WorldWideScience

Sample records for register call 426-1131

  1. 47 CFR 11.31 - EAS protocol.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 1 2010-10-01 2010-10-01 false EAS protocol. 11.31 Section 11.31... characters. FM or TV call signs must use a slash ASCII character number 47 (/) in lieu of a dash. (c) The EAS... the State EAS Mapbook. FIPS# State: AL 01 AK 02 AZ 04 AR 05 CA 06 CO 08 CT 09 DE 10 DC 11 FL 12 GA 13...

  2. 7 CFR 1131.6 - Supply plant.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Supply plant. 1131.6 Section 1131.6 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Definitions § 1131.6 Supply plant. See § 1000.6. ...

  3. 7 CFR 1131.54 - Equivalent price.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Equivalent price. 1131.54 Section 1131.54 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Handling Class Prices § 1131.54 Equivalent price. See § 1000.54. Uniform Prices ...

  4. 7 CFR 1131.14 - Other source milk.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Other source milk. 1131.14 Section 1131.14 Agriculture... and Orders; Milk), DEPARTMENT OF AGRICULTURE MILK IN THE ARIZONA MARKETING AREA Order Regulating Handling Definitions § 1131.14 Other source milk. See § 1000.14. ...

  5. 7 CFR 1131.86 - Deduction for marketing services.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Deduction for marketing services. 1131.86 Section 1131... SERVICE (Marketing Agreements and Orders; Milk), DEPARTMENT OF AGRICULTURE MILK IN THE ARIZONA MARKETING AREA Order Regulating Handling Administrative Assessment and Marketing Service Deduction § 1131.86...

  6. 7 CFR 1131.44 - Classification of producer milk.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Classification of producer milk. 1131.44 Section 1131... SERVICE (Marketing Agreements and Orders; Milk), DEPARTMENT OF AGRICULTURE MILK IN THE ARIZONA MARKETING AREA Order Regulating Handling Classification of Milk § 1131.44 Classification of producer milk. See...

  7. 7 CFR 1131.2 - Arizona marketing area.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Arizona marketing area. 1131.2 Section 1131.2 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Milk), DEPARTMENT OF AGRICULTURE MILK IN THE ARIZONA MARKETING AREA Order Regulating...

  8. 7 CFR 1131.85 - Assessment for order administration.

    Science.gov (United States)

    2010-01-01

    ... 1131.85 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Milk), DEPARTMENT OF AGRICULTURE MILK IN THE ARIZONA MARKETING AREA Order Regulating Handling Administrative Assessment and Marketing Service Deduction § 1131.85...

  9. 7 CFR 1131.19 - Commercial food processing establishment.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Commercial food processing establishment. 1131.19 Section 1131.19 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Milk), DEPARTMENT OF AGRICULTURE MILK IN THE ARIZONA MARKETING AREA Order Regulating Handling Definition...

  10. 19 CFR 113.1 - Authority to require security or execution of bond.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Authority to require security or execution of bond. 113.1 Section 113.1 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY CUSTOMS BONDS General Provisions § 113.1 Authority to require security or...

  11. 47 CFR 42.6 - Retention of telephone toll records.

    Science.gov (United States)

    2010-10-01

    ... whether it is billing its own toll service customers for toll calls or billing customers for another... Section 42.6 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES... telephone toll records. Each carrier that offers or bills toll telephone service shall retain for a period...

  12. 7 CFR 1131.50 - Class prices, component prices, and advanced pricing factors.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Class prices, component prices, and advanced pricing factors. 1131.50 Section 1131.50 Agriculture Regulations of the Department of Agriculture (Continued..., and advanced pricing factors. See § 1000.50. ...

  13. Dicty_cDB: SLC426 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC426 (Link to dictyBase) - G01922 DDB0233225 Contig-U14991-1 SLC4...26E (Link to Original site) SLC426F 335 SLC426Z 320 SLC426P 655 SLC426E 335 Show SLC426 Library SL (Lin...Contig Contig-U14991-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLC4-B/SLC4...26Q.Seq.d/ Representative seq. ID SLC426E (Link to Original site) Representative DNA sequence >SLC426 (SLC4...26Q) /CSM/SL/SLC4-B/SLC426Q.Seq.d/ AAATAATAAATAGTAAATAATAAATAATAATAAATAATAATAATAATATTTNAAAATGGG

  14. 32 CFR 644.426 - Classification.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 4 2010-07-01 2010-07-01 true Classification. 644.426 Section 644.426 National... HANDBOOK Disposal Disposal of Fee-Owned Real Property and Easement Interests § 644.426 Classification... required by the special acts, classification will be coordinated with the interested Federal agency. The...

  15. 42 CFR 426.532 - Discovery.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Discovery. 426.532 Section 426.532 Public Health... § 426.532 Discovery. (a) General rule. If the Board orders discovery, the Board must establish a reasonable timeframe for discovery. (b) Protective order—(1) Request for a protective order. Any party...

  16. 42 CFR 426.432 - Discovery.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Discovery. 426.432 Section 426.432 Public Health... § 426.432 Discovery. (a) General rule. If the ALJ orders discovery, the ALJ must establish a reasonable timeframe for discovery. (b) Protective order—(1) Request for a protective order. Any party receiving a...

  17. 25 CFR 11.426 - Bribery.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Bribery. 11.426 Section 11.426 Indians BUREAU OF INDIAN... Criminal Offenses § 11.426 Bribery. (a) A person is guilty of bribery, a misdemeanor, if he or she offers... a person whom the actor sought to influence was not qualified to act in the desired way, whether...

  18. 7 CFR 1131.13 - Producer milk.

    Science.gov (United States)

    2010-01-01

    ... Handling Definitions § 1131.13 Producer milk. Producer milk means the skim milk (or the skim equivalent of components of skim milk) and butterfat in milk of a producer that is: (a) Received by the operator of a pool... percentage in paragraph (d)(2) of this section may be increased or decreased by the market administrator if...

  19. 7 CFR 1131.53 - Announcement of class prices, component prices, and advanced pricing factors.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Announcement of class prices, component prices, and advanced pricing factors. 1131.53 Section 1131.53 Agriculture Regulations of the Department of Agriculture... class prices, component prices, and advanced pricing factors. See § 1000.53. ...

  20. 49 CFR 172.426 - OXIDIZER label.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false OXIDIZER label. 172.426 Section 172.426... SECURITY PLANS Labeling § 172.426 OXIDIZER label. (a) Except for size and color, the OXIDIZER label must be... OXIDIZER label must be yellow. [Amdt. 172-123, 56 FR 66257, Dec. 20, 1991] ...

  1. 29 CFR 42.6 - Enforcement strategy.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Enforcement strategy. 42.6 Section 42.6 Labor Office of the Secretary of Labor COORDINATED ENFORCEMENT § 42.6 Enforcement strategy. (a) Each Regional Farm Labor... enforcement strategy for each protective statute pursuant to § 42.20(c)(3). The National Committee shall...

  2. 42 CFR 426.425 - LCD review.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false LCD review. 426.425 Section 426.425 Public Health... PROGRAM REVIEW OF NATIONAL COVERAGE DETERMINATIONS AND LOCAL COVERAGE DETERMINATIONS Review of an LCD § 426.425 LCD review. (a) Opportunity for the aggrieved party, after his or her review of the LCD record...

  3. 42 CFR 426.525 - NCD review.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false NCD review. 426.525 Section 426.525 Public Health... PROGRAM REVIEW OF NATIONAL COVERAGE DETERMINATIONS AND LOCAL COVERAGE DETERMINATIONS Review of an NCD § 426.525 NCD review. (a) Opportunity for the aggrieved party after his or her review of the NCD record...

  4. 42 CFR 426.406 - Ex parte contacts.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Ex parte contacts. 426.406 Section 426.406 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED... LCD § 426.406 Ex parte contacts. No party or person (except employees of the ALJ's office...

  5. NADH Oxidase of Streptococcus thermophilus 1131 is Required for the Effective Yogurt Fermentation with Lactobacillus delbrueckii subsp. bulgaricus 2038.

    Science.gov (United States)

    Sasaki, Yasuko; Horiuchi, Hiroshi; Kawashima, Hiroko; Mukai, Takao; Yamamoto, Yuji

    2014-01-01

    We previously reported that dissolved oxygen (DO) suppresses yogurt fermentation with an industrial starter culture composed of Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) 2038 and Streptococcus thermophilus 1131, and also found that reducing the DO in the medium prior to fermentation (deoxygenated fermentation) shortens the fermentation time. In this study, we found that deoxygenated fermentation primarily increased the cell number of S. thermophilus 1131 rather than that of L. bulgaricus 2038, resulting in earlier l-lactate and formate accumulation. Measurement of the DO concentration and hydrogen peroxide generation in the milk medium suggested that DO is mainly removed by S. thermophilus 1131. The results using an H2O-forming NADH oxidase (Nox)-defective mutant of S. thermophilus 1131 revealed that Nox is the major oxygen-consuming enzyme of the bacterium. Yogurt fermentation with the S. thermophilus Δnox mutant and L. bulgaricus 2038 was significantly slower than with S. thermophilus 1131 and L. bulgaricus 2038, and the DO concentrations of the mixed culture did not decrease to less than 2 mg/kg within 3 hr. These observations suggest that Nox of S. thermophilus 1131 contributes greatly to yogurt fermentation, presumably by removing the DO in milk.

  6. 17 CFR 256.426.1 - Donations.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Donations. 256.426.1 Section... COMPANY ACT OF 1935 Income and Expense Accounts § 256.426.1 Donations. This account shall include all payments or donations for charitable, social or community welfare purposes. ...

  7. 38 CFR 4.26 - Bilateral factor.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Bilateral factor. 4.26... DISABILITIES General Policy in Rating § 4.26 Bilateral factor. When a partial disability results from disease... disability. The bilateral factor will be applied to such bilateral disabilities before other combinations are...

  8. 24 CFR 570.426 - Program income.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 3 2010-04-01 2010-04-01 false Program income. 570.426 Section 570... in Hawaii and Insular Areas Programs § 570.426 Program income. (a) The provisions of § 570.504(b) apply to all program income generated by a specific grant and received prior to grant closeout. (b) If...

  9. 42 CFR 426.415 - CMS' role in the LCD review.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false CMS' role in the LCD review. 426.415 Section 426... Review of an LCD § 426.415 CMS' role in the LCD review. CMS may provide to the ALJ, and all parties to the LCD review, information identifying the person who represents the contractor or CMS, if necessary...

  10. Genetic polymorphisms of T-1131C APOA5 and ALOX5AP ...

    Indian Academy of Sciences (India)

    Both males and females can be affected by this disease at any time of life. Ischaemic stroke ... (e.g. arachidonate 5-lipoxygenase-activating protein ALOX5AP ... 2) healthy blood ..... (2012) who demonstrated in a meta-analysis that T-1131C.

  11. 7 CFR 1131.73 - Payments to producers and to cooperative associations.

    Science.gov (United States)

    2010-01-01

    ... the milk using the most recent class prices available for skim milk and butterfat at the receiving... less than 1.3 times the lowest class price for the preceding month less proper deductions authorized in... § 1131.72: (i) Multiply the hundredweight of producer skim milk received times the uniform skim milk...

  12. NADH Oxidase of Streptococcus thermophilus 1131 is Required for the Effective Yogurt Fermentation with Lactobacillus delbrueckii subsp. bulgaricus 2038

    OpenAIRE

    SASAKI, Yasuko; HORIUCHI, Hiroshi; KAWASHIMA, Hiroko; MUKAI, Takao; YAMAMOTO, Yuji

    2014-01-01

    We previously reported that dissolved oxygen (DO) suppresses yogurt fermentation with an industrial starter culture composed of Lactobacillus delbrueckii subsp. bulgaricus (L. bulgaricus) 2038 and Streptococcus thermophilus 1131, and also found that reducing the DO in the medium prior to fermentation (deoxygenated fermentation) shortens the fermentation time. In this study, we found that deoxygenated fermentation primarily increased the cell number of S. thermophilus 1131 rather than that of ...

  13. 14 CFR 11.31 - How does FAA process direct final rules?

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false How does FAA process direct final rules? 11... PROCEDURAL RULES GENERAL RULEMAKING PROCEDURES Rulemaking Procedures General § 11.31 How does FAA process direct final rules? (a) A direct final rule will take effect on a specified date unless FAA receives an...

