lung transplant recipients 1970 to 2008.

  8. Immune physiology in tissue regeneration and aging, tumor growth, and regenerative medicine.

    Science.gov (United States)

    Bukovsky, Antonin; Caudle, Michael R; Carson, Ray J; Gaytán, Francisco; Huleihel, Mahmoud; Kruse, Andrea; Schatten, Heide; Telleria, Carlos M

    2009-02-13

    The immune system plays an important role in immunity (immune surveillance), but also in the regulation of tissue homeostasis (immune physiology). Lessons from the female reproductive tract indicate that immune system related cells, such as intraepithelial T cells and monocyte-derived cells (MDC) in stratified epithelium, interact amongst themselves and degenerate whereas epithelial cells proliferate and differentiate. In adult ovaries, MDC and T cells are present during oocyte renewal from ovarian stem cells. Activated MDC are also associated with follicular development and atresia, and corpus luteum differentiation. Corpus luteum demise resembles rejection of a graft since it is attended by a massive influx of MDC and T cells resulting in parenchymal and vascular regression. Vascular pericytes play important roles in immune physiology, and their activities (including secretion of the Thy-1 differentiation protein) can be regulated by vascular autonomic innervation. In tumors, MDC regulate proliferation of neoplastic cells and angiogenesis. Tumor infiltrating T cells die among malignant cells. Alterations of immune physiology can result in pathology, such as autoimmune, metabolic, and degenerative diseases, but also in infertility and intrauterine growth retardation, fetal morbidity and mortality. Animal experiments indicate that modification of tissue differentiation (retardation or acceleration) during immune adaptation can cause malfunction (persistent immaturity or premature aging) of such tissue during adulthood. Thus successful stem cell therapy will depend on immune physiology in targeted tissues. From this point of view, regenerative medicine is more likely to be successful in acute rather than chronic tissue disorders.

  9. Assessment of Routine Immunization Coverage in Nyala Locality, Reasons behind Incomplete Immunization in South Darfur State, Sudan

    OpenAIRE

    Ismail, Ismail Tibin Adam; El-Tayeb, Elsadeg Mahgoob; Omer, Mohammed Diaaeldin F.A.; Eltahir, Yassir Mohammed; El-Sayed, El-Tayeb Ahmed; Deribe, Kebede

    2014-01-01

    Little is known about the coverage of routine immunization service in South Darfur state, Sudan. Therefore, this study was conducted to determine the vaccination rate and barriers for vaccination. A cross-sectional community-based study was undertaken in Nyala locality, south Darfur, Sudan, including urban, rural and Internal Displaced Peoples (IDPs) population in proportional representation. Survey data were collected by a questionnaire which was applied face to face to parents of 213 childr...

  10. Immune system development during early childhood in tropical Latin America: evidence for the age-dependent down regulation of the innate immune response.

    Science.gov (United States)

    Teran, Rommy; Mitre, Edward; Vaca, Maritza; Erazo, Silvia; Oviedo, Gisela; Hübner, Marc P; Chico, Martha E; Mattapallil, Joseph J; Bickle, Quentin; Rodrigues, Laura C; Cooper, Philip J

    2011-03-01

    The immune response that develops in early childhood underlies the development of inflammatory diseases such as asthma and there are few data from tropical Latin America (LA). This study investigated the effects of age on the development of immunity during the first 5 years of life by comparing innate and adaptive immune responses in Ecuadorian children aged 6-9 months, 22-26 months, and 48-60 months. Percentages of naïve CD4+ T cells declined with age while those of memory CD4(+) and CD8(+) T cells increased indicating active development of the immune system throughout the first five years. Young infants had greater innate immune responses to TLR agonists compared to older children while regulatory responses including SEB-induced IL-10 and percentages of FoxP3(+) T-regulatory cells decreased with age. Enhanced innate immunity in early life may be important for host defense against pathogens but may increase the risk of immunopathology. Copyright © 2010 Elsevier Inc. All rights reserved.

  11. PPARgamma in immunity and inflammation: cell types and diseases.

    Science.gov (United States)

    Széles, Lajos; Töröcsik, Dániel; Nagy, László

    2007-08-01

    The lipid activated transcription factor, PPARgamma appears to have multiple functions in the immune system. There are several cell types expressing the receptor, most prominently antigen presenting cells, such as macrophages and dendritic cells. The receptor's activation leads to primary transcriptional activation of many, mostly lipid metabolism-related genes. However, gene regulation also occurs on immunity and inflammation-related genes. Key questions are: in what way lipid metabolism and immune regulation are connected and how activation and/or repression of gene expression may modulate inflammatory and anti-inflammatory responses and in what way can these be utilized in therapy. Here we provide a cell type and disease centric review on the role of this lipid activated transcription factor in the various cells of the immune system it is expressed in, and in some major inflammatory diseases such as atherosclerosis, inflammatory bowel disease and rheumatoid arthritis.

