About an adaptively weighted Kaplan-Meier estimate.
Plante, Jean-François
2009-09-01
The minimum averaged mean squared error nonparametric adaptive weights use data from m possibly different populations to infer about one population of interest. The definition of these weights is based on the properties of the empirical distribution function. We use the Kaplan-Meier estimate to let the weights accommodate right-censored data and use them to define the weighted Kaplan-Meier estimate. The proposed estimate is smoother than the usual Kaplan-Meier estimate and converges uniformly in probability to the target distribution. Simulations show that the performances of the weighted Kaplan-Meier estimate on finite samples exceed that of the usual Kaplan-Meier estimate. A case study is also presented.
Kaplan-Meier Survival Analysis Overestimates the Risk of Revision Arthroplasty: A Meta-analysis.
Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter D; Ghali, William A; Marshall, Deborah A
2015-11-01
Although Kaplan-Meier survival analysis is commonly used to estimate the cumulative incidence of revision after joint arthroplasty, it theoretically overestimates the risk of revision in the presence of competing risks (such as death). Because the magnitude of overestimation is not well documented, the potential associated impact on clinical and policy decision-making remains unknown. We performed a meta-analysis to answer the following questions: (1) To what extent does the Kaplan-Meier method overestimate the cumulative incidence of revision after joint replacement compared with alternative competing-risks methods? (2) Is the extent of overestimation influenced by followup time or rate of competing risks? We searched Ovid MEDLINE, EMBASE, BIOSIS Previews, and Web of Science (1946, 1980, 1980, and 1899, respectively, to October 26, 2013) and included article bibliographies for studies comparing estimated cumulative incidence of revision after hip or knee arthroplasty obtained using both Kaplan-Meier and competing-risks methods. We excluded conference abstracts, unpublished studies, or studies using simulated data sets. Two reviewers independently extracted data and evaluated the quality of reporting of the included studies. Among 1160 abstracts identified, six studies were included in our meta-analysis. The principal reason for the steep attrition (1160 to six) was that the initial search was for studies in any clinical area that compared the cumulative incidence estimated using the Kaplan-Meier versus competing-risks methods for any event (not just the cumulative incidence of hip or knee revision); we did this to minimize the likelihood of missing any relevant studies. We calculated risk ratios (RRs) comparing the cumulative incidence estimated using the Kaplan-Meier method with the competing-risks method for each study and used DerSimonian and Laird random effects models to pool these RRs. Heterogeneity was explored using stratified meta-analyses and
Understanding survival analysis: Kaplan-Meier estimate.
Goel, Manish Kumar; Khanna, Pardeep; Kishore, Jugal
2010-10-01
Kaplan-Meier estimate is one of the best options to be used to measure the fraction of subjects living for a certain amount of time after treatment. In clinical trials or community trials, the effect of an intervention is assessed by measuring the number of subjects survived or saved after that intervention over a period of time. The time starting from a defined point to the occurrence of a given event, for example death is called as survival time and the analysis of group data as survival analysis. This can be affected by subjects under study that are uncooperative and refused to be remained in the study or when some of the subjects may not experience the event or death before the end of the study, although they would have experienced or died if observation continued, or we lose touch with them midway in the study. We label these situations as censored observations. The Kaplan-Meier estimate is the simplest way of computing the survival over time in spite of all these difficulties associated with subjects or situations. The survival curve can be created assuming various situations. It involves computing of probabilities of occurrence of event at a certain point of time and multiplying these successive probabilities by any earlier computed probabilities to get the final estimate. This can be calculated for two groups of subjects and also their statistical difference in the survivals. This can be used in Ayurveda research when they are comparing two drugs and looking for survival of subjects.
The analysis of competing events like cause-specific mortality--beware of the Kaplan-Meier method
Verduijn, Marion; Grootendorst, Diana C.; Dekker, Friedo W.; Jager, Kitty J.; le Cessie, Saskia
2011-01-01
Kaplan-Meier analysis is a popular method used for analysing time-to-event data. In case of competing event analyses such as that of cardiovascular and non-cardiovascular mortality, however, the Kaplan-Meier method profoundly overestimates the cumulative mortality probabilities for each of the
Gerds, Thomas A.
2016-01-01
Survival is difficult to estimate when observation periods of individuals differ in length. Students imagine sailing the Titanic and then recording whether they "live" or "die." A clever algorithm is performed which results in the Kaplan-Meier estimate of survival.
Lacny, Sarah; Wilson, Todd; Clement, Fiona; Roberts, Derek J; Faris, Peter; Ghali, William A; Marshall, Deborah A
2018-01-01
Kaplan-Meier survival analysis overestimates cumulative incidence in competing risks (CRs) settings. The extent of overestimation (or its clinical significance) has been questioned, and CRs methods are infrequently used. This meta-analysis compares the Kaplan-Meier method to the cumulative incidence function (CIF), a CRs method. We searched MEDLINE, EMBASE, BIOSIS Previews, Web of Science (1992-2016), and article bibliographies for studies estimating cumulative incidence using the Kaplan-Meier method and CIF. For studies with sufficient data, we calculated pooled risk ratios (RRs) comparing Kaplan-Meier and CIF estimates using DerSimonian and Laird random effects models. We performed stratified meta-analyses by clinical area, rate of CRs (CRs/events of interest), and follow-up time. Of 2,192 identified abstracts, we included 77 studies in the systematic review and meta-analyzed 55. The pooled RR demonstrated the Kaplan-Meier estimate was 1.41 [95% confidence interval (CI): 1.36, 1.47] times higher than the CIF. Overestimation was highest among studies with high rates of CRs [RR = 2.36 (95% CI: 1.79, 3.12)], studies related to hepatology [RR = 2.60 (95% CI: 2.12, 3.19)], and obstetrics and gynecology [RR = 1.84 (95% CI: 1.52, 2.23)]. The Kaplan-Meier method overestimated the cumulative incidence across 10 clinical areas. Using CRs methods will ensure accurate results inform clinical and policy decisions. Copyright © 2017 Elsevier Inc. All rights reserved.
van Walraven, Carl; McAlister, Finlay A
2016-01-01
Risk estimates from Kaplan-Meier curves are well known to medical researchers, reviewers, and editors. In this study, we determined the proportion of Kaplan-Meier analyses published in prominent medical journals that are potentially biased because of competing events ("competing risk bias"). We randomly selected 100 studies that had at least one Kaplan-Meier analysis and were recently published in prominent medical journals. Susceptibility to competing risk bias was determined by examining the outcome and potential competing events. In susceptible studies, bias was quantified using a previously validated prediction model when the number of outcomes and competing events were given. Forty-six studies (46%) contained Kaplan-Meier analyses susceptible to competing risk bias. Sixteen studies (34.8%) susceptible to competing risk cited the number of outcomes and competing events; in six of these studies (6/16, 37.5%), the outcome risk from the Kaplan-Meier estimate (relative to the true risk) was biased upward by 10% or more. Almost half of Kaplan-Meier analyses published in medical journals are susceptible to competing risk bias and may overestimate event risk. This bias was found to be quantitatively important in a third of such studies. Copyright © 2016 Elsevier Inc. All rights reserved.
The Kaplan-Meier Integral in the Presence of Covariates
DEFF Research Database (Denmark)
Gerds, Thomas A.; Beyersmann, Jan; Starkopf, Liis
2017-01-01
In a series of papers, Winfried Stute introduced and studied the Kaplan-Meier integral as an estimator of parameters of the joint distribution of survival times and covariates based on right censored survival times. We present a review of this work and show that his estimator has an inverse...... probability of censoring weighting (IPCW) representation. We further investigate large sample bias and efficiency. As a central application in a biostatistical context, Kaplan-Meier integrals are used to estimate transition probabilities in a non-Markov illness-death model. We extend already existing...
Modified Weighted Kaplan-Meier Estimator
Directory of Open Access Journals (Sweden)
Mohammad Shafiq
2007-01-01
Full Text Available In many medical studies majority of the study subjects do not reach to the event of interest during the study period. In such situations survival probabilities can be estimated for censored observation by Kaplan Meier estimator. However in case of heavy censoring these estimates are biased and over estimate the survival probabilities. For heavy censoring a new method was proposed (Bahrawar Jan, 2005 to estimate the survival probabilities by weighting the censored observations by non-censoring rate. But the main defect in this weighted method is that it gives zero weight to the last censored observation. To over come this difficulty a new weight is proposed which also gives a non-zero weight to the last censored observation.
J. Szymszal; A. Gierek; J. Kliś
2010-01-01
The article evaluates the reliability of AlSi17CuNiMg alloys using Kaplan-Meier-based technique, very popular as a survival estimation tool in medical science. The main object of survival analysis is a group (or groups) of units for which the time of occurrence of an event (failure) taking place after some time of waiting is estimated. For example, in medicine, the failure can be patient’s death. In this study, the failure was the specimen fracture during a periodical fatigue test, while the ...
DEFF Research Database (Denmark)
Gerds, Thomas Alexander
2016-01-01
Survival probabilities are not straightforward toobtain when observation periods of individuals differ in length. The Kaplan–Meier theatre is a classroom activity, which starts by a data collection exercise where students imagine sailing on the Titanic. Several students ‘fall in the water’ where....... The Kaplan–Meier method assumes that censored individuals have the same survival chances as the individuals who are still observed. During the Kaplan–Meier theatre, students perform a clever algorithm (Efron 1967), which translates the assumption into action and results in the Kaplan–Meier estimate...
Gross, Arnd; Ziepert, Marita; Scholz, Markus
2012-01-01
Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.
Directory of Open Access Journals (Sweden)
Arnd Gross
Full Text Available BACKGROUND: Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav, SAS export (xpt or text file (dat, which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. RESULTS: On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. CONCLUSIONS: We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups.
Gross, Arnd; Ziepert, Marita; Scholz, Markus
2012-01-01
Background Analysis of clinical studies often necessitates multiple graphical representations of the results. Many professional software packages are available for this purpose. Most packages are either only commercially available or hard to use especially if one aims to generate or customize a huge number of similar graphical outputs. We developed a new, freely available software tool called KMWin (Kaplan-Meier for Windows) facilitating Kaplan-Meier survival time analysis. KMWin is based on the statistical software environment R and provides an easy to use graphical interface. Survival time data can be supplied as SPSS (sav), SAS export (xpt) or text file (dat), which is also a common export format of other applications such as Excel. Figures can directly be exported in any graphical file format supported by R. Results On the basis of a working example, we demonstrate how to use KMWin and present its main functions. We show how to control the interface, customize the graphical output, and analyse survival time data. A number of comparisons are performed between KMWin and SPSS regarding graphical output, statistical output, data management and development. Although the general functionality of SPSS is larger, KMWin comprises a number of features useful for survival time analysis in clinical trials and other applications. These are for example number of cases and number of cases under risk within the figure or provision of a queue system for repetitive analyses of updated data sets. Moreover, major adjustments of graphical settings can be performed easily on a single window. Conclusions We conclude that our tool is well suited and convenient for repetitive analyses of survival time data. It can be used by non-statisticians and provides often used functions as well as functions which are not supplied by standard software packages. The software is routinely applied in several clinical study groups. PMID:22723912
Guyot, Patricia; Ades, A E; Ouwens, Mario J N M; Welton, Nicky J
2012-02-01
The results of Randomized Controlled Trials (RCTs) on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios) with statistics based on repeated reconstructions by multiple observers. The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.
Survival analysis II: Cox regression
Stel, Vianda S.; Dekker, Friedo W.; Tripepi, Giovanni; Zoccali, Carmine; Jager, Kitty J.
2011-01-01
In contrast to the Kaplan-Meier method, Cox proportional hazards regression can provide an effect estimate by quantifying the difference in survival between patient groups and can adjust for confounding effects of other variables. The purpose of this article is to explain the basic concepts of the
Directory of Open Access Journals (Sweden)
Guyot Patricia
2012-02-01
Full Text Available Abstract Background The results of Randomized Controlled Trials (RCTs on time-to-event outcomes that are usually reported are median time to events and Cox Hazard Ratio. These do not constitute the sufficient statistics required for meta-analysis or cost-effectiveness analysis, and their use in secondary analyses requires strong assumptions that may not have been adequately tested. In order to enhance the quality of secondary data analyses, we propose a method which derives from the published Kaplan Meier survival curves a close approximation to the original individual patient time-to-event data from which they were generated. Methods We develop an algorithm that maps from digitised curves back to KM data by finding numerical solutions to the inverted KM equations, using where available information on number of events and numbers at risk. The reproducibility and accuracy of survival probabilities, median survival times and hazard ratios based on reconstructed KM data was assessed by comparing published statistics (survival probabilities, medians and hazard ratios with statistics based on repeated reconstructions by multiple observers. Results The validation exercise established there was no material systematic error and that there was a high degree of reproducibility for all statistics. Accuracy was excellent for survival probabilities and medians, for hazard ratios reasonable accuracy can only be obtained if at least numbers at risk or total number of events are reported. Conclusion The algorithm is a reliable tool for meta-analysis and cost-effectiveness analyses of RCTs reporting time-to-event data. It is recommended that all RCTs should report information on numbers at risk and total number of events alongside KM curves.
International Nuclear Information System (INIS)
Grybaeck, P.; Naeslund, E.; Hellstroem, P.M.; Jacobsson, H.; Backman, L.
1996-01-01
It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs
Energy Technology Data Exchange (ETDEWEB)
Grybaeck, P. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden); Naeslund, E. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden); Hellstroem, P.M. [Department of Internal Medicine, Karolinska Hospital, Stockholm (Sweden); Jacobsson, H. [Department of Diagnostic Radiology, Karolinska Hospital, Stockholm (Sweden)]|[Department of Nuclear Medicine, Karolinska Hospital, Stockholm (Sweden); Backman, L. [Department of Surgery, Karolinska Institute at Danderyd Hospital, Stockholm (Sweden)
1996-12-01
It has been suggested that obesity is associated with an altered rate of gastric emptying, and that there are also sex differences in gastric emptying. The results of earlier studies examining gastric emptying rates in obesity and in males and females have proved inconsistent. The aim of this study was to investigate the influence of obesity and gender on gastric emptying, by extending conventional evaluation methods with Kaplan-Meier plots, in order to assess whether these factors have to be accounted for when interpreting results of scintigraphic gastric emptying tests. Twenty-one normal-weight volunteers and nine obese subjects were fed a standardised technetium-99m labelled albumin omelette. Imaging data were acquired at 5- and 10-min intervals in both posterior and anterior projections with the subjects in the sitting position. The half-emptying time, analysed by Kaplan-Meier plot (log-rank test), were shorter in obese subjects compared to normal-weight subjects and later in females compared to males. Also, the lag-phase and half-emptying time were shorter in obese females than in normal females. This study shows an association between different gastric emptying rates and obesity and gender. Therefore, body mass index and gender have to be accounted for when interpreting results of scintigraphic gastric emptying studies. (orig.). With 6 figs., 4 tabs.
International Nuclear Information System (INIS)
Mould, Richard F.
1995-01-01
Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method
Energy Technology Data Exchange (ETDEWEB)
Mould, Richard F
1995-07-01
Purpose/Objective: To explain some of the most useful statistical calculation procedures which are relevant to radiation oncologists and to provide insights on what tests and procedures should be used in various situations such as when survival rates and their associated standard errors have to be determined. To describe some of the problems and pitfalls in clinical trial designs which have to be overcome if a trial is to have the possibility of reaching a successful conclusion. To review methods of computing criteria to quantitatively describe criteria of success (eg. quality of life, long-term survival, cure) of radiation oncology and to suggest possible future statistical improvements in this area. Chi-Squared Test: The chi-squared test is probably the most useful of the tests of statistical significance for the radiation oncologist. Applications will be described, including goodness of fit tests and 2x2 contingency tables which are the simplest of the generalized nxm contingency tables. Degrees of Freedom and P<0.05 for Significance Testing: An Introduction will be given to the meaning of P<0.05 in relation to significance testing and the use of tables of critical values of a test statistic (eg. chi-squared) which are given as a function of degrees of freedom and P-values. Survival Rate Calculations for Grouped and Ungrouped Data: The life-table method (sometimes termed the actuarial method) will be explained for both grouped data (eg. survival times grouped in annual intervals for patients who have died and for those who are still alive or lost to follow-up) and for ungrouped data (when individual survival times are used). The method for ungrouped data is variously termed the Kaplan-Meier or Product Limit method. Logrank Test: This is the most useful test for comparison of the survival experience of two groups of patients and its use will be explained. In part the computation is similar to that for the Kaplan-Meier/Product Limit method.
Applying Kaplan-Meier to Item Response Data
McNeish, Daniel
2018-01-01
Some IRT models can be equivalently modeled in alternative frameworks such as logistic regression. Logistic regression can also model time-to-event data, which concerns the probability of an event occurring over time. Using the relation between time-to-event models and logistic regression and the relation between logistic regression and IRT, this…
Uno, Hajime; Tian, Lu; Claggett, Brian; Wei, L J
2015-12-10
With censored event time observations, the logrank test is the most popular tool for testing the equality of two underlying survival distributions. Although this test is asymptotically distribution free, it may not be powerful when the proportional hazards assumption is violated. Various other novel testing procedures have been proposed, which generally are derived by assuming a class of specific alternative hypotheses with respect to the hazard functions. The test considered by Pepe and Fleming (1989) is based on a linear combination of weighted differences of the two Kaplan-Meier curves over time and is a natural tool to assess the difference of two survival functions directly. In this article, we take a similar approach but choose weights that are proportional to the observed standardized difference of the estimated survival curves at each time point. The new proposal automatically makes weighting adjustments empirically. The new test statistic is aimed at a one-sided general alternative hypothesis and is distributed with a short right tail under the null hypothesis but with a heavy tail under the alternative. The results from extensive numerical studies demonstrate that the new procedure performs well under various general alternatives with a caution of a minor inflation of the type I error rate when the sample size is small or the number of observed events is small. The survival data from a recent cancer comparative study are utilized for illustrating the implementation of the process. Copyright © 2015 John Wiley & Sons, Ltd.
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue microarray......, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots...
[Survival analysis with competing risks: estimating failure probability].
Llorca, Javier; Delgado-Rodríguez, Miguel
2004-01-01
To show the impact of competing risks of death on survival analysis. We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection). Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.
DEFF Research Database (Denmark)
Kyndi, Marianne; Sørensen, Flemming Brandt; Knudsen, Helle
2008-01-01
-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2......PURPOSE: To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). PATIENTS AND METHODS: The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b&c studies. Tissue...... tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. RESULTS: p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan...
Kaplan turbine tip vortex cavitation - analysis and prevention
Motycak, L.; Skotak, A.; Kupcik, R.
2012-11-01
The work is focused on one type of Kaplan turbine runner cavitation - a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.
Directory of Open Access Journals (Sweden)
Javier Llorca
2004-10-01
Full Text Available Objetivo: Mostrar el efecto de los riesgos competitivos de muerte en el análisis de supervivencia. Métodos: Se presenta un ejemplo sobre la supervivencia libre de rechazo tras un trasplante cardíaco, en el que la muerte antes de desarrollar el rechazo actúa como riesgo competitivo. Mediante una simulación se comparan el estimador de Kaplan-Meier y el modelo de decrementos múltiples. Resultados: El método de Kaplan-Meier sobrestima el riesgo de rechazo. A continuación, se expone la aplicación del modelo de decrementos múltiples para el análisis de acontecimientos secundarios (en el ejemplo, la muerte tras el rechazo. Finalmente, se discuten las asunciones propias del método de Kaplan-Meier y las razones por las que no puede ser aplicado en presencia de riesgos competitivos. Conclusiones: El análisis de supervivencia debe ajustarse por los riesgos competitivos de muerte para evitar la sobrestimación del riesgo de fallo que se produce con el método de Kaplan-Meier.Objective: To show the impact of competing risks of death on survival analysis. Method: We provide an example of survival time without chronic rejection after heart transplantation, where death before rejection acts as a competing risk. Using a computer simulation, we compare the Kaplan-Meier estimator and the multiple decrement model. Results: The Kaplan-Meier method overestimated the probability of rejection. Next, we illustrate the use of the multiple decrement model to analyze secondary end points (in our example: death after rejection. Finally, we discuss Kaplan-Meier assumptions and why they fail in the presence of competing risks. Conclusions: Survival analysis should be adjusted for competing risks of death to avoid overestimation of the risk of rejection produced with the Kaplan-Meier method.
Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis
Directory of Open Access Journals (Sweden)
Jie Zhao
2015-01-01
Full Text Available Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-order curve fitting method. Progressively the linearized Kaplan turbine model, improved ideal Kaplan turbine model, and nonlinear Kaplan turbine model were developed. The nonlinear Kaplan turbine model considered the correction function of the blade angle on the turbine power, thereby improving the model simulation accuracy. The model parameters were calculated or obtained by the improved particle swarm optimization (IPSO algorithm. For the blade control system model, the default blade servomotor time constant given by value of one simplified the modeling and experimental work. Further studies combined with measured test data verified the established model accuracy and laid a foundation for further research into the influence of Kaplan turbine connecting to the grid.
International Nuclear Information System (INIS)
Kyndi, M.; Alsner, J.; Nielsen, H.M.; Overgaard, J.; Soerensen, F.B.; Knudsen, H.; Overgaard, M.
2008-01-01
Purpose. To examine p53 and BCL2 expression in high-risk breast cancer patients randomized to postmastectomy radiotherapy (PMRT). Patients and methods. The present analysis included 1 000 of 3 083 high-risk breast cancer patients randomly assigned to PMRT in the DBCG82 b and c studies. Tissue microarray sections were stained with immunohistochemistry for p53 and BCL2. Median potential follow-up was 17 years. Clinical endpoints were locoregional recurrence (LRR), distant metastases (DM), overall mortality, and overall survival (OS). Statistical analyses included Kappa statistics, χ2 or exact tests, Kaplan-Meier probability plots, Log-rank test, and Cox univariate and multivariate regression analyses. Results. p53 accumulation was not significantly associated with increased overall mortality, DM or LRR probability in univariate or multivariate Cox regression analyses. Kaplan-Meier probability plots showed reduced OS and improved DM and LRR probabilities after PMRT within subgroups of both p53 negative and p53 positive patients. Negative BCL2 expression was significantly associated with increased overall mortality, DM and LRR probability in multivariate Cox regression analyses. Kaplan-Meier probability plots showed a significantly improved overall survival after PMRT for the BCL2 positive subgroup, whereas practically no survival improvement was seen after PMRT for the BCL2 negative subgroup. In multivariate analysis of OS, however, no significant interaction was found between BCL2 and randomization status. Significant reductions in LRR probability after PMRT were recorded within both the BCL2 positive and BCL2 negative subgroups. Conclusion. p53 was not associated with survival after radiotherapy in high-risk breast cancer, but BCL2 might be
Survival Analysis of Patients with End Stage Renal Disease
Urrutia, J. D.; Gayo, W. S.; Bautista, L. A.; Baccay, E. B.
2015-06-01
This paper provides a survival analysis of End Stage Renal Disease (ESRD) under Kaplan-Meier Estimates and Weibull Distribution. The data were obtained from the records of V. L. MakabaliMemorial Hospital with respect to time t (patient's age), covariates such as developed secondary disease (Pulmonary Congestion and Cardiovascular Disease), gender, and the event of interest: the death of ESRD patients. Survival and hazard rates were estimated using NCSS for Weibull Distribution and SPSS for Kaplan-Meier Estimates. These lead to the same conclusion that hazard rate increases and survival rate decreases of ESRD patient diagnosed with Pulmonary Congestion, Cardiovascular Disease and both diseases with respect to time. It also shows that female patients have a greater risk of death compared to males. The probability risk was given the equation R = 1 — e-H(t) where e-H(t) is the survival function, H(t) the cumulative hazard function which was created using Cox-Regression.
DEFF Research Database (Denmark)
Lindebjerg, J; Spindler, Karen-Lise Garm; Ploen, J
2009-01-01
to the tumour regression grade system and lymph node status in the surgical specimen was assessed. The prognostic value of clinico-pathological parameters was analysed using univariate analysis and Kaplan-Meier methods for comparison of groups. RESULTS: All patients responded to treatment and 47% had a major......OBJECTIVE: The purpose of the present study was to investigate the impact of tumour regression and the post-treatment lymph node status on the prognosis of rectal cancer treated by preoperative neoadjuvant chemoradiotherapy. METHOD: One hundred and thirty-five patients with locally advanced T3.......01). CONCLUSION: The combined assessment of lymph-node status and tumour response has strong prognostic value in locally advanced rectal cancer patient treated with preoperative long-course chemoradiation....
Dynamic Model of Kaplan Turbine Regulating System Suitable for Power System Analysis
Zhao, Jie; Wang, Li; Liu, Dichen; Wang, Jun; Zhao, Yu; Liu, Tian; Wang, Haoyu
2015-01-01
Accurate modeling of Kaplan turbine regulating system is of great significance for grid security and stability analysis. In this paper, Kaplan turbine regulating system model is divided into the governor system model, the blade control system model, and the turbine and water diversion system model. The Kaplan turbine has its particularity, and the on-cam relationship between the wicket gate opening and the runner blade angle under a certain water head on the whole range was obtained by high-o...
LINEAR REGRESSION MODEL ESTİMATİON FOR RIGHT CENSORED DATA
Directory of Open Access Journals (Sweden)
Ersin Yılmaz
2016-05-01
Full Text Available In this study, firstly we will define a right censored data. If we say shortly right-censored data is censoring values that above the exact line. This may be related with scaling device. And then we will use response variable acquainted from right-censored explanatory variables. Then the linear regression model will be estimated. For censored data’s existence, Kaplan-Meier weights will be used for the estimation of the model. With the weights regression model will be consistent and unbiased with that. And also there is a method for the censored data that is a semi parametric regression and this method also give useful results for censored data too. This study also might be useful for the health studies because of the censored data used in medical issues generally.
Kaplan turbine tip vortex cavitation – analysis and prevention
International Nuclear Information System (INIS)
Motycak, L; Skotak, A; Kupcik, R
2012-01-01
The work is focused on one type of Kaplan turbine runner cavitation – a tip vortex cavitation. For detailed description of the tip vortex, the CFD analysis is used. On the basis of this analysis it is possible to estimate the intensity of cavitating vortex core, danger of possible blade surface and runner chamber cavitation pitting. In the paper, the ways how to avoid the pitting effect of the tip vortex are described. In order to prevent the blade surface against pitting, the following possibilities as the change of geometry of the runner blade, dimension of tip clearance and finally the installation of the anti-cavitation lips are discussed. The knowledge of the shape and intensity of the tip vortex helps to design the anti-cavitation lips more sophistically. After all, the results of the model tests of the Kaplan runner with or without anti-cavitation lips and the results of the CFD analysis are compared.
Some Supplementary Methods for the Analysis of the Delis-Kaplan Executive Function System
Crawford, John R.; Garthwaite, Paul H.; Sutherland, David; Borland, Nicola
2011-01-01
Supplementary methods for the analysis of the Delis-Kaplan Executive Function System (Delis, Kaplan, & Kramer, 2001) are made available, including (a) quantifying the number of abnormally low achievement scores exhibited by an individual and accompanying this with an estimate of the percentage of the normative population expected to exhibit at…
Directory of Open Access Journals (Sweden)
Béranger Lueza
2016-03-01
Full Text Available Abstract Background The difference in restricted mean survival time ( rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , the area between two survival curves up to time horizon t ∗ $$ {t}^{\\ast } $$ , is often used in cost-effectiveness analyses to estimate the treatment effect in randomized controlled trials. A challenge in individual patient data (IPD meta-analyses is to account for the trial effect. We aimed at comparing different methods to estimate the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ from an IPD meta-analysis. Methods We compared four methods: the area between Kaplan-Meier curves (experimental vs. control arm ignoring the trial effect (Naïve Kaplan-Meier; the area between Peto curves computed at quintiles of event times (Peto-quintile; the weighted average of the areas between either trial-specific Kaplan-Meier curves (Pooled Kaplan-Meier or trial-specific exponential curves (Pooled Exponential. In a simulation study, we varied the between-trial heterogeneity for the baseline hazard and for the treatment effect (possibly correlated, the overall treatment effect, the time horizon t ∗ $$ {t}^{\\ast } $$ , the number of trials and of patients, the use of fixed or DerSimonian-Laird random effects model, and the proportionality of hazards. We compared the methods in terms of bias, empirical and average standard errors. We used IPD from the Meta-Analysis of Chemotherapy in Nasopharynx Carcinoma (MAC-NPC and its updated version MAC-NPC2 for illustration that included respectively 1,975 and 5,028 patients in 11 and 23 comparisons. Results The Naïve Kaplan-Meier method was unbiased, whereas the Pooled Exponential and, to a much lesser extent, the Pooled Kaplan-Meier methods showed a bias with non-proportional hazards. The Peto-quintile method underestimated the rmstD t ∗ $$ rmstD\\left({t}^{\\ast}\\right $$ , except with non-proportional hazards at t ∗ $$ {t}^{\\ast } $$ = 5 years. In the presence of treatment effect
DEFF Research Database (Denmark)
Wells, J Connor; Stukalin, Igor; Norton, Craig
2017-01-01
and were included in the analysis. OUTCOME MEASUREMENTS AND STATISTICAL ANALYSIS: Patients were analyzed for overall survival (OS) and progression-free survival using Kaplan-Meier curves, and were evaluated for overall response. Cox regression analyses were used to determine the statistical association...
Cortés-Alaguero, Caterina; González-Mirasol, Esteban; Morales-Roselló, José; Poblet-Martinez, Enrique
2017-03-15
To determine whether medical history, clinical examination and human papilloma virus (HPV) genotype influence spontaneous regression in cervical intraepithelial neoplasia grade I (CIN-I). We retrospectively evaluated 232 women who were histologically diagnosed as have CIN-I by means of Kaplan-Meier curves, the pattern of spontaneous regression according to the medical history, clinical examination, and HPV genotype. Spontaneous regression occurred in most patients and was influenced by the presence of multiple HPV genotypes but not by the HPV genotype itself. In addition, regression frequency was diminished when more than 50% of the cervix surface was affected or when an abnormal cytology was present at the beginning of follow-up. The frequency of regression in CIN-I is high, making long-term follow-up and conservative management advisable. Data from clinical examination and HPV genotyping might help to anticipate which lesions will regress.
Mount, David W; Putnam, Charles W; Centouri, Sara M; Manziello, Ann M; Pandey, Ritu; Garland, Linda L; Martinez, Jesse D
2014-06-10
Numerous microarray-based prognostic gene expression signatures of primary neoplasms have been published but often with little concurrence between studies, thus limiting their clinical utility. We describe a methodology using logistic regression, which circumvents limitations of conventional Kaplan Meier analysis. We applied this approach to a thrice-analyzed and published squamous cell carcinoma (SQCC) of the lung data set, with the objective of identifying gene expressions predictive of early death versus long survival in early-stage disease. A similar analysis was applied to a data set of triple negative breast carcinoma cases, which present similar clinical challenges. Important to our approach is the selection of homogenous patient groups for comparison. In the lung study, we selected two groups (including only stages I and II), equal in size, of earliest deaths and longest survivors. Genes varying at least four-fold were tested by logistic regression for accuracy of prediction (area under a ROC plot). The gene list was refined by applying two sliding-window analyses and by validations using a leave-one-out approach and model building with validation subsets. In the breast study, a similar logistic regression analysis was used after selecting appropriate cases for comparison. A total of 8594 variable genes were tested for accuracy in predicting earliest deaths versus longest survivors in SQCC. After applying the two sliding window and the leave-one-out analyses, 24 prognostic genes were identified; most of them were B-cell related. When the same data set of stage I and II cases was analyzed using a conventional Kaplan Meier (KM) approach, we identified fewer immune-related genes among the most statistically significant hits; when stage III cases were included, most of the prognostic genes were missed. Interestingly, logistic regression analysis of the breast cancer data set identified many immune-related genes predictive of clinical outcome. Stratification of
DEFF Research Database (Denmark)
Sidenius, N; Sier, C.F.M.; Ullum, H
2000-01-01
levels of soluble uPAR (suPAR) in patients with advanced HIV-1 disease and whether the serum level of suPAR is predictive of clinical outcome. Using an enzyme-linked immunosorbent assay, the level of suPAR was measured retrospectively in serum samples from 314 patients with HIV-1 infection. By Kaplan......-Meier and Cox regression analyses, the serum suPAR levels were correlated to survival with AIDS-related death as the end point. High levels of serum suPAR (greater than median) were associated with poor overall survival, and Kaplan-Meier analysis on patients stratified by suPAR level demonstrated a continuous...
Markov chains and semi-Markov models in time-to-event analysis.
Abner, Erin L; Charnigo, Richard J; Kryscio, Richard J
2013-10-25
A variety of statistical methods are available to investigators for analysis of time-to-event data, often referred to as survival analysis. Kaplan-Meier estimation and Cox proportional hazards regression are commonly employed tools but are not appropriate for all studies, particularly in the presence of competing risks and when multiple or recurrent outcomes are of interest. Markov chain models can accommodate censored data, competing risks (informative censoring), multiple outcomes, recurrent outcomes, frailty, and non-constant survival probabilities. Markov chain models, though often overlooked by investigators in time-to-event analysis, have long been used in clinical studies and have widespread application in other fields.
Fatigue Analysis of an Outer Bearing Bush of a Kaplan Turbine
Directory of Open Access Journals (Sweden)
Doina Frunzaverde
2011-01-01
Full Text Available The paper presents the fatigue analysis of an outer bearing bush of aKaplan turbine. This outer bush, together with an inner one, bear thepin lever - trunion - blade subassembly of the runner blade operatingmechanism. For modeling and simulation, SolidWorks software is used.
DEFF Research Database (Denmark)
Kyndi, M.; Sorensen, F.B.; Alsner, J.
2008-01-01
-points were loco-regional recurrence, distant metastases, disease-specific survival and overall survival. Statistical analyses included kappa statistics, chi(2) or exact tests, Kaplan-Meier probability plots, Log-rank test and Cox regression analyses. Results CA IX was assessable in 945 cores. The percentage...
Epilepsy in Rett syndrome--lessons from the Rett networked database
DEFF Research Database (Denmark)
Nissenkorn, Andreea; Levy-Drummer, Rachel S; Bondi, Ori
2015-01-01
collected. Statistical analysis was done using the IBM SPSS Version 21 software, logistic regression, and Kaplan-Meier survival curves. RESULTS: Epilepsy was present in 68.1% of the patients, with uncontrolled seizures in 32.6% of the patients with epilepsy. Mean age of onset of epilepsy was 4...
Survival analysis in hematologic malignancies: recommendations for clinicians
Delgado, Julio; Pereira, Arturo; Villamor, Neus; López-Guillermo, Armando; Rozman, Ciril
2014-01-01
The widespread availability of statistical packages has undoubtedly helped hematologists worldwide in the analysis of their data, but has also led to the inappropriate use of statistical methods. In this article, we review some basic concepts of survival analysis and also make recommendations about how and when to perform each particular test using SPSS, Stata and R. In particular, we describe a simple way of defining cut-off points for continuous variables and the appropriate and inappropriate uses of the Kaplan-Meier method and Cox proportional hazard regression models. We also provide practical advice on how to check the proportional hazards assumption and briefly review the role of relative survival and multiple imputation. PMID:25176982
A cyclostationary multi-domain analysis of fluid instability in Kaplan turbines
Pennacchi, P.; Borghesani, P.; Chatterton, S.
2015-08-01
Hydraulic instabilities represent a critical problem for Francis and Kaplan turbines, reducing their useful life due to increase of fatigue on the components and cavitation phenomena. Whereas an exhaustive list of publications on computational fluid-dynamic models of hydraulic instability is available, the possibility of applying diagnostic techniques based on vibration measurements has not been investigated sufficiently, also because the appropriate sensors seldom equip hydro turbine units. The aim of this study is to fill this knowledge gap and to exploit fully, for this purpose, the potentiality of combining cyclostationary analysis tools, able to describe complex dynamics such as those of fluid-structure interactions, with order tracking procedures, allowing domain transformations and consequently the separation of synchronous and non-synchronous components. This paper will focus on experimental data obtained on a full-scale Kaplan turbine unit, operating in a real power plant, tackling the issues of adapting such diagnostic tools for the analysis of hydraulic instabilities and proposing techniques and methodologies for a highly automated condition monitoring system.
ASURV: Astronomical SURVival Statistics
Feigelson, E. D.; Nelson, P. I.; Isobe, T.; LaValley, M.
2014-06-01
ASURV (Astronomical SURVival Statistics) provides astronomy survival analysis for right- and left-censored data including the maximum-likelihood Kaplan-Meier estimator and several univariate two-sample tests, bivariate correlation measures, and linear regressions. ASURV is written in FORTRAN 77, and is stand-alone and does not call any specialized libraries.
Influence of antiviral therapy on survival of patients with hepatitis B ...
African Journals Online (AJOL)
The mortality rates in two groups were evaluated with Kaplan-Meier estimate. ... 274 (76.9 %) died, with 89 patients belonging to the antiviral group while the ... TACE is different from systemic ... and identification of study participants was not ..... Table 3: Cox regression analysis to deteermine variables associated with overall ...
Water hammer 2 phase analysis hydraulic system with a Kaplan turbine
Dudlik, A.; Koutnik, J.
2009-01-01
This investigation has been carried out for a case of sudden closing of a Kaplan turbine from a runaway operation. This work has been done at Fraunhofer UMSICHT, supported by VH. The runaway case has been selected as it is known that the discharge through a Kaplan turbine increases with its speed, and may reach up to twice the value of nominal discharge. The simulation model consists of: - penstock - Kaplan turbine (modelled with a valve characteristic) - draft tube All hydraulic pipe element...
Analysis of the Kaplan turbine draft tube effect
International Nuclear Information System (INIS)
Motycak, L; Skotak, A; Obrovsky, J
2010-01-01
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Analysis of the Kaplan turbine draft tube effect
Energy Technology Data Exchange (ETDEWEB)
Motycak, L; Skotak, A; Obrovsky, J, E-mail: motycak.vhs@cbeng.c [CKD Blansko Engineering, a.s., Capkova 2357/5, Blansko 67801 (Czech Republic)
2010-08-15
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Analysis of the Kaplan turbine draft tube effect
Motycak, L.; Skotak, A.; Obrovsky, J.
2010-08-01
The aim of this paper is to present information about possible problems and errors which can appear during numerical analyses of low head Kaplan turbines with a view to the runner - draft tube interaction. The setting of numerical model, grid size, used boundary conditions are the interface definition between runner and draft tube are discussed. There are available data from physical model tests which gives a great opportunity to compare CFD and experiment results and on the basis of this comparison to determine the approach to the CFD flow modeling. The main purpose for the Kaplan turbine model measurement was to gather the information about real flow field. The model tests were carried out in new hydraulic laboratory of CKD Blansko Engineering. The model tests were focused on the detailed velocity measurements downstream of the runner by differential pressure probe and on the velocity measurement downstream of the draft tube elbow by Particle Image Velocimetry method (PIV). The data from CFD simulation were compared to the velocity measurement results. In the paper also the design of the original draft tube modification due to flow improvement is discussed in the case of the Kaplan turbine uprating project. The results of the draft tube modification were confirmed by model tests in the hydraulic laboratory as well.
Munnik, S.A. de; Hoefsloot, E.H.; Roukema, J.; Schoots, J.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, E.M.H.F.
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females
DEFF Research Database (Denmark)
Rosendahl, Mikkel; Høgdall, Claus Kim; Mosgaard, Berit Jul
2016-01-01
OBJECTIVE: With the 2013 International Federation of Gynecology and Obstetrics (FIGO) staging for ovarian, fallopian tube, and primary peritoneal cancer, the number of substages changed from 10 to 14. Any classification of a malignancy should easily assign patients to prognostic groups, refer....... MATERIALS AND METHODS: Demographic, surgical, histological, and survival data from 4036 ovarian cancer patients were used in the analysis. Five-year survival rates (5YSR) and hazard ratios for the old and revised FIGO staging were calculated using Kaplan-Meier curves and Cox regression. RESULTS: A total...
Directory of Open Access Journals (Sweden)
Min-jie Mao
2017-01-01
Full Text Available Background. The pretreatment albumin and globulin ratio (AGR was an inflammation-associated factor which was related to the overall survival in various malignancies. The aim of this study was to evaluate the prognostic value of AGR in patients with gastric cancer. Method. This retrospective study included 862 cases pathologically diagnosed with gastric cancer. All patients were randomly divided into the testing group (431 cases and validation group (431 cases. The relationships of AGR with clinicopathologic characteristics and prognosis were analyzed by Kaplan-Meier and Cox regression methods. Results. In the testing group, the median overall survival was 26.90 months and the cutoff value of AGR was 1.50 based on R language. Kaplan-Meier analysis showed that lower AGR was correlated with poorer overall survival. Multivariate analysis demonstrated that AGR was an independent prognostic factor for overall survival (HR: 0.584, 95% CI = 0.351–0.973, and p = 0.039. In the validation group, the median overall survival was 24.10 months. Lower AGR (≤1.50 also had a significantly poorer overall survival by Kaplan-Meier analysis. According to multivariate analysis, the AGR was also confirmed to be an independent prognostic factor for overall survival (HR: 0.578, 95% CI = 0.373–0.897, and p = 0.015. Conclusions. Our study suggested that the pretreatment AGR could be a prognostic biomarker for overall survival in patients with gastric cancer.
Martínez-Camblor, Pablo; Larrañaga, Nerea; Sarasqueta, Cristina; Mitxelena, María José; Basterretxea, Mikel
2009-01-01
To analyze time of disease-free survival and relative survival in women diagnosed with breast cancer in the province of Gipuzkoa within the context of competing risks by assessing differences between the direct use of the Kaplan-Meier estimator and the multiple decrement method on the one hand, and relative survival on the other. All registered breast cancer cases in Gipuzkoa in 1995 and 1996 with stages other than stage IV were included. An 8-year follow-up for recurrence and a 10-year follow-up for survival were performed. Time of disease-free survival was studied by the multiple decrement model. Observed survival and survival corrected by the expected mortality in the population (relative survival) were also studied. Estimation of the probability of recurrence at 8 years with the multiple decrement method was 8.8% lower than that obtained with the Kaplan-Meier method. The difference between the observed and relative survival rates at 10 years was 10.8%. Both results show how, in this case, the Kaplan-Meier estimator overestimates both the probability of recurrence and that of mortality from the disease. Two issues are often overlooked when performing survival analyses: firstly, because of the lack of independence between survival time and censoring time, the results obtained by the Kaplan-Meier estimator are uninterpretable; secondly, it is an incontrovertible fact that one way or another, everyone causes failures. In this approach, survival analyses must take into account the probability of failure in the general population of reference. The results obtained in this study show that superficial use of the Kaplan Meier estimator overestimates both the probability of recurrence and that of mortality caused by the disease.
Competing approaches to analysis of failure times with competing risks.
Farley, T M; Ali, M M; Slaymaker, E
2001-12-15
For the analysis of time to event data in contraceptive studies when individuals are subject to competing causes for discontinuation, some authors have recently advocated the use of the cumulative incidence rate as a more appropriate measure to summarize data than the complement of the Kaplan-Meier estimate of discontinuation. The former method estimates the rate of discontinuation in the presence of competing causes, while the latter is a hypothetical rate that would be observed if discontinuations for the other reasons could not occur. The difference between the two methods of analysis is the continuous time equivalent of a debate that took place in the contraceptive literature in the 1960s, when several authors advocated the use of net (adjusted or single decrement life table rates) rates in preference to crude rates (multiple decrement life table rates). A small simulation study illustrates the interpretation of the two types of estimate - the complement of the Kaplan-Meier estimate corresponds to a hypothetical rate where discontinuations for other reasons did not occur, while the cumulative incidence gives systematically lower estimates. The Kaplan-Meier estimates are more appropriate when estimating the effectiveness of a contraceptive method, but the cumulative incidence estimates are more appropriate when making programmatic decisions regarding contraceptive methods. Other areas of application, such as cancer studies, may prefer to use the cumulative incidence estimates, but their use should be determined according to the application. Copyright 2001 John Wiley & Sons, Ltd.
de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia...
International Nuclear Information System (INIS)
Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I.; Babikir, S.
2017-01-01
The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)
2017-10-01
of time for mutant mice to moribundity. We recorded numbers of subjects at risk at 0, 25, 50, 75, 100 days old and use the number to generate Kaplan ...Meier curve. We obtained Kaplan -Meier analysis data showed that time to moribundity doubled in Notch4iGOF- EC;RbpjiΔEC mice, as compared to
Energy Technology Data Exchange (ETDEWEB)
Ganeshan, B.; Miles, K.A.; Shortman, R.; Afaq, A.; Ardeshna, K.M.; Groves, A.M.; Kayani, I. [University College London, Institute of Nuclear Medicine, London (United Kingdom); Babikir, S. [International Atomic Energy Agency (IAEA), Human Health Division, Nuclear Medicine and Diagnostic Imaging Section, Vienna (Austria)
2017-03-15
The purpose of this study was to investigate the ability of computed tomography texture analysis (CTTA) to provide additional prognostic information in patients with Hodgkin's lymphoma (HL) and high-grade non-Hodgkin's lymphoma (NHL). This retrospective, pilot-study approved by the IRB comprised 45 lymphoma patients undergoing routine 18F-FDG-PET-CT. Progression-free survival (PFS) was determined from clinical follow-up (mean-duration: 40 months; range: 10-62 months). Non-contrast-enhanced low-dose CT images were submitted to CTTA comprising image filtration to highlight features of different sizes followed by histogram-analysis using kurtosis. Prognostic value of CTTA was compared to PET FDG-uptake value, tumour-stage, tumour-bulk, lymphoma-type, treatment-regime, and interim FDG-PET (iPET) status using Kaplan-Meier analysis. Cox regression analysis determined the independence of significantly prognostic imaging and clinical features. A total of 27 patients had aggressive NHL and 18 had HL. Mean PFS was 48.5 months. There was no significant difference in pre-treatment CTTA between the lymphoma sub-types. Kaplan-Meier analysis found pre-treatment CTTA (medium feature scale, p=0.010) and iPET status (p<0.001) to be significant predictors of PFS. Cox analysis revealed that an interaction between pre-treatment CTTA and iPET status was the only independent predictor of PFS (HR: 25.5, 95% CI: 5.4-120, p<0.001). Specifically, pre-treatment CTTA risk stratified patients with negative iPET. CTTA can potentially provide prognostic information complementary to iPET for patients with HL and aggressive NHL. (orig.)
Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet
International Nuclear Information System (INIS)
Muntean, S; Ciocan, T; Susan-Resiga, R F; Cervantes, M; Nilsson, H
2012-01-01
The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.
Mathematical, numerical and experimental analysis of the swirling flow at a Kaplan runner outlet
Muntean, S.; Ciocan, T.; Susan-Resiga, R. F.; Cervantes, M.; Nilsson, H.
2012-11-01
The paper presents a novel mathematical model for a-priori computation of the swirling flow at Kaplan runners outlet. The model is an extension of the initial version developed by Susan-Resiga et al [1], to include the contributions of non-negligible radial velocity and of the variable rothalpy. Simple analytical expressions are derived for these additional data from three-dimensional numerical simulations of the Kaplan turbine. The final results, i.e. velocity components profiles, are validated against experimental data at two operating points, with the same Kaplan runner blades opening, but variable discharge.
International Nuclear Information System (INIS)
Badwe, R.A.
1999-01-01
The primary endpoint in the majority of the studies has been either disease recurrence or death. This kind of analysis requires a special method since all patients in the study experience the endpoint. The standard method for estimating such survival distribution is Kaplan Meier method. The survival function is defined as the proportion of individuals who survive beyond certain time. Multi-variate comparison for survival has been carried out with Cox's proportional hazard model
Directory of Open Access Journals (Sweden)
P. Wang
2007-07-01
Full Text Available Transitional cell carcinoma (TCC of the urothelium is often multifocal and subsequent tumors may occur anywhere in the urinary tract after the treatment of a primary carcinoma. Patients initially presenting a bladder cancer are at significant risk of developing metachronous tumors in the upper urinary tract (UUT. We evaluated the prognostic factors of primary invasive bladder cancer that may predict a metachronous UUT TCC after radical cystectomy. The records of 476 patients who underwent radical cystectomy for primary invasive bladder TCC from 1989 to 2001 were reviewed retrospectively. The prognostic factors of UUT TCC were determined by multivariate analysis using the COX proportional hazards regression model. Kaplan-Meier analysis was also used to assess the variable incidence of UUT TCC according to different risk factors. Twenty-two patients (4.6%. developed metachronous UUT TCC. Multiplicity, prostatic urethral involvement by the bladder cancer and the associated carcinoma in situ (CIS were significant and independent factors affecting the occurrence of metachronous UUT TCC (P = 0.0425, 0.0082, and 0.0006, respectively. These results were supported, to some extent, by analysis of the UUT TCC disease-free rate by the Kaplan-Meier method, whereby patients with prostatic urethral involvement or with associated CIS demonstrated a significantly lower metachronous UUT TCC disease-free rate than patients without prostatic urethral involvement or without associated CIS (log-rank test, P = 0.0116 and 0.0075, respectively. Multiple tumors, prostatic urethral involvement and associated CIS were risk factors for metachronous UUT TCC, a conclusion that may be useful for designing follow-up strategies for primary invasive bladder cancer after radical cystectomy.
Sobouti, Farhad; Rakhshan, Vahid; Saravi, Mahdi Gholamrezaei; Zamanian, Ali; Shariati, Mahsa
2016-03-01
Traditional retainers (both metal and fiber-reinforced composite [FRC]) have limitations, and a retainer made from more flexible ligature wires might be advantageous. We aimed to compare an experimental design with two traditional retainers. In this prospective preliminary clinical trial, 150 post-treatment patients were enrolled and randomly divided into three groups of 50 patients each to receive mandibular canine-to-canine retainers made of FRC, flexible spiral wire (FSW), and twisted wire (TW). The patients were monitored monthly. The time at which the first signs of breakage/debonding were detected was recorded. The success rates of the retainers were compared using chi-squared, Kaplan-Meier, and Cox proportional-hazard regression analyses (α = 0.05). In total, 42 patients in the FRC group, 41 in the FSW group, and 45 in the TW group completed the study. The 2-year failure rates were 35.7% in the FRC group, 26.8% in the FSW group, and 17.8% in the TW group. These rates differed insignificantly (chi-squared p = 0.167). According to the Kaplan-Meier analysis, failure occurred at 19.95 months in the FRC group, 21.37 months in the FSW group, and 22.36 months in the TW group. The differences between the survival rates in the three groups were not significant (Cox regression p = 0.146). Although the failure rate of the experimental retainer was two times lower than that of the FRC retainer, the difference was not statistically significant. The experimental TW retainer was successful, and larger studies are warranted to verify these results.
The Role of Polycomb Group Gene BMI1 in the Development of Prostate Cancer
2014-03-01
8217CTGTGGGAGCAAAGGAAGAC3’ Reverse, 5’AGAAGGAAACGGATCCCCTA3’: BCL2 ( P2 - promoter, TATA site), Forward, 5’CAAGTGTTCCGCG`TGATTG3’ Reverse 5’CCCGGTTA...expression of various proteins. A Kaplan -Meier survival analysis with the corresponding Log-Rank and Linear Regression analysis was used to measure...promoter ( P2 promoter). We found very little or no occupancy by TCF4 on - 3.41Kb and -8.41kb of BCL2 promoter (data not shown). Notably, BMI1-overexpression
Genetics Home Reference: Meier-Gorlin syndrome
... Additional NIH Resources (1 link) National Institute of Neurological Disorders and Stroke: Microcephaly Information Page Educational Resources (10 links) Boston Children's Hospital: Growth Problems Disease InfoSearch: Meier-Gorlin syndrome ...
Perturbative analysis for Kaplan's lattice chiral fermions
International Nuclear Information System (INIS)
Aoki, S.; Hirose, H.
1994-01-01
Perturbation theory for lattice fermions with domain wall mass terms is developed and is applied to investigate the chiral Schwinger model formulated on the lattice by Kaplan's method. We calculate the effective action for gauge fields to one loop, and find that it contains a longitudinal component even for anomaly-free cases. From the effective action we obtain gauge anomalies and Chern-Simons currents without ambiguity. We also show that the current corresponding to the fermion number has a nonzero divergence and it flows off the wall into the extra dimension. Similar results are obtained for a proposal by Shamir, who used a constant mass term with free boundaries instead of domain walls
Multi-objective shape optimization of runner blade for Kaplan turbine
International Nuclear Information System (INIS)
Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Semenova, A; Power machines LMZ, Saint Petersburg (Russian Federation))" data-affiliation=" (OJSC Power machines LMZ, Saint Petersburg (Russian Federation))" >Pylev, I; Chirkov, D; Lyutov, A; Chemy, S; Skorospelov, V
2014-01-01
Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads
Multi-objective shape optimization of runner blade for Kaplan turbine
Semenova, A.; Chirkov, D.; Lyutov, A.; Chemy, S.; Skorospelov, V.; Pylev, I.
2014-03-01
Automatic runner shape optimization based on extensive CFD analysis proved to be a useful design tool in hydraulic turbomachinery. Previously the authors developed an efficient method for Francis runner optimization. It was successfully applied to the design of several runners with different specific speeds. In present work this method is extended to the task of a Kaplan runner optimization. Despite of relatively simpler blade shape, Kaplan turbines have several features, complicating the optimization problem. First, Kaplan turbines normally operate in a wide range of discharges, thus CFD analysis of each variant of the runner should be carried out for several operation points. Next, due to a high specific speed, draft tube losses have a great impact on the overall turbine efficiency, and thus should be accurately evaluated. Then, the flow in blade tip and hub clearances significantly affects the velocity profile behind the runner and draft tube behavior. All these features are accounted in the present optimization technique. Parameterization of runner blade surface using 24 geometrical parameters is described in details. For each variant of runner geometry steady state three-dimensional turbulent flow computations are carried out in the domain, including wicket gate, runner, draft tube, blade tip and hub clearances. The objectives are maximization of efficiency in best efficiency and high discharge operation points, with simultaneous minimization of cavitation area on the suction side of the blade. Multiobjective genetic algorithm is used for the solution of optimization problem, requiring the analysis of several thousands of runner variants. The method is applied to optimization of runner shape for several Kaplan turbines with different heads.
Elevated plasma vitamin B12 levels and cancer prognosis: A population-based cohort study
DEFF Research Database (Denmark)
Arendt, Johan Frederik Håkonsen; Farkas, Dora Kormendine; Pedersen, Lars
2015-01-01
patients without a plasma Cbl measurement. Patients treated with Cbl were excluded. Survival probability was assessed using Kaplan-Meier curves. Mortality risk ratios (MRR) were computed using Cox proportional hazard regression, adjusted for age, sex, calendar year, cancer stage and comorbidity, scored...
International Nuclear Information System (INIS)
Carlson, Matthew L.; Glasgow, Amy E.; Jacob, Jeffrey T.; Habermann, Elizabeth B.; Link, Michael J.
2016-01-01
Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases
Energy Technology Data Exchange (ETDEWEB)
Carlson, Matthew L., E-mail: carlson.matthew@mayo.edu [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Glasgow, Amy E. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Jacob, Jeffrey T. [Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Habermann, Elizabeth B. [Division of Health Care Policy and Research and the Robert D. and Patricia E. Kern Center for the Science of Health Care Delivery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Link, Michael J. [Department of Otorhinolaryngology, Mayo Clinic School of Medicine, Rochester, Minnesota (United States); Department of Neurologic Surgery, Mayo Clinic School of Medicine, Rochester, Minnesota (United States)
2016-07-15
Purpose: To determine the incidence of second intracranial neoplasms after the diagnosis and treatment of sporadic vestibular schwannoma (VS). Methods and Materials: Analysis of the Surveillance, Epidemiology, and End Results (SEER) database including all patients identified with a diagnosis of VS and a second intracranial tumor. The Kaplan-Meier method was used to determine the incidence of second tumors while allowing for censoring at loss to follow-up or death. Multivariable associations between treatment modality and second tumor formation were explored using Cox proportional hazards regression analysis. Two illustrative cases are also presented. Results: In all, 9460 patients with unilateral VS were identified between 2004 and 2012. Overall, 66 (0.7%) patients experienced a separate intracranial tumor, benign or malignant, after treatment of VS. Kaplan-Meier estimates for time to second neoplasm at 1, 3, and 5 years were 0.3%, 0.7%, and 0.8%, respectively. Multivariable comparison between VS treatment modalities revealed that the risk of second tumor formation was similar between radiation and surgery (hazard ratio [HR] 0.74; 95% confidence interval [CI] 0.36-1.51; P=.93) but greater for tumors managed with observation alone compared with radiation (HR 2.48; 95% CI 1.31-4.71; P<.01). A total of 6 (0.06%) intracranial malignancies were diagnosed after VS treatment. Kaplan-Meier estimates for time to malignancy at 1, 3, and 5 years were 0%, 0.1%, and 0.1%, respectively. After adjustment for age at diagnosis, sex, and treatment modality, the probability of malignancy after radiation was not greater than after observation alone or microsurgery (HR 4.88; 95% CI 0.85-28.14; P=.08) during the study period. Conclusions: The risk for the development of a second intracranial neoplasm, benign or malignant, at 5 years after treatment of unilateral VS is approximately 0.8%, whereas the risk of acquiring a separate malignancy is 0.1%, or approximately 1 per 1000 cases
Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage
Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung
2014-01-01
In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and ...
Wu, Gang; Zhang, Dai-Yang; Duan, Yu-Han; Zhang, Ying-Qiong; Cui, Xian-Nian; Luo, Zheng
2017-05-23
BACKGROUND This study was designed to explore the correlations of hemoglobin level (Hb) and perioperative blood transfusion with the prognosis of gastric cancer (GC). MATERIAL AND METHODS Our study consisted of 210 patients with GC who all received a D2 radical operation. These patients were assigned into three groups: 68 cases in group A (blood transfusion >5 U); 59 cases in group B (blood transfusion blood transfusion). A 5-year follow-up was conducted to evaluate the disease-free survival of the patients. Univariate analysis was performed to reveal the relationship between the indicators and the patients with GC. Kaplan-Meier method was employed to analyze the survival rate of patients, and Cox regression analysis was applied to determine the independent prognostic factors of GC. RESULTS The univariate analysis indicated that age, perioperative blood transfusion amount, TNM staging, maximal tumor diameter, differentiation degree and invasion degree were associated with the prognosis of GC. The Kaplan-Meier curve showed that the disease-free survival rate was declined in the patients who were older, those received more amount of blood transfusion, those in advanced TNM staging, those had larger tumor diameter, and those with decreased degree of differentiation and invasion. Cox regression analysis indicated that perioperative blood transfusion, maximal tumor diameter and invasion degree were the independent factors affecting disease-free survival of the GC. CONCLUSIONS Our study revealed that large amount of perioperative blood transfusion leads to poor prognosis of GC.
Growth pattern of colorectal liver metastasis as a marker of recurrence risk
DEFF Research Database (Denmark)
Eefsen, R L; Vermeulen, P B; Christensen, I J
2015-01-01
from patient and pathology records. Histological GP were evaluated and related to recurrence free and OS. Kaplan-Meier curves, log-rank test and Cox regression analysis were used. The 5-year OS was 41.8% (95% CI 33.8-49.8%). Growth pattern evaluation of the largest liver metastasis was possible in 224...... free survival (RFS) than patients resected for non-desmoplastic liver metastases (p=0.05). When patients were stratified according to neo-adjuvant treatment in the multivariate Cox regression model, hazard ratios for RFS compared to desmoplastic were: pushing (HR=1.37, 95% CI 0.93-2.02, p=0...
Regression analysis by example
Chatterjee, Samprit
2012-01-01
Praise for the Fourth Edition: ""This book is . . . an excellent source of examples for regression analysis. It has been and still is readily readable and understandable."" -Journal of the American Statistical Association Regression analysis is a conceptually simple method for investigating relationships among variables. Carrying out a successful application of regression analysis, however, requires a balance of theoretical results, empirical rules, and subjective judgment. Regression Analysis by Example, Fifth Edition has been expanded
Varadarajan, Padmini; Gandhi, Siddharth; Sharma, Sanjay; Umakanthan, Branavan; Pai, Ramdas G
2006-10-01
Previous studies have shown low hemoglobin (Hb) to have an adverse effect on survival in patients with congestive heart failure (CHF) and reduced left ventricular (LV) ejection fraction (EF); but its effect on survival in patients with CHF and normal EF is not known. This study sought to determine whether low Hb has an effect on survival in patients with both CHF and normal EF. Detailed chart reviews were performed by medical residents on 2,246 patients (48% with normal EF) with a discharge diagnosis of CHF in a large tertiary care hospital from 1990 to 1999. The CHF diagnosis was validated using the Framingham criteria. Mortality data were obtained from the National Death Index. Survival analysis was performed using Kaplan-Meier and Cox regression models. By Kaplan-Meier analysis, low Hb (< 12 gm/dl) compared with normal hemoglobin was associated with a lower 5-year survival in patients with CHF and both normal (38 vs. 50%, p = 0.0008) and reduced (35 vs. 48%, p = 0.0009) EF. Using the Cox regression model, low Hb was an independent predictor of mortality after adjusting for age, gender, renal dysfunction, diabetes mellitus, hypertension, and EF in both groups of patients. Low Hb has an independent adverse effect on survival in patients with CHF and both normal and reduced EF in both groups of patients.
DEFF Research Database (Denmark)
Andersen, Kim Francis; Fuglo, Hanna Maria; Rasmussen, Sine Hvid
2015-01-01
analysis. Kaplan-Meier survival estimates and log-rank test were used to compare the degree of equality of survival distributions. Prognostic variables with related hazard ratios (HR) were assessed using Cox proportional hazards regression analysis.Forty-one of 92 patients died during follow-up (45%; 12 BS.......05, HR 3.37 [95% CI 1.02-11.11]). No significant results were demonstrated for MTV40%.Volume-based F-18 FDG PET/CT imaging markers in terms of pretreatment estimation of TLG provide supplemental prognostic information to histologic grading, with significant independent properties for prediction...
Is there racial/ethnic variance in cervical cancer- specific survival of ...
African Journals Online (AJOL)
incident cervical carcinoma, between 1992 and 1999, in the Surveillance Epidemiology and End Results (SEER) Data was linked with Medicare to examine the impact of race/ethnicity on overall and cancer-specific survival, using Kaplan Meier survival estimates and multivariable Cox Regression model. Results: There was ...