  14. The difficult medical emergency call

    DEFF Research Database (Denmark)

    Møller, Thea Palsgaard; Kjærulff, Thora Majlund; Viereck, Søren

    2017-01-01

    BACKGROUND: Pre-hospital emergency care requires proper categorization of emergency calls and assessment of emergency priority levels by the medical dispatchers. We investigated predictors for emergency call categorization as "unclear problem" in contrast to "symptom-specific" categories and the ......BACKGROUND: Pre-hospital emergency care requires proper categorization of emergency calls and assessment of emergency priority levels by the medical dispatchers. We investigated predictors for emergency call categorization as "unclear problem" in contrast to "symptom-specific" categories...... and the effect of categorization on mortality. METHODS: Register-based study in a 2-year period based on emergency call data from the emergency medical dispatch center in Copenhagen combined with nationwide register data. Logistic regression analysis (N = 78,040 individuals) was used for identification...

  15. 7 CFR 28.426 - Strict Good Ordinary Spotted Color.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Strict Good Ordinary Spotted Color. 28.426 Section 28.426 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards... Spotted Color. Strict Good Ordinary Spotted Color is color which is within the range represented by a set...

  16. Genetic polymorphisms of T-1131C APOA5 and ALOX5AP ...

    Indian Academy of Sciences (India)

    Abstract. Ischaemic stroke is a multifactorial disease. Genetic polymorphisms involved in lipid, inflammatory and thrombotic metabolisms play an important role in the development of ischaemic stroke. The present study aimed to assess the relationship between T1131C APOA5 and SG13S114 ALOX5AP polymorphisms and ...

  17. Unexpected pathological findings after laparoscopic cholecystectomy - analysis of 1131 cases.

    Science.gov (United States)

    Bartosiak, Katarzyna; Liszka, Maciej; Drazba, Tomasz; Paśnik, Krzysztof; Janik, Michal R

    2018-03-01

    Gallbladder specimens are routinely sent for histopathological examination after cholecystectomy in order to rule out the presence of unexpected pathological findings. To establish the overall incidence of unexpected pathological findings in patients who underwent laparoscopic cholecystectomy for symptomatic gallbladder disease and determine whether the macroscopic appearance of the gallbladder in ultrasound examination could be a valid method for identifying patients with gallbladder malignancy. A retrospective study was conducted between 2013 and 2015. All histological reports (n = 1131) after cholecystectomy were searched for unexpected pathological findings. In cases where unexpected pathological findings were identified the additional analysis of preoperative abdominal ultrasound examination (USG) was done to determine the usefulness of USG in diagnosis of gallbladder malignancy. Of the 1131 patients included in the study, 356 (31.47%) were male and 774 (68.43%) were female. Unexpected pathological findings were present in 21 cases. The overall incidence of unexpected pathological findings was 1.86%. Only in 5 patients were suspicious appearances of gallbladder observed in preoperative ultrasound examination. In 16 patients there was no suspicion of malignancy. The positive predictive value of USG was 0.238. The incidence of unexpected pathological findings after laparoscopic cholecystectomy was 1.86%. Ultrasonography has low positive predictive value for identifying patients with malignant findings in a gallbladder specimen.

  18. Genetic polymorphisms of T-1131C APOA5 and ALOX5AP

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 95; Issue 2. Genetic polymorphisms of T-1131C APOA5 and ALOX5AP SG13S114 with the susceptibility of ischemic stroke in Morocco. BREHIMA DIAKITE KHALIL HAMZI WIAM HMIMECH SELLAMA NADIFI GMRAVC. RESEARCH ARTICLE Volume 95 Issue 2 June 2016 pp ...

  19. 42 CFR 426.517 - CMS' statement regarding new evidence.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false CMS' statement regarding new evidence. 426.517... DETERMINATIONS Review of an NCD § 426.517 CMS' statement regarding new evidence. (a) CMS may review any new... experts; and (5) Presented during any hearing. (b) CMS may submit a statement regarding whether the new...

  20. 42 CFR 426.515 - CMS' role in making the NCD record available.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false CMS' role in making the NCD record available. 426.515 Section 426.515 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND... COVERAGE DETERMINATIONS Review of an NCD § 426.515 CMS' role in making the NCD record available. CMS will...

  1. 40 CFR 426.100 - Applicability; description of the glass tubing (Danner) manufacturing subcategory.

    Science.gov (United States)

    2010-07-01

    ... glass tubing (Danner) manufacturing subcategory. 426.100 Section 426.100 Protection of Environment... CATEGORY Glass Tubing (Danner) Manufacturing Subcategory § 426.100 Applicability; description of the glass tubing (Danner) manufacturing subcategory. The provisions of this subpart are applicable to discharges...

  2. 49 CFR 173.426 - Excepted packages for articles containing natural uranium or thorium.

    Science.gov (United States)

    2010-10-01

    ... outer surface of the uranium or thorium is enclosed in an inactive sheath made of metal or other durable... uranium or thorium. 173.426 Section 173.426 Transportation Other Regulations Relating to Transportation....426 Excepted packages for articles containing natural uranium or thorium. A manufactured article in...

  3. 27 CFR 40.426 - Closing.

    Science.gov (United States)

    2010-04-01

    ... TOBACCO Manufacture of Cigarette Papers and Tubes Operations by Manufacturers § 40.426 Closing. A closing report, covering the period from the first of the month to the date of the closing inventory, shall be made with such inventory. (72 Stat. 1422; 26 U.S.C. 5722) Inventories ...

  4. Association of Apolipoprotein A5 Gene   −1131T>C Polymorphism with the Risk of Metabolic Syndrome in Korean Subjects

    Directory of Open Access Journals (Sweden)

    Kwang Hoon Song

    2013-01-01

    Full Text Available We assessed the associations between the APOA5  −1131T>C polymorphism and lipid parameters and other risk factors of the metabolic syndrome in Korean subjects. A total of 2,901 participants from 20 oriental medical hospitals in Korea were enrolled between 2006 and 2011. According to the modified National Cholesterol Education Program Adult Treatment Panel III definitions, subjects were classified into the metabolic syndrome group and control group. The APOA5  −1131T>C genotype was significantly associated with serum high-density lipoprotein cholesterol levels (effect = − 1.700 mg/dL, P=6.550-E07 in the total study population after adjustment for differences in age and gender. The association of the APOA5  −1131T>C genotype with serum log-transformed triglyceride was also significant in an additive genetic model (effect = 0.056 mg/dL, P=2.286E-19. After adjustment for age and gender, we determined that the odds ratio for the occurrence of the metabolic syndrome was 1.322 for C-allele carriers in the additive model (95% CI = [1.165 − 1.501], P=1.48E-05. In the current study, we demonstrated that the APOA5  −1131T>C polymorphism is associated with the metabolic syndrome because of its remarkable effect on serum triglyceride levels in Korean subjects.

  5. Call Centre- Computer Telephone Integration

    Directory of Open Access Journals (Sweden)

    Dražen Kovačević

    2012-10-01

    Full Text Available Call centre largely came into being as a result of consumerneeds converging with enabling technology- and by the companiesrecognising the revenue opportunities generated by meetingthose needs thereby increasing customer satisfaction. Regardlessof the specific application or activity of a Call centre, customersatisfaction with the interaction is critical to the revenuegenerated or protected by the Call centre. Physical(v, Call centreset up is a place that includes computer, telephone and supervisorstation. Call centre can be available 24 hours a day - whenthe customer wants to make a purchase, needs information, orsimply wishes to register a complaint.

  6. 43 CFR 426.23 - Recovery of operation and maintenance (O&M) costs.

    Science.gov (United States)

    2010-10-01

    ... operation and maintenance (O&M) costs. (a) General. All new, amended, and renewed contracts shall provide... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Recovery of operation and maintenance (O&M) costs. 426.23 Section 426.23 Public Lands: Interior Regulations Relating to Public Lands BUREAU OF...

  7. Interactions between the APOA5 -1131T>C and the FEN1 10154G>T polymorphisms on ω6 polyunsaturated fatty acids in serum phospholipids and coronary artery disease

    Science.gov (United States)

    Park, Ju Yeon; Paik, Jean Kyung; Kim, Oh Yoen; Chae, Jey Sook; Jang, Yangsoo; Lee, Jong Ho

    2010-01-01

    We determined the contribution of the combination of FEN1 10154G>T with the most significant association in the analysis of plasma arachidonic acid (AA, 20:4ω6) and the APOA5-1131T>C on phospholipid ω6PUFA and coronary artery disease (CAD). Patients with CAD (n = 807, 27–81 years of age) and healthy controls (n = 1123) were genotyped for FEN1 10154G>T and APOA5-1131T>C. We found a significant interaction between these two genes for CAD risk (P = 0.007) adjusted for confounding factors. APOA5-1131C allele carriers had a higher CAD risk [odds ratio (OR):1.484, 95% confidence interval (CI):1.31–1.96; P = 0.005] compared with APOA5-1131TT individuals in the FEN1 10154GG genotype group but not in the FEN1 10154T allele group (OR:1.096, 95%CI:0.84–1.43; P = 0.504). Significant interactions between these two genes were also observed for the AA proportion (P = 0.04) and the ratio of AA/linoleic acid (LA, 18:2ω6) (P = 0.004) in serum phospholipids of controls. The APOA5-1131C allele was associated with lower AA (P = 0.027) and AA/LA (P = 0.014) only in controls carrying the FEN1 10154T allele. In conclusion, the interaction between these genes suggests that the FEN1 10154T variant allele decreases AA and AA/LA in the serum phospholipids of carriers of the APOA5-1131C allele, but contributes no significant increase in CAD risk for this population subset despite their increased triglylcerides and decreased apoA5. PMID:20802161

  8. The-1131T > C Polymorphism in the Apolipoprotein A5 Gene is Related to Hypertriglyceridemia in Taiwanese Aborigines

    Directory of Open Access Journals (Sweden)

    Meng-Chuan Huang

    2008-04-01

    Full Text Available The prevalence of hypertriglyceridemia, considered to be an independent risk factor for the development of cardiovascular disease, is high in Taiwanese aborigines. This study was undertaken to examine the effect of the -1131T > C polymorphism in the apolipoprotein A5 gene on serum triglyceride levels in female Taiwanese aborigines. This was a cross-sectional study, and a total of 316 unrelated female Taiwanese aborigines were genotyped at the -1131T > C polymorphism in apolipoprotein A5 using the polymerase chain reaction-restriction fragment length polymorphism method. Serum triglyceride ≥150 mg/dL was defined as the hypertriglyceridemia group and triglyceride C polymorphism of the Apo A5 gene influences serum triglyceride levels in female Taiwanese aborigines, and that differences exist in the frequency of the C allele among people of various ethnicities.

  9. Optimizing Instruction Scheduling and Register Allocation for Register-File-Connected Clustered VLIW Architectures

    Science.gov (United States)

    Tang, Haijing; Wang, Siye; Zhang, Yanjun

    2013-01-01

    Clustering has become a common trend in very long instruction words (VLIW) architecture to solve the problem of area, energy consumption, and design complexity. Register-file-connected clustered (RFCC) VLIW architecture uses the mechanism of global register file to accomplish the inter-cluster data communications, thus eliminating the performance and energy consumption penalty caused by explicit inter-cluster data move operations in traditional bus-connected clustered (BCC) VLIW architecture. However, the limit number of access ports to the global register file has become an issue which must be well addressed; otherwise the performance and energy consumption would be harmed. In this paper, we presented compiler optimization techniques for an RFCC VLIW architecture called Lily, which is designed for encryption systems. These techniques aim at optimizing performance and energy consumption for Lily architecture, through appropriate manipulation of the code generation process to maintain a better management of the accesses to the global register file. All the techniques have been implemented and evaluated. The result shows that our techniques can significantly reduce the penalty of performance and energy consumption due to access port limitation of global register file. PMID:23970841

  10. Optimizing Instruction Scheduling and Register Allocation for Register-File-Connected Clustered VLIW Architectures

    Directory of Open Access Journals (Sweden)

    Haijing Tang

    2013-01-01

    Full Text Available Clustering has become a common trend in very long instruction words (VLIW architecture to solve the problem of area, energy consumption, and design complexity. Register-file-connected clustered (RFCC VLIW architecture uses the mechanism of global register file to accomplish the inter-cluster data communications, thus eliminating the performance and energy consumption penalty caused by explicit inter-cluster data move operations in traditional bus-connected clustered (BCC VLIW architecture. However, the limit number of access ports to the global register file has become an issue which must be well addressed; otherwise the performance and energy consumption would be harmed. In this paper, we presented compiler optimization techniques for an RFCC VLIW architecture called Lily, which is designed for encryption systems. These techniques aim at optimizing performance and energy consumption for Lily architecture, through appropriate manipulation of the code generation process to maintain a better management of the accesses to the global register file. All the techniques have been implemented and evaluated. The result shows that our techniques can significantly reduce the penalty of performance and energy consumption due to access port limitation of global register file.