  12. big bang gene modulates gut immune tolerance in Drosophila.

    Science.gov (United States)

    Bonnay, François; Cohen-Berros, Eva; Hoffmann, Martine; Kim, Sabrina Y; Boulianne, Gabrielle L; Hoffmann, Jules A; Matt, Nicolas; Reichhart, Jean-Marc

    2013-02-19

    Chronic inflammation of the intestine is detrimental to mammals. Similarly, constant activation of the immune response in the gut by the endogenous flora is suspected to be harmful to Drosophila. Therefore, the innate immune response in the gut of Drosophila melanogaster is tightly balanced to simultaneously prevent infections by pathogenic microorganisms and tolerate the endogenous flora. Here we describe the role of the big bang (bbg) gene, encoding multiple membrane-associated PDZ (PSD-95, Discs-large, ZO-1) domain-containing protein isoforms, in the modulation of the gut immune response. We show that in the adult Drosophila midgut, BBG is present at the level of the septate junctions, on the apical side of the enterocytes. In the absence of BBG, these junctions become loose, enabling the intestinal flora to trigger a constitutive activation of the anterior midgut immune response. This chronic epithelial inflammation leads to a reduced lifespan of bbg mutant flies. Clearing the commensal flora by antibiotics prevents the abnormal activation of the gut immune response and restores a normal lifespan. We now provide genetic evidence that Drosophila septate junctions are part of the gut immune barrier, a function that is evolutionarily conserved in mammals. Collectively, our data suggest that septate junctions are required to maintain the subtle balance between immune tolerance and immune response in the Drosophila gut, which represents a powerful model to study inflammatory bowel diseases.

  13. ROS-activated calcium signaling mechanisms regulating endothelial barrier function.

    Science.gov (United States)

    Di, Anke; Mehta, Dolly; Malik, Asrar B

    2016-09-01

    Increased vascular permeability is a common pathogenic feature in many inflammatory diseases. For example in acute lung injury (ALI) and its most severe form, the acute respiratory distress syndrome (ARDS), lung microvessel endothelia lose their junctional integrity resulting in leakiness of the endothelial barrier and accumulation of protein rich edema. Increased reactive oxygen species (ROS) generated by neutrophils (PMNs) and other inflammatory cells play an important role in increasing endothelial permeability. In essence, multiple inflammatory syndromes are caused by dysfunction and compromise of the barrier properties of the endothelium as a consequence of unregulated acute inflammatory response. This review focuses on the role of ROS signaling in controlling endothelial permeability with particular focus on ALI. We summarize below recent progress in defining signaling events leading to increased endothelial permeability and ALI. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. PPARγ Agonists in Adaptive Immunity: What Do Immune Disorders and Their Models Have to Tell Us?

    Directory of Open Access Journals (Sweden)

    Laurindo Ferreira da Rocha Junior

    2013-01-01

    Full Text Available Adaptive immunity has evolved as a very powerful and highly specialized tool of host defense. Its classical protagonists are lymphocytes of the T- and B-cell lineage. Cytokines and chemokines play a key role as effector mechanisms of the adaptive immunity. Some autoimmune and inflammatory diseases are caused by disturbance of the adaptive immune system. Recent advances in understanding the pathogenesis of autoimmune diseases have led to research on new molecular and therapeutic targets. PPARγ are members of the nuclear receptor superfamily and are transcription factors involved in lipid metabolism as well as innate and adaptive immunity. PPARγ is activated by synthetic and endogenous ligands. Previous studies have shown that PPAR agonists regulate T-cell survival, activation and T helper cell differentiation into effector subsets: Th1, Th2, Th17, and Tregs. PPARγ has also been associated with B cells. The present review addresses these issues by placing PPARγ agonists in the context of adaptive immune responses and the relation of the activation of these receptors with the expression of cytokines involved in adaptive immunity.

  15. MicroRNAs, Innate Immunity and Ventricular Rupture in Human Myocardial Infarction

    Directory of Open Access Journals (Sweden)

    Nina Zidar

    2011-01-01

    Full Text Available MicroRNAs are non-coding RNAs, functionioning as post-transcriptional regulators of gene expression. Some microRNAs have been demonstrated to play a role in regulation of innate immunity. After myocardial infarction (MI, innate immunity is activated leading to an acute inflammatory reaction. There is evidence that an intense inflammatory reaction might contribute to the development of ventricular rupture (VR after MI.