MAINTAINANCE OF KAPLAN TURBINE TO ENHANCE THE EFFICIENCY
Mr. Shakti Prasanna Khadanga*; Nitish Kumar; Milind Kumar Singh; L. Raj Kumar
2016-01-01
Hydro power plant is the source of renewable energy which leads to reduction in burning of fossil fuels. So the environment is no longer polluted. This project depicts how sediment erosion occurs in Kaplan turbine and the various components of Kaplan turbine where actually erosion takes place. It reduces efficiency [7] and life of hydro power turbine but also causes problems in operations and maintenance. We conducted some necessary test on Kaplan turbine in fluid power laboratory. We are d...
Lundgren, Sebastian; Warfvinge, Carl Fredrik; Elebro, Jacob; Heby, Margareta; Nodin, Björn; Krzyzanowska, Agnieszka; Bjartell, Anders; Leandersson, Karin; Eberhard, Jakob; Jirström, Karin
2016-01-01
Natural killer (NK) cells and NK T cells (NKT) are vital parts of tumour immunosurveillance. However, their impact on prognosis and chemotherapy response in periampullary adenocarcinoma, including pancreatic cancer, has not yet been described. Immune cell-specific expression of CD56, CD3, CD68 and CD1a was analysed by immunohistochemistry on tissue microarrays with tumours from 175 consecutive cases of periampullary adenocarcinoma, 110 of pancreatobiliary type (PB-type) and 65 of intestinal type (I-type) morphology. Kaplan-Meier and Cox regression analysis were applied to determine the impact of CD56+ NK/NKT cells on 5-year overall survival (OS). High density of CD56+ NK/NKT cells correlated with low N-stage and lack of perineural, lymphatic vessel and peripancreatic fat invasion. High density of CD56+ NK/NKT cells was associated with prolonged OS in Kaplan-Meier analysis (p = 0.003), and in adjusted Cox regression analysis (HR = 0.49; 95% CI 0.29-0.86). The prognostic effect of high CD56+ NK/NKT cell infiltration was only evident in cases not receiving adjuvant chemotherapy in PB-type tumours (p for interaction = 0.014). This study demonstrates that abundant infiltration of CD56+ NK/NKT cells is associated with a prolonged survival in periampullary adenocarcinoma. However, the negative interaction with adjuvant treatment is noteworthy. NK cell enhancing strategies may prove to be successful in the management of these cancers.
Rutten, I J G; Ubachs, J; Kruitwagen, R F P M; van Dijk, D P J; Beets-Tan, R G H; Massuger, L F A G; Olde Damink, S W M; Van Gorp, T
2017-04-01
Sarcopenia, severe skeletal muscle loss, has been identified as a prognostic factor in various malignancies. This study aims to investigate whether sarcopenia is associated with overall survival (OS) and surgical complications in patients with advanced ovarian cancer undergoing primary debulking surgery (PDS). Ovarian cancer patients (n = 216) treated with PDS were enrolled retrospectively. Total skeletal muscle surface area was measured on axial computed tomography at the level of the third lumbar vertebra. Optimum stratification was used to find the optimal skeletal muscle index cut-off to define sarcopenia (≤38.73 cm 2 /m 2 ). Cox-regression and Kaplan-Meier analysis were used to analyse the relationship between sarcopenia and OS. The effect of sarcopenia on the development of major surgical complications was studied with logistic regression. Kaplan-Meier analysis showed a significant survival disadvantage for patients with sarcopenia compared to patients without sarcopenia (p = 0.010). Sarcopenia univariably predicted OS (HR 1.536 (95% CI 1.105-2.134), p = 0.011) but was not significant in multivariable Cox-regression analysis (HR 1.362 (95% CI 0.968-1.916), p = 0.076). Significant predictors for OS in multivariable Cox-regression analysis were complete PDS, treatment in a specialised centre and the development of major complications. Sarcopenia was not predictive of major complications. Sarcopenia was not predictive of OS or major complications in ovarian cancer patients undergoing primary debulking surgery. However a strong trend towards a survival disadvantage for patients with sarcopenia was seen. Future prospective studies should focus on interventions to prevent or reverse sarcopenia and possibly increase ovarian cancer survival. Complete cytoreduction remains the strongest predictor of ovarian cancer survival. Copyright © 2017 Elsevier Ltd, BASO ~ The Association for Cancer Surgery, and the European Society of Surgical Oncology. All rights
DEFF Research Database (Denmark)
Mickley, H; Nielsen, J R; Berning, J
1995-01-01
infarction. MAIN OUTCOME MEASURES: Relation of ambulatory ST segment depression, exercise test variables, and left ventricular ejection fraction to subsequent objective (cardiac death or myocardial infarction) or subjective (need for coronary revascularisation) events. RESULTS: 23 of the 123 patients had...... an association between transient ST segment depression and an adverse long term outcome was found (Kaplan-Meier analysis; P = 0.004). The presence of exercise induced angina identified a similar proportion of patients with a poor prognosis (Kaplan-Meier analysis; P ... ST segment depression had high specificity but poor sensitivity. The presence of exercise induced ST segment depression was of no value in predicting combined cardiac events. Indeed, patients without exertional ST segment depression were at increased risk of future objective end points (Kaplan...
Meier-Gorlin syndrome Clinical genetics and genomics
S. de Munnik (Sonja); E.H. Hoefsloot (Lies); J. Roukema (Jolt); J. Schoots (Jeroen); N.V.A.M. Knoers (Nine); H.G. Brunner; A.P. Jackson (Andrew); E. Bongers (Ernie)
2015-01-01
textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia
Directory of Open Access Journals (Sweden)
Pablo Martínez-Camblor
2009-12-01
Full Text Available Objetivo: Analizar el tiempo de supervivencia libre de enfermedad y la supervivencia relativa en mujeres diagnosticadas de cáncer de mama en la provincia de Gipuzkoa en un contexto de riesgos competitivos, valorando las diferencias encontradas entre el uso directo del estimador de Kaplan-Meier y el método de decrementos múltiples por un lado y la supervivencia relativa por otro. Métodos: Se consideraron todos los casos de cáncer de mama registrados en la provincia de Gipuzkoa durante los años 1995 y 1996 en estadio distinto del IV, y se hizo un seguimiento de 8 años para la recidiva y de 10 años para la supervivencia. Se analizó el tiempo de supervivencia libre de enfermedad mediante el método de decrementos múltiples. Asimismo, también se analizó el tiempo de supervivencia observado y corregido por la mortalidad esperada de la población, conocido como supervivencia relativa. Resultados: La estimación de la probabilidad de recidiva a los 8 años por el método de decrementos múltiples es un 8,8% inferior a la obtenida por el método de Kaplan-Meier. La diferencia entre la supervivencia observada y la relativa a los 10 años es del 10,8%. Ambos resultados indican que, en este caso, el método de Kaplan-Meier sobrestima tanto la probabilidad de recaída como la de muerte por la enfermedad. Conclusiones: Dos cuestiones que muchas veces se obvian al realizar un análisis de supervivencia son, por un lado, que la no independencia entre el tiempo de supervivencia y el tiempo de censura hacen no interpretables los resultados obtenidos por el estimador de Kaplan-Meier, y por otro el hecho, hasta hora incuestionable, de que de una manera u otra todos causamos fallo y, desde este planteamiento, en el estudio del tiempo de supervivencia hay que tener presente la probabilidad de fallo en la población general de referencia. En los resultados obtenidos se observa que utilizar de manera superficial el estimador de Kaplan-Meier comporta una
Meier-Gorlin syndrome Clinical genetics and genomics
De Munnik, Sonja A.; Hoefsloot, Elisabeth H.; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine Vam; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie Mhf
2015-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females
Kaplan SpellRead. What Works Clearinghouse Intervention Report
What Works Clearinghouse, 2007
2007-01-01
"Kaplan SpellRead" (formerly known as "SpellRead Phonological Auditory Training"[R]) is a literacy program for struggling readers in grades 2 or above, including special education students, English language learners, and students more than two years below grade level in reading. "Kaplan SpellRead" integrates the…
Survival Analysis of Factors Influencing Cyclic Fatigue of Nickel-Titanium Endodontic Instruments
Directory of Open Access Journals (Sweden)
Eva Fišerová
2015-01-01
Full Text Available Objective. The aim of this study was to validate a survival analysis assessing the effect of type of rotary system, canal curvature, and instrument size on cyclic resistance. Materials and Methods. Cyclic fatigue testing was carried out in stainless steel artificial canals with radii of curvature of 3 or 5 mm and the angle of curvature of 60 degrees. All the instruments were new and 25 mm in working length, and ISO colour coding indicated the instrument size (yellow for size 20; red for size 25. Wizard Navigator instruments, Mtwo instruments, ProTaper instruments, and Revo-S instruments were passively rotated at 250 rotations per minute, and the time fracture was being recorded. Subsequently, fractographic analysis of broken tips was performed by scanning electron microscope. The data were then analysed by the Kaplan-Meier estimator of the survival function, the Cox proportional hazards model, the Wald test for regression covariates, and the Wald test for significance of regression model. Conclusion. The lifespan registered for the tested instruments was Mtwo > Wizard Navigator > Revo-S > ProTaper; 5 mm radius > 3 mm radius; and yellow > red in ISO colour coding system.
High serum uric acid concentration predicts poor survival in patients with breast cancer.
Yue, Cai-Feng; Feng, Pin-Ning; Yao, Zhen-Rong; Yu, Xue-Gao; Lin, Wen-Bin; Qian, Yuan-Min; Guo, Yun-Miao; Li, Lai-Sheng; Liu, Min
2017-10-01
Uric acid is a product of purine metabolism. Recently, uric acid has gained much attraction in cancer. In this study, we aim to investigate the clinicopathological and prognostic significance of serum uric acid concentration in breast cancer patients. A total of 443 female patients with histopathologically diagnosed breast cancer were included. After a mean follow-up time of 56months, survival was analysed using the Kaplan-Meier method. To further evaluate the prognostic significance of uric acid concentrations, univariate and multivariate Cox regression analyses were applied. Of the clinicopathological parameters, uric acid concentration was associated with age, body mass index, ER status and PR status. Univariate analysis identified that patients with increased uric acid concentration had a significantly inferior overall survival (HR 2.13, 95% CI 1.15-3.94, p=0.016). In multivariate analysis, we found that high uric acid concentration is an independent prognostic factor predicting death, but insufficient to predict local relapse or distant metastasis. Kaplan-Meier analysis indicated that high uric acid concentration is related to the poor overall survival (p=0.013). High uric acid concentration predicts poor survival in patients with breast cancer, and might serve as a potential marker for appropriate management of breast cancer patients. Copyright © 2017 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Sevcik, Petr
2009-07-01
The Kaplan turbine has the best theoretical efficiency chart in the total range of operation. In order to achieve these good properties, the turbine has to be adjusted optimally. In general, these settings are performed by the manufacturer of turbines during commissioning. In practice one often meets Kaplan turbines where the scenery does not correspond to the optimal control line. The author of the contribution under consideration reports on possible causes for these errors and also methods of how this scenery can be optimized cost-effectively and how to minimize power losses.
Deciphering the Adaptive Immune Response to Ovarian Cancer
2013-10-01
positive for CD8þ TIL. Conversely, of the cases that were positive for CD8þ TIL, approximately half also contained CD20þ TIL. By Kaplan –Meier analysis...and D). Scale bars: 100 mm (A and B) or 50 mm (C and D). Representative of 5 tumor samples. E, Kaplan –Meier curves showing that the presence of both...CH, Subramanian S, van de Rijn M, Turbin D, et al. Intraepithelial T cells and prognosis in ovarian carcinoma: novel associations with stage, tumor
Blade profile optimization of kaplan turbine using cfd analysis
International Nuclear Information System (INIS)
Janjua, A.B.; Khalil, M.S.
2013-01-01
Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof-river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional) CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models. (author)
Blade Profile Optimization of Kaplan Turbine Using CFD Analysis
Directory of Open Access Journals (Sweden)
Aijaz Bashir Janjua
2013-10-01
Full Text Available Utilization of hydro-power as renewable energy source is of prime importance in the world now. Hydropower energy is available in abundant in form of falls, canals rivers, dams etc. It means, there are various types of sites with different parameters like flow rate, heads, etc. Depending upon the sites, water turbines are designed and manufactured to avail hydro-power energy. Low head turbines on runof-river are widely used for the purpose. Low head turbines are classified as reaction turbines. For runof river, depending upon the variety of site data, low head Kaplan turbines are selected, designed and manufactured. For any given site requirement, it becomes very essential to design the turbine runner blades through optimization of the CAD model of blades profile. This paper presents the optimization technique carried out on a complex geometry of blade profile through static and dynamic computational analysis. It is used through change of the blade profile geometry at five different angles in the 3D (Three Dimensional CAD model. Blade complex geometry and design have been developed by using the coordinates point system on the blade in PRO-E /CREO software. Five different blade models are developed for analysis purpose. Based on the flow rate and heads, blade profiles are analyzed using ANSYS software to check and compare the output results for optimization of the blades for improved results which show that by changing blade profile angle and its geometry, different blade sizes and geometry can be optimized using the computational techniques with changes in CAD models.
Survival analysis of heart failure patients: A case study.
Ahmad, Tanvir; Munir, Assia; Bhatti, Sajjad Haider; Aftab, Muhammad; Raza, Muhammad Ali
2017-01-01
This study was focused on survival analysis of heart failure patients who were admitted to Institute of Cardiology and Allied hospital Faisalabad-Pakistan during April-December (2015). All the patients were aged 40 years or above, having left ventricular systolic dysfunction, belonging to NYHA class III and IV. Cox regression was used to model mortality considering age, ejection fraction, serum creatinine, serum sodium, anemia, platelets, creatinine phosphokinase, blood pressure, gender, diabetes and smoking status as potentially contributing for mortality. Kaplan Meier plot was used to study the general pattern of survival which showed high intensity of mortality in the initial days and then a gradual increase up to the end of study. Martingale residuals were used to assess functional form of variables. Results were validated computing calibration slope and discrimination ability of model via bootstrapping. For graphical prediction of survival probability, a nomogram was constructed. Age, renal dysfunction, blood pressure, ejection fraction and anemia were found as significant risk factors for mortality among heart failure patients.
Rossman, Allan; Kaplan, Danny
2017-01-01
Danny Kaplan is DeWitt Wallace Professor of Mathematics and Computer Science at Macalester College. He received Macalester's Excellence in teaching Award in 2006 and the CAUSE/USCOTS Lifetime Achievement Award in 2017. This interview took place via email on March 4-June 17, 2017. Topics covered in the interview include: (1) the current state of…
DEFF Research Database (Denmark)
Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, Jesper
1999-01-01
for folate biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP. METHODS: We studied bronchoalveolar samples collected in 1989-99 from a prospective cohort of HIV-1-infected patients who had PCP. In 144...... patients with 152 episodes of PCP, we analysed portions of DHPS using PCR and direct sequencing. The relation between survival, P. carinii DHPS mutations, and other predictors of treatment failure was assessed by Kaplan-Meier and multivariate Cox regression analysis. FINDINGS: P. carinii DHPS mutations...
DEFF Research Database (Denmark)
Badawy, Mona; Fenstad, Anne M.; Bartz-Johannessen, Christoffer A.
2017-01-01
Background: High procedure volume and dedication to unicompartmental knee arthroplasty (UKA) has been suggested to improve revision rates. This study aimed to quantify the annual hospital volume effect on revision risk in Oxfordu? nicompartmental knee arthroplasty in the Nordic countries. Methods......). The outcome was revision risk after 2 and 10 years calculated using Kaplan Meier method. Multivariate Cox regression analysis was used to assess the Hazard Ratio (HR) of any revision due to specific reasons with 95% confidence intervals (CI). Results: The implant survival was 80% at 10 years in the volume...
Metagenes Associated with Survival in Non-Small Cell Lung Cancer
Urgard, Egon; Vooder, Tõnu; Võsa, Urmo; Välk, Kristjan; Liu, Mingming; Luo, Cheng; Hoti, Fabian; Roosipuu, Retlav; Annilo, Tarmo; Laine, Jukka; Frenz, Christopher M.; Zhang, Liqing; Metspalu, Andres
2011-01-01
NSCLC (non-small cell lung cancer) comprises about 80% of all lung cancer cases worldwide. Surgery is most effective treatment for patients with early-stage disease. However, 30%–55% of these patients develop recurrence within 5 years. Therefore, markers that can be used to accurately classify early-stage NSCLC patients into different prognostic groups may be helpful in selecting patients who should receive specific therapies. A previously published dataset was used to evaluate gene expression profiles of different NSCLC subtypes. A moderated two-sample t-test was used to identify differentially expressed genes between all tumor samples and cancer-free control tissue, between SCC samples and AC/BC samples and between stage I tumor samples and all other tumor samples. Gene expression microarray measurements were validated using qRT-PCR. Bayesian regression analysis and Kaplan-Meier survival analysis were performed to determine metagenes associated with survival. We identified 599 genes which were down-regulated and 402 genes which were up-regulated in NSCLC compared to the normal lung tissue and 112 genes which were up-regulated and 101 genes which were down-regulated in AC/BC compared to the SCC. Further, for stage Ib patients the metagenes potentially associated with survival were identified. Genes that expressed differently between normal lung tissue and cancer showed enrichment in gene ontology terms which were associated with mitosis and proliferation. Bayesian regression and Kaplan-Meier analysis showed that gene-expression patterns and metagene profiles can be applied to predict the probability of different survival outcomes in NSCLC patients. PMID:21695068
Numerical investigation of hub clearance flow in a Kaplan turbine
Wu, H.; Feng, J. J.; Wu, G. K.; Luo, X. Q.
2012-11-01
In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.
Numerical investigation of hub clearance flow in a Kaplan turbine
International Nuclear Information System (INIS)
Wu, H; Feng, J J; Wu, G K; Luo, X Q
2012-01-01
In this paper, the flow field considering the hub clearance flow in a Kaplan turbine has been investigated through using the commercial CFD code ANSYS CFX based on high-quality structured grids generated by ANSYS ICEM CFD. The turbulence is simulated by k-ω based shear stress transport (SST) turbulence model together with automatic near wall treatments. Four kinds of simulations have been conducted for the runner geometry without hub clearance, with only the hub front clearance, with only the rear hub clearance, and with both front and rear clearance. The analysis of the obtained results is focused on the flow structure of the hub clearance flow, the effect on the turbine performance including hydraulic efficiency and cavitation performance, which can improve the understanding on the flow field in a Kaplan turbine.
Principal component regression analysis with SPSS.
Liu, R X; Kuang, J; Gong, Q; Hou, X L
2003-06-01
The paper introduces all indices of multicollinearity diagnoses, the basic principle of principal component regression and determination of 'best' equation method. The paper uses an example to describe how to do principal component regression analysis with SPSS 10.0: including all calculating processes of the principal component regression and all operations of linear regression, factor analysis, descriptives, compute variable and bivariate correlations procedures in SPSS 10.0. The principal component regression analysis can be used to overcome disturbance of the multicollinearity. The simplified, speeded up and accurate statistical effect is reached through the principal component regression analysis with SPSS.
Wu, Dongping; Chen, Xiaoying; Xu, Yan; Wang, Haiyong; Yu, Guangmao; Jiang, Luping; Hong, Qingxiao; Duan, Shiwei
2017-04-01
The DNA mismatch repair (MMR) gene MutL homolog 1 ( MLH1 ) is critical for the maintenance of genomic integrity. Methylation of the MLH1 gene promoter was identified as a prognostic marker for numerous types of cancer including glioblastoma, colorectal, ovarian and gastric cancer. The present study aimed to determine whether MLH1 promoter methylation was associated with survival in male patients with esophageal squamous cell carcinoma (ESCC). Formalin-fixed, paraffin-embedded ESCC tissues were collected from 87 male patients. MLH1 promoter methylation was assessed using the methylation-specific polymerase chain reaction approach. Kaplan-Meier survival curves and log-rank tests were used to evaluate the association between MLH1 promoter methylation and overall survival (OS) in patients with ESCC. Cox regression analysis was used to obtain crude and multivariate hazard ratios (HR), and 95% confidence intervals (CI). The present study revealed that MLH1 promoter methylation was observed in 53/87 (60.9%) of male patients with ESCC. Kaplan-Meier survival analysis demonstrated that MLH1 promoter hypermethylation was significantly associated with poorer prognosis in patients with ESCC (P=0.048). Multivariate survival analysis revealed that MLH1 promoter hypermethylation was an independent predictor of poor OS in male patients with ESCC (HR=1.716; 95% CI=1.008-2.921). Therefore, MLH1 promoter hypermethylation may be a predictor of prognosis in male patients with ESCC.
Estimation of Unemployment Duration in Botoşani County Using Survival Analysis
Directory of Open Access Journals (Sweden)
Darabă Gabriel
2017-01-01
Full Text Available In this paper we aim at estimating the unemployment duration in Botosani County in order tostudy the impact of individual characteristics (gender, age, place of residence, unemploymentbenefit, etc. on the length of unemployment spells. We use Cox regression model to measure theeffects of gender, age, residential environment, etc. on the hazard rate of leaving unemploymentandKaplan-Meier estimator to compare survival probabilities among different categories ofunemployed persons. The study is carried out on a sample of 200 unemployment spellsregisteredwith the Employment Agency of Botoşani County from January 2012 to December 2015. Theresults reveal that place of residence, unemployment benefit and unemployed category have asignificant impact on unemployment spells.
Barnes, Leslie Fink; Lombardi, Joseph; Gardner, Thomas R; Strauch, Robert J; Rosenwasser, Melvin P
2018-01-01
The aim of this study was to compare the complete visible surface area of the radial head, neck, and coronoid in the Kaplan and Kocher approaches to the lateral elbow. The hypothesis was that the Kaplan approach would afford greater visibility due to the differential anatomy of the intermuscular planes. Ten cadavers were dissected with the Kaplan and Kocher approaches, and the visible surface area was measured in situ using a 3-dimensional digitizer. Six measurements were taken for each approach by 2 surgeons, and the mean of these measurements were analyzed. The mean surface area visible with the lateral collateral ligament (LCL) preserved in the Kaplan approach was 616.6 mm 2 in comparison with the surface area of 136.2 mm 2 visible in the Kocher approach when the LCL was preserved. Using a 2-way analysis of variance, the difference between these 2 approaches was statistically significant. When the LCL complex was incised in the Kocher approach, the average visible surface area of the Kocher approach was 456.1 mm 2 and was statistically less than the Kaplan approach. The average surface area of the coronoid visible using a proximally extended Kaplan approach was 197.8 mm 2 . The Kaplan approach affords significantly greater visible surface area of the proximal radius than the Kocher approach.
Energy Technology Data Exchange (ETDEWEB)
Uebleis, Christopher; Hellweger, Stefan; Lehner, Sebastian; Haug, Alexander; Bartenstein, Peter; Cumming, Paul; Hacker, Marcus [Ludwig-Maximilians University, Department of Nuclear Medicine, Munich (Germany); Laubender, Ruediger Paul [Ludwig-Maximilians University, Institute of Medical Informatics, Biometry, and Epidemiology (IBE), Munich (Germany); Becker, Alexander [Ludwig-Maximilians University, Medical Department I, Munich (Germany); Sohn, Hae-Young [Ludwig-Maximilians University, Medical Department Innenstadt, Munich (Germany); Van Kriekinge, Serge D.; Slomka, Piotr J. [Cedars-Sinai Medical Center, Los Angeles, CA (United States); UCLA, David Geffen School of Medicine, Los Angeles, CA (United States)
2012-10-15
Left ventricular (LV) mechanical dyssynchrony (LVMD) was assessed by gated single-photon emission CT myocardial perfusion imaging (MPI) as an independent predictor of death from any cause in patients with known coronary artery disease (CAD) and reduced LV function. Between 2001 and 2010, 135 patients (64 {+-} 11 years of age, 84 % men) with known CAD, reduced LV ejection fraction (LVEF, 38 {+-} 15 %) and without an implanted cardiac resynchronization therapy device underwent gated MPI at rest. LV functional evaluation, which included phase analysis, was conducted to identify patients with LVMD. Kaplan-Meier survival curves were calculated for death of any cause during a mean follow-up of 2.0 {+-} 1.7 years. Uni- and multivariate Cox proportional hazards regression models were calculated to identify independent predictors of death from any cause. Of the 135 patients, 30 (22 %) died during follow-up (18 cardiac deaths and 12 deaths from other causes). Kaplan-Meier curves showed a significantly shorter survival time in the patients with severely reduced LVEF (<30 %, n = 45) or with LVMD (n = 81, log-rank test P <0.005). Cox models identified LVMD, LVEF <30 % and a total perfusion deficit at rest of {>=}20 % as independent predictors of death from any cause. While patients with LVEF <30 % in conjunction with LVMD had similar survival times irrespective of whether they had early revascularization or medical therapy, those patients with LVEF {>=}30% and LVMD who underwent revascularization had significantly longer survival. In patients with known CAD and reduced LV function, dyssynchrony of the LV is an independent predictor of death from any cause. (orig.)
Ali, Ayyaz; Patel, Amit; Ali, Ziad; Abu-Omar, Yasir; Saeed, Amber; Athanasiou, Thanos; Pepper, John
2011-08-01
Aortic valve replacement in patients with aortic stenosis is usually followed by regression of left ventricular hypertrophy. More complete resolution of left ventricular hypertrophy is suggested to be associated with superior clinical outcomes; however, its translational impact on long-term survival after aortic valve replacement has not been investigated. Demographic, operative, and clinical data were obtained retrospectively through case note review. Transthoracic echocardiography was used to measure left ventricular mass preoperatively and at annual follow-up visits. Patients were classified according to their reduction in left ventricular mass at 1 year after the operation: group 1, less than 25 g; group 2, 25 to 150 g; and group 3, more than 150 g. Kaplan-Meier and multivariable Cox regression were used. A total of 147 patients were discharged from the hospital after aortic valve replacement for aortic stenosis between 1991 and 2001. Preoperative left ventricular mass was 279 ± 98 g in group 1 (n = 47), 347 ± 104 g in group 2 (n = 62), and 491 ± 183 g in group 3 (n = 38) (P regression such as ischemic heart disease or hypertension, valve type, or valve size used. Ten-year actuarial survival was not statistically different in patients with enhanced left ventricular mass regression when compared with the log-rank test (group 1, 51% ± 9%; group 2, 54% ± 8%; and group 3, 72% ± 10%) (P = .26). After adjustment, left ventricular mass reduction of more than 150 g was demonstrated as an independent predictor of improved long-term survival on multivariate analysis (P = .02). Our study is the first to suggest that enhanced postoperative left ventricular mass regression, specifically in patients undergoing aortic valve replacement for aortic stenosis, may be associated with improved long-term survival. In view of these findings, strategies purported to be associated with superior left ventricular mass regression should be considered when undertaking
Meier-Gorlin syndrome Clinical genetics and genomics
Munnik, Sonja; Hoefsloot, Lies; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine; Brunner, H.G.; Jackson, Andrew; Bongers, Ernie
2015-01-01
textabstractMeier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-...
Renal replacement therapy for autosomal dominant polycystic kidney disease (ADPKD) in Europe
DEFF Research Database (Denmark)
Spithoven, Edwin M; Kramer, Anneke; Meijer, Esther
2014-01-01
on RRT prevalence and survival on RRT in 12 European countries with 208 million inhabitants. We studied four 5-year periods (1991-2010). Survival analysis was performed by the Kaplan-Meier method and by Cox proportional hazards regression. RESULTS: From the first to the last study period, the prevalence...... for non-ADPKD subjects. Improved survival was noted for all RRT modalities: haemodialysis [adjusted hazard ratio for mortality during the last versus first time period 0.75 (95% confidence interval 0.61-0.91), peritoneal dialysis 0.55 (0.38-0.80) and transplantation 0.52 (0.32-0.74)]. Cardiovascular...
DEFF Research Database (Denmark)
Kronborg, Mads Brix; Johansen, Jens Brock; Haarbo, Jens
2017-01-01
/mid-ventricular/apical for the LV-LP, and as apical/non-apical for the RV-LP. Appropriate and inappropriate therapies were registered during follow-up via remote monitoring or at device interrogations. Time to event was summarized with Kaplan-Meier plots, and competed risk regression analysis was used to calculate adjusted hazard...... with an apical. We observed no significant association between appropriate therapy and LV-LP in left anterior oblique or right anterior oblique views or inappropriate therapy between any lead positions. Conclusion: An apical RV-LP is associated with an increased risk of appropriate therapy for ventricular...
SAMSN1 is highly expressed and associated with a poor survival in glioblastoma multiforme.
Directory of Open Access Journals (Sweden)
Yong Yan
Full Text Available OBJECTIVES: To study the expression pattern and prognostic significance of SAMSN1 in glioma. METHODS: Affymetrix and Arrystar gene microarray data in the setting of glioma was analyzed to preliminarily study the expression pattern of SAMSN1 in glioma tissues, and Hieratical clustering of gene microarray data was performed to filter out genes that have prognostic value in malignant glioma. Survival analysis by Kaplan-Meier estimates stratified by SAMSN1 expression was then made based on the data of more than 500 GBM cases provided by The Cancer Genome Atlas (TCGA project. At last, we detected the expression of SAMSN1 in large numbers of glioma and normal brain tissue samples using Tissue Microarray (TMA. Survival analysis by Kaplan-Meier estimates in each grade of glioma was stratified by SAMSN1 expression. Multivariate survival analysis was made by Cox proportional hazards regression models in corresponding groups of glioma. RESULTS: With the expression data of SAMSN1 and 68 other genes, high-grade glioma could be classified into two groups with clearly different prognoses. Gene and large sample tissue microarrays showed high expression of SAMSN1 in glioma particularly in GBM. Survival analysis based on the TCGA GBM data matrix and TMA multi-grade glioma dataset found that SAMSN1 expression was closely related to the prognosis of GBM, either PFS or OS (P<0.05. Multivariate survival analysis with Cox proportional hazards regression models confirmed that high expression of SAMSN1 was a strong risk factor for PFS and OS of GBM patients. CONCLUSION: SAMSN1 is over-expressed in glioma as compared with that found in normal brains, especially in GBM. High expression of SAMSN1 is a significant risk factor for the progression free and overall survival of GBM.
Computer Aided Design of Kaplan Turbine Piston with SolidWorks
Camelia Jianu
2010-01-01
The paper presents the steps for 3D computer aided design (CAD) of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.
Polynomial regression analysis and significance test of the regression function
International Nuclear Information System (INIS)
Gao Zhengming; Zhao Juan; He Shengping
2012-01-01
In order to analyze the decay heating power of a certain radioactive isotope per kilogram with polynomial regression method, the paper firstly demonstrated the broad usage of polynomial function and deduced its parameters with ordinary least squares estimate. Then significance test method of polynomial regression function is derived considering the similarity between the polynomial regression model and the multivariable linear regression model. Finally, polynomial regression analysis and significance test of the polynomial function are done to the decay heating power of the iso tope per kilogram in accord with the authors' real work. (authors)
Censoring approach to the detection limits in X-ray fluorescence analysis
International Nuclear Information System (INIS)
Pajek, M.; Kubala-Kukus, A.
2004-01-01
We demonstrate that the effect of detection limits in the X-ray fluorescence analysis (XRF), which limits the determination of very low concentrations of trace elements and results in appearance of the so-called 'nondetects', can be accounted for using the statistical concept of censoring. More precisely, the results of such measurements can be viewed as the left random censored data, which can further be analyzed using the Kaplan-Meier method correcting the data for the presence of nondetects. Using this approach, the results of measured, detection limit censored concentrations can be interpreted in a nonparametric manner including the correction for the nondetects, i.e. the measurements in which the concentrations were found to be below the actual detection limits. Moreover, using the Monte Carlo simulation technique we show that by using the Kaplan-Meier approach the corrected mean concentrations for a population of the samples can be estimated within a few percent uncertainties with respect of the simulated, uncensored data. This practically means that the final uncertainties of estimated mean values are limited in fact by the number of studied samples and not by the correction procedure itself. The discussed random-left censoring approach was applied to analyze the XRF detection-limit-censored concentration measurements of trace elements in biomedical samples
Talent in Female Gymnastics: a Survival Analysis Based upon Performance Characteristics.
Pion, J; Lenoir, M; Vandorpe, B; Segers, V
2015-11-01
This study investigated the link between the anthropometric, physical and motor characteristics assessed during talent identification and dropout in young female gymnasts. 3 cohorts of female gymnasts (n=243; 6-9 years) completed a test battery for talent identification. Performance-levels were monitored over 5 years of competition. Kaplan-Meier and Cox Proportional Hazards analyses were conducted to determine the survival rate and the characteristics that influence dropout respectively. Kaplan-Meier analysis indicated that only 18% of the female gymnasts that passed the baseline talent identification test survived at the highest competition level 5 years later. The Cox Proportional Hazards Model indicated that gymnasts with a score in the best quartile for a specific characteristic significantly increased chances of survival by 45-129%. These characteristics being: basic motor skills (129%), shoulder strength (96%), leg strength (53%) and 3 gross motor coordination items (45-73%). These results suggest that tests batteries commonly used for talent identification in young female gymnasts may also provide valuable insights into future dropout. Therefore, multidimensional test batteries deserve a prominent place in the selection process. The individual test results should encourage trainers to invest in an early development of basic physical and motor characteristics to prevent attrition. © Georg Thieme Verlag KG Stuttgart · New York.
Applied regression analysis a research tool
Pantula, Sastry; Dickey, David
1998-01-01
Least squares estimation, when used appropriately, is a powerful research tool. A deeper understanding of the regression concepts is essential for achieving optimal benefits from a least squares analysis. This book builds on the fundamentals of statistical methods and provides appropriate concepts that will allow a scientist to use least squares as an effective research tool. Applied Regression Analysis is aimed at the scientist who wishes to gain a working knowledge of regression analysis. The basic purpose of this book is to develop an understanding of least squares and related statistical methods without becoming excessively mathematical. It is the outgrowth of more than 30 years of consulting experience with scientists and many years of teaching an applied regression course to graduate students. Applied Regression Analysis serves as an excellent text for a service course on regression for non-statisticians and as a reference for researchers. It also provides a bridge between a two-semester introduction to...
Survival analysis of heart failure patients: A case study.
Directory of Open Access Journals (Sweden)
Tanvir Ahmad
Full Text Available This study was focused on survival analysis of heart failure patients who were admitted to Institute of Cardiology and Allied hospital Faisalabad-Pakistan during April-December (2015. All the patients were aged 40 years or above, having left ventricular systolic dysfunction, belonging to NYHA class III and IV. Cox regression was used to model mortality considering age, ejection fraction, serum creatinine, serum sodium, anemia, platelets, creatinine phosphokinase, blood pressure, gender, diabetes and smoking status as potentially contributing for mortality. Kaplan Meier plot was used to study the general pattern of survival which showed high intensity of mortality in the initial days and then a gradual increase up to the end of study. Martingale residuals were used to assess functional form of variables. Results were validated computing calibration slope and discrimination ability of model via bootstrapping. For graphical prediction of survival probability, a nomogram was constructed. Age, renal dysfunction, blood pressure, ejection fraction and anemia were found as significant risk factors for mortality among heart failure patients.
Arshi, Armin; Sharim, Justin; Park, Don Y; Park, Howard Y; Bernthal, Nicholas M; Yazdanshenas, Hamed; Shamie, Arya N
2017-05-01
Retrospective analysis. To determine the epidemiology and prognostic indicators in patients with chondrosarcoma of the osseous spine. Chondrosarcoma of the spine is rare, with limited data on its epidemiology, clinicopathologic features, and treatment outcomes. Therapy centers on complete en bloc resection with radiotherapy reserved for subtotal resection or advanced disease. The Surveillance, Epidemiology, and End Results Registry was queried for patients with chondrosarcoma of the osseous spine from 1973 to 2012. Study variables included age, sex, race, year of diagnosis, size, grade, extent of disease, and treatment modality. The search identified 973 cases of spinal chondrosarcoma. Mean age at diagnosis was 51.6 years, and 627% of patients were males. Surgical resection and radiotherapy were performed in 75.2% and 21.3% of cases, respectively. Kaplan-Meier analysis demonstrated overall survival (OS) and disease-specific survival (DSS) of 53% and 64%, respectively, at 5 years. Multivariate Cox regression analysis showed that age (OS, P chondrosarcoma of the spine independent of extent of disease. Radiotherapy improves survival in patients with metastatic disease and worsens outcomes in patients with confined and locally invasive disease. 4.
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
International Nuclear Information System (INIS)
Weili, L; Jinling, L; Xingqi, L; Yuan, L
2010-01-01
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
Energy Technology Data Exchange (ETDEWEB)
Weili, L; Jinling, L; Xingqi, L; Yuan, L, E-mail: liaoweili2004@163.co [Institute of Water Resources and Hydro-Electric Engineering, Xi' an University of Technology No.5 South Jinhua Road, Xi' an, Shaanxi, 710048 (China)
2010-08-15
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Research on the cavitation characteristic of Kaplan turbine under sediment flow condition
Weili, L.; Jinling, L.; Xingqi, L.; Yuan, L.
2010-08-01
The sediment concentration in many rivers in our world is very high, and the Kaplan turbine running in these rivers are usually seriously abraded. Since the existence of sand, the probability of cavitation is greatly enhanced. Under the joint action and mutual promotion of cavitation and sand erosion, serious abrasion could be made, the hydraulic performance of the Kaplan turbine may be descended, and the safety and stability of turbine are greatly threatened. Therefore, it is very important and significant to investigate the cavitation characteristic of Kaplan turbine under sediment flow condition. In this paper, numerical simulation of cavitation characteristic in pure water and solid-liquid two-phase flow in Kaplan turbine was performed. The solid-liquid two-fluid model were adopted in the numerical simulation, and the pressure, velocity and particle concentration distributive regularity on turbine blade surface under different diameter and concentration was revealed. Particle trajectory model was used to investigate the region and degree of runner blade abrasion in different conditions. The results showed that serious sand abrasion could be found near the blade head and outlet in large flow rate working condition. Relatively slight abrasion may be found near blade flange in small flow rate working condition. The more the sediment concentration and the large the sand diameter, the serious the runner is abraded, and the greater the efficiency is decreased. further analysis of the combined effects of wear and abrasion was performed. The result shows that the cavitation in silt flow is more serious than in pure water. The runner cavitation performance become worse under high sand concentration and large particle diameter, and the efficiency decrease greatly with the increase of sediment concentration.
Wen, Jiahuai; Yang, Yanning; Ye, Feng; Huang, Xiaojia; Li, Shuaijie; Wang, Qiong; Xie, Xiaoming
2015-12-01
Previous studies have suggested that plasma fibrinogen contributes to tumor cell proliferation, progression and metastasis. The current study was performed to evaluate the prognostic relevance of preoperative plasma fibrinogen in breast cancer patients. Data of 2073 consecutive breast cancer patients, who underwent surgery between January 2002 and December 2008 at the Sun Yat-sen University Cancer Center, were retrospectively evaluated. Plasma fibrinogen levels were routinely measured before surgeries. Participants were grouped by the cutoff value estimated by the receiver operating characteristic (ROC) curve analysis. Overall survival (OS) was assessed using Kaplan-Meier analysis, and multivariate Cox proportional hazards regression model was performed to evaluate the independent prognostic value of plasma fibrinogen level. The optimal cutoff value of preoperative plasma fibrinogen was determined to be 2.83 g/L. The Kaplan-Meier analysis showed that patients with high fibrinogen levels had shorter OS than patients with low fibrinogen levels (p factor for OS in breast cancer patients (HR = 1.475, 95% confidence interval (CI): 1.177-1.848, p = 0.001). Subgroup analyses revealed that plasma fibrinogen level was an unfavorable prognostic parameter in stage II-III, Luminal subtypes and triple-negative breast cancer patients. Elevated preoperative plasma fibrinogen was independently associated with poor prognosis in breast cancer patients and may serve as a valuable parameter for risk assessment in breast cancer patients. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
High Rab27A expression indicates favorable prognosis in CRC.
Shi, Chuanbing; Yang, Xiaojun; Ni, Yijiang; Hou, Ning; Xu, Li; Zhan, Feng; Zhu, Huijun; Xiong, Lin; Chen, Pingsheng
2015-06-13
Rab27A is a peculiar member in Rab family and has been suggested to play essential roles in the development of human cancers. However, the association between Rab27A expression and clinicopathological characteristics of colorectal cancer (CRC) has not been elucidated yet. One-step quantitative real-time polymerase chain reaction (qPCR) test with 18 fresh-frozen CRC samples and immunohistochemistry (IHC) analysis in 112 CRC cases were executed to evaluate the relationship between Rab27A expression and the clinicopathological features of CRC. Cox regression and Kaplan-Meier survival analyses were performed to identify the prognostic factors for 112 CRC patients. The results specified that the expression levels of Rab27A mRNA and protein were significantly higher in CRC tissues than that in matched non-cancerous tissues, in both qPCR test (p = 0.029) and IHC analysis (p = 0.020). The IHC data indicated that the Rab27A protein expression in CRC was statistically correlated with lymph node metastasis (p = 0.022) and TNM stage (p = 0.026). Cox multi-factor analysis and Kaplan-Meier method suggested Rab27A protein expression (p = 0.012) and tumor differentiation (p = 0.004) were significantly associated with the overall survival of CRC patients. The data indicated the differentiate expression of Rab27A in CRC tissues and matched non-cancerous tissues. Rab27A may be used as a valuable prognostic biomarker for CRC patients.
Regression Analysis by Example. 5th Edition
Chatterjee, Samprit; Hadi, Ali S.
2012-01-01
Regression analysis is a conceptually simple method for investigating relationships among variables. Carrying out a successful application of regression analysis, however, requires a balance of theoretical results, empirical rules, and subjective judgment. "Regression Analysis by Example, Fifth Edition" has been expanded and thoroughly…
DEFF Research Database (Denmark)
Schnack, Tine H; Sørensen, Rie D; Nedergaard, Lotte
2014-01-01
OBJECTIVES: Invasive serous adenocarcinomas may present as primary ovarian (POC), primary fallopian tube (PFC) or primary peritoneal (PPC) carcinomas. Whether they are variants of the same malignancy or develop through different pathways is debated. METHODS: Population-based prospectively collected...... data on POC (n=1443), PPC (n=268) and PFC (n=171) cases was obtained from the Danish Gynecological Cancer Database (2005-2013). Chi-square, Fisher's or Wilcoxon-Mann-Whitney test, multivariate logistic regression, Kaplan-Meier and multivariate Cox-regression were used as appropriate. Statistical tests...
2017-08-01
28 weeks) to complete this study. Furthermore, using Kaplan - Meier survival curves, we have discovered that TR AMP; L ck-cre; Klf2fl/fl mice do...3 2 Thymus Spleen Thymus Spleen FoxP3 FoxP3 Figure 2. Kaplan -Meier survival curve. TRAMP (black) versus TRAMP; Lck-cre; Klf2fl/fl (red) survival
International Nuclear Information System (INIS)
Bergant, A; Gregorc, B; Gale, J
2012-01-01
This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatolicje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.
Bergant, A.; Gregorc, B.; Gale, J.
2012-11-01
This paper deals with critical flow regimes that may induce unacceptable water hammer in Kaplan turbine hydropower plants. Water hammer analysis should be performed for normal, emergency and catastrophic operating conditions. Hydropower plants with Kaplan turbines are usually comprised of relatively short inlet and outlet conduits. The rigid water hammer theory can be used for this case. For hydropower plants with long penstocks the elastic water hammer should be used. Some Kaplan turbine units are installed in systems with long open channels. In this case, water level oscillations in the channels should be carefully investigated. Computational results are compared with results of measurements in recently rehabilitated seven Drava river hydroelectric power plants in Slovenia. Water hammer in the six power plants is controlled by appropriate adjustment of the wicket gates and runner blades closing/opening manoeuvres. Due to very long inflow and outflow open channels in Zlatoličje HPP a special vaned pressure regulating device attenuates extreme pressures in Kaplan turbine flow-passage system and controls unsteady flow in both open channels. Comparisons of results include normal operating regimes. The agreement between computed and measured results is reasonable.
Regression analysis with categorized regression calibrated exposure: some interesting findings
Directory of Open Access Journals (Sweden)
Hjartåker Anette
2006-07-01
Full Text Available Abstract Background Regression calibration as a method for handling measurement error is becoming increasingly well-known and used in epidemiologic research. However, the standard version of the method is not appropriate for exposure analyzed on a categorical (e.g. quintile scale, an approach commonly used in epidemiologic studies. A tempting solution could then be to use the predicted continuous exposure obtained through the regression calibration method and treat it as an approximation to the true exposure, that is, include the categorized calibrated exposure in the main regression analysis. Methods We use semi-analytical calculations and simulations to evaluate the performance of the proposed approach compared to the naive approach of not correcting for measurement error, in situations where analyses are performed on quintile scale and when incorporating the original scale into the categorical variables, respectively. We also present analyses of real data, containing measures of folate intake and depression, from the Norwegian Women and Cancer study (NOWAC. Results In cases where extra information is available through replicated measurements and not validation data, regression calibration does not maintain important qualities of the true exposure distribution, thus estimates of variance and percentiles can be severely biased. We show that the outlined approach maintains much, in some cases all, of the misclassification found in the observed exposure. For that reason, regression analysis with the corrected variable included on a categorical scale is still biased. In some cases the corrected estimates are analytically equal to those obtained by the naive approach. Regression calibration is however vastly superior to the naive method when applying the medians of each category in the analysis. Conclusion Regression calibration in its most well-known form is not appropriate for measurement error correction when the exposure is analyzed on a
Chen, Jinyun; Pande, Mala; Huang, Yu-Jing; Wei, Chongjuan; Amos, Christopher I; Talseth-Palmer, Bente A; Meldrum, Cliff J; Chen, Wei V; Gorlov, Ivan P; Lynch, Patrick M; Scott, Rodney J; Frazier, Marsha L
2013-02-01
Heterogeneity in age of onset of colorectal cancer in individuals with mutations in DNA mismatch repair genes (Lynch syndrome) suggests the influence of other lifestyle and genetic modifiers. We hypothesized that genes regulating the cell cycle influence the observed heterogeneity as cell cycle-related genes respond to DNA damage by arresting the cell cycle to provide time for repair and induce transcription of genes that facilitate repair. We examined the association of 1456 single nucleotide polymorphisms (SNPs) in 128 cell cycle-related genes and 31 DNA repair-related genes in 485 non-Hispanic white participants with Lynch syndrome to determine whether there are SNPs associated with age of onset of colorectal cancer. Genotyping was performed on an Illumina GoldenGate platform, and data were analyzed using Kaplan-Meier survival analysis, Cox regression analysis and classification and regression tree (CART) methods. Ten SNPs were independently significant in a multivariable Cox proportional hazards regression model after correcting for multiple comparisons (P Lynch syndrome.
Gaussian process regression analysis for functional data
Shi, Jian Qing
2011-01-01
Gaussian Process Regression Analysis for Functional Data presents nonparametric statistical methods for functional regression analysis, specifically the methods based on a Gaussian process prior in a functional space. The authors focus on problems involving functional response variables and mixed covariates of functional and scalar variables.Covering the basics of Gaussian process regression, the first several chapters discuss functional data analysis, theoretical aspects based on the asymptotic properties of Gaussian process regression models, and new methodological developments for high dime
Computer Aided Design of Kaplan Turbine Piston with\tSolidWorks
Directory of Open Access Journals (Sweden)
Camelia Jianu
2010-10-01
Full Text Available The paper presents the steps for 3D computer aided design (CAD of Kaplan turbine piston made in SolidWorks.The present paper is a tutorial for a Kaplan turbine piston 3D geometry, which is dedicaded to the Parts Sketch and Parts Features design and Drawing Geometry and Drawing Annotation.
Thanapprapasr, Kamolrat; Nartthanarung, Adisak; Thanapprapasr, Duangmani; Jinawath, Artit
2017-01-01
Focal adhesion kinase (FAK) is important for tumor cell survival and metastasis in various cancers. However, its expression and prognostic value in patients with metastatic osteosarcoma remain unknown. We investigated the expression of FAK and its phosphorylated form (pFAK-Y397) in osteosarcoma tissues from 53 patients by immunohistochemistry and evaluated their correlations with clinicopathologic characteristics and outcomes. The prognostic values were assessed using Kaplan-Meier survival and Cox regression analyses. Total FAK and pFAK-Y397 were overexpressed in 48 (90.6%) and 33 (62.3%) cases, respectively. pFAK-Y397 overexpression was correlated with poor histologic response after neoadjuvant chemotherapy in patients with osteosarcoma regardless of the presence of metastasis or not. Kaplan-Meier curve showed that patients with metastatic osteosarcoma with pFAK-Y397 overexpression had significantly worse overall survival (OS) than those with non-overexpression (P = 0.044). Multivariate Cox regression analysis confirmed pFAK-Y397 overexpression as an independent prognostic predictor for OS and post metastases OS (PMOS) (P = 0.017, P = 0.006, respectively). Age at diagnosis was also an independent indicator for PMOS (P = 0.003). However, total FAK expression was not correlated with any clinicopathologic characteristics or OS in patients with metastatic osteosarcoma. In conclusion, our findings identified FAK as a common aberrant protein overexpression in various subtypes of osteosarcoma. pFAK-Y397 overexpression can be used as a prognostic biomarker predicting poor OS for patients with metastatic osteosarcoma, and the expression of pFAK-Y397 differentiated good and poor responders to neoadjuvant chemotherapy.
Wang, Qin; Hu, Ke-Jie; Ren, Ye-Ping; Dong, Jie; Han, Qing-Feng; Zhu, Tong-Ying; Chen, Jiang-Hua; Zhao, Hui-Ping; Chen, Meng-Hua; Xu, Rong; Wang, Yue; Hao, Chuan-Ming; Zhang, Xiao-Hui; Wang, Mei; Tian, Na; Wang, Hai-Yan
2016-01-01
♦ Research indicates that the socioeconomic status (SES) of individuals and the area where they live are related to initial peritonitis and outcomes in peritoneal dialysis (PD). We conducted a retrospective, multi-center cohort study in China to examine these associations. ♦ Data on 2,171 PD patients were collected from 7 centers, including baseline demographic, socioeconomic, and laboratory data. We explored the potential risk factors for initial peritonitis and outcomes using univariate Cox regression and unadjusted binary logistic regression. Then, we used propensity score matching to balance statistically significant risk factors for initial peritonitis and outcomes, and Kaplan-Meier survival analysis to compare differences in peritonitis-free rates between different groups of participants after matching. ♦ A total of 563 (25.9%) initial episodes of peritonitis occurred during the study period. The Kaplan-Meier peritonitis-free rate curve showed high-income patients had a significantly lower risk than low-income patients (p = 0.007) after matching for age, hemoglobin, albumin, and regional SES and PD center. The risk of treatment failure was significantly lower in the high-income than the low-income group after matching for the organism causing peritonitis and PD center: odds ratio (OR) = 0.27 (0.09 - 0.80, p = 0.018). Regional SES and education were not associated with initial peritonitis and outcomes. ♦ Our study demonstrates low individual income is a risk factor for the initial onset of peritonitis and treatment failure after initial peritonitis. Copyright © 2016 International Society for Peritoneal Dialysis.
Zhang, Li-Min; Li, Rui; Zhao, Xiao-Chun; Zhang, Qian; Luo, Xing-Liao
2017-08-01
The fresh frozen plasma (FFP) transfusion threshold and timing for traumatic brain injury (TBI)-associated coagulopathy are controversial. Thus, a multicenter retrospective study was conducted to determine whether or not FFP transfusion is associated with poor outcomes after severe TBI. Data from decompressive craniotomy after blunt force trauma that took place between December 2013 and June 2016 were collected in a multicenter chart. The primary outcomes were mortality and survival, as well as worse outcomes (defined as a Glasgow Outcome Scale [GOS] score ≤3) and better outcomes (GOS score ≥4). Secondary outcomes included 90-day survival rates in all patients with or without FFP transfusion, as well as length of hospital stay in patients with a better prognosis (GOS score ≥4). Univariate analysis, bivariate logistic regression, Spearman rank correlation, and Kaplan-Meier analysis were performed to account for the association between perioperative FFP transfusion and different outcomes. Bivariate logistic analysis showed that mortality and worse outcomes were correlated with FFP transfusion and Glasgow Coma Scale score (P < 0.05). Kaplan-Meier analysis suggested that mortality was statistically higher in the FFP transfusion groups compared with the no FFP transfusion groups, regardless of the severity of TBI (P < 0.05). The overall complications, acute respiratory distress syndrome, and pneumonia rate were significantly higher for patients receiving FFP transfusion (P < 0.05). Increased perioperative FFP infusion was independently associated with mortality or worse outcomes across a spectrum of surgical risk profiles. Copyright © 2017 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Axén, Iben; Bodin, Lennart; Kongsted, Alice
2012-01-01
to recovery? This question was answered using survival analysis, illustrated in Kaplan-Meier curves, Proportional Hazard regression analyses and spline regression analyses. 4: How is the repeatedly measured data associated with baseline (predictor) variables? This question was answered using generalized...... involves some challenges. Vital issues to consider are the within-subject correlation, the between measurement occasion correlation and the presence of missing values. The overall aim of this commentary is to describe different methods of analyzing repeated data. It is meant to give an overview...... for the clinical researcher in order for complex outcome measures to be interpreted in a clinically meaningful way. METHODS: A model data set was formed using data from two clinical studies, where patients with low back pain were followed with weekly text messages for 18 weeks. Different research questions...
Physical activity increases survival after heart valve surgery
DEFF Research Database (Denmark)
Lund, K.; Sibilitz, Kirstine Lærum; Kikkenborg Berg, Selina
2016-01-01
physical activity levels 6-12 months after heart valve surgery and (1) survival, (2) hospital readmission 18-24 months after surgery and (3) participation in exercise-based cardiac rehabilitation. METHODS: Prospective cohort study with registry data from The CopenHeart survey, The Danish National Patient......OBJECTIVES: Increased physical activity predicts survival and reduces risk of readmission in patients with coronary heart disease. However, few data show how physical activity is associated with survival and readmission after heart valve surgery. Objective were to assess the association between...... Register and The Danish Civil Registration System of 742 eligible patients. Physical activity was quantified with the International Physical Activity Questionnaire and analysed using Kaplan-Meier analysis and Cox regression and logistic regression methods. RESULTS: Patients with a moderate to high physical...
Evaluation of the TRPM2 channel as a biomarker in breast cancer using public databases analysis.
Sumoza-Toledo, Adriana; Espinoza-Gabriel, Mario Iván; Montiel-Condado, Dvorak
Breast cancer is one of the most common malignancies affecting women. Recent investigations have revealed a major role of ion channels in cancer. The transient receptor potential melastatin-2 (TRPM2) is a plasma membrane and lysosomal channel with important roles in cell migration and cell death in immune cells and tumor cells. In this study, we investigated the prognostic value of TRPM2 channel in breast cancer, analyzing public databases compiled in Oncomine™ (Thermo Fisher, Ann Arbor, MI) and online Kaplan-Meier Plotter platforms. The results revealed that TRPM2 mRNA overexpression is significant in situ and invasive breast carcinoma compared to normal breast tissue. Furthermore, multi-gene validation using Oncomine™ showed that this channel is coexpressed with proteins related to cellular migration, transformation, and apoptosis. On the other hand, Kaplan-Meier analysis exhibited that low expression of TRPM2 could be used to predict poor outcome in ER- and HER2+ breast carcinoma patients. TRPM2 is a promising biomarker for aggressiveness of breast cancer, and a potential target for the development of new therapies. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.
Improved Governing of Kaplan Turbine Hydropower Plants Operating Island Grids
Gustafsson, Martin
2013-01-01
To reduce the consequences of a major fault in the electric power grid, functioning parts of the grid can be divided into smaller grid islands. The grid islands are operated isolated from the power network, which places new demands on a faster frequency regulation. This thesis investigates a Kaplan turbine hydropower plant operating an island grid. The Kaplan turbine has two control signals, the wicket gate and the turbine blade positions, controlling the mechanical power. The inputs are comb...
Kaplan og Norton bør læses af hele ledelsen
DEFF Research Database (Denmark)
Bukh, Per Nikolaj
2009-01-01
Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april......Anmeldelse af "Eksekveringsgevinsten - Øget konkurrencekraft med fokuseret strategi og drift", Robert S. Kaplan & David P. Norton, 2009, Gyldendal Business. Udgivelsesdato: 8. april...
Saadat, Mostafa; Khalili, Maryam; Omidvari, Shahpour; Ansari-Lari, Maryam
2011-03-28
The main aim of the present study was investigating the association between parental consanguinity and clinical response to chemotherapy in females affected with locally advanced breast cancer. A consecutive series of 92 patients were prospectively included in this study. Clinical assessment of treatment was accomplished by comparing initial tumor size with preoperative tumor size using revised RECIST guideline (version 1.1). Clinical response defined as complete response, partial response and no response. The Kaplan-Meier survival analysis were used to evaluate the association of parental marriages (first cousin vs unrelated marriages) and clinical response to chemotherapy (complete and partial response vs no response). Number of courses of chemotherapy was considered as time, in the analysis. Kaplan-Meier analysis revealed that offspring of unrelated marriages had poorer response to chemotherapy (log rank statistic=5.10, df=1, P=0.023). Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
International Nuclear Information System (INIS)
Jafri, Y.Z.; Kamal, L.
2007-01-01
Various statistical techniques was used on five-year data from 1998-2002 of average humidity, rainfall, maximum and minimum temperatures, respectively. The relationships to regression analysis time series (RATS) were developed for determining the overall trend of these climate parameters on the basis of which forecast models can be corrected and modified. We computed the coefficient of determination as a measure of goodness of fit, to our polynomial regression analysis time series (PRATS). The correlation to multiple linear regression (MLR) and multiple linear regression analysis time series (MLRATS) were also developed for deciphering the interdependence of weather parameters. Spearman's rand correlation and Goldfeld-Quandt test were used to check the uniformity or non-uniformity of variances in our fit to polynomial regression (PR). The Breusch-Pagan test was applied to MLR and MLRATS, respectively which yielded homoscedasticity. We also employed Bartlett's test for homogeneity of variances on a five-year data of rainfall and humidity, respectively which showed that the variances in rainfall data were not homogenous while in case of humidity, were homogenous. Our results on regression and regression analysis time series show the best fit to prediction modeling on climatic data of Quetta, Pakistan. (author)
Regression Analysis and the Sociological Imagination
De Maio, Fernando
2014-01-01
Regression analysis is an important aspect of most introductory statistics courses in sociology but is often presented in contexts divorced from the central concerns that bring students into the discipline. Consequently, we present five lesson ideas that emerge from a regression analysis of income inequality and mortality in the USA and Canada.
Weide, Benjamin; Faller, Christine; Els?sser, Margrit; B?ttner, Petra; Pflugfelder, Annette; Leiter, Ulrike; Eigentler, Thomas Kurt; Bauer, J?rgen; Meier, Friedegund; Garbe, Claus
2013-01-01
BACKGROUND: A direct comparison of prognosis between patients with regional lymph node metastases (LNM) detected synchronously with the primary melanoma (primary LNM), patients who developed their first LNM subsequently (secondary LNM) and those with initial LNM in melanoma with unknown primary site (MUP) is missing thus far. PATIENTS AND METHODS: Survival of 498 patients was calculated from the time point of the first macroscopic LNM using Kaplan Meier and multivariate Cox hazard regression ...
Kaplan-Narayanan-Neuberger lattice fermions pass a perturbative test
International Nuclear Information System (INIS)
Aoki, S.; Levien, R.B.
1995-01-01
We test perturbatively a recent scheme for implementing chiral fermions on the lattice, proposed by Kaplan and modified by Narayanan and Neuberger, using as our testing ground the chiral Schwinger model. The scheme is found to reproduce the desired form of the effective action, whose real part is gauge invariant and whose imaginary part gives the correct anomaly in the continuum limit, once technical problems relating to the necesary infinite extent of the extra dimension are properly addressed. The indications from this study are that the Kaplan-Narayanan-Neuberger scheme has a good chance at being a correct lattice regularization of chiral gauge theories
Case Report: Meier-Gorlin syndrome: Report of an additional patient ...
African Journals Online (AJOL)
We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS), (microtia, absent patella and short stature). She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level.
Improvements of a Kaplan type small turbine: Forbedre og vidreutvikle en Kaplan småturbin
Fjærvold, Lars
2012-01-01
The goal with this master thesis was to establish Hill diagrams and improve a Kaplan turbine intended for use in Afghanistan. The turbine efficiency has been tested in setting 1 and 2. Turbine efficiency in setting 3 and 4 could not be tested because the runner blades interfere with the housing making it impossible to rotate the turbine. The efficiency was tested with an effective pressure head ranging from 2 to 8 meters. Best efficiency point was not reached because of limitations in the te...
International Nuclear Information System (INIS)
Dietl, B.; Schaefer, C.; Koelbl, O.
2005-01-01
Purpose: to answer the question, how the parameters waiting time, radiation treatment time and overall treatment time (OTT) influenced the endpoints overall (OS), event-free (EFS) and local recurrence-free survival (LRFS) in patients with locally advanced head-and-neck cancer, who had received postoperative radiotherapy. Patients and methods: 138 patients were included into a retrospective analysis from 10/1993 to 05/2000. Besides the time parameters waiting time, radiation treatment time and OTT, tumor- and therapy-related parameters (T-, N-, R-status, grading, tumor site, surgical technique, and postoperative hemoglobin < 12 g/dl) with potential impact on the endpoints were investigated in the univariate analysis (Kaplan-Meier log-rank test). Individual parameters with a significant impact (p = 0.05) were subjected to a multivariate Cox regression analysis. Results: besides a postoperative hemoglobin value < 12 g/dl, in the univariate analysis an OTT ≥ 105 days negatively influenced all endpoints, as well as a radiation treatment time ≥ 60 days. On multivariate Cox regression analysis, postoperative hemoglobin < 12 g/dl and an OTT ≥ 105 days were identified as independent negative prognostic factors for all endpoints. Conclusion: the waiting time should be managed according to the ASARA (as short as reasonably achievable) recommendation, radiation treatment should not be protracted exceeding an overall treatment of 105 days. Generally, time parameters should be routinely included in the standard tumor documentation, thus facilitating further evaluation of these prognostically relevant factors. (orig.)
Polylinear regression analysis in radiochemistry
International Nuclear Information System (INIS)
Kopyrin, A.A.; Terent'eva, T.N.; Khramov, N.N.