  11. 17 CFR 256.426.5 - Other deductions.

    Science.gov (United States)

    2010-04-01

    ... deductible before determining total income before interest charges. (b) Records shall be so maintained by...) UNIFORM SYSTEM OF ACCOUNTS FOR MUTUAL SERVICE COMPANIES AND SUBSIDIARY SERVICE COMPANIES, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935 Income and Expense Accounts § 256.426.5 Other deductions. (a) This account...

  12. Effectiveness of the Call in Beach Volleyball Attacking Play

    Directory of Open Access Journals (Sweden)

    Künzell Stefan

    2014-12-01

    Full Text Available In beach volleyball the setter has the opportunity to give her or his hitter a “call”. The call intends that the setter suggests to her or his partner where to place the attack in the opponent’s court. The effectiveness of a call is still unknown. We investigated the women’s and men’s Swiss National Beach Volleyball Championships in 2011 and analyzed 2185 attacks. We found large differences between female and male players. While men called in only 38.4% of attacks, women used calls in 85.5% of attacks. If the male players followed a given call, 63% of the attacks were successful. The success rate of attacks without any call was 55.8% and 47.6% when the call was ignored. These differences were not significant (χ2(2 = 4.55, p = 0.103. In women’s beach volleyball, the rate of successful attacks was 61.5% when a call was followed, 35% for attacks without a call, and 42.6% when a call was ignored. The differences were highly significant (χ2(2 = 23.42, p < 0.0005. Taking into account the findings of the present study, we suggested that the call was effective in women’s beach volleyball, while its effect in men’s game was unclear. Considering the quality of calls we indicate that there is a significant potential to increase the effectiveness of a call.

  13. PENGGUNAAN REGISTER DALAM WACANA RESEP MASAKAN BLUE BAND

    Directory of Open Access Journals (Sweden)

    Asri Soraya Afsari

    2018-03-01

    Full Text Available AbstractOn its using, language has diverse variation. Language in formal situation will be different from the informal one. Likewise the language for advertisement is different from scientific paper. In Sociolinguistics, the application of a language variant is called as Register. The food recipe discourse is one type of the register for it has specific characteristics in particular grammar and structure. This writing tries to review the application of the register in Blue Band  food recipe discourse. The result of the research indicates that it comprises vocabularies, morphology of derivatives and phrases, and also clauses. The finding register shows ingredients, tools, processing, and, serving.Keyword: register, food recipe discourse, sociolinguistics, vocabulary, morphology

  14. 18 CFR 367.4261 - Account 426.1, Donations.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Account 426.1, Donations. 367.4261 Section 367.4261 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY..., Donations. This account must include all payments or donations for charitable, social or community welfare...

  15. Register-based studies of cardiovascular disease

    DEFF Research Database (Denmark)

    Abildstrøm, Steen Z; Torp-Pedersen, Christian; Madsen, Mette

    2011-01-01

    Introduction: The use of the unique personal identification number in the Nordic database systems enables the researchers to link the registers at the individual level. The registers can be used for both defining specific patient populations and to identify later events during follow-up. This rev...... the hospitalisation rate and treatment of cardiovascular disease. The risk of unmeasured factors affecting the results calls for cautious interpretation of the results.......-up. This review gives three examples within cardiovascular epidemiology to illustrate the use of the national administrative registers available to all researchers upon request. Research topics: The hospitalisation rate of acute myocardial infarction (AMI) was expected to be increased and case-fatality rate......-based treatment increased significantly over time and adherence to treatment was high. Finally, use of specific nonsteroidal antiinflammatory drugs by healthy subjects was associated with a dose-dependent increase in cardiovascular risk. CONCLUSION: The nationwide registers have proven very useful in monitoring...

  16. 43 CFR 426.14 - Involuntary acquisition of land.

    Science.gov (United States)

    2010-10-01

    ... from excess status, except for: (A) Financial institutions; or (B) Landowners for which § 426.12(g) (1.... (a) Definitions for purposes of this section. Financial institution means a commercial bank or trust company, a private bank, an agency or branch of a foreign bank in the United States, a thrift institution...

  17. Universal Verification Methodology Based Register Test Automation Flow.

    Science.gov (United States)

    Woo, Jae Hun; Cho, Yong Kwan; Park, Sun Kyu

    2016-05-01

    In today's SoC design, the number of registers has been increased along with complexity of hardware blocks. Register validation is a time-consuming and error-pron task. Therefore, we need an efficient way to perform verification with less effort in shorter time. In this work, we suggest register test automation flow based UVM (Universal Verification Methodology). UVM provides a standard methodology, called a register model, to facilitate stimulus generation and functional checking of registers. However, it is not easy for designers to create register models for their functional blocks or integrate models in test-bench environment because it requires knowledge of SystemVerilog and UVM libraries. For the creation of register models, many commercial tools support a register model generation from register specification described in IP-XACT, but it is time-consuming to describe register specification in IP-XACT format. For easy creation of register model, we propose spreadsheet-based register template which is translated to IP-XACT description, from which register models can be easily generated using commercial tools. On the other hand, we also automate all the steps involved integrating test-bench and generating test-cases, so that designers may use register model without detailed knowledge of UVM or SystemVerilog. This automation flow involves generating and connecting test-bench components (e.g., driver, checker, bus adaptor, etc.) and writing test sequence for each type of register test-case. With the proposed flow, designers can save considerable amount of time to verify functionality of registers.

  18. Storage potential of ‘SCS426 Venice’ apples under different storage technologies

    Directory of Open Access Journals (Sweden)

    Mariuccia Schlichting de Martin

    2018-04-01

    Full Text Available Abstract This study aimed to evaluate the storage potential of SCS426 Venice apples under different storage technologies. Fruits were harvested in an experimental orchard located in Fraiburgo, SC and stored for up to eight and ten months in 2013 and 2014, respectively. Apples were treated or not with methylcyclopropene (1-MCP and stored under air atmosphere (AA, 0.5±0.5 °C/RH 85±5% or controlled atmosphere (CA; 1.5 kPa of O2 and 1.5 kPa of CO2 at 0.7±0.5 °C/RH of 93±3%. Fruits were evaluated every two months of storage, after one and seven days of shelf life (23 ± 0.3 °C/RH 93±3%. The storage period of ‘SCS426 Venice’ apples under AA without 1-MCP application should not extend beyond six months. Under this storage condition, fruits had higher incidence of decay, ethylene production and respiratory rates, higher skin degreening, lower flesh firmness, titratable acidity and soluble solids content than fruits stored under CA or AA with 1-MCP. ‘SCS426 Venice’ apples develop flesh browning and superficial scald after long-term storage. ‘SCS426 Venice’ apples under AA treated with 1-MCP or under CA (regardless of 1-MCP application can be stored for more than eight months, keeping flesh firmness above 14 lb and low incidence of physiological disorders even after ten months of storage.

  19. 9 CFR 93.426 - Inspection at port of entry.

    Science.gov (United States)

    2010-01-01

    ... CERTAIN ANIMALS, BIRDS, FISH, AND POULTRY, AND CERTAIN ANIMAL, BIRD, AND POULTRY PRODUCTS; REQUIREMENTS FOR MEANS OF CONVEYANCE AND SHIPPING CONTAINERS Ruminants Mexico 10 § 93.426 Inspection at port of entry. (a) All ruminants offered for entry from Mexico, including such ruminants intended for movement...

  20. Lensing substructure quantification in RXJ1131-1231: a 2 keV lower bound on dark matter thermal relic mass

    Energy Technology Data Exchange (ETDEWEB)

    Birrer, Simon; Amara, Adam; Refregier, Alexandre, E-mail: simon.birrer@phys.ethz.ch, E-mail: adam.amara@phys.ethz.ch, E-mail: alexandre.refregier@phys.ethz.ch [Institute for Astronomy, Department of Physics, ETH Zurich, Wolfgang-Pauli-Strasse 27, 8093, Zurich (Switzerland)

    2017-05-01

    We study the substructure content of the strong gravitational lens RXJ1131-1231 through a forward modelling approach that relies on generating an extensive suite of realistic simulations. We use a semi-analytic merger tree prescription that allows us to stochastically generate substructure populations whose properties depend on the dark matter particle mass. These synthetic halos are then used as lenses to produce realistic mock images that have the same features, e.g. luminous arcs, quasar positions, instrumental noise and PSF, as the data. We then analyse the data and the simulations in the same way with summary statistics that are sensitive to the signal being targeted and are able to constrain models of dark matter statistically using Approximate Bayesian Computing (ABC) techniques. (In this work, we focus on the thermal relic mass estimate and fix the semi-analytic descriptions of the substructure evolution based on recent literature.) We are able, based on the HST data for RXJ1131-1231, to rule out a warm dark matter thermal relic mass below 2 keV at the 2σ confidence level.

  1. The -1131T>C polymorphism in the apolipoprotein A5 gene is related to hypertriglyceridemia in Taiwanese aborigines.

    Science.gov (United States)

    Huang, Meng-Chuan; Wang, Tsu-Nai; Wang, Huan-Sen; Sung, Yi-Ching; Ko, Ying-Chin; Chiang, Hung-Che

    2008-04-01

    The prevalence of hypertriglyceridemia, considered to be an independent risk factor for the development of cardiovascular disease, is high in Taiwanese aborigines. This study was undertaken to examine the effect of the -1131T>C polymorphism in the apolipoprotein A5 gene on serum triglyceride levels in female Taiwanese aborigines. This was a cross-sectional study, and a total of 316 unrelated female Taiwanese aborigines were genotyped at the -1131T>C polymorphism in apolipoprotein A5 using the polymerase chain reaction-restriction fragment length polymorphism method. Serum triglyceride > or = 150 mg/dL was defined as the hypertriglyceridemia group and triglyceride Japanese and Han Chinese, but was higher than that in Caucasians. In a multiple logistic model adjusted for possible confounders, C allele-containing variants were independently associated with greater risks (CT genotype: OR = 3.28, 95% CI = 1.43-7.56; CC genotype: OR = 5.86, 95% CI = 2.15-15.99) of hypertriglyceridemia than the TT genotype (p fashion (for trend, p C polymorphism of the Apo A5 gene influences serum triglyceride levels in female Taiwanese aborigines, and that differences exist in the frequency of the C allele among people of various ethnicities.

  2. 43 CFR 426.8 - Nonresident aliens and foreign entities.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Nonresident aliens and foreign entities..., DEPARTMENT OF THE INTERIOR ACREAGE LIMITATION RULES AND REGULATIONS § 426.8 Nonresident aliens and foreign... reclamation law or these regulations, a nonresident alien or foreign entity that directly holds land in a...

  3. 38 CFR 42.6 - Prerequisites for issuing a complaint.

    Science.gov (United States)

    2010-07-01

    ... this section), the amount of money or the value of property or services, or both, demanded or requested... are unrelated or were not submitted simultaneously, regardless of the amount of money, or the value of... AFFAIRS (CONTINUED) STANDARDS IMPLEMENTING THE PROGRAM FRAUD CIVIL REMEDIES ACT § 42.6 Prerequisites for...