  16. Effects of kefir fractions on innate immunity.

    Science.gov (United States)

    Vinderola, Gabriel; Perdigon, Gabriela; Duarte, Jairo; Thangavel, Deepa; Farnworth, Edward; Matar, Chantal

    2006-01-01

    Innate immunity that protects against pathogens in the tissues and circulation is the first line of defense in the immune reaction, where macrophages have a critical role in directing the fate of the infection. We recently demonstrated that kefir modulates the immune response in mice, increasing the number of IgA+ cells in the intestinal and bronchial mucosa and the phagocytic activity of peritoneal and pulmonary macrophages. The aim of this study was to further characterize the immunomodulating capacity of the two fractions of kefir (F1: solids including bacteria and F2: liquid supernatant), by studying the cytokines produced by cells from the innate immune system: peritoneal macrophages and the adherent cells from Peyer's patches. BALB/c mice were fed either kefir solid fraction (F1) or kefir supernatant (F2) for 2, 5 or 7 consecutive days. The number of cytokine (IL-1alpha, IFNgamma, TNFalpha, IL-6 and IL-10) producing cells was determined on peritoneal macrophages and adherent cells from Peyer's patches. Both kefir fractions (F1 and F2) induced similar cytokine profiles on peritoneal macrophages (only TNFalpha and IL-6 were up-regulated). All cytokines studied on adherent cells from Peyer's patches were enhanced after F1 and F2 feeding, except for IFNgamma after F2 administration. Moreover, the percentage of IL-10+cells induced by fraction F2 on adherent cells from Peyer's patches was significantly higher than the one induced by fraction F1. Different components of kefir have an in vivo role as oral biotherapeutic substances capable of stimulating immune cells of the innate immune system, to down-regulate the Th2 immune phenotype or to promote cell-mediated immune responses against tumours and also against intracellular pathogenic infections.

  17. Cow's Milk and Immune Function in the Respiratory Tract: Potential Mechanisms.

    Science.gov (United States)

    Perdijk, Olaf; van Splunter, Marloes; Savelkoul, Huub F J; Brugman, Sylvia; van Neerven, R J Joost

    2018-01-01

    During the last decades, the world has witnessed a dramatic increase in allergy prevalence. Epidemiological evidence shows that growing up on a farm is a protective factor, which is partly explained by the consumption of raw cow's milk. Indeed, recent studies show inverse associations between raw cow's milk consumption in early life and asthma, hay fever, and rhinitis. A similar association of raw cow's milk consumption with respiratory tract infections is recently found. In line with these findings, controlled studies in infants with milk components such as lactoferrin, milk fat globule membrane, and colostrum IgG have shown to reduce respiratory infections. However, for ethical reasons, it is not possible to conduct controlled studies with raw cow's milk in infants, so formal proof is lacking to date. Because viral respiratory tract infections and aeroallergen exposure in children may be causally linked to the development of asthma, it is of interest to investigate whether cow's milk components can modulate human immune function in the respiratory tract and via which mechanisms. Inhaled allergens and viruses trigger local immune responses in the upper airways in both nasal and oral lymphoid tissue. The components present in raw cow's milk are able to promote a local microenvironment in which mucosal immune responses are modified and the epithelial barrier is enforced. In addition, such responses may also be triggered in the gut after exposure to allergens and viruses in the nasal cavity that become available in the GI tract after swallowing. However, these immune cells that come into contact with cow's milk components in the gut must recirculate into the blood and home to the (upper and lower) respiratory tract to regulate immune responses locally. Expression of the tissue homing-associated markers α4β7 and CCR9 or CCR10 on lymphocytes can be influenced by vitamin A and vitamin D3, respectively. Since both vitamins are present in milk, we speculate that raw

  18. The role of selenium in inflammation and immunity: from molecular mechanisms to therapeutic opportunities.

    Science.gov (United States)

    Huang, Zhi; Rose, Aaron H; Hoffmann, Peter R

    2012-04-01

    Dietary selenium (]Se), mainly through its incorporation into selenoproteins, plays an important role in inflammation and immunity. Adequate levels of Se are important for initiating immunity, but they are also involved in regulating excessive immune responses and chronic inflammation. Evidence has emerged regarding roles for individual selenoproteins in regulating inflammation and immunity, and this has provided important insight into mechanisms by which Se influences these processes. Se deficiency has long been recognized to negatively impact immune cells during activation, differentiation, and proliferation. This is related to increased oxidative stress, but additional functions such as protein folding and calcium flux may also be impaired in immune cells under Se deficient conditions. Supplementing diets with above-adequate levels of Se can also impinge on immune cell function, with some types of inflammation and immunity particularly affected and sexually dimorphic effects of Se levels in some cases. In this comprehensive article, the roles of Se and individual selenoproteins in regulating immune cell signaling and function are discussed. Particular emphasis is given to how Se and selenoproteins are linked to redox signaling, oxidative burst, calcium flux, and the subsequent effector functions of immune cells. Data obtained from cell culture and animal models are reviewed and compared with those involving human physiology and pathophysiology, including the effects of Se levels on inflammatory or immune-related diseases including anti-viral immunity, autoimmunity, sepsis, allergic asthma, and chronic inflammatory disorders. Finally, the benefits and potential adverse effects of intervention with Se supplementation for various inflammatory or immune disorders are discussed.