1995-01-01
A number of radiochemical problems have been formulated in the framework of polylinear regression analysis, which permits the use of conventional mathematical methods for their solution. The authors have considered features of the use of polylinear regression analysis for estimating the contributions of various sources to the atmospheric pollution, for studying irradiated nuclear fuel, for estimating concentrations from spectral data, for measuring neutron fields of a nuclear reactor, for estimating crystal lattice parameters from X-ray diffraction patterns, for interpreting data of X-ray fluorescence analysis, for estimating complex formation constants, and for analyzing results of radiometric measurements. The problem of estimating the target parameters can be incorrect at certain properties of the system under study. The authors showed the possibility of regularization by adding a fictitious set of data open-quotes obtainedclose quotes from the orthogonal design. To estimate only a part of the parameters under consideration, the authors used incomplete rank models. In this case, it is necessary to take into account the possibility of confounding estimates. An algorithm for evaluating the degree of confounding is presented which is realized using standard software or regression analysis
Risk of Recurrence in Operated Parasagittal Meningiomas: A Logistic Binary Regression Model.
Escribano Mesa, José Alberto; Alonso Morillejo, Enrique; Parrón Carreño, Tesifón; Huete Allut, Antonio; Narro Donate, José María; Méndez Román, Paddy; Contreras Jiménez, Ascensión; Pedrero García, Francisco; Masegosa González, José
2018-02-01
Parasagittal meningiomas arise from the arachnoid cells of the angle formed between the superior sagittal sinus (SSS) and the brain convexity. In this retrospective study, we focused on factors that predict early recurrence and recurrence times. We reviewed 125 patients with parasagittal meningiomas operated from 1985 to 2014. We studied the following variables: age, sex, location, laterality, histology, surgeons, invasion of the SSS, Simpson removal grade, follow-up time, angiography, embolization, radiotherapy, recurrence and recurrence time, reoperation, neurologic deficit, degree of dependency, and patient status at the end of follow-up. Patients ranged in age from 26 to 81 years (mean 57.86 years; median 60 years). There were 44 men (35.2%) and 81 women (64.8%). There were 57 patients with neurologic deficits (45.2%). The most common presenting symptom was motor deficit. World Health Organization grade I tumors were identified in 104 patients (84.6%), and the majority were the meningothelial type. Recurrence was detected in 34 cases. Time of recurrence was 9 to 336 months (mean: 84.4 months; median: 79.5 months). Male sex was identified as an independent risk for recurrence with relative risk 2.7 (95% confidence interval 1.21-6.15), P = 0.014. Kaplan-Meier curves for recurrence had statistically significant differences depending on sex, age, histologic type, and World Health Organization histologic grade. A binary logistic regression was made with the Hosmer-Lemeshow test with P > 0.05; sex, tumor size, and histologic type were used in this model. Male sex is an independent risk factor for recurrence that, associated with other factors such tumor size and histologic type, explains 74.5% of all cases in a binary regression model. Copyright © 2017 Elsevier Inc. All rights reserved.
Seber, George A F
2012-01-01
Concise, mathematically clear, and comprehensive treatment of the subject.* Expanded coverage of diagnostics and methods of model fitting.* Requires no specialized knowledge beyond a good grasp of matrix algebra and some acquaintance with straight-line regression and simple analysis of variance models.* More than 200 problems throughout the book plus outline solutions for the exercises.* This revision has been extensively class-tested.
Stewart, David J.; Behrens, Carmen; Roth, Jack; Wistuba, Ignacio I.
2010-01-01
Background For processes that follow first order kinetics, exponential decay nonlinear regression analysis (EDNRA) may delineate curve characteristics and suggest processes affecting curve shape. We conducted a preliminary feasibility assessment of EDNRA of patient survival curves. Methods EDNRA was performed on Kaplan-Meier overall survival (OS) and time-to-relapse (TTR) curves for 323 patients with resected NSCLC and on OS and progression-free survival (PFS) curves from selected publications. Results and Conclusions In our resected patients, TTR curves were triphasic with a “cured” fraction of 60.7% (half-life [t1/2] >100,000 months), a rapidly-relapsing group (7.4%, t1/2=5.9 months) and a slowly-relapsing group (31.9%, t1/2=23.6 months). OS was uniphasic (t1/2=74.3 months), suggesting an impact of co-morbidities; hence, tumor molecular characteristics would more likely predict TTR than OS. Of 172 published curves analyzed, 72 (42%) were uniphasic, 92 (53%) were biphasic, 8 (5%) were triphasic. With first-line chemotherapy in advanced NSCLC, 87.5% of curves from 2-3 drug regimens were uniphasic vs only 20% of those with best supportive care or 1 drug (p<0.001). 54% of curves from 2-3 drug regimens had convex rapid-decay phases vs 0% with fewer agents (p<0.001). Curve convexities suggest that discontinuing chemotherapy after 3-6 cycles “synchronizes” patient progression and death. With postoperative adjuvant chemotherapy, the PFS rapid-decay phase accounted for a smaller proportion of the population than in controls (p=0.02) with no significant difference in rapid-decay t1/2, suggesting adjuvant chemotherapy may move a subpopulation of patients with sensitive tumors from the relapsing group to the cured group, with minimal impact on time to relapse for a larger group of patients with resistant tumors. In untreated patients, the proportion of patients in the rapid-decay phase increased (p=0.04) while rapid-decay t1/2 decreased (p=0.0004) with increasing
Preface to Berk's "Regression Analysis: A Constructive Critique"
de Leeuw, Jan
2003-01-01
It is pleasure to write a preface for the book ”Regression Analysis” of my fellow series editor Dick Berk. And it is a pleasure in particular because the book is about regression analysis, the most popular and the most fundamental technique in applied statistics. And because it is critical of the way regression analysis is used in the sciences, in particular in the social and behavioral sciences. Although the book can be read as an introduction to regression analysis, it can also be read as a...
Directory of Open Access Journals (Sweden)
Bender Ralf
2011-09-01
Full Text Available Abstract Background To assess the reporting of loss to follow-up (LTFU information in articles on randomised controlled trials (RCTs with time-to-event outcomes, and to assess whether discrepancies affect the validity of study results. Methods Literature survey of all issues of the BMJ, Lancet, JAMA, and New England Journal of Medicine published between 2003 and 2005. Eligible articles were reports of RCTs including at least one Kaplan-Meier plot. Articles were classified as "assessable" if sufficient information was available to assess LTFU. In these articles, LTFU information was derived from Kaplan-Meier plots, extracted from the text, and compared. Articles were then classified as "consistent" or "not consistent". Sensitivity analyses were performed to assess the validity of study results. Results 319 eligible articles were identified. 187 (59% were classified as "assessable", as they included sufficient information for evaluation; 140 of 319 (44% presented consistent LTFU information between the Kaplan-Meier plot and text. 47 of 319 (15% were classified as "not consistent". These 47 articles were included in sensitivity analyses. When various imputation methods were used, the results of a chi2-test applied to the corresponding 2 × 2 table changed and hence were not robust in about half of the studies. Conclusions Less than half of the articles on RCTs using Kaplan-Meier plots provide assessable and consistent LTFU information, thus questioning the validity of the results and conclusions of many studies presenting survival analyses. Authors should improve the presentation of both Kaplan-Meier plots and LTFU information, and reviewers of study publications and journal editors should critically appraise the validity of the information provided.
Multicollinearity and Regression Analysis
Daoud, Jamal I.
2017-12-01
In regression analysis it is obvious to have a correlation between the response and predictor(s), but having correlation among predictors is something undesired. The number of predictors included in the regression model depends on many factors among which, historical data, experience, etc. At the end selection of most important predictors is something objective due to the researcher. Multicollinearity is a phenomena when two or more predictors are correlated, if this happens, the standard error of the coefficients will increase [8]. Increased standard errors means that the coefficients for some or all independent variables may be found to be significantly different from In other words, by overinflating the standard errors, multicollinearity makes some variables statistically insignificant when they should be significant. In this paper we focus on the multicollinearity, reasons and consequences on the reliability of the regression model.
DEFF Research Database (Denmark)
Schnack, Tine H; Høgdall, Estrid; Nedergaard, Lotte
2016-01-01
-based prospectively collected data on oCCC (n = 179) and oSAC (n = 2363) cases were obtained from the Danish Gynecological Cancer Database. χ, Fischer or Wilcoxon-Mann-Whitney, multivariate logistic regression, univariate Kaplan-Meier, and multivariate Cox regression tests were used. Statistical tests were 2-sided. P......, 0.62; 95% confidence interval, 0.37-0.92).Although more oSAC than oCCC cases diagnosed in stage III or IV were referred to neoadjuvant chemotherapy, a higher proportion of oCCC achieved complete cytoreduction at primary debulking surgery and/or had lymphadenectomy performed; overall survival were...
Primary Squamous Cell Carcinoma of the Thyroid: A Population-Based Analysis.
Au, Joshua K; Alonso, Jose; Kuan, Edward C; Arshi, Armin; St John, Maie A
2017-07-01
Objectives To analyze the epidemiology and describe the prognostic indicators of patients with primary squamous cell carcinoma of the thyroid. Study Design and Setting Retrospective cohort study based on a national database. Methods The US National Cancer Institute's SEER registry (Surveillance, Epidemiology, and End Results) was reviewed for patients with primary squamous cell carcinoma of the thyroid from 1973 to 2012. Study variables included age, sex, race, tumor size, tumor grade, regional and distant metastases, and treatment modality. Survival measures included overall survival (OS) and disease-specific survival (DSS). Results A total of 199 cases of primary squamous cell carcinoma of the thyroid were identified. Mean age at diagnosis was 68.1 years; 58.3% were female; and 79.4% were white. Following diagnosis, 46.3% of patients underwent surgery; 55.7%, radiation therapy; and 45.8%, surgery with radiation therapy. Kaplan-Meier analysis demonstrated OS and DSS of 16% and 21% at 5 years, respectively. Median survival after diagnosis was 9.1 months. Multivariate Cox regression analysis showed that predictors of OS and DSS included age ( P Squamous cell carcinoma of the thyroid is a rare malignancy with a very poor prognosis. Surgical resection confers an overall survival benefit. Age, tumor grade, and tumor size are predictors of OS and DSS.
Bowden, T J; Bricknell, I R; Preziosi, B M
2018-01-01
Juvenile Atlantic halibut (~100 mg, Hippoglossus hippoglossus) were exposed to Vibrio proteolyticus, a Vibrio spp. isolate, Photobacterium damselae ssp. damselae and five different isolates of Aeromonas salmonicida ssp. achromogenes via an hour-long bath immersion to ascertain their variation in pathogenicity to this fish species. Results were analysed using Kaplan-Meier survival analysis. Analysis of the data from challenges using A. salmonicida ssp. achromogenes revealed three survival values of zero and a spread of values from 0 to 28.43. Challenges using a Vibrio spp isolate, V. proteolyticus and P. damselae resulted in Kaplan-Meier survival estimates of 31.21, 50.41 and 57.21, respectively. As all bacterial species tested could induce juvenile halibut mortalities, they must all be considered as potential pathogens. However, the degree of pathogenicity of A. salmonicida is isolate dependent. © 2017 John Wiley & Sons Ltd.
Stemmer, Salomon M; Steiner, Mariana; Rizel, Shulamith; Soussan-Gutman, Lior; Ben-Baruch, Noa; Bareket-Samish, Avital; Geffen, David B; Nisenbaum, Bella; Isaacs, Kevin; Fried, Georgeta; Rosengarten, Ora; Uziely, Beatrice; Svedman, Christer; McCullough, Debbie; Maddala, Tara; Klang, Shmuel H; Zidan, Jamal; Ryvo, Larisa; Kaufman, Bella; Evron, Ella; Karminsky, Natalya; Goldberg, Hadassah; Shak, Steven; Liebermann, Nicky
2017-01-01
The 21-gene Recurrence Score® (RS) assay is a validated prognostic/predictive tool in ER + early-stage breast cancer. However, clinical outcome data from prospective studies in RS ≥ 11 patients are lacking, as are relevant real-life clinical practice data. In this retrospective analysis of a prospectively designed registry, we evaluated treatments/clinical outcomes in patients undergoing RS-testing through Clalit Health Services. The analysis included N0 ER + HER2-negative breast cancer patients who were RS-tested from 1/2006 through 12/2010. Medical records were reviewed to verify treatments/recurrences/survival. The cohort included 1801 patients (median follow-up, 6.2 years). Median age was 60 years, 50.4% were grade 2 and 81.1% had invasive ductal carcinoma; 48.9% had RS < 18, 40.7% RS 18-30, and 10.4% RS ≥ 31, with chemotherapy use of 1.4, 23.7, and 87.2%, respectively. The 5-year Kaplan-Meier estimates for distant recurrence were 0.8, 3.0, and 8.6%, for patients with RS < 18, RS 18-30 and RS ≥ 31, respectively; the corresponding 5-year Kaplan-Meier estimates for breast cancer death were 0.0, 0.9, and 6.2%. Chemotherapy-untreated patients with RS < 11 ( n = 304) and 11-25 ( n = 1037) (TAILORx categorizatio n ) had 5-year Kaplan-Meier estimates for distant recurrence risk/breast cancer death of 1.0%/0.0% and 1.3%/0.4%, respectively. Our results extend those of the prospective TAILORx trial: the 5-year Kaplan-Meier estimates for distant recurrence and breast cancer death rate for the RS < 18 patients were very low supporting the use of endocrine therapy alone. Furthermore, in chemotherapy-untreated patients with RS 11-25 (where TAILORx patients were randomized to chemoendocrine or endocrine therapy alone), 5-year distant recurrence rates were also very low, suggesting that chemotherapy would not have conferred clinically meaningful benefit.
Hierarchical regression analysis in structural Equation Modeling
de Jong, P.F.
1999-01-01
In a hierarchical or fixed-order regression analysis, the independent variables are entered into the regression equation in a prespecified order. Such an analysis is often performed when the extra amount of variance accounted for in a dependent variable by a specific independent variable is the main
Multivariate Regression Analysis and Slaughter Livestock,
AGRICULTURE, *ECONOMICS), (*MEAT, PRODUCTION), MULTIVARIATE ANALYSIS, REGRESSION ANALYSIS , ANIMALS, WEIGHT, COSTS, PREDICTIONS, STABILITY, MATHEMATICAL MODELS, STORAGE, BEEF, PORK, FOOD, STATISTICAL DATA, ACCURACY
Fasano, Serena; Pierro, Luciana; Pantano, Ilenia; Iudici, Michele; Valentini, Gabriele
2017-07-01
Systemic lupus erythematosus (SLE) is associated with an increased risk of cardiovascular disease (CVD). Thromboprophylaxis with low-dose aspirin (ASA) and hydroxychloroquine (HCQ) seems promising in SLE. We investigated the effects of HCQ cumulative dosages (c-HCQ) and the possible synergistic efficacy of ASA and HCQ in preventing a first CV event (CVE) in patients with SLE. Patients consecutively admitted to our center who, at admission, satisfied the 1997 American College of Rheumatology and/or 2012 Systemic Lupus Collaborating Clinics classification criteria for SLE, and had not experienced any CVE, were enrolled. The occurrence of a thrombotic event, use of ASA, and c-HCQ were recorded. Kaplan-Meier analysis was performed to determine the c-HCQ associated with a lower incidence of CVE. Cox regression analysis served to identify factors associated with a first CVE. For the study, 189 patients with SLE were enrolled and monitored for 13 years (median). Ten CVE occurred during followup. At Kaplan-Meier analysis, the CVE-free rate was higher in ASA-treated patients administered a c-HCQ > 600 g (standard HCQ dose for at least 5 yrs) than in patients receiving ASA alone, or with a c-HCQ dose < 600 g (log-rank test chi-square = 4.01, p = 0.04). Multivariate analysis showed that antimalarials plus ASA protected against thrombosis (HR 0.041 and HR 0.047, respectively), while antiphospholipid antibodies (HR 17.965) and hypertension (HR 18.054) increased the risk of a first CVE. Our results suggest that prolonged use of HCQ plus ASA is thromboprotective in SLE and provides additional evidence for its continued use in patients with SLE.
Directory of Open Access Journals (Sweden)
Strazzullo Viviana
2006-12-01
Full Text Available Abstract Background A large number of renal cancer patients shows poor or partial response to chemotherapy and the mechanisms have not been still understood. Multi-drug resistance is the principal mechanism by which many cancers develop resistance to chemotherapic drugs. The role of the multi-drug resistant transporter (MDR-1/P-glycoprotein, the gene product of MDR-1, and that one of the so-called multi-drug resistance associated protein (MRP, two energy-dependent efflux pumps, are commonly known to confer drug resistance. We studied MDR-1 expression in selected cases of renal cell carcinoma (RCC, clear cell type, with long-term follow-up, in order to establish its prognostic role and its possible contribution in the choice of post-surgical therapy. Methods MDR-1 has been studied by standard LSAB-HRP immunohistochemical technique, in paraffin embedded RCC samples. Protein expression has been compared to clinical and histopathological data and to disease specific survival of RCC patients, by Kaplan-Meier curve and Cox multivariate regression analyses. Results Two groups of RCCs were obtained by esteeming MDR-1 expression and disease specific survival (obtained with Kaplan-Meier curve and Cox multivariate regression analyses: the first one presents low or absent MDR-1 expression and good survival; the second one is characterized by high MDR-1 expression and significant poor outcome (p p p p Conclusion In our opinion, the results of this study well prove the relationship between MDR-1 expression and worse clinical prognosis in RCC, because MDR-1 over-expressing RCCs can be considered a group of tumours with a more aggressive behavior. This finding outlines a possible role of MDR-1 as prognostic factor, dependent and independent of multidrug resistance. These results could be useful to predict cancer evolution and to choose the appropriate treatment: this is another step that can stimulate further promising and interesting investigations on broader
Ebrahimzadeh, Farzad; Hajizadeh, Ebrahim; Vahabi, Nasim; Almasian, Mohammad; Bakhteyar, Katayoon
2015-01-01
Unwanted pregnancy not intended by at least one of the parents has undesirable consequences for the family and the society. In the present study, three classification models were used and compared to predict unwanted pregnancies in an urban population. In this cross-sectional study, 887 pregnant mothers referring to health centers in Khorramabad, Iran, in 2012 were selected by the stratified and cluster sampling; relevant variables were measured and for prediction of unwanted pregnancy, logistic regression, discriminant analysis, and probit regression models and SPSS software version 21 were used. To compare these models, indicators such as sensitivity, specificity, the area under the ROC curve, and the percentage of correct predictions were used. The prevalence of unwanted pregnancies was 25.3%. The logistic and probit regression models indicated that parity and pregnancy spacing, contraceptive methods, household income and number of living male children were related to unwanted pregnancy. The performance of the models based on the area under the ROC curve was 0.735, 0.733, and 0.680 for logistic regression, probit regression, and linear discriminant analysis, respectively. Given the relatively high prevalence of unwanted pregnancies in Khorramabad, it seems necessary to revise family planning programs. Despite the similar accuracy of the models, if the researcher is interested in the interpretability of the results, the use of the logistic regression model is recommended.
Bayesian logistic regression analysis
Van Erp, H.R.N.; Van Gelder, P.H.A.J.M.
2012-01-01
In this paper we present a Bayesian logistic regression analysis. It is found that if one wishes to derive the posterior distribution of the probability of some event, then, together with the traditional Bayes Theorem and the integrating out of nuissance parameters, the Jacobian transformation is an
Patterns of Occurrence and Outcomes of Contralateral Breast Cancer: Analysis of SEER Data
Directory of Open Access Journals (Sweden)
Zhenchong Xiong
2018-05-01
Full Text Available Population-based estimates are lacking for the temporal trends in the contralateral breast cancer (CBC risk for patients with breast cancer (BC. Data for BC patients diagnosed with CBC were collected from the Surveillance, Epidemiology, and End Results database. CBC incidence was calculated using the Kaplan-Meier method and the temporal trend in CBC incidence was assessed using joinpoint regression. Survival analysis was calculated using propensity scoring (PS and multivariate Cox regression with a competing risk model. We found that 10,944 of 212,630 patients with early-stage BC were subsequently diagnosed with secondary BC in the contralateral breast. The 5-, 10-, 15-, and 20-year cumulative CBC incidences were 1.9, 4.6, 7.6, and 10.5%, respectively. Being younger (<40 years, black, hormone receptor-negative, and having undergone radiotherapy were correlated with a high risk of CBC occurrence. CBC incidence increased continuously in the first 11 years after the initial cancer diagnosis, and the upward trend slowed from years 11 to 21, and tended to decline from years 21 to 24. CBC diagnosis was significantly and negatively associated with survival. We reported population-based estimates of the CBC occurrence pattern and risk factors. Patients are at high risk of developing CBC in the first 21 years after the initial BC diagnosis.
Regression analysis using dependent Polya trees.
Schörgendorfer, Angela; Branscum, Adam J
2013-11-30
Many commonly used models for linear regression analysis force overly simplistic shape and scale constraints on the residual structure of data. We propose a semiparametric Bayesian model for regression analysis that produces data-driven inference by using a new type of dependent Polya tree prior to model arbitrary residual distributions that are allowed to evolve across increasing levels of an ordinal covariate (e.g., time, in repeated measurement studies). By modeling residual distributions at consecutive covariate levels or time points using separate, but dependent Polya tree priors, distributional information is pooled while allowing for broad pliability to accommodate many types of changing residual distributions. We can use the proposed dependent residual structure in a wide range of regression settings, including fixed-effects and mixed-effects linear and nonlinear models for cross-sectional, prospective, and repeated measurement data. A simulation study illustrates the flexibility of our novel semiparametric regression model to accurately capture evolving residual distributions. In an application to immune development data on immunoglobulin G antibodies in children, our new model outperforms several contemporary semiparametric regression models based on a predictive model selection criterion. Copyright © 2013 John Wiley & Sons, Ltd.
de Munnik, Sonja A; Hoefsloot, Elisabeth H; Roukema, Jolt; Schoots, Jeroen; Knoers, Nine V A M; Brunner, Han G; Jackson, Andrew P; Bongers, Ernie M H F
2015-09-17
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive primordial dwarfism disorder, characterized by microtia, patellar applasia/hypoplasia, and a proportionate short stature. Associated clinical features encompass feeding problems, congenital pulmonary emphysema, mammary hypoplasia in females and urogenital anomalies, such as cryptorchidism and hypoplastic labia minora and majora. Typical facial characteristics during childhood comprise a small mouth with full lips and micro-retrognathia. During ageing, a narrow, convex nose becomes more prominent. The diagnosis MGS should be considered in patients with at least two of the three features of the clinical triad of microtia, patellar anomalies, and pre- and postnatal growth retardation. In patients with short stature and/or microtia, the patellae should be assessed with care by ultrasonography before age 6 or radiography thereafter. Mutations in one of five genes (ORC1, ORC4, ORC6, CDT1, and CDC6) of the pre-replication complex, involved in DNA-replication, are detected in approximately 67-78% of patients with MGS. Patients with ORC1 and ORC4 mutations appear to have the most severe short stature and microcephaly. Management should be directed towards in-depth investigation, treatment and prevention of associated problems, such as growth retardation, feeding problems, hearing loss, luxating patellae, knee pain, gonarthrosis, and possible pulmonary complications due to congenital pulmonary emphysema with or without broncho- or laryngomalacia. Growth hormone treatment is ineffective in most patients with MGS, but may be effective in patients in whom growth continues to decrease after the first year of life (usually growth velocity normalizes after the first year) and with low levels of IGF1. At present, few data is available about reproduction of females with MGS, but the risk of premature labor might be increased. Here, we propose experience-based guidelines for the regular care and treatment of MGS patients.
RAWS II: A MULTIPLE REGRESSION ANALYSIS PROGRAM,
This memorandum gives instructions for the use and operation of a revised version of RAWS, a multiple regression analysis program. The program...of preprocessed data, the directed retention of variable, listing of the matrix of the normal equations and its inverse, and the bypassing of the regression analysis to provide the input variable statistics only. (Author)
Fazeli, Bahare; Ravari, Hassan; Assadi, Reza
2012-08-01
The aim of this study was first to describe the natural history of Buerger's disease (BD) and then to discuss a clinical approach to this disease based on multivariate analysis. One hundred eight patients who corresponded with Shionoya's criteria were selected from 2000 to 2007 for this study. Major amputation was considered the ultimate adverse event. Survival analyses were performed by Kaplan-Meier curves. Independent variables including gender, duration of smoking, number of cigarettes smoked per day, minor amputation events and type of treatments, were determined by multivariate Cox regression analysis. The recorded data demonstrated that BD may present in four forms, including relapsing-remitting (75%), secondary progressive (4.6%), primary progressive (14.2%) and benign BD (6.2%). Most of the amputations occurred due to relapses within the six years after diagnosis of BD. In multivariate analysis, duration of smoking of more than 20 years had a significant relationship with further major amputation among patients with BD. Smoking cessation programs with experienced psychotherapists are strongly recommended for those areas in which Buerger's disease is common. Patients who have smoked for more than 20 years should be encouraged to quit smoking, but should also be recommended for more advanced treatment for limb salvage.
STAT3 inhibitor enhances chemotherapy drug efficacy by ...
African Journals Online (AJOL)
Immunohistochemistry and Kaplan-Meier method of survival analysis were used to determine chemoresistance trends in patients. STAT3 inhibitor treatment, RNAi or ectopic overexpression of STAT3 or MUC1 in NSCLC cells were used to determine their inter-molecular relation and for modulating stemness-related genes.
High Expression of PHGDH Predicts Poor Prognosis in Non–Small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Jinhong Zhu
2016-12-01
Full Text Available Tumors have exceptionally high demands for energy and anabolism because of their rapid growth. The de novo serine synthesis pathway initiated by phosphoglycerate dehydrogenase (PHGDH has been recognized as a hallmark of metabolic adaption in carcinogenesis. The oncogenic role and prognostic value of PHGDH have been investigated in multiple cancer types, including breast cancer, melanoma, cervical cancer, and colon cancer. Due to the importance of PHGDH in cancer, we attempted to determine the clinical significance of PHGDH in 319 patients with non–small cell lung cancer (NSCLC. We evaluated the mRNA and protein expression levels of PHGDH gene, using quantitative reverse transcriptase polymerase chain reaction and tissue array–based immunohistochemistry, respectively. Significantly increased PHGDH expression in mRNA and protein levels was identified in tumor tissues versus matched adjacent nontumor tissues. More interestingly, immunohistochemical expression of PHGDH was significantly associated with lymph node metastasis (P = .021 and TNM stage (P = .016. Kaplan-Meier survival analysis indicated that NSCLC patients with low levels of PHGDH outperformed patients with high levels of PHGDH regarding 5-year overall survival. Significantly longer survival in the former suggested the prognostic implication of PHGDH in NSCLC. Multivariate survival analysis using Cox regression model demonstrated that high PHGDH levels and advanced TNM stage (III + IV were independent predictors of prognosis in NSCLC. Moreover, bioinformatics analysis confirmed the increase in PHGDH transcripts (data from The Cancer Genome Atlas and its prognostic value (Kaplan-Meier plotter in NSCLC. In conclusion, this study suggested the clinical implication of PHGDH in NSCLC. PHGDH may be a promising therapeutic target in NSCLC.
Prita Meier, Swahili Port Cities: The Architecture of Elsewhere
Longair, Sarah
2018-01-01
Prita Meier’s Swahili Port Cities: the Architecture of Elsewhere is a highly original and important contribution to scholarship on East Africa, and more widely for scholars interested in complicating how we understand the formation of global cities and border zone societies. It is not a conventional architectural history, yet it places buildings, in particular the coral and lime stone constructions found on the Swahili coast, at its heart. Meier uses the “materiality of city life” to offer “a...
Kaplan kõneles Iraagis rahust / Raivo Nikiforov ; interv. Eda Post
Nikiforov, Raivo
2005-01-01
Tapa väljaõppekeskuse kaplan leitnant Raivo Nikiforov käis Bagdadis Eesti rahuvalvajatele jõulujumalateenistust pidamas ning eestlaste elu jälgimas. Iraagi missioonist, rahuvalvajate elamistingimustest
Han, Tianci; Shu, Tianci; Dong, Siyuan; Li, Peiwen; Li, Weinan; Liu, Dali; Qi, Ruiqun; Zhang, Shuguang; Zhang, Lin
2017-05-01
Decreased expression of human chemokine-like factor-like MARVEL transmembrane domain-containing 3 (CMTM3) has been identified in a number of human tumors and tumor cell lines, including gastric and testicular cancer, and PC3, CAL27 and Tca-83 cell lines. However, the association between CMTM3 expression and the clinicopathological features and prognosis of esophageal squamous cell carcinoma (ESCC) patients remains unclear. The aim of the present study was to investigate the correlation between CMTM3 expression and clinicopathological parameters and prognosis in ESCC. CMTM3 mRNA and protein expression was analyzed in ESCC and paired non-tumor tissues by quantitative real-time polymerase chain reaction, western blotting and immunohistochemical analysis. The Kaplan-Meier method was used to plot survival curves and the Cox proportional hazards regression model was also used for univariate and multivariate survival analysis. The results revealed that CMTM3 mRNA and protein expression levels were lower in 82.5% (30/40) and 75% (30/40) of ESCC tissues, respectively, when compared with matched non-tumor tissues. Statistical analysis demonstrated that CMTM3 expression was significantly correlated with lymph node metastasis (P=0.002) and clinical stage (P<0.001) in ESCC tissues. Furthermore, the survival time of ESCC patients exhibiting low CMTM3 expression was significantly shorter than that of ESCC patients exhibiting high CMTM3 expression (P=0.01). In addition, Kaplan-Meier survival analysis revealed that the overall survival time of patients exhibiting low CMTM3 expression was significantly decreased compared with patients exhibiting high CMTM3 expression (P=0.010). Cox multivariate analysis indicated that CMTM3 protein expression was an independent prognostic predictor for ESCC after resection. This study indicated that CMTM3 expression is significantly decreased in ESCC tissues and CMTM3 protein expression in resected tumors may present an effective prognostic
Common pitfalls in statistical analysis: Linear regression analysis
Directory of Open Access Journals (Sweden)
Rakesh Aggarwal
2017-01-01
Full Text Available In a previous article in this series, we explained correlation analysis which describes the strength of relationship between two continuous variables. In this article, we deal with linear regression analysis which predicts the value of one continuous variable from another. We also discuss the assumptions and pitfalls associated with this analysis.
Directory of Open Access Journals (Sweden)
Mridula Krishnan
2017-08-01
Full Text Available Background: Adjuvant therapy after curative resection is associated with survival benefit in stage III pancreatic cancer. We analyzed the factors affecting the outcome of adjuvant therapy in stage III pancreatic cancer and compared overall survival with different modalities of adjuvant treatment. Methods: This is a retrospective study of patients with stage III pancreatic cancer listed in the National Cancer Database (NCDB who were diagnosed between 2004 and 2012. Patients were stratified based on adjuvant therapy they received. Unadjusted Kaplan-Meier and multivariable Cox regression analysis were performed. Results: We analyzed a cohort included 1731 patients who were recipients of adjuvant therapy for stage III pancreatic cancer within the limits of our database. Patients who received adjuvant chemoradiation had the longest postdiagnosis survival time, followed by patients who received adjuvant chemotherapy, and finally patients who received no adjuvant therapy. On multivariate analysis, advancing age and patients with Medicaid had worse survival, whereas Spanish origin and lower Charlson comorbidity score had better survival. Conclusions: Our study is the largest trial using the NCDB addressing the effects of adjuvant therapy specifically in stage III pancreatic cancer. Within the limits of our study, survival benefit with adjuvant therapy was more apparent with longer duration from date of diagnosis.
Sammour, Tarik; Malakorn, Songphol; Bednarski, Brian K; Kaur, Harmeet; Shin, Ui Sup; Messick, Craig; You, Yi-Qian Nancy; Chang, George J
2018-03-01
The aim of this study is to evaluate the oncological outcomes of robotic total mesorectal excision (TME) at an NCI designated cancer center. The effectiveness of laparoscopic TME could not be established, but the robotic-assisted approach may hold some promise, with improved visualization and ergonomics for pelvic dissection. Oncological outcome data is presently lacking. Patients who underwent total mesorectal excision or tumor-specific mesorectal excision for rectal cancer between April 2009 and April 2016 via a robotic approach were identified from a prospective single-institution database. The circumferential resection margin (CRM), distal resection margin, and TME completeness rates were determined. Kaplan-Meier analysis of disease-free survival and overall survival was performed for all patients treated with curative intent. A total of 276 patients underwent robotic proctectomy during the study period. Robotic surgery was performed initially by 1 surgeon with 3 additional surgeons progressively transitioning from open to robotic during the study period with annual increase in the total number of cases performed robotically. Seven patients had involved circumferential resection margins (2.5%), and there were no positive distal or proximal resection margins. One hundred eighty-six patients had TME quality assessed, and only 1 patient (0.5%) had an incomplete TME. Eighty-three patients were followed up for a minimum of 3 years, with a local recurrence rate of 2.4%, and a distant recurrence rate of 16.9%. Five-year disease-free survival on Kaplan-Meier analysis was 82%, and 5-year overall survival was 87%. Robotic proctectomy for rectal cancer can be performed with good short and medium term oncological outcomes in selected patients.
Onisko, Agnieszka; Druzdzel, Marek J; Austin, R Marshall
2016-01-01
Classical statistics is a well-established approach in the analysis of medical data. While the medical community seems to be familiar with the concept of a statistical analysis and its interpretation, the Bayesian approach, argued by many of its proponents to be superior to the classical frequentist approach, is still not well-recognized in the analysis of medical data. The goal of this study is to encourage data analysts to use the Bayesian approach, such as modeling with graphical probabilistic networks, as an insightful alternative to classical statistical analysis of medical data. This paper offers a comparison of two approaches to analysis of medical time series data: (1) classical statistical approach, such as the Kaplan-Meier estimator and the Cox proportional hazards regression model, and (2) dynamic Bayesian network modeling. Our comparison is based on time series cervical cancer screening data collected at Magee-Womens Hospital, University of Pittsburgh Medical Center over 10 years. The main outcomes of our comparison are cervical cancer risk assessments produced by the three approaches. However, our analysis discusses also several aspects of the comparison, such as modeling assumptions, model building, dealing with incomplete data, individualized risk assessment, results interpretation, and model validation. Our study shows that the Bayesian approach is (1) much more flexible in terms of modeling effort, and (2) it offers an individualized risk assessment, which is more cumbersome for classical statistical approaches.
Survival of Root-filled Teeth in the Swedish Adult Population
DEFF Research Database (Denmark)
Fransson, Helena; Dawson, Victoria S; Frisk, Fredrik
2016-01-01
INTRODUCTION: The aim was to assess survival in the Swedish population of teeth treated by nonsurgical root canal treatment during 2009. METHODS: Data from the Swedish Social Insurance Agency were analyzed by Kaplan-Meier analysis to assess cumulative tooth survival during a period of 5-6 years o...
DEFF Research Database (Denmark)
Morgen, Søren Schmidt; Nielsen, Dennis Hallager; Larsen, Claus Falck
2014-01-01
and compared to the observed survival. We assessed how precise the scoring systems predicted survival with McNemar's test. The prognostic value was illustrated with Kaplan-Meier curves, and the individual prognostic components were analyzed with Cox regression analysis. RESULTS: The mean age was 65 years...... (range 20-95), and 57 % of the patients were men. The majority of tumors were lung (23 %), prostate (21 %), and breast tumors (18 %). The overall precision of predicted survival was 58.7 % for the Tokuhashi Revised score and 52.9 % for the Tomita score. The observed survival in each of the scoring groups...... was most precise in predicting survival. However, due to the relatively low precision, we suggest that a modification of both scoring systems is necessary....
Prognostic value of body mass index before treatment for laryngeal squamous cell carcinoma
International Nuclear Information System (INIS)
Li, Zhao-Qu; Zou, Lan; Liu, Tian-Run; Yang, An-Kui
2015-01-01
Patients with head and neck cancer often suffer from malnutrition. This study aims to investigate the influence of body mass index (BMI) on the prognosis of laryngeal squamous cell carcinoma (LSCC). A total of 473 patients with LSCC initially treated at Sun Yat-sen University Cancer Center between January 2005 and July 2009 were retrospectively reviewed. Survival analysis was performed by the Kaplan-Meier method and Cox regression model. Low BMI before treatment was significantly associated with poor overall survival in patients with LSCC (P<0.001). BMI was an independent prognostic factor for patients with LSCC. Leanness before treatment was associated with poor prognosis in patients with LSCC. Good nutritional status is favorable to improve survival in patients with LSCC
DEFF Research Database (Denmark)
Møller, Henrik; Coupland, Victoria H; Tataru, Daniela
2018-01-01
INTRODUCTION: Lung cancer outcomes in England are inferior to comparable countries. Patient or disease characteristics, healthcare-seeking behaviour, diagnostic pathways, and oncology service provision may contribute. We aimed to quantify associations between geographic variations in treatment...... and survival of patients in England. METHODS: We retrieved detailed cancer registration data to analyse the variation in survival of 176,225 lung cancer patients, diagnosed 2010-2014. We used Kaplan-Meier analysis and Cox proportional hazards regression to investigate survival in the two-year period following...... to statistical adjustments for age, sex, socio-economic status, performance status and co-morbidity. CONCLUSION: The extent of use of different treatment modalities varies between geographical areas in England. These variations are not attributable to measurable patient and tumour characteristics, and more...
A 10-year cohort analysis of routine paediatric ART data in a rural South African setting.
Lilian, R R; Mutasa, B; Railton, J; Mongwe, W; McINTYRE, J A; Struthers, H E; Peters, R P H
2017-01-01
South Africa's paediatric antiretroviral therapy (ART) programme is managed using a monitoring and evaluation tool known as TIER.Net. This electronic system has several advantages over paper-based systems, allowing profiling of the paediatric ART programme over time. We analysed anonymized TIER.Net data for HIV-infected children aged ART in a rural district of South Africa between 2005 and 2014. We performed Kaplan-Meier survival analysis to assess outcomes over time. Records of 5461 children were available for analysis; 3593 (66%) children were retained in care. Losses from the programme were higher in children initiated on treatment in more recent years (P ART programme and highlights interventions to improve programme performance.
Verification of Kaplan turbine cam curves realization accuracy at power plant
Directory of Open Access Journals (Sweden)
Džepčeski Dane
2016-01-01
Full Text Available Sustainability of approximately constant value of Kaplan turbine efficiency, for relatively large net head changes, is a result of turbine runner variable geometry. Dependence of runner blades position change on guide vane opening represents the turbine cam curve. The cam curve realization accuracy is of great importance for the efficient and proper exploitation of turbines and consequently complete units. Due to the reasons mentioned above, special attention has been given to the tests designed for cam curves verification. The goal of this paper is to provide the description of the methodology and the results of the tests performed in the process of Kaplan turbine cam curves verification.
Ackerman, Ari
2008-01-01
This article will examine educational ideals by exploring the relation between the individual, the collective, and humanity in Kaplan's Jewish and educational philosophy. Generally the goals of individualism, nationalism, and universalism are seen as mutually exclusive. By contrast, Kaplan argues for the symbiotic relationship between…
Cheung, Li C; Pan, Qing; Hyun, Noorie; Schiffman, Mark; Fetterman, Barbara; Castle, Philip E; Lorey, Thomas; Katki, Hormuzd A
2017-09-30
For cost-effectiveness and efficiency, many large-scale general-purpose cohort studies are being assembled within large health-care providers who use electronic health records. Two key features of such data are that incident disease is interval-censored between irregular visits and there can be pre-existing (prevalent) disease. Because prevalent disease is not always immediately diagnosed, some disease diagnosed at later visits are actually undiagnosed prevalent disease. We consider prevalent disease as a point mass at time zero for clinical applications where there is no interest in time of prevalent disease onset. We demonstrate that the naive Kaplan-Meier cumulative risk estimator underestimates risks at early time points and overestimates later risks. We propose a general family of mixture models for undiagnosed prevalent disease and interval-censored incident disease that we call prevalence-incidence models. Parameters for parametric prevalence-incidence models, such as the logistic regression and Weibull survival (logistic-Weibull) model, are estimated by direct likelihood maximization or by EM algorithm. Non-parametric methods are proposed to calculate cumulative risks for cases without covariates. We compare naive Kaplan-Meier, logistic-Weibull, and non-parametric estimates of cumulative risk in the cervical cancer screening program at Kaiser Permanente Northern California. Kaplan-Meier provided poor estimates while the logistic-Weibull model was a close fit to the non-parametric. Our findings support our use of logistic-Weibull models to develop the risk estimates that underlie current US risk-based cervical cancer screening guidelines. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.
Energy Technology Data Exchange (ETDEWEB)
Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J. [Ludwig-Maximilians-Universitaet Muenchen (Germany). Inst. fuer Klinische Radiologie; Hautmann, H.; Huber, R.M. [Klinikum Innenstadt der Ludwig-Maximilians-Universitaet Muenchen (Germany). Abteilung Pulmonologie, Medizinische Klinik
2002-08-01
Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [German] Ziel: Erfassung des therapeutischen Potenzials der Stentbehandlung bei tracheobronchialen Stenosen, in-vivo Vergleich verschiedener Stenttypen und Erarbeitung von geeigneten Kriterien zur Stentwahl. Material und Methodik: Prospektive Fallanalyse. Zwischen 1993 und 1999 wurden insgesamt 53 Stents in das Tracheobronichalsystem von 39 konsekutiven Patienten implantiert. Jeder einzelne Stent (26 Streckerstents, 18 Wallstents, 6 Nitinolstents, ein Dumonstent
Directory of Open Access Journals (Sweden)
Jung Kwon Kim
Full Text Available There have been conflicting reports regarding the association of perioperative blood transfusion (PBT with oncologic outcomes including recurrence rates and survival outcomes in prostate cancer. We aimed to evaluate whether perioperative blood transfusion (PBT affects biochemical recurrence-free survival (BRFS, cancer-specific survival (CSS, and overall survival (OS following radical prostatectomy (RP for patients with prostate cancer.A total of 2,713 patients who underwent RP for clinically localized prostate cancer between 1993 and 2014 were retrospectively analyzed. We performed a comparative analysis based on receipt of transfusion (PBT group vs. no-PBT group and transfusion type (autologous PBT vs. allogeneic PBT. Univariate and multivariate Cox-proportional hazard regression analysis were performed to evaluate variables associated with BRFS, CSS, and OS. The Kaplan-Meier method was used to calculate survival estimates for BRFS, CSS, and OS, and log-rank test was used to conduct comparisons between the groups.The number of patients who received PBT was 440 (16.5%. Among these patients, 350 (79.5% received allogeneic transfusion and the other 90 (20.5% received autologous transfusion. In a multivariate analysis, allogeneic PBT was found to be statistically significant predictors of BRFS, CSS, and OS; conversely, autologous PBT was not. The Kaplan-Meier survival analysis showed significantly decreased 5-year BRFS (79.2% vs. 70.1%, log-rank, p = 0.001, CSS (98.5% vs. 96.7%, log-rank, p = 0.012, and OS (95.5% vs. 90.6%, log-rank, p < 0.001 in the allogeneic PBT group compared to the no-allogeneic PBT group. In the autologous PBT group, however, none of these were statistically significant compared to the no-autologous PBT group.We found that allogeneic PBT was significantly associated with decreased BRFS, CSS, and OS. This provides further support for the immunomodulation hypothesis for allogeneic PBT.
Badar, Athar A; Perez-Moreno, Ana Cristina; Jhund, Pardeep S; Wong, Chih M; Hawkins, Nathaniel M; Cleland, John G F; van Veldhuisen, Dirk J; Wikstrand, John; Kjekshus, John; Wedel, Hans; Watkins, Stuart; Gardner, Roy S; Petrie, Mark C; McMurray, John J V
2014-12-21
Angina pectoris is common in patients with heart failure and reduced ejection fraction (HF-REF) but its relationship with outcomes has not been well defined. This relationship was investigated further in a retrospective analysis of the Controlled Rosuvastatin Multinational Trial in Heart Failure (CORONA). Four thousand, eight hundred and seventy-eight patients were divided into three categories: no history of angina and no chest pain at baseline (Group A; n = 1240), past history of angina but no chest pain at baseline (Group B; n = 1353) and both a history of angina and chest pain at baseline (Group C; n = 2285). Outcomes were examined using Kaplan-Meier and Cox regression survival analysis. Compared with Group A, Group C had a higher risk of non-fatal myocardial infarction or unstable angina (HR: 2.36, 1.54-3.61; P angina are at an increased risk of acute coronary syndrome and HF hospitalization. Whether these patients would benefit from more aggressive medical therapy or percutaneous revascularization is not known and merits further investigation. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2014. For permissions please email: journals.permissions@oup.com.
Moderation analysis using a two-level regression model.
Yuan, Ke-Hai; Cheng, Ying; Maxwell, Scott
2014-10-01
Moderation analysis is widely used in social and behavioral research. The most commonly used model for moderation analysis is moderated multiple regression (MMR) in which the explanatory variables of the regression model include product terms, and the model is typically estimated by least squares (LS). This paper argues for a two-level regression model in which the regression coefficients of a criterion variable on predictors are further regressed on moderator variables. An algorithm for estimating the parameters of the two-level model by normal-distribution-based maximum likelihood (NML) is developed. Formulas for the standard errors (SEs) of the parameter estimates are provided and studied. Results indicate that, when heteroscedasticity exists, NML with the two-level model gives more efficient and more accurate parameter estimates than the LS analysis of the MMR model. When error variances are homoscedastic, NML with the two-level model leads to essentially the same results as LS with the MMR model. Most importantly, the two-level regression model permits estimating the percentage of variance of each regression coefficient that is due to moderator variables. When applied to data from General Social Surveys 1991, NML with the two-level model identified a significant moderation effect of race on the regression of job prestige on years of education while LS with the MMR model did not. An R package is also developed and documented to facilitate the application of the two-level model.
Wang, Yinqing; Cai, Ranze; Wang, Rui; Wang, Chunhua; Chen, Chunmei
2018-06-01
This is a retrospective study.The aim of this study was to illustrate the survival outcomes of patients with classic ependymoma (CE) and identify potential prognostic factors.CE is the most common category of spinal ependymomas, but few published studies have discussed predictors of the survival outcome.A Boolean search of the PubMed, Embase, and OVID databases was conducted by 2 investigators independently. The objects were intramedullary grade II ependymoma according to 2007 WHO classification. Univariate Kaplan-Meier analysis and Log-Rank tests were performed to identify variables associated with progression-free survival (PFS) or overall survival (OS). Multivariate Cox regression was performed to assess hazard ratios (HRs) with 95% confidence intervals (95% CIs). Statistical analysis was performed by SPSS version 23.0 (IBM Corp.) with statistical significance defined as P analysis showed that patients who had undergone total resection (TR) had better PFS and OS than those with subtotal resection (STR) and biopsy (P = .002, P = .004, respectively). Within either univariate or multivariate analysis (P = .000, P = .07, respectively), histological type was an independent prognostic factor for PFS of CE [papillary type: HR 0.002, 95% CI (0.000-0.073), P = .001, tanycytic type: HR 0.010, 95% CI (0.000-0.218), P = .003].It was the first integrative analysis of CE to elucidate the correlation between kinds of factors and prognostic outcomes. Definite histological type and safely TR were foundation of CE's management. 4.
De 'wraak van de geografie' volgens Robert D. Kaplan
Mamadouh, V.
2013-01-01
De Amerikaanse publicist Robert D. Kaplan heeft een nieuwe bestseller, De wraak van de geografie, waarin hij het belang van geografie voor de internationale politiek uit de doeken doet. Zijn roep om meer aandacht voor geografie is echter erg eenzijdig en een miskenning van alles waar ons vak voor
Unsteady load on an oscillating Kaplan turbine runner
Puolakka, O.; Keto-Tokoi, J.; Matusiak, J.
2013-02-01
A Kaplan turbine runner oscillating in turbine waterways is subjected to a varying hydrodynamic load. Numerical simulation of the related unsteady flow is time-consuming and research is very limited. In this study, a simplified method based on unsteady airfoil theory is presented for evaluation of the unsteady load for vibration analyses of the turbine shaft line. The runner is assumed to oscillate as a rigid body in spin and axial heave, and the reaction force is resolved into added masses and dampings. The method is applied on three Kaplan runners at nominal operating conditions. Estimates for added masses and dampings are considered to be of a magnitude significant for shaft line vibration. Moderate variation in the added masses and minor variation in the added dampings is found in the frequency range of interest. Reference results for added masses are derived by solving the boundary value problem for small motions of inviscid fluid using the finite element method. Good correspondence is found in the added mass estimates of the two methods. The unsteady airfoil method is considered accurate enough for design purposes. Experimental results are needed for validation of unsteady load analyses.
CASAS: Cancer Survival Analysis Suite, a web based application.
Rupji, Manali; Zhang, Xinyan; Kowalski, Jeanne
2017-01-01
We present CASAS, a shiny R based tool for interactive survival analysis and visualization of results. The tool provides a web-based one stop shop to perform the following types of survival analysis: quantile, landmark and competing risks, in addition to standard survival analysis. The interface makes it easy to perform such survival analyses and obtain results using the interactive Kaplan-Meier and cumulative incidence plots. Univariate analysis can be performed on one or several user specified variable(s) simultaneously, the results of which are displayed in a single table that includes log rank p-values and hazard ratios along with their significance. For several quantile survival analyses from multiple cancer types, a single summary grid is constructed. The CASAS package has been implemented in R and is available via http://shinygispa.winship.emory.edu/CASAS/. The developmental repository is available at https://github.com/manalirupji/CASAS/.
Lin, Sheng-Chieh; Lin, Hui-Wen
2015-04-01
Childhood asthma and premature birth are both common; however, no studies have reported urbanization association between asthma and prematurity and the duration of prematurity affect asthma development. We use Taiwan Longitudinal Health Insurance Database (LHID) to explore association between asthma and prematurity among children by using a population-based analysis. This is a retrospective cohort study with registration data derived from Taiwan LHID. We evaluated prematurely born infants and children aged prematurely and 13 851 (40.27 per 1000 person-years) controls. The hazard ratio for asthma during 5-year follow-up period was 1.95 (95% confidence interval = 1.67-2.28) among children born prematurely. Boys born prematurely aged 0-2 years were associated with higher asthma rates compared with girls in non-premature and premature groups. Living in urban areas, those born prematurely were associated with higher rates of asthma compared with non-prematurity. Those born prematurely lived in northern region had higher asthma hazard ratio than other regions. Our analyses indicated that sex, age, urbanization level, and geographic region are significantly associated with prematurity and asthma. Based on cumulative asthma-free survival curve generated using the Kaplan-Meier method, infants born prematurely should be closely monitored to see if they would develop asthma until the age of 6 years.
Martínez-Pastor, Juan C.; Muñoz-Mahamud, Ernesto; Vilchez, Félix; García-Ramiro, Sebastián; Bori, Guillem; Sierra, Josep; Martínez, José A.; Font, Lluis; Mensa, Josep; Soriano, Alex
2009-01-01
The aim of our study was to evaluate the outcome of acute prosthetic joint infections (PJIs) due to gram-negative bacilli (GNB) treated without implant removal. Patients with an acute PJI due to GNB diagnosed from 2000 to 2007 were prospectively registered. Demographics, comorbidity, type of implant, microbiology data, surgical treatment, antimicrobial therapy, and outcome were recorded. Classification and regression tree analysis, the Kaplan-Meier survival method, and the Cox regression model were applied. Forty-seven patients were included. The mean age was 70.7 years, and there were 15 hip prostheses and 32 knee prostheses. The median number of days from the time of arthroplasty was 20. The most frequent pathogens were members of the Enterobacteriaceae family in 41 cases and Pseudomonas spp. in 20 cases. Among the Enterobacteriaceae, 14 were resistant to ciprofloxacin, while all Pseudomonas aeruginosa isolates were susceptible to ciprofloxacin. The median durations of intravenous and oral antibiotic treatment were 14 and 64 days, respectively. A total of 35 (74.5%) patients were in remission after a median follow-up of 463 days (interquartile range, 344 to 704) days. By use of the Kaplan-Meier survival curve, a C-reactive protein (CRP) concentration of ≤15 mg/dl (P = 0.03) and receipt of a fluoroquinolone, when all GNB isolated were susceptible (P = 0.0009), were associated with a better outcome. By use of a Cox regression model, a CRP concentration of ≤15 mg/dl (odds ratio [OR], 3.57; 95% confidence interval [CI], 1.05 to 12.5; P = 0.043) and receipt of a fluoroquinolone (OR, 9.09; 95% CI, 1.96 to 50; P = 0.005) were independently associated with better outcomes. Open debridement without removal of the implant had a success rate of 74.5%, and the factors associated with good prognosis were a CRP concentration at the time of diagnosis ≤15 mg/dl and treatment with a fluoroquinolone. PMID:19687237
Numerical investigation of tip clearance cavitation in Kaplan runners
Nikiforova, K.; Semenov, G.; Kuznetsov, I.; Spiridonov, E.
2016-11-01
There is a gap between the Kaplan runner blade and the shroud that makes for a special kind of cavitation: cavitation in the tip leakage flow. Two types of cavitation caused by the presence of clearance gap are known: tip vortex cavitation that appears at the core of the rolled up vortex on the blade suction side and tip clearance cavitation that appears precisely in the gap between the blade tip edge and the shroud. In the context of this work numerical investigation of the model Kaplan runner has been performed taking into account variable tip clearance for several cavitation regimes. The focus is put on investigation of structure and origination of mechanism of cavitation in the tip leakage flow. Calculations have been performed with the help of 3-D unsteady numerical model for two-phase medium. Modeling of turbulent flow in this work has been carried out using full equations of Navier-Stokes averaged by Reynolds with correction for streamline curvature and system rotation. For description of this medium (liquid-vapor) simplification of Euler approach is used; it is based on the model of interpenetrating continuums, within the bounds of this two- phase medium considered as a quasi-homogeneous mixture with the common velocity field and continuous distribution of density for both phases. As a result, engineering techniques for calculation of cavitation conditioned by existence of tip clearance in model turbine runner have been developed. The detailed visualization of the flow was carried out and vortex structure on the suction side of the blade was reproduced. The range of frequency with maximum value of pulsation was assigned and maximum energy frequency was defined; it is based on spectral analysis of the obtained data. Comparison between numerical computation results and experimental data has been also performed. The location of cavitation zone has a good agreement with experiment for all analyzed regimes.
International Nuclear Information System (INIS)
Garcia Vicente, Ana Maria; Soriano Castrejon, Angel; Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano; Mar Munoz Sanchez, Maria del; Alvarez Cabellos, Ruth; Espinosa Aunion, Ruth
2015-01-01
To explore the relationship between basal 18 F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent 18 F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with 18 F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Garcia Vicente, Ana Maria; Soriano Castrejon, Angel [University General Hospital, Nuclear Medicine Department, Ciudad Real (Spain); Lopez-Fidalgo, Jesus Fernando; Amo-Salas, Mariano [University of Castilla-La Mancha, Department of Mathematics, Ciudad Real (Spain); Mar Munoz Sanchez, Maria del [Virgen de la Luz Hospital, Oncology Department, Cuenca (Spain); Alvarez Cabellos, Ruth [Virgen de la Salud Hospital, Oncology Department, Toledo (Spain); Espinosa Aunion, Ruth [La Mancha Centro Hospital, Oncology Department, Ciudad Real (Spain)
2015-11-15
To explore the relationship between basal {sup 18}F-FDG PET/CT information in breast tumours and survival in locally advanced breast cancer (LABC). This prospective, multicentre study included 198 women diagnosed with LABC. All patients underwent {sup 18}F-FDG PET/CT prior to treatment. The maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N) and the N/T ratio was obtained in all cases. Stage according to PET/CT imaging (metabolic stage) and conventional imaging techniques (clinical stage) was established. During follow-up, patient status was established (disease free status or not). The relationship between all the variables and overall survival (OS) and disease-free survival (DFS) was analysed using the Kaplan-Meier and Cox regression methods. A ROC analysis was performed to obtain a cut-off value of SUVmax that was useful in the prediction of outcome. The mean SUVmax ± SD values in the primary tumour, lymph nodes and the SUVmax N/T index were 7.40 ± 5.57, 4.17 ± 4.74 and 0.73 ± 1.20, respectively. Higher semiquantitative metabolic values were found in more advanced metabolic and clinical stages. During follow-up, 78.4 % of patients were free of disease. Significant relationships were observed between SUVT and SUVN and patient status. With respect to OS and DFS, significant differences were detected for the metabolic stage. Kaplan-Meier analysis revealed that using the cut-off values, a primary-tumour SUVmax ≥ 6.05 or a nodal SUVmax ≥2.25 were significantly correlated with DFS and OS. PET imaging with {sup 18}F-FDG offers prognostic information for LABC that can be obtained preoperatively and noninvasively. (orig.)
Sublobar resection is equivalent to lobectomy for clinical stage 1A lung cancer in solid nodules.
Altorki, Nasser K; Yip, Rowena; Hanaoka, Takaomi; Bauer, Thomas; Aye, Ralph; Kohman, Leslie; Sheppard, Barry; Thurer, Richard; Andaz, Shahriyour; Smith, Michael; Mayfield, William; Grannis, Fred; Korst, Robert; Pass, Harvey; Straznicka, Michaela; Flores, Raja; Henschke, Claudia I
2014-02-01
A single randomized trial established lobectomy as the standard of care for the surgical treatment of early-stage non-small cell lung cancer. Recent advances in imaging/staging modalities and detection of smaller tumors have once again rekindled interest in sublobar resection for early-stage disease. The objective of this study was to compare lung cancer survival in patients with non-small cell lung cancer with a diameter of 30 mm or less with clinical stage 1 disease who underwent lobectomy or sublobar resection. We identified 347 patients diagnosed with lung cancer who underwent lobectomy (n = 294) or sublobar resection (n = 53) for non-small cell lung cancer manifesting as a solid nodule in the International Early Lung Cancer Action Program from 1993 to 2011. Differences in the distribution of the presurgical covariates between sublobar resection and lobectomy were assessed using unadjusted P values determined by logistic regression analysis. Propensity scoring was performed using the same covariates. Differences in the distribution of the same covariates between sublobar resection and lobectomy were assessed using adjusted P values determined by logistic regression analysis with adjustment for the propensity scores. Lung cancer-specific survival was determined by the Kaplan-Meier method. Cox survival regression analysis was used to compare sublobar resection with lobectomy, adjusted for the propensity scores, surgical, and pathology findings, when adjusted and stratified by propensity quintiles. Among 347 patients, 10-year Kaplan-Meier for 53 patients treated by sublobar resection compared with 294 patients treated by lobectomy was 85% (95% confidence interval, 80-91) versus 86% (confidence interval, 75-96) (P = .86). Cox survival analysis showed no significant difference between sublobar resection and lobectomy when adjusted for propensity scores or when using propensity quintiles (P = .62 and P = .79, respectively). For those with cancers 20 mm or less in
Influence of Body Mass Index on Tumor Pathology and Survival in Uterine Cancer
DEFF Research Database (Denmark)
Bjerrum Kristensen, Anne; Hare-Bruun, Helle; Høgdall, Claus Kim
2017-01-01
OBJECTIVE: To evaluate the influence of body mass index (BMI) on endometrial tumor pathology, stage and complication rate and to identify individual prognostic factors, such as BMI, in types I and II endometrial cancer. DESIGN: Register study included all Danish women who underwent surgery...... I and II endometrial cancer were retrieved. Kaplan-Meier plot was used to illustrate differences in survival in relation to BMI. Log-rank test was used to demonstrate difference between the curves. Cox regression hazard model was used to estimate hazard ratios (HR) of the effect of BMI on overall...
Influence of Working Environment on Fatigue Life Time Duration for Runner Blades of Kaplan Turbines
Directory of Open Access Journals (Sweden)
Ana-Maria Budai
2010-10-01
Full Text Available The paper present an analytical analyzes refer to influence of working environment on life time duration in service of runner blades of Kaplan turbines. The study are made using only analytical method, the entry dates being obtained from measurements made in situ for a Kaplan turbine. To calculate the maximum number of stress cycles whereupon the runner blades work without any damage it was used an analytical relation known in specialized literatures under the name of Morrow’s relation. To estimate fatigue life time duration will be used a formula obtained from one of most common cumulative damage methodology taking in consideration the real exploitation conditions of a specified Kaplan turbine.
Donati, Gabriele; Cianciolo, Giuseppe; Mauro, Raffaella; Rucci, Paola; Scrivo, Anna; Marchetti, Antonio; Giampalma, Emanuela; Golfieri, Rita; Panicali, Laura; Iorio, Mario; Stella, Andrea; La Manna, Gaetano; Stefoni, Sergio
2015-02-01
Vascular access-related complications are still one of the leading causes of morbidity in hemodialysis patients. The aim of this study was to compare polytetrafluoroethylene (PTFE) grafts versus tunneled cuffed permanent catheters (TCCs) in terms of vascular access and patients' survival. An observational study was carried out with a 2-year follow-up. Eighty-seven chronic hemodialysis patients were enrolled: 31 with a PTFE graft as vascular access for hemodialysis versus 56 with a TCC. Patients' mean age was 63.8 ± 14.6 (grafts) versus 73.5 ± 11.3 years (TCCs), P = 0.001. Significantly more patients with TCC had atrial fibrillation than patients with grafts (30.3% versus 6.5%, P = 0.01). In an unadjusted Kaplan-Meier analysis, median TCC survival at 24 months was 5.4 months longer than that of PTFE grafts but not significantly (log-rank test = 1.3, P = ns). In a Cox regression analysis adjusted for age, gender, number of previous vascular accesses, diabetes, atrial fibrillation, smoking, and any complication, this lack of significant difference in survival of the vascular access between TCC and PTFE groups was confirmed and diabetes proved to be an independent risk factor for the survival of both vascular accesses considered (P = 0.02). In an unadjusted Kaplan-Meier analysis, a higher mortality was found in the TCC group than in the PTFE group at 24 months (log-rank test = 10.07, P PTFE grafts. When an arteriovenous fistula (AVF) is not possible, PTFE grafts can be considered the vascular access of second choice, whereas TCCs can be used when an AVF or PTFE graft are not feasible or as a bridge to AVF or PTFE graft creation. Copyright © 2014 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Baumann, Brian C.; He, Jiwei; Hwang, Wei-Ting; Tucker, Kai N.; Bekelman, Justin E.; Herr, Harry W.; Lerner, Seth P.; Guzzo, Thomas J.; Malkowicz, S. Bruce; Christodouleas, John P.