  4. Context Switching with Multiple Register Windows: A RISC Performance Study

    Science.gov (United States)

    Konsek, Marion B.; Reed, Daniel A.; Watcharawittayakul, Wittaya

    1987-01-01

    Although previous studies have shown that a large file of overlapping register windows can greatly reduce procedure call/return overhead, the effects of register windows in a multiprogramming environment are poorly understood. This paper investigates the performance of multiprogrammed, reduced instruction set computers (RISCs) as a function of window management strategy. Using an analytic model that reflects context switch and procedure call overheads, we analyze the performance of simple, linearly self-recursive programs. For more complex programs, we present the results of a simulation study. These studies show that a simple strategy that saves all windows prior to a context switch, but restores only a single window following a context switch, performs near optimally.

  5. Voice over IP phone calls from your smartphone

    CERN Multimedia

    2014-01-01

    All CERN users do have a Lync account (see here) and can use Instant Messaging, presence and other features. In addition, if your number is activated on Lync IP Phone(1) system then you can make standard phone calls from your computer (Windows/Mac).   Recently, we upgraded the infrastructure to Lync 2013. One of the major features is the possibility to make Voice over IP phone calls from a smartphone using your CERN standard phone number (not mobile!). Install Lync 2013 on iPhone/iPad, Android or Windows Phone, connect to WiFi network and make phone calls as if you were in your office. There will be no roaming charges because you will be using WiFi to connect to CERN phone system(2). Register here to the presentation on Tuesday 29 April at 11 a.m. in the Technical Training Center and see the most exciting features of Lync 2013.   Looking forward to seeing you! The Lync team (1) How to register on Lync IP Phone system: http://information-technology.web.cern.ch/book/lync-ip-phone-serv...

  6. Pollutant emission registers-INES and EPER toward PRTR

    International Nuclear Information System (INIS)

    Caricchia, A.M.; Cirillo, M.C.; Gagna, A.

    2005-01-01

    PRTRs (Pollutant Release and Transfer Registers) are information systems collecting and providing public access to information on pollutant releases in the environment. These registers are based on a scheduled reporting by the manufacturing facilities. Since the establishment of the TRI (Toxic Release lnventory) at the end of the '80s in the USA, international interest grew focussing on the definition of the features of national PRTRs as environmental management systems. The Protocol on PRTRs, the first international legally binding agreement, was signed in 2003 in the frame of the UNECE-Convention on Access to Information, Public Participation in Decision-making and Access to Justice in Environmental Matters (Aarhus Convention, 1999). The European register EPER (European Pollutant Emission Register), established in the Directive 96/61/EC, represents the first step at a European level towards a truly integrated pollutant emissions register, an experience which is going to improve further with the forthcoming introduction of the E-PRTR (European Pollutant Release and Transfer Register). Operating since 2003, EPER collects the information provided by 9377 facilities spread over EU15 countries plus Norway and Hungary. Concerning Italy, in accordance with European EPER, a national pollutant emission register has been established, called INES ('Inventario Nazionale delle Emissioni e loro Sorgenti'). INES can be currently browsed and queried on the following web-page: http://www.sinanet.apat.it [it

  7. 34 CFR 426.5 - What activities does the Secretary fund under the Program for Model Consumer and Homemaking...

    Science.gov (United States)

    2010-07-01

    ... the impact of new technology on life and work; (k) Applying consumer and homemaking education skills... 34 Education 3 2010-07-01 2010-07-01 false What activities does the Secretary fund under the Program for Model Consumer and Homemaking Education Projects? 426.5 Section 426.5 Education Regulations of...

  8. The ring cycle: an iterative lens reconstruction technique applied to MG1131 + 0456

    International Nuclear Information System (INIS)

    Kochanek, C.S.; Blandford, R.D.; Lawrence, C.R.; Narayan, R.

    1989-01-01

    A new technique is described for the analysis of well-resolved gravitational lens images. This method allows us to solve for the brightness distribution of the unlensed source as well as a parametrized model of the lens. Our algorithm computes a figure of merit for a lens model based on the scatter in the surface brightnesses of image elements that, according to the model, come from the same source element. Minimization of the figure of merit leads to an optimum solution for the source and the lens. We present a successful application of the method to VLA maps of the 'Einstein ring' radio source MG1131 + 0456 observed by previous authors. The inversion gives a normal galaxy-like elliptical potential for the lens and an ordinary double-lobed structure for the background radio source. (author)

  9. Make a 21st century phone call

    CERN Multimedia

    Katarina Anthony

    2014-01-01

    Want to avoid roaming charges? Click to call anyone at CERN? How about merging your CERN landline with your existing smartphone? That's all easily done with Lync, CERN's new opt-in service that can take your calls to the next level.   The Lync application on Windows (left) and iPhone (right). Lync unites CERN's traditional telephone service with the digital sphere. "Lync gives you the gift of mobility, by letting you access your CERN landline on the go," explains Pawel Grzywaczewski, service manager of the Lync system. "Once you've registered your CERN telephone with the service, you can run the Lync application and make calls from a range of supported devices. No matter where you are in the world - be it simply out to lunch or off at an international conference - you can make a CERN call as though you were in the office. All you need is an Internet connection!" Following a recent upgrade, CERN's Lync service now has...

  10. Should these potential CMR substances have been registered under REACH?

    DEFF Research Database (Denmark)

    Wedebye, Eva Bay; Nikolov, Nikolai Georgiev; Dybdahl, Marianne

    2013-01-01

    (Q)SAR models were applied to screen around 68,000 REACH pre-registered substances for CMR properties (carcinogenic, mutagenic or toxic to reproduction). Predictions from 14 relevant models were combined to reach overall calls for C, M and R. Combining predictions may reduce “noise” and increase...

  11. Das sprachliche Register (Speech Registers)

    Science.gov (United States)

    Hess-Luttich, Ernest W. B.

    1974-01-01

    The linguistic behavior of a given individual varies; he will on different occasions speak (or write) differently according to what may be roughly described as different social situations: he will use a number of different registers. The application of such registers both in the field of text analysis and in the preparation of teaching materials…

  12. Electrostatic discharges and their effect on the validity of registered values in intracranial pressure monitors

    DEFF Research Database (Denmark)

    Andresen, Morten; Thomsen, Ole Cornelius; Juhler, Marianne

    2013-01-01

    Object Intracranial pressure (ICP) monitoring is used extensively in clinical practice, and as such, the accuracy of registered ICP values is paramount. Clinical observations of nonphysiological changes in ICP have called into question the accuracy of registered ICP values. Subsequently, the auth......Object Intracranial pressure (ICP) monitoring is used extensively in clinical practice, and as such, the accuracy of registered ICP values is paramount. Clinical observations of nonphysiological changes in ICP have called into question the accuracy of registered ICP values. Subsequently......, the authors have tried to determine if the ICP monitors from major manufacturers were affected by electrostatic discharges (ESDs), if the changes were permanent or transient in nature, and if the changes were modified by the addition of different electrical appliances normally used in the neurointensive care....... Results Five pressure monitors from 4 manufacturers were evaluated. Three monitors containing electrical circuitry at the tip of the transducer were all affected by ESDs. Clinically significant permanent changes in the reported ICP values for 1 pressure monitor were observed, as well as temporary...

  13. External review and validation of the Swedish national inpatient register

    Directory of Open Access Journals (Sweden)

    Kim Jeong-Lim

    2011-06-01

    Full Text Available Abstract Background The Swedish National Inpatient Register (IPR, also called the Hospital Discharge Register, is a principal source of data for numerous research projects. The IPR is part of the National Patient Register. The Swedish IPR was launched in 1964 (psychiatric diagnoses from 1973 but complete coverage did not begin until 1987. Currently, more than 99% of all somatic (including surgery and psychiatric hospital discharges are registered in the IPR. A previous validation of the IPR by the National Board of Health and Welfare showed that 85-95% of all diagnoses in the IPR are valid. The current paper describes the history, structure, coverage and quality of the Swedish IPR. Methods and results In January 2010, we searched the medical databases, Medline and HighWire, using the search algorithm "validat* (inpatient or hospital discharge Sweden". We also contacted 218 members of the Swedish Society of Epidemiology and an additional 201 medical researchers to identify papers that had validated the IPR. In total, 132 papers were reviewed. The positive predictive value (PPV was found to differ between diagnoses in the IPR, but is generally 85-95%. Conclusions In conclusion, the validity of the Swedish IPR is high for many but not all diagnoses. The long follow-up makes the register particularly suitable for large-scale population-based research, but for certain research areas the use of other health registers, such as the Swedish Cancer Register, may be more suitable.

  14. A Retrospective Performance Assessment of the Developmental Neurotoxicity Study in Support of OECD Test Guideline 426

    DEFF Research Database (Denmark)

    Makris, Susan L.; Raffaele, Kathleen; Allen, Sandra

    2009-01-01

    OBJECTIVE: We conducted a review of the history and performance of developmental neurotoxicity mic (DNT) testing in support of the finalization and implementation of Organisation of Economic Co-operation and Development (OECD) DNT test guideline 426 (TG 426). INFORMATION SOURCES AND ANALYSIS......: In this review we summarize extensive scientific efforts that form the foundation for this testing paradigm, including basic neurotoxicology research, interlaboratory collaborative studies, expert workshops, and validation studies, and we address the relevance, applicability, and use of the DNT study in risk...... and international acceptance of new or updated test methods for hazard characterization. Multiple independent, expert scientific peer reviews affirm these conclusions....

  15. 25 CFR 42.6 - When does due process require a formal disciplinary hearing?

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false When does due process require a formal disciplinary... RIGHTS § 42.6 When does due process require a formal disciplinary hearing? Unless local school policies and procedures provide for less, a formal disciplinary hearing is required before a suspension in...

  16. Role of endothelin-converting enzyme, chymase and neutral endopeptidase in the processing of big ET-1, ET-1(1-21) and ET-1(1-31) in the trachea of allergic mice.

    Science.gov (United States)

    De Campo, Benjamin A; Goldie, Roy G; Jeng, Arco Y; Henry, Peter J

    2002-08-01

    The present study examined the roles of endothelin-converting enzyme (ECE), neutral endopeptidase (NEP) and mast cell chymase as processors of the endothelin (ET) analogues ET-1(1-21), ET-1(1-31) and big ET-1 in the trachea of allergic mice. Male CBA/CaH mice were sensitized with ovalbumin (10 microg) delivered intraperitoneal on days 1 and 14, and exposed to aerosolized ovalbumin on days 14, 25, 26 and 27 (OVA mice). Mice were killed and the trachea excised for histological analysis and contraction studies on day 28. Tracheae from OVA mice had 40% more mast cells than vehicle-sensitized mice (sham mice). Ovalbumin (10 microg/ml) induced transient contractions (15+/-3% of the C(max)) in tracheae from OVA mice. The ECE inhibitor CGS35066 (10 microM) inhibited contractions induced by big ET-1 (4.8-fold rightward shift of dose-response curve; Peffect on contractions induced by any of the ET analogues used. The NEP inhibitor CGS24592 (10 microM) inhibited contractions induced by ET-1(1-31) (6.2-fold rightward shift; Pbig ET-1. These data suggest that big ET-1 is processed predominantly by a CGS35066-sensitive ECE within allergic airways rather than by mast cell-derived proteases such as chymase. If endogenous ET-1(1-31) is formed within allergic airways, it is likely to undergo further conversion by NEP to more active products.

  17. Efficient Ada multitasking on a RISC register window architecture

    Science.gov (United States)

    Kearns, J. P.; Quammen, D.

    1987-01-01

    This work addresses the problem of reducing context switch overhead on a processor which supports a large register file - a register file much like that which is part of the Berkeley RISC processors and several other emerging architectures (which are not necessarily reduced instruction set machines in the purest sense). Such a reduction in overhead is particularly desirable in a real-time embedded application, in which task-to-task context switch overhead may result in failure to meet crucial deadlines. A storage management technique by which a context switch may be implemented as cheaply as a procedure call is presented. The essence of this technique is the avoidance of the save/restore of registers on the context switch. This is achieved through analysis of the static source text of an Ada tasking program. Information gained during that analysis directs the optimized storage management strategy for that program at run time. A formal verification of the technique in terms of an operational control model and an evaluation of the technique's performance via simulations driven by synthetic Ada program traces are presented.