  19. Innate immunity in the lung regulates the development of asthma.

    Science.gov (United States)

    DeKruyff, Rosemarie H; Yu, Sanhong; Kim, Hye Young; Umetsu, Dale T

    2014-07-01

    The lung, while functioning as a gas exchange organ, encounters a large array of environmental factors, including particulate matter, toxins, reactive oxygen species, chemicals, allergens, and infectious microbes. To rapidly respond to and counteract these elements, a number of innate immune mechanisms have evolved that can lead to lung inflammation and asthma, which is the focus of this review. These innate mechanisms include a role for two incompletely understood cell types, invariant natural killer T (iNKT) cells and innate lymphoid cells (ILCs), which together produce a wide range of cytokines, including interleukin-4 (IL-4), IL-5, IL-13, interferon-γ, IL-17, and IL-22, independently of adaptive immunity and conventional antigens. The specific roles of iNKT cells and ILCs in immunity are still being defined, but both cell types appear to play important roles in the lungs, particularly in asthma. As we gain a better understanding of these innate cell types, we will acquire great insight into the mechanisms by which allergic and non-allergic asthma phenotypes develop. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Stress, depression and immunity: the role of defense and coping styles

    NARCIS (Netherlands)

    Olff, M.

    1999-01-01

    It is by now widely recognized that acute and chronic stress have an impact on the immune system. Acute stress may have a stimulating effect on the immune system, while in the case of chronic stress--and in particular in depression--the immune system may be down-regulated. However, there is

  1. Stress, depression and immunity : the role of defense and coping styles

    NARCIS (Netherlands)

    Olff, M

    1999-01-01

    It is by now widely recognized that acute and chronic stress have an impact on the immune system. Acute stress may have a stimulating effect on the immune system, while in the case of chronic stress - and in particular in depression - the immune system may be down-regulated. However, there is

  2. The Immune System in Irritable Bowel Syndrome

    Science.gov (United States)

    Cremon, Cesare; Carini, Giovanni; Bellacosa, Lara; Zecchi, Lisa; De Giorgio, Roberto; Corinaldesi, Roberto; Stanghellini, Vincenzo

    2011-01-01

    The potential relevance of systemic and gastrointestinal immune activation in the pathophysiology and symptom generation in the irritable bowel syndrome (IBS) is supported by a number of observations. Infectious gastroenteritis is the strongest risk factor for the development of IBS and increased rates of IBS-like symptoms have been detected in patients with inflammatory bowel disease in remission or in celiac disease patients on a gluten free diet. The number of T cells and mast cells in the small and large intestine of patients with IBS is increased in a large proportion of patients with IBS over healthy controls. Mediators released by immune cells and likely from other non-immune competent cells impact on the function of enteric and sensory afferent nerves as well as on epithelial tight junctions controlling mucosal barrier of recipient animals, isolated human gut tissues or cell culture systems. Antibodies against microbiota antigens (bacterial flagellin), and increased levels of cytokines have been detected systemically in the peripheral blood advocating the existence of abnormal host-microbial interactions and systemic immune responses. Nonetheless, there is wide overlap of data obtained in healthy controls; in addition, the subsets of patients showing immune activation have yet to be clearly identified. Gender, age, geographic differences, genetic predisposition, diet and differences in the intestinal microbiota likely play a role and further research has to be done to clarify their relevance as potential mechanisms in the described immune system dysregulation. Immune activation has stimulated interest for the potential identification of biomarkers useful for clinical and research purposes and the development of novel therapeutic approaches. PMID:22148103

  3. Herbal medicines that benefit epidermal permeability barrier function

    Directory of Open Access Journals (Sweden)

    Lizhi Hu

    2015-06-01

    Full Text Available Epidermal permeability barrier function plays a critical role in regulating cutaneous functions. Hence, researchers have been searching for effective and affordable regimens to enhance epidermal permeability barrier function. In addition to topical stratum corneum lipids, peroxisome proliferator-activated receptor, and liver X receptor ligands, herbal medicines have been proven to benefit epidermal permeability barrier function in both normal and diseased skin, including atopic dermatitis, glucocorticoid-induced skin damage, and UVB-damaged skin. The potential mechanisms by which herbal medicines improve the permeability barrier include stimulation of epidermal differentiation, lipid production, antimicrobial peptide expression, and antioxidation. Therefore, utilization of herbal medicines could be a valuable alternative approach to enhance epidermal permeability barrier function in order to prevent and/or treat skin disorders associated with permeability barrier abnormalities.