2016-01-01
Purpose: To inform prospective trials of adjuvant radiation therapy (adj-RT) for bladder cancer after radical cystectomy, a locoregional failure (LF) risk stratification was proposed. This stratification was developed and validated using surgical databases that may not reflect the outcomes expected in prospective trials. Our purpose was to assess sources of bias that may affect the stratification model's validity or alter the LF risk estimates for each subgroup: time bias due to evolving surgical techniques; trial accrual bias due to inclusion of patients who would be ineligible for adj-RT trials because of early disease progression, death, or loss to follow-up shortly after cystectomy; bias due to different statistical methods to estimate LF; and subgrouping bias due to different definitions of the LF subgroups. Methods and Materials: The LF risk stratification was developed using a single-institution cohort (n=442, 1990-2008) and the multi-institutional SWOG 8710 cohort (n=264, 1987-1998) treated with radical cystectomy with or without chemotherapy. We evaluated the sensitivity of the stratification to sources of bias using Fine-Gray regression and Kaplan-Meier analyses. Results: Year of radical cystectomy was not associated with LF risk on univariate or multivariate analysis after controlling for risk group. By use of more stringent inclusion criteria, 26 SWOG patients (10%) and 60 patients from the single-institution cohort (14%) were excluded. Analysis of the remaining patients confirmed 3 subgroups with significantly different LF risks with 3-year rates of 7%, 17%, and 36%, respectively (P<.01), nearly identical to the rates without correcting for trial accrual bias. Kaplan-Meier techniques estimated higher subgroup LF rates than competing risk analysis. The subgroup definitions used in the NRG-GU001 adj-RT trial were validated. Conclusions: These sources of bias did not invalidate the LF risk stratification or substantially change the model's LF estimates.
Two Paradoxes in Linear Regression Analysis
FENG, Ge; PENG, Jing; TU, Dongke; ZHENG, Julia Z.; FENG, Changyong
2016-01-01
Summary Regression is one of the favorite tools in applied statistics. However, misuse and misinterpretation of results from regression analysis are common in biomedical research. In this paper we use statistical theory and simulation studies to clarify some paradoxes around this popular statistical method. In particular, we show that a widely used model selection procedure employed in many publications in top medical journals is wrong. Formal procedures based on solid statistical theory should be used in model selection. PMID:28638214
Yang, D H; Su, Z Q; Chen, Y; Chen, Z B; Ding, Z N; Weng, Y Y; Li, J; Li, X; Tong, Q L; Han, Y X; Zhang, X
2016-03-08
To assess the predictive value of the albumin to globulin ratio (AGR) in evaluation of disease severity and prognosis in myasthenia gravis patients. A total of 135 myasthenia gravis (MG) patients were enrolled between February 2009 and March 2015. The AGR was detected on the first day of hospitalization and ranked from lowest to highest, and the patients were divided into three equal tertiles according to the AGR values, which were T1 (AGR 1.53). The Kaplan-Meier curve was used to evaluate the prognostic value of AGR. Cox model analysis was used to evaluate the relevant factors. Multivariate Logistic regression analysis was used to find the predictors of myasthenia crisis during hospitalization. The median length of hospital stay for each tertile was: for the T1 21 days (15-35.5), T2 18 days (14-27.5), and T3 16 days (12-22.5) (Pmyasthenia gravis. At the multivariate Cox regression analysis, the AGR (Pmyasthenia gravis patients. Respectively, the hazard ratio (HR) were 4.655 (95% CI: 2.355-9.202) and 0.596 (95% CI: 0.492-0.723). Multivariate Logistic regression analysis showed the AGR (Pmyasthenia crisis. The AGR may represent a simple, potentially useful predictive biomarker for evaluating the disease severity and prognosis of patients with myasthenia gravis.
Using Dominance Analysis to Determine Predictor Importance in Logistic Regression
Azen, Razia; Traxel, Nicole
2009-01-01
This article proposes an extension of dominance analysis that allows researchers to determine the relative importance of predictors in logistic regression models. Criteria for choosing logistic regression R[superscript 2] analogues were determined and measures were selected that can be used to perform dominance analysis in logistic regression. A…
Huang, Si-Si; Xie, Dong-Mei; Cai, Yi-Jing; Wu, Jian-Min; Chen, Rui-Chong; Wang, Xiao-Dong; Song, Mei; Zheng, Ming-Hua; Wang, Yu-Qun; Lin, Zhuo; Shi, Ke-Qing
2017-04-01
Hepatitis B virus (HBV) infection remains a major health problem and HBV-related-decompensated cirrhosis (HBV-DC) usually leads to a poor prognosis. Our aim was to determine the utility of inflammatory biomarkers in predicting mortality of HBV-DC. A total of 329 HBV-DC patients were enrolled. Survival estimates for the entire study population were generated using the Kaplan-Meier method. The prognostic values for model for end-stage liver disease (MELD) score, Child-Pugh score, and inflammatory biomarkers neutrophil/lymphocyte ratio, C-reactive protein-to-albumin ratio (CAR), and lymphocyte-to-monocyte ratio (LMR) for HBV-DC were compared using time-dependent receiver operating characteristic curves and time-dependent decision curves. The survival time was 23.1±15.8 months. Multivariate analysis identified age, CAR, LMR, and platelet count as prognostic independent risk factors. Kaplan-Meier analysis indicated that CAR of at least 1.0 (hazard ratio, 7.19; 95% confidence interval, 4.69-11.03), and LMR less than 1.9 (hazard ratio, 2.40; 95% confidence interval, 1.69-3.41) were independently associated with mortality of HBV-DC. The time-dependent receiver operating characteristic indicated that CAR showed the best performance in predicting mortality of HBV-DC compared with LMR, MELD score, and Child-Pugh score. The results were also confirmed by time-dependent decision curves. CAR and LMR were associated with the prognosis of HBV-DC. CAR was superior to LMR, MELD score, and Child-Pugh score in HBV-DC mortality prediction.
Linear regression and sensitivity analysis in nuclear reactor design
International Nuclear Information System (INIS)
Kumar, Akansha; Tsvetkov, Pavel V.; McClarren, Ryan G.
2015-01-01
Highlights: • Presented a benchmark for the applicability of linear regression to complex systems. • Applied linear regression to a nuclear reactor power system. • Performed neutronics, thermal–hydraulics, and energy conversion using Brayton’s cycle for the design of a GCFBR. • Performed detailed sensitivity analysis to a set of parameters in a nuclear reactor power system. • Modeled and developed reactor design using MCNP, regression using R, and thermal–hydraulics in Java. - Abstract: The paper presents a general strategy applicable for sensitivity analysis (SA), and uncertainity quantification analysis (UA) of parameters related to a nuclear reactor design. This work also validates the use of linear regression (LR) for predictive analysis in a nuclear reactor design. The analysis helps to determine the parameters on which a LR model can be fit for predictive analysis. For those parameters, a regression surface is created based on trial data and predictions are made using this surface. A general strategy of SA to determine and identify the influential parameters those affect the operation of the reactor is mentioned. Identification of design parameters and validation of linearity assumption for the application of LR of reactor design based on a set of tests is performed. The testing methods used to determine the behavior of the parameters can be used as a general strategy for UA, and SA of nuclear reactor models, and thermal hydraulics calculations. A design of a gas cooled fast breeder reactor (GCFBR), with thermal–hydraulics, and energy transfer has been used for the demonstration of this method. MCNP6 is used to simulate the GCFBR design, and perform the necessary criticality calculations. Java is used to build and run input samples, and to extract data from the output files of MCNP6, and R is used to perform regression analysis and other multivariate variance, and analysis of the collinearity of data
Duration of Psoriatic Skin Disease as Risk Factor for Subsequent Onset of Psoriatic Arthritis
DEFF Research Database (Denmark)
Egeberg, Alexander; Skov, Lone; Zachariae, Claus
2018-01-01
It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10,011 psoria......It is unclear whether psoriasis is a progressive disease that requires early aggressive intervention. This population-based study identified patients with psoriasis and psoriatic arthritis (PsA). Survival analysis and Kaplan-Meier life table techniques were used. The study comprised 10......,011 psoriasis patients (severe n = 4,618), and 1,269 patients also had PsA. Incidence of PsA increased with duration of cutaneous symptoms (p = 0.0001). Psoriasis diagnosed before age 20 or 30 years, respectively, suggested a lower risk of PsA than psoriasis diagnosed after age 50 years, yet age at first...... cutaneous symptoms did not predict development of PsA. No clear association with disease severity was found. PsA incidence appeared stable with longer duration of psoriasis, but further data are needed to firmly establish the relationship with age of psoriasis onset....
Leybovitz-Haleluya, Noa; Wainstock, Tamar; Landau, Daniella; Sheiner, Eyal
2018-06-01
Cigarette smoke is a well-known reproductive toxicant. We aimed to study the long-term effect of cigarette smoking during pregnancy on the risk for childhood cardiovascular morbidity of the offspring. A population-based cohort analysis was performed comparing total and subtypes of cardiovascular related pediatric hospitalizations among offspring of smoking mothers versus offspring of non-smoking mothers. The analysis included all singletons born between the years 1999-2014.A Kaplan-Meier survival curve was used to compare the cumulative cardiovascular morbidity, and a Cox proportional hazards model was constructed to adjust for confounders. The study population included 242,342 newborns which met inclusion criteria; among them 2861 were born to smoking mothers. Offspring of smoking mothers had higher rates of cardiovascular-related hospitalizations (1.3% vs. 0.6%, OR 2.1, 95% CI 1.5-2.9; p < 0.001; Kaplan-Meier log-rank test p < 0.001). Smoking exposure during pregnancy is associated with an increased risk for long-term pediatric cardiovascular morbidity of the offspring. Copyright © 2018 Elsevier Inc. All rights reserved.
Floyd, Randy G.; Bergeron, Renee; Hamilton, Gloria; Parra, Gilbert R.
2010-01-01
This study investigated the relations among executive functions and cognitive abilities through a joint exploratory factor analysis and joint confirmatory factor analysis of 25 test scores from the Delis-Kaplan Executive Function System and the Woodcock-Johnson III Tests of Cognitive Abilities. Participants were 100 children and adolescents…
DEFF Research Database (Denmark)
Møller, Henrik; Coupland, Victoria H; Tataru, Daniela
2018-01-01
INTRODUCTION: Lung cancer outcomes in England are inferior to comparable countries. Patient or disease characteristics, healthcare-seeking behaviour, diagnostic pathways, and oncology service provision may contribute. We aimed to quantify associations between geographic variations in treatment...... and survival of patients in England. METHODS: We retrieved detailed cancer registration data to analyse the variation in survival of 176,225 lung cancer patients, diagnosed 2010-2014. We used Kaplan-Meier analysis and Cox proportional hazards regression to investigate survival in the two-year period following...... diagnosis. RESULTS: Survival improved over the period studied. The use of active treatment varied between geographical areas, with inter-quintile ranges of 9%-17% for surgical resection, 4%-13% for radical radiotherapy, and 22%-35% for chemotherapy. At 2 years, there were 188 potentially avoidable deaths...
PAM50 breast cancer intrinsic subtypes and effect of gemcitabine in advanced breast cancer patients
DEFF Research Database (Denmark)
Jørgensen, Charlotte Levin Tykjær; Nielsen, Torsten O; Bjerre, Karsten D
2014-01-01
BACKGROUND: In vitro studies suggest basal breast cancers are more sensitive to gemcitabine relative to other intrinsic subtypes. The main objective of this study was to use specimens from a randomized clinical trial to evaluate whether the basal-like subtype identifies patients with advanced...... breast cancer who benefit from gemcitabine plus docetaxel (GD) compared to single agent docetaxel (D). MATERIAL AND METHODS: From patients randomly assigned to GD or D, RNA was isolated from archival formalin-fixed, paraffin-embedded primary breast tumor tissue and used for PAM50 intrinsic subtyping...... chemotherapy were analyzed by the Kaplan-Meier method, and Cox proportional hazards regression models. Data analysis was performed independently by the Danish Breast Cancer Cooperative Group (DBCG) statistical core and all statistical tests were two-sided. RESULTS: RNA from 270 patients was evaluable; 84...
DEFF Research Database (Denmark)
Tanadini-Lang, S; Rieber, J; Filippi, A R
2017-01-01
BACKGROUND: Radical local treatment of pulmonary metastases is practiced with increasing frequency due to acknowledgment and better understanding of oligo-metastatic disease. This study aimed to develop a nomogram predicting overall survival (OS) after stereotactic body radiotherapy (SBRT......) for pulmonary metastases. PATIENTS AND METHODS: A multi-institutional database of 670 patients treated with SBRT for pulmonary metastases was used as training cohort. Cox regression analysis with bidirectional variable elimination was performed to identify factors to be included into the nomogram model...... to predict 2-year OS. The calibration rate of the nomogram was assessed by plotting the actual Kaplan-Meier 2-year OS against the nomogram predicted survival. The nomogram was externally validated using two separate monocentric databases of 145 and 92 patients treated with SBRT for pulmonary metastases...
DEFF Research Database (Denmark)
Loeve, Martine; Hop, Wim C. J.; de Bruijne, Marleen
2012-01-01
Rationale: Up to a third of cystic fibrosis (CF) patients awaiting lung transplantation (LTX) die while waiting. Inclusion of computed tomography (CT) scores may improve survival prediction models such as the lung allocation score (LAS). Objectives: This study investigated the association between...... CT and survival in CF patients screened for LTX. Methods: Clinical data and chest CTs of 411 CF patients screened for LTX between 1990 and 2005 were collected from 17 centers. CTs were scored with the Severe Advanced Lung Disease (SALD) 4-category scoring system, including the components "infection....../inflammation" (INF), air trapping/hypoperfusion (AT), normal/hyperperfusion (NOR) and bulla/cysts (BUL). The volume of each component was computed using semi-automated software. Survival analysis included Kaplan-Meier curves, and Cox-regression models. Measurements and main results: 366 (186 males) out of 411...
Least Squares Adjustment: Linear and Nonlinear Weighted Regression Analysis
DEFF Research Database (Denmark)
Nielsen, Allan Aasbjerg
2007-01-01
This note primarily describes the mathematics of least squares regression analysis as it is often used in geodesy including land surveying and satellite positioning applications. In these fields regression is often termed adjustment. The note also contains a couple of typical land surveying...... and satellite positioning application examples. In these application areas we are typically interested in the parameters in the model typically 2- or 3-D positions and not in predictive modelling which is often the main concern in other regression analysis applications. Adjustment is often used to obtain...... the clock error) and to obtain estimates of the uncertainty with which the position is determined. Regression analysis is used in many other fields of application both in the natural, the technical and the social sciences. Examples may be curve fitting, calibration, establishing relationships between...
The development of a new algorithm to calculate a survival function in non-parametric ways
International Nuclear Information System (INIS)
Ahn, Kwang Won; Kim, Yoon Ik; Chung, Chang Hyun; Kim, Kil Yoo
2001-01-01
In this study, a generalized formula of the Kaplan-Meier method is developed. The idea of this algorithm is that the result of the Kaplan-Meier estimator is the same as that of the redistribute-to-the right algorithm. Hence, the result of the Kaplan-Meier estimator is used when we redistribute to the right. This can be explained as the following steps, at first, the same mass is distributed to all the points. At second, when you reach the censored points, you must redistribute the mass of that point to the right according to the following rule; to normalize the masses, which are located to the right of the censored point, and redistribute the mass of the censored point to the right according to the ratio of the normalized mass. Until now, we illustrate the main idea of this algorithm.The meaning of that idea is more efficient than PL-estimator in the sense that it decreases the mass of after that area. Just like a redistribute to the right algorithm, this method is enough for the probability theory
Wu, Jitao; Suk-Ouichai, Chalairat; Dong, Wen; Antonio, Elvis Caraballo; Derweesh, Ithaar H; Lane, Brian R; Demirjian, Sevag; Li, Jianbo; Campbell, Steven C
2018-01-01
To evaluate predictors of long-term survival for patients with chronic kidney disease primarily due to surgery (CKD-S). Patients with CKD-S have generally good survival that approximates patients who do not have CKD even after renal cancer surgery (RCS), yet there may be heterogeneity within this cohort. From 1997 to 2008, 4 246 patients underwent RCS at our centre. The median (interquartile range [IQR]) follow-up was 9.4 (7.3-11.0) years. New baseline glomerular filtration rate (GFR) was defined as highest GFR between nadir and 6 weeks after RCS. We retrospectively evaluated three cohorts: no-CKD (new baseline GFR of ≥60 mL/min/1.73 m 2 ); CKD-S (new baseline GFR of cancer-related survival (NRCRS) for the CKD-S cohort. Kaplan-Meier analysis assessed the longitudinal impact of new baseline GFR (45-60 mL/min/1.73 m 2 vs <45 mL/min/1.73 m 2 ) and Cox regression evaluated relative impact of preoperative GFR, new baseline GFR, and relevant demographics/comorbidities. Of the 4 246 patients who underwent RCS, 931 had CKD-S and 1 113 had CKD-M/S, whilst 2 202 had no-CKD even after RCS. Partial/radical nephrectomy (PN/RN) was performed in 54%/46% of the patients, respectively. For CKD-S, 641 patients had a new baseline GFR of 45-60 mL/min/1.73 m 2 and 290 had a new baseline GFR of <45 mL/min/1.73 m 2 . Kaplan-Meier analysis showed significantly reduced NRCRS for patients with CKD-S with a GFR of <45 mL/min/1.73 m 2 compared to those with no-CKD or CKD-S with a GFR of 45-60 mL/min/1.73 m 2 (both P ≤ 0.004), and competing risk analysis confirmed this (P < 0.001). Age, gender, heart disease, and new baseline GFR were all associated independently with NRCRS for patients with CKD-S (all P ≤ 0.02). Our data suggest that CKD-S is heterogeneous, and patients with a reduced new baseline GFR have compromised survival, particularly if <45 mL/min/1.73 m 2 . Our findings may have implications regarding choice of PN/RN in patients at risk of developing
Design and analysis of experiments classical and regression approaches with SAS
Onyiah, Leonard C
2008-01-01
Introductory Statistical Inference and Regression Analysis Elementary Statistical Inference Regression Analysis Experiments, the Completely Randomized Design (CRD)-Classical and Regression Approaches Experiments Experiments to Compare Treatments Some Basic Ideas Requirements of a Good Experiment One-Way Experimental Layout or the CRD: Design and Analysis Analysis of Experimental Data (Fixed Effects Model) Expected Values for the Sums of Squares The Analysis of Variance (ANOVA) Table Follow-Up Analysis to Check fo
International Nuclear Information System (INIS)
Ko, P; Kurosawa, S
2014-01-01
The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine
Ko, P.; Kurosawa, S.
2014-03-01
The understanding and accurate prediction of the flow behaviour related to cavitation and pressure fluctuation in a Kaplan turbine are important to the design work enhancing the turbine performance including the elongation of the operation life span and the improvement of turbine efficiency. In this paper, high accuracy turbine and cavitation performance prediction method based on entire flow passage for a Kaplan turbine is presented and evaluated. Two-phase flow field is predicted by solving Reynolds-Averaged Navier-Stokes equations expressed by volume of fluid method tracking the free surface and combined with Reynolds Stress model. The growth and collapse of cavitation bubbles are modelled by the modified Rayleigh-Plesset equation. The prediction accuracy is evaluated by comparing with the model test results of Ns 400 Kaplan model turbine. As a result that the experimentally measured data including turbine efficiency, cavitation performance, and pressure fluctuation are accurately predicted. Furthermore, the cavitation occurrence on the runner blade surface and the influence to the hydraulic loss of the flow passage are discussed. Evaluated prediction method for the turbine flow and performance is introduced to facilitate the future design and research works on Kaplan type turbine.
Toro, Jorge R.; Blake, Patrick W.; Björkholm, Magnus; Kristinsson, Sigurdur Y.; Wang, Zhuoqiao; Landgren, Ola
2009-01-01
We investigated whether a previous diagnosis of non-melanoma skin cancer among chronic lymphocytic leukemia patients is a predictor of poor outcome. Using the Swedish Cancer Registry, we conducted a population-based study to evaluate the survival patterns among chronic lymphocytic leukemia patients with and without non-melanoma skin cancer. Cox proportional hazards regression models were used and Kaplan-Meier curves were constructed. Of a total of 12,041 chronic lymphocytic leukemia cases identified, 236 cases, including 111 squamous cell cancer, had a prior history of non-melanoma skin cancer. Chronic lymphocytic leukemia patients with a prior history of non-melanoma skin cancer had a 1.29-fold (95% CI 1.10–1.52; p=0.0024) increased risk of dying; and those with a history of squamous cell cancer had a further elevated 1.86-fold (95% CI 1.46–2.36; p<0.0001) risk of dying. Kaplan-Meier plots showed that patients with a history of non-melanoma skin cancer, particularly those with squamous cell cancer, had significantly poorer survival than chronic lymphocytic leukemia patients without non-melanoma skin cancer (p<0.0001; log-rank test). Non-melanoma skin cancer may be a novel clinical predictor of worse chronic lymphocytic leukemia outcome. PMID:19794092
Sparse Regression by Projection and Sparse Discriminant Analysis
Qi, Xin
2015-04-03
© 2015, © American Statistical Association, Institute of Mathematical Statistics, and Interface Foundation of North America. Recent years have seen active developments of various penalized regression methods, such as LASSO and elastic net, to analyze high-dimensional data. In these approaches, the direction and length of the regression coefficients are determined simultaneously. Due to the introduction of penalties, the length of the estimates can be far from being optimal for accurate predictions. We introduce a new framework, regression by projection, and its sparse version to analyze high-dimensional data. The unique nature of this framework is that the directions of the regression coefficients are inferred first, and the lengths and the tuning parameters are determined by a cross-validation procedure to achieve the largest prediction accuracy. We provide a theoretical result for simultaneous model selection consistency and parameter estimation consistency of our method in high dimension. This new framework is then generalized such that it can be applied to principal components analysis, partial least squares, and canonical correlation analysis. We also adapt this framework for discriminant analysis. Compared with the existing methods, where there is relatively little control of the dependency among the sparse components, our method can control the relationships among the components. We present efficient algorithms and related theory for solving the sparse regression by projection problem. Based on extensive simulations and real data analysis, we demonstrate that our method achieves good predictive performance and variable selection in the regression setting, and the ability to control relationships between the sparse components leads to more accurate classification. In supplementary materials available online, the details of the algorithms and theoretical proofs, and R codes for all simulation studies are provided.
Directory of Open Access Journals (Sweden)
Vasile Cojocaru
2011-09-01
Full Text Available In order to increase the lifetime of runner blades of Kaplan turbines damaged by cavitation erosion, an anticavitation lip is attached to the periphery of the runner blades on the suction side. The anticavitation lip overtakes the cavitation pitting which appears between the runner blades and the runner chamber. A blade with the original anticavitation lip was modeled using CAE. The numerical simulations showed the tip vortex position and the source of the cavitation erosion. Using these data, a modified profile of the anticavitation lip was designed.
The Use of Nonparametric Kernel Regression Methods in Econometric Production Analysis
DEFF Research Database (Denmark)
Czekaj, Tomasz Gerard
and nonparametric estimations of production functions in order to evaluate the optimal firm size. The second paper discusses the use of parametric and nonparametric regression methods to estimate panel data regression models. The third paper analyses production risk, price uncertainty, and farmers' risk preferences...... within a nonparametric panel data regression framework. The fourth paper analyses the technical efficiency of dairy farms with environmental output using nonparametric kernel regression in a semiparametric stochastic frontier analysis. The results provided in this PhD thesis show that nonparametric......This PhD thesis addresses one of the fundamental problems in applied econometric analysis, namely the econometric estimation of regression functions. The conventional approach to regression analysis is the parametric approach, which requires the researcher to specify the form of the regression...
Simulation Experiments in Practice: Statistical Design and Regression Analysis
Kleijnen, J.P.C.
2007-01-01
In practice, simulation analysts often change only one factor at a time, and use graphical analysis of the resulting Input/Output (I/O) data. The goal of this article is to change these traditional, naïve methods of design and analysis, because statistical theory proves that more information is obtained when applying Design Of Experiments (DOE) and linear regression analysis. Unfortunately, classic DOE and regression analysis assume a single simulation response that is normally and independen...
General Nature of Multicollinearity in Multiple Regression Analysis.
Liu, Richard
1981-01-01
Discusses multiple regression, a very popular statistical technique in the field of education. One of the basic assumptions in regression analysis requires that independent variables in the equation should not be highly correlated. The problem of multicollinearity and some of the solutions to it are discussed. (Author)
Computer Aided Design of the Link-Fork Head-Piston Assembly of the Kaplan Turbine with Solidworks
Directory of Open Access Journals (Sweden)
Camelia Jianu
2010-10-01
Full Text Available The paper presents the steps for 3D computer aided design (CAD of the link-fork head-piston assembly of the Kaplan turbine made in SolidWorks.The present paper is a tutorial for a Kaplan turbine assembly 3D geometry, which is dedicated to the Assembly design and Drawing Geometry and Drawing Annotation.
On logistic regression analysis of dichotomized responses.
Lu, Kaifeng
2017-01-01
We study the properties of treatment effect estimate in terms of odds ratio at the study end point from logistic regression model adjusting for the baseline value when the underlying continuous repeated measurements follow a multivariate normal distribution. Compared with the analysis that does not adjust for the baseline value, the adjusted analysis produces a larger treatment effect as well as a larger standard error. However, the increase in standard error is more than offset by the increase in treatment effect so that the adjusted analysis is more powerful than the unadjusted analysis for detecting the treatment effect. On the other hand, the true adjusted odds ratio implied by the normal distribution of the underlying continuous variable is a function of the baseline value and hence is unlikely to be able to be adequately represented by a single value of adjusted odds ratio from the logistic regression model. In contrast, the risk difference function derived from the logistic regression model provides a reasonable approximation to the true risk difference function implied by the normal distribution of the underlying continuous variable over the range of the baseline distribution. We show that different metrics of treatment effect have similar statistical power when evaluated at the baseline mean. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Geeslin, Andrew G; Chahla, Jorge; Moatshe, Gilbert; Muckenhirn, Kyle J; Kruckeberg, Bradley M; Brady, Alex W; Coggins, Ashley; Dornan, Grant J; Getgood, Alan M; Godin, Jonathan A; LaPrade, Robert F
2018-05-01
The individual kinematic roles of the anterolateral ligament (ALL) and the distal iliotibial band Kaplan fibers in the setting of anterior cruciate ligament (ACL) deficiency require further clarification. This will improve understanding of their potential contribution to residual anterolateral rotational laxity after ACL reconstruction and may influence selection of an anterolateral extra-articular reconstruction technique, which is currently a matter of debate. Hypothesis/Purpose: To compare the role of the ALL and the Kaplan fibers in stabilizing the knee against tibial internal rotation, anterior tibial translation, and the pivot shift in ACL-deficient knees. We hypothesized that the Kaplan fibers would provide greater tibial internal rotation restraint than the ALL in ACL-deficient knees and that both structures would provide restraint against internal rotation during a simulated pivot-shift test. Controlled laboratory study. Ten paired fresh-frozen cadaveric knees (n = 20) were used to investigate the effect of sectioning the ALL and the Kaplan fibers in ACL-deficient knees with a 6 degrees of freedom robotic testing system. After ACL sectioning, sectioning was randomly performed for the ALL and the Kaplan fibers. An established robotic testing protocol was utilized to assess knee kinematics when the specimens were subjected to a 5-N·m internal rotation torque (0°-90° at 15° increments), a simulated pivot shift with 10-N·m valgus and 5-N·m internal rotation torque (15° and 30°), and an 88-N anterior tibial load (30° and 90°). Sectioning of the ACL led to significantly increased tibial internal rotation (from 0° to 90°) and anterior tibial translation (30° and 90°) as compared with the intact state. Significantly increased internal rotation occurred with further sectioning of the ALL (15°-90°) and Kaplan fibers (15°, 60°-90°). At higher flexion angles (60°-90°), sectioning the Kaplan fibers led to significantly greater internal rotation
On two flexible methods of 2-dimensional regression analysis
Czech Academy of Sciences Publication Activity Database
Volf, Petr
2012-01-01
Roč. 18, č. 4 (2012), s. 154-164 ISSN 1803-9782 Grant - others:GA ČR(CZ) GAP209/10/2045 Institutional support: RVO:67985556 Keywords : regression analysis * Gordon surface * prediction error * projection pursuit Subject RIV: BB - Applied Statistics, Operational Research http://library.utia.cas.cz/separaty/2013/SI/volf-on two flexible methods of 2-dimensional regression analysis.pdf
Can a polynomial interpolation improve on the Kaplan-Yorke dimension?
International Nuclear Information System (INIS)
Richter, Hendrik
2008-01-01
The Kaplan-Yorke dimension can be derived using a linear interpolation between an h-dimensional Lyapunov exponent λ (h) >0 and an h+1-dimensional Lyapunov exponent λ (h+1) <0. In this Letter, we use a polynomial interpolation to obtain generalized Lyapunov dimensions and study the relationships among them for higher-dimensional systems
International Nuclear Information System (INIS)
Skwarchuk, Mark W.; Jackson, Andrew; Zelefsky, Michael J.; Venkatraman, Ennapadam S.; Cowen, Didier M.; Levegruen, Sabine; Burman, Chandra M.; Fuks, Zvi; Leibel, Steven A.; Ling, C. Clifton
2000-01-01
Purpose: The purpose of this paper is to use the outcome of a dose escalation protocol for three-dimensional conformal radiation therapy (3D-CRT) of prostate cancer to study the dose-response for late rectal toxicity and to identify anatomic, dosimetric, and clinical factors that correlate with late rectal bleeding in multivariate analysis. Methods and Materials: Seven hundred forty-three patients with T1c-T3 prostate cancer were treated with 3D-CRT with prescribed doses of 64.8 to 81.0 Gy. The 5-year actuarial rate of late rectal toxicity was assessed using Kaplan-Meier statistics. A retrospective dosimetric analysis was performed for patients treated to 70.2 Gy (52 patients) or 75.6 Gy (119 patients) who either exhibited late rectal bleeding (RTOG Grade 2/3) within 30 months after treatment (i.e., 70.2 Gy--13 patients, 75.6 Gy--36 patients) or were nonbleeding for at least 30 months (i.e., 70.2 Gy--39 patients, 75.6 Gy--83 patients). Univariate and multivariate logistic regression was performed to correlate late rectal bleeding with several anatomic, dosimetric, and clinical variables. Results: A dose response for ≥ Grade 2 late rectal toxicity was observed. By multivariate analysis, the following factors were significantly correlated with ≥ Grade 2 late rectal bleeding for patients prescribed 70.2 Gy: 1) enclosure of the outer rectal contour by the 50% isodose on the isocenter slice (i.e., Iso50) (p max (p max
Unsteady numerical simulation of the flow in the U9 Kaplan turbine model
International Nuclear Information System (INIS)
Javadi, Ardalan; Nilsson, Håkan
2014-01-01
The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m 3 /s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation
Unsteady numerical simulation of the flow in the U9 Kaplan turbine model
Javadi, Ardalan; Nilsson, Håkan
2014-03-01
The Reynolds-averaged Navier-Stokes equations with the RNG k-ε turbulence model closure are utilized to simulate the unsteady turbulent flow throughout the whole flow passage of the U9 Kaplan turbine model. The U9 Kaplan turbine model comprises 20 stationary guide vanes and 6 rotating blades (696.3 RPM), working at best efficiency load (0.71 m3/s). The computations are conducted using a general finite volume method, using the OpenFOAM CFD code. A dynamic mesh is used together with a sliding GGI interface to include the effect of the rotating runner. The clearance is included in the guide vane. The hub and tip clearances are also included in the runner. An analysis is conducted of the unsteady behavior of the flow field, the pressure fluctuation in the draft tube, and the coherent structures of the flow. The tangential and axial velocity distributions at three sections in the draft tube are compared against LDV measurements. The numerical result is in reasonable agreement with the experimental data, and the important flow physics close to the hub in the draft tube is captured. The hub and tip vortices and an on-axis forced vortex are captured. The numerical results show that the frequency of the forced vortex in 1/5 of the runner rotation.
Li, Z; Sun, F; Hu, Z; Xiang, J; Zhou, J; Yan, S; Wu, J; Zhou, L; Zheng, S
2016-01-01
New-onset diabetes mellitus (NODM) after liver transplantation (LT) occurs with increased frequency in recipients with hepatitis C virus (HCV). We compared the incidence and risk factors for NODM in HCV vs non-HCV recipients. Among 24,956 liver recipients, 18,741 without pretransplantation diabetes were identified. NODM-free survival was analyzed using Kaplan-Meier and log-rank tests, and risk factors for NODM were examined using multivariate Cox regression analysis. The overall incidence of NODM was 13.0% at 1 year after LT. At 1, 2, 3, and 5 years after LT, incidence of NODM in HCV recipients was 14.4%, 4.3%, 3.1%, and 3.5%, respectively, compared with 11.9%, 3.5%, 3.2%, and 6.4%, respectively, in non-HCV recipients. HCV recipients had a higher risk of NODM than non-HCV recipients (hazard ratio 1.17 [1.09-1.27], P diabetes mellitus. Risk factors in non-HCV recipients were male recipient, BMI, and recipients with nonalcoholic steatohepatitis diagnosis. HCV recipients have a higher incidence and more risk factors for NODM than non-HCV recipients. Early identification of modifiable risk factors will assist clinical interventions to prevent NODM complications after LT. Copyright © 2016 Elsevier Inc. All rights reserved.
Adding gauge fields to Kaplan's fermions
International Nuclear Information System (INIS)
Blum, T.; Kaerkkaeinen, L.
1994-01-01
We experiment with adding dynamical gauge field to Kaplan (defect) fermions. In the case of U(1) gauge theory we use an inhomogeneous Higgs mechanism to restrict the 3d gauge dynamics to a planar 2d defect. In our simulations the 3d theory produce the correct 2d gauge dynamics. We measure fermion propagators with dynamical gauge fields. They posses the correct chiral structure. The fermions at the boundary of the support of the gauge field (waveguide) are non-chiral, and have a mass two times heavier than the chiral modes. Moreover, these modes cannot be excited by a source at the defect; implying that they are dynamically decoupled. We have also checked that the anomaly relation is fullfilled for the case of a smooth external gauge field. (orig.)
Chan, H. M.; van der Velden, B. H. M.; E Loo, C.; Gilhuijs, K. G. A.
2017-08-01
We present a radiomics model to discriminate between patients at low risk and those at high risk of treatment failure at long-term follow-up based on eigentumors: principal components computed from volumes encompassing tumors in washin and washout images of pre-treatment dynamic contrast-enhanced (DCE-) MR images. Eigentumors were computed from the images of 563 patients from the MARGINS study. Subsequently, a least absolute shrinkage selection operator (LASSO) selected candidates from the components that contained 90% of the variance of the data. The model for prediction of survival after treatment (median follow-up time 86 months) was based on logistic regression. Receiver operating characteristic (ROC) analysis was applied and area-under-the-curve (AUC) values were computed as measures of training and cross-validated performances. The discriminating potential of the model was confirmed using Kaplan-Meier survival curves and log-rank tests. From the 322 principal components that explained 90% of the variance of the data, the LASSO selected 28 components. The ROC curves of the model yielded AUC values of 0.88, 0.77 and 0.73, for the training, leave-one-out cross-validated and bootstrapped performances, respectively. The bootstrapped Kaplan-Meier survival curves confirmed significant separation for all tumors (P < 0.0001). Survival analysis on immunohistochemical subgroups shows significant separation for the estrogen-receptor subtype tumors (P < 0.0001) and the triple-negative subtype tumors (P = 0.0039), but not for tumors of the HER2 subtype (P = 0.41). The results of this retrospective study show the potential of early-stage pre-treatment eigentumors for use in prediction of treatment failure of breast cancer.
Exposure-response relationship of regorafenib efficacy in patients with hepatocellular carcinoma.
Solms, Alexander; Reinecke, Isabel; Fiala-Buskies, Sabine; Keunecke, Anne; Drenth, Henk-Jan; Bruix, Jordi; Meinhardt, Gerold; Cleton, Adriaan; Ploeger, Bart
2017-11-15
To explore the relationship between regorafenib exposure and efficacy in patients with hepatocellular carcinoma (HCC) who had disease progression during sorafenib treatment (RESORCE). Exposure-response (ER) analyses for regorafenib were performed using data from a phase 3, randomized, placebo-controlled trial (RESORCE). Patients received 160mg regorafenib or placebo once daily (3weeks on/1week off in a 4-week cycle) with best supportive care until disease progression, death, or unacceptable toxicity. Kaplan-Meier analyses for overall survival (OS) and time-to-progression (TTP) were performed in which regorafenib-treated patients were grouped into four categories according to their estimated average exposure over 4weeks in cycle 1. While this analysis primarily focused on efficacy, a potential correlation between exposure and treatment-emergent adverse events (TEAEs) was also evaluated. If any differences were observed between Kaplan-Meier plots, the ER analysis continued with a multivariate Cox regression analysis to evaluate the correlation between exposure quartile categories and the efficacy and safety parameters while taking into consideration the effect of the predefined clinically relevant demographic and baseline covariates. The functional form of the ER relationship within the regorafenib treatment group was subsequently evaluated. Based on visual assessment of the Kaplan-Meier plots, no meaningful relationship between the exposure categories and TEAEs were observed, although median OS and TTP tended to be longer in the higher exposure categories. Further ER analyses, which considered the effects of predefined covariates and the different shapes of the ER relationship, focused on efficacy. The baseline risk factors Eastern Cooperative Oncology Group (ECOG) performance status ≥1, alpha-fetoprotein levels ≥400ng/ml, and aspartate transaminase or alanine transaminase levels >3×upper limit of normal were significantly associated with OS (Pregorafenib
Reverse hybrid total hip arthroplasty
DEFF Research Database (Denmark)
Wangen, Helge; Havelin, Leif I.; Fenstad, Anne M
2017-01-01
Background and purpose - The use of a cemented cup together with an uncemented stem in total hip arthroplasty (THA) has become popular in Norway and Sweden during the last decade. The results of this prosthetic concept, reverse hybrid THA, have been sparsely described. The Nordic Arthroplasty....... Patients and methods - From the NARA, we extracted data on reverse hybrid THAs from January 1, 2000 until December 31, 2013. 38,415 such hips were studied and compared with cemented THAs. The Kaplan-Meier method and Cox regression analyses were used to estimate the prosthesis survival and the relative risk...
Increased 30-day mortality in patients with diabetes undergoing surgery for colorectal cancer
DEFF Research Database (Denmark)
Fransgaard, T; Thygesen, L C; Gögenur, I
2016-01-01
with the use of antidiabetic drugs identified through the Danish National Prescription Registry and DCCG. The 30-day mortality was examined by the Kaplan-Meier method with the log-rank test and the Cox regression model used to test statistical significance. RESULTS: The study included 29 353 patients, of whom...... 3250 had preexisting diabetes. The 30-day mortality was significantly increased in patients with CRC and preexisting diabetes (adjusted hazard ratio 1.17, 95% CI 1.01-1.35, P = 0.03). The type of antidiabetic medication used was not associated with 30-day mortality. CONCLUSION: Preexisting diabetes...
DEFF Research Database (Denmark)
Søgaard, Mette; Nørgaard, Mette; Sørensen, Henrik Toft
2009-01-01
for age, gender, coexisting chronic diseases, marital status, use of immunosuppressives, and calendar period. Further, we conducted analyses restricted to patients a discharge diagnose of infectious diseases (ICD-10 codes A00-B99). Results: In total, 1,665 (8.2%) patients had positive blood culture...... System. We computed Kaplan-Meier curves and product limit estimates for the main study variables. Next, time-dependent Cox regression analyses was used to compare the risk of death in patients with positive blood cultures and patients with negative cultures at days 0-7, 8-30, and 31-180, controlling...
de Munnik, Sonja A.; Otten, Barto J.; Schoots, Jeroen; Bicknell, Louise S.; Aftimos, Salim; Al-Aama, Jumana Y.; van Bever, Yolande; Bober, Michael B.; Borm, George F.; Clayton-Smith, Jill; Deal, Cheri L.; Edrees, Alaa Y.; Feingold, Murray; Fryer, Alan; van Hagen, Johanna M.; Hennekam, Raoul C.; Jansweijer, Maaike C. E.; Johnson, Diana; Kant, Sarina G.; Opitz, John M.; Ramadevi, A. Radha; Reardon, Willie; Ross, Alison; Sarda, Pierre; Schrander-Stumpel, Constance T. R. M.; Sluiter, A. Erik; Temple, I. Karen; Terhal, Paulien A.; Toutain, Annick; Wise, Carol A.; Wright, Michael; Skidmore, David L.; Samuels, Mark E.; Hoefsloot, Lies H.; Knoers, Nine V. A. M.; Brunner, Han G.; Jackson, Andrew P.; Bongers, Ernie M. H. F.
2012-01-01
MeierGorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This complex
de Munnik, S.A.; Otten, B.J.; Schoots, J.; Bicknell, L.S.; Aftimos, S.; Al-Aama, J.Y.; van Bever, Y.; Bober, M.B.; Borm, G.F.; Clayton-Smith, J.; Deal, C.L.; Edrees, A.Y.; Feingold, M.; Fryer, A.; van Hagen, J.M.; Hennekam, R.C.M.; Jansweijer, M.C.E.; Johnson, D.; Kant, S.G.; Opitz, J.M.; Ramadevi, A.R.; Reardon, W.; Ross, A.; Sarda, P.; Schrander-Stumpel, C.T.R.M.; Sluiter, A.E.; Temple, I.K.; Terhal, P.A.; Toutain, A.; Wise, C.A.; Wright, M.; Skidmore, D.L.; Samuels, M.E.; Hoefsloot, L.H.; Knoers, N.V.A.M.; Brunner, H.G.; Jackson, A.P.; Bongers, M.H.F.
2012-01-01
Meier-Gorlin syndrome (MGS) is a rare autosomal recessive disorder characterized by primordial dwarfism, microtia, and patellar aplasia/hypoplasia. Recently, mutations in the ORC1, ORC4, ORC6, CDT1, and CDC6 genes, encoding components of the pre-replication complex, have been identified. This
Resting-state functional magnetic resonance imaging: the impact of regression analysis.
Yeh, Chia-Jung; Tseng, Yu-Sheng; Lin, Yi-Ru; Tsai, Shang-Yueh; Huang, Teng-Yi
2015-01-01
To investigate the impact of regression methods on resting-state functional magnetic resonance imaging (rsfMRI). During rsfMRI preprocessing, regression analysis is considered effective for reducing the interference of physiological noise on the signal time course. However, it is unclear whether the regression method benefits rsfMRI analysis. Twenty volunteers (10 men and 10 women; aged 23.4 ± 1.5 years) participated in the experiments. We used node analysis and functional connectivity mapping to assess the brain default mode network by using five combinations of regression methods. The results show that regressing the global mean plays a major role in the preprocessing steps. When a global regression method is applied, the values of functional connectivity are significantly lower (P ≤ .01) than those calculated without a global regression. This step increases inter-subject variation and produces anticorrelated brain areas. rsfMRI data processed using regression should be interpreted carefully. The significance of the anticorrelated brain areas produced by global signal removal is unclear. Copyright © 2014 by the American Society of Neuroimaging.
Prognostic and survival analysis of 837 Chinese colorectal cancer patients.
Yuan, Ying; Li, Mo-Dan; Hu, Han-Guang; Dong, Cai-Xia; Chen, Jia-Qi; Li, Xiao-Fen; Li, Jing-Jing; Shen, Hong
2013-05-07
To develop a prognostic model to predict survival of patients with colorectal cancer (CRC). Survival data of 837 CRC patients undergoing surgery between 1996 and 2006 were collected and analyzed by univariate analysis and Cox proportional hazard regression model to reveal the prognostic factors for CRC. All data were recorded using a standard data form and analyzed using SPSS version 18.0 (SPSS, Chicago, IL, United States). Survival curves were calculated by the Kaplan-Meier method. The log rank test was used to assess differences in survival. Univariate hazard ratios and significant and independent predictors of disease-specific survival and were identified by Cox proportional hazard analysis. The stepwise procedure was set to a threshold of 0.05. Statistical significance was defined as P analysis suggested age, preoperative obstruction, serum carcinoembryonic antigen level at diagnosis, status of resection, tumor size, histological grade, pathological type, lymphovascular invasion, invasion of adjacent organs, and tumor node metastasis (TNM) staging were positive prognostic factors (P analysis showed a significant statistical difference in 3-year survival among these groups: LNR1, 73%; LNR2, 55%; and LNR3, 42% (P analysis results showed that histological grade, depth of bowel wall invasion, and number of metastatic lymph nodes were the most important prognostic factors for CRC if we did not consider the interaction of the TNM staging system (P < 0.05). When the TNM staging was taken into account, histological grade lost its statistical significance, while the specific TNM staging system showed a statistically significant difference (P < 0.0001). The overall survival of CRC patients has improved between 1996 and 2006. LNR is a powerful factor for estimating the survival of stage III CRC patients.
Development of a User Interface for a Regression Analysis Software Tool
Ulbrich, Norbert Manfred; Volden, Thomas R.
2010-01-01
An easy-to -use user interface was implemented in a highly automated regression analysis tool. The user interface was developed from the start to run on computers that use the Windows, Macintosh, Linux, or UNIX operating system. Many user interface features were specifically designed such that a novice or inexperienced user can apply the regression analysis tool with confidence. Therefore, the user interface s design minimizes interactive input from the user. In addition, reasonable default combinations are assigned to those analysis settings that influence the outcome of the regression analysis. These default combinations will lead to a successful regression analysis result for most experimental data sets. The user interface comes in two versions. The text user interface version is used for the ongoing development of the regression analysis tool. The official release of the regression analysis tool, on the other hand, has a graphical user interface that is more efficient to use. This graphical user interface displays all input file names, output file names, and analysis settings for a specific software application mode on a single screen which makes it easier to generate reliable analysis results and to perform input parameter studies. An object-oriented approach was used for the development of the graphical user interface. This choice keeps future software maintenance costs to a reasonable limit. Examples of both the text user interface and graphical user interface are discussed in order to illustrate the user interface s overall design approach.
Landy, Rebecca; Cheung, Li C; Schiffman, Mark; Gage, Julia C; Hyun, Noorie; Wentzensen, Nicolas; Kinney, Walter K; Castle, Philip E; Fetterman, Barbara; Poitras, Nancy E; Lorey, Thomas; Sasieni, Peter D; Katki, Hormuzd A
2018-06-01
Electronic health-records (EHR) are increasingly used by epidemiologists studying disease following surveillance testing to provide evidence for screening intervals and referral guidelines. Although cost-effective, undiagnosed prevalent disease and interval censoring (in which asymptomatic disease is only observed at the time of testing) raise substantial analytic issues when estimating risk that cannot be addressed using Kaplan-Meier methods. Based on our experience analysing EHR from cervical cancer screening, we previously proposed the logistic-Weibull model to address these issues. Here we demonstrate how the choice of statistical method can impact risk estimates. We use observed data on 41,067 women in the cervical cancer screening program at Kaiser Permanente Northern California, 2003-2013, as well as simulations to evaluate the ability of different methods (Kaplan-Meier, Turnbull, Weibull and logistic-Weibull) to accurately estimate risk within a screening program. Cumulative risk estimates from the statistical methods varied considerably, with the largest differences occurring for prevalent disease risk when baseline disease ascertainment was random but incomplete. Kaplan-Meier underestimated risk at earlier times and overestimated risk at later times in the presence of interval censoring or undiagnosed prevalent disease. Turnbull performed well, though was inefficient and not smooth. The logistic-Weibull model performed well, except when event times didn't follow a Weibull distribution. We have demonstrated that methods for right-censored data, such as Kaplan-Meier, result in biased estimates of disease risks when applied to interval-censored data, such as screening programs using EHR data. The logistic-Weibull model is attractive, but the model fit must be checked against Turnbull non-parametric risk estimates. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
A. V. Rusanov
2016-12-01
Full Text Available The results of numerical investigation of spatial flow of viscous incompressible fluid in flow part of Kaplan turbine PL20 Kremenchug HPP at optimum setting angle of runner blade φb = 15° and at maximum setting angle φb = 35° are shown. The flow simulation has been carried out on basis of numerical integration of the Reynolds equations with an additional term containing artificial compressibility. The differential two-parameter model of Menter (SST has been applied to take into account turbulent effects. Numerical integration of the equations is carried out using an implicit quasi-monotone Godunov type scheme of second - order accuracy in space and time. The calculations have been conducted with the help of the software system IPMFlow. The analysis of fluid flow in the flow part elements is shown and the values of hydraulic losses and local cavitation coefficient have been obtained. Comparison of calculated and experimental results has been carried out.
XRF and XANES Data for Kaplan U Paper
The dataset contains two XRF images of iron and uranium distribution on plant roots and a database of XANES data used to produce XANES spectra figure for Figure 7 in the published paper.This dataset is associated with the following publication:Kaplan, D., R. Kukkadapu, J. Seaman, B. Arey, A. Dohnalkova, S. Buettner, D. Li, T. Varga, K. Scheckel, and P. Jaffe. Iron Mineralogy and Uranium-Binding Environment in the Rhizosphere of a Wetland Soil. D. Barcelo SCIENCE OF THE TOTAL ENVIRONMENT. Elsevier BV, AMSTERDAM, NETHERLANDS, 569: 53-64, (2016).
DEFF Research Database (Denmark)
Schnack, Tine H; Høgdall, Estrid; Thomsen, Lotte Nedergaard
2017-01-01
OBJECTIVES: Women with endometriosis carry an increased risk for ovarian clear cell adenocarcinomas (CCCs). Clear cell adenocarcinoma may develop from endometriosis lesions. Few studies have compared clinical and prognostic factors and overall survival in patients diagnosed as having CCC according...... to endometriosis status. METHODS: Population-based prospectively collected data on CCC with coexisting pelvic (including ovarian; n = 80) and ovarian (n = 46) endometriosis or without endometriosis (n = 95) were obtained through the Danish Gynecological Cancer Database. χ Test, independent-samples t test, logistic...... regression, Kaplan-Meier test, and Cox regression were used. Statistical tests were 2 sided. P values less than 0.05 were considered statistically significant. RESULTS: Patients with CCC and pelvic or ovarian endometriosis were significantly younger than CCC patients without endometriosis, and a higher...
Method for nonlinear exponential regression analysis
Junkin, B. G.
1972-01-01
Two computer programs developed according to two general types of exponential models for conducting nonlinear exponential regression analysis are described. Least squares procedure is used in which the nonlinear problem is linearized by expanding in a Taylor series. Program is written in FORTRAN 5 for the Univac 1108 computer.
International Nuclear Information System (INIS)
Coleman, D.J.; Lizzi, F.L.; Silverman, R.H.; Ellsworth, R.M.; Haik, B.G.; Abramson, D.H.; Smith, M.E.; Rondeau, M.J.
1985-01-01
Parameters derived from computer analysis of digital radio-frequency (rf) ultrasound scan data of untreated uveal malignant melanomas were examined for correlations with tumor regression following cobalt-60 plaque. Parameters included tumor height, normalized power spectrum and acoustic tissue type (ATT). Acoustic tissue type was based upon discriminant analysis of tumor power spectra, with spectra of tumors of known pathology serving as a model. Results showed ATT to be correlated with tumor regression during the first 18 months following treatment. Tumors with ATT associated with spindle cell malignant melanoma showed over twice the percentage reduction in height as those with ATT associated with mixed/epithelioid melanomas. Pre-treatment height was only weakly correlated with regression. Additionally, significant spectral changes were observed following treatment. Ultrasonic spectrum analysis thus provides a noninvasive tool for classification, prediction and monitoring of tumor response to cobalt-60 plaque
Interdisciplinary interventional therapy for tracheobronchial stenosis with modern metal net stents
International Nuclear Information System (INIS)
Rieger, J.; Linsenmaier, U.; Fedorowski, A.; Pfeifer, K.J.; Hautmann, H.; Huber, R.M.
2002-01-01
Study objectives: Assessment of the therapeutic potential of tracheobronchial stenting for obstructive tracheobronchial disease, in-vivo comparison of different stent types and development of helpful criteria for choosing the suitable stent type. Material and Methods: Prospective case analysis. Between 1993 and 1999 53 stents were implanted into the tracheobronchial system of 39 consecutive patients with benign or malignant airway obstruction. Every single stent (26 Strecker Stents, 18 Wallstents, 6 Accuflex Nitinolstents, 1 Dumon-, 1 Ruesch- and 1 Palmazstent) was recorded in an unified database. Analysis comprised clinical effectiveness, lung function if possible, relevant complications and radiologic follow-up parameters. The probability of their remaining within the tracheobronchial system, of their remaining undislocated and uncompressed was calculated using Kaplan-Meier analysis for three stent types. Results: Stent placement proved itself to be an effective treatment in 86% of the patients. Resistance could be normalized in 9/9 patients. Kaplan-Meier analysis clearly revealed a higher probability for the Wall- and Nitinolstent to remain within the tracheobronchial system and to remain uncompressed. Dislocation also occurred more rarely. Explanation of the Wallstent, however, if desired, was much more difficult compared to the Strecker stent. The Wallstent also occasionally led to the formation of granulation tissue especially at the proximal stent end and, as such, required reintervention. (orig.) [de
Failure rate of cemented and uncemented total hip replacements
DEFF Research Database (Denmark)
Makela, K. T.; Matilainen, M.; Pulkkinen, P.
2014-01-01
). Participants 347 899 total hip replacements performed during 1995-2011. Main outcome measures Probability of implant survival (Kaplan-Meier analysis) along with implant survival with revision for any reason as endpoint (Cox multiple regression) adjusted for age, sex, and diagnosis in age groups 55-64, 65......Objective To assess the failure rate of cemented, uncemented, hybrid, and reverse hybrid total hip replacements in patients aged 55 years or older. Design Register study. Setting Nordic Arthroplasty Register Association database (combined data from Sweden, Norway, Denmark, and Finland......-74, and 75 years or older. Results The proportion of total hip replacements using uncemented implants increased rapidly towards the end of the study period. The 10 year survival of cemented implants in patients aged 65 to 74 and 75 or older (93.8%, 95% confidence interval 93.6% to 94.0% and 95.9%, 95...
Gafni-Kane, Adam; Botros, Sylvia M; Du, Hongyan; Sand, Robert I; Sand, Peter K
2013-02-01
The purpose of this study was to investigate change in bladder capacity as a measure of response to combined intravesical dimethyl sulfoxide (DMSO) and triamcinolone instillations for the treatment of newly diagnosed bladder pain syndrome/interstitial cystitis (BPS/IC). 141 newly diagnosed women were identified retrospectively. 79 were treated with weekly DMSO/triamcinolone instillations. Change in bladder capacity with bladder retrofill, daytime urinary frequency, nocturia episodes per night, and Likert scale symptom scores were reviewed. Wilcoxon signed-rank tests, Wilcoxon rank-sum tests, Spearman's rank correlations, COX regression analysis, and a Kaplan-Meier survival curve were performed. Significant changes (median (25(th)-percentile to 75(th)-percentile) were noted for bladder capacity (75 mL (25 to 130 mL), p measure of response to intravesical DMSO/triamcinolone for newly diagnosed BPS/IC. Clinical outcomes do not differ based upon presence of DO.
DEFF Research Database (Denmark)
Wilke, Thomas; Mueller, Sabrina; Groth, Antje
2015-01-01
BACKGROUND: The aim of this study was to analyse which factors predict the real-world macro-/microvascular event, hospitalisation and death risk in patients with type 2 diabetes mellitus. Furthermore, we aimed to investigate whether there exists both an under- and over-treatment risk...... of these patients. METHODS: We used a German claims/clinical data set covering the years 2010-12. Diabetes-related events were defined as (1) macro-, (2) microvascular events leading to inpatient hospitalisation, (3) other hospitalisations with type 2 diabetes mellitus as main diagnosis, (4) all-cause death and (5......) a composite outcome including all event categories 1-4. Factors associated with event risk were analysed by a Kaplan-Meier curve analysis and by multivariable Cox regression models. RESULTS: 229,042 patients with type 2 diabetes mellitus (mean age 70.2 years; mean CCI 6.03) were included. Among factors...
International Nuclear Information System (INIS)
Ran, Zhang; Jun, He; Zeng-Hui, Peng; Li, Xuan
2009-01-01
This paper investigates the average dielectric permittivity (ε-bar ) in the Maier–Meier theory for calculating the dielectric anisotropy (Δε) of nematic liquid crystals. For the reason that ε-bar of nematics has the same expression as the dielectric permittivity of the isotropic state, the Onsager equation for isotropic dielectric was used to calculate it. The computed ε-bar shows reasonable agreement with the results of the numerical methods used in the literature. Molecular parameters, such as the polarizability and its anisotropy, the dipole moment and its angle with the molecular long axis, were taken from semi-empirical quantum chemistry (MOCPAC/AM1) modeling. The calculated values of Δε according to the Maier–Meier equation are in good agreement with the experimental results for the investigated compounds having different core structures and polar substituents. (condensed matter: structure, thermal and mechanical properties)
Detecting overdispersion in count data: A zero-inflated Poisson regression analysis
Afiqah Muhamad Jamil, Siti; Asrul Affendi Abdullah, M.; Kek, Sie Long; Nor, Maria Elena; Mohamed, Maryati; Ismail, Norradihah
2017-09-01
This study focusing on analysing count data of butterflies communities in Jasin, Melaka. In analysing count dependent variable, the Poisson regression model has been known as a benchmark model for regression analysis. Continuing from the previous literature that used Poisson regression analysis, this study comprising the used of zero-inflated Poisson (ZIP) regression analysis to gain acute precision on analysing the count data of butterfly communities in Jasin, Melaka. On the other hands, Poisson regression should be abandoned in the favour of count data models, which are capable of taking into account the extra zeros explicitly. By far, one of the most popular models include ZIP regression model. The data of butterfly communities which had been called as the number of subjects in this study had been taken in Jasin, Melaka and consisted of 131 number of subjects visits Jasin, Melaka. Since the researchers are considering the number of subjects, this data set consists of five families of butterfly and represent the five variables involve in the analysis which are the types of subjects. Besides, the analysis of ZIP used the SAS procedure of overdispersion in analysing zeros value and the main purpose of continuing the previous study is to compare which models would be better than when exists zero values for the observation of the count data. The analysis used AIC, BIC and Voung test of 5% level significance in order to achieve the objectives. The finding indicates that there is a presence of over-dispersion in analysing zero value. The ZIP regression model is better than Poisson regression model when zero values exist.
An Analysis of Bank Service Satisfaction Based on Quantile Regression and Grey Relational Analysis
Directory of Open Access Journals (Sweden)
Wen-Tsao Pan
2016-01-01
Full Text Available Bank service satisfaction is vital to the success of a bank. In this paper, we propose to use the grey relational analysis to gauge the levels of service satisfaction of the banks. With the grey relational analysis, we compared the effects of different variables on service satisfaction. We gave ranks to the banks according to their levels of service satisfaction. We further used the quantile regression model to find the variables that affected the satisfaction of a customer at a specific quantile of satisfaction level. The result of the quantile regression analysis provided a bank manager with information to formulate policies to further promote satisfaction of the customers at different quantiles of satisfaction level. We also compared the prediction accuracies of the regression models at different quantiles. The experiment result showed that, among the seven quantile regression models, the median regression model has the best performance in terms of RMSE, RTIC, and CE performance measures.
Hall, David O; Hooper, Clare E; Searle, Julie; Darby, Michael; White, Paul; Harvey, John E; Braybrooke, Jeremy P; Maskell, Nick A; Masani, Vidan; Lyburn, Iain D
2018-02-01
The purpose of this study was to compare the use of fluorine-18-fluorodeoxyglucose (F-FDG) PET with computed tomography (CT) and dynamic contrast-enhanced (DCE) MRI to predict prognosis and monitor treatment in malignant pleural mesothelioma. F-FDG PET/CT and DCE-MRI studies carried out as part of the South West Area Mesothelioma Pemetrexed trial were used. F-FDG PET/CT and DCE-MRI studies were carried out before treatment, and after two cycles of chemotherapy, on patients treated with pemetrexed and cisplatin. A total of 73 patients were recruited, of whom 65 had PET/CT and DCE-MRI scans. Baseline measurements from F-FDG PET/CT (maximum standardized uptake value, metabolic tumour volume and total lesion glycolysis) and DCE-MRI (integrated area under the first 90s of the curve and washout slope) were compared with overall survival (OS) using Kaplan-Meier and Cox regression analyses, and changes in imaging measurements were compared with disease progression. PET/CT and DCE-MRI measurements were not correlated with each other. Maximum standardized uptake value, metabolic tumour volume and total lesion glycolysis were significantly related to OS with Cox regression analysis and Kaplan-Meir analysis, and DCE-MRI washout curve shape was significantly related to OS. DCE-MRI curve shape can be combined with F-FDG PET/CT to give additional prognostic information. Changes in measurements were not related to progression-free survival. F-FDG PET/CT and DCE-MRI give prognostic information in malignant pleural mesothelioma. Neither PET/CT nor DCE-MRI is useful for monitoring disease progression.
Wang, Lu; Wang, Cong; Wang, Jiangfeng; Huang, Xiaochen; Cheng, Yufeng
2017-10-01
A novel systemic immune-inflammation index (SII) based on platelet (P), neutrophil (N), and lymphocyte (L) counts has been reported to be associated with clinical outcomes in several solid tumors. We aimed to investigate its prognostic value in esophageal squamous cell carcinoma (ESCC) and the potential relationship with quality of life (QOL). A total of 280 ESCC patients who underwent esophagectomy were enrolled. SII (SII = P × N/L) was calculated on the basis of data obtained within 1 week before surgery. An optimal cut-off value stratified patients into high (≥560) and low (<560) preoperative SII groups. The widely used EORTC QLQ-C30 and QLQ-OES18 were utilized to assess QOL at cancer diagnosis and 36 months after surgery. Generalized estimating equations (GEEs) were used to evaluate the association of SII with QOL. Kaplan-Meier method and Cox proportional regression were used to analyze the prognostic value of SII. Kaplan-Meier analyses revealed that higher SII correlated significantly with poorer overall survival (OS) (p < 0.001) and disease-free survival (DFS) (p < 0.001) in patients with ESCC. Multivariate analysis identified SII as an independent prognostic factor for OS (p < 0.001; HR 2.578; 95% CI 1.625-4.088) and DFS (p < 0.001; HR 2.699; 95% CI 1.726-4.223). In addition, patients with high SII exhibited notably deteriorating QOL (p < 0.05). The preoperative SII is a promising biomarker for predicting survival and QOL of patients with ESCC. It may help to identify the high-risk patients for treatment strategy decisions.