  18. The mass-sheet degeneracy and time-delay cosmography: analysis of the strong lens RXJ1131-1231

    International Nuclear Information System (INIS)

    Birrer, Simon; Amara, Adam; Refregier, Alexandre

    2016-01-01

    We present extended modelling of the strong lens system RXJ1131-1231 with archival data in two HST bands in combination with existing line-of-sight contribution and velocity dispersion estimates. Our focus is on source size and its influence on time-delay cosmography. We therefore examine the impact of mass-sheet degeneracy and especially the degeneracy pointed out by Schneider and Sluse (2013) [1] using the source reconstruction scale. We also extend on previous work by further exploring the effects of priors on the kinematics of the lens and the external convergence in the environment of the lensing system. Our results coming from RXJ1131-1231 are given in a simple analytic form so that they can be easily combined with constraints coming from other cosmological probes. We find that the choice of priors on lens model parameters and source size are subdominant for the statistical errors for H 0 measurements of this systems. The choice of prior for the source is sub-dominant at present (2% uncertainty on H 0 ) but may be relevant for future studies. More importantly, we find that the priors on the kinematic anisotropy of the lens galaxy have a significant impact on our cosmological inference. When incorporating all the above modeling uncertainties, we find H 0 = 86.6 +6.8 -6.9 km s -1 Mpc -1 , when using kinematic priors similar to other studies. When we use a different kinematic prior motivated by Barnabè et al. (2012) [2] but covering the same anisotropic range, we find H 0 = 74.5 +8.0 -7.8 km s -1 Mpc -1 . This means that the choice of kinematic modeling and priors have a significant impact on cosmographic inferences. The way forward is either to get better velocity dispersion measures which would down weight the impact of the priors or to construct physically motivated priors for the velocity dispersion model.

  19. 76 FR 54185 - Fenamiphos; Proposed Data Call-In Order for Pesticide Tolerance

    Science.gov (United States)

    2011-08-31

    ... Data Call-In authority of section 3(c)(2)(B) of the Federal Insecticide, Fungicide, and Rodenticide Act... nematicide/insecticide. It is not currently registered under FIFRA. Fenamiphos' last FIFRA registration was... toxic effects induced by fenamiphos are related to its cholinesterase-inhibiting activity. In animal...

  20. 76 FR 27078 - Agency Information Collection Activities: Form N-426, Extension of a Currently Approved...

    Science.gov (United States)

    2011-05-10

    ... DEPARTMENT OF HOMELAND SECURITY U.S. Citizenship and Immigration Services Agency Information... Military or Naval Service; OMB Control No. 1615-0053. The Department of Homeland Security, U.S. Citizenship... sponsoring the collection: Form N-426, U.S. Citizenship and Immigration Services. (4) Affected public who...

  1. Regional legal consequences of the separation of the notion of registered office

    Directory of Open Access Journals (Sweden)

    Silvia CRISTEA

    2011-06-01

    Full Text Available Starting from the importance of defining the registered office with the commercial law, this study aims at analyzing the legal connotations of the business office in the fiscal law. The separations of the notions originate in the European regulations included in Law no 31/1990 regarding the commercial companies. Law no 105/1992 regarding the international private law, the Fiscal Code, and the International Conventions regarding the avoidance of double taxation. Depending on the fiscal legal status of the subject as either resident or non-resident, this study aims at finding what are the differences and the relations between the institutions called: registered office – business office.

  2. Closure Report for Corrective Action Unit 426: Cactus Spring Waste Trenches, Tonopah Test Range, Nevada

    Energy Technology Data Exchange (ETDEWEB)

    Dave Madsen

    1998-08-01

    This Closure Report provides the documentation for closure of the Cactus Spring Waste Trenches Corrective Action Unit (CAU) 426. The site is located on the Tonopah Test Range, approximately 225 kilometers northwest of Las Vegas, NV. CAU 426 consists of one corrective action site (CAS) which is comprised of four waste trenches. The trenches were excavated to receive solid waste generated in support of Operation Roller Coaster, primary the Double Tracks Test in 1963, and were subsequently backfilled. The Double Tracks Test involved use of live animals to assess the biological hazards associated with the nonnuclear detonation of plutonium-bearing devices. The Nevada Division of Environmental Protection approved Corrective Action Plan (CAP)which proposed ''capping'' methodology. The closure activities were completed in accordance with the approved CAP and consisted of constructing an engineered cover in the area of the trenches, constructing/planting a vegetative cover, installing a perimeter fence and signs, implementing restrictions on future use, and preparing a Post-Closure Monitoring Plan.

  3. Methodologies for optimizing ROP detector layout for CANDU (registered) reactors

    Energy Technology Data Exchange (ETDEWEB)

    Kastanya, Doddy, E-mail: kastanyd@aecl.c [Reactor Core Physics Branch, Atomic Energy of Canada Limited, 2251 Speakman Drive, Mississauga, ON, L5K 1B2 (Canada); Caxaj, Victor [Reactor Core Physics Branch, Atomic Energy of Canada Limited, 2251 Speakman Drive, Mississauga, ON, L5K 1B2 (Canada)

    2011-01-15

    The regional overpower protection (ROP) systems protect CANDU (registered) reactors against overpower in the fuel that would reduce the safety margin-to-dryout. Both a localized power peaking within the core (for example, as a result of certain reactivity device configuration) or a general increase in the core power level during a slow-loss-of-regulation (SLOR) event could cause overpower in the fuel. This overpower could lead to fuel sheath dryout. In the CANDU (registered) 600 MW (CANDU 6) design, there are two ROP systems in the core, one for each fast-acting shutdown systems. Each ROP system includes a number of fast-responding, self-powered flux detectors suitably distributed throughout the core within vertical and horizontal assemblies. Traditionally, the placement of these detectors was done using a method called the detector layout optimization (DLO). A new methodology for designing the detector layout for the ROP system has been developed recently. The new method, called the DETPLASA algorithm, utilizes the simulated annealing (SA) technique to optimize the placement of the detectors in the core. Both methodologies will be discussed in detail in this paper. Numerical examples are employed to better illustrate how each method works. Results from some sensitivity studies on three SA parameters are also presented.

  4. Australian lobbyist registers are not serving the purposes they were designed for.

    Science.gov (United States)

    Robertson, Narelle; Kypri, Kypros; Stafford, Julia; Daube, Mike; Avery, Michelle; Miller, Peter

    2017-07-11

    There is widespread concern about the nature, extent and impacts of lobbying by industries selling unhealthy commodities, which threatens public health and undermines important democratic processes. In the last decade, all Australian jurisdictions (except the Northern Territory) have established lobbyist registers with the stated objective of increasing the capacity of government and the public to scrutinise lobbying. Our aim was to assess whether the registers are fulfilling this objective. We conducted web searches of registers in Australian jurisdictions in 2014 and 2015 to determine what type of information they collected and whether data were accessible. We supplemented searches with e-mails and phone calls to registrars to clarify policies and seek additional information. We found that the data were lacking in critical details and historical information was difficult or impossible to obtain. None of the registers required in-house lobbyists to register or to be bound by the Lobbying Codes of Conduct. None required that informal lobbying (e.g. by government relations staff within a company) be recorded, and none provided detailed information about the nature and extent of lobbying activities. The registers do not meet the stated objective of making lobbying activity transparent to the Australian public. Timely access to comprehensive information is essential to help promote the rational development of policy concerning tobacco, alcohol and gambling problems. There is an urgent need to reform lobbyist registers to ensure that they are comprehensive and transparent. [Robertson N, Kypri K, Stafford J, Daube M, Avery M, Miller P. Australian lobbyist registers are not serving the purposes they were designed for. Drug Alcohol Rev 2017;00:000-000]. © 2017 Australasian Professional Society on Alcohol and other Drugs.

  5. A Scandinavian Experience of Register Collaboration: The Nordic Arthroplasty Register Association (NARA)

    DEFF Research Database (Denmark)

    Havelin, Leif I; Robertsson, Otto; Fenstad, Anne M

    2011-01-01

    The Nordic (Scandinavian) countries have had working arthroplasty registers for several years. However, the small numbers of inhabitants and the conformity within each country with respect to preferred prosthesis brands and techniques have limited register research.......The Nordic (Scandinavian) countries have had working arthroplasty registers for several years. However, the small numbers of inhabitants and the conformity within each country with respect to preferred prosthesis brands and techniques have limited register research....

  6. Josephson shift registers

    International Nuclear Information System (INIS)

    Przybysz, J.X.

    1989-01-01

    This paper gives a review of Josephson shift register circuits that were designed, fabricated, or tested, with emphasis on work in the 1980s. Operating speed is most important, since it often limits system performance. Older designs used square-wave clocks, but most modern designs use offset sine waves, with either two or three phases. Operating margins and gate bias uniformity are key concerns. The fastest measured Josephson shift register operated at 2.3 GHz, which compares well with a GaAs shift register that consumes 250 times more power. The difficulties of high-speed testing have prevented many Josephson shift registers from being operated at their highest speeds. Computer simulations suggest that 30-GHz operation is possible with current Nb/Al 2 O 3 /Nb technology. Junctions with critical current densities near 10 kA/cm 2 would make 100-GHz shift registers feasible

  7. Psychosocial correlates of police-registered youth crime. A Finnish population-based study.

    Science.gov (United States)

    Elonheimo, Henrik; Sourander, Andre; Niemelä, Solja; Nuutila, Ari-Matti; Helenius, Hans; Sillanmäki, Lauri; Ristkari, Terja; Parkkola, Kai

    2009-01-01

    This study is focused on psychosocial correlates of youth crime in a sample of 2330 Finnish boys born in 1981. Two kinds of data were combined: questionnaires completed by the boys at call-up in 1999 and crime registered in the Finnish National Police Register between 1998 and 2001. One-fifth of the boys were registered to offending during the 4-year period in late adolescence; 14% were registered for one or two offences, 4% for three to five offences, and 3% for more than five offences. Crime accumulated heavily in those with more than five offences, as they accounted for 68% of all crime. Independent correlates of crime were living in a small community, parents' low educational level and divorce, having a regular relationship, self-reported delinquency, daily smoking, and weekly drunkenness, whereas anxious-depressiveness was reversely associated with crime. Most psychosocial problems covaried linearly with offending frequency, being particularly manifested by multiple recidivists. However, recidivists had very rarely used mental health services. The results indicate that offending and various psychosocial problems accumulate in a small minority of boys not reached by mental health services.

  8. ''MOSAIK {sup registered}'' 20 years of experience with a cask system for transportation, conditioning and storage of radioactive waste

    Energy Technology Data Exchange (ETDEWEB)

    Gestermann, G. [GNS Gesellschaft fuer Nuklear-Service mbH, Essen (Germany)

    2004-07-01

    In Europe shielding casks for transportation and storage of radioactive waste with higher specific activity are in use. These casks developed by GNS and fabricated from ductile cast iron are called MOSAIK {sup registered} cask. At the moment 4 main types with some subtypes, named MOSAIK {sup registered} I, II, III and 80 T, are in use. The MOSAIK {sup registered} casks are licensed for the German interim storages and the planned final repository MOSAIK {sup registered} II and MOSAIK {sup registered} 80 T are licensed as a type B(U) cask also. Till now more then 4100 MOSAIK {sup registered} cask have been built and loaded with radioactive MAW material.

  9. 40 CFR 426.122 - Effluent limitations guidelines representing the degree of effluent reduction attainable by the...

    Science.gov (United States)

    2010-07-01

    ... Incandescent Lamp Envelope Manufacturing Subcategory § 426.122 Effluent limitations guidelines representing the...): (a) Any manufacturing plant which produces incandescent lamp envelopes shall meet the following... any 1 day Average of daily values for 30 consecutive days shall not exceed— Metric units (g/kkg of...