  4. Mucosal Immune Regulation in Early Infancy: Monitoring and Intervention

    NARCIS (Netherlands)

    J. Hol (Jeroen)

    2011-01-01

    textabstractThe mucosal immune system of infants is dependent on the maintenance of mucosal homeostasis. Homeostasis results from the interaction between the mucosa and exogenous factors such as dietar and microbial agents. Induction and maintenance of homeostasis is a highly regluated system that

  5. Predicting the Role of IL-10 in the Regulation of the Adaptive Immune Responses in Mycobacterium avium Subsp. paratuberculosis Infections Using Mathematical Models

    Science.gov (United States)

    Magombedze, Gesham; Eda, Shigetoshi; Stabel, Judy

    2015-01-01

    Mycobacterium avium subsp. paratuberculosis (MAP) is an intracellular bacterial pathogen that causes Johne’s disease (JD) in cattle and other animals. The hallmark of MAP infection in the early stages is a strong protective cell-mediated immune response (Th1-type), characterized by antigen-specific γ-interferon (IFN-γ). The Th1 response wanes with disease progression and is supplanted by a non-protective humoral immune response (Th2-type). Interleukin-10 (IL-10) is believed to play a critical role in the regulation of host immune responses to MAP infection and potentially orchestrate the reversal of Th1/Th2 immune dominance during disease progression. However, how its role correlates with MAP infection remains to be completely deciphered. We developed mathematical models to explain probable mechanisms for IL-10 involvement in MAP infection. We tested our models with IL-4, IL-10, IFN-γ, and MAP fecal shedding data collected from calves that were experimentally infected and followed over a period of 360 days in the study of Stabel and Robbe-Austerman (2011). Our models predicted that IL-10 can have different roles during MAP infection, (i) it can suppress the Th1 expression, (ii) can enhance Th2 (IL-4) expression, and (iii) can suppress the Th1 expression in synergy with IL-4. In these predicted roles, suppression of Th1 responses was correlated with increased number of MAP. We also predicted that Th1-mediated responses (IFN-γ) can lead to high expression of IL-10 and that infection burden regulates Th2 suppression by the Th1 response. Our models highlight areas where more experimental data is required to refine our model assumptions, and further test and investigate the role of IL-10 in MAP infection. PMID:26619346

  6. Predicting the Role of IL-10 in the Regulation of the Adaptive Immune Responses in Mycobacterium avium Subsp. paratuberculosis Infections Using Mathematical Models.

    Directory of Open Access Journals (Sweden)

    Gesham Magombedze

    Full Text Available Mycobacterium avium subsp. paratuberculosis (MAP is an intracellular bacterial pathogen that causes Johne's disease (JD in cattle and other animals. The hallmark of MAP infection in the early stages is a strong protective cell-mediated immune response (Th1-type, characterized by antigen-specific γ-interferon (IFN-γ. The Th1 response wanes with disease progression and is supplanted by a non-protective humoral immune response (Th2-type. Interleukin-10 (IL-10 is believed to play a critical role in the regulation of host immune responses to MAP infection and potentially orchestrate the reversal of Th1/Th2 immune dominance during disease progression. However, how its role correlates with MAP infection remains to be completely deciphered. We developed mathematical models to explain probable mechanisms for IL-10 involvement in MAP infection. We tested our models with IL-4, IL-10, IFN-γ, and MAP fecal shedding data collected from calves that were experimentally infected and followed over a period of 360 days in the study of Stabel and Robbe-Austerman (2011. Our models predicted that IL-10 can have different roles during MAP infection, (i it can suppress the Th1 expression, (ii can enhance Th2 (IL-4 expression, and (iii can suppress the Th1 expression in synergy with IL-4. In these predicted roles, suppression of Th1 responses was correlated with increased number of MAP. We also predicted that Th1-mediated responses (IFN-γ can lead to high expression of IL-10 and that infection burden regulates Th2 suppression by the Th1 response. Our models highlight areas where more experimental data is required to refine our model assumptions, and further test and investigate the role of IL-10 in MAP infection.

  7. Dissecting Phaseolus vulgaris innate immune system against Colletotrichum lindemuthianum infection.

    Directory of Open Access Journals (Sweden)