Miners’ return to work following injuries in coal mines
Directory of Open Access Journals (Sweden)
Ashis Bhattacherjee
2016-12-01
Full Text Available Background: The occupational injuries in mines are common and result in severe socio-economical consequences. Earlier studies have revealed the role of multiple factors such as demographic factors, behavioral factors, health-related factors, working environment, and working conditions for mine injuries. However, there is a dearth of information about the role of some of these factors in delayed return to work (RTW following a miner’s injury. These factors may likely include personal characteristics of injured persons and his or her family, the injured person’s social and economic status, and job characteristics. This study was conducted to assess the role of some of these factors for the return to work following coal miners’ injuries. Material and Methods: A study was conducted for 109 injured workers from an underground coal mine in the years 2000–2009. A questionnaire, which was completed by the personnel interviews, included among others age, height, weight, seniority, alcohol consumption, sleeping duration, presence of diseases, job stress, job satisfaction, and injury type. The data was analyzed using the Kaplan-Meier estimates and the Cox proportional hazard model. Results: According to Kaplan-Meier estimate it was revealed that a lower number of dependents, longer sleep duration, no job stress, no disease, no alcohol addiction, and higher monthly income have a great impact on early return to work after injury. The Cox regression analysis revealed that the significant risk factors which influenced miners’ return to work included presence of disease, job satisfaction and injury type. Conclusions: The mine management should pay attention to significant risk factors for injuries in order to develop effective preventive measures. Med Pr 2016;67(6:729–742
Research and analyze of physical health using multiple regression analysis
Directory of Open Access Journals (Sweden)
T. S. Kyi
2014-01-01
Full Text Available This paper represents the research which is trying to create a mathematical model of the "healthy people" using the method of regression analysis. The factors are the physical parameters of the person (such as heart rate, lung capacity, blood pressure, breath holding, weight height coefficient, flexibility of the spine, muscles of the shoulder belt, abdominal muscles, squatting, etc.., and the response variable is an indicator of physical working capacity. After performing multiple regression analysis, obtained useful multiple regression models that can predict the physical performance of boys the aged of fourteen to seventeen years. This paper represents the development of regression model for the sixteen year old boys and analyzed results.
An improved multiple linear regression and data analysis computer program package
Sidik, S. M.
1972-01-01
NEWRAP, an improved version of a previous multiple linear regression program called RAPIER, CREDUC, and CRSPLT, allows for a complete regression analysis including cross plots of the independent and dependent variables, correlation coefficients, regression coefficients, analysis of variance tables, t-statistics and their probability levels, rejection of independent variables, plots of residuals against the independent and dependent variables, and a canonical reduction of quadratic response functions useful in optimum seeking experimentation. A major improvement over RAPIER is that all regression calculations are done in double precision arithmetic.
Molecular genetics analysis of hereditary breast and ovarian cancer patients in India
Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan
2009-01-01
Abstract Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differe...
Functional data analysis of generalized regression quantiles
Guo, Mengmeng; Zhou, Lan; Huang, Jianhua Z.; Hä rdle, Wolfgang Karl
2013-01-01
Generalized regression quantiles, including the conditional quantiles and expectiles as special cases, are useful alternatives to the conditional means for characterizing a conditional distribution, especially when the interest lies in the tails. We develop a functional data analysis approach to jointly estimate a family of generalized regression quantiles. Our approach assumes that the generalized regression quantiles share some common features that can be summarized by a small number of principal component functions. The principal component functions are modeled as splines and are estimated by minimizing a penalized asymmetric loss measure. An iterative least asymmetrically weighted squares algorithm is developed for computation. While separate estimation of individual generalized regression quantiles usually suffers from large variability due to lack of sufficient data, by borrowing strength across data sets, our joint estimation approach significantly improves the estimation efficiency, which is demonstrated in a simulation study. The proposed method is applied to data from 159 weather stations in China to obtain the generalized quantile curves of the volatility of the temperature at these stations. © 2013 Springer Science+Business Media New York.
Functional data analysis of generalized regression quantiles
Guo, Mengmeng
2013-11-05
Generalized regression quantiles, including the conditional quantiles and expectiles as special cases, are useful alternatives to the conditional means for characterizing a conditional distribution, especially when the interest lies in the tails. We develop a functional data analysis approach to jointly estimate a family of generalized regression quantiles. Our approach assumes that the generalized regression quantiles share some common features that can be summarized by a small number of principal component functions. The principal component functions are modeled as splines and are estimated by minimizing a penalized asymmetric loss measure. An iterative least asymmetrically weighted squares algorithm is developed for computation. While separate estimation of individual generalized regression quantiles usually suffers from large variability due to lack of sufficient data, by borrowing strength across data sets, our joint estimation approach significantly improves the estimation efficiency, which is demonstrated in a simulation study. The proposed method is applied to data from 159 weather stations in China to obtain the generalized quantile curves of the volatility of the temperature at these stations. © 2013 Springer Science+Business Media New York.
Analysis of Relationship Between Personality and Favorite Places with Poisson Regression Analysis
Directory of Open Access Journals (Sweden)
Yoon Song Ha
2018-01-01
Full Text Available A relationship between human personality and preferred locations have been a long conjecture for human mobility research. In this paper, we analyzed the relationship between personality and visiting place with Poisson Regression. Poisson Regression can analyze correlation between countable dependent variable and independent variable. For this analysis, 33 volunteers provided their personality data and 49 location categories data are used. Raw location data is preprocessed to be normalized into rates of visit and outlier data is prunned. For the regression analysis, independent variables are personality data and dependent variables are preprocessed location data. Several meaningful results are found. For example, persons with high tendency of frequent visiting to university laboratory has personality with high conscientiousness and low openness. As well, other meaningful location categories are presented in this paper.
Mawency Vergel Ortega; José Joaquín Martínez Lozano; Eduardo Ibargüen Mondragón
2016-01-01
The article shows factors associated with college desertion. The survival analysis technique allowed to perform a study with students from different programs at the Francisco de Paula Santander University, considering the events: semester, abandonment, punishment, punishment - abandonment. Using the Kaplan-Meier estimator [1], the survival function for each event of interest was estimated and desertion models whose variables were significant at 10% using the semi-parametric met...
application of multilinear regression analysis in modeling of soil
African Journals Online (AJOL)
Windows User
Accordingly [1, 3] in their work, they applied linear regression ... (MLRA) is a statistical technique that uses several explanatory ... order to check this, they adopted bivariate correlation analysis .... groups, namely A-1 through A-7, based on their relative expected ..... Multivariate Regression in Gorgan Province North of Iran” ...
Multiple regression analysis of Jominy hardenability data for boron treated steels
International Nuclear Information System (INIS)
Komenda, J.; Sandstroem, R.; Tukiainen, M.
1997-01-01
The relations between chemical composition and their hardenability of boron treated steels have been investigated using a multiple regression analysis method. A linear model of regression was chosen. The free boron content that is effective for the hardenability was calculated using a model proposed by Jansson. The regression analysis for 1261 steel heats provided equations that were statistically significant at the 95% level. All heats met the specification according to the nordic countries producers classification. The variation in chemical composition explained typically 80 to 90% of the variation in the hardenability. In the regression analysis elements which did not significantly contribute to the calculated hardness according to the F test were eliminated. Carbon, silicon, manganese, phosphorus and chromium were of importance at all Jominy distances, nickel, vanadium, boron and nitrogen at distances above 6 mm. After the regression analysis it was demonstrated that very few outliers were present in the data set, i.e. data points outside four times the standard deviation. The model has successfully been used in industrial practice replacing some of the necessary Jominy tests. (orig.)
KRAS polymorphisms are associated with survival of CRC in Chinese population.
Dai, Qiong; Wei, Hui Lian; Huang, Juan; Zhou, Tie Jun; Chai, Li; Yang, Zhi-Hui
2016-04-01
rs12245, rs12587, rs9266, rs1137282, rs61764370, and rs712 of KRAS oncogene are characterized in the 3'UTR. The study highlights the important role of these polymorphisms playing in the susceptibility, oxaliplatin-based chemotherapy sensitivity, progression, and prognosis of CRC. Improved multiplex ligation detection reaction (iMLDR) technique is used for genotyping. An unconditional logistic regression model was used to estimate the association of certain polymorphism and CRC risk. The Kaplan-Meier method, log-rank test, and Cox regression model were used to evaluate the effects of polymorphisms on survival analysis. Results demonstrated that TT genotype and T allele of rs712 were associated with the increased risk of CRC; the patients with GG genotype and G allele of rs61764370 had a shorter survival and a higher risk of relapse or metastasis of CRC. Our studies supported the conclusions that rs61764370 and rs712 polymorphisms of the KRAS are functional and it may play an important role in the development of CRC and oxaliplatin-based chemotherapy efficiency and prognosis of CRC.
Energy Technology Data Exchange (ETDEWEB)
Alfke, H.; Alfke, B.; Froelich, J.J.; Klose, K.J.; Wagner, H.J. [Klinik fuer Strahlendiagnostik Philipps Univ. Marburg (Germany)
2003-08-01
Purpose: To analyze outcome and predictive factors for patient survival and patency rates of unresectable malignant biliary obstruction treated with percutaneous transhepatic insertion of metal stents. Materials and Methods: This is a retroselective analysis of 130 patients treated in one interventional radiological center with data collected from patient records and by telephone interviews. The procedure-related data had been prospectively documented in a computer data base. The Kaplan-Meier analysis was performed for univariate and multivariate comparison of survival and patency rates with the log-rank test used for different tumor types. Predictive factors for survival and 30-day mortality were analyzed by a stepwise logistic regression. Results: Underlying causes of malignant biliary obstructions were cholangiocarcinoma in 50, pancreatic carcinoma in 29, liver metastases in 27, gallbladder carcinoma in 20, and other tumors in 4 patients. The technical success rate was 99%, the complication rate 27% and the 30-day mortality 11%. Primary patency rates (406 days with a median of 207 days) did not differ significantly for different tumor types. The survival rates were significantly (p = 0.03 by log-rank test) better for patients with cholangiocarcinoma than for patients with pancreatic carcinoma and liver metastases. Multiple regression analysis revealed no predictive factor for patient survival and 30-day mortality. Conclusion: Percutaneous transhepatic insertion of metal biliary endoprostheses offers a good initial and long-term relief of jaundice caused by malignant biliary obstruction. Although survival rates for patients with cholangiocarcinoma are better than for other causes of malignant biliary obstruction, a clear predictive factor is lacking for patients undergoing palliative biliary stent insertion. (orig.) [German] Ziel: Ergebnisse der perkutanen transhepatischen Metallendoprothesenimplantation bei malignen Gallenwegsverschluessen zu evaluieren und
Pressure pulsation in Kaplan turbines: Prototype-CFD comparison
International Nuclear Information System (INIS)
Rivetti, A; Lucino, C; Liscia, S; Muguerza, D; Avellan, F
2012-01-01
Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.
Pressure pulsation in Kaplan turbines: Prototype-CFD comparison
Rivetti, A.; Lucino1, C.; Liscia, S.; Muguerza, D.; Avellan, F.
2012-11-01
Pressure pulsation phenomena in a large Kaplan turbine are investigated by means of numerical simulations (CFD) and prototype measurements in order to study the dynamic behavior of flow due to the blade passage and its interaction with other components of the turbine. Numerical simulations are performed with the commercial software Ansys CFX code, solving the incompressible Unsteady Reynolds-Averaged-Navier Stokes equations under a finite volume scheme. The computational domain involves the entire machine at prototype scale. Special care is taken in the discretization of the wicket gate overhang and runner blade gap. Prototype measurements are performed using pressure transducers at different locations among the wicket gate outlet and the draft tube inlet. Then, CFD results are compared with temporary signals of prototype measurements at identical locations to validate the numerical model. A detailed analysis was focused on the tip gap flow and the pressure field at the discharge ring. From a rotating reference frame perspective, it is found that the mean pressure fluctuates accordingly the wicket gate passage. Moreover, in prototype measurements the pressure frequency that reveals the presence of modulated cavitation at the discharge ring is distinguished, as also verified from the shape of erosion patches in concordance with the number of wicket gates.
de Wit, R.; van den Berg, H.; Burghouts, J.; Nortier, J.; Slee, P.; Rodenburg, C.; Keizer, J.; Fonteyn, M.; Verweij, J.; Wils, J.
1998-01-01
We have reported previously that the anti-emetic efficacy of single agent 5HT3 antagonists is not maintained when analysed with the measurement of cumulative probabilities. Presently, the most effective anti-emetic regimen is a combination of a 5HT3 antagonist plus dexamethasone. We, therefore, assessed the sustainment of efficacy of such a combination in 125 patients, scheduled to receive cisplatin > or = 70 mg m(-2) either alone or in combination with other cytotoxic drugs. Anti-emetic therapy was initiated with 10 mg of dexamethasone and 3 mg of granisetron intravenously, before cisplatin. On days 1-6, patients received 8 mg of dexamethasone and 1 mg of granisetron twice daily by oral administration. Protection was assessed during all cycles and calculated based on cumulative probability analyses using the method of Kaplan-Meier and a model for transitional probabilities. Irrespective of the type of analysis used, the anti-emetic efficacy of granisetron/dexamethasone decreased over cycles. The initial complete acute emesis protection rate of 66% decreased to 30% according to the method of Kaplan-Meier and to 39% using the model for transitional probabilities. For delayed emesis, the initial complete protection rate of 52% decreased to 21% (Kaplan-Meier) and to 43% (transitional probabilities). In addition, we observed that protection failure in the delayed emesis period adversely influenced the acute emesis protection in the next cycle. We conclude that the anti-emetic efficacy of a 5HT3 antagonist plus dexamethasone is not maintained over multiple cycles of highly emetogenic chemotherapy, and that the acute emesis protection is adversely influenced by protection failure in the delayed emesis phase. PMID:9652766
Large mass limit of the continuum theories in Kaplan's formulation
International Nuclear Information System (INIS)
Kawano, T.; Kikukawa, Y.
1994-01-01
Being inspired by Kaplan's proposal for simulating chiral fermions on a lattice, we examine the continuum analogue of his domain-wall construction for two-dimensional chiral Schwinger models. Adopting a slightly unusual dimensional regularization, we explicitly evaluate the one-loop effective action in the limit that the domain-wall mass goes to infinity. For anomaly-free cases, the effective action turns out to be gauge invariant in the two-dimensional sense
Understanding logistic regression analysis
Sperandei, Sandro
2014-01-01
Logistic regression is used to obtain odds ratio in the presence of more than one explanatory variable. The procedure is quite similar to multiple linear regression, with the exception that the response variable is binomial. The result is the impact of each variable on the odds ratio of the observed event of interest. The main advantage is to avoid confounding effects by analyzing the association of all variables together. In this article, we explain the logistic regression procedure using ex...
DEFF Research Database (Denmark)
Cannon, Christopher P; Husted, Steen; Harrington, Robert A
2007-01-01
, or clopidogrel 300-mg loading dose plus 75 mg once daily for up to 12 weeks. RESULTS: The primary end point, the Kaplan-Meier rate of major or minor bleeding through 4 weeks, was 8.1% in the clopidogrel group, 9.8% in the AZD6140 90-mg group, and 8.0% in the AZD6140 180-mg group (p = 0.43 and p = 0.......96, respectively, vs. clopidogrel); the major bleeding rates were 6.9%, 7.1%, and 5.1%, respectively (p = 0.91 and p = 0.35, respectively, vs. clopidogrel). Although not statistically significant, favorable trends were seen in the Kaplan-Meier rates of myocardial infarction (MI) over the entire study period (MI: 5...
Meier-Gorlin syndrome: Report of an additional patient with congenital heart disease
Directory of Open Access Journals (Sweden)
Rabah M. Shawky
2014-10-01
Full Text Available We report a 7 year old female child with the classical triad of Meier-Gorlin syndrome (MGS, (microtia, absent patella and short stature. She had the characteristic facial features, with normal mentality and defective speech, skeletal abnormalities, conductive hearing loss, cystitis and normal growth hormone level. She suffered from recurrent chest infection during the first year of life which improved gradually with age. Although congenital heart is rarely observed in MGS, our patient had in addition fenestrated interatrial septal defect.
Air injection test on a Kaplan turbine: prototype - model comparison
Angulo, M.; Rivetti, A.; Díaz, L.; Liscia, S.
2016-11-01
Air injection is a very well-known resource to reduce pressure pulsation magnitude in turbines, especially on Francis type. In the case of large Kaplan designs, even when not so usual, it could be a solution to mitigate vibrations arising when tip vortex cavitation phenomenon becomes erosive and induces structural vibrations. In order to study this alternative, aeration tests were performed on a Kaplan turbine at model and prototype scales. The research was focused on efficiency of different air flow rates injected in reducing vibrations, especially at the draft tube and the discharge ring and also in the efficiency drop magnitude. It was found that results on both scales presents the same trend in particular for vibration levels at the discharge ring. The efficiency drop was overestimated on model tests while on prototype were less than 0.2 % for all power output. On prototype, air has a beneficial effect in reducing pressure fluctuations up to 0.2 ‰ of air flow rate. On model high speed image computing helped to quantify the volume of tip vortex cavitation that is strongly correlated with the vibration level. The hydrophone measurements did not capture the cavitation intensity when air is injected, however on prototype, it was detected by a sonometer installed at the draft tube access gallery.
Energy Technology Data Exchange (ETDEWEB)
Drygas, A.; Bauer, K. [E.ON Wasserkraft GmbH, Landshut (Germany)
2008-07-01
In spite of aiming at minimum maintenance costs, runners of Kaplan turbines need to be kept in good repair. Besides preserving their main function as an energy converter, ecological reasons have to be considered as well. The latter aspect accounts for fully functional, safe seals of the pivot-mounted Kaplan runner blades. Advanced wear of the sealing surfaces may require mechanical processing, which formerly called for a costly dismantling of the runner. A newly developed and patented processing device now allows for machining the worn out sealing surfaces without dismantling the runner, thus reducing costs considerably. The device was first successfully applied to a Kaplan turbine runner with a diameter of 5.35 m. The device, so far designed for grinding, will be enhanced for lathing, in order to obtain a process even more efficient when combining lathing and grinding. (orig.)
Background stratified Poisson regression analysis of cohort data.
Richardson, David B; Langholz, Bryan
2012-03-01
Background stratified Poisson regression is an approach that has been used in the analysis of data derived from a variety of epidemiologically important studies of radiation-exposed populations, including uranium miners, nuclear industry workers, and atomic bomb survivors. We describe a novel approach to fit Poisson regression models that adjust for a set of covariates through background stratification while directly estimating the radiation-disease association of primary interest. The approach makes use of an expression for the Poisson likelihood that treats the coefficients for stratum-specific indicator variables as 'nuisance' variables and avoids the need to explicitly estimate the coefficients for these stratum-specific parameters. Log-linear models, as well as other general relative rate models, are accommodated. This approach is illustrated using data from the Life Span Study of Japanese atomic bomb survivors and data from a study of underground uranium miners. The point estimate and confidence interval obtained from this 'conditional' regression approach are identical to the values obtained using unconditional Poisson regression with model terms for each background stratum. Moreover, it is shown that the proposed approach allows estimation of background stratified Poisson regression models of non-standard form, such as models that parameterize latency effects, as well as regression models in which the number of strata is large, thereby overcoming the limitations of previously available statistical software for fitting background stratified Poisson regression models.
DEFF Research Database (Denmark)
Freilich, Jonatan; Manouchehrinia, Ali; Trusheim, Mark
2017-01-01
Previous research characterizing factors influencing multiple sclerosis (MS) disease progression has typically been based on time to disease milestones (Kaplan-Meier, Cox hazard regression, etc.). A limitation of these methods is the handling of the often large groups of patients not reaching...... the milestone. To characterize clinical factors influencing MS disease progression as annual transitions from each Expanded Disability Status Scale (EDSS). The annual progression of 11,964 patients from the Swedish MS Registry was analysed with 10 multinomial logistic regressions, that is, one for transition...... from each full EDSS with explanatory variables age, sex, age at onset, time in current EDSS, highest prior EDSS, MS course and treatment. All factors (except sex) investigated had statistically significant impacts on transitions from at least one EDSS. However, significance and size of the effect...
Magnitude of bacteraemia predicts one-year mortality
DEFF Research Database (Denmark)
Gradel, Kim Oren; Schønheyder, Henrik Carl; Søgaard, Mette
Objectives: All hospitals in our region use the BacT/Alert® blood culture (BC) system with a 3-bottle BC set for adults. We hypothesized that the magnitude of bacteremia (i.e., number of positive bottles in the initial BC set) predicted one-year mortality. Methods In a population-based study we...... with a BC index of 1 (i.e., one positive bottle) were chosen as the reference group. We computed Kaplan-Meier curves and performed Cox regression analyses to estimate mortality rate ratios (MRRs) with 95 % confidence intervals [CIs] 30 and 365 days after the initial BC sampling date, first in crude analyses...... mortality....
Concurrent chemoradiation for vaginal cancer.
Directory of Open Access Journals (Sweden)
David T Miyamoto
Full Text Available BACKGROUND: It is not known whether the addition of chemotherapy to radiation therapy improves outcomes in primary vaginal cancer. Here, we review clinical outcomes in patients with primary vaginal cancer treated with radiation therapy (RT or concurrent chemoradiation therapy (CRT. METHODS: Seventy-one patients with primary vaginal cancer treated with definitive RT with or without concurrent chemotherapy at a single institution were identified and their records reviewed. A total of 51 patients were treated with RT alone; 20 patients were treated with CRT. Recurrences were analyzed. Overall survival (OS and disease-free survival (DFS rates were estimated using the Kaplan-Meier method. Cox regression analysis was performed. RESULTS: The median age at diagnosis was 61 years (range, 18-92 years and the median follow-up time among survivors was 3.0 years. Kaplan-Meier estimates for OS and DFS differed significantly between the RT and CRT groups (3-yr OS = 56% vs. 79%, log-rank p = 0.037; 3-yr DFS = 43% vs. 73%, log-rank p = 0.011. Twenty-three patients (45% in the RT group had a relapse at any site compared to 3 (15% in the CRT group (p = 0.027. With regard to the sites of first relapse, 10 patients (14% had local only, 4 (6% had local and regional, 9 (13% had regional only, 1 (1% had regional and distant, and 2 (3% had distant only relapse. On univariate analysis, the use of concurrent chemotherapy, FIGO stage, tumor size, and date of diagnosis were significant predictors of DFS. On multivariate analysis, the use of concurrent chemotherapy remained a significant predictor of DFS (hazard ratio 0.31 (95% CI, 0.10-0.97; p = 0.04. CONCLUSIONS: Vaginal cancer results in poor outcomes. Adequate radiation dose is essential to ensure curative management. Concurrent chemotherapy should be considered for vaginal cancer patients.
Poisson Regression Analysis of Illness and Injury Surveillance Data
Energy Technology Data Exchange (ETDEWEB)
Frome E.L., Watkins J.P., Ellis E.D.
2012-12-12
The Department of Energy (DOE) uses illness and injury surveillance to monitor morbidity and assess the overall health of the work force. Data collected from each participating site include health events and a roster file with demographic information. The source data files are maintained in a relational data base, and are used to obtain stratified tables of health event counts and person time at risk that serve as the starting point for Poisson regression analysis. The explanatory variables that define these tables are age, gender, occupational group, and time. Typical response variables of interest are the number of absences due to illness or injury, i.e., the response variable is a count. Poisson regression methods are used to describe the effect of the explanatory variables on the health event rates using a log-linear main effects model. Results of fitting the main effects model are summarized in a tabular and graphical form and interpretation of model parameters is provided. An analysis of deviance table is used to evaluate the importance of each of the explanatory variables on the event rate of interest and to determine if interaction terms should be considered in the analysis. Although Poisson regression methods are widely used in the analysis of count data, there are situations in which over-dispersion occurs. This could be due to lack-of-fit of the regression model, extra-Poisson variation, or both. A score test statistic and regression diagnostics are used to identify over-dispersion. A quasi-likelihood method of moments procedure is used to evaluate and adjust for extra-Poisson variation when necessary. Two examples are presented using respiratory disease absence rates at two DOE sites to illustrate the methods and interpretation of the results. In the first example the Poisson main effects model is adequate. In the second example the score test indicates considerable over-dispersion and a more detailed analysis attributes the over-dispersion to extra
Enhanced Predictive Capability of a 1-Hour Oral Glucose Tolerance Test
DEFF Research Database (Denmark)
Pareek, Manan; Bhatt, Deepak L; Nielsen, Mette L
2018-01-01
OBJECTIVE: To examine whether the 1-h blood glucose measurement would be a more suitable screening tool for assessing the risk of diabetes and its complications than the 2-h measurement. RESEARCH DESIGN AND METHODS: We conducted a prospective population-based cohort study of 4,867 men, randomly...... selected from prespecified birth cohorts between 1921 and 1949, who underwent an oral glucose tolerance test with blood glucose measurements at 0, 1, and 2 h. Subjects were followed for up to 39 years, with registry-based recording of events. Discriminative abilities of elevated 1-h (≥8.6 mmol/L) versus 2......-h (≥7.8 mmol/L) glucose for predicting incident type 2 diabetes, vascular complications, and mortality were compared using Kaplan-Meier analysis, Cox proportional hazards regression, and net reclassification improvement. RESULTS: Median age was 48 years (interquartile range [IQR] 48-49). During...
The influence of unilateral oophorectomy on the age of menopause
DEFF Research Database (Denmark)
Rosendahl, M; Simonsen, M K; Kjer, J J
2017-01-01
OBJECTIVE: To determine the age of menopause after premenopausal unilateral oophorectomy (UO) and to establish whether UO at a young age leads to menopause at a younger age than if UO occurs at an older age. METHODS: A cohort of 28 731 women, of whom 17 781 (62%) were menopausal, was investigated....... Information on menopause was obtained from self-reported questionnaires. Surgical data were obtained from the National Patient Register to avoid recollection bias. Age of menopause after UO/not UO was determined using Kaplan-Meier curves. Cox regression was used to identify factors of importance for early...... menopause. RESULTS: UO was performed in 1148 women. Women with UO after the age of 45 years, premenopausal hysterectomy, bilateral oophorectomy and cancer were excluded, leaving 236 in the analysis. Menopause occurred 1.8 years earlier after UO compared to women with two intact ovaries (mean 49.5 vs. 51...
DEFF Research Database (Denmark)
Vestergaard, Per; Licht, Rasmus Wentzer; Brodersen, Anders Torp
1998-01-01
The purpose of the study was to examine the outcome of long-term lithium treatment in consecutively admitted affective disorder patients assigned to high and low serum lithium levels. A total of 91 patients were diagnosed according to DSM-III criteria and randomly allocated to two open treatment...... groups in which prophylactic lithium was administered in high (serum lithium 0.8-1.0 mmol L-1) and low (serum lithium 0.5-0.8 mmol L-1) doses, respectively. The patients were followed for 2 years or until discontinuation of lithium treatment or readmission to hospital for recurrence of affective illness....... The main outcome of the treatment groups was compared with Kaplan-Meier survival curves and by Cox regression analysis. A total of 31 patients (34%) completed 24 months of prophylactic lithium treatment without recurrence and readmission to hospital. In total, 18 patients (20%) suffered a recurrence...
DEFF Research Database (Denmark)
Roed, Casper; Engsig, Frederik Neess; Omland, Lars Haukali
2012-01-01
OBJECTIVES: To determine the long-term mortality, the causes of death and the incidence of cancer in listeria meningitis patients. METHODS: Nationwide, population-based cohort study including all adult patients diagnosed with listeria meningitis from 1977 to 2006 and alive 1 year after diagnosis......, and an age-and gender-matched, population control cohort. Kaplan-Meier tables, Cox regression analysis and cumulative incidence function were used as outcome analyses. RESULTS: We identified 114 listeria meningitis patients and 1026 population controls. The adjusted mortality rate ratio (MRR) for listeria...... meningitis patients the first 5 years of follow-up was 2.35(95% confidence interval (CI) 1.60-3.45) thereafter the MRR was 0.93(95% CI: 0.56-1.55). Listeria meningitis patients had an increased risk of death due to cancer the first 5 years of follow-up, and in the same period patients above 50 years of age...
DEFF Research Database (Denmark)
Hansen, N; Obel, N; Christensen, P B
2009-01-01
Predictive factors for initiation of antiviral therapy in chronically infected hepatitis C virus (HCV) patients are not fully elucidated. The aim of this study was to determine predictive factors for initiation of treatment with standard or pegylated interferon either alone or combined...... with ribavirin. A Danish cohort of individuals chronically infected with HCV was used and observation time was calculated from the date of inclusion in the cohort to date of death, last clinical observation, 1 January 2007, or start of HCV antiviral treatment in treatment-naïve patients. Kaplan-Meier survival...... analysis was used to construct time to event curves. Cox regression was used to determine the incidence rate ratios as estimates of relative risk (RR) and 95% confidence intervals (CI). A total of 1780 patients were enrolled in the study. The cumulative chance of treatment initiation over 5 years was 33...
Directory of Open Access Journals (Sweden)
YE Peiyan
2013-04-01
Full Text Available ObjectiveTo identify the risk factors associated with progression of acute-on-chronic liver failure (ACLF occurring in patients with chronic hepatitis B virus (HBV infection (CHB. MethodsThe clinical, demographic, treatment and outcome data of 180 ACLF patients with concomitant CHB managed in our hospital between June 2009 and September 2012 were retrospectively reviewed. Clinical data, taken at baseline, included markers of inflammation/infection (white blood cell (WBC count, coagulation (prothrombin time (PT and prothrombin activity (PTA, and liver function (alanine aminotransferase (ALT, aspartate aminotransferase (AST, total bilirubin (TBil, direct bilirubin (DBil, choninesterase (CHE, albumin (Alb, globulin (Glb, total cholesterol (TC, and ammonia. In-hospital treatments included supplementation with traditional Chinese medicine-based therapies, such as Tuihuang decoction and detoxification enema. The primary outcome was survival during hospitalization. The patients were grouped for analysis according to ACLF stage (early, n=93; mid, n=61; late, n=26 and the risk factors associated with each stage were identified by using univariate (log-rank test and multivariate (Cox’s test regression analyses. The association of risk factors with patient survival was assessed by Kaplan-Meier curve analysis. ResultsThe three ACLF groups showed significantly different amounts of leukocytes, with the late ACLF group showing the highest WBC. The late ACLF group also showed significantly lower Glb and TC. There was a trend in reduced cumulative survival rate and shorter time to death that significantly corresponded to progressive stages of ACLF (early ACLF>mid ACLF>late ACLF; all P<0.001. One-hundred-and-twenty-six (70.0% of the patients died during their hospitalization, and multivariate regression analysis of this entire patient population identified absence of colonic enema, presence of hepatic encephalopathy, presence of hepatorenal syndrome, PTA
DEFF Research Database (Denmark)
Heeran, Mel C; Rask, Lene; Høgdall, Claus K
2015-01-01
of the disease. Using tissue arrays we analysed the expression levels in tissues from 166 women with borderline ovarian tumours (BOTs) and 592 women with ovarian cancer (OC). A panel of three antibodies was used for immunohistochemistry: a polyclonal and two monoclonal antibodies. Serum TN was measured using...... found to imply longer OS (p Kaplan-Meier survival analysis performed on all OC cases showed a significantly longer OS (p = 0...
Directory of Open Access Journals (Sweden)
Muge Akmansu
2010-12-01
Full Text Available We presented 9 recurrent head and neck carcinoma patients. Priorly all of them had received radiochemotherapy. We used cetuximab and irradiation concomitantly. Overall survival analysis of the patients was performed using the Kaplan-Meier method on SPSS version 15.0. Based on this calculation, mean follow-up duration is 12.8 months. Mean survival time is 19.8 months and annual mean survival rate is 59.3%.
A Quality Assessment Tool for Non-Specialist Users of Regression Analysis
Argyrous, George
2015-01-01
This paper illustrates the use of a quality assessment tool for regression analysis. It is designed for non-specialist "consumers" of evidence, such as policy makers. The tool provides a series of questions such consumers of evidence can ask to interrogate regression analysis, and is illustrated with reference to a recent study published…
Background stratified Poisson regression analysis of cohort data
International Nuclear Information System (INIS)
Richardson, David B.; Langholz, Bryan
2012-01-01
Background stratified Poisson regression is an approach that has been used in the analysis of data derived from a variety of epidemiologically important studies of radiation-exposed populations, including uranium miners, nuclear industry workers, and atomic bomb survivors. We describe a novel approach to fit Poisson regression models that adjust for a set of covariates through background stratification while directly estimating the radiation-disease association of primary interest. The approach makes use of an expression for the Poisson likelihood that treats the coefficients for stratum-specific indicator variables as 'nuisance' variables and avoids the need to explicitly estimate the coefficients for these stratum-specific parameters. Log-linear models, as well as other general relative rate models, are accommodated. This approach is illustrated using data from the Life Span Study of Japanese atomic bomb survivors and data from a study of underground uranium miners. The point estimate and confidence interval obtained from this 'conditional' regression approach are identical to the values obtained using unconditional Poisson regression with model terms for each background stratum. Moreover, it is shown that the proposed approach allows estimation of background stratified Poisson regression models of non-standard form, such as models that parameterize latency effects, as well as regression models in which the number of strata is large, thereby overcoming the limitations of previously available statistical software for fitting background stratified Poisson regression models. (orig.)
Understanding logistic regression analysis.
Sperandei, Sandro
2014-01-01
Logistic regression is used to obtain odds ratio in the presence of more than one explanatory variable. The procedure is quite similar to multiple linear regression, with the exception that the response variable is binomial. The result is the impact of each variable on the odds ratio of the observed event of interest. The main advantage is to avoid confounding effects by analyzing the association of all variables together. In this article, we explain the logistic regression procedure using examples to make it as simple as possible. After definition of the technique, the basic interpretation of the results is highlighted and then some special issues are discussed.
Directory of Open Access Journals (Sweden)
Jing-Ping Zhang
2015-12-01
Full Text Available Preoperative serum lactate dehydrogenase (LDH has been used as a prognostic indicator for patients with hepatocellular carcinoma (HCC treated with sorafenib or undergoing transcatheter arterial chemoembolization, but its significance in predicting survival of HCC patients who received curative resection remains undefined. A total of 683 patients with histopathologically confirmed HCC were enrolled in this study. The prognostic significance of preoperative serum LDH was determined by Kaplan-Meier analysis and a Cox proportional hazards regression model. The association between the preoperative serum LDH and clinicopathological parameters was evaluated by the χ2 test or linear regression analysis when appropriate. Higher preoperative serum LDH level was associated with worse prognosis. In a multivariate Cox proportional hazards analysis, the preoperative serum LDH level could predict overall survival and recurrence independently. Higher preoperative serum LDH level is associated with the elevated serum alpha-fetoprotein, the presence of hepatitis B surface antigen, larger tumor size, the presence of macrovascular invasion, the advanced tumor–lymph node–metastasis stage, worse tumor differentiation, and Child-Pugh B. Preoperative serum LDH level was an inexpensive, simple, convenient, and routinely measured biomarker exhibiting a potential to select patients at high risk with poor clinical outcome for appropriate treatment strategies.
Waters, Eugenie; Dingle, Brian; Rodrigues, George; Vincent, Mark; Ash, Robert; Dar, Rashid; Inculet, Richard; Kocha, Walter; Malthaner, Richard; Sanatani, Michael; Stitt, Larry; Yaremko, Brian; Younus, Jawaid; Yu, Edward
2010-07-01
The London Regional Cancer Program (LRCP) uses a unique schedule of induction plus concurrent chemoradiation, termed VCRT (vinblastine, cisplatin, and radiation therapy), for the treatment of a subset of unresectable stage IIIA and IIIB non-small-cell lung cancer (NSCLC). This analysis was conducted to better understand the outcomes in VCRT-treated patients. We report a retrospective analysis of a large cohort of patients who underwent VCRT at the LRCP over a 10-year period, from 1996 to 2006. The analysis focused on OS, toxicities, and the outcomes from completion surgery in a small subset of patients. A total of 294 patients were included and 5-year OS, determined using Kaplan-Meier methodology, was 19.8% with a MST of 18.2 months. Reported grade 3-4 toxicities included neutropenia (39%), anemia (10%), pneumonitis (1%), and esophagitis (3%). Significant differences in survival between groups of patients were demonstrated with log-rank tests for completion surgery, use of radiation therapy, and cisplatin dose. Similarly, Univariate Cox regression showed that completion surgery, use of radiation therapy, cisplatin dose, and vinblastine dose were associated with increased survival. This retrospective analysis of a large cohort of patients reveals an OS for VCRT comparable to that reported in the literature for other current combined chemoradiation protocols. The success of this protocol seems to be dose dependent and the outcomes in those who underwent completion surgery suggests that pathologic complete remission is possible for IIIA and IIIB NSCLC.
Directory of Open Access Journals (Sweden)
Deyan Davidov
2017-05-01
Full Text Available Objective: The aim of this study was to investigate the prognostic significance for survival of certain clinical and pathological factors in patients with advanced or metastatic colorectal carcinoma (CRC treated with first- line chemotherapy. Methods: From 2002 to 2011 seventy- four consecutive patients with advanced or metastatic CRC, treated in UMHAT- Dr. G. Stranski, Department of Medical Oncology entered the study. Some patient’s characteristics, hematological and pathological parameters, were evaluated for their role as predictors of overall survival. The therapeutic regimens included FOLFOX or FOlFIRI. Survival analysis was evaluated by Kaplan- Meier test. The influence of pretreatment characteristics as prognostic factor for survival was analyzed using multivariate stepwise Cox regression analyses. Results: In multivariate analysis a significant correlation was exhibited between survival, poor performance status and multiple sites of metastasis. Variables significantly associated with overall survival in univariate analysis were performance status>1, thrombocytosis, anemia and number of metastatic sites >1. Conclusion: These results indicated that poor performance status, anemia, thrombocytosis as well as multiple site of metastasis could be useful prognostic factors in patients with metastatic CRC.
Retro-regression--another important multivariate regression improvement.
Randić, M
2001-01-01
We review the serious problem associated with instabilities of the coefficients of regression equations, referred to as the MRA (multivariate regression analysis) "nightmare of the first kind". This is manifested when in a stepwise regression a descriptor is included or excluded from a regression. The consequence is an unpredictable change of the coefficients of the descriptors that remain in the regression equation. We follow with consideration of an even more serious problem, referred to as the MRA "nightmare of the second kind", arising when optimal descriptors are selected from a large pool of descriptors. This process typically causes at different steps of the stepwise regression a replacement of several previously used descriptors by new ones. We describe a procedure that resolves these difficulties. The approach is illustrated on boiling points of nonanes which are considered (1) by using an ordered connectivity basis; (2) by using an ordering resulting from application of greedy algorithm; and (3) by using an ordering derived from an exhaustive search for optimal descriptors. A novel variant of multiple regression analysis, called retro-regression (RR), is outlined showing how it resolves the ambiguities associated with both "nightmares" of the first and the second kind of MRA.
Linear regression analysis: part 14 of a series on evaluation of scientific publications.
Schneider, Astrid; Hommel, Gerhard; Blettner, Maria
2010-11-01
Regression analysis is an important statistical method for the analysis of medical data. It enables the identification and characterization of relationships among multiple factors. It also enables the identification of prognostically relevant risk factors and the calculation of risk scores for individual prognostication. This article is based on selected textbooks of statistics, a selective review of the literature, and our own experience. After a brief introduction of the uni- and multivariable regression models, illustrative examples are given to explain what the important considerations are before a regression analysis is performed, and how the results should be interpreted. The reader should then be able to judge whether the method has been used correctly and interpret the results appropriately. The performance and interpretation of linear regression analysis are subject to a variety of pitfalls, which are discussed here in detail. The reader is made aware of common errors of interpretation through practical examples. Both the opportunities for applying linear regression analysis and its limitations are presented.
Tinkle, Christopher L; Fernandez-Pineda, Israel; Sykes, April; Lu, Zhaohua; Hua, Chia-Ho; Neel, Michael D; Bahrami, Armita; Shulkin, Barry L; Kaste, Sue C; Pappo, Alberto; Spunt, Sheri L; Krasin, Matthew J
2017-11-15
Indications for and delivery of adjuvant therapies for pediatric nonrhabdomyosarcoma soft tissue sarcoma (NRSTS) have been derived largely from adult studies; therefore, significant concern remains regarding radiation exposure to normal tissue. The authors report long-term treatment outcomes and toxicities for pediatric and young adult patients with high-grade NRSTS who were treated on a prospective trial using limited-margin radiotherapy. Sixty-two patients (ages 3-22 years) with predominantly high-grade NRSTS requiring radiation were treated on a phase 2 institutional study of conformal external-beam radiotherapy and/or brachytherapy using a 1.5-cm to 2-cm anatomically constrained margin. The estimated cumulative incidence of local failure, Gray's method estimated cumulative incidence of local failure, Kaplan-Meier method estimated survival, competing-risk regression model determined predictors of disease outcome, and toxicity was reported according to CTCAE v2.0. At a median follow-up of 5.1 years (range, 0.2-10.9 years), 9 patients had experienced local failure. The 5-year overall cumulative incidence of local failure was 14.8% (95% confidence interval [CI], 7.2%-25%), and all but 1 local failure occurred outside the highest-dose irradiation volume. The 5-year Kaplan-Meier estimates for event-free and overall survival were 49.3% (95% CI, 36.3%-61.1%) and 67.9% (95% CI, 54.2%-78.3%), respectively. Multivariable analysis indicated that younger age was the only independent predictor of local recurrence (P = .004). The 5-year cumulative incidence of grade 3 or 4 late toxicity was 15% (95% CI, 7.2%-25.3%). The delivery of limited-margin radiotherapy using conformal external-beam radiotherapy or brachytherapy provides a high rate of local tumor control without an increase in marginal failures and with acceptable treatment-related morbidity. Cancer 2017;123:4419-29. © 2017 American Cancer Society. © 2017 American Cancer Society.
Miners' return to work following injuries in coal mines.
Bhattacherjee, Ashis; Kunar, Bijay Mihir
2016-12-22
The occupational injuries in mines are common and result in severe socio-economical consequences. Earlier studies have revealed the role of multiple factors such as demographic factors, behavioral factors, health-related factors, working environment, and working conditions for mine injuries. However, there is a dearth of information about the role of some of these factors in delayed return to work (RTW) following a miner's injury. These factors may likely include personal characteristics of injured persons and his or her family, the injured person's social and economic status, and job characteristics. This study was conducted to assess the role of some of these factors for the return to work following coal miners' injuries. A study was conducted for 109 injured workers from an underground coal mine in the years 2000-2009. A questionnaire, which was completed by the personnel interviews, included among others age, height, weight, seniority, alcohol consumption, sleeping duration, presence of diseases, job stress, job satisfaction, and injury type. The data was analyzed using the Kaplan-Meier estimates and the Cox proportional hazard model. According to Kaplan-Meier estimate it was revealed that a lower number of dependents, longer sleep duration, no job stress, no disease, no alcohol addiction, and higher monthly income have a great impact on early return to work after injury. The Cox regression analysis revealed that the significant risk factors which influenced miners' return to work included presence of disease, job satisfaction and injury type. The mine management should pay attention to significant risk factors for injuries in order to develop effective preventive measures. Med Pr 2016;67(6):729-742. This work is available in Open Access model and licensed under a CC BY-NC 3.0 PL license.
Directory of Open Access Journals (Sweden)
Vogt A
2011-11-01
Full Text Available Alexander Vogt1, Anke Schoelmerich1, Franziska Pollner1, Manuela Schlitt1, Uwe Raaz1, Lars Maegdefessel2, Iris Reindl1, Michael Buerke1, Karl Werdan1, Axel Schlitt11Department of Medicine III, Martin Luther-University, Halle, Germany; 2Division of Cardiovascular Medicine, Stanford University School of Medicine, Stanford, CA, USAPurpose: The aim of this study was to determine the long-term safety of drug-eluting stent (DES versus bare metal stent (BMS implantation in a “real-world” setting.Patients and methods: A total of 1809 patients who were treated with implantation of either BMS or DES were assessed. Kaplan-Meier and multivariate Cox regression analyses concerning primary endpoint of cardiac mortality were performed.Results: A total of 609 patients received DES. Mean age was 66.2 ± 11.3 years, 69.4% were male, and 1517 (83.8% were treated for acute coronary syndrome (unstable angina 510 [28.2%], non-ST-elevation myocardial infarction [NSTEMI] 506 [28.0%], and ST-elevation myocardial infarction [STEMI] 501 [27.7%]. Mean follow-up was 34 ± 15 months. During follow-up, 268 patients died of cardiac causes (DES 42 [7.3%]; BMS 226 [19.6%]; P < 0.001. Univariate Kaplan-Meier analysis showed an advantage of DES over BMS concerning the primary endpoint (P < 0.001. When adjusting for classic risk factors and additional factors that affect the progression of coronary heart disease (CHD, DES was not found to be superior to BMS (hazard ratio 0.996, 95% confidence interval 0.455–2.182, P = 0.993. Severely impaired renal function was an independent predictor for cardiac mortality after stent implantation.Conclusion: Treatment with DES is safe in the long term, also in patients presenting with STEMI. However, in multivariate analyses it is not superior to BMS treatment.Keywords: coronary stent, outcome, renal insufficiency, myocardial infarction, STEMI
Management of Industrial Performance Indicators: Regression Analysis and Simulation
Directory of Open Access Journals (Sweden)
Walter Roberto Hernandez Vergara
2017-11-01
Full Text Available Stochastic methods can be used in problem solving and explanation of natural phenomena through the application of statistical procedures. The article aims to associate the regression analysis and systems simulation, in order to facilitate the practical understanding of data analysis. The algorithms were developed in Microsoft Office Excel software, using statistical techniques such as regression theory, ANOVA and Cholesky Factorization, which made it possible to create models of single and multiple systems with up to five independent variables. For the analysis of these models, the Monte Carlo simulation and analysis of industrial performance indicators were used, resulting in numerical indices that aim to improve the goals’ management for compliance indicators, by identifying systems’ instability, correlation and anomalies. The analytical models presented in the survey indicated satisfactory results with numerous possibilities for industrial and academic applications, as well as the potential for deployment in new analytical techniques.
Amiri, Zohreh; Mohammad, Kazem; Mahmoudi, Mahmood; Parsaeian, Mahbubeh; Zeraati, Hojjat
2013-01-01
There are numerous unanswered questions in the application of artificial neural network models for analysis of survival data. In most studies, independent variables have been studied as qualitative dichotomous variables, and results of using discrete and continuous quantitative, ordinal, or multinomial categorical predictive variables in these models are not well understood in comparison to conventional models. This study was designed and conducted to examine the application of these models in order to determine the survival of gastric cancer patients, in comparison to the Cox proportional hazards model. We studied the postoperative survival of 330 gastric cancer patients who suffered surgery at a surgical unit of the Iran Cancer Institute over a five-year period. Covariates of age, gender, history of substance abuse, cancer site, type of pathology, presence of metastasis, stage, and number of complementary treatments were entered in the models, and survival probabilities were calculated at 6, 12, 18, 24, 36, 48, and 60 months using the Cox proportional hazards and neural network models. We estimated coefficients of the Cox model and the weights in the neural network (with 3, 5, and 7 nodes in the hidden layer) in the training group, and used them to derive predictions in the study group. Predictions with these two methods were compared with those of the Kaplan-Meier product limit estimator as the gold standard. Comparisons were performed with the Friedman and Kruskal-Wallis tests. Survival probabilities at different times were determined using the Cox proportional hazards and a neural network with three nodes in the hidden layer; the ratios of standard errors with these two methods to the Kaplan-Meier method were 1.1593 and 1.0071, respectively, revealed a significant difference between Cox and Kaplan-Meier (P neural network, and the neural network and the standard (Kaplan-Meier), as well as better accuracy for the neural network (with 3 nodes in the hidden layer
Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D
2011-12-01
To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.
[Expression and clinical significance of 5hmC in bladder urothelial carcinoma].
Li, Jie; Xu, Yuqiao; Zhang, Zhiwen; Zhang, Ming; Zhang, Zhekai; Zhang, Feng; Li, Qing
2016-02-01
To investigate the expression of 5-hydroxymethylcytosine (5hmC) in bladder urothelial carcinoma (UC) and its clinical significance. The expression of 5hmC in 21 cases of UC tissues and pericarcinous urinary tract epithelium was detected by immunohistochemical staining. Then the expression of 5hmC in the surgical resection of UC tissues in 92 cases was also surveyed. Non parametric U Mann-Whitney test was used to analyze the correlation between 5hmC expression and clinical data. Single factor survival analysis was performed by Kaplan-Meier test. The expression of 5hmC in normal urinary tract epithelium and UC tissues was significantly different, but there was no significant difference in the expression of 5hmC between low and high grades of UC tissues as well as between different TNM grades. Kaplan-Meier single factor survival analysis showed that there was no significant correlation between the 5hmC expression level and the survival rate or the recurrence-free survival of UC patients. The expression level of 5hmC in UC tissues is significantly lower than that in pericarcinous urinary tract epithelium. There is no correlation between the 5hmC expression and the progression, prognosis and recurrence of UC.
Hecht, Jeffrey B.
The analysis of regression residuals and detection of outliers are discussed, with emphasis on determining how deviant an individual data point must be to be considered an outlier and the impact that multiple suspected outlier data points have on the process of outlier determination and treatment. Only bivariate (one dependent and one independent)…
Survival Analysis and its Associated Factors of Beta Thalassemia Major in Hamadan Province
Directory of Open Access Journals (Sweden)
Reza Zamani
2015-05-01
Full Text Available Background: There currently is a lack of knowledge about the long-term survival of patients with beta thalassemia (BT, particularly in regions with low incidence of the disease. The aim of the present study was to determine the survival rate of the patients with BT major and the factors associated with the survival time. Methods: This retrospective cohort study was performed in Hamadan province, located in the west of Iran. The study included patients that referred to the provincial hospitals during 16 year period from 1997 to 2013. The follow up of each subject was calculated from the date of birth to the date of death. Demographic and clinical data were extracted from patients’ medical records using a checklist. Statistical analysis included the Kaplan-Meier method to analyze survivals, log-rank to compare curves between groups, and Cox regression for multivariate prognostic analysis. Results: A total of 133 patients with BT major were enrolled, 54.9% of whom were male and 66.2% were urban. The 10-, 20- and 30-year survival rate for all patients were 98.3%, 88.4% and 80.5%, respectively. Based on hazard ratio (HR, we found that accompanied diseases (P=0.01, blood type (P=0.03 and residency status (P=0.01 were significant predictors for the survival time of patients. Conclusion: The survival rate of BT patients has improved. Future researches such as prospective designs are required for the estimation of survival rate and to find other prognostic factors, which have reliable sources of data.
Directory of Open Access Journals (Sweden)
Dong-dong Cheng
2015-07-01
Full Text Available Background/Aims: This aim of the present study was to identify specific markers determining the recurrence of the giant cell tumor of bone (GCTB. Methods: This study involved the clinicopathological analysis of 80 cases. All of the clinical features, pathological fracture, Campanacci grade, histological features and surgical methods were reviewed. Immunohistochemistry was used to detect the expression of Ki-67, CD147, mutant p53 and p63 in GCTB. Comparisons between different groups were performed using the Chi-square test. The risk factors affecting recurrence were analyzed using a binary logistic model. Kaplan-Meier analysis was employed for the survival analysis between the groups. Cell proliferation assays, migration and invasion assays were used to detect the function of CD147 on GCTB in vitro. Results: The univariate analysis showed that Ki-67 and CD147 expression, pathological fracture, Campanacci grade and surgical method were associated with recurrence. The multivariate analysis revealed that CD147 expression, Campanacci grade and surgical method were the factors affecting GCTB recurrence. In addition, the Kaplan-Meier analysis revealed that these factors affected tumor-free survival time. In vitro study revealed that the CD147 knockdown by small interfering RNA (siRNA technique dramatically reduced the proliferation, migration and invasion of GCTB. Conclusion: Our results suggest that CD147 may serve as an adequate marker for GCTB recurrence. Campanacci grade is a risk factor for GCTB recurrence, which is also affected by the surgical method used.
TÜ, TPÜ ja EHI uusi magistreid / Eda Tursk, Hille Roots, Heidi Meier
Tursk, Eda
2004-01-01
Tartu ülikooli eesti ja soome-ugri keeleteaduse osakonnas ning kirjanduse ja rahvaluule osakonnas kaitsesid 2003.a. magistritööd Niina Aasmäe, Piret Voll, Larissa Degel, Reet Hendrikson, Tiina Pai, Petar Kehayov, Anna Baidullina, Katrin Ennus, Kristi Jõesaar, Ell Vahtramäe, Lauri Sommer, Andreas Kalkun, Mirjam Hinrikus, Kristel Nõlvak. Tallinna Pedagoogikaülikoolis kaitsesid 2003.a. magistritööd Sirje Nootre, Merike Mägedi, Tiiu Koovit, Heidi Meier, Jaanika Stackhouse, Lilian Ossi, Annika Vamper, Marika Mikkor, Piret Õunapuu, Helin Puksand, Taimi Rosenberg. Eesti Humanitaarinstituudis kaitses 2003.a. magistritööd Merilin Miljan
Long-Term Survivors Using Intraoperative Radiotherapy for Recurrent Gynecologic Malignancies
International Nuclear Information System (INIS)
Tran, Phuoc T.; Su Zheng; Hara, Wendy; Husain, Amreen; Teng, Nelson; Kapp, Daniel S.
2007-01-01
Purpose: To analyze the outcomes of therapy and identify prognostic factors for patients treated with surgery followed by intraoperative radiotherapy (IORT) for gynecologic malignancies at a single institution. Methods and Materials: We performed a retrospective review of 36 consecutive patients treated with IORT to 44 sites with mean follow-up of 50 months. The primary site was the cervix in 47%, endometrium in 31%, vulva in 14%, vagina in 6%, and fallopian tubes in 3%. Previous RT had failed in 72% of patients, and 89% had recurrent disease. Of 38 IORT sessions, 84% included maximal cytoreductive surgery, including 18% exenterations. The mean age was 52 years (range, 30-74), mean tumor size was 5 cm (range, 0.5-12), previous disease-free interval was 32 months (range, 0-177), and mean IORT dose was 1,152 cGy (range, 600-1,750). RT and systemic therapy after IORT were given to 53% and 24% of the cohort, respectively. The outcomes measured were locoregional control (LRC), distant metastasis-free survival (DMFS), disease-specific survival (DSS), and treatment-related complications. Results: The Kaplan-Meier 5-year LRC, DMFS, and DSS probability for the whole group was 44%, 51%, and 47%, respectively. For cervical cancer patients, the Kaplan-Meier 5-year LRC, DMFS, and DSS estimate was 45%, 60%, and 46%, respectively. The prognostic factors found on multivariate analysis (p ≤ 0.05) were the disease-free interval for LRC, tumor size for DMFS, and cervical primary, previous surgery, and locoregional relapse for DSS. Our cohort had 10 Grade 3-4 complications associated with treatment (surgery and IORT) and a Kaplan-Meier 5-year Grade 3-4 complication-free survival rate of 72%. Conclusions: Survival for pelvic recurrence of gynecologic cancer is poor (range, 0-25%). IORT after surgery seems to confer long-term local control in carefully selected patients
Predicting Dropouts of University Freshmen: A Logit Regression Analysis.
Lam, Y. L. Jack
1984-01-01
Stepwise discriminant analysis coupled with logit regression analysis of freshmen data from Brandon University (Manitoba) indicated that six tested variables drawn from research on university dropouts were useful in predicting attrition: student status, residence, financial sources, distance from home town, goal fulfillment, and satisfaction with…
Simulation Experiments in Practice : Statistical Design and Regression Analysis
Kleijnen, J.P.C.
2007-01-01
In practice, simulation analysts often change only one factor at a time, and use graphical analysis of the resulting Input/Output (I/O) data. Statistical theory proves that more information is obtained when applying Design Of Experiments (DOE) and linear regression analysis. Unfortunately, classic
Does buccal cancer have worse prognosis than other oral cavity cancers?
Camilon, P Ryan; Stokes, William A; Fuller, Colin W; Nguyen, Shaun A; Lentsch, Eric J
2014-06-01
To determine whether buccal squamous cell carcinoma has worse overall survival (OS) and disease-specific survival (DSS) than cancers in the rest of the oral cavity. Retrospective analysis of a large population database. We began with a Kaplan-Meier analysis of OS and DSS for buccal versus nonbuccal tumors with unmatched data, followed by an analysis of cases matched for race, age at diagnosis, stage at diagnosis, and treatment modality. This was supported by a univariate Cox regression comparing buccal cancer to nonbuccal cancer, followed by a multivariate Cox regression that included all significant variables studied. With unmatched data, buccal cancer had significantly lesser OS and DSS values than cancers in the rest of the oral cavity (P cancer versus nonbuccal oral cancer were no longer significant. Univariate Cox regression models with respect to OS and DSS showed a significant difference between buccal cancer and nonbuccal cancer. However, with multivariate analysis, buccal hazard ratios for OS and DSS were not significant. With the largest series of buccal carcinoma to date, our study concludes that the OS and DSS of buccal cancer are similar to those of cancers in other oral cavity sites once age at diagnosis, tumor stage, treatment, and race are taken into consideration. The previously perceived poor prognosis of buccal carcinoma may be due to variations in tumor presentation, such as later stage and older patient age. 2b. © 2014 The American Laryngological, Rhinological and Otological Society, Inc.
Quality of life in breast cancer patients--a quantile regression analysis.
Pourhoseingholi, Mohamad Amin; Safaee, Azadeh; Moghimi-Dehkordi, Bijan; Zeighami, Bahram; Faghihzadeh, Soghrat; Tabatabaee, Hamid Reza; Pourhoseingholi, Asma
2008-01-01
Quality of life study has an important role in health care especially in chronic diseases, in clinical judgment and in medical resources supplying. Statistical tools like linear regression are widely used to assess the predictors of quality of life. But when the response is not normal the results are misleading. The aim of this study is to determine the predictors of quality of life in breast cancer patients, using quantile regression model and compare to linear regression. A cross-sectional study conducted on 119 breast cancer patients that admitted and treated in chemotherapy ward of Namazi hospital in Shiraz. We used QLQ-C30 questionnaire to assessment quality of life in these patients. A quantile regression was employed to assess the assocciated factors and the results were compared to linear regression. All analysis carried out using SAS. The mean score for the global health status for breast cancer patients was 64.92+/-11.42. Linear regression showed that only grade of tumor, occupational status, menopausal status, financial difficulties and dyspnea were statistically significant. In spite of linear regression, financial difficulties were not significant in quantile regression analysis and dyspnea was only significant for first quartile. Also emotion functioning and duration of disease statistically predicted the QOL score in the third quartile. The results have demonstrated that using quantile regression leads to better interpretation and richer inference about predictors of the breast cancer patient quality of life.
Castro-Otero, C.
2017-04-01
Very often small turbine manufacturers are requested to produce sizeable turbines, too large in terms of physical dimensions, power or designing capacity. In these cases clever alternative solutions should be found to meet customers’ needs. For instance: in the old times twin runner Francis turbines were an option instead of one large machine, or if a too large Pelton turbine cannot be manufactured or designed, a good option is to install a medium size Francis and a small Pelton. Likewise, a similar approach needs to be taken should the manufacturer be asked for a too large Kaplan. Facing this situation a good option is to install three or more small Kaplan turbines. This particular case was studied in depth and after all the considerations had been made, the following question arouse: Is this a way out for the manufacturer or is it really the best option for the customer? The choice made as a way out for the manufacturer became the best option for the customer and a success for both parties. This paper aims to encourage developers and engineering firms to search for more options than the traditional one to find the best option in plant design.
Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study
International Nuclear Information System (INIS)
Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M.; Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta; Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue; Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis; Martino, Juan; Velasquez, Carlos; Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael; Delgado, Maria del Carmen; Valle, Ana del; Falkov, Anthony; Schucht, Philippe; Arana, Estanislao
2017-01-01
The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)
Ti, Lianping; Richardson, Lindsey; DeBeck, Kora; Nguyen, Paul; Montaner, Julio; Wood, Evan; Kerr, Thomas
2014-08-01
Despite the growing prevalence of illicit stimulant drug use internationally, and the widespread involvement of people who inject drugs (IDU) within street-based drug markets, little is known about the impact of different types of street-based income generation activities on the cessation of stimulant use among IDU. Data were derived from an open prospective cohort of IDU in Vancouver, Canada. We used Kaplan-Meier methods and Cox proportional hazards regression to examine the effect of different types of street-based income generation activities (e.g., sex work, drug dealing, and scavenging) on time to cessation of stimulant use. Between December, 2005 and November, 2012, 887 IDU who use stimulant drugs (cocaine, crack cocaine, or crystal methamphetamine) were prospectively followed-up for a median duration of 47 months. In Kaplan-Meier analyses, compared to those who did not engage in street-based income generation activities, participants who reported sex work, drug dealing, scavenging, or more than one of these activities were significantly less likely to report stimulant drug use cessation (all pstreet-based income generation activity remained significantly associated with a slower time to stimulant drug cessation (all p<0.005). Our findings highlight the urgent need for strategies to address stimulant dependence, including novel pharmacotherapies. Also important, structural interventions, such as low-threshold employment opportunities, availability of supportive housing, legal reforms regarding drug use, and evidence-based approaches that reduce harm among IDU are urgently required. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Factors affecting commencement and cessation of smoking behaviour in Malaysian adults
Directory of Open Access Journals (Sweden)
Ghani Wan
2012-03-01
Full Text Available Abstract Background Tobacco consumption peak in developed countries has passed, however, it is on the increase in many developing countries. Apart from cigarettes, consumption of local hand-rolled cigarettes such as bidi and rokok daun are prevalent in specific communities. Although factors associated with smoking initiation and cessation has been investigated elsewhere, the only available data for Malaysia is on prevalence. This study aims to investigate factors associated with smoking initiation and cessation which is imperative in designing intervention programs. Methods Data were collected from 11,697 adults by trained recording clerks on sociodemographic characteristics, practice of other risk habit and details of smoking such as type, duration and frequency. Smoking commencement and cessation were analyzed using the Kaplan-Meier estimates and log-rank tests. Univariate and multivariate Cox proportional hazard regression models were used to calculate the hazard rate ratios. Results Males had a much higher prevalence of the habit (61.7% as compared to females (5.8%. Cessation was found to be most common among the Chinese and those regularly consuming alcoholic beverages. Kaplan-Meier plot shows that although males are more likely to start smoking, females are found to be less likely to stop. History of betel quid chewing and alcohol consumption significantly increase the likelihood of commencement (p Conclusions Gender, ethnicity, history of quid chewing and alcohol consumption have been found to be important factors in smoking commencement; while ethnicity, betel quid chewing and type of tobacco smoked influences cessation.