  10. Arthroplasty register for Germany

    Directory of Open Access Journals (Sweden)

    Hagen, Anja

    2009-10-01

    Full Text Available Scientific background: The annual number of joint replacement operations in Germany is high. The introduction of an arthroplasty register promises an important contribution to the improvement of the quality of patient’s care. Research questions: The presented report addresses the questions on organization and functioning, benefits and cost-benefits as well as on legal, ethical and social aspects of the arthroplasty registers. Methods: A systematic literature search was conducted in September 2008 in the medical databases MEDLINE, EMBASE etc. and was complemented with a hand search. Documents describing arthroplasty registers and/or their relevance as well as papers on legal, ethical and social aspects of such registers were included in the evaluation. The most important information was extracted and analysed. Results: Data concerning 30 arthroplasty registers in 19 countries as well as one international arthroplasty register were identified. Most of the arthroplasty registers are maintained by national orthopedic societies, others by health authorities or by their cooperation. Mostly, registries are financially supported by governments and rarely by other sources.The participation of the orthopedists in the data collection process of the arthroplasty registry is voluntary in most countries. The consent of the patients is usually required. The unique patient identification is ensured in nearly all registers.Each data set consists of patient and clinic identification numbers, data on diagnosis, the performed intervention, the operation date and implanted prostheses. The use of clinical scores, patient-reported questionnaires and radiological documentation is rare. Methods for data documentation and transfer are paper form, electronic entry as well as scanning of the data using bar codes. The data are mostly being checked for their completeness and validity. Most registers offer results of the data evaluation to the treating orthopedists and

  11. Characterization of a thermophilic cellulase from Geobacillus sp. HTA426, an efficient cellulase-producer on alkali pretreated of lignocellulosic biomass.

    Science.gov (United States)

    Potprommanee, Laddawan; Wang, Xiao-Qin; Han, Ye-Ju; Nyobe, Didonc; Peng, Yen-Ping; Huang, Qing; Liu, Jing-Yong; Liao, Yu-Ling; Chang, Ken-Lin

    2017-01-01

    A themophilic cellulase-producing bacterium was isolated from a hot spring district and identified as Geobacillus sp. HTA426. The cellulase enzyme produced by the Geobacillus sp. HTA426 was purified through ammonium sulfate precipitation and ion exchange chromatography, with the recovery yield and fold purification of 10.14% and 5.12, respectively. The purified cellulase has a molecular weight of 40 kDa. The optimum temperature and pH for carboxymethyl cellulase (CMCase) activity of the purified cellulase were 60°C and pH 7.0, respectively. The enzyme was also stable over a wide temperature range of 50°C to 70°C after 5 h of incubation. Moreover, the strain HTA426 was able to grow and produce cellulase on alkali-treated sugarcane bagasse, rice straw and water hyacinth as carbon sources. Enzymatic hydrolysis of sugarcane bagasse, which was regarded as the most effective carbon source for cellulase production (CMCase activity = 103.67 U/mL), followed by rice straw (74.70 U/mL) and water hyacinth (51.10 U/mL). This strain producing an efficient thermostable cellulose is a potential candidate for developing a more efficient and cost-effective process for converting lignocellulosic biomass into biofuel and other industrial process.

  12. A 32-bit NMOS microprocessor with a large register file

    Science.gov (United States)

    Sherburne, R. W., Jr.; Katevenis, M. G. H.; Patterson, D. A.; Sequin, C. H.

    1984-10-01

    Two scaled versions of a 32-bit NMOS reduced instruction set computer CPU, called RISC II, have been implemented on two different processing lines using the simple Mead and Conway layout rules with lambda values of 2 and 1.5 microns (corresponding to drawn gate lengths of 4 and 3 microns), respectively. The design utilizes a small set of simple instructions in conjunction with a large register file in order to provide high performance. This approach has resulted in two surprisingly powerful single-chip processors.

  13. 47 CFR 80.1131 - Transmissions of urgency communications.

    Science.gov (United States)

    2010-10-01

    ... consists of the words PAN PAN. In radiotelephony each word of the group must be pronounced as the French word “panne”. (d) The urgency call format and the urgency signal indicate that the calling station has... International Telecommunication Union (ITU), Place des Nations, CH-1211 Geneva 20, Switzerland. (k) Urgency...

  14. Call Forecasting for Inbound Call Center

    Directory of Open Access Journals (Sweden)

    Peter Vinje

    2009-01-01

    Full Text Available In a scenario of inbound call center customer service, the ability to forecast calls is a key element and advantage. By forecasting the correct number of calls a company can predict staffing needs, meet service level requirements, improve customer satisfaction, and benefit from many other optimizations. This project will show how elementary statistics can be used to predict calls for a specific company, forecast the rate at which calls are increasing/decreasing, and determine if the calls may stop at some point.

  15. Debug register rootkits : A study of malicious use of the IA-32 debug registers

    OpenAIRE

    Persson, Emil; Mattsson, Joel

    2012-01-01

    The debug register rootkit is a special type of rootkit that has existed for over a decade, and is told to be undetectable by any scanning tools. It exploits the debug registers in Intel’s IA-32 processor architecture. This paper investigates the debug register rootkit to find out why it is considered a threat, and which malware removal tools have implemented detection algorithms against this threat. By implementing and running a debug register rootkit against the most popular Linux tools, ne...

  16. The Danish Adoption Register.

    Science.gov (United States)

    Petersen, Liselotte; Sørensen, Thorkild I A

    2011-07-01

    The Danish Adoption Register was established in 1963-1964 to explore the genetic and environmental contribution to familial aggregation of schizophrenia. The register encompass information on all 14,425 non-familial adoptions of Danish children legally granted in Denmark 1924-1947. It includes name and date of birth of each adoptee and his or her biological and adoptive parents, date of transfer to adoptive parents and date of formal adoption. The linkage to biological and adoptive parents is close to complete, even biological fathers are registered for 91.4% of the adoptees. Adoption registers are a unique source allowing disentangling of genetic and familial environmental influences on traits, risk of diseases, and mortality.

  17. Danish registers on aspects of reproduction

    DEFF Research Database (Denmark)

    Blenstrup, Lene Tølbøll; Knudsen, Lisbeth B.

    2011-01-01

    Introduction: The establishing of three Danish population based registers, namely the Fertility Database, the Register of Legally Induced Abortions and the In Vitro Fertilisation register aimed at providing data for surveying of reproductive outcome. Content: The registers include information...... on births, abortions and assisted reproduction as well as selected characteristics of the women (and men) involved. Validity and Coverage: Both the validity and coverage of each register is considered of high quality. Conclusions: These registers provide, both individually and in combination, unique...

  18. Vapor-Liquid Equilibrium in the Mixture 1,1-Difluoroethane C2H4F2 + C4H8 2-Methylpropene (EVLM1131, LB5730_E)

    Science.gov (United States)

    Cibulka, I.; Fontaine, J.-C.; Sosnkowska-Kehiaian, K.; Kehiaian, H. V.

    This document is part of Subvolume A 'Binary Liquid Systems of Nonelectrolytes I' of Volume 26 'Heats of Mixing, Vapor-Liquid Equilibrium, and Volumetric Properties of Mixtures and Solutions' of Landolt-Börnstein Group IV 'Physical Chemistry'. It contains the Chapter 'Vapor-Liquid Equilibrium in the Mixture 1,1-Difluoroethane C2H4F2 + C4H8 2-Methylpropene (EVLM1131, LB5730_E)' providing data from direct measurement of pressure and mole fraction in vapor phase at variable mole fraction in liquid phase and constant temperature.

  19. 42 CFR 137.426 - May an Indian Tribe get an extension of time to file a notice of appeal?

    Science.gov (United States)

    2010-10-01

    ...-GOVERNANCE Appeals Pre-Award Disputes § 137.426 May an Indian Tribe get an extension of time to file a notice... time period. If the Indian Tribe has a valid reason for not filing its notice of appeal on time, it may...

  20. National Register Historic Districts

    Data.gov (United States)

    Iowa State University GIS Support and Research Facility — The National Register Historic District layer is a shape file showing the boundaries of Historic Districts that are listed on the National Register of Historic Places.

  1. a Discussion about Effective Ways of Basic Resident Register on GIS

    Science.gov (United States)

    Oku, Naoya; Nonaka, Yasuaki; Ito, Yutaka

    2016-06-01

    In Japan, each municipality keeps a database of every resident's name, address, gender and date of birth called the Basic Resident Register. If the address information in the register is converted into coordinates by geocoding, it can be plotted as point data on a map. This would enable prompt evacuation from disaster, analysis of distribution of residents, integrating statistics and so on. Further, it can be used for not only analysis of the current situation but also future planning. However, the geographic information system (GIS) incorporating the Basic Resident Register is not widely used in Japan because of the following problems: - Geocoding In order to plot address point data, it is necessary to match the Basic Resident Register and the address dictionary by using the address as a key. The information in the Basic Resident Register does not always match the actual addresses. As the register is based on applications made by residents, the information is prone to errors, such as incorrect Kanji characters. - Security policy on personal information In the register, the address of a resident is linked with his/her name and date of birth. If the information in the Basic Resident Register were to be leaked, it could be used for malicious purposes. This paper proposes solutions to the above problems. The suitable solutions for the problems depend on the purpose of use, thus it is important that the purpose should be defined and a suitable way of the application for each purpose should be chosen. In this paper, we mainly focus on the specific purpose of use: to analyse the distribution of the residents. We provide two solutions to improve the matching rate in geocoding. First, regarding errors in Kanji characters, a correction list of possible errors should be compiled in advance. Second, some sort of analyses such as distribution of residents may not require exactly correct position for the address point. Therefore we set the matching level in order: prefecture

  2. Relating timed and register automata

    Directory of Open Access Journals (Sweden)

    Diego Figueira

    2010-11-01

    Full Text Available Timed automata and register automata are well-known models of computation over timed and data words respectively. The former has clocks that allow to test the lapse of time between two events, whilst the latter includes registers that can store data values for later comparison. Although these two models behave in appearance differently, several decision problems have the same (undecidability and complexity results for both models. As a prominent example, emptiness is decidable for alternating automata with one clock or register, both with non-primitive recursive complexity. This is not by chance. This work confirms that there is indeed a tight relationship between the two models. We show that a run of a timed automaton can be simulated by a register automaton, and conversely that a run of a register automaton can be simulated by a timed automaton. Our results allow to transfer complexity and decidability results back and forth between these two kinds of models. We justify the usefulness of these reductions by obtaining new results on register automata.

  3. The Copenhagen School Health Records Register

    DEFF Research Database (Denmark)

    Baker, Jennifer L; Sørensen, Thorkild I A

    2011-01-01

    The Copenhagen School Health Records Register is an electronic register of health examination information on 372,636 children who attended school in Copenhagen, Denmark from 1936 to 2005.......The Copenhagen School Health Records Register is an electronic register of health examination information on 372,636 children who attended school in Copenhagen, Denmark from 1936 to 2005....

  4. The Danish Adoption Register

    DEFF Research Database (Denmark)

    Petersen, Liselotte; Sørensen, Thorkild I A

    2011-01-01

    The Danish Adoption Register was established in 1963-1964 to explore the genetic and environmental contribution to familial aggregation of schizophrenia.......The Danish Adoption Register was established in 1963-1964 to explore the genetic and environmental contribution to familial aggregation of schizophrenia....

  5. Registers of multiple sclerosis in Denmark

    DEFF Research Database (Denmark)

    Koch-Henriksen, N; Magyari, M; Laursen, B

    2015-01-01

    between a number of different environmental exposures in the past and the subsequent risk of MS. Some of these studies have been able to exonerate suspected risk factors. The other register, the nationwide Danish Multiple Sclerosis Treatment Register, is a follow-up register for all patients who have......There are two nationwide population-based registers for multiple sclerosis (MS) in Denmark. The oldest register is The Danish Multiple Sclerosis Registry (DMSR), which is an epidemiological register for estimation of prevalence and incidence of MS and survival, and for identifying exposures earlier...... received disease-modifying treatments since 1996. It has, in particular, contributed to the knowledge of the role of antibodies against the biological drugs used for the treatment of MS....

  6. [Bioacoustic of the advertisement call of Ceratophrys cranwelli (Anura: Ceratophryidae)].