    Paula Rodrigues Oblessuc

    Full Text Available BACKGROUND: The genus Colletotrichum is one of the most economically important plant pathogens, causing anthracnose on a wide range of crops including common beans (Phaseolus vulgaris L.. Crop yield can be dramatically decreased depending on the plant cultivar used and the environmental conditions. This study aimed to identify potential genetic components of the bean immune system to provide environmentally friendly control measures against this fungus. METHODOLOGY AND PRINCIPAL FINDINGS: As the common bean is not amenable to reverse genetics to explore functionality and its genome is not fully curated, we used putative Arabidopsis orthologs of bean expressed sequence tag (EST to perform bioinformatic analysis and experimental validation of gene expression to identify common bean genes regulated during the incompatible interaction with C. lindemuthianum. Similar to model pathosystems, Gene Ontology (GO analysis indicated that hormone biosynthesis and signaling in common beans seem to be modulated by fungus infection. For instance, cytokinin and ethylene responses were up-regulated and jasmonic acid, gibberellin, and abscisic acid responses were down-regulated, indicating that these hormones may play a central role in this pathosystem. Importantly, we have identified putative bean gene orthologs of Arabidopsis genes involved in the plant immune system. Based on experimental validation of gene expression, we propose that hypersensitive reaction as part of effector-triggered immunity may operate, at least in part, by down-regulating genes, such as FLS2-like and MKK5-like, putative orthologs of the Arabidopsis genes involved in pathogen perception and downstream signaling. CONCLUSIONS/SIGNIFICANCE: We have identified specific bean genes and uncovered metabolic processes and pathways that may be involved in the immune response against pathogens. Our transcriptome database is a rich resource for mining novel defense-related genes, which enabled us to

  8. Trachoma: protective and pathogenic ocular immune responses to Chlamydia trachomatis.

    Directory of Open Access Journals (Sweden)

    Victor H Hu

    Full Text Available Trachoma, caused by Chlamydia trachomatis (Ct, is the leading infectious blinding disease worldwide. Chronic conjunctival inflammation develops in childhood and leads to eyelid scarring and blindness in adulthood. The immune response to Ct provides only partial protection against re-infection, which can be frequent. Moreover, the immune response is central to the development of scarring pathology, leading to loss of vision. Here we review the current literature on both protective and pathological immune responses in trachoma. The resolution of Ct infection in animal models is IFNγ-dependent, involving Th1 cells, but whether this is the case in human ocular infection still needs to be confirmed. An increasing number of studies indicate that innate immune responses arising from the epithelium and other innate immune cells, along with changes in matrix metalloproteinase activity, are important in the development of tissue damage and scarring. Current trachoma control measures, which are centred on repeated mass antibiotic treatment of populations, are logistically challenging and have the potential to drive antimicrobial resistance. A trachoma vaccine would offer significant advantages. However, limited understanding of the mechanisms of both protective immunity and immunopathology to Ct remain barriers to vaccine development.

  9. NKT cell self-reactivity: evolutionary master key of immune homeostasis?

    Science.gov (United States)

    Issazadeh-Navikas, Shohreh

    2012-04-01

    Complex immune responses have evolved to protect multicellular organisms against the invasion of pathogens. This has exerted strong developmental pressure for specialized functions that can also limit damage to self-tissue. Two arms of immunity, the innate and adaptive immune systems, have evolved for quick, non-specific immune responses to pathogens and more efficient, long-lasting ones upon specific recognition of recurrent pathogens. Specialized cells have arisen as the sentinels of these functions, including macrophages, natural killer (NK), and T and B-lymphocytes. Interestingly, a population of immune cells that can exert both of these complex functions, NKT cells, not only share common functions but also exhibit shared cell surface markers of cells of both arms of the immune system. These features, in combination with sophisticated maintenance of immune homeostasis, will be discussed. The recent finding of self-peptide reactivity of NKT cells in the context of CD1d, with capacity to regulate multiple autoimmune and inflammatory conditions, motivates the current proposal that self-reactive NKT cells might be the ancestral link between present NK and T cells. Their parallel selection through evolution by higher vertebrates could be related to their central function as master regulators of immune homeostasis that in part is shared with regulatory T cells. Hypothetical views on how self-reactive NKT cells secure such a central role will also be proposed.

  10. The vagal innervation of the gut and immune homeostasis

    NARCIS (Netherlands)

    Matteoli, Gianluca; Boeckxstaens, Guy E.

    2013-01-01

    The central nervous system interacts dynamically with the immune system to modulate inflammation through humoral and neural pathways. Recently, in animal models of sepsis, the vagus nerve (VN) has been proposed to play a crucial role in the regulation of the immune response, also referred to as the

  11. Regulation of intestinal health by branched-chain amino acids.

    Science.gov (United States)

    Zhou, Hua; Yu, Bing; Gao, Jun; Htoo, John Khun; Chen, Daiwen

    2018-01-01

    Besides its primary role in the digestion and absorption of nutrients, the intestine also interacts with a complex external milieu, and is the first defense line against noxious pathogens and antigens. Dysfunction of the intestinal barrier is associated with enhanced intestinal permeability and development of various gastrointestinal diseases. The branched-chain amino acids (BCAAs) are important nutrients, which are the essential substrates for protein biosynthesis. Recently, emerging evidence showed that BCAAs are involved in maintaining intestinal barrier function. It has been reported that dietary supplementation with BCAAs promotes intestinal development, enhances enterocyte proliferation, increases intestinal absorption of amino acids (AA) and glucose, and improves the immune defenses of piglets. The underlying mechanism of these effects is mediated by regulating expression of genes and proteins associate with various signaling pathways. In addition, BCAAs promote the production of beneficial bacteria in the intestine of mice. Compelling evidence supports the notion that BCAAs play important roles in both nutrition and intestinal health. Therefore, as functional amino acids with various physiological effects, BCAAs hold key roles in promoting intestinal development and health in animals and humans. © 2017 Japanese Society of Animal Science.