Latent cluster analysis of ALS phenotypes identifies prognostically differing groups.
Directory of Open Access Journals (Sweden)
Jeban Ganesalingam
2009-09-01
Full Text Available Amyotrophic lateral sclerosis (ALS is a degenerative disease predominantly affecting motor neurons and manifesting as several different phenotypes. Whether these phenotypes correspond to different underlying disease processes is unknown. We used latent cluster analysis to identify groupings of clinical variables in an objective and unbiased way to improve phenotyping for clinical and research purposes.Latent class cluster analysis was applied to a large database consisting of 1467 records of people with ALS, using discrete variables which can be readily determined at the first clinic appointment. The model was tested for clinical relevance by survival analysis of the phenotypic groupings using the Kaplan-Meier method.The best model generated five distinct phenotypic classes that strongly predicted survival (p<0.0001. Eight variables were used for the latent class analysis, but a good estimate of the classification could be obtained using just two variables: site of first symptoms (bulbar or limb and time from symptom onset to diagnosis (p<0.00001.The five phenotypic classes identified using latent cluster analysis can predict prognosis. They could be used to stratify patients recruited into clinical trials and generating more homogeneous disease groups for genetic, proteomic and risk factor research.
Zarb, Francis; McEntee, Mark F; Rainford, Louise
2015-06-01
To evaluate visual grading characteristics (VGC) and ordinal regression analysis during head CT optimisation as a potential alternative to visual grading assessment (VGA), traditionally employed to score anatomical visualisation. Patient images (n = 66) were obtained using current and optimised imaging protocols from two CT suites: a 16-slice scanner at the national Maltese centre for trauma and a 64-slice scanner in a private centre. Local resident radiologists (n = 6) performed VGA followed by VGC and ordinal regression analysis. VGC alone indicated that optimised protocols had similar image quality as current protocols. Ordinal logistic regression analysis provided an in-depth evaluation, criterion by criterion allowing the selective implementation of the protocols. The local radiology review panel supported the implementation of optimised protocols for brain CT examinations (including trauma) in one centre, achieving radiation dose reductions ranging from 24 % to 36 %. In the second centre a 29 % reduction in radiation dose was achieved for follow-up cases. The combined use of VGC and ordinal logistic regression analysis led to clinical decisions being taken on the implementation of the optimised protocols. This improved method of image quality analysis provided the evidence to support imaging protocol optimisation, resulting in significant radiation dose savings. • There is need for scientifically based image quality evaluation during CT optimisation. • VGC and ordinal regression analysis in combination led to better informed clinical decisions. • VGC and ordinal regression analysis led to dose reductions without compromising diagnostic efficacy.
Regression analysis of radiological parameters in nuclear power plants
International Nuclear Information System (INIS)
Bhargava, Pradeep; Verma, R.K.; Joshi, M.L.
2003-01-01
Indian Pressurized Heavy Water Reactors (PHWRs) have now attained maturity in their operations. Indian PHWR operation started in the year 1972. At present there are 12 operating PHWRs collectively producing nearly 2400 MWe. Sufficient radiological data are available for analysis to draw inferences which may be utilised for better understanding of radiological parameters influencing the collective internal dose. Tritium is the main contributor to the occupational internal dose originating in PHWRs. An attempt has been made to establish the relationship between radiological parameters, which may be useful to draw inferences about the internal dose. Regression analysis have been done to find out the relationship, if it exist, among the following variables: A. Specific tritium activity of heavy water (Moderator and PHT) and tritium concentration in air at various work locations. B. Internal collective occupational dose and tritium release to environment through air route. C. Specific tritium activity of heavy water (Moderator and PHT) and collective internal occupational dose. For this purpose multivariate regression analysis has been carried out. D. Tritium concentration in air at various work location and tritium release to environment through air route. For this purpose multivariate regression analysis has been carried out. This analysis reveals that collective internal dose has got very good correlation with the tritium activity release to the environment through air route. Whereas no correlation has been found between specific tritium activity in the heavy water systems and collective internal occupational dose. The good correlation has been found in case D and F test reveals that it is not by chance. (author)
Directory of Open Access Journals (Sweden)
Graefen M
1999-01-01
Full Text Available Die radikale Prostatektomie scheint die zur Zeit effektivste Therapie des klinisch lokalisierten Prostatakarzinoms zu sein. Dennoch liegt die Rezidivrate bei bis zu 40 % der operierten Patienten. Mit dieser Arbeit wurde anhand präoperativer Befunde ein Algorithmus entwickelt, mit welchem die Prognose des klinisch lokalisierten Prostatakarzinoms bereits vor einer operativen Therapie abgeschätzt werden kann. Hierzu wurden multiple präoperative Befunde, welche bei der Diagnose des Prostatakarzinoms erhoben werden, bezüglich ihres Einflusses auf einen PSA-Progress nach radikaler Prostatektomie geprüft. Dies erfolgte mittels einer univariaten Kaplan-Meier Analyse sowie einer multivariaten Statistik (Cox-Regression und CART-Analyse. Schwerpunkt bildete hierbei die Einbeziehung der Ergebnisse der systematischen Sextanten-Biopsie der Prostata. Alle präoperativen Befunde haben in der univariaten Kaplan-Meier Analyse einen signifikanten Einfluß auf ein PSA-Rezidiv. In der Cox-Regression hatte der Anteil an niedrigdifferenziertem Prostatakarzinom den größten Einfluß auf das Auftreten eines Tumorprogresses, gefolgt von der Anzahl der positiven Stanzen in der Biopsie und dem präoperativen PSA-Wert; alle anderen Parameter hatten keinen unabhängig signifikanten Einfluß auf den Tumorprogress. Mittels der zusätzlich durchgeführten CART Analyse konnten verschiedene Risikogruppen definiert werden, deren Rezidivrisiko bei 3 % für Patienten mit geringem Rezidivrisiko sowie 80 % für solche mit einem hohen Rezidivrisiko 2 Jahre nach der Operation betrug. Der niedrigdifferenzierte Tumoranteil hat somit den größten Einfluß auf die Prognose eines klinisch lokalisierten Prostatakarzinoms. Anhand der präsentierten CART-Analysen wurden einfach anwendbare Entscheidungsbäume entwickelt, mit denen eine Abschätzung des Therapieerfolges des klinisch lokalisierten Prostatakarzinoms bereits vor einer Operation möglich ist.
Comparison of cranial sex determination by discriminant analysis and logistic regression.
Amores-Ampuero, Anabel; Alemán, Inmaculada
2016-04-05
Various methods have been proposed for estimating dimorphism. The objective of this study was to compare sex determination results from cranial measurements using discriminant analysis or logistic regression. The study sample comprised 130 individuals (70 males) of known sex, age, and cause of death from San José cemetery in Granada (Spain). Measurements of 19 neurocranial dimensions and 11 splanchnocranial dimensions were subjected to discriminant analysis and logistic regression, and the percentages of correct classification were compared between the sex functions obtained with each method. The discriminant capacity of the selected variables was evaluated with a cross-validation procedure. The percentage accuracy with discriminant analysis was 78.2% for the neurocranium (82.4% in females and 74.6% in males) and 73.7% for the splanchnocranium (79.6% in females and 68.8% in males). These percentages were higher with logistic regression analysis: 85.7% for the neurocranium (in both sexes) and 94.1% for the splanchnocranium (100% in females and 91.7% in males).
Regression Analysis: Instructional Resource for Cost/Managerial Accounting
Stout, David E.
2015-01-01
This paper describes a classroom-tested instructional resource, grounded in principles of active learning and a constructivism, that embraces two primary objectives: "demystify" for accounting students technical material from statistics regarding ordinary least-squares (OLS) regression analysis--material that students may find obscure or…
Adamkowski, A.; Krzemianowski, Z.
2012-11-01
The paper presents experiences gathered during many years of utilizing the current-meter and pressure-time methods for flow rate measurements in many hydropower plants. The integration techniques used in these both methods are different from the recommendations contained in the relevant international standards, mainly from the graphical and arithmetical ones. The results of the comparative analysis of both methods applied at the same time during the hydraulic performance tests of two Kaplan turbines in one of the Polish hydropower plant are presented in the final part of the paper. In the case of the pressure-time method application, the concrete penstocks of the tested turbines required installing a special measuring instrumentation inside the penstock. The comparison has shown a satisfactory agreement between the results of discharge measurements executed using the both considered methods. Maximum differences between the discharge values have not exceeded 1.0 % and the average differences have not been greater than 0.5 %.
International Nuclear Information System (INIS)
Adamkowski, A; Krzemianowski, Z
2012-01-01
The paper presents experiences gathered during many years of utilizing the current-meter and pressure-time methods for flow rate measurements in many hydropower plants. The integration techniques used in these both methods are different from the recommendations contained in the relevant international standards, mainly from the graphical and arithmetical ones. The results of the comparative analysis of both methods applied at the same time during the hydraulic performance tests of two Kaplan turbines in one of the Polish hydropower plant are presented in the final part of the paper. In the case of the pressure-time method application, the concrete penstocks of the tested turbines required installing a special measuring instrumentation inside the penstock. The comparison has shown a satisfactory agreement between the results of discharge measurements executed using the both considered methods. Maximum differences between the discharge values have not exceeded 1.0 % and the average differences have not been greater than 0.5 %.
Feng, Huan; Zhang, Wei; Li, Jiajun; Lu, Xiaozhe
2015-01-01
To compare the pathological features and long-term survival of bladder cancer (BCa) in young patients with elderly counterparts. Using the U.S. National Cancer Institute's Surveillance, Epidemiology, and End Results (SEER) population-based data, we identified 93115 patients with non-metastatic bladder cancer diagnosed between 1988 and 2003. Patients were categorized into young (50 years and under) and elderly groups (over 50 years of age). The overall and five-year bladder cancer specific survival (BCSS) data were obtained using Kaplan-Meier plots. Multivariable Cox regression models were built for the analysis of long-term survival outcomes and risk factors. There were significant differences between the two groups in primary site, pathologic grading, histologic type, AJCC stage (pstage patients. The study findings show different patterns in the prognostic value of age for determining BCSS, depending on the tumor stages. Compared with elderly patients, young patients with bladder cancer surgery appear to have unique characteristics and a higher overall and cancer specific survival rate.
DEFF Research Database (Denmark)
Birkbak, Nicolai Juul; Kochupurakkal, Bose; Gonzalez-Izarzugaza, Jose Maria
2013-01-01
drugs and relative to non-mutation carriers present a favorable clinical outcome following therapy. Genome sequencing studies have shown a high number of mutations in the tumor genome in patients carrying BRCA1 or BRCA2 mutations (mBRCA). The present study used exome-sequencing and SNP 6 array data...... between low Nmut and shorter PFS and OS in mBRCA HGSOC by Cox regression and Kaplan-Meier analyses. The association was also significant when the analysis was limited to germline BRCA1 or BRCA2 mutated patients with SNP array-determined loss of heterozygosity of the BRCA1 or BRCA2 locus in the tumors....... In the mBRCA HGSOC tumors, Nmut was correlated with the genome fraction with loss of heterozygosity and with number of telomeric allelic imbalance, genomic measures evaluating chromosomal instability. However, no significant association between Nmut and PFS or OS was found in HGSOC carrying wild-type BRCA1...
Colman, Ian; Kingsbury, Mila; Weeks, Murray; Ataullahjan, Anushka; Bélair, Marc-André; Dykxhoorn, Jennifer; Hynes, Katie; Loro, Alexandra; Martin, Michael S; Naicker, Kiyuri; Pollock, Nathaniel; Rusu, Corneliu; Kirkbride, James B
2014-12-16
To assess the risk of on-screen death of important characters in children's animated films versus dramatic films for adults. Kaplan-Meier survival analysis with Cox regression comparing time to first on-screen death. Authors' television screens, with and without popcorn. Important characters in 45 top grossing children's animated films and a comparison group of 90 top grossing dramatic films for adults. Time to first on-screen death. Important characters in children's animated films were at an increased risk of death compared with characters in dramatic films for adults (hazard ratio 2.52, 95% confidence interval 1.30 to 4.90). Risk of on-screen murder of important characters was higher in children's animated films than in comparison films (2.78, 1.02 to 7.58). Rather than being the innocuous form of entertainment they are assumed to be, children's animated films are rife with on-screen death and murder. © Colman et al 2014.
Kingsbury, Mila; Weeks, Murray; Ataullahjan, Anushka; Bélair, Marc-André; Dykxhoorn, Jennifer; Hynes, Katie; Loro, Alexandra; Martin, Michael S; Naicker, Kiyuri; Pollock, Nathaniel; Rusu, Corneliu; Kirkbride, James B
2014-01-01
Objectives To assess the risk of on-screen death of important characters in children’s animated films versus dramatic films for adults. Design Kaplan-Meier survival analysis with Cox regression comparing time to first on-screen death. Setting Authors’ television screens, with and without popcorn. Participants Important characters in 45 top grossing children’s animated films and a comparison group of 90 top grossing dramatic films for adults. Main outcome measures Time to first on-screen death. Results Important characters in children’s animated films were at an increased risk of death compared with characters in dramatic films for adults (hazard ratio 2.52, 95% confidence interval 1.30 to 4.90). Risk of on-screen murder of important characters was higher in children’s animated films than in comparison films (2.78, 1.02 to 7.58). Conclusions Rather than being the innocuous form of entertainment they are assumed to be, children’s animated films are rife with on-screen death and murder. PMID:25515715
Jin, Haojie; Zhang, Yurong; You, Haiyan; Tao, Xuemei; Wang, Cun; Jin, Guangzhi; Wang, Ning; Ruan, Haoyu; Gu, Dishui; Huo, Xisong; Cong, Wenming; Qin, Wenxin
2015-06-23
Kynurenine 3-monooxygenase (KMO) is a pivotal enzyme in the kynurenine pathway of tryptophan degradation and plays a critical role in Huntington's and Alzheimer's diseases. This study aimed to examine the expression of KMO in human hepatocellular carcinoma (HCC) and investigate the relationship between its expression and prognosis of HCC patients. We first analyzed KMO expression in 120 paired HCC samples (HCC tissues vs matched adjacent non-cancerous liver tissues), and 205 clinical HCC specimens using immunohistochemistry (IHC). Kaplan-Meier survival and Cox regression analyses were executed to evaluate the prognosis of HCC. The results of IHC analysis showed that KMO expression was significantly higher in HCC tissues than that in normal liver tissues (all p KMO was an independent prognostic factor for overall survival (OS) and time to recurrence (TTR) (both pKMO positively regulated proliferation, migration, and invasion of HCC cells. These results suggest that KMO exhibits tumor-promoting effects towards HCC and it may serve as a novel prognostic marker in HCC.
High mortality risk among individuals assumed to be TB-negative can be predicted using a simple test
DEFF Research Database (Denmark)
Rabna, Paulo; Andersen, Andreas; Wejse, Christian
2009-01-01
1007 aTBneg individuals who were enrolled from 2004 to 2006; 4983 age-matched controls were followed for comparison. Plasma suPAR levels were measured using the suPARnostic ELISA. Survival was analysed using Cox regression, ROC curves and Kaplan-Meier analysis. RESULTS: After 3 months of follow......-up, mortality was 21 per 100 person-year-observation (PYO) among aTBneg individuals and three per 100 PYO among the control population [mortality rate ratio (MRR) = 6.92 (95% CI 4.48-10.7)]. SuPAR values ranged between 0.9 and 45 ng/ml in aTBneg individuals. A log-linear relationship was found between su......PAR levels linear range, a 1 ng/ml increase was associated with a 46% increase in the mortality rate: MRR = 1.46 (95% CI 1.34-1.59). The area under the ROC curves was 0.88 for HIV-positive individuals and 0.79 for HIV-negative individuals. CONCLUSIONS: Our study showed...
Censoring: a new approach for detection limits in total-reflection X-ray fluorescence
International Nuclear Information System (INIS)
Pajek, M.; Kubala-Kukus, A.; Braziewicz, J.
2004-01-01
It is shown that the detection limits in the total-reflection X-ray fluorescence (TXRF), which restrict quantification of very low concentrations of trace elements in the samples, can be accounted for using the statistical concept of censoring. We demonstrate that the incomplete TXRF measurements containing the so-called 'nondetects', i.e. the non-measured concentrations falling below the detection limits and represented by the estimated detection limit values, can be viewed as the left random-censored data, which can be further analyzed using the Kaplan-Meier (KM) method correcting for nondetects. Within this approach, which uses the Kaplan-Meier product-limit estimator to obtain the cumulative distribution function corrected for the nondetects, the mean value and median of the detection limit censored concentrations can be estimated in a non-parametric way. The Monte Carlo simulations performed show that the Kaplan-Meier approach yields highly accurate estimates for the mean and median concentrations, being within a few percent with respect to the simulated, uncensored data. This means that the uncertainties of KM estimated mean value and median are limited in fact only by the number of studied samples and not by the applied correction procedure for nondetects itself. On the other hand, it is observed that, in case when the concentration of a given element is not measured in all the samples, simple approaches to estimate a mean concentration value from the data yield erroneous, systematically biased results. The discussed random-left censoring approach was applied to analyze the TXRF detection-limit-censored concentration measurements of trace elements in biomedical samples. We emphasize that the Kaplan-Meier approach allows one to estimate the mean concentrations being substantially below the mean level of detection limits. Consequently, this approach gives a new access to lower the effective detection limits for TXRF method, which is of prime interest for
Robust Mediation Analysis Based on Median Regression
Yuan, Ying; MacKinnon, David P.
2014-01-01
Mediation analysis has many applications in psychology and the social sciences. The most prevalent methods typically assume that the error distribution is normal and homoscedastic. However, this assumption may rarely be met in practice, which can affect the validity of the mediation analysis. To address this problem, we propose robust mediation analysis based on median regression. Our approach is robust to various departures from the assumption of homoscedasticity and normality, including heavy-tailed, skewed, contaminated, and heteroscedastic distributions. Simulation studies show that under these circumstances, the proposed method is more efficient and powerful than standard mediation analysis. We further extend the proposed robust method to multilevel mediation analysis, and demonstrate through simulation studies that the new approach outperforms the standard multilevel mediation analysis. We illustrate the proposed method using data from a program designed to increase reemployment and enhance mental health of job seekers. PMID:24079925
Directory of Open Access Journals (Sweden)
Marcia Regina Gianotti Franco
Full Text Available Abstract Introduction: Data on impact of high body mass index (BMI on mortality of patients on peritoneal dialysis (PD, especially among elderly, are inconsistent. Objective: To evaluate impact of BMI on cohort of incident elderly PD patients over time. Methods: Prospective multicenter cohort study (December / 2004-October/2007 with 674 patients. Socio-demographic and clinical data evaluated with patients followed until death, transfer to hemodialysis (HD, recovery of renal function, loss of follow-up or transplant. Patients were divided into incident on renal replacement therapy (RRT for PD (PD first: 230 and transferred from hemodialysis (HD first: 444. Analysis was performed comparing these two groups using chi-square or Kruskal Wallis. Similar analysis was used to compare patients on automated peritoneal dialysis (APD vs. continuous ambulatory peritoneal dialysis (CAPD. Data were compared between patients according to BMI by ANOVA, Kruskal Wallis or chi-square. For analysis of survival, Kaplan Meier method was used and to adjust confounding variables, Cox regression proportional hazard. Joint model for longitudinal and time-dependent data was conducted, assessing impact that a longitudinal variable displays on time of survival. Results: Malnourished patients (76.79 ± 7.53 years were older (p < 0.0001 with higher percentage of death (44.6%, p = 0.001; diabetes mellitus showed high prevalence in obese patients (68%, p < 0.0001; higher blood pressure levels (p = 0.002 were present in obese and overweight patients. Conclusions: Increased BMI variation over time proved to be a protective factor, with a decrease of about 1% in risk of death for every BMI unit earned.
Krishan, Kewal; Kanchan, Tanuj; Sharma, Abhilasha
2012-05-01
Estimation of stature is an important parameter in identification of human remains in forensic examinations. The present study is aimed to compare the reliability and accuracy of stature estimation and to demonstrate the variability in estimated stature and actual stature using multiplication factor and regression analysis methods. The study is based on a sample of 246 subjects (123 males and 123 females) from North India aged between 17 and 20 years. Four anthropometric measurements; hand length, hand breadth, foot length and foot breadth taken on the left side in each subject were included in the study. Stature was measured using standard anthropometric techniques. Multiplication factors were calculated and linear regression models were derived for estimation of stature from hand and foot dimensions. Derived multiplication factors and regression formula were applied to the hand and foot measurements in the study sample. The estimated stature from the multiplication factors and regression analysis was compared with the actual stature to find the error in estimated stature. The results indicate that the range of error in estimation of stature from regression analysis method is less than that of multiplication factor method thus, confirming that the regression analysis method is better than multiplication factor analysis in stature estimation. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.
Directory of Open Access Journals (Sweden)
Silvana de Araújo SILVA
2015-04-01
Full Text Available The identification of predictors for the progression of chronic Chagas cardiomyopathy (CCC is essential to ensure adequate patient management. This study looked into a non-concurrent cohort of 165 CCC patients between 1985 and 2010 for independent predictors for CCC progression. The outcomes were worsening of the CCC scores and the onset of left ventricular dysfunction assessed by means of echo-Doppler cardiography. Patients were analyzed for social, demographic, epidemiologic, clinical and workup-related variables. A descriptive analysis was conducted, followed by survival curves based on univariate (Kaplan-Meier and Cox’s univariate model and multivariate (Cox regression model analysis. Patients were followed from two to 20 years (mean: 8.2. Their mean age was 44.8 years (20-77. Comparing both iterations of the study, in the second there was a statistically significant increase in the PR interval and in the QRS duration, despite a reduction in heart rates (Wilcoxon < 0.01. The predictors for CCC progression in the final regression model were male gender (HR = 2.81, Holter monitoring showing pauses equal to or greater than two seconds (HR = 3.02 increased cardiothoracic ratio (HR = 7.87 and time of use of digitalis (HR = 1.41. Patients with multiple predictive factors require stricter follow-up and treatment.
A comparative study of multiple regression analysis and back ...
Indian Academy of Sciences (India)
Abhijit Sarkar
artificial neural network (ANN) models to predict weld bead geometry and HAZ width in submerged arc welding ... Keywords. Submerged arc welding (SAW); multi-regression analysis (MRA); artificial neural network ..... Degree of freedom.
Directory of Open Access Journals (Sweden)
Deyan Davidov
2014-12-01
Full Text Available Objective: The aim of this study was to evaluate elevated platelet count as a prognostic factor for survival in patients with advanced (stage IIIB/ IV non- small cell lung cancer (NSCLC receiving first- line chemotherapy. Methods: From 2005 to 2009 three hundreds forty seven consecutive patients with stage IIIB or IV NSCLC, treated in Department of Medical Oncology, UMHAT "Dr Georgi Stranski" entered the study. The therapeutic regimens included intravenous administration of platinum- based doublets. Survival analysis was evaluated by Kaplan- Meier test. The influence of pretreatment thrombocytosis as prognostic factor for survival was analyzed using multivariate stepwise Cox regression analyses. Results: Elevated platelet counts were found in 78 patients. The overall survival for patients without elevated platelet counts was 9,6 months versus 6,9 months for these with thrombocytosis. In multivariate analysis as independent poor prognostic factors were identified: stage, performance status and elevated platelet counts. Conclusions: These results indicated that platelet counts as well as some clinical pathologic characteristics could be useful prognostic factors in patients with unresectable NSCLC.
Reilly, J T; Snowden, J A; Spearing, R L; Fitzgerald, P M; Jones, N; Watmore, A; Potter, A
1997-07-01
The prognostic significance of cytogenetic abnormalities was determined in 106 patients with well-characterized idiopathic myelofibrosis who were successfully karyotyped at diagnosis. 35% of the cases exhibited a clonal abnormality (37/106), whereas 65% (69/106) had a normal karyotype. Three characteristic defects, namely del(13q) (nine cases), del(20q) (eight cases) and partial trisomy 1q (seven cases), were present in 64.8% (24/37) of patients with clonal abnormalities. Kaplan-Meier plots and log rank analysis demonstrated an abnormal karyotype to be an adverse prognostic variable (P 10.3 x 10(9)/l; P=0.06) were also associated with a shorter survival. In contrast, sex, spleen and liver size, and percentage blast cells were not found to be significant. Multivariate analysis, using Cox's regression, revealed karyotype, haemoglobin concentration, platelet and leucocyte counts to retain their unfavourable prognostic significance. A simple and useful schema for predicting survival in idiopathic myelofibrosis has been produced by combining age, haemoglobin concentration and karyotype with median survival times varying from 180 months (good-risk group) to 16 months (poor-risk group).
Adalimumab Dose Tapering in Psoriasis: Predictive Factors for Maintenance of Complete Clearance.
Hansel, Katharina; Bianchi, Leonardo; Lanza, Francesco; Bini, Vittorio; Stingeni, Luca
2017-03-10
Psoriasis can be managed successfully with long-term biologics. Real-life clinical practice may require dose tapering as a therapeutic option to reduce the risk of drug-exposure and to increase cost-effectiveness. The responsiveness to extended intervals between adalimumab doses and the possible predictive factors of maintenance of complete clearance were studied in a retrospective 7-year single-centre analysis. Thirty patients who achieved complete clearance with adalimumab underwent dose tapering, progressively extending between-dose intervals (to 21-28 days). Sixty percent of subjects (group A) maintained complete clearance, whereas 40.0% (group B) relapsed and were switched back to the standard dosage to re-achieve complete clearance. Body mass index (BMI) and time to achieve Psoriasis Area Severity Index (PASI-100) with adalimumab standard treatment before dose tapering were significantly lower in group A than in group B (multi-variate Cox regression: p < 0.05, Kaplan-Meier analysis: p < 0.001, respectively). This study suggests that patients with lower BMI and shorter time to achieve PASI-100 with adalimumab standard dose were significantly more likely to be candidates for dose tapering.
Cardiovascular Risk Factors and 5-year Mortality in the Copenhagen Stroke Study
DEFF Research Database (Denmark)
Kammersgaard, Lars Peter; Olsen, Tom Skyhøj
2005-01-01
population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...
Cardiovascular risk factors and 5-year mortality in the Copenhagen Stroke Study
DEFF Research Database (Denmark)
Kammersgaard, Lars Peter; Olsen, Tom Skyhøj
2005-01-01
population. METHODS: We studied 905 ischemic stroke patients from the community-based Copenhagen Stroke Study. Patients had a CT scan and stroke severity was measured by the Scandinavian Stroke Scale on admission. A comprehensive evaluation was performed by a standardized medical examination...... and questionnaire for cardiovascular risk factors, age, and sex. Follow-up was performed 5 years after stroke, and data on mortality were obtained for all, except 6, who had left the country. Five-year mortality was calculated by the Kaplan-Meier procedure and the influence of multiple predictors was analyzed...... by Cox proportional hazards analyses adjusted for age, gender, stroke severity, and risk factor profile. RESULTS: In Kaplan-Meier analyses atrial fibrillation (AF), ischemic heart disease, diabetes, and previous stroke were associated with increased mortality, while smoking and alcohol intake were...
Multilayer perceptron for robust nonlinear interval regression analysis using genetic algorithms.
Hu, Yi-Chung
2014-01-01
On the basis of fuzzy regression, computational models in intelligence such as neural networks have the capability to be applied to nonlinear interval regression analysis for dealing with uncertain and imprecise data. When training data are not contaminated by outliers, computational models perform well by including almost all given training data in the data interval. Nevertheless, since training data are often corrupted by outliers, robust learning algorithms employed to resist outliers for interval regression analysis have been an interesting area of research. Several approaches involving computational intelligence are effective for resisting outliers, but the required parameters for these approaches are related to whether the collected data contain outliers or not. Since it seems difficult to prespecify the degree of contamination beforehand, this paper uses multilayer perceptron to construct the robust nonlinear interval regression model using the genetic algorithm. Outliers beyond or beneath the data interval will impose slight effect on the determination of data interval. Simulation results demonstrate that the proposed method performs well for contaminated datasets.
Directory of Open Access Journals (Sweden)
Ju-Chuan Yen
2015-01-01
Full Text Available We use Taiwanese national health insurance research database (NHIRD to investigate whether thrombolism (carotid artery disease (CAD as a surrogate or embolism (atrial fibrillation (AF as a surrogate plays roles in later retinal artery occlusion (RAO development and examine their relative weights. The relative risks of RAO between AF and CAD patients and controls were compared by estimating the crude hazard ratio with logistic regression. Kaplan-Meier analysis was used to calculate the cumulative incidence rates of developing RAO, and a log-rank test was used to analyze the differences between the survival curves. Separate Cox proportional hazard regressions were done to compute the RAO-free rate after adjusting for possible confounding factors such as age and sex. The crude hazard ratios were 7.98 for the AF group and 5.27 for the CAD group, and the adjusted hazard ratios were 8.32 and 5.34 for the AF and CAD groups, respectively. The observation time with RAO-free was shorter for AF compared with CAD group (1490 versus 1819 days. AF and CAD were both risk factors for RAO with different hazard ratios. To tackle both AF and CAD is crucial for curbing RAO.
Exploratory regression analysis: a tool for selecting models and determining predictor importance.
Braun, Michael T; Oswald, Frederick L
2011-06-01
Linear regression analysis is one of the most important tools in a researcher's toolbox for creating and testing predictive models. Although linear regression analysis indicates how strongly a set of predictor variables, taken together, will predict a relevant criterion (i.e., the multiple R), the analysis cannot indicate which predictors are the most important. Although there is no definitive or unambiguous method for establishing predictor variable importance, there are several accepted methods. This article reviews those methods for establishing predictor importance and provides a program (in Excel) for implementing them (available for direct download at http://dl.dropbox.com/u/2480715/ERA.xlsm?dl=1) . The program investigates all 2(p) - 1 submodels and produces several indices of predictor importance. This exploratory approach to linear regression, similar to other exploratory data analysis techniques, has the potential to yield both theoretical and practical benefits.
Regression analysis for LED color detection of visual-MIMO system
Banik, Partha Pratim; Saha, Rappy; Kim, Ki-Doo
2018-04-01
Color detection from a light emitting diode (LED) array using a smartphone camera is very difficult in a visual multiple-input multiple-output (visual-MIMO) system. In this paper, we propose a method to determine the LED color using a smartphone camera by applying regression analysis. We employ a multivariate regression model to identify the LED color. After taking a picture of an LED array, we select the LED array region, and detect the LED using an image processing algorithm. We then apply the k-means clustering algorithm to determine the number of potential colors for feature extraction of each LED. Finally, we apply the multivariate regression model to predict the color of the transmitted LEDs. In this paper, we show our results for three types of environmental light condition: room environmental light, low environmental light (560 lux), and strong environmental light (2450 lux). We compare the results of our proposed algorithm from the analysis of training and test R-Square (%) values, percentage of closeness of transmitted and predicted colors, and we also mention about the number of distorted test data points from the analysis of distortion bar graph in CIE1931 color space.
Energy Technology Data Exchange (ETDEWEB)
Deng, Yangyang; Parajuli, Prem B.
2011-08-10
Evaluation of economic feasibility of a bio-gasification facility needs understanding of its unit cost under different production capacities. The objective of this study was to evaluate the unit cost of syngas production at capacities from 60 through 1800Nm 3/h using an economic model with three regression analysis techniques (simple regression, reciprocal regression, and log-log regression). The preliminary result of this study showed that reciprocal regression analysis technique had the best fit curve between per unit cost and production capacity, with sum of error squares (SES) lower than 0.001 and coefficient of determination of (R 2) 0.996. The regression analysis techniques determined the minimum unit cost of syngas production for micro-scale bio-gasification facilities of $0.052/Nm 3, under the capacity of 2,880 Nm 3/h. The results of this study suggest that to reduce cost, facilities should run at a high production capacity. In addition, the contribution of this technique could be the new categorical criterion to evaluate micro-scale bio-gasification facility from the perspective of economic analysis.
Nested Cohort - R software package
NestedCohort is an R software package for fitting Kaplan-Meier and Cox Models to estimate standardized survival and attributable risks for studies where covariates of interest are observed on only a sample of the cohort.
A primer for biomedical scientists on how to execute model II linear regression analysis.
Ludbrook, John
2012-04-01
1. There are two very different ways of executing linear regression analysis. One is Model I, when the x-values are fixed by the experimenter. The other is Model II, in which the x-values are free to vary and are subject to error. 2. I have received numerous complaints from biomedical scientists that they have great difficulty in executing Model II linear regression analysis. This may explain the results of a Google Scholar search, which showed that the authors of articles in journals of physiology, pharmacology and biochemistry rarely use Model II regression analysis. 3. I repeat my previous arguments in favour of using least products linear regression analysis for Model II regressions. I review three methods for executing ordinary least products (OLP) and weighted least products (WLP) regression analysis: (i) scientific calculator and/or computer spreadsheet; (ii) specific purpose computer programs; and (iii) general purpose computer programs. 4. Using a scientific calculator and/or computer spreadsheet, it is easy to obtain correct values for OLP slope and intercept, but the corresponding 95% confidence intervals (CI) are inaccurate. 5. Using specific purpose computer programs, the freeware computer program smatr gives the correct OLP regression coefficients and obtains 95% CI by bootstrapping. In addition, smatr can be used to compare the slopes of OLP lines. 6. When using general purpose computer programs, I recommend the commercial programs systat and Statistica for those who regularly undertake linear regression analysis and I give step-by-step instructions in the Supplementary Information as to how to use loss functions. © 2011 The Author. Clinical and Experimental Pharmacology and Physiology. © 2011 Blackwell Publishing Asia Pty Ltd.
DEFF Research Database (Denmark)
Lange, Jeppe; Troelsen, Anders; Solgaard, Søren
2018-01-01
was re-revision performed due to infection and was evaluated by competing risk analysis, with death and aseptic revision as competing events. All-cause mortality was evaluated by Kaplan-Meier survival analysis. Oxford Hip Score (OHS) was used as disease-specific patient-reported outcome measure. RESULTS......BACKGROUND: Cementless 1-stage revision in chronic periprosthetic hip joint infections is limited evaluated. The purpose of this study was to evaluate a specific treatment protocol in this patient group. METHODS: The study was performed as a multicenter, proof-of-concept, observational study...
DEFF Research Database (Denmark)
Pantalone, Gaetano Restivo; Maggio, Aurelio; Vitrano, Angela
2011-01-01
In β-thalassemia major (β-TM) patients, iron chelation therapy is mandatory to reduce iron overload secondary to transfusions. Recommended first line treatment is deferoxamine (DFO) from the age of 2 and second line treatment after the age of 6 is deferiprone (L1). A multicenter randomized open...... thalassemia patients were randomized and underwent intention-to-treat analysis. Statistically, a decrease of serum ferritin level was significantly higher in alternating sequential L1-DFO patients compared with L1 alone patients (p = 0.005). Kaplan-Meier survival analysis for the two chelation treatments did...
Parsons, Vickie s.
2009-01-01
The request to conduct an independent review of regression models, developed for determining the expected Launch Commit Criteria (LCC) External Tank (ET)-04 cycle count for the Space Shuttle ET tanking process, was submitted to the NASA Engineering and Safety Center NESC on September 20, 2005. The NESC team performed an independent review of regression models documented in Prepress Regression Analysis, Tom Clark and Angela Krenn, 10/27/05. This consultation consisted of a peer review by statistical experts of the proposed regression models provided in the Prepress Regression Analysis. This document is the consultation's final report.
Tutorial on Biostatistics: Linear Regression Analysis of Continuous Correlated Eye Data.
Ying, Gui-Shuang; Maguire, Maureen G; Glynn, Robert; Rosner, Bernard
2017-04-01
To describe and demonstrate appropriate linear regression methods for analyzing correlated continuous eye data. We describe several approaches to regression analysis involving both eyes, including mixed effects and marginal models under various covariance structures to account for inter-eye correlation. We demonstrate, with SAS statistical software, applications in a study comparing baseline refractive error between one eye with choroidal neovascularization (CNV) and the unaffected fellow eye, and in a study determining factors associated with visual field in the elderly. When refractive error from both eyes were analyzed with standard linear regression without accounting for inter-eye correlation (adjusting for demographic and ocular covariates), the difference between eyes with CNV and fellow eyes was 0.15 diopters (D; 95% confidence interval, CI -0.03 to 0.32D, p = 0.10). Using a mixed effects model or a marginal model, the estimated difference was the same but with narrower 95% CI (0.01 to 0.28D, p = 0.03). Standard regression for visual field data from both eyes provided biased estimates of standard error (generally underestimated) and smaller p-values, while analysis of the worse eye provided larger p-values than mixed effects models and marginal models. In research involving both eyes, ignoring inter-eye correlation can lead to invalid inferences. Analysis using only right or left eyes is valid, but decreases power. Worse-eye analysis can provide less power and biased estimates of effect. Mixed effects or marginal models using the eye as the unit of analysis should be used to appropriately account for inter-eye correlation and maximize power and precision.
Non-stationary hydrologic frequency analysis using B-spline quantile regression
Nasri, B.; Bouezmarni, T.; St-Hilaire, A.; Ouarda, T. B. M. J.
2017-11-01
Hydrologic frequency analysis is commonly used by engineers and hydrologists to provide the basic information on planning, design and management of hydraulic and water resources systems under the assumption of stationarity. However, with increasing evidence of climate change, it is possible that the assumption of stationarity, which is prerequisite for traditional frequency analysis and hence, the results of conventional analysis would become questionable. In this study, we consider a framework for frequency analysis of extremes based on B-Spline quantile regression which allows to model data in the presence of non-stationarity and/or dependence on covariates with linear and non-linear dependence. A Markov Chain Monte Carlo (MCMC) algorithm was used to estimate quantiles and their posterior distributions. A coefficient of determination and Bayesian information criterion (BIC) for quantile regression are used in order to select the best model, i.e. for each quantile, we choose the degree and number of knots of the adequate B-spline quantile regression model. The method is applied to annual maximum and minimum streamflow records in Ontario, Canada. Climate indices are considered to describe the non-stationarity in the variable of interest and to estimate the quantiles in this case. The results show large differences between the non-stationary quantiles and their stationary equivalents for an annual maximum and minimum discharge with high annual non-exceedance probabilities.
Post, Carl M; Lin, Chi; Adeberg, Sebastian; Gupta, Mrigank; Zhen, Weining; Verma, Vivek
2018-03-01
The standard of care for T1N0 nasopharyngeal cancer (NPC) is definitive radiation therapy (RT). However, practice patterns in the elderly may not necessarily follow national guidelines. Herein, we investigated national practice patterns for T1N0 NPC. The National Cancer Data Base (NCDB) was queried for clinical T1N0 primary NPC cases (2004-2013) in patients ≥70 years old. Patient, tumor, and treatment parameters were extracted. Kaplan-Meier analysis was used to compare overall survival (OS) between patients receiving RT versus those under observation. Logistic regression was used to examine variables associated with receipt of RT. Cox proportional hazards modeling determined variables associated with OS. Landmark analysis of patients surviving 1 year or more was performed to assess survival differences between groups. In total, data of 147 patients were analyzed. RT was delivered to 89 patients (61%), whereas 58 (39%) patients underwent observation. On multivariable analysis, older patients were less likely to receive RT (p=0.003), but there were no differences between groups in terms of Charlson-Deyo comorbidity index. Median and 5-year OS in patients receiving RT versus those under observation were 71 and 33 months, and 59% and 48% (p=0.011), respectively. For patients surviving 1 year or more (n=96), there was a strong trend showing that receipt of RT was associated with better median and 5-year OS. This National Data Base analysis shows that observation is relatively common for T1N0 NPC in the elderly, but is associated with poorer survival. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Dave, Anushree
2017-12-01
This is a review of Patrick Meier's 2015 book, Digital Humanitarians: How Big Data Is Changing the Face of Humanitarian Response. The book explores the role of technologies such as high-resolution satellite imagery, online social media, drones, and artificial intelligence in humanitarian responses during disasters such as the 2010 Haiti earthquake. In this analysis, the book is examined using a humanitarian health ethics perspective.
Schein, Jeffrey; Caplan, Eric
2014-01-01
The thoughts of Mordecai Kaplan and Michael Rosenak present surprising commonalities as well as illuminating differences. Similarities include the perception that Judaism and Jewish education are in crisis, the belief that Jewish peoplehood must include commitment to meaningful content, the need for teachers to teach from a position of…
Energy Technology Data Exchange (ETDEWEB)
Kim, Yi Jun; Lee, Kyung Ja; Park, Kyung Ran [Dept. of Radiation Oncology, (Korea, Republic of); and others
2015-06-15
To analyze prognostic factors for locoregional recurrence (LRR), distant metastasis (DM), and overall survival (OS) in cervical cancer patients who underwent radical hysterectomy followed by postoperative radiotherapy (PORT) in a single institute. Clinicopathologic data of 135 patients with clinical stage IA2 to IIA2 cervical cancer treated with PORT from 2001 to 2012 were reviewed, retrospectively. Postoperative parametrial resection margin (PRM) and vaginal resection margin (VRM) were investigated separately. The median treatment dosage of external beam radiotherapy (EBRT) to the whole pelvis was 50.4 Gy in 1.8 Gy/fraction. High-dose-rate vaginal brachytherapy after EBRT was given to patients with positive or close VRMs. Concurrent platinum-based chemoradiotherapy (CCRT) was administered to 73 patients with positive resection margin, lymph node (LN) metastasis, or direct extension of parametrium. Kaplan-Meier method and log-rank test were used for analyzing LRR, DM, and OS; Cox regression was applied to analyze prognostic factors. The 5-year disease-free survival was 79% and 5-year OS was 91%. In univariate analysis, positive or close PRM, LN metastasis, direct extension of parametrium, lymphovascular invasion, histology of adenocarcinoma, and chemotherapy were related with more DM and poor OS. In multivariate analysis, PRM and LN metastasis remained independent prognostic factors for OS. PORT after radical hysterectomy in uterine cervical cancer showed excellent OS in this study. Positive or close PRM after radical hysterectomy in uterine cervical cancer correlates with poor prognosis even with CCRT. Therefore, additional treatments to improve local control such as radiation boosting need to be considered.
Alternative Methods of Regression
Birkes, David
2011-01-01
Of related interest. Nonlinear Regression Analysis and its Applications Douglas M. Bates and Donald G. Watts ".an extraordinary presentation of concepts and methods concerning the use and analysis of nonlinear regression models.highly recommend[ed].for anyone needing to use and/or understand issues concerning the analysis of nonlinear regression models." --Technometrics This book provides a balance between theory and practice supported by extensive displays of instructive geometrical constructs. Numerous in-depth case studies illustrate the use of nonlinear regression analysis--with all data s
ORIGINAL ARTICLES Antiretroviral treatment for children
African Journals Online (AJOL)
Kaplan-Meier survival estimate for 407 children at 1 year was. 84% (95% ... highly active antiretroviral therapy (HAART) to 3 million people living with HIV I AIDS in ... 5 Furthermore, improvements in growth and body composition parameters,.
Regional recurrence of oropharyngeal cancer after definitive radiotherapy: a case control study
International Nuclear Information System (INIS)
Söderström, Karin; Nilsson, Per; Dalianis, Tina; Kjellén, Elisabeth; Zackrisson, Björn
2015-01-01
Elective treatment of lymph nodes in oropharyngeal cancer (OPC) has impact on both regional recurrences (RR) and risk of late side effects. This study was performed to quantify the dose-dependent impact on RR and overall survival (OS) in a prospectively collected cohort of OPC from the ARTSCAN study with emphasis on elective treatment. ARTSCAN is a previously published prospective, randomized, multicentre study of altered radiotherapy (RT) fractionation in head and neck cancer. In ARTSCAN the elective treatment volume for node positive OPC varied significantly between centres due to local treatment principles. All patients with OPC in complete response after primary treatment were eligible for the present case–control study. Cases were patients with RR during five years follow-up. Patients with no recurrence were eligible as controls. Four controls per case were matched according to T- and N-stage. Mean (D mean ) and median (D 50% ) dose for the lymph node level (LNL) of RR in the cases and the corresponding LNL in the controls were analysed with conditional logistic regression. OS was estimated with the Kaplan-Meier method and evaluated by multivariate Cox regression analysis. There was a dose-dependent risk reduction for D 50% in the interval that represented elective treatment (40–50 Gy) (OR = 0.18, p < 0.05) and a trend in the same dose interval for D mean (OR = 0.19, p = 0.07). OS rates at five years were 0.39 (0.24-0.65) for cases and 0.70 (0.62–0.81) for controls (p < 0.001). The Kaplan-Meier and the Cox regression analysis for cases categorised by delivered dose showed an inverse relationship between dose and survival. The cases with RR in a LNL outside planning target volume (PTV) (D mean < 40 Gy) had an OS rate comparable to that of all patients, and those with RR in a LNL in PTV elective (D mean 40–60 Gy) or PTV tumour (D mean >60 Gy) did significantly worse (p < 0.05). The same inverse relationship was also shown for a small subset of patient
Ishito, Noritaka; Takamoto, Hitoshi; Kunitomi, Kimito; Satoh, Eiichi; Ishii, Ayano; Shiotuka, Youichi; Sako, Shinichi; Ohta, Naoki; Araki, Tohru
2002-11-01
ESWL is now widely used for the treatment of renal stone disease. Although ESWL has many advantages for patients' quality of life, few reports have demonstrated the long-term outcomes of the alterations of renal morphology after ESWL. We reported renal scarring after ESWL monotherapy in patients with renal calyceal stones. In this study, we evaluated a large series of patients' cohort treated at our institution, and assessed the causal effect of ESWL on the late occurrence of renal scar formation. ESWL was performed with EDAP (LT-01,02) that generates shock wave energy by piezoelectric discharge. We analyzed the records of 285 kidneys treated between Dec. 1986 and Nov. 1998. Renal scarring was noted in 44 kidneys and not in 241 kidneys with periodical ultrasonography. We compared the backgrounds of the two groups using chi-square or non-parametric analysis. The Kaplan-Meier method and Cox regression model determined the analysis of renal scar formation. Univariate and multiple regression analysis revealed that the total amount of ESWL emission and hyperuricemia independently affected the probability of renal scar formation. Over-emission of ESWL (over 10,000 shots) must be care for the prevention of renal scarring in patients with renal calyceal calculi, especially when associated with hyperuricemia. After ESWL, periodical checkups with ultrasonography will provide useful information for the clinical diagnosis of renal scarring.
Cassidy, Richard J; Liu, Yuan; Patel, Kirtesh; Zhong, Jim; Steuer, Conor E; Kooby, David A; Russell, Maria C; Gillespie, Theresa W; Landry, Jerome C
2017-03-01
Stage II and III rectal cancers have been effectively treated with neoadjuvant chemoradiotherapy (NCRT) followed by definitive resection. Advancements in surgical technique and systemic therapy have prompted investigation of neoadjuvant multiagent chemotherapy (NMAC) regimens with the elimination of radiation (RT). The objective of the current study was to investigate factors that predict for the use of NCRT versus NMAC and compare outcomes using the National Cancer Data Base (NCDB) for select stage II and III rectal cancers. In the NCDB, 21,707 patients from 2004 through 2012 with clinical T2N1 (cT2N1), cT3N0, or cT3N1 rectal cancers were identified who had received NCRT or NMAC followed by low anterior resection. Kaplan-Meier analyses, log-rank tests, and Cox-proportional hazards regression analyses were conducted along with propensity score matching analysis to reduce treatment selection bias. The 5-year actuarial overall survival (OS) rate was 75% for patients who received NCRT versus 67.2% for those who received NMAC (P elimination of neoadjuvant RT for select patients with stage II and III rectal adenocarcinoma was associated with worse OS and should not be recommended outside of a clinical trial. Cancer 2017;123:783-93. © 2016 American Cancer Society. © 2016 American Cancer Society.
On macroeconomic values investigation using fuzzy linear regression analysis
Directory of Open Access Journals (Sweden)
Richard Pospíšil
2017-06-01
Full Text Available The theoretical background for abstract formalization of the vague phenomenon of complex systems is the fuzzy set theory. In the paper, vague data is defined as specialized fuzzy sets - fuzzy numbers and there is described a fuzzy linear regression model as a fuzzy function with fuzzy numbers as vague parameters. To identify the fuzzy coefficients of the model, the genetic algorithm is used. The linear approximation of the vague function together with its possibility area is analytically and graphically expressed. A suitable application is performed in the tasks of the time series fuzzy regression analysis. The time-trend and seasonal cycles including their possibility areas are calculated and expressed. The examples are presented from the economy field, namely the time-development of unemployment, agricultural production and construction respectively between 2009 and 2011 in the Czech Republic. The results are shown in the form of the fuzzy regression models of variables of time series. For the period 2009-2011, the analysis assumptions about seasonal behaviour of variables and the relationship between them were confirmed; in 2010, the system behaved fuzzier and the relationships between the variables were vaguer, that has a lot of causes, from the different elasticity of demand, through state interventions to globalization and transnational impacts.
Survival and clinical outcome of dogs with ischaemic stroke
DEFF Research Database (Denmark)
Gredal, Hanne Birgit; Toft, Nils; Westrup, Ulrik
2013-01-01
The objectives of the present study were to investigate survival time, possible predictors of survival and clinical outcome in dogs with ischaemic stroke. A retrospective study of dogs with a previous diagnosis of ischaemic stroke diagnosed by magnetic resonance imaging (MRI) was performed....... The association between survival and the hypothesised risk factors was examined using univariable exact logistic regression. Survival was examined using Kaplan-Meier and Cox regression. Twenty-two dogs were identified. Five dogs (23%) died within the first 30days of the stroke event. Median survival in 30-day...... survivors was 505days. Four dogs (18%) were still alive by the end of the study. Right-sided lesions posed a significantly increased risk of mortality with a median survival time in dogs with right-sided lesions of 24days vs. 602days in dogs with left sided lesions (P=0.006). Clinical outcome was considered...
REGRESSION ANALYSIS OF SEA-SURFACE-TEMPERATURE PATTERNS FOR THE NORTH PACIFIC OCEAN.
SEA WATER, *SURFACE TEMPERATURE, *OCEANOGRAPHIC DATA, PACIFIC OCEAN, REGRESSION ANALYSIS , STATISTICAL ANALYSIS, UNDERWATER EQUIPMENT, DETECTION, UNDERWATER COMMUNICATIONS, DISTRIBUTION, THERMAL PROPERTIES, COMPUTERS.
Liu, Cheng-wu; Luo, Meng; Mei, Jian-dong; Zhu, Yun-ke; Pu, Qiang; Ma, Lin; Che, Guo-wei; Lin, Yi-dan; Wu, Zhu; Wang, Yun; Kou, Ying-li; Liu, Lun-xu
2013-01-01
Thymectomy is an established treatment for myasthenia gravis (MG), and video-assisted thoracoscopic surgery (VATS) thymectomy has become an acceptable surgical procedure. This study aimed to compare the results of VATS thymectomy and open thymectomy and to identify the prognostic factors after thymectomy. The clinical data of 187 consecutive thymectomies performed between July 2000 and December 2009 were retrospectively reviewed; 75 open thymectomies and 112 VATS thymectomies. Clinical efficacy and variables influencing outcome were assessed by Kaplan-Meier survival curves and Cox proportional hazards regression analysis. The operative blood loss in the VATS group was significantly less than that in the open group ((62.14 ± 55.43) ml vs. (137.87 ± 165.25) ml, P CSR) was the end point for evaluation of the treatment results. The overall five-year CSR rate was 57.5%. Two good prognostic factors were identified; preoperative prescription of anticholinesterase alone (P = 0.035) and non-thymomatous MG (P = 0.003). The five-year CSR rate of the ocular type of MG reached a high level of 67.4%. Thymectomy can achieve good long-term CSR in MG, and VATS is an ideal alternative method. High-dose prescription of anticholinesterase and the advanced stage by Myasthenia Gravis Foundation of America (MGFA) classification have higher risks of postoperative crisis. Preoperative prescription of anticholinesterase alone and non-thymomatous MG are good prognostic factors. Thymectomy should also be considered for the ocular type of MG.
International Nuclear Information System (INIS)
Liu, X; Luo, Y Y; Wang, Z W
2014-01-01
As an important component of the blade-control system in Kaplan turbines, piston rods are subjected to fluctuating forces transferred by the turbines blades from hydraulic pressure oscillations. Damage due to unsteady hydraulic loads might generate unexpected down time and high repair cost. In one running hydropower plant, the fracture failure of the piston rod was found twice at the same location. With the transient dynamic analysis, the retainer ring structure of the piston rod existed a relative high stress concentration. This predicted position of the stress concentration agreed well with the actual fracture position in the plant. However, the local strain approach was not able to explain why this position broke frequently. Since traditional structural fatigue analyses use a local stress strain approach to assess structural integrity, do not consider the effect of flaws which can significantly degrade structural life. Using linear elastic fracture mechanism (LEFM) approaches that include the effect of flaws is becoming common practice in many industries. In this research, a case involving a small semi-ellipse crack was taken into account at the stress concentration area, crack growth progress was calculated by FEM. The relationship between crack length and remaining life was obtained. The crack propagation path approximately agreed with the actual fracture section. The results showed that presence of the crack had significantly changed the local stress and strain distributions of the piston rod compared with non-flaw assumption
Liu, X.; Y Luo, Y.; Wang, Z. W.
2014-03-01
As an important component of the blade-control system in Kaplan turbines, piston rods are subjected to fluctuating forces transferred by the turbines blades from hydraulic pressure oscillations. Damage due to unsteady hydraulic loads might generate unexpected down time and high repair cost. In one running hydropower plant, the fracture failure of the piston rod was found twice at the same location. With the transient dynamic analysis, the retainer ring structure of the piston rod existed a relative high stress concentration. This predicted position of the stress concentration agreed well with the actual fracture position in the plant. However, the local strain approach was not able to explain why this position broke frequently. Since traditional structural fatigue analyses use a local stress strain approach to assess structural integrity, do not consider the effect of flaws which can significantly degrade structural life. Using linear elastic fracture mechanism (LEFM) approaches that include the effect of flaws is becoming common practice in many industries. In this research, a case involving a small semi-ellipse crack was taken into account at the stress concentration area, crack growth progress was calculated by FEM. The relationship between crack length and remaining life was obtained. The crack propagation path approximately agreed with the actual fracture section. The results showed that presence of the crack had significantly changed the local stress and strain distributions of the piston rod compared with non-flaw assumption.
Regression analysis understanding and building business and economic models using Excel
Wilson, J Holton
2012-01-01
The technique of regression analysis is used so often in business and economics today that an understanding of its use is necessary for almost everyone engaged in the field. This book will teach you the essential elements of building and understanding regression models in a business/economic context in an intuitive manner. The authors take a non-theoretical treatment that is accessible even if you have a limited statistical background. It is specifically designed to teach the correct use of regression, while advising you of its limitations and teaching about common pitfalls. This book describe
Comparison of colorectal and gastric cancer: Survival and prognostic factors
International Nuclear Information System (INIS)
Moghimi-Dehkordi, Bijan; Safaee, Azadeh; Zali, Mohammad R
2009-01-01
Gastric and colorectal cancers are the most common gastrointestinal malignancies in Iran. We aim to compare the survival rates and prognostic factors between these two cancers. We studied 1873 patients with either gastric or colorectal cancer who were registered in one referral cancer registry center in Tehran, Iran. All patients were followed from their time of diagnosis until December 2006 (as failure time). Survival curves were calculated according to the Kaplan-Meier Method and compared by the Log-rank test. Multivariate analysis of prognostic factors was carried out using the Cox proportional hazard model. Of 1873 patients, there were 746 with gastric cancer and 1138 with colorectal cancer. According to the Kaplan-Meier method 1, 3, 5, and 7-year survival rates were 71.2, 37.8, 25.3, and 19.5%, respectively, in gastric cancer patients and 91.1, 73.1, 61, and 54.9%, respectively, in patients with colorectal cancer. Also, univariate analysis showed that age at diagnosis, sex, grade of tumor, and distant metastasis were of prognostic significance in both cancers ( P < 0.0001). However, in multivariate analysis, only distant metastasis in colorectal cancer and age at diagnosis, grade of tumor, and distant metastasis in colorectal cancer were identified as independent prognostic factors influencing survival. According to our findings, survival is significantly related to histological differentiation of tumor and distant metastasis in colorectal cancer patients and only to distant metastasis in gastric cancer patients. (author)
Garcia Vicente, A M; Soriano Castrejón, A; Amo-Salas, M; Lopez Fidalgo, J F; Muñoz Sanchez, M M; Alvarez Cabellos, R; Espinosa Aunion, R; Muñoz Madero, V
2016-01-01
To explore the relationship between basal (18)F-FDG uptake in breast tumors and survival in patients with breast cancer (BC) using a molecular phenotype approach. This prospective and multicentre study included 193 women diagnosed with BC. All patients underwent an (18)F-FDG PET/CT prior to treatment. Maximum standardized uptake value (SUVmax) in tumor (T), lymph nodes (N), and the N/T index was obtained in all the cases. Metabolic stage was established. As regards biological prognostic parameters, tumors were classified into molecular sub-types and risk categories. Overall survival (OS) and disease free survival (DFS) were obtained. An analysis was performed on the relationship between semi-quantitative metabolic parameters with molecular phenotypes and risk categories. The effect of molecular sub-type and risk categories in prognosis was analyzed using Kaplan-Meier and univariate and multivariate tests. Statistical differences were found in both SUVT and SUVN, according to the molecular sub-types and risk classifications, with higher semi-quantitative values in more biologically aggressive tumors. No statistical differences were observed with respect to the N/T index. Kaplan-Meier analysis revealed that risk categories were significantly related to DFS and OS. In the multivariate analysis, metabolic stage and risk phenotype showed a significant association with DFS. High-risk phenotype category showed a worst prognosis with respect to the other categories with higher SUVmax in primary tumor and lymph nodes. Copyright © 2015 Elsevier España, S.L.U. and SEMNIM. All rights reserved.
Song, Kyung-Jin; Choi, Byung-Wan; Kim, Jong-Kil
2014-12-01
Retrospective study. To analyze the incidence and prevalence of clinical adjacent segment pathology (CASP) following anterior decompression and fusion with cage and plate augmentation for degenerative cervical diseases. No long-term data on the use of cage and plate augmentation have been reported. The study population consisted of 231 patients who underwent anterior cervical discectomy and fusion (ACDF) with cage and plate for degenerative cervical spinal disease. The incidence and prevalence of CASP was determined by using the Kaplan-Meier survival analysis. To analyze the factors that influence CASP, data on preoperative and postoperative sagittal alignment, spinal canal diameter, the distance between the plate and adjacent disc, extent of fusion level, and the presence or absence of adjacent segment degenerative changes by imaging studies were evaluated. CASP occurred in 15 of the cases, of which 9 required additional surgery. At 8-year follow-up, the average yearly incidence was 1.1%. The rate of disease-free survival based on Kaplan-Meier survival analysis was 93.6% at 5 years and 90.2% at 8 years. No statistically significant differences in CASP incidence based on radiological analysis were observed. Significantly high incidence of CASP was observed in the presence of increased adjacent segment degenerative changes (pdegenerative cervical disease is associated with a lower incidence in CSAP by 1.1% per year, and the extent of preoperative adjacent segment degenerative changes has been shown as a risk factor for CASP.
Glioblastoma: does the pre-treatment geometry matter? A postcontrast T1 MRI-based study
Energy Technology Data Exchange (ETDEWEB)
Perez-Beteta, Julian; Martinez-Gonzalez, Alicia; Molina, David; Amo-Salas, Mariano; Luque, Belen; Perez-Garcia, Victor M. [Universidad de Castilla-La Mancha, Laboratory of Mathematical Oncology, Edificio Politecnico, Instituto de Matematica Aplicada a la Ciencia y la Ingenieria, Ciudad Real (Spain); Arregui, Elena; Calvo, Manuel; Borras, Jose M.; Lopez, Carlos; Claramonte, Marta [Hospital General de Ciudad Real, Ciudad Real (Spain); Barcia, Juan A.; Iglesias, Lidia; Avecillas, Josue [Hospital Clinico San Carlos, Madrid (Spain); Albillo, David; Navarro, Miguel; Villanueva, Jose M.; Paniagua, Juan C.; Perez-Romasanta, Luis [Hospital Universitario de Salamanca, Salamanca (Spain); Martino, Juan; Velasquez, Carlos [Hospital Marques de Valdecilla, Santander (Spain); Asenjo, Beatriz; Benavides, Manuel; Herruzo, Ismael [Hospital Carlos Haya, Malaga (Spain); Delgado, Maria del Carmen; Valle, Ana del [Universidad de Sevilla, Facultad de Matematicas, Sevilla (Spain); Falkov, Anthony [Auckland Radiation Oncology, Auckland (New Zealand); Schucht, Philippe [Bern Inselspital, Neurosurgery Department, Bern (Switzerland); Arana, Estanislao [Instituto Valenciano de Oncologia, Valencia (Spain)
2017-03-15
The potential of a tumour's volumetric measures obtained from pretreatment MRI sequences of glioblastoma (GBM) patients as predictors of clinical outcome has been controversial. Mathematical models of GBM growth have suggested a relation between a tumour's geometry and its aggressiveness. A multicenter retrospective clinical study was designed to study volumetric and geometrical measures on pretreatment postcontrast T1 MRIs of 117 GBM patients. Clinical variables were collected, tumours segmented, and measures computed including: contrast enhancing (CE), necrotic, and total volumes; maximal tumour diameter; equivalent spherical CE width and several geometric measures of the CE ''rim''. The significance of the measures was studied using proportional hazards analysis and Kaplan-Meier curves. Kaplan-Meier and univariate Cox survival analysis showed that total volume [p = 0.034, Hazard ratio (HR) = 1.574], CE volume (p = 0.017, HR = 1.659), spherical rim width (p = 0.007, HR = 1.749), and geometric heterogeneity (p = 0.015, HR = 1.646) were significant parameters in terms of overall survival (OS). Multivariable Cox analysis for OS provided the later two parameters as age-adjusted predictors of OS (p = 0.043, HR = 1.536 and p = 0.032, HR = 1.570, respectively). Patients with tumours having small geometric heterogeneity and/or spherical rim widths had significantly better prognosis. These novel imaging biomarkers have a strong individual and combined prognostic value for GBM patients. (orig.)