    Science.gov (United States)

    Valetti, Julián Alonso; Salas, Nancy Edith; Martino, Adolfo Ludovico

    2013-03-01

    The advertisement call plays an important role in the life history of anuran amphibians, mainly during the breeding season. Call features represent an important character to discriminate species, and sound emissions are very effective to assure or reinforce genetic incompatibility, especially in the case of sibling species. Since frogs are ectotherms, acoustic properties of their calls will vary with temperature. In this study, we described the advertisement call of C. cranwelli, quantifying the temperature effect on its components. The acoustic emissions were recorded during 2007 using a DAT record Sony TCD-100 with stereo microphone ECM-MS907 Sony and tape TDK DAT-RGX 60. As males emit their calls floating in temporary ponds, water temperatures were registered after recording the advertisement calls with a digital thermometer TES 1300+/-0.1 degreeC. Altogether, 54 calls from 18 males were analyzed. The temporal variables of each advertisement call were measured using oscillograms and sonograms and the analyses of dominant frequency were performed using a spectrogram. Multiple correlation analysis was used to identify the temperature-dependent acoustic variables and the temperature effect on these variables was quantified using linear regression models. The advertisement call of C. cranwelli consists of a single pulse group. Call duration, Pulse duration and Pulse interval decreased with the temperature, whereas the Pulse rate increased with temperature. The temperature-dependent variables were standardized at 25 degreeC according to the linear regression model obtained. The acoustic variables that were correlated with the temperature are the variables which emissions depend on laryngeal muscles and the temperature constraints the contractile properties of muscles. Our results indicated that temperature explains an important fraction of the variability in some acoustic variables (79% in the Pulse rate), and demonstrated the importance of considering the effect of

  7. The Danish Pathology Register

    DEFF Research Database (Denmark)

    Bjerregaard, Beth; Larsen, Ole B

    2011-01-01

    The National Board of Health, Denmark in 1997 published guidelines for reporting of pathology data and the Danish Pathology Register (DPR) was established.......The National Board of Health, Denmark in 1997 published guidelines for reporting of pathology data and the Danish Pathology Register (DPR) was established....

  8. IT Risk register

    OpenAIRE

    Kohout, Karel

    2011-01-01

    The theoretical part of the thesis analyzes several selected methodologies and best-practices related to information technology risks management, with focus on documents and guidance developed by ISACA. It builds a set of ideas and basic requirements for effective model of an IT risk register. Strong emphasis is placed on mapping CobiT 4.1 based Risk IT to COBIT 5. The practical part describes implementation of an exploratory web-based IT risk register in Python programming language utilizing...

  9. Very wide register : an asymmetric register file organization for low power embedded processors.

    NARCIS (Netherlands)

    Raghavan, P.; Lambrechts, A.; Jayapala, M.; Catthoor, F.; Verkest, D.T.M.L.; Corporaal, H.

    2007-01-01

    In current embedded systems processors, multi-ported register files are one of the most power hungry parts of the processor, even when they are clustered. This paper presents a novel register file architecture, which has single ported cells and asymmetric interfaces to the memory and to the

  10. Registered Nurse (Associate Degree).

    Science.gov (United States)

    Ohio State Univ., Columbus. Center on Education and Training for Employment.

    This document, which is designed for use in developing a tech prep competency profile for the occupation of registered nurse (with an associate degree), lists technical competencies and competency builders for 19 units pertinent to the health technologies cluster in general and 5 units specific to the occupation of registered nurse. The following…

  11. Effects of a 3-year dietary intervention on age-related changes in triglyceride and apolipoprotein A-V levels in patients with impaired fasting glucose or new-onset type 2 diabetes as a function of the APOA5 -1131 T > C polymorphism.

    Science.gov (United States)

    Kim, Minjoo; Chae, Jey Sook; Kim, Miri; Lee, Sang-Hyun; Lee, Jong Ho

    2014-04-28

    The purpose of this study was to estimate the effects of a 3-year dietary intervention on age-related changes in triglyceride and apolipoprotein (apo A-V) levels in patients with impaired fasting glucose (IFG) or new-onset type 2 diabetes as a function of the APOA5 -1131 T > C polymorphism. We genotyped the APOA5 -1131 T > C polymorphism in 203 Korean individuals with IFG or new-onset type 2 diabetes for the TT (n = 91), TC (n = 98), and CC (n = 14) alleles. Plasma apo A-V and triglyceride levels were evaluated at baseline and after a 3-year dietary intervention. Our results showed that HDL, glucose, insulin, HOMA-IR index, free fatty acids, and apo A-V decreased and brachial-ankle pulse wave velocity (ba-PWV) and malondialdehyde (MDA) increased at the 3-year follow-up visit compared with baseline. Plasma apo A-V levels were reduced in subjects with the C allele (TC or CC) (P = 0.036) and triglyceride levels were reduced in subjects with the TT allele (P = 0.047). Subjects with the C allele showed lower post-treatment apo A-V and higher post-treatment fasting triglyceride levels than subjects with the TT allele. Changes in apo A-V and triglyceride levels were negatively correlated in subjects with the TT allele and positively correlated in subjects with the C allele. This study showed that the dietary intervention prevented an age-related increase in triglyceride levels in individuals with IFG or new-onset type 2 diabetes who possess the TT allele, but not the CT or CC allele, of the APOA5 -1131 T > C polymorphism.

  12. 1 CFR 11.7 - Federal Register Index.

    Science.gov (United States)

    2010-01-01

    ... 1 General Provisions 1 2010-01-01 2010-01-01 false Federal Register Index. 11.7 Section 11.7... REGISTER PUBLICATIONS SUBSCRIPTIONS § 11.7 Federal Register Index. The annual subscription price for the monthly Federal Register Index, purchased separately, in paper form, is $29. The price excludes postage...

  13. Illinois I/O Register to FASTBUS Interface

    International Nuclear Information System (INIS)

    Downing, R.; Lesny, D.; Whitten, W.

    1983-01-01

    The I/O Register to FASTBUS Interface (IORFI) is connected to a processor via two 16-bit output registers (OR1,OR2) and two 16-bit output resisters (IR1,IR2). One of the output registers (OR1) is used to specify the interface function which is to be performed when the interface is accessed via the Data-in Register (IR2) or the Data-out Register (OR2). The other input register (IR1) is used to read the direct status of the FASTBUS lines independent of OR1. The changes made to the SLAC design at the University of Illinois are described

  14. Molecular Electronic Shift Registers

    Science.gov (United States)

    Beratan, David N.; Onuchic, Jose N.

    1990-01-01

    Molecular-scale shift registers eventually constructed as parts of high-density integrated memory circuits. In principle, variety of organic molecules makes possible large number of different configurations and modes of operation for such shift-register devices. Several classes of devices and implementations in some specific types of molecules proposed. All based on transfer of electrons or holes along chains of repeating molecular units.

  15. Validation of a Cerebral Palsy Register

    DEFF Research Database (Denmark)

    Topp, Monica; Langhoff-Roos, Jens; Uldall, P.

    1997-01-01

    OBJECTIVES: To analyse completeness and validity of data in the Cerebral Palsy Register in Denmark, 1979-1982. METHODS: Completeness has been assessed by comparing data from The Danish National Patient Register (DNPR) with the cases included in the Cerebral Palsy Register (CPR). Agreement between......, but gestational age was subject to a systematic error, and urinary infections in pregnancy (kappa = 0.43) and placental abruption (kappa = 0.52) were seriously under-reported in the CPR. CONCLUSIONS: Completeness of the Cerebral Palsy Register in Denmark, 1979-1982, has been assessed to maximal 85%, emphasizing...

  16. Register-based studies of healthcare costs

    DEFF Research Database (Denmark)

    Kruse, Marie; Christiansen, Terkel

    2011-01-01

    Introduction: The aim of this paper is to provide an overview and a few examples of how national registers are used in analyses of healthcare costs in Denmark. Research topics: The paper focuses on health economic analyses based on register data. For the sake of simplicity, the studies are divided...... into three main categories: economic evaluations of healthcare interventions, cost-of-illness analyses, and other analyses such as assessments of healthcare productivity. Conclusion: We examined a number of studies using register-based data on healthcare costs. Use of register-based data renders...

  17. Register-based studies on migration, ethnicity, and health

    DEFF Research Database (Denmark)

    Norredam, Marie; Kastrup, Marianne; Helweg-Larsen, Karin

    2011-01-01

    INTRODUCTION: Researchers in Denmark have unique possibilities of register-based research in relation to migration, ethnicity, and health. This review article outlines how these opportunities have been used, so far, by presenting a series of examples. RESEARCH TOPICS: We selected six registers...... it discriminatory. Although, we do not register ethnicity in relation to use of health care in Denmark, our possibilities of linkage between population registers and registers on diseases and healthcare utilisation appear to render the same potentials....... to highlight the process of how migrant study populations have been established and studied in relation to different registers: The Danish Cancer Registry, the Danish Central Psychiatric Research Register, the Danish National Patient Register, the Danish National Health Service Register, the Danish Injury...

  18. In-memory interconnect protocol configuration registers

    Energy Technology Data Exchange (ETDEWEB)

    Cheng, Kevin Y.; Roberts, David A.

    2017-09-19

    Systems, apparatuses, and methods for moving the interconnect protocol configuration registers into the main memory space of a node. The region of memory used for storing the interconnect protocol configuration registers may also be made cacheable to reduce the latency of accesses to the interconnect protocol configuration registers. Interconnect protocol configuration registers which are used during a startup routine may be prefetched into the host's cache to make the startup routine more efficient. The interconnect protocol configuration registers for various interconnect protocols may include one or more of device capability tables, memory-side statistics (e.g., to support two-level memory data mapping decisions), advanced memory and interconnect features such as repair resources and routing tables, prefetching hints, error correcting code (ECC) bits, lists of device capabilities, set and store base address, capability, device ID, status, configuration, capabilities, and other settings.

  19. In-memory interconnect protocol configuration registers

    Science.gov (United States)

    Cheng, Kevin Y.; Roberts, David A.

    2017-09-19

    Systems, apparatuses, and methods for moving the interconnect protocol configuration registers into the main memory space of a node. The region of memory used for storing the interconnect protocol configuration registers may also be made cacheable to reduce the latency of accesses to the interconnect protocol configuration registers. Interconnect protocol configuration registers which are used during a startup routine may be prefetched into the host's cache to make the startup routine more efficient. The interconnect protocol configuration registers for various interconnect protocols may include one or more of device capability tables, memory-side statistics (e.g., to support two-level memory data mapping decisions), advanced memory and interconnect features such as repair resources and routing tables, prefetching hints, error correcting code (ECC) bits, lists of device capabilities, set and store base address, capability, device ID, status, configuration, capabilities, and other settings.

  20. Register-based research on twins

    DEFF Research Database (Denmark)

    Christensen, Kaare; Ohm Kyvik, Kirsten; Holm, Niels V

    2011-01-01

    Introduction: The Danish Twin Registry (DTR) has for more than 50 years been based on surveys and clinical investigations and over the two last decades also on register linkage. Currently these two approaches are merged within Statistics Denmark. Research topics: Here we report on three major...... groups of register-based research in the DTR that used the uniqueness of twinning. First, we focus on the ''long-term prognosis'' of being a twin compared with being a singleton and show that Danish twins have health trajectories in adulthood similar to singletons, which is a result of interest for twins...... illustrate how the co-twin control method in a register setting can be used to control for the effect of rearing environment and genetic factors in studies of the association between exposures and health. CONCLUSION: The spectrum of register-based twin studies is very wide and have changed in accordance...

  1. Songbirds use pulse tone register in two voices to generate low-frequency sound

    DEFF Research Database (Denmark)

    Jensen, Kenneth Kragh; Cooper, Brenton G.; Larsen, Ole Næsbye

    2007-01-01

    , the syrinx, is unknown. We present the first high-speed video records of the intact syrinx during induced phonation. The syrinx of anaesthetized crows shows a vibration pattern of the labia similar to that of the human vocal fry register. Acoustic pulses result from short opening of the labia, and pulse...... generation alternates between the left and right sound sources. Spontaneously calling crows can also generate similar pulse characteristics with only one sound generator. Airflow recordings in zebra finches and starlings show that pulse tone sounds can be generated unilaterally, synchronously...

  2. Barriers and opportunities in assessing calls to emergency medical communication centre--a qualitative study.

    Science.gov (United States)

    Lindström, Veronica; Heikkilä, Kristiina; Bohm, Katarina; Castrèn, Maaret; Falk, Ann-Charlotte

    2014-11-11

    Previous studies have described the difficulties and the complexity of assessing an emergency call, and assessment protocols intended to support the emergency medical dispatcher's (EMD) assessment have been developed and evaluated in recent years. At present, the EMD identifies about 50-70 % of patients suffering from cardiac arrest, acute myocardial infarction or stroke. The previous research has primarily been focused on specific conditions, and it is still unclear whether there are any overall factors that may influence the assessment of the call to the emergency medical communication centre (EMCC). The aim of the study was to identify overall factors influencing the registered nurses' (RNs) assessment of calls to the EMCC. A qualitative study design was used; a purposeful selection of calls to the EMCC was analysed by content analysis. One hundred calls to the EMCC were analysed. Barriers and opportunities related to the RN or the caller were identified as the main factors influencing the RN's assessment of calls to the EMCC. The opportunities appeared in the callers' symptom description and the communication strategies used by the RN. The barriers appeared in callers' descriptions of unclear symptoms, paradoxes and the RN's lack of communication strategies during the call. Barriers in assessing the call to the EMCC were associated with contradictory information, the absence of a primary problem, or the structure of the call. Opportunities were associated with a clear symptom description that was also repeated, and the RN's use of different communication strategies such as closed loop communication.