  12. The long noncoding RNA TUG1 regulates blood-tumor barrier permeability by targeting miR-144.

    Science.gov (United States)

    Cai, Heng; Xue, Yixue; Wang, Ping; Wang, Zhenhua; Li, Zhen; Hu, Yi; Li, Zhiqing; Shang, Xiuli; Liu, Yunhui

    2015-08-14

    Blood-tumor barrier (BTB) limits the delivery of chemotherapeutic agent to brain tumor tissues. Long non-coding RNAs (lncRNAs) have been shown to play critical regulatory roles in various biologic processes of tumors. However, the role of lncRNAs in BTB permeability is unclear. LncRNA TUG1 (taurine upregulated gene 1) was highly expressed in glioma vascular endothelial cells from glioma tissues. It also upregulated in glioma co-cultured endothelial cells (GEC) from BTB model in vitro. Knockdown of TUG1 increased BTB permeability, and meanwhile down-regulated the expression of the tight junction proteins ZO-1, occludin, and claudin-5. Both bioinformatics and luciferase reporter assays demonstrated that TUG1 influenced BTB permeability via binding to miR-144. Furthermore, Knockdown of TUG1 also down-regulated Heat shock transcription factor 2 (HSF2), a transcription factor of the heat shock transcription factor family, which was defined as a direct and functional downstream target of miR-144. HSF2 up-regulated the promoter activities and interacted with the promoters of ZO-1, occludin, and claudin-5 in GECs. In conclusion, our results indicate that knockdown of TUG1 increased BTB permeability via binding to miR-144 and then reducing EC tight junction protein expression by targeting HSF2. Thus, TUG1 may represent a useful future therapeutic target for enhancing BTB permeability.

  13. The Role of the Immune System in Metabolic Health and Disease.

    Science.gov (United States)

    Zmora, Niv; Bashiardes, Stavros; Levy, Maayan; Elinav, Eran

    2017-03-07

    In addition to the immune system's traditional roles of conferring anti-infectious and anti-neoplastic protection, it has been recently implicated in the regulation of systemic metabolic homeostasis. This cross-talk between the immune and the metabolic systems is pivotal in promoting "metabolic health" throughout the life of an organism and plays fundamental roles in its adaptation to ever-changing environmental makeups and nutritional availability. Perturbations in this intricate immune-metabolic cross-talk contribute to the tendency to develop altered metabolic states that may culminate in metabolic disorders such as malnutrition, obesity, type 2 diabetes mellitus (T2DM), and other features of the metabolic syndrome. Regulators of immune-metabolic interactions include host genetics, nutritional status, and the intestinal microbiome. In this Perspective, we highlight current understanding of immune-metabolism interactions, illustrate differences among individuals and between populations in this respect, and point toward future avenues of research possibly enabling immune harnessing as means of personalized treatment for common metabolic disorders. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. MicroRNA in innate immunity and autophagy during mycobacterial infection.

    Science.gov (United States)

    Kim, Jin Kyung; Kim, Tae Sung; Basu, Joyoti; Jo, Eun-Kyeong

    2017-01-01

    The fine-tuning of innate immune responses is an important aspect of host defenses against mycobacteria. MicroRNAs (miRNAs), small non-coding RNAs, play essential roles in regulating multiple biological pathways including innate host defenses against various infections. Accumulating evidence shows that many miRNAs regulate the complex interplay between mycobacterial survival strategies and host innate immune pathways. Recent studies have contributed to understanding the role of miRNAs, the levels of which can be modulated by mycobacterial infection, in tuning host autophagy to control bacterial survival and innate effector function. Despite considerable efforts devoted to miRNA profiling over the past decade, further work is needed to improve the selection of appropriate biomarkers for tuberculosis. Understanding the roles and mechanisms of miRNAs in regulating innate immune signaling and autophagy may provide insights into new therapeutic modalities for host-directed anti-mycobacterial therapies. Here, we present a comprehensive review of the recent literature regarding miRNA profiling in tuberculosis and the roles of miRNAs in modulating innate immune responses and autophagy defenses against mycobacterial infections. © 2016 John Wiley & Sons Ltd.

  15. Immune mechanisms and immuno therapy of thyroid cancer

    International Nuclear Information System (INIS)

    Samuel, A.M.