International Nuclear Information System (INIS)
Sarrach, D.; Strohner, P.
1986-01-01
The Gauss-Newton algorithm has been used to evaluate tracer binding parameters of RIA by nonlinear regression analysis. The calculations were carried out on the K1003 desk computer. Equations for simple binding models and its derivatives are presented. The advantages of nonlinear regression analysis over linear regression are demonstrated
Regression analysis for the social sciences
Gordon, Rachel A
2010-01-01
The book provides graduate students in the social sciences with the basic skills that they need to estimate, interpret, present, and publish basic regression models using contemporary standards. Key features of the book include: interweaving the teaching of statistical concepts with examples developed for the course from publicly-available social science data or drawn from the literature. thorough integration of teaching statistical theory with teaching data processing and analysis. teaching of both SAS and Stata "side-by-side" and use of chapter exercises in which students practice programming and interpretation on the same data set and course exercises in which students can choose their own research questions and data set.
Jakubowski, J.; Stypulkowski, J. B.; Bernardeau, F. G.
2017-12-01
The first phase of the Abu Hamour drainage and storm tunnel was completed in early 2017. The 9.5 km long, 3.7 m diameter tunnel was excavated with two Earth Pressure Balance (EPB) Tunnel Boring Machines from Herrenknecht. TBM operation processes were monitored and recorded by Data Acquisition and Evaluation System. The authors coupled collected TBM drive data with available information on rock mass properties, cleansed, completed with secondary variables and aggregated by weeks and shifts. Correlations and descriptive statistics charts were examined. Multivariate Linear Regression and CART regression tree models linking TBM penetration rate (PR), penetration per revolution (PPR) and field penetration index (FPI) with TBM operational and geotechnical characteristics were performed for the conditions of the weak/soft rock of Doha. Both regression methods are interpretable and the data were screened with different computational approaches allowing enriched insight. The primary goal of the analysis was to investigate empirical relations between multiple explanatory and responding variables, to search for best subsets of explanatory variables and to evaluate the strength of linear and non-linear relations. For each of the penetration indices, a predictive model coupling both regression methods was built and validated. The resultant models appeared to be stronger than constituent ones and indicated an opportunity for more accurate and robust TBM performance predictions.
Fan, Heng; Zhu, Jian-Hua; Yao, Xue-Qing
2018-05-01
Long non-coding RNA (lncRNA) plays a very important role in the occurrence and development of various tumors, and is a potential biomarker for cancer diagnosis and prognosis. The purpose of this study was to investigate the relationship between the expression of lncRNA plasmacytoma variant translocation 1 (PVT1) and the prognostic significance in patients with colorectal cancer. The expression of PVT1 was measured by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) in cancerous and adjacent tissues of 210 colorectal cancer patients. The disease-free survival and overall survival of colorectal cancer patients were evaluated by Kaplan-Meier analysis, and univariate and multivariate analysis were performed by Cox proportional-hazards model. Our results revealed that PVT1 expression in cancer tissues of colorectal cancer was significantly higher than that of adjacent tissues ( Pcolorectal cancer patients, whether at TNM I/II stage or at TNM III/IV stage. A multivariate Cox regression analysis demonstrated that high PVT1 expression was an independent predictor of poor prognosis in colorectal cancer patients. Our results suggest that high PVT1 expression might be a potential biomarker for assessing tumor recurrence and prognosis in colorectal cancer patients.
Composite marginal quantile regression analysis for longitudinal adolescent body mass index data.
Yang, Chi-Chuan; Chen, Yi-Hau; Chang, Hsing-Yi
2017-09-20
Childhood and adolescenthood overweight or obesity, which may be quantified through the body mass index (BMI), is strongly associated with adult obesity and other health problems. Motivated by the child and adolescent behaviors in long-term evolution (CABLE) study, we are interested in individual, family, and school factors associated with marginal quantiles of longitudinal adolescent BMI values. We propose a new method for composite marginal quantile regression analysis for longitudinal outcome data, which performs marginal quantile regressions at multiple quantile levels simultaneously. The proposed method extends the quantile regression coefficient modeling method introduced by Frumento and Bottai (Biometrics 2016; 72:74-84) to longitudinal data accounting suitably for the correlation structure in longitudinal observations. A goodness-of-fit test for the proposed modeling is also developed. Simulation results show that the proposed method can be much more efficient than the analysis without taking correlation into account and the analysis performing separate quantile regressions at different quantile levels. The application to the longitudinal adolescent BMI data from the CABLE study demonstrates the practical utility of our proposal. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.
Directory of Open Access Journals (Sweden)
Rahim Tahmasebi
2010-09-01
Full Text Available Background: The objective of this study was to evaluate graft survival among the recipients of second renal transplant in Imam Khomeini centre hospital in Urmia. Methods: The study population consisted of 50 patients receiving renal grafts for the second time between 1988 and 2008 in Imam Khomeini centre hospital in Urmia. Two survival outcomes, first and second graft survival, were analyzed. Graft survival was defined from date of transplant until its rejection. For the purpose of graft survival analysis, graft failure was defined as return to dialysis, and death due to the functioning graft. Data were collected through individual patient questionnaires. Demographic and clinical factors, transfusion history, type of immunosuppressive drugs, levels of serum creatinine, triglyceride, cholesterol, and LDL at 3 and 6 months after transplantation were collected. Cox-proportional hazard model and Kaplan-Meier were used to data analysis. Results: First graft survival at 1, 2, 3, and 5 years was 74%, 66%, 53%, and 41%, respectively. Second graft survival at 1, 2, 3, and 5 years was 81%, 74%, 70%, and 61%, respectively. Causes of graft loss in first renal transplantation were 6% sever acute graft rejection, 12% acute graft rejection and 82% chronic graft rejection. In the multivariate analysis, only serum creatinine, blood pressure, and immunosuppressive drugs predicted first graft loss and serum creatinine, immunosuppressive drugs, and related donor family predicted second graft rejection. Conclusion: The serum creatinine and immunosuppressive drugs including cyclosporine, cellcept, and prednisolone are the most influential factors on graft survival.
Treating experimental data of inverse kinetic method by unitary linear regression analysis
International Nuclear Information System (INIS)
Zhao Yusen; Chen Xiaoliang
2009-01-01
The theory of treating experimental data of inverse kinetic method by unitary linear regression analysis was described. Not only the reactivity, but also the effective neutron source intensity could be calculated by this method. Computer code was compiled base on the inverse kinetic method and unitary linear regression analysis. The data of zero power facility BFS-1 in Russia were processed and the results were compared. The results show that the reactivity and the effective neutron source intensity can be obtained correctly by treating experimental data of inverse kinetic method using unitary linear regression analysis and the precision of reactivity measurement is improved. The central element efficiency can be calculated by using the reactivity. The result also shows that the effect to reactivity measurement caused by external neutron source should be considered when the reactor power is low and the intensity of external neutron source is strong. (authors)
Regression analysis of informative current status data with the additive hazards model.
Zhao, Shishun; Hu, Tao; Ma, Ling; Wang, Peijie; Sun, Jianguo
2015-04-01
This paper discusses regression analysis of current status failure time data arising from the additive hazards model in the presence of informative censoring. Many methods have been developed for regression analysis of current status data under various regression models if the censoring is noninformative, and also there exists a large literature on parametric analysis of informative current status data in the context of tumorgenicity experiments. In this paper, a semiparametric maximum likelihood estimation procedure is presented and in the method, the copula model is employed to describe the relationship between the failure time of interest and the censoring time. Furthermore, I-splines are used to approximate the nonparametric functions involved and the asymptotic consistency and normality of the proposed estimators are established. A simulation study is conducted and indicates that the proposed approach works well for practical situations. An illustrative example is also provided.
Credit Scoring Problem Based on Regression Analysis
Khassawneh, Bashar Suhil Jad Allah
2014-01-01
ABSTRACT: This thesis provides an explanatory introduction to the regression models of data mining and contains basic definitions of key terms in the linear, multiple and logistic regression models. Meanwhile, the aim of this study is to illustrate fitting models for the credit scoring problem using simple linear, multiple linear and logistic regression models and also to analyze the found model functions by statistical tools. Keywords: Data mining, linear regression, logistic regression....
Retrospective analysis of dental implants placed and restored by advanced prosthodontic residents.
Barias, Pamela A; Lee, Damian J; Yuan, Judy Chia-Chun; Sukotjo, Cortino; Campbell, Stephen D; Knoernschild, Kent L
2013-02-01
The purposes of this retrospective clinical review were to: (1) describe the demographics of implant patients, types of implant treatment and implant-supported prostheses in an Advanced Education in Prosthodontic Program, (2) evaluate the survival rate of dental implants placed by prosthodontic residents from 2006 to 2008, and (3) analyze the relationship between resident year of training and implant survival rate. All patients who received dental implants placed by prosthodontic residents from January 2006 to October of 2008 in the Advanced Prosthodontic Program at the University of Illinois at Chicago College of Dentistry were selected for this study. Age, gender, implant diameter, length, implant locations, surgical and restorative detail, and year of prosthodontic residency training were collected and analyzed. Life-table and Kaplan-Meier survival analyses were performed based on implants overall, locations, year of training, and use of a computer-generated surgical guide. A Logrank statistic was performed between implant survival and year of prosthodontic residency training, location, and use of computer-generated surgical guide (α= 0.05). Three hundred and six implants were placed, and of these, seven failed. Life-table and Kaplan-Meier analyses computed a cumulative survival rate (CSR) of 97% for overall implants and implants placed with a computer-generated surgical guide. No statistical difference was found in implant survival rates as a function of year of training (P= 0.85). Dental implants placed by prosthodontic residents had a CSR comparable to previously published studies by other specialties. The year of prosthodontic residency training and implant failure rate did not have any significant relationship. © 2012 by the American College of Prosthodontists.
MULGRES: a computer program for stepwise multiple regression analysis
A. Jeff Martin
1971-01-01
MULGRES is a computer program source deck that is designed for multiple regression analysis employing the technique of stepwise deletion in the search for most significant variables. The features of the program, along with inputs and outputs, are briefly described, with a note on machine compatibility.
Real-time regression analysis with deep convolutional neural networks
Huerta, E. A.; George, Daniel; Zhao, Zhizhen; Allen, Gabrielle
2018-01-01
We discuss the development of novel deep learning algorithms to enable real-time regression analysis for time series data. We showcase the application of this new method with a timely case study, and then discuss the applicability of this approach to tackle similar challenges across science domains.
Wang, D Z; Wang, C; Shen, C F; Zhang, Y; Zhang, H; Song, G D; Xue, X D; Xu, Z L; Zhang, S; Jiang, G H
2017-05-10
We described the time trend of acute myocardial infarction (AMI) from 1999 to 2013 in Tianjin incidence rate with Cochran-Armitage trend (CAT) test and linear regression analysis, and the results were compared. Based on actual population, CAT test had much stronger statistical power than linear regression analysis for both overall incidence trend and age specific incidence trend (Cochran-Armitage trend P valuelinear regression P value). The statistical power of CAT test decreased, while the result of linear regression analysis remained the same when population size was reduced by 100 times and AMI incidence rate remained unchanged. The two statistical methods have their advantages and disadvantages. It is necessary to choose statistical method according the fitting degree of data, or comprehensively analyze the results of two methods.
Application of the standard lymphadenectomy in gastric adenocarcinoma
International Nuclear Information System (INIS)
Aguirre Fernandez, Roberto Eduardo; LLera Dominguez, Gerardo de la; Pennon Guerra, Maria; Alvarez Perez, Alvaro
2011-01-01
The 5-years postoperative survival of 132 patients operated on due to gastric adenocarcinoma that underwent lymphadenectomy of the two first ganglionic levels. The results of the epidemiological parameters were determined and the survival by Kaplan-Meier method was defined
Cholecystokinin in plasma predicts cardiovascular mortality in elderly females
DEFF Research Database (Denmark)
Gøtze, Jens P.; Rehfeld, Jens F; Alehagen, Urban
2016-01-01
BACKGROUND: Cholecystokinin (CCK) and gastrin are related gastrointestinal hormones with documented cardiovascular effects of exogenous administration. It is unknown whether measurement of endogenous CCK or gastrin in plasma contains information regarding cardiovascular mortality. METHODS......: Mortality risk was evaluated using Cox proportional hazard regression and Kaplan-Meier analyses. Elderly patients in a primary care setting with symptoms of cardiac disease, i.e. shortness of breath, peripheral edema, and/or fatigue, were evaluated (n=470). Primary care patients were followed for 13years...... information was obtained from 4th quartile gastrin concentrations on 5-year cardiovascular mortality risk. CONCLUSIONS: CCK in plasma is an independent marker of cardiovascular mortality in elderly female patients. The study thus introduces measurement of plasma CCK in gender-specific cardiovascular risk...
Smooth conditional distribution function and quantiles under random censorship.
Leconte, Eve; Poiraud-Casanova, Sandrine; Thomas-Agnan, Christine
2002-09-01
We consider a nonparametric random design regression model in which the response variable is possibly right censored. The aim of this paper is to estimate the conditional distribution function and the conditional alpha-quantile of the response variable. We restrict attention to the case where the response variable as well as the explanatory variable are unidimensional and continuous. We propose and discuss two classes of estimators which are smooth with respect to the response variable as well as to the covariate. Some simulations demonstrate that the new methods have better mean square error performances than the generalized Kaplan-Meier estimator introduced by Beran (1981) and considered in the literature by Dabrowska (1989, 1992) and Gonzalez-Manteiga and Cadarso-Suarez (1994).
The evolution of GDP in USA using cyclic regression analysis
Catalin Angelo IOAN; Gina IOAN
2013-01-01
Based on the four major types of economic cycles (Kondratieff, Juglar, Kitchin, Kuznet), the paper aims to determine their actual length (for the U.S. economy) using cyclic regressions based on Fourier analysis.
Morera-Sendra, Natalia; Tejera-Vaquerizo, Antonio; Traves, Víctor; Requena, Celia; Bolumar, Isidro; Pla, Angel; Vázquez, Carlos; Soriano, Virtudes; Nagore, Eduardo
2016-01-01
The role of sentinel lymph node biopsy and the benefit of immunotherapy with interferon in thick (>4 mm) melanomas remain uncertain. Our aim was to assess the value of both sentinel lymph node (SLN) biopsy and immunotherapy in the prognosis of thick melanomas. A retrospective study based on a computerized patient database in which patients have been prospectively collected since 2005 was performed. Age, sex, location, Breslow thickness, tumor ulceration, regression, Clark level, tumor infiltrating lymphocytes, tumor mitotic rate, microscopic satellite and vascular invasion were included in the analysis. Disease-free (DFS), disease-specific (DSS) and overall (OS) survivals were evaluated by the Kaplan-Meier method and Cox regression analysis. A series of 141 patients with melanomas thicker than 4 mm were included. Multivariate regression showed a worse prognosis in SLN-positive patients with respect to SLN biopsy-negative patients (DFS, hazard ratio [HR] 2, p = 0.04; DSS, HR 2.2, p = 0.002; OS, HR 2.4, p = 0.02). The observational group was shown to have a worse prognosis than the SLN-positive group but was very similar to the clinically positive group. Immunotherapy with high-dose interferon showed a protective effect (DFS, HR 0.5, p = 0.02; DSS, HR 0.3, p = 0.001; OS, HR 0.3, p = 0.001). Our data indicate that SLN biopsy and adjuvant interferon should be considered for patients with thick melanomas.
Directory of Open Access Journals (Sweden)
Bermúdez Morata, Lluís
2008-01-01
Full Text Available El presente trabajo se centra en el estudio del tiempo hasta la discapacitación para las actividades de la vida diaria en la población activa de Cataluña mayor de 60 años. El riesgo de sufrir discapacidades es mayor para este grupo de edad que en los más jóvenes y, además, se incrementa con la edad. La aparición de discapacidades resta habilidades a la hora de realizar las distintas actividades de la vida diaria, por ello hemos centrado nuestro interés en la variable tiempo hasta que una persona de 60 años que no muestra discapacidad alguna, se discapacita, identificando factores ligados a los incrementos del riesgo de discapacitación. A partir de los datos que proporciona la Encuesta sobre Discapacidades, Deficiencias y Estado de Salud (EDDES, INE 1999 y, utilizando el estimador de Kaplan-Meier, se estiman las funciones de supervivencia que permiten calcular probabilidades relacionadas con la edad de discapacitación. Asimismo, se ha realizado un análisis del modelo de regresión de Weibull que permite interpretar cómo y en qué medida afectan las características individuales. = In Spain individuals aged 60 years and above are major consumers of the health care system. The risk of becoming unable to perform daily life activities is higher for the elderly than for the younger population, and in addition, it increases with age. As a consequence we focus on the study of the period of life after an abled person who is 60 years old becomes disabled and we also study the factors that are related to the risk of disability. Using data from the Survey of Disabilities, Handicaps and Health Status (EDDES, INE 1999, and using the Kaplan-Meier estimator, we estimate the survival functions to calculate the probability of becoming disabled at different age points. Besides, a Weibull regression model is estimated in order to interpret the effects of individual characteristics on the disability risk.
Quantile regression for the statistical analysis of immunological data with many non-detects.
Eilers, Paul H C; Röder, Esther; Savelkoul, Huub F J; van Wijk, Roy Gerth
2012-07-07
Immunological parameters are hard to measure. A well-known problem is the occurrence of values below the detection limit, the non-detects. Non-detects are a nuisance, because classical statistical analyses, like ANOVA and regression, cannot be applied. The more advanced statistical techniques currently available for the analysis of datasets with non-detects can only be used if a small percentage of the data are non-detects. Quantile regression, a generalization of percentiles to regression models, models the median or higher percentiles and tolerates very high numbers of non-detects. We present a non-technical introduction and illustrate it with an implementation to real data from a clinical trial. We show that by using quantile regression, groups can be compared and that meaningful linear trends can be computed, even if more than half of the data consists of non-detects. Quantile regression is a valuable addition to the statistical methods that can be used for the analysis of immunological datasets with non-detects.
Optimal choice of basis functions in the linear regression analysis
International Nuclear Information System (INIS)
Khotinskij, A.M.
1988-01-01
Problem of optimal choice of basis functions in the linear regression analysis is investigated. Step algorithm with estimation of its efficiency, which holds true at finite number of measurements, is suggested. Conditions, providing the probability of correct choice close to 1 are formulated. Application of the step algorithm to analysis of decay curves is substantiated. 8 refs
Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients
International Nuclear Information System (INIS)
Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho
2010-01-01
We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate
Radiologic Placement of Tunneled Central Venous Catheters in Pediatric Patients
Energy Technology Data Exchange (ETDEWEB)
Kim, Eun Ji; Song, Soon Young; Cho, On Koo; Koh, Byung Hee; Kim, Yong Soo; Jeong, Woo Kyoung; Lee, Yong Ho [Hanyang University College of Medicine, Seoul (Korea, Republic of)
2010-08-15
We evaluated the technical success and complication rates associated with the radiological placement of tunneled central venous catheters in pediatric patients. Between May 1, 2005 and March 31, 2008, a total of 46 tunneled central venous catheters were placed in 34 children (M:F = 22:12; mean age, 9.9 years [9 months to 16.8 years]). All procedures were performed under ultrasonographic and fluoroscopic guidance. Follow-up data were obtained through the retrospective review of the medical records. We used the Kaplan-Meier survival method for the evaluation of survival rate of the catheters. All procedures were technically successful. The observed periprocedural complications included hematoma formation in three patients. The mean catheter life was 189.3 days (total, 8710 days; range, 7-810). Catheters were removed due to death (n=9), the end of treatment (n=8), catheter sepsis (n=4), malfunction (n=8), and accidental removal (n=4). The rate of catheter sepsis and malfunction was 0.459 and 0.919 for every 1000 catheter days, respectively. The expected mean catheter life was 479.6 days as per the Kaplan- Meier analysis. The results suggest that the radiologic placement of a tunneled central venous catheter is an effective technique with a high technical success rate and low complication rate.
Analysis of BAG3 plasma concentrations in patients with acutely decompensated heart failure.
Gandhi, Parul U; Gaggin, Hanna K; Belcher, Arianna M; Harisiades, Jamie E; Basile, Anna; Falco, Antonia; Rosati, Alessandra; Piscione, Federico; Januzzi, James L; Turco, M Caterina
2015-05-20
BCL-2-associated athanogene 3 (BAG3) is a protein implicated in the cardiomyocyte stress response and genesis of cardiomyopathy. Extracellular BAG3 is measurable in patients with heart failure (HF), but the relationship of BAG3 with HF prognosis is unclear. BAG3 plasma concentrations were measured in 39 acutely decompensated HF patients; the primary endpoint was death at 1 year. Baseline characteristics were compared by vital status and median BAG3 concentration. Correlation of BAG3 with left ventricular ejection fraction (LVEF) and other biomarkers was performed. Prognostic value was assessed using Cox proportional hazards regression and Kaplan-Meier analysis. At baseline, median BAG3 was significantly higher in decedents (N=11) than survivors (N=28; 1489 ng/mL versus 50 ng/mL; P=0.04); decedents also had worse renal function and higher median natriuretic peptide (NP) and sST2. BAG3 was not significantly correlated with NPs, mid-regional pro-adrenomedullin, sST2, or eGFR, however. Mortality was increased in patients with supra-median BAG3 (>336 ng/mL; 42.1% versus 15.0%, P=0.06). In age and LVEF-adjusted Cox proportional hazards, BAG3 remained a significant mortality predictor (HR=3.20; 95% CI=1.34-7.65; P=0.02); those with supra-median BAG3 had significantly shorter time-to-death (P=0.04). The stress response protein BAG3 is measurable in patients with ADHF and may be prognostic for death. Copyright © 2015 Elsevier B.V. All rights reserved.
Regression analysis for the social sciences
Gordon, Rachel A
2015-01-01
Provides graduate students in the social sciences with the basic skills they need to estimate, interpret, present, and publish basic regression models using contemporary standards. Key features of the book include: interweaving the teaching of statistical concepts with examples developed for the course from publicly-available social science data or drawn from the literature. thorough integration of teaching statistical theory with teaching data processing and analysis. teaching of Stata and use of chapter exercises in which students practice programming and interpretation on the same data set. A separate set of exercises allows students to select a data set to apply the concepts learned in each chapter to a research question of interest to them, all updated for this edition.
International Nuclear Information System (INIS)
Scorticati, Carlos; Aguilar, Jorge A.; Gonzalez Granda, Pablo; Mendez, Fernando; Montiel, Raul; Rege, Eduardo; Alvarez, Patricio; Lopez, Miguel A.; Rizzi, Alfredo; Mazza, Osvaldo
2009-01-01
Introduction and Objectives: To analyze the results of the treatment in patients with cancer of prostate of high risk. Material and Method: Retrospective and observational analysis of 130 patients operated by CAP of high risk (criteria of D'Amico) average 41,48 months, divided in form nonrandomized in three groups 1: radical prostatectomy, 2: neoadjuvant hormonoterapy (BAC) + PR, 3: BAC + PR + x-ray (RT). Statistical analysis: multivaried, test of curved Chi2 and p statistical and of Kaplan Meier. Results: Biochemical relapse 68 patients (52.3%), average 23,37 months. Without differences according to therapeutic modality (p: 0.043). In the multivaried analysis of the 3 factors of presurgical, single risk we found a statistically significant relation in the coexistence of the 3 factors with the presence of positive margin in the PR piece. (p: 0,002). The analysis to make or not, neoadjuvant BAC without significant difference (p: 0,403) evaluating in such the rate of M+, actuarial global survival according to curves of Kaplan Meier to 5 and 10 years (P: 0,5257) and survival 5 actuarial specific cancer to and 10a (P: 0,2165). Conclusions: Without significant differences in: RB, clinical progression, pathological relapse, global and specific survival, rate of positive surgical margins. The 3 criteria of D'Amico were predictive of positive surgical margins and RB, the patients with RB in group 2 presented/displayed greater risk of clinical progression, the PR demonstrated a global survival and specify actuarial to 10 years greater to 50%, considering it therapeutic an option been worth. (authors) [es
A method for nonlinear exponential regression analysis
Junkin, B. G.
1971-01-01
A computer-oriented technique is presented for performing a nonlinear exponential regression analysis on decay-type experimental data. The technique involves the least squares procedure wherein the nonlinear problem is linearized by expansion in a Taylor series. A linear curve fitting procedure for determining the initial nominal estimates for the unknown exponential model parameters is included as an integral part of the technique. A correction matrix was derived and then applied to the nominal estimate to produce an improved set of model parameters. The solution cycle is repeated until some predetermined criterion is satisfied.
Analysis of Functional Data with Focus on Multinomial Regression and Multilevel Data
DEFF Research Database (Denmark)
Mousavi, Seyed Nourollah
Functional data analysis (FDA) is a fast growing area in statistical research with increasingly diverse range of application from economics, medicine, agriculture, chemometrics, etc. Functional regression is an area of FDA which has received the most attention both in aspects of application...... and methodological development. Our main Functional data analysis (FDA) is a fast growing area in statistical research with increasingly diverse range of application from economics, medicine, agriculture, chemometrics, etc. Functional regression is an area of FDA which has received the most attention both in aspects...
Regression analysis of a chemical reaction fouling model
International Nuclear Information System (INIS)
Vasak, F.; Epstein, N.
1996-01-01
A previously reported mathematical model for the initial chemical reaction fouling of a heated tube is critically examined in the light of the experimental data for which it was developed. A regression analysis of the model with respect to that data shows that the reference point upon which the two adjustable parameters of the model were originally based was well chosen, albeit fortuitously. (author). 3 refs., 2 tabs., 2 figs
[A SAS marco program for batch processing of univariate Cox regression analysis for great database].
Yang, Rendong; Xiong, Jie; Peng, Yangqin; Peng, Xiaoning; Zeng, Xiaomin
2015-02-01
To realize batch processing of univariate Cox regression analysis for great database by SAS marco program. We wrote a SAS macro program, which can filter, integrate, and export P values to Excel by SAS9.2. The program was used for screening survival correlated RNA molecules of ovarian cancer. A SAS marco program could finish the batch processing of univariate Cox regression analysis, the selection and export of the results. The SAS macro program has potential applications in reducing the workload of statistical analysis and providing a basis for batch processing of univariate Cox regression analysis.
Kleijnen, J.P.C.
1995-01-01
This tutorial discusses what-if analysis and optimization of System Dynamics models. These problems are solved, using the statistical techniques of regression analysis and design of experiments (DOE). These issues are illustrated by applying the statistical techniques to a System Dynamics model for
Artaç, Mehmet; Uysal, Mükremin; Karaağaç, Mustafa; Korkmaz, Levent; Er, Zehra; Güler, Tunç; Börüban, Melih Cem; Bozcuk, Hakan
2017-06-01
Metastatic colorectal cancer (mCRC) is a lethal disease and fluorouracil-leucovorin-irinotecan (FOLFIRI) plus bevacizumab (bev) is a standard approach. Hence, there is a strong need for identifying new prognostic factors to show the efficacy of FOLFIRI-bev. This is a retrospective study including patients (n = 90) with mCRC from two centers in Turkey. Neutrophil/lymphocyte (N/L) ratio, platelet count, albumin, and C-reactive protein (CRP) were recorded before FOLFIRI-bev therapy. The efficacy of these factors on progression-free survival (PFS) was analyzed with Kaplan Meier and Cox regression analysis. And the cutoff value of N/L ratio was analyzed with ROC analysis. The median age was 56 years (range 21-80). Forty-seven percent of patients with N/L ratio >2.5 showed progressive disease versus 43 % in patients with N/L ratio ratio >2.5 versus 13.5 months for the patients with N/L ratio analysis, high baseline neutrophil count, LDH, N/L ratio, and CRP were all significantly associated with poor prognosis. At multivariate Cox regression analysis, CRP was confirmed to be a better independent prognostic factor. CRP variable was divided into above the upper limit of normal (ULN) and normal value. The median PFSs of the patients with normal and above ULN were 11.3 versus 5.8 months, respectively (p = 0.022). CRP and N/L ratio are potential predictors for advanced mCRC treated with FOLFIRI-bev.
Application of multilinear regression analysis in modeling of soil ...
African Journals Online (AJOL)
The application of Multi-Linear Regression Analysis (MLRA) model for predicting soil properties in Calabar South offers a technical guide and solution in foundation designs problems in the area. Forty-five soil samples were collected from fifteen different boreholes at a different depth and 270 tests were carried out for CBR, ...
Association of versican turnover with all-cause mortality in patients on haemodialysis
DEFF Research Database (Denmark)
Genovese, Federica; Karsdal, Morten A; Leeming, Diana J
2014-01-01
with cardiovascular diseases. The objective of the study was to investigate the association of versican turnover assessed in plasma with survival in haemodialysis patients. METHODS: A specific matrix metalloproteinase-generated neo-epitope fragment of versican (VCANM) was measured in plasma of 364 haemodialysis...... patients with a 5-years follow-up, using a robust competitive enzyme-linked immunosorbent assays. Association between VCANM plasma concentration and survival was assessed by Kaplan-Meier analysis and adjusted Cox model. RESULTS: Haemodialysis patients with plasma VCANM concentrations in the lowest quartile...
Directory of Open Access Journals (Sweden)
Matthias Schmid
Full Text Available Regression analysis with a bounded outcome is a common problem in applied statistics. Typical examples include regression models for percentage outcomes and the analysis of ratings that are measured on a bounded scale. In this paper, we consider beta regression, which is a generalization of logit models to situations where the response is continuous on the interval (0,1. Consequently, beta regression is a convenient tool for analyzing percentage responses. The classical approach to fit a beta regression model is to use maximum likelihood estimation with subsequent AIC-based variable selection. As an alternative to this established - yet unstable - approach, we propose a new estimation technique called boosted beta regression. With boosted beta regression estimation and variable selection can be carried out simultaneously in a highly efficient way. Additionally, both the mean and the variance of a percentage response can be modeled using flexible nonlinear covariate effects. As a consequence, the new method accounts for common problems such as overdispersion and non-binomial variance structures.
Treatment of primary tracheal carcinoma. The role of external and endoluminal radiotherapy
International Nuclear Information System (INIS)
Harms, W.; Wannenmacher, M.; Becker, H.; Herth, F.; Gagel, B.
2000-01-01
Background and Purpose: In a retrospective study the role of radiation therapy for the treatment of primary tracheal carcinoma was investigated. Patients and Methods: Between 1984 and 1997, 25 patients with primary tracheal carcinoma were treated with external beam radiotherapy (17 squamous-cell carcinoma [SCC], 8 adenoid cystic carcinoma [ACC], median dose SCC 60 Gy, ACC 55 Gy). An additional brachytherapy boost was carried out in 10/25 patients (median dose SCC 18 Gy, ACC 15 Gy). Ten patients underwent operative treatment. Results: The median survival (Kaplan-Meier) for patients with SCC was 33 months (ACC 94.2). The 1-, 2- and 5-year survival rates (Kaplan-Meier) for patients with SCC were 64.7% (ACC 85.7%), 64.7% (ACC 85.7%), and 26% (ACC 85.7%). Patients with ACC and patients with a complete remission after treatment had a significantly better survival probability (log rank test, p [de
DEFF Research Database (Denmark)
Schneider, Uffe; Nielsen, Rikke; Pedersen, Court
2007-01-01
. METHODS: DNA samples were collected retrospectively from 145 Danes infected with HIV-1 with known seroconversion times. In addition, plasma was collected retrospectively from 81 of these participants for use in the suPAR analysis. Survival was analysed using Kaplan Meier analysis. RESULTS: Survival...... to A transition at -118 and an A to G transition at -465 comparative to the transcription start site. These promoter transitions did not influence neither the suPAR levels nor patient survival. CONCLUSION: Plasma suPAR levels, as measured by the suPARnosticTM assay, were strongly predictive of survival in ART...
International Nuclear Information System (INIS)
Brearley, M.J.; Hayes, A.M.; Murphy, S.
1999-01-01
Thirteen dogs with invasive thyroid carcinoma (WHO classification T2b or T3b) seen between January 1991 and October 1997 were treated by external beam Irradiation. Four once-weekly fractions of 9 gray of 4 MeV X-rays were administered. Four of the dogs died of progression of the primary disease and four from metastatic spread. Of the remaining dogs, three died of unrelated problems, although two were still alive at the time of the censor. Kaplan-Meier analysis of the survival time from first dose to death from either primary or metastatic disease gave a median survival time of 96 weeks (mean 85 weeks, range six to 247 weeks). Radiographic evidence of pulmonary metastatic disease at presentation had no prognostic value whereas crude growth rate was a highly significant factor. The present series Indicates that radiation therapy should be considered an important modality for the control of invasive thyroid carcinoma in the dog
Item response theory analyses of the Delis-Kaplan Executive Function System card sorting subtest.
Spencer, Mercedes; Cho, Sun-Joo; Cutting, Laurie E
2018-02-02
In the current study, we examined the dimensionality of the 16-item Card Sorting subtest of the Delis-Kaplan Executive Functioning System assessment in a sample of 264 native English-speaking children between the ages of 9 and 15 years. We also tested for measurement invariance for these items across age and gender groups using item response theory (IRT). Results of the exploratory factor analysis indicated that a two-factor model that distinguished between verbal and perceptual items provided the best fit to the data. Although the items demonstrated measurement invariance across age groups, measurement invariance was violated for gender groups, with two items demonstrating differential item functioning for males and females. Multigroup analysis using all 16 items indicated that the items were more effective for individuals whose IRT scale scores were relatively high. A single-group explanatory IRT model using 14 non-differential item functioning items showed that for perceptual ability, females scored higher than males and that scores increased with age for both males and females; for verbal ability, the observed increase in scores across age differed for males and females. The implications of these findings are discussed.
Bias due to two-stage residual-outcome regression analysis in genetic association studies.
Demissie, Serkalem; Cupples, L Adrienne
2011-11-01
Association studies of risk factors and complex diseases require careful assessment of potential confounding factors. Two-stage regression analysis, sometimes referred to as residual- or adjusted-outcome analysis, has been increasingly used in association studies of single nucleotide polymorphisms (SNPs) and quantitative traits. In this analysis, first, a residual-outcome is calculated from a regression of the outcome variable on covariates and then the relationship between the adjusted-outcome and the SNP is evaluated by a simple linear regression of the adjusted-outcome on the SNP. In this article, we examine the performance of this two-stage analysis as compared with multiple linear regression (MLR) analysis. Our findings show that when a SNP and a covariate are correlated, the two-stage approach results in biased genotypic effect and loss of power. Bias is always toward the null and increases with the squared-correlation between the SNP and the covariate (). For example, for , 0.1, and 0.5, two-stage analysis results in, respectively, 0, 10, and 50% attenuation in the SNP effect. As expected, MLR was always unbiased. Since individual SNPs often show little or no correlation with covariates, a two-stage analysis is expected to perform as well as MLR in many genetic studies; however, it produces considerably different results from MLR and may lead to incorrect conclusions when independent variables are highly correlated. While a useful alternative to MLR under , the two -stage approach has serious limitations. Its use as a simple substitute for MLR should be avoided. © 2011 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Smith, Graham D.; Pickles, Tom; Crook, Juanita; Martin, Andre-Guy; Vigneault, Eric; Cury, Fabio L.; Morris, Jim; Catton, Charles; Lukka, Himu; Warner, Andrew; Yang, Ying; Rodrigues, George
2015-01-01
Purpose: To compare, in a retrospective study, biochemical failure-free survival (bFFS) and overall survival (OS) in low-risk and intermediate-risk prostate cancer patients who received brachytherapy (BT) (either low-dose-rate brachytherapy [LDR-BT] or high-dose-rate brachytherapy with external beam radiation therapy [HDR-BT+EBRT]) versus external beam radiation therapy (EBRT) alone. Methods and Materials: Patient data were obtained from the ProCaRS database, which contains 7974 prostate cancer patients treated with primary radiation therapy at four Canadian cancer institutions from 1994 to 2010. Propensity score matching was used to obtain the following 3 matched cohorts with balanced baseline prognostic factors: (1) low-risk LDR-BT versus EBRT; (2) intermediate-risk LDR-BT versus EBRT; and (3) intermediate-risk HDR-BT+EBRT versus EBRT. Kaplan-Meier survival analysis was performed to compare differences in bFFS (primary endpoint) and OS in the 3 matched groups. Results: Propensity score matching created acceptable balance in the baseline prognostic factors in all matches. Final matches included 2 1:1 matches in the intermediate-risk cohorts, LDR-BT versus EBRT (total n=254) and HDR-BT+EBRT versus EBRT (total n=388), and one 4:1 match in the low-risk cohort (LDR-BT:EBRT, total n=400). Median follow-up ranged from 2.7 to 7.3 years for the 3 matched cohorts. Kaplan-Meier survival analysis showed that all BT treatment options were associated with statistically significant improvements in bFFS when compared with EBRT in all cohorts (intermediate-risk EBRT vs LDR-BT hazard ratio [HR] 4.58, P=.001; intermediate-risk EBRT vs HDR-BT+EBRT HR 2.08, P=.007; low-risk EBRT vs LDR-BT HR 2.90, P=.004). No significant difference in OS was found in all comparisons (intermediate-risk EBRT vs LDR-BT HR 1.27, P=.687; intermediate-risk EBRT vs HDR-BT+EBRT HR 1.55, P=.470; low-risk LDR-BT vs EBRT HR 1.41, P=.500). Conclusions: Propensity score matched analysis showed that BT options led
An Original Stepwise Multilevel Logistic Regression Analysis of Discriminatory Accuracy
DEFF Research Database (Denmark)
Merlo, Juan; Wagner, Philippe; Ghith, Nermin
2016-01-01
BACKGROUND AND AIM: Many multilevel logistic regression analyses of "neighbourhood and health" focus on interpreting measures of associations (e.g., odds ratio, OR). In contrast, multilevel analysis of variance is rarely considered. We propose an original stepwise analytical approach that disting...
Risk analysis for autonomous underwater vehicle operations in extreme environments.
Brito, Mario Paulo; Griffiths, Gwyn; Challenor, Peter
2010-12-01
Autonomous underwater vehicles (AUVs) are used increasingly to explore hazardous marine environments. Risk assessment for such complex systems is based on subjective judgment and expert knowledge as much as on hard statistics. Here, we describe the use of a risk management process tailored to AUV operations, the implementation of which requires the elicitation of expert judgment. We conducted a formal judgment elicitation process where eight world experts in AUV design and operation were asked to assign a probability of AUV loss given the emergence of each fault or incident from the vehicle's life history of 63 faults and incidents. After discussing methods of aggregation and analysis, we show how the aggregated risk estimates obtained from the expert judgments were used to create a risk model. To estimate AUV survival with mission distance, we adopted a statistical survival function based on the nonparametric Kaplan-Meier estimator. We present theoretical formulations for the estimator, its variance, and confidence limits. We also present a numerical example where the approach is applied to estimate the probability that the Autosub3 AUV would survive a set of missions under Pine Island Glacier, Antarctica in January-March 2009. © 2010 Society for Risk Analysis.
Advanced statistics: linear regression, part I: simple linear regression.
Marill, Keith A
2004-01-01
Simple linear regression is a mathematical technique used to model the relationship between a single independent predictor variable and a single dependent outcome variable. In this, the first of a two-part series exploring concepts in linear regression analysis, the four fundamental assumptions and the mechanics of simple linear regression are reviewed. The most common technique used to derive the regression line, the method of least squares, is described. The reader will be acquainted with other important concepts in simple linear regression, including: variable transformations, dummy variables, relationship to inference testing, and leverage. Simplified clinical examples with small datasets and graphic models are used to illustrate the points. This will provide a foundation for the second article in this series: a discussion of multiple linear regression, in which there are multiple predictor variables.
International Nuclear Information System (INIS)
Leng Ling; Zhang Tianyi; Kleinman, Lawrence; Zhu Wei
2007-01-01
Regression analysis, especially the ordinary least squares method which assumes that errors are confined to the dependent variable, has seen a fair share of its applications in aerosol science. The ordinary least squares approach, however, could be problematic due to the fact that atmospheric data often does not lend itself to calling one variable independent and the other dependent. Errors often exist for both measurements. In this work, we examine two regression approaches available to accommodate this situation. They are orthogonal regression and geometric mean regression. Comparisons are made theoretically as well as numerically through an aerosol study examining whether the ratio of organic aerosol to CO would change with age
Comparative Study of Barotrauma Risk during Fish Passage through Kaplan Turbines
Energy Technology Data Exchange (ETDEWEB)
Richmond, Marshall C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Romero-Gomez, Pedro [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Serkowski, John A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Rakowski, Cynthia L. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States). Hydrology Group; Graf, Michael J. [Voith Hydro, York, PA (United States)
2015-10-01
Rapid pressure changes in hydroelectric turbine flows can cause barotrauma that can be hazardous to the passage of fish, in particular migratory juvenile salmonids. Although numerous laboratory tests have evaluated the effect of rapid decompression in fish species of relevance, numerical modeling studies offer the advantage of predicting, for new turbine designs, the potential risks of mortality and injury from rapid pressure change during turbine passage. However, rapid pressure change is only one of several hydraulic risks encountered by fish during turbine passage in addition to blade strike, shear, and turbulence. To better understand the role of rapid pressure changes, the present work focuses on the application of a computational fluid dynamics based method for evaluating the risk of pressure-related mortality to fish passing through an early 1960s era original hydroelectric Kaplan turbine at Wanapum Dam (Columbia River, Washington), and a modern advanced Kaplan turbine installed in 2005. The results show that the modeling approach acceptably reproduced the nadir pressure distributions compared to field data previously collected at the site using an autonomous sensor. Our findings show that the new advanced-design unit performs better, in terms of reduced barotrauma risk to fish from exposure to low pressures, than the original turbine unit. The outcomes allow for comparative analyses of turbine designs and operations prior to installation, an advantage that can potentially be integrated in the process of designing new turbine units to achieve superior environmental performance. Overall, the results show that modern turbine designs can achieve the multiple objectives of increasing power generation, lowering cavitation potential, and reducing barotrauma risks to passing fish.
Sampaio-Barros, Percival D; Bortoluzzo, Adriana B; Marangoni, Roberta G; Rocha, Luiza F; Del Rio, Ana Paula T; Samara, Adil M; Yoshinari, Natalino H; Marques-Neto, João Francisco
2012-10-01
To analyze survival, prognostic factors, and causes of death in a large cohort of patients with systemic sclerosis (SSc). From 1991 to 2010, 947 patients with SSc were treated at 2 referral university centers in Brazil. Causes of death were considered SSc-related and non-SSc-related. Multiple logistic regression analysis was used to identify prognostic factors. Survival at 5 and 10 years was estimated using the Kaplan-Meier method. One hundred sixty-eight patients died during the followup. Among the 110 deaths considered related to SSc, there was predominance of lung (48.1%) and heart (24.5%) involvement. Most of the 58 deaths not related to SSc were caused by infection, cardiovascular or cerebrovascular disease, and cancer. Male sex, modified Rodnan skin score (mRSS) > 20, osteoarticular involvement, lung involvement, and renal crisis were the main prognostic factors associated to death. Overall survival rate was 90% for 5 years and 84% for 10 years. Patients presented worse prognosis if they had diffuse SSc (85% vs 92% at 5 yrs, respectively, and 77% vs 87% at 10 yrs, compared to limited SSc), male sex (77% vs 90% at 5 yrs and 64% vs 86% at 10 yrs, compared to female sex), and mRSS > 20 (83% vs 90% at 5 yrs and 66% vs 86% at 10 yrs, compared to mRSS < 20). Survival was worse in male patients with diffuse SSc, and lung and heart involvement represented the main causes of death in this South American series of patients with SSc.
International Nuclear Information System (INIS)
Hyun, Seung Hyup; Choi, Joon Young; Lee, Kyung-Han; Eo, Jae Seon; Lee, Jeong Won; Na, Sae Jung; Hong, Il Ki; Oh, Jin Kyoung; Chung, Yong An; Song, Bong-Il; Kim, Tae-Sung; Kim, Kyung Sik; Moon, Dae Hyuk; Yun, Mijin
2016-01-01
We evaluated the prognostic value of pretreatment 18 F-fluorodeoxyglucose positron emission tomography with computed tomography (FDG PET/CT) in patients with Barcelona Clinic Liver Cancer (BCLC) stage 0 or A hepatocellular carcinoma (HCC) who had received curative treatment or transarterial chemoembolization (TACE). Between 2009 and 2010, 317 patients diagnosed with HCC at seven hospitals were enrolled. Among these, 195 patients underwent curative treatments including resection, liver transplantation, and radiofrequency ablation. TACE was performed in 122 patients. The tumor-to-normal liver standardized uptake value ratio (TLR) of the primary tumor was measured using pretreatment FDG PET/CT. The prognostic significance of TLR and other clinical variables was assessed using Cox regression models. Differences in the overall survival (OS) associated with TLR or other significant clinical factors were examined using the Kaplan-Meier method. Over a median follow-up period of 46 months, 77 patients died from cancer. In the curative cohort, higher TLR (≥2) was significantly associated with death (hazard ratio [HR] = 2.68; 95 % CI, 1.16-6.15; P = 0.020) in multivariable analysis. Patients with a higher TLR had significantly worse OS than patients with a lower TLR (5-year overall survival, 61 % vs. 79.4 %; P = 0.006). In the TACE cohort, the Model for End-Stage Liver Disease (MELD) score (≥8) was a significant independent prognostic factor for OS (HR = 3.34; 95 % CI, 1.49-7.48; P = 0.003), whereas TLR was not associated with OS. The Kaplan-Meier curves showed significantly poorer OS in patients with higher MELD scores (≥8) than in those with lower MELD scores (5-year survival rate, 33.1 % vs. 79.6 %; P < 0.001). Pretreatment TLR measured using FDG PET/CT was an independent prognostic factor for OS in patients with BCLC stage 0 or A HCC undergoing curative treatment. In contrast, underlying liver function appeared to be important in predicting the prognosis of patients
Spiess, Philippe E; Levy, David A; Mouraviev, Vladimir; Pisters, Louis L; Jones, J Stephen
2013-08-01
What's known on the subject? and what does the study add?: Previous studies have identified the most important prognostic factors of the likely outcomes of salvage prostate whole-gland ablation, including initial clinical stage, biopsy Gleason score, and PSA (total and doubling time). There is potential for further optimization of candidate selection for salvage cryoablation with curative intent and nadir PSA achieved after whole-gland cryotherapy may provide additional prognostic value. The study shows that the most important prognostic factors of biochemical progression-free survival for patients who have undergone whole-gland salvage prostate cryotherapy are nadir PSA achieved after therapy and pre-therapy biopsy Gleason score. Based on these two prognostic variables, we have identified risk stratification groups (low, intermediate and high) which help predict the expected outcomes of salvage whole-gland prostate cryotherapy in a given patient. This risk stratification constitutes a useful clinical tool in defining which patients maybe best suited for this local salvage treatment method. To assess the prognostic variables predicting the risk of biochemical progression-free survival (bPFS) after salvage prostate whole-gland cryotherapy using the Phoenix definition of bPFS. A total of 132 patients underwent prostate whole-gland salvage cryotherapy with curative intent. No patient underwent neoadjuvant/adjuvant hormonal ablative therapy, and all had extended post-salvage prostate-specific antigen (PSA) follow-up data. Cox univariate and multivariate logistic regression analyses of potential predictors of bPFS were conducted. Kaplan-Meier analyses of bPFS was also performed. At a mean (range) follow-up of 4.3 (0.9-12.7) years, the median (range) post-cryotherapy nadir PSA achieved was 0.17 (0-33.9) ng/mL. On multivariate analysis, predictors of bPFS were nadir PSA post-cryotherapy and pre-salvage biopsy Gleason score (P 2.5 ng/mL or biopsy Gleason score ≥ 7, with
Graft survival rate of renal transplantation during a period of 10 years in Iran
Directory of Open Access Journals (Sweden)
Fatemeh Shahbazi
2015-01-01
Full Text Available Background: Kidney transplantation is a preferred treatment for many patients with end-stage renal disease (ESRD and is far more profitable than hemodialysis. Analyzing renal transplantation data can help to evaluate the effectiveness of transplantation interventions. The aim of this study was to determine the organ survival rate after kidney transplantation during a period of 10 years (March 2001-March 2011 among transplanted patients in Arak, Markazi Province, Iran. Materials and Methods: In this historical cohort study, all recipients of kidney transplantation from Arak, Markazi Province, Iran who had medical records in Valiasr Hospital and "charity for kidney patients" of Arak, Markazi Province, Iran during a period of 10 years from March 2001 to March 2011 were included. Data collected by using checklists were completed from patients′ hospital records. Kaplan-Meier method was used to determine the graft cumulative survival rate, log-rank test to compare survival curves in subgroups, and Cox regression model to define the hazard ratio and for ruling out the intervening factors. Statistical analysis was conducted by Statistical Package for the Social Sciences (SPSS 20 and Stata 11. Results: Mean duration of follow-up was 55.43 ± 42.02 months. By using the Kaplan-Meier method, the cumulative probability of graft survival at 1, 3, 5, 7, and 10 years was 99.1, 97.7, 94.3, 85.7, and 62.1%, respectively. The number of dialysis by controlling the effect of other variables had a significant association with the risk of graft failure [hazard ratios and 95% confidence interval (CI: 1.47 (1.02-2.13]. Conclusion: This study showed that the graft survival rate was satisfactory in this community and was similar to the results of single-center studies in the world. Dialysis time after transplantation was a significant predictor of survival in the recipients of kidney transplantation that should be considered.
Modelling the survivorship of Nigeria children in their first 10 years of ...
African Journals Online (AJOL)
Fagbamigbe
Conflict of Interest: Authors declared no conflict of interest ... Keywords: Survivorship, Nigeria, children mortality, Kaplan Meier, Brass Indirect method, Prediction ... variables or sex of older siblings, post- neonatal mortality is 12% higher and 2nd ... Relationship between maternal education and child survival in developing ...
Forecasting urban water demand: A meta-regression analysis.
Sebri, Maamar
2016-12-01
Water managers and planners require accurate water demand forecasts over the short-, medium- and long-term for many purposes. These range from assessing water supply needs over spatial and temporal patterns to optimizing future investments and planning future allocations across competing sectors. This study surveys the empirical literature on the urban water demand forecasting using the meta-analytical approach. Specifically, using more than 600 estimates, a meta-regression analysis is conducted to identify explanations of cross-studies variation in accuracy of urban water demand forecasting. Our study finds that accuracy depends significantly on study characteristics, including demand periodicity, modeling method, forecasting horizon, model specification and sample size. The meta-regression results remain robust to different estimators employed as well as to a series of sensitivity checks performed. The importance of these findings lies in the conclusions and implications drawn out for regulators and policymakers and for academics alike. Copyright © 2016. Published by Elsevier Ltd.
Anderson, Carl A; McRae, Allan F; Visscher, Peter M
2006-07-01
Standard quantitative trait loci (QTL) mapping techniques commonly assume that the trait is both fully observed and normally distributed. When considering survival or age-at-onset traits these assumptions are often incorrect. Methods have been developed to map QTL for survival traits; however, they are both computationally intensive and not available in standard genome analysis software packages. We propose a grouped linear regression method for the analysis of continuous survival data. Using simulation we compare this method to both the Cox and Weibull proportional hazards models and a standard linear regression method that ignores censoring. The grouped linear regression method is of equivalent power to both the Cox and Weibull proportional hazards methods and is significantly better than the standard linear regression method when censored observations are present. The method is also robust to the proportion of censored individuals and the underlying distribution of the trait. On the basis of linear regression methodology, the grouped linear regression model is computationally simple and fast and can be implemented readily in freely available statistical software.
The use of cognitive ability measures as explanatory variables in regression analysis.
Junker, Brian; Schofield, Lynne Steuerle; Taylor, Lowell J
2012-12-01
Cognitive ability measures are often taken as explanatory variables in regression analysis, e.g., as a factor affecting a market outcome such as an individual's wage, or a decision such as an individual's education acquisition. Cognitive ability is a latent construct; its true value is unobserved. Nonetheless, researchers often assume that a test score , constructed via standard psychometric practice from individuals' responses to test items, can be safely used in regression analysis. We examine problems that can arise, and suggest that an alternative approach, a "mixed effects structural equations" (MESE) model, may be more appropriate in many circumstances.
Multiple Imputation of a Randomly Censored Covariate Improves Logistic Regression Analysis.
Atem, Folefac D; Qian, Jing; Maye, Jacqueline E; Johnson, Keith A; Betensky, Rebecca A
2016-01-01
Randomly censored covariates arise frequently in epidemiologic studies. The most commonly used methods, including complete case and single imputation or substitution, suffer from inefficiency and bias. They make strong parametric assumptions or they consider limit of detection censoring only. We employ multiple imputation, in conjunction with semi-parametric modeling of the censored covariate, to overcome these shortcomings and to facilitate robust estimation. We develop a multiple imputation approach for randomly censored covariates within the framework of a logistic regression model. We use the non-parametric estimate of the covariate distribution or the semiparametric Cox model estimate in the presence of additional covariates in the model. We evaluate this procedure in simulations, and compare its operating characteristics to those from the complete case analysis and a survival regression approach. We apply the procedures to an Alzheimer's study of the association between amyloid positivity and maternal age of onset of dementia. Multiple imputation achieves lower standard errors and higher power than the complete case approach under heavy and moderate censoring and is comparable under light censoring. The survival regression approach achieves the highest power among all procedures, but does not produce interpretable estimates of association. Multiple imputation offers a favorable alternative to complete case analysis and ad hoc substitution methods in the presence of randomly censored covariates within the framework of logistic regression.
Directory of Open Access Journals (Sweden)
Køber Lars
2010-01-01
Full Text Available Abstract Background The optimal duration of clopidogrel treatment after percutaneous coronary intervention (PCI is unclear. We studied the risk of death or recurrent myocardial infarction (MI in relation to 6- and 12-months clopidogrel treatment among MI patients treated with PCI. Methods Using nationwide registers of hospitalizations and drug dispensing from pharmacies we identified 11 680 patients admitted with MI, treated with PCI and clopidogrel. Clopidogrel treatment was categorized in a 6-months and a 12-months regimen. Rates of death, recurrent MI or a combination of both were analyzed by the Kaplan Meier method and Cox proportional hazards models. Bleedings were compared between treatment regimens. Results The Kaplan Meier analysis indicated no benefit of the 12-months regimen compared with the 6-months in all endpoints. The Cox proportional hazards analysis confirmed these findings with hazard ratios for the 12-months regimen (the 6-months regimen used as reference for the composite endpoint of 1.01 (confidence intervals 0.81-1.26 and 1.24 (confidence intervals 0.95-1.62 for Day 0-179 and Day 180-540 after discharge. Bleedings occurred in 3.5% and 4.1% of the patients in the 6-months and 12-months regimen (p = 0.06. Conclusions We found comparable rates of death and recurrent MI in patients treated with 6- and 12-months' clopidogrel. The potential benefit of prolonged clopidogrel treatment in a real-life setting remains uncertain.
Temporal trends in sperm count: a systematic review and meta-regression analysis.
Levine, Hagai; Jørgensen, Niels; Martino-Andrade, Anderson; Mendiola, Jaime; Weksler-Derri, Dan; Mindlis, Irina; Pinotti, Rachel; Swan, Shanna H
2017-11-01
Reported declines in sperm counts remain controversial today and recent trends are unknown. A definitive meta-analysis is critical given the predictive value of sperm count for fertility, morbidity and mortality. To provide a systematic review and meta-regression analysis of recent trends in sperm counts as measured by sperm concentration (SC) and total sperm count (TSC), and their modification by fertility and geographic group. PubMed/MEDLINE and EMBASE were searched for English language studies of human SC published in 1981-2013. Following a predefined protocol 7518 abstracts were screened and 2510 full articles reporting primary data on SC were reviewed. A total of 244 estimates of SC and TSC from 185 studies of 42 935 men who provided semen samples in 1973-2011 were extracted for meta-regression analysis, as well as information on years of sample collection and covariates [fertility group ('Unselected by fertility' versus 'Fertile'), geographic group ('Western', including North America, Europe Australia and New Zealand versus 'Other', including South America, Asia and Africa), age, ejaculation abstinence time, semen collection method, method of measuring SC and semen volume, exclusion criteria and indicators of completeness of covariate data]. The slopes of SC and TSC were estimated as functions of sample collection year using both simple linear regression and weighted meta-regression models and the latter were adjusted for pre-determined covariates and modification by fertility and geographic group. Assumptions were examined using multiple sensitivity analyses and nonlinear models. SC declined significantly between 1973 and 2011 (slope in unadjusted simple regression models -0.70 million/ml/year; 95% CI: -0.72 to -0.69; P regression analysis reports a significant decline in sperm counts (as measured by SC and TSC) between 1973 and 2011, driven by a 50-60% decline among men unselected by fertility from North America, Europe, Australia and New Zealand. Because
Takagi, Daisuke; Ikeda, Ken'ichi; Kawachi, Ichiro
2012-11-01
Crime is an important determinant of public health outcomes, including quality of life, mental well-being, and health behavior. A body of research has documented the association between community social capital and crime victimization. The association between social capital and crime victimization has been examined at multiple levels of spatial aggregation, ranging from entire countries, to states, metropolitan areas, counties, and neighborhoods. In multilevel analysis, the spatial boundaries at level 2 are most often drawn from administrative boundaries (e.g., Census tracts in the U.S.). One problem with adopting administrative definitions of neighborhoods is that it ignores spatial spillover. We conducted a study of social capital and crime victimization in one ward of Tokyo city, using a spatial Durbin model with an inverse-distance weighting matrix that assigned each respondent a unique level of "exposure" to social capital based on all other residents' perceptions. The study is based on a postal questionnaire sent to 20-69 years old residents of Arakawa Ward, Tokyo. The response rate was 43.7%. We examined the contextual influence of generalized trust, perceptions of reciprocity, two types of social network variables, as well as two principal components of social capital (constructed from the above four variables). Our outcome measure was self-reported crime victimization in the last five years. In the spatial Durbin model, we found that neighborhood generalized trust, reciprocity, supportive networks and two principal components of social capital were each inversely associated with crime victimization. By contrast, a multilevel regression performed with the same data (using administrative neighborhood boundaries) found generally null associations between neighborhood social capital and crime. Spatial regression methods may be more appropriate for investigating the contextual influence of social capital in homogeneous cultural settings such as Japan. Copyright
Introduction to regression graphics
Cook, R Dennis
2009-01-01
Covers the use of dynamic and interactive computer graphics in linear regression analysis, focusing on analytical graphics. Features new techniques like plot rotation. The authors have composed their own regression code, using Xlisp-Stat language called R-code, which is a nearly complete system for linear regression analysis and can be utilized as the main computer program in a linear regression course. The accompanying disks, for both Macintosh and Windows computers, contain the R-code and Xlisp-Stat. An Instructor's Manual presenting detailed solutions to all the problems in the book is ava
Nájera-Ortiz, J. C.; Sánchez-Pérez, H. J.; Ochoa-Díaz-López, H.; Leal-Fernández, G.; Navarro-Giné, A.
2012-01-01
Objective. To analyse survival in patients with pulmonary tuberculosis (PTB) and factors associated with such survival. Design. Study of a cohort of patients aged over 14 years diagnosed with PTB from January 1, 1998 to July 31, 2005. During 2004–2006 a home visit was made to each patient and, during 2008-2009, they were visited again. During these visits a follow-up interview was administered; when the patient had died, a verbal autopsy was conducted with family members. Statistical analysis consisted of survival tests, Kaplan-Meier log-rank test and Cox regression. Results. Of 305 studied patients, 68 had died due to PTB by the time of the first evaluation, 237 were followed-up for a second evaluation, and 10 of them had died of PTB. According to the Cox regression, age (over 45 years) and treatment duration (under six months) were associated with a poorer survival. When treatment duration was excluded, the association between poorer survival with age persisted, whereas with having been treated via DOTS strategy, was barely significant. Conclusions. In the studied area it is necessary that patients receive a complete treatment scheme, and to give priority to patients aged over 45 years. PMID:22701170
Retention and Healing Outcomes after Intentional Replantation.
Cho, Sin-Yeon; Lee, Yoon; Shin, Su-Jung; Kim, Euiseong; Jung, Il-Young; Friedman, Shimon; Lee, Seung-Jong
2016-06-01
Intentional replantation is an alternative to tooth extraction and prosthetic replacement when conventional endodontic treatment modalities are unfeasible or contraindicated. This study assessed tooth retention and healing after intentional replantation and explored predictors of these outcomes. Data of intentional replantation procedures performed between March 2000 and December 2010 were collected prospectively, excluding teeth with preoperative periodontal and root defects. A cohort of 159 teeth was followed up for 0.5-12 years. Retention and healed status without complications (periapical radiolucency, external root resorption, ankylosis, signs/symptoms, probing ≥6 mm) was recorded and analyzed with Kaplan-Meier survival analysis and Cox proportional hazard regression model (P regression identified extraoral time ≤15 minutes as predictor of complication-free healing (P < .04; hazard ratio, 2.767; 95% confidence interval, 1.053-7.272). This prospective cohort study of contemporary intentional replantation suggested a cumulative 12-year retention rate of 93% and healed rate of 77% after 3 years. Healing occurred 1.7 times more frequently in teeth replanted within 15 minutes. Although most complications occurred within 1 year after replantation, follow-up should extend for at least 3 years to capture late complications. Copyright © 2016 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Yu, Zheng; Peng, Sun; Hong-Ming, Pan; Kai-Feng, Wang
2012-01-01
To investigate the expression of multi-drug resistance-related genes, MDR3 and MRP, in clinical specimens of primary liver cancer and their potential as prognostic factors in liver cancer patients. A total of 26 patients with primary liver cancer were enrolled. The expression of MDR3 and MRP genes was measured by real-time PCR and the association between gene expression and the prognosis of patients was analyzed by the Kaplan-Meier method and COX regression model. This study showed that increases in MDR3 gene expression were identified in cholangiocellular carcinoma, cirrhosis and HBsAg-positive patients, while MRP expression increased in hepatocellular carcinoma, non-cirrhosis and HBsAg-negative patients. Moreover, conjugated bilirubin and total bile acid in the serum were significantly reduced in patients with high MRP expression compared to patients with low expression. The overall survival tended to be longer in patients with high MDR3 and MRP expression compared to the control group. MRP might be an independent prognostic factor in patients with liver cancer by COX regression analysis. MDR3 and MRP may play important roles in liver cancer patients as prognostic factors and their underlying mechanisms in liver cancer are worthy of further investigation.
Directory of Open Access Journals (Sweden)
J. C. Nájera-Ortiz
2012-01-01
Full Text Available Objective. To analyse survival in patients with pulmonary tuberculosis (PTB and factors associated with such survival. Design. Study of a cohort of patients aged over 14 years diagnosed with PTB from January 1, 1998 to July 31, 2005. During 2004–2006 a home visit was made to each patient and, during 2008-2009, they were visited again. During these visits a follow-up interview was administered; when the patient had died, a verbal autopsy was conducted with family members. Statistical analysis consisted of survival tests, Kaplan-Meier log-rank test and Cox regression. Results. Of 305 studied patients, 68 had died due to PTB by the time of the first evaluation, 237 were followed-up for a second evaluation, and 10 of them had died of PTB. According to the Cox regression, age (over 45 years and treatment duration (under six months were associated with a poorer survival. When treatment duration was excluded, the association between poorer survival with age persisted, whereas with having been treated via DOTS strategy, was barely significant. Conclusions. In the studied area it is necessary that patients receive a complete treatment scheme, and to give priority to patients aged over 45 years.
McHugh, Matthew D
2007-11-01
To determine if readiness for change (RFC) at admission predicted length of stay (LOS) and short-term outcomes among female adolescents in residential treatment for anorexia nervosa (AN). Using a prospective cohort design to collect data from participants (N = 65) at admission and discharge, Kaplan-Meier survival analysis and Cox regression tested whether RFC on admission predicted time in LOS to a favorable short-term outcome--a composite endpoint based on minimum criteria for weight gain, drive for thinness, depression, anxiety, and health-related quality of life (HRQOL). Participants with low RFC had a mean survival time to a favorable short-term outcome of 59.4 days compared to 34.1 days for those with high RFC (log rank = 8.44, df = 1, p = .003). The probability of a favorable short-term outcome was 5.30 times greater for participants with high RFC. Readiness for change is a useful predictor of a favorable short-term outcome and should be considered in the assessment profile of patients with AN. (c) 2007 by Wiley Periodicals, Inc.
Prognostic Factors of Uterine Serous Carcinoma-A Multicenter Study.
Zhong, Xiaozhu; Wang, Jianliu; Kaku, Tengen; Wang, Zhiqi; Li, Xiaoping; Wei, Lihui
2018-04-04
The prognostic factors of uterine serous carcinoma (USC) vary among studies, and there is no report of Chinese USC patients. The aim of this study was to investigate the clinicopathological characteristics and prognostic factors in Chinese patients with USC. Patients with USC from 13 authoritative university hospitals in China and treated between 2004 and 2014 were retrospectively reviewed. Three-year disease-free survival rate (DFSR), cumulative recurrence, and cumulative mortality were estimated by Kaplan-Meier analyses and log-rank tests. Multivariate Cox regression analysis was used to model the association of potential prognostic factors with clinical outcomes. Data of a total of 241 patients were reviewed. The median follow-up was 26 months (range, 1-128 months). Median age was 60 years (range, 39-84 years), and 58.0% had stages I-II disease. The 3-year DFSR and cumulative recurrence were 46.8% and 27.7%. Advanced stage (III and IV) (P = 0.004), myometrial invasion (P = 0.001), adnexal involvement (P USC. Prospective studies are needed to confirm these results.
Morales-Buenrostro, Luis E; Marino-Vázquez, Lluvia A; Alberú, Josefina
2009-01-01
This is a retrospective study that includes four decades of kidney transplant program at our Institute, with a total of 923 kidney transplants in 872 recipients. In this report, the effect of variables in recipient, donor, and transplant on long-term graft survival was analyzed using the Kaplan Meier method with log-rank test for survival comparisons. Global graft survival at our center-analyzed by censoring for death-with-functioning-graft-for 1, 5 and 10 years was 93%, 83% and 74%, respectively, with median survival of 24.5 years. When analyzed for all-cause graft loss, 1, 5 and 10 year survival was 90%, 76% and 61%, with 12.8-year median survival. Variables associated with lower graft survival censored for death-with-functioning-graft were transplantation in an earlier decade, less histocompatibility, younger kidney transplant recipients, no induction therapy, and double drug initial immunosuppression. After Cox's regression multivariate analysis, the risk factors that remained associated with worse survival were younger recipient, earlier transplant decade, and deceased donor.
Wan, Ke; Sun, Jiayu; Han, Yuchi; Liu, Hong; Yang, Dan; Li, Weihao; Wang, Jie; Cheng, Wei; Zhang, Qing; Zeng, Zhi; Chen, Yucheng
2018-02-23
Late gadolinium enhancement (LGE) pattern is a powerful imaging biomarker for prognosis of cardiac amyloidosis. It is unknown if the query amyloid late enhancement (QALE) score in light-chain (AL) amyloidosis could provide increased prognostic value compared with LGE pattern.Methods and Results:Seventy-eight consecutive patients with AL amyloidosis underwent contrast-enhanced cardiovascular magnetic resonance imaging. Patients with cardiac involvement were grouped by LGE pattern and analyzed using QALE score. Receiver operating characteristic curve was used to identify the optimal cut-off for QALE score in predicting all-cause mortality. Survival of these patients was analyzed with the Kaplan-Meier method and multivariate Cox regression. During a median follow-up of 34 months, 53 of 78 patients died. The optimal cut-off for QALE score to predict mortality at 12-month follow-up was 9.0. On multivariate Cox analysis, QALE score ≥9 (HR, 5.997; 95% CI: 2.665-13.497; Pvalue in AL cardiac amyloidosis. QALE score ≥9 has added value to differentiate prognosis in AL amyloidosis patients with a subendocardial LGE pattern.
Wei, Xue-Biao; Liu, Yuan-Hui; He, Peng-Cheng; Yu, Dan-Qing; Zhou, Ying-Ling; Tan, Ning; Chen, Ji-Yan
2017-05-01
Background Limited research studies with a large sample size were performed to evaluate the prognostic value of N-terminal pro-B-type natriuretic peptide (NT-proBNP) for in-hospital or long-term poor outcomes in patients with infective endocarditis. Methods A total of 703 patients with infective endocarditis were enrolled and divided into four groups according to admission NT-pro-BNP (pg/mL) quartiles: Q1 (3522). Multivariate regression was used to determine independent risk of NT-proBNP for in-hospital and one-year death. Results In-hospital death occurred in 9.0% of patients. The in-hospital mortality was increased from the lowest to the highest NT-proBNP quartiles (1.1%, 3.4%, 9.1% and 22.3%, P 2260 pg/mL had 76.2% sensitivity and 69.1% specificity for predicting in-hospital death. Kaplan-Meier analysis showed that patients with NT-proBNP > 2260 pg/ml had a worse prognosis than those without (log-rank test 18.84, P endocarditis.
Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage.
Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung
2014-07-01
In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and 2.86 days and were quicker compared with that in the UV only group (4.21 days); (2) zebrafish fins in the UV+comfrey (50 and 100 ppm) groups were 2.05 and 3.25 times more likely to return to normal than those in the UV only group; and (3) comfrey leave extracts had UV-absorbance abilities and significantly reduced ROS production in UV-exposed zebrafish embryos, which may attenuate UV-mediated apoptosis. In conclusion, comfrey leaves extracts may have the potential to be developed as UV-protective agents to protect zebrafish embryos from UV-induced damage.
Directory of Open Access Journals (Sweden)
Chao Hsing-Lung
2010-05-01
Full Text Available Abstract Background To analyze the rate of larynx preservation in patients of locally advanced hypopharyngeal cancer treated with intensity modulated radiotherapy (IMRT plus concurrent chemotherapy, and compare the results with patients treated with primary surgery. Methods Between January 2003 and November 2007, 14 patients were treated with primary surgery and 33 patients were treated with concurrent chemoradiotherapy (CCRT using IMRT technique. Survival rate, larynx preservation rate were calculated with the Kaplan-Meier method. Multivariate analysis was conducted for significant prognostic factors with Cox-regression method. Results The median follow-up was 19.4 months for all patients, and 25.8 months for those alive. The 5-year overall survival rate was 33% and 44% for primary surgery and definitive CCRT, respectively (p = 0.788. The 5-year functional larynx-preservation survival after IMRT was 40%. Acute toxicities were common, but usually tolerable. The rates of treatment-related mucositis (≥ grade 2 and pharyngitis (≥ grade 3 were higher in the CCRT group. For multivariate analysis, treatment response and cricoid cartilage invasion strongly correlated with survival. Conclusions IMRT plus concurrent chemotherapy may preserve the larynx without compromising survival. Further studies on new effective therapeutic agents are essential.
Bernal-Morell, Enrique; García-Villalba, Eva; Vera, Maria Del Carmen; Medina, Blanca; Martinez, Monica; Callejo, Victoria; Valero, Salvador; Cinesi, Cesar; Piñera, Pascual; Alcaraz, Antonia; Marin, Irene; Muñoz, Angeles; Cano, Alfredo
2018-03-01
Midregional proadrenomedullin (MR-proADM) is a prognostic biomarker in patients with community-acquired pneumonia (CAP) and sepsis. In this paper, we examined the ability of MR-proADM to predict organ damage and long-term mortality in sepsis patients, compared to that of procalcitonin, C-reactive protein and lactate. This was a prospective observational cohort, enrolling severe sepsis or septic shock patients admitted to internal service department. The association between biomarkers and 90-day mortality was assessed by Cox regression analysis and Kaplan-Meier curves. The accuracy of biomarkers for mortality was determined by area under the receiver operating characteristic curve (AUROC) analysis. A total of 148 patients with severe sepsis, according to the criteria of the campaign to survive sepsis, were enrolled. Eighty-five (57.4%) had sepsis according to the new criteria of Sepsis-3. MR-proADM showed the best AUROC to predict sepsis as defined by the Sepsis-3 criteria (AUROC of 0.771, 95% CI 0.692-0.850, p scale, especially when scores are low. Copyright © 2017 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
Analysis of γ spectra in airborne radioactivity measurements using multiple linear regressions
International Nuclear Information System (INIS)
Bao Min; Shi Quanlin; Zhang Jiamei
2004-01-01
This paper describes the net peak counts calculating of nuclide 137 Cs at 662 keV of γ spectra in airborne radioactivity measurements using multiple linear regressions. Mathematic model is founded by analyzing every factor that has contribution to Cs peak counts in spectra, and multiple linear regression function is established. Calculating process adopts stepwise regression, and the indistinctive factors are eliminated by F check. The regression results and its uncertainty are calculated using Least Square Estimation, then the Cs peak net counts and its uncertainty can be gotten. The analysis results for experimental spectrum are displayed. The influence of energy shift and energy resolution on the analyzing result is discussed. In comparison with the stripping spectra method, multiple linear regression method needn't stripping radios, and the calculating result has relation with the counts in Cs peak only, and the calculating uncertainty is reduced. (authors)
Ulbrich, N.; Volden, T.
2018-01-01
Analysis and use of temperature-dependent wind tunnel strain-gage balance calibration data are discussed in the paper. First, three different methods are presented and compared that may be used to process temperature-dependent strain-gage balance data. The first method uses an extended set of independent variables in order to process the data and predict balance loads. The second method applies an extended load iteration equation during the analysis of balance calibration data. The third method uses temperature-dependent sensitivities for the data analysis. Physical interpretations of the most important temperature-dependent regression model terms are provided that relate temperature compensation imperfections and the temperature-dependent nature of the gage factor to sets of regression model terms. Finally, balance calibration recommendations are listed so that temperature-dependent calibration data can be obtained and successfully processed using the reviewed analysis methods.
Labhardt, Niklaus Daniel; Keiser, Olivia; Sello, Motlalepula; Lejone, Thabo Ishmael; Pfeiffer, Karolin; Davies, Mary-Ann; Egger, Matthias; Ehmer, Jochen; Wandeler, Gilles
2013-11-21
Lesotho was among the first countries to adopt decentralization of care from hospitals to nurse-led health centres (HCs) to scale up the provision of antiretroviral therapy (ART). We compared outcomes between patients who started ART at HCs and hospitals in two rural catchment areas in Lesotho. The two catchment areas comprise two hospitals and 12 HCs. Patients ≥16 years starting ART at a hospital or HC between 2008 and 2011 were included. Loss to follow-up (LTFU) was defined as not returning to the facility for ≥180 days after the last visit, no follow-up (no FUP) as not returning after starting ART, and retention in care as alive and on ART at the facility. The data were analysed using logistic regression, competing risk regression and Kaplan-Meier methods. Multivariable analyses were adjusted for sex, age, CD4 cell count, World Health Organization stage, catchment area and type of ART. All analyses were stratified by gender. Of 3747 patients, 2042 (54.5%) started ART at HCs. Both women and men at hospitals had more advanced clinical and immunological stages of disease than those at HCs. Over 5445 patient-years, 420 died and 475 were LTFU. Kaplan-Meier estimates for three-year retention were 68.7 and 69.7% at HCs and hospitals, respectively, among women (p=0.81) and 68.8% at HCs versus 54.7% at hospitals among men (phospitals among women (odds ratio (OR): 0.89, 95% confidence interval (CI): 0.73-1.09) and higher retention at HCs among men (OR: 1.53, 95% CI: 1.20-1.96). The latter result was mainly driven by a lower proportion of patients LTFU at HCs (OR: 0.68, 95% CI: 0.51-0.93). In rural Lesotho, overall retention in care did not differ significantly between nurse-led HCs and hospitals. However, men seemed to benefit most from starting ART at HCs, as they were more likely to remain in care in these facilities compared to hospitals.
Kovalska, M P; Bürki, E; Schoetzau, A; Orguel, S F; Orguel, S; Grieshaber, M C
2011-04-01
The distinction of real progression from test variability in visual field (VF) series may be based on clinical judgment, on trend analysis based on follow-up of test parameters over time, or on identification of a significant change related to the mean of baseline exams (event analysis). The aim of this study was to compare a new population-based method (Octopus field analysis, OFA) with classic regression analyses and clinical judgment for detecting glaucomatous VF changes. 240 VF series of 240 patients with at least 9 consecutive examinations available were included into this study. They were independently classified by two experienced investigators. The results of such a classification served as a reference for comparison for the following statistical tests: (a) t-test global, (b) r-test global, (c) regression analysis of 10 VF clusters and (d) point-wise linear regression analysis. 32.5 % of the VF series were classified as progressive by the investigators. The sensitivity and specificity were 89.7 % and 92.0 % for r-test, and 73.1 % and 93.8 % for the t-test, respectively. In the point-wise linear regression analysis, the specificity was comparable (89.5 % versus 92 %), but the sensitivity was clearly lower than in the r-test (22.4 % versus 89.7 %) at a significance level of p = 0.01. A regression analysis for the 10 VF clusters showed a markedly higher sensitivity for the r-test (37.7 %) than the t-test (14.1 %) at a similar specificity (88.3 % versus 93.8 %) for a significant trend (p = 0.005). In regard to the cluster distribution, the paracentral clusters and the superior nasal hemifield progressed most frequently. The population-based regression analysis seems to be superior to the trend analysis in detecting VF progression in glaucoma, and may eliminate the drawbacks of the event analysis. Further, it may assist the clinician in the evaluation of VF series and may allow better visualization of the correlation between function and structure owing to VF
International Nuclear Information System (INIS)
Zhu Wanqi; Yu Jinming; Sun Xiaorong; Xing Ligang; Xie Peng; Sun Xindong; Guo Hongbo; Yang Guoren; Kong Li
2011-01-01
Objective: To evaluate the prognostic value of MTV on 18 F-FDG PET/CT in patients with esophageal cancer. Methods: Forty-nine patients with esophageal cancer underwent 18 F-FDG PET/CT scan before surgery. The median follow-up time for the patients was 29 months (range, 8-57 months). The prognostic significance of MTV, age, sex, histologic grade, SUV max of the primary tumor, tumor size measured on PET/CT, T stage, N stage, M stage, American Joint Committee on Cancer (AJCC) stage, number and location of lymph nodes metastases were assessed by Kaplan-Meier analysis and multivariate Cox model. Results: In the univariate analysis, AJCC stage (χ 2 =16.206, hazard ratio (HR)=1.177, P<0.001), N stage (χ 2 =9.536, HR=10.833, P=0.002), T stage (χ 2 =5.810, HR=2.397, P=0.016), number of lymph nodes metastases (χ 2 =11.423, HR=1.567, P=0.001), and MTV (χ 2 =3.872, HR=2.433, P=0.049) were significant predictors of survival.Multivariate analysis showed that MTV and AJCC stage were independent predictors of survival (χ 2 =4.525, HR 1.170, P=0.033; χ 2 =4.875, HR=3.071, P=0.027). Kaplan-Meier survival curves revealed longer survival time of low-MTV group as compared to high-MTV group (Log-rank, χ 2 =4.186, P=0.041). Conclusion: MTV on 18 F-FDG PET/CT may be an independent prognostic factor in patients with esophageal cancer. (authors)
Selective principal component regression analysis (SPCR) uses a subset of the original image bands for principal component transformation and regression. For optimal band selection before the transformation, this paper used genetic algorithms (GA). In this case, the GA process used the regression co...
Determining Balıkesir’s Energy Potential Using a Regression Analysis Computer Program
Directory of Open Access Journals (Sweden)
Bedri Yüksel
2014-01-01
Full Text Available Solar power and wind energy are used concurrently during specific periods, while at other times only the more efficient is used, and hybrid systems make this possible. When establishing a hybrid system, the extent to which these two energy sources support each other needs to be taken into account. This paper is a study of the effects of wind speed, insolation levels, and the meteorological parameters of temperature and humidity on the energy potential in Balıkesir, in the Marmara region of Turkey. The relationship between the parameters was studied using a multiple linear regression method. Using a designed-for-purpose computer program, two different regression equations were derived, with wind speed being the dependent variable in the first and insolation levels in the second. The regression equations yielded accurate results. The computer program allowed for the rapid calculation of different acceptance rates. The results of the statistical analysis proved the reliability of the equations. An estimate of identified meteorological parameters and unknown parameters could be produced with a specified precision by using the regression analysis method. The regression equations also worked for the evaluation of energy potential.
Simple multiple regression model for long range forecasting of Indian summer monsoon rainfall
Digital Repository Service at National Institute of Oceanography (India)
Sadhuram, Y.; Murthy, T.V.R.
, Wang J, Roy J, Dennis J (1996) The NCEP=NCAR 40-year reanalysis project. Bull Amer Meteorol Soc 77: 437–71 Kaplan A, Cane MA, Kushner Y, Clement AC, Blumenthal MB, Rajagopalan B (1998) Analysis of global sea-surface temperature: 1856–1991. J Geophys Res...
Covariate Imbalance and Adjustment for Logistic Regression Analysis of Clinical Trial Data
Ciolino, Jody D.; Martin, Reneé H.; Zhao, Wenle; Jauch, Edward C.; Hill, Michael D.; Palesch, Yuko Y.
2014-01-01
In logistic regression analysis for binary clinical trial data, adjusted treatment effect estimates are often not equivalent to unadjusted estimates in the presence of influential covariates. This paper uses simulation to quantify the benefit of covariate adjustment in logistic regression. However, International Conference on Harmonization guidelines suggest that covariate adjustment be pre-specified. Unplanned adjusted analyses should be considered secondary. Results suggest that that if adjustment is not possible or unplanned in a logistic setting, balance in continuous covariates can alleviate some (but never all) of the shortcomings of unadjusted analyses. The case of log binomial regression is also explored. PMID:24138438
Directory of Open Access Journals (Sweden)
Li-Kun Hou
Full Text Available This study aims to explore the expression pattern and prognostic significance of miR-33a in non-small cell lung cancer (NSCLC treated with adjuvant chemotherapy.MiR-33aexpression in NSCLC was analyzed in silico using the GEO database and was subsequently confirmed by quantitative RT-PCR in 147 NSCLC biopsies. Among these, 32 of these biopsies were paired with adjacent non-neoplastic tissues. The survival analysis of NSCLC by Kaplan-Meier estimates was stratified based on miR-33a expression. In addition, multivariate survival analysis in corresponding groups of NSCLC patients was conducted by Cox proportional hazards regression model.The in silico analysis of miR-33a expression in NSCLC resulted to its down-regulation in different tumor types. The expression level of miR-33a was lower in each grade of NSCLC tumor biopsies than in normal lung tissues. Univariate and multivariate survival analysis further established that low miR-33a expression was an important risk factor for overall survival and disease free survival in NSCLC patients.Our study implied that miR-33a expression levels may have an essential role in NSCLC progression, and could act as a specific and sensitive biomarker for NSCLC patients who have undergone adjuvant chemotherapy.
Declining Bias and Gender Wage Discrimination? A Meta-Regression Analysis
Jarrell, Stephen B.; Stanley, T. D.
2004-01-01
The meta-regression analysis reveals that there is a strong tendency for discrimination estimates to fall and wage discrimination exist against the woman. The biasing effect of researchers' gender of not correcting for selection bias has weakened and changes in labor market have made it less important.
DEFF Research Database (Denmark)
Charlot, Mette; Grove, Erik; Hansen, Peter Riis
2011-01-01
: All aspirin treated patients surviving 30 days after a first myocardial infarction from 1997 to 2006, with follow-up for one year. Patients treated with clopidogrel were excluded. MAIN OUTCOME MEASURES: The risk of the combined end point of cardiovascular death, myocardial infarction, or stroke...... associated with use of proton pump inhibitors was analysed using Kaplan-Meier analysis, Cox proportional hazard models, and propensity score matched Cox proportional hazard models. Results 3366 of 19 925 (16.9%) aspirin treated patients experienced recurrent myocardial infarction, stroke, or cardiovascular...
DEFF Research Database (Denmark)
van Keimpema, Loes; Nevens, Frederik; Adam, René
2011-01-01
Patients with end-stage isolated polycystic liver disease (PCLD) suffer from incapacitating symptoms because of very large liver volumes. Liver transplantation (LT) is the only curative option. This study assesses the feasibility of LT in PCLD. We used the European Liver Transplant Registry (ELTR......) database to extract demographics and outcomes of 58 PCLD patients. We used Kaplan-Meier survival analysis for survival rates. Severe abdominal pain (75%) was the most prominent symptom, while portal hypertension (35%) was the most common complication in PCLD. The explantation of the polycystic liver...
Clinical Features in a Danish Population-Based Cohort of Probable Multiple System Atrophy Patients
DEFF Research Database (Denmark)
Starhof, Charlotte; Korbo, Lise; Lassen, Christina Funch
2016-01-01
Background: Multiple system atrophy (MSA) is a rare, sporadic and progressive neurodegenerative disorder. We aimed to describe the clinical features of Danish probable MSA patients, evaluate their initial response to dopaminergic therapy and examine mortality. Methods: From the Danish National...... the criteria for probable MSA. We recorded clinical features, examined differences by MSA subtype and used Kaplan-Meier survival analysis to examine mortality. Results: The mean age at onset of patients with probable MSA was 60.2 years (range 36-75 years) and mean time to wheelchair dependency was 4.7 years...
The influence of obesity on response to tumour necrosis factor-α inhibitors in psoriatic arthritis
DEFF Research Database (Denmark)
Højgaard, Pil; Glintborg, Bente; Kristensen, Lars Erik
2016-01-01
OBJECTIVES: To investigate the impact of obesity on response to the first TNF-α inhibitor (TNFI) treatment course in patients with PsA followed in routine care. METHODS: We performed an observational cohort study based on the Danish and Icelandic biologics registries. Kaplan-Meier plots, Cox and ...
Statistical methods in regression and calibration analysis of chromosome aberration data
International Nuclear Information System (INIS)
Merkle, W.
1983-01-01
The method of iteratively reweighted least squares for the regression analysis of Poisson distributed chromosome aberration data is reviewed in the context of other fit procedures used in the cytogenetic literature. As an application of the resulting regression curves methods for calculating confidence intervals on dose from aberration yield are described and compared, and, for the linear quadratic model a confidence interval is given. Emphasis is placed on the rational interpretation and the limitations of various methods from a statistical point of view. (orig./MG)
Lakatos, Peter Laszlo; Czegledi, Zsofia; Szamosi, Tamas; Banai, Janos; David, Gyula; Zsigmond, Ferenc; Pandur, Tunde; Erdelyi, Zsuzsanna; Gemela, Orsolya; Papp, Janos; Lakatos, Laszlo
2009-07-28
To assess the combined effect of disease phenotype, smoking and medical therapy [steroid, azathioprine (AZA), AZA/biological therapy] on the probability of disease behavior change in a Caucasian cohort of patients with Crohn's disease (CD). Three hundred and forty well-characterized, unrelated, consecutive CD patients were analyzed (M/F: 155/185, duration: 9.4 +/- 7.5 years) with a complete clinical follow-up. Medical records including disease phenotype according to the Montreal classification, extraintestinal manifestations, use of medications and surgical events were analyzed retrospectively. Patients were interviewed on their smoking habits at the time of diagnosis and during the regular follow-up visits. A change in disease behavior was observed in 30.8% of patients with an initially non-stricturing, non-penetrating disease behavior after a mean disease duration of 9.0 +/- 7.2 years. In a logistic regression analysis corrected for disease duration, perianal disease, smoking, steroid use, early AZA or AZA/biological therapy use were independent predictors of disease behavior change. In a subsequent Kaplan-Meier survival analysis and a proportional Cox regression analysis, disease location (P = 0.001), presence of perianal disease (P < 0.001), prior steroid use (P = 0.006), early AZA (P = 0.005) or AZA/biological therapy (P = 0.002), or smoking (P = 0.032) were independent predictors of disease behavior change. Our data suggest that perianal disease, small bowel disease, smoking, prior steroid use, early AZA or AZA/biological therapy are all predictors of disease behavior change in CD patients.
Energy Technology Data Exchange (ETDEWEB)
Martin, Katherine J.; Patrick, Denis R.; Bissell, Mina J.; Fournier, Marcia V.
2008-10-20
One of the major tenets in breast cancer research is that early detection is vital for patient survival by increasing treatment options. To that end, we have previously used a novel unsupervised approach to identify a set of genes whose expression predicts prognosis of breast cancer patients. The predictive genes were selected in a well-defined three dimensional (3D) cell culture model of non-malignant human mammary epithelial cell morphogenesis as down-regulated during breast epithelial cell acinar formation and cell cycle arrest. Here we examine the ability of this gene signature (3D-signature) to predict prognosis in three independent breast cancer microarray datasets having 295, 286, and 118 samples, respectively. Our results show that the 3D-signature accurately predicts prognosis in three unrelated patient datasets. At 10 years, the probability of positive outcome was 52, 51, and 47 percent in the group with a poor-prognosis signature and 91, 75, and 71 percent in the group with a good-prognosis signature for the three datasets, respectively (Kaplan-Meier survival analysis, p<0.05). Hazard ratios for poor outcome were 5.5 (95% CI 3.0 to 12.2, p<0.0001), 2.4 (95% CI 1.6 to 3.6, p<0.0001) and 1.9 (95% CI 1.1 to 3.2, p = 0.016) and remained significant for the two larger datasets when corrected for estrogen receptor (ER) status. Hence the 3D-signature accurately predicts breast cancer outcome in both ER-positive and ER-negative tumors, though individual genes differed in their prognostic ability in the two subtypes. Genes that were prognostic in ER+ patients are AURKA, CEP55, RRM2, EPHA2, FGFBP1, and VRK1, while genes prognostic in ER patients include ACTB, FOXM1 and SERPINE2 (Kaplan-Meier p<0.05). Multivariable Cox regression analysis in the largest dataset showed that the 3D-signature was a strong independent factor in predicting breast cancer outcome. The 3D-signature accurately predicts breast cancer outcome across multiple datasets and holds prognostic
Energy Technology Data Exchange (ETDEWEB)
Giganti, Francesco; Salerno, Annalaura; Marra, Paolo; Esposito, Antonio; Del Maschio, Alessandro; De Cobelli, Francesco [Department of Radiology and Centre for Experimental Imaging San Raffaele Scientific Institute, Milan (Italy); San Raffaele Vita-Salute University, Milan (Italy); Antunes, Sofia [San Raffaele Scientific Institute, Centre for Experimental Imaging, Milan (Italy); Ambrosi, Alessandro [San Raffaele Vita-Salute University, Milan (Italy); Nicoletti, Roberto [Department of Radiology and Centre for Experimental Imaging San Raffaele Scientific Institute, Milan (Italy); Orsenigo, Elena [San Raffaele Scientific Institute, Department of Surgery, Milan (Italy); Chiari, Damiano; Staudacher, Carlo [San Raffaele Vita-Salute University, Milan (Italy); San Raffaele Scientific Institute, Department of Surgery, Milan (Italy); Albarello, Luca [San Raffaele Scientific Institute, Pathology Unit, Milan (Italy)
2017-05-15
To investigate the association between preoperative texture analysis from multidetector computed tomography (MDCT) and overall survival in patients with gastric cancer. Institutional review board approval and informed consent were obtained. Fifty-six patients with biopsy-proved gastric cancer were examined by MDCT and treated with surgery. Image features from texture analysis were quantified, with and without filters for fine to coarse textures. The association with survival time was assessed using Kaplan-Meier and Cox analysis. The following parameters were significantly associated with a negative prognosis, according to different thresholds: energy [no filter] - Logarithm of relative risk (Log RR): 3.25; p = 0.046; entropy [no filter] (Log RR: 5.96; p = 0.002); entropy [filter 1.5] (Log RR: 3.54; p = 0.027); maximum Hounsfield unit value [filter 1.5] (Log RR: 3.44; p = 0.027); skewness [filter 2] (Log RR: 5.83; p = 0.004); root mean square [filter 1] (Log RR: - 2.66; p = 0.024) and mean absolute deviation [filter 2] (Log RR: - 4.22; p = 0.007). Texture analysis could increase the performance of a multivariate prognostic model for risk stratification in gastric cancer. Further evaluations are warranted to clarify the clinical role of texture analysis from MDCT. (orig.)
Cruz-Oliver, D M; Malmstrom, T K; Allen, C M; Tumosa, N; Morley, J E
2012-07-01
To evaluate predictive validity of cognitive dysfunction of the Saint Louis University mental status (SLUMS) exam or mini-mental state exam (MMSE) for institutionalization and mortality after 7.5-years. Longitudinal study. Geriatric Research, Education and Clinical Center Veterans Affairs Hospital St. Louis, MO. Patients (N=705) were screened for cognitive dysfunction in 2003 using the SLUMS exam and MMSE, and mortality and institutionalization up to 7.5-years later were evaluated as outcome measures. The associations between outcome measures and MMSE and SLUMS exam total scores, and cognitive status were examined using Kaplan-Meier curves and Cox proportional-hazards regression. Five hundred thirty-three charts were reviewed, 176/533(33%) patients had died and 31/526 (6%) were institutionalized during 7.5-year follow-up period. All subjects were male with a mean age of 75 years and most had high school education or greater (71%). MMSE dementia, SLUMS dementia (ps<.001) and MCI (p<.05) groups had significantly lower survival rates than normal cognition group in the Kaplan-Meier curves. Scores classified as dementia on SLUMS (HR=2.4, 95% CI 1.6-3.7; p <.001) or MMSE (HR=2.3, 95% CI 1.5-3.6; p <.001) both predicted mortality and, also, institutionalization (SLUMS: HR=3.5, 95% CI 1.3-9.1; p <.01; MMSE: HR=3.8, 95% CI 1.6-9.0; p <.001) after adjustment for covariates. Unadjusted SLUMS exam MCI predicted morality (HR=1.5, 95% CI 1.1-2.2; p <.019) but not institutionalization. The SLUMS exam and MMSE both predict mortality and institutionalization for male patients screened as positive for dementia.
International Nuclear Information System (INIS)
Hanks, Gerald E.; Hanlon, Alexandra L. M.S.; Schultheiss, Timothy E.; Pinover, Wayne H.; Movsas, Benjamin; Epstein, Barry E.; Hunt, Margie
1998-01-01
Purpose: To report the 5-year outcomes of dose escalation with 3D conformal treatment (3DCRT) of prostate cancer. Methods and Materials: Two hundred thirty-two consecutive patients were treated with 3DCRT alone between 6/89 and 10/92 with ICRU reporting point dose that increased from 63 to 79 Gy. The median follow-up was 60 months, and any patient free of clinical or biochemical evidence of disease was termed bNED. Biochemical failure was defined as prostate-specific antigen (PSA) rising on two consecutive recordings and exceeding 1.5 ng/ml. Morbidity was reported by the Radiation Therapy Oncology Group (RTOG) scale, the Late Effects Normal Tissue (LENT) scale, and a Fox Chase modification of the latter (FC-LENT). All patients were treated with a four-field technique with a 1 cm clinical target volume (CTV) to planning target volume (PTV) margin to the prostate or prostate boost; the CTV and gross tumor volume (GTV) were the same. Actuarial rates of outcome were calculated by Kaplan-Meier and cumulative incidence methods and compared using the log rank and Gray's test statistic, respectively. Cox regression models were used to establish prognostic factors predictive of the various measures of outcome. Five-year Kaplan-Meier bNED rates were utilized by dose group to estimate logit response models for bNED and late morbidity. Results: PSA 10 ng/ml based on 5-year bNED results. No dose response was observed for patients with pretreatment PSA 10 ng/ml strongly suggests that clinical trials employing radiation should investigate the use of 3DCRT and prostate doses of 76-80 Gy
Energy Technology Data Exchange (ETDEWEB)
Dong, Yi-Yuan [Affiliated Hospital of Guilin Medical University, Department of Radiation Oncology, Guilin (China); Guilin Medical University Affiliated Hospital, Department of Otorhinolaryngology, Guilin (China); Xiang, Chun [Nan Xishan Hospital, Department of Otorhinolaryngology, Guilin (China); Lu, Jian-Xun [Affiliated Hospital of Youjiang Medical University for Nationalities, Department of Oncology, Baise (China); Su, Yi-Xin [Lingshan People' s Hospital, Department of Radiation Oncology, Lingshan (China); Pan, Yu-Fei [Nan Xishan Hospital, Department of Radiation Oncology, Guilin (China); Cai, Rui; Zhang, Rong-Jun; He, Zhuo-Kai; Liu, Mei-Lian; Huang, Hui; Bai, Xue; Tang, Hua-Ying; Shi, Yun-Hua; Wang, Yan; Jiang, Wei [Affiliated Hospital of Guilin Medical University, Department of Radiation Oncology, Guilin (China)
2016-06-15
The benefit of adjuvant chemotherapy (AC) in locoregionally advanced nasopharyngeal carcinoma (NPC) is controversial. This study compared concurrent chemoradiotherapy plus AC (CCRT/AC) with CCRT. Pair-matched analysis based on eight clinicopathological features of 244 patients treated with platinum-based CCRT/AC or CCRT alone was performed. Survival outcomes were assessed using the Kaplan-Meier method and log-rank test. Toxicities and response rates were compared using Fisher's exact test. Four-year overall survival, progression-free survival, distant failure-free survival, and locoregional failure-free survival were 72 %, 61 %, 71 %, and 81 %, respectively, for the CCRT arm, compared to 74 % (hazard ratio, HR 0.89; 95 % confidence interval, CI 0.64-1.23; P = 0.474), 62 % (HR 0.91, 95 % CI 0.68-1.20, P = 0.489), 73 % (HR 0.84, 95 % CI 0.59-1.18, P = 0.316), and 84 % (HR 0.84, 95 % CI 0.52-1.24, P = 0.323), respectively, for the CCRT/AC arm. Cox multivariate regression analysis demonstrated AC was not an independent prognostic factor. Overall, there was a higher incidence of grade 3-4 toxicities in the CCRT/AC arm. The most common grade 3-4 adverse events in the CCRT/AC arm were vomiting (27 %), nausea (43 %), leukopenia/neutropenia (23 %), thrombocytopenia (8.8 %), and anemia (6.2 %). Addition of AC to CCRT increased toxicities but did not improve survival in locoregionally advanced NPC. (orig.) [German] Der Nutzen der adjuvanten Chemotherapie (AC) bei lokoregional fortgeschrittenem nasopharyngealem Karzinom (NPC) ist kontrovers. In dieser Studie wurde die simultane Radiochemotherapie (''concurrent chemoradiotherapy'', CCRT) plus adjuvante Chemotherapie (AC) mit einer alleinigen CCRT verglichen. Die Matched-pair-Analyse basiert auf acht klinisch-pathologischen Merkmalen von 244 Patienten, die mit platinbasierter CCRT/AC oder alleiniger CCRT behandelt wurden. Die Ueberlebensendpunkte wurden mit der Kaplan-Meier-Methode und dem Log
Length bias correction in gene ontology enrichment analysis using logistic regression.
Mi, Gu; Di, Yanming; Emerson, Sarah; Cumbie, Jason S; Chang, Jeff H
2012-01-01
When assessing differential gene expression from RNA sequencing data, commonly used statistical tests tend to have greater power to detect differential expression of genes encoding longer transcripts. This phenomenon, called "length bias", will influence subsequent analyses such as Gene Ontology enrichment analysis. In the presence of length bias, Gene Ontology categories that include longer genes are more likely to be identified as enriched. These categories, however, are not necessarily biologically more relevant. We show that one can effectively adjust for length bias in Gene Ontology analysis by including transcript length as a covariate in a logistic regression model. The logistic regression model makes the statistical issue underlying length bias more transparent: transcript length becomes a confounding factor when it correlates with both the Gene Ontology membership and the significance of the differential expression test. The inclusion of the transcript length as a covariate allows one to investigate the direct correlation between the Gene Ontology membership and the significance of testing differential expression, conditional on the transcript length. We present both real and simulated data examples to show that the logistic regression approach is simple, effective, and flexible.
Directory of Open Access Journals (Sweden)
Giuseppe Bonaccorso
2014-06-01
. The most important aspects of the eastern quadrant of the Roman periphery are described “from the inside”, accentuating the passages, spaces and elements of composition standing in the origin of form and structure of the neighborhoods in the vicinity of Great Circular Road. The article proposes that the key episodes in this process are the new churches by internationally famous architects, created as new focal points for peripheral neighborhoods whilst replacing libraries, squares and malls. Recent realizations are seen as intention to enforce, or, better, to construct, an identity factor for each of the neighborhoods in the dicussed sector of the city. Starting from the general discourse, the article focuses on one church and one neighborhood that might be considered as models to follow in the entire periphery around GCR: the jubilee church of God the Father of Mercy designed by Richard Meier in the neighborhood of Tor Tre Teste. The sequence of events related to the architectural competition for the church, the choice of proposal by Richard Meier, the complexity of construction as well as the technical, stylistic and symbolical analysis of the building are put in relation to the neighborhood, and finally read as an attempt to create centre of attention for the entire periphery.
Analysis of designed experiments by stabilised PLS Regression and jack-knifing
DEFF Research Database (Denmark)
Martens, Harald; Høy, M.; Westad, F.
2001-01-01
Pragmatical, visually oriented methods for assessing and optimising bi-linear regression models are described, and applied to PLS Regression (PLSR) analysis of multi-response data from controlled experiments. The paper outlines some ways to stabilise the PLSR method to extend its range...... the reliability of the linear and bi-linear model parameter estimates. The paper illustrates how the obtained PLSR "significance" probabilities are similar to those from conventional factorial ANOVA, but the PLSR is shown to give important additional overview plots of the main relevant structures in the multi....... An Introduction, Wiley, Chichester, UK, 2001]....
2D and 3D CT Radiomics Features Prognostic Performance Comparison in Non-Small Cell Lung Cancer
Directory of Open Access Journals (Sweden)
Chen Shen
2017-12-01
Full Text Available OBJECTIVE: To compare 2D and 3D radiomics features prognostic performance differences in CT images of non-small cell lung cancer (NSCLC. METHOD: We enrolled 588 NSCLC patients from three independent cohorts. Two sets of 463 patients from two different institutes were used as the training cohort. The remaining cohort with 125 patients was set as the validation cohort. A total of 1014 radiomics features (507 2D features and 507 3D features correspondingly were assessed. Based on the dichotomized survival data, 2D and 3D radiomics indicators were calculated for each patient by trained classifiers. We used the area under the receiver operating characteristic curve (AUC to assess the prediction performance of trained classifiers (the support vector machine and logistic regression. Kaplan–Meier and Cox hazard survival analyses were also employed. Harrell's concordance index (C-Index and Akaike's information criteria (AIC were applied to assess the trained models. RESULTS: Radiomics indicators were built and compared by AUCs. In the training cohort, 2D_AUC = 0.653, 3D_AUC = 0.671. In the validation cohort, 2D_AUC = 0.755, 3D_AUC = 0.663. Both 2D and 3D trained indicators achieved significant results (P < .05 in the Kaplan-Meier analysis and Cox regression. In the validation cohort, 2D Cox model had a C-Index = 0.683 and AIC = 789.047; 3D Cox model obtained a C-Index = 0.632 and AIC = 799.409. CONCLUSION: Both 2D and 3D CT radiomics features have a certain prognostic ability in NSCLC, but 2D features showed better performance in our tests. Considering the cost of the radiomics features calculation, 2D features are more recommended for use in the current study.
Replica analysis of overfitting in regression models for time-to-event data
Coolen, A. C. C.; Barrett, J. E.; Paga, P.; Perez-Vicente, C. J.
2017-09-01
Overfitting, which happens when the number of parameters in a model is too large compared to the number of data points available for determining these parameters, is a serious and growing problem in survival analysis. While modern medicine presents us with data of unprecedented dimensionality, these data cannot yet be used effectively for clinical outcome prediction. Standard error measures in maximum likelihood regression, such as p-values and z-scores, are blind to overfitting, and even for Cox’s proportional hazards model (the main tool of medical statisticians), one finds in literature only rules of thumb on the number of samples required to avoid overfitting. In this paper we present a mathematical theory of overfitting in regression models for time-to-event data, which aims to increase our quantitative understanding of the problem and provide practical tools with which to correct regression outcomes for the impact of overfitting. It is based on the replica method, a statistical mechanical technique for the analysis of heterogeneous many-variable systems that has been used successfully for several decades in physics, biology, and computer science, but not yet in medical statistics. We develop the theory initially for arbitrary regression models for time-to-event data, and verify its predictions in detail for the popular Cox model.
Suzuki, Taku; Iwamoto, Takuji; Shizu, Kanae; Suzuki, Katsuji; Yamada, Harumoto; Sato, Kazuki
2017-05-01
This retrospective study was designed to investigate prognostic factors for postoperative outcomes for cubital tunnel syndrome (CubTS) using multiple logistic regression analysis with a large number of patients. Eighty-three patients with CubTS who underwent surgeries were enrolled. The following potential prognostic factors for disease severity were selected according to previous reports: sex, age, type of surgery, disease duration, body mass index, cervical lesion, presence of diabetes mellitus, Workers' Compensation status, preoperative severity, and preoperative electrodiagnostic testing. Postoperative severity of disease was assessed 2 years after surgery by Messina's criteria which is an outcome measure specifically for CubTS. Bivariate analysis was performed to select candidate prognostic factors for multiple linear regression analyses. Multiple logistic regression analysis was conducted to identify the association between postoperative severity and selected prognostic factors. Both bivariate and multiple linear regression analysis revealed only preoperative severity as an independent risk factor for poor prognosis, while other factors did not show any significant association. Although conflicting results exist regarding prognosis of CubTS, this study supports evidence from previous studies and concludes early surgical intervention portends the most favorable prognosis. Copyright © 2017 The Japanese Orthopaedic Association. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Gu Wendong; Ji Qinghai; Lu Xueguan; Feng Yan
2003-01-01
Objective: To analyze the results of neck dissection in patients who failed in cervical lymph nodes after radiotherapy for nasopharyngeal carcinoma. Methods: Eighty-three patients who received neck dissection due to lymph node persistence or recurrence after definitive radiotherapy were analyzed retrospectively according to the following relevant factors: age, sex, the interval between completion of radiotherapy and surgery, rN stage, postoperative radiotherapy given or not, the adjacent tissues involved or not and the number of positive nodes. Kaplan-Meier method, Log-rank method and Cox method were used in the statistical analysis. Results: The 1-, 3- and 5-year overall survival rates were 80.7%, 47.1% and 34.9%. The interval between completion of radiotherapy and surgery, postoperative radiotherapy given or not, the adjacent tissues involved or not were significantly prognostic factors in statistic analysis. Conclusions: Neck dissection can be applied in the management of cervical lymph node failure in nasopharyngeal carcinoma after radiotherapy. Postoperative radiotherapy should be considered in patients with capsular invasion and/or adjacent tissue involvement
Energy Technology Data Exchange (ETDEWEB)
Ulyte, Agne [Vilnius University, Faculty of Medicine, Vilnius (Lithuania); Katsaros, Vasileios K. [General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Advanced Imaging Modalities - CT and MRI, Athens (Greece); University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Liouta, Evangelia; Stranjalis, Georgios [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); Boskos, Christos [University of Athens, Department of Neurosurgery, Evangelismos Hospital, Athens (Greece); General Anticancer and Oncological Hospital ' ' St. Savvas' ' , Department of Radiation Oncology, Athens (Greece); Papanikolaou, Nickolas [Champalimaud Foundation, Department of Radiology, Centre for the Unknown, Lisbon (Portugal); Usinskiene, Jurgita [National Cancer Institute, Vilnius (Lithuania); Affidea Lietuva, Vilnius (Lithuania); Bisdas, Sotirios [University College London Hospitals, Department of Neuroradiology, The National Hospital for Neurology and Neurosurgery, London (United Kingdom)
2016-12-15
The prognostic value of the dynamic contrast-enhanced (DCE) MRI perfusion and its histogram analysis-derived metrics is not well established for high-grade glioma (HGG) patients. The aim of this prospective study was to investigate DCE perfusion transfer coefficient (K{sup trans}), vascular plasma volume fraction (v{sub p}), extracellular volume fraction (v{sub e}), reverse transfer constant (k{sub ep}), and initial area under gadolinium concentration time curve (IAUGC) as predictors of progression-free (PFS) and overall survival (OS) in HGG patients. Sixty-nine patients with suspected anaplastic astrocytoma or glioblastoma underwent preoperative DCE-MRI scans. DCE perfusion whole tumor region histogram parameters, clinical details, and PFS and OS data were obtained. Univariate, multivariate, and Kaplan-Meier survival analyses were conducted. Receiver operating characteristic (ROC) curve analysis was employed to identify perfusion parameters with the best differentiation performance. On univariate analysis, v{sub e} and skewness of v{sub p} had significant negative impacts, while k{sub ep} had significant positive impact on OS (P < 0.05). v{sub e} was also a negative predictor of PFS (P < 0.05). Patients with lower v{sub e} and IAUGC had longer median PFS and OS on Kaplan-Meier analysis (P < 0.05). K{sup trans} and v{sub e} could also differentiate grade III from IV gliomas (area under the curve 0.819 and 0.791, respectively). High v{sub e} is a consistent predictor of worse PFS and OS in HGG glioma patients. v{sub p} skewness and k{sub ep} are also predictive for OS. K{sup trans} and v{sub e} demonstrated the best diagnostic performance for differentiating grade III from IV gliomas. (orig.)
Multiple linear regression analysis
Edwards, T. R.
1980-01-01
Program rapidly selects best-suited set of coefficients. User supplies only vectors of independent and dependent data and specifies confidence level required. Program uses stepwise statistical procedure for relating minimal set of variables to set of observations; final regression contains only most statistically significant coefficients. Program is written in FORTRAN IV for batch execution and has been implemented on NOVA 1200.
Feldens, Carlos Alberto; Kramer, Paulo Floriani; Ferreira, Simone Helena; Spiguel, Mônica Hermann; Marquezan, Marcela
2010-04-01
This cross-sectional study aimed to investigate the factors associated with dental trauma in preschool children using Poisson regression analysis with robust variance. The study population comprised 888 children aged 3- to 5-year-old attending public nurseries in Canoas, southern Brazil. Questionnaires assessing information related to the independent variables (age, gender, race, mother's educational level and family income) were completed by the parents. Clinical examinations were carried out by five trained examiners in order to assess traumatic dental injuries (TDI) according to Andreasen's classification. One of the five examiners was calibrated to assess orthodontic characteristics (open bite and overjet). Multivariable Poisson regression analysis with robust variance was used to determine the factors associated with dental trauma as well as the strengths of association. Traditional logistic regression was also performed in order to compare the estimates obtained by both methods of statistical analysis. 36.4% (323/888) of the children suffered dental trauma and there was no difference in prevalence rates from 3 to 5 years of age. Poisson regression analysis showed that the probability of the outcome was almost 30% higher for children whose mothers had more than 8 years of education (Prevalence Ratio = 1.28; 95% CI = 1.03-1.60) and 63% higher for children with an overjet greater than 2 mm (Prevalence Ratio = 1.63; 95% CI = 1.31-2.03). Odds ratios clearly overestimated the size of the effect when compared with prevalence ratios. These findings indicate the need for preventive orientation regarding TDI, in order to educate parents and caregivers about supervising infants, particularly those with increased overjet and whose mothers have a higher level of education. Poisson regression with robust variance represents a better alternative than logistic regression to estimate the risk of dental trauma in preschool children.
Zhou, Huaqiang; Zhang, Yuanzhe; Song, Yiyan; Tan, Wulin; Qiu, Zeting; Li, Si; Chen, Qinchang; Gao, Shaowei
2017-09-01
Marital status's prognostic impact on pancreatic neuroendocrine tumors (PNET) has not been rigorously studied. We aimed to explore the relationship between marital status and outcomes of PNET. We retrospectively investigated 2060 PNET cases between 2004 and 2010 from Surveillance, Epidemiology, and End Results (SEER) database. Variables were compared by Chi 2 test, t-test as appropriate. Kaplan-Meier methods and COX proportional hazard models were used to ascertain independent prognostic factors. Married patients had better 5-year overall survival (OS) (53.37% vs. 42.27%, Pvs. 59.82%, P=0.001) comparing with unmarried patients. Multivariate analysis revealed marital status is an independent prognostic factor, with married patients showing better OS (HR=0.74; 95% CI: 0.65-0.84; Punmarried patients may be associated with a delayed diagnosis with advanced tumor stage, psychosocial and socioeconomic factors. Further studies are needed. Copyright © 2017. Published by Elsevier Masson SAS.
Age at sexual initiation and factors associated with it among youths ...
African Journals Online (AJOL)
Bernt Lindtjorn
Objective: The objective of the study was to determine the median age at first sexual intercourse and the associated .... Wollo Zone, Amhara National Regional State, North East ..... censored. Urba n. Rura l. Residence rural/urban. Fig 2: Kaplan Meier curve showing log survival for ..... renting and selling pornography films.
Application of range-test in multiple linear regression analysis in ...
African Journals Online (AJOL)
Application of range-test in multiple linear regression analysis in the presence of outliers is studied in this paper. First, the plot of the explanatory variables (i.e. Administration, Social/Commercial, Economic services and Transfer) on the dependent variable (i.e. GDP) was done to identify the statistical trend over the years.
Community Music during the New Deal: The Contributions of Willem Van de Wall and Max Kaplan
Krikun, Andrew
2010-01-01
Willem Van de Wall (1887-1953) and Max Kaplan (1911-98) built careers spanning music performance, music education, adult education, sociology, social work, music therapy and community music. Willem Van de Wall was a seminal influence on the development of the fields of music therapy and adult education--researching the role of music in…
Huaman, Moises A; Vilchez, Valery; Mei, Xiaonan; Shah, Malay B; Daily, Michael F; Berger, Jonathan; Gedaly, Roberto
2017-06-01
Liver transplantation using blood culture positive donors (BCPD) has allowed a significant expansion of the donor pool. We aimed to characterize BCPD and assess the outcomes of BCPD liver transplant recipients. We retrieved data from the United Network for Organ Sharing (UNOS) registry on all adults who underwent primary, single-organ deceased-donor liver transplantation in the USA between 2008 and 2013. Patients were classified into two cohorts: the BCPD cohort and the non-BCPD cohort. One-year graft and patient survival were compared between cohorts using Kaplan-Meier estimates and Cox models. A total of 28 961 patients were included. There were 2316 (8.0%) recipients of BCPD. BCPD were more likely to be older, female, black, diabetic, hypertensive, and obese compared to non-BCPD. Graft survival was significantly lower in BCPD recipients compared to non-BCPD recipients (Kaplan-Meier, 0.85 vs. 0.87; P = 0.009). Results remained significant in propensity-matched analysis (P = 0.038). BCPD was independently associated with decreased graft survival (adjusted HR; 1.10, 95% CI 1.01-1.20; P = 0.04). There were no significant differences in patient survival between study groups. BCPD was associated with decreased graft survival in liver transplant recipients. Studies are needed to identify subgroups of BCPD with the highest risk of graft failure and characterize the underlying pathogenic mechanisms. © 2016 Steunstichting ESOT.
Hossain, Md Golam; Saw, Aik; Alam, Rashidul; Ohtsuki, Fumio; Kamarul, Tunku
2013-09-01
Cephalic index (CI), the ratio of head breadth to head length, is widely used to categorise human populations. The aim of this study was to access the impact of anthropometric measurements on the CI of male Japanese university students. This study included 1,215 male university students from Tokyo and Kyoto, selected using convenient sampling. Multiple regression analysis was used to determine the effect of anthropometric measurements on CI. The variance inflation factor (VIF) showed no evidence of a multicollinearity problem among independent variables. The coefficients of the regression line demonstrated a significant positive relationship between CI and minimum frontal breadth (p regression analysis showed a greater likelihood for minimum frontal breadth (p regression analysis revealed bizygomatic breadth, head circumference, minimum frontal breadth, head height and morphological facial height to be the best predictor craniofacial measurements with respect to CI. The results suggest that most of the variables considered in this study appear to influence the CI of adult male Japanese students.
Fellin, Giovanni; Mirri, Maria A; Santoro, Luigi; Jereczek-Fossa, Barbara A; Divan, Claudio; Mussari, Salvatore; Ziglio, Francesco; La Face, Beniamino; Barbera, Fernando; Buglione, Michela; Bandera, Laura; Ghedi, Barbara; Di Muzio, Nadia G; Losa, Andrea; Mangili, Paola; Nava, Luciano; Chiarlone, Renato; Ciscognetti, Nunzia; Gastaldi, Emilio; Cattani, Federica; Spoto, Ruggero; Vavassori, Andrea; Giglioli, Francesca R; Guarneri, Alessia; Cerboneschi, Valentina; Mignogna, Marcello; Paoluzzi, Mauro; Ravaglia, Valentina; Chiumento, Costanza; Clemente, Stefania; Fusco, Vincenzo; Santini, Roberto; Stefanacci, Marco; Mangiacotti, Francesco P; Martini, Marco; Palloni, Tiziana; Schinaia, Giuseppe; Lazzari, Grazia; Silvano, Giovanni; Magrini, Stefano; Ricardi, Umberto; Santoni, Riccardo; Orecchia, Roberto
2016-09-01
Low-dose-rate brachytherapy (LDR-BT) in localized prostate cancer is available since 15 years in Italy. We realized the first national multicentre and multidisciplinary data collection to evaluate LDR-BT practice, given as monotherapy, and outcome in terms of biochemical failure. Between May 1998 and December 2011, 2237 patients with early-stage prostate cancer from 11 Italian community and academic hospitals were treated with iodine-125 ((125)I) or palladium-103 LDR-BT as monotherapy and followed up for at least 2 years. (125)I seeds were implanted in 97.7% of the patients: the mean dose received by 90% of target volume was 145 Gy; the mean target volume receiving 100% of prescribed dose (V100) was 91.1%. Biochemical failure-free survival (BFFS), disease-specific survival (DSS) and overall survival (OS) were estimated using Kaplan-Meier method. Log-rank test and multivariable Cox regression were used to evaluate the relationship of covariates with outcomes. Median follow-up time was 65 months. 5- and 7-year DSS, OS and BFFS were 99 and 98%, 94 and 89%, and 92 and 88%, respectively. At multivariate analysis, the National Comprehensive Cancer Network score (p LDR-BT. This first multicentre Italian report confirms LDR-BT as an excellent curative modality for low-/intermediate-risk prostate cancer. Multidisciplinary teams may help to select adequately patients to be treated with brachytherapy, with a direct impact on the implant quality and, possibly, on outcome.
J Cerqueira, Rui; Melo, Renata; Moreira, Soraia; A Saraiva, Francisca; Andrade, Marta; Salgueiro, Elson; Almeida, Jorge; J Amorim, Mário; Pinho, Paulo; Lourenço, André; F Leite-Moreira, Adelino
2017-01-01
To compare stentless Freedom Solo and stented Trifecta aortic bioprostheses regarding hemodynamic profile, left ventricular mass regression, early and late postoperative outcomes and survival. Longitudinal cohort study of consecutive patients undergoing aortic valve replacement (from 2009 to 2016) with either Freedom Solo or Trifecta at one centre. Local databases and national records were queried. Postoperative echocardiography (3-6 months) was obtained for hemodynamic profile (mean transprosthetic gradient and effective orifice area) and left ventricle mass determination. After propensity score matching (21 covariates), Kaplan-Meier analysis and cumulative incidence analysis were performed for survival and combined outcome of structural valve deterioration and endocarditis, respectively. Hemodynamics and left ventricle mass regression were assessed by a mixed- -effects model including propensity score as a covariate. From a total sample of 397 Freedom Solo and 525 Trifecta patients with a median follow-up time of 4.0 (2.2- 6.0) and 2.4 (1.4-3.7) years, respectively, a matched sample of 329 pairs was obtained. Well-balanced matched groups showed no difference in survival (hazard ratio=1.04, 95% confidence interval=0.69-1.56) or cumulative hazards of combined outcome (subhazard ratio=0.54, 95% confidence interval=0.21-1.39). Although Trifecta showed improved hemodynamic profile compared to Freedom Solo, no differences were found in left ventricle mass regression. Trifecta has a slightly improved hemodynamic profile compared to Freedom Solo but this does not translate into differences in the extent of mass regression, postoperative outcomes or survival, which were good and comparable for both bioprostheses. Long-term follow-up is needed for comparisons with older models of bioprostheses.
Shi, Xiao; Zhang, Ting-Ting; Hu, Wei-Ping; Ji, Qing-Hai
2017-04-25
The relationship between marital status and oral cavity squamous cell carcinoma (OCSCC) survival has not been explored. The objective of our study was to evaluate the impact of marital status on OCSCC survival and investigate the potential mechanisms. Married patients had better 5-year cancer-specific survival (CSS) (66.7% vs 54.9%) and 5-year overall survival (OS) (56.0% vs 41.1%). In multivariate Cox regression models, unmarried patients also showed higher mortality risk for both CSS (Hazard Ratio [HR]: 1.260, 95% confidence interval (CI): 1.187-1.339, P married patients were more likely to be diagnosed at earlier stage (P Married patients still demonstrated better prognosis in the 1:1 matched group analysis (CSS: 62.9% vs 60.8%, OS: 52.3% vs 46.5%). 11022 eligible OCSCC patients were identified from Surveillance, Epidemiology, and End Results (SEER) database, including 5902 married and 5120 unmarried individuals. Kaplan-Meier analysis, Log-rank test and Cox proportional hazards regression model were used to analyze survival and mortality risk. Influence of marital status on stage, age at diagnosis and selection of treatment was determined by binomial and multinomial logistic regression. Propensity score matching method was adopted to perform a 1:1 matched cohort. Marriage has an independently protective effect on OCSCC survival. Earlier diagnosis and more sufficient treatment are possible explanations. Besides, even after 1:1 matching, survival advantage of married group still exists, indicating that spousal support from other aspects may also play an important role.
Understanding poisson regression.
Hayat, Matthew J; Higgins, Melinda
2014-04-01
Nurse investigators often collect study data in the form of counts. Traditional methods of data analysis have historically approached analysis of count data either as if the count data were continuous and normally distributed or with dichotomization of the counts into the categories of occurred or did not occur. These outdated methods for analyzing count data have been replaced with more appropriate statistical methods that make use of the Poisson probability distribution, which is useful for analyzing count data. The purpose of this article is to provide an overview of the Poisson distribution and its use in Poisson regression. Assumption violations for the standard Poisson regression model are addressed with alternative approaches, including addition of an overdispersion parameter or negative binomial regression. An illustrative example is presented with an application from the ENSPIRE study, and regression modeling of comorbidity data is included for illustrative purposes. Copyright 2014, SLACK Incorporated.
Wang, Wen-Cheng; Cho, Wen-Chien; Chen, Yin-Jen
2014-01-01
It is estimated that mainland Chinese tourists travelling to Taiwan can bring annual revenues of 400 billion NTD to the Taiwan economy. Thus, how the Taiwanese Government formulates relevant measures to satisfy both sides is the focus of most concern. Taiwan must improve the facilities and service quality of its tourism industry so as to attract more mainland tourists. This paper conducted a questionnaire survey of mainland tourists and used grey relational analysis in grey mathematics to analyze the satisfaction performance of all satisfaction question items. The first eight satisfaction items were used as independent variables, and the overall satisfaction performance was used as a dependent variable for quantile regression model analysis to discuss the relationship between the dependent variable under different quantiles and independent variables. Finally, this study further discussed the predictive accuracy of the least mean regression model and each quantile regression model, as a reference for research personnel. The analysis results showed that other variables could also affect the overall satisfaction performance of mainland tourists, in addition to occupation and age. The overall predictive accuracy of quantile regression model Q0.25 was higher than that of the other three models.
Wang, Wen-Cheng; Cho, Wen-Chien; Chen, Yin-Jen
2014-01-01
It is estimated that mainland Chinese tourists travelling to Taiwan can bring annual revenues of 400 billion NTD to the Taiwan economy. Thus, how the Taiwanese Government formulates relevant measures to satisfy both sides is the focus of most concern. Taiwan must improve the facilities and service quality of its tourism industry so as to attract more mainland tourists. This paper conducted a questionnaire survey of mainland tourists and used grey relational analysis in grey mathematics to analyze the satisfaction performance of all satisfaction question items. The first eight satisfaction items were used as independent variables, and the overall satisfaction performance was used as a dependent variable for quantile regression model analysis to discuss the relationship between the dependent variable under different quantiles and independent variables. Finally, this study further discussed the predictive accuracy of the least mean regression model and each quantile regression model, as a reference for research personnel. The analysis results showed that other variables could also affect the overall satisfaction performance of mainland tourists, in addition to occupation and age. The overall predictive accuracy of quantile regression model Q0.25 was higher than that of the other three models. PMID:24574916