    1999-01-01

    In recent years the role of immune mechanisms in the induction and progress of cancer has been established. The importance of oncogenes, growth suppressor genes, gene regulation immune surveillance and the interactions of the various components of the immune system in the pathogenesis and progress of cancers is being extensively studied. In fact, the newer concepts of using immune reactions as a modality of therapy is being explored in conjunction with the treatments for cancer. The increased hope and enthusiasm for tumor immunotherapy is in a large part due to animal studies and a better understanding about surface antigens on tumors, major histocompatibility complex molecules, adhesion molecules, cytokines and a variety of newly discovered molecules which play a role in immune interactions

  16. A Common Language: How Neuroimmunological Cross Talk Regulates Adult Hippocampal Neurogenesis

    Directory of Open Access Journals (Sweden)

    Odette Leiter

    2016-01-01

    Full Text Available Immune regulation of the brain is generally studied in the context of injury or disease. Less is known about how the immune system regulates the brain during normal brain function. Recent work has redefined the field of neuroimmunology and, as long as their recruitment and activation are well regulated, immune cells are now known to have protective properties within the central nervous system in maintaining brain health. Adult neurogenesis, the process of new neuron generation in the adult brain, is highly plastic and regulated by diverse extrinsic and intrinsic cues. Emerging research has shown that immune cells and their secreted factors can influence adult neurogenesis, both under baseline conditions and during conditions known to change neurogenesis levels, such as aging and learning in an enriched environment. This review will discuss how, under nonpathological conditions, the immune system can interact with the neural stem cells to regulate adult neurogenesis with particular focus on the hippocampus—a region crucial for learning and memory.

  17. Probiotics, antibiotics and the immune responses to vaccines.

    Science.gov (United States)

    Praharaj, Ira; John, Sushil M; Bandyopadhyay, Rini; Kang, Gagandeep

    2015-06-19

    Orally delivered vaccines have been shown to perform poorly in developing countries. There are marked differences in the structure and the luminal environment of the gut in developing countries resulting in changes in immune and barrier function. Recent studies using newly developed technology and analytic methods have made it increasingly clear that the intestinal microbiota activate a multitude of pathways that control innate and adaptive immunity in the gut. Several hypotheses have been proposed for the underperformance of oral vaccines in developing countries, and modulation of the intestinal microbiota is now being tested in human clinical trials. Supplementation with specific strains of probiotics has been shown to have modulatory effects on intestinal and systemic immune responses in animal models and forms the basis for human studies with vaccines. However, most studies published so far that have evaluated the immune response to vaccines in children and adults have been small and results have varied by age, antigen, type of antibody response and probiotic strain. Use of anthelminthic drugs in children has been shown to possibly increase immunogenicity following oral cholera vaccination, lending further support to the rationale for modulation of the immune response to oral vaccination through the intestinal microbiome. © 2015 The Author(s) Published by the Royal Society. All rights reserved.

  18. Indian Hedgehog Suppresses a Stromal Cell–Driven Intestinal Immune Response

    Directory of Open Access Journals (Sweden)

    B. Florien Westendorp

    2018-01-01

    Conclusions: We show that epithelium-derived Indian Hedgehog signals exclusively to fibroblasts in the intestine. Loss of Ihh leads to a rapid immune response with up-regulation of fibroblast-derived CXCL12, and migration of immune cells into the lamina propria.

  19. Growth versus immunity--a redirection of the cell cycle?

    Science.gov (United States)

    Eichmann, Ruth; Schäfer, Patrick

    2015-08-01

    Diseases caused by plant pathogens significantly reduce growth and yield in agricultural crop production. Raising immunity in crops is therefore a major aim in breeding programs. However, efforts to enhance immunity are challenged by the occurrence of growth inhibition triggered by immunity that can be as detrimental as diseases. In this review, we will propose molecular models to explain the inhibitory growth-immunity crosstalk. We will briefly discuss why the resource reallocation model might not represent the driving force for the observed growth-immunity trade-offs. We suggest a model in which immunity redirects and initiates hormone signalling activities that can impair plant growth by antagonising cell cycle regulation and meristem activities. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Role of Cortistatin in the Stressed Immune System.

    Science.gov (United States)

    Delgado, Mario; Gonzalez-Rey, Elena

    2017-01-01

    The immune system is faced with the daunting job of defending the organism against invading pathogens, while at the same time preserving the body integrity and maintaining tolerance to its own tissues. Loss of self-tolerance compromises immune homeostasis and leads to the onset of autoimmune disorders. The identification of endogenous factors that control immune tolerance and inflammation is a key goal for immunologists. Evidences from the last decade indicate that the neuropeptide cortistatin is one of the endogenous factors. Cortistatin is produced by immune cells and through its binding to various receptors, it exerts potent anti-inflammatory actions and participates in the maintenance of immune tolerance at multiple levels, especially in immunological disorders. Cortistatin emerges as a key element in the bidirectional communication between the neuroendocrine and immune systems aimed at regulating body homeostasis. © 2017 S. Karger AG, Basel.