  3. The Danish Hip Arthroplasty Register

    DEFF Research Database (Denmark)

    Gundtoft, Per Hviid; Varnum, Claus; Pedersen, Alma Becic

    2016-01-01

    AIM OF DATABASE: The aim of the Danish Hip Arthroplasty Register (DHR) is to continuously monitor and improve the quality of treatment of primary and revision total hip arthroplasty (THA) in Denmark. STUDY POPULATION: The DHR is a Danish nationwide arthroplasty register established in January 1995...

  4. Village registers for vital registration in rural Malawi.

    Science.gov (United States)

    Singogo, E; Kanike, E; van Lettow, M; Cataldo, F; Zachariah, R; Bissell, K; Harries, A D

    2013-08-01

    Paper-based village registers were introduced 5 years ago in Malawi as a tool to measure vital statistics of births and deaths at the population level. However, usage, completeness and accuracy of their content have never been formally evaluated. In Traditional Authority Mwambo, Zomba district, Malawi, we assessed 280 of the 325 village registers with respect to (i) characteristics of village headmen who used village registers, (ii) use and content of village registers, and (iii) whether village registers provided accurate information on births and deaths. All village headpersons used registers. There were 185 (66%) registers that were regarded as 95% completed, and according to the registers, there were 115 840 people living in the villages in the catchment area. In 2011, there were 1753 births recorded in village registers, while 6397 births were recorded in health centre registers in the same catchment area. For the same year, 199 deaths were recorded in village registers, giving crude death rates per 100 000 population of 189 for males and 153 for females. These could not be compared with death rates in health centre registers due to poor and inconsistent recording in these registers, but they were compared with death rates obtained from the 2010 Malawi Demographic Health Survey that reported 880 and 840 per 100 000 for males and females, respectively. In conclusion, this study shows that village registers are a potential source for vital statistics. However, considerable inputs are needed to improve accuracy of births and deaths, and there are no functional systems for the collation and analysis of data at the traditional authority level. Innovative ways to address these challenges are discussed, including the use of solar-powered electronic village registers and mobile phones, connected with each other and the health facilities and the District Commissioner's office through the cellular network and wireless coverage. © 2013 John Wiley & Sons Ltd.

  5. The European Register of Specialists in Clinical Chemistry and Laboratory Medicine: guide to the Register, version 3-2010

    DEFF Research Database (Denmark)

    McMurray, Janet; Zérah, Simone; Hallworth, Michael

    2010-01-01

    In 1997, the European Communities Confederation of Clinical Chemistry and Laboratory Medicine (EC4) set up a Register for European Specialists in Clinical Chemistry and Laboratory Medicine. The operation of the Register is undertaken by a Register Commission (EC4RC). During the last 12 years, more...... than 2200 specialists in Clinical Chemistry and Laboratory Medicine have joined the Register. In 2007, EC4 merged with the Forum of European Societies of Clinical Chemistry and Laboratory Medicine (FESCC) to form the European Federation of Clinical Chemistry and Laboratory Medicine (EFCC). Two previous...

  6. REGISTER PELAKU INDUSTRI BATIK DI KOTA PEKALONGAN: KAJIAN SOSIOLINGUISTIS

    Directory of Open Access Journals (Sweden)

    Afrinar Pramitasari

    2014-08-01

    Full Text Available Register merupakan pemakaian bahasa dalam setiap bidang kehidupan yang tiap-tiap bidang kehidupanmempunyai bahasa khusus yang tidak dimengerti oleh kelompok lain. Pekalongan dikenal sebagai kota dansebagian besar pekerjaan masyarakat di Kota Pekalongan adalah sebagai perajin batik, maka dalam tuturanmereka sehari-hari juga banyak menggunakan kosakata khas bidang industri batik. Sumber data dalampenelitian ini adalah penggalan percakapan masyarakat perajin batik di Kota Pekalongan yang di dugamengandung register. Pengumpulan data menggunakan metode simak yang dalam pelaksanaanya diwujudkanmelalui teknik dasar dan teknik lanjutan. Hasil yang diperoleh dari penelitian ini adalah ada dua bentuk registerindustri batik yang ditemukan dalam penelitian ini yaitu register berdasarkan satuan lingual bahasanya danberdasarkan jenis kata. Berdasarkan satuan lingual bahasa ditemukan dua bentuk register yaitu registerberbentuk kata tunggal dan register berbentuk kata kompleks. Register berbentuk kata kompleks mencakup 1register berbentuk frasa, 2 register berbentuk kata majemuk, 3 register bentuk reduplikasi, dan 4 registerbentuk berafiks. Register a use of language in every area of life, the life of each field specific language that is notunderstood by other groups. Pekalongan City is known as the city that have potential in the batikindustry, because most of the people work in the City Pekalongan batik is as crafters, then in theireveryday speech too much use of vocabulary typical batik industry. Data sources in the form ofpublic speech in Pekalongan batik artisans containing registers. Refer to the method of datacollection that the implementation is realized through basic techniques and advanced techniques.The results of this study was two are three forms of batik industry registers were found in thisstudy is based on the unit registers lingual languag and based on grammatical categories. Basedon unit lingual language, found two registers form the single

  7. Effects of a 3-year dietary intervention on age-related changes in triglyceride and apolipoprotein A-V levels in patients with impaired fasting glucose or new-onset type 2 diabetes as a function of the APOA5 -1131 T > C polymorphism

    Science.gov (United States)

    2014-01-01

    Background The purpose of this study was to estimate the effects of a 3-year dietary intervention on age-related changes in triglyceride and apolipoprotein (apo A-V) levels in patients with impaired fasting glucose (IFG) or new-onset type 2 diabetes as a function of the APOA5 -1131 T > C polymorphism. Methods We genotyped the APOA5 -1131 T > C polymorphism in 203 Korean individuals with IFG or new-onset type 2 diabetes for the TT (n = 91), TC (n = 98), and CC (n = 14) alleles. Plasma apo A-V and triglyceride levels were evaluated at baseline and after a 3-year dietary intervention. Results Our results showed that HDL, glucose, insulin, HOMA-IR index, free fatty acids, and apo A-V decreased and brachial-ankle pulse wave velocity (ba-PWV) and malondialdehyde (MDA) increased at the 3-year follow-up visit compared with baseline. Plasma apo A-V levels were reduced in subjects with the C allele (TC or CC) (P = 0.036) and triglyceride levels were reduced in subjects with the TT allele (P = 0.047). Subjects with the C allele showed lower post-treatment apo A-V and higher post-treatment fasting triglyceride levels than subjects with the TT allele. Changes in apo A-V and triglyceride levels were negatively correlated in subjects with the TT allele and positively correlated in subjects with the C allele. Conclusions This study showed that the dietary intervention prevented an age-related increase in triglyceride levels in individuals with IFG or new-onset type 2 diabetes who possess the TT allele, but not the CT or CC allele, of the APOA5 -1131 T > C polymorphism. PMID:24775272

  8. Implementing the supportive supervision intervention for registered nurses in a long-term care home: a feasibility study.

    Science.gov (United States)

    McGilton, Katherine S; Profetto-McGrath, Joanne; Robinson, Angela

    2013-11-01

    This pilot study was conducted in response to the call in 2009 by the International Association of Gerontology and Geriatrics to focus on effective leadership structures in nursing homes and to develop leadership capacity. Few researchers have evaluated interventions aimed at enhancing the leadership ability of registered nurses in long-term care. The aim of the pilot study was to test the feasibility of a three-part supportive supervisory intervention to improve supervisory skills of registered nurses in long-term care. A repeated measures group design was used. Quantitative data were collected from healthcare aides, licensed practical nurses (i.e., supervised staff), and registered nurses (i.e., supervisors). Focus groups with care managers and supervisors examined perceptions of the intervention. There were nonsignificant changes in both the registered nurse supervisors' job satisfaction and the supervised staff's perception of their supervisors' support. Supervised staff scores indicated an increase in the use of research utilization but did not reflect an increase in job satisfaction. Focus group discussions revealed that the supervisors and care managers perceived the workshop to be valuable; however, the weekly self-reflection, coaching, and mentoring components of the intervention were rare and inconsistent. While the primary outcomes were not influenced by the Supportive Supervision Intervention, further effort is required to understand how best to enhance the supportive supervisory skills of RNs. Examples of how to improve the possibility of a successful intervention are advanced. Effective supervisory skills among registered nurses are crucial for improving the quality of care in long-term care homes. Registered nurses are receptive to interventions that will enhance their roles as supervisors. © 2013 Sigma Theta Tau International.

  9. 46 CFR 401.510 - Operation without Registered Pilots.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Operation without Registered Pilots. 401.510 Section 401... REGULATIONS Penalties; Operations Without Registered Pilots § 401.510 Operation without Registered Pilots. (a... Registered Pilot when the vessel or its cargo is in distress or jeopardy. (b) A vessel may be navigated in...

  10. Identifying victims of violence using register-based data

    DEFF Research Database (Denmark)

    Kruse, Marie; Sørensen, Jan; Brønnum-Hansen, Henrik

    2010-01-01

    AIMS: The aim of this study was twofold. Firstly we identified victims of violence in national registers and discussed strengths and weaknesses of this approach. Secondly we assessed the magnitude of violence and the characteristics of the victims using register-based data. METHODS: We used three...... nationwide registers to identify victims of violence: The National Patient Register, the Victim Statistics, and the Causes of Death Register. We merged these data and assessed the degree of overlap between data sources. We identified a reference population by selecting all individuals in Denmark over 15....... RESULTS: In 2006, 22,000 individuals were registered as having been exposed to violence. About 70% of these victims were men. Most victims were identified from emergency room contacts and police records, and few from the Causes of Death Register. There was some overlap between the two large data sources...

  11. Register as the Situational Variety of Language

    Directory of Open Access Journals (Sweden)

    Natalya B. Boyeva-Omelechko

    2016-12-01

    Full Text Available The problem discussed in the article is topical due to the interest of scientists to different types of language variations and especially registers or situational dialects treated by M.A.K. Halliday as use-related varieties of language or varieties used in a particular social setting. As discourse categorization is a very complex problem scholarly consensus has not been reached for the definitions of the term «register». The universal criteria for defining and discriminating registers have not been worked out either. The authors of the article give the review of scientific works devoted to the problem in question especially works by M.A.K. Halliday, R. Quirk, M. Joos, D. Hymes P. Trudgill, E.I. Belyaeva and others and analyze different definitions of the term «register», spectrums of registers and criteria for their discriminating. It enables the authors to come to the conclusion that only registers with the same field (religious, political, business etc. and mode (oral/written, dialogue/monologue can be compared. The difference lies in the sphere of tenor which depends on the degree of formality, distance of power and socio-psychological distance between speakers. The authors believe that it is also necessary to take into account the cooperative/ uncooperative character of conversation and para-verbal and non-verbal components of the speech situation. With this in mind they offer their definition of the register and describe main characteristics of registers in the sphere of oral communication.

  12. New course: “Lync – click to call and collaborate with others”

    CERN Multimedia

    2013-01-01

    The presentation will cover main features of Lync: initiating and receiving phone calls from Lync, chatting (Instant Message), how to stay connected as if you were in your office, creating and participating in online meetings, sharing presentations/desktops with other people, using voice mailbox on Exchange, integration with Outlook, CERN Phone book, phone system etc. General information about Lync can be found on http://cern.ch/lync. Softphone features of Lync are detailed on http://cern.ch/softphone. Next session: 16 May 2013 from 2 p.m. to 3 p.m. in English. Please register through the training catalogue. Lync service & Technical training

  13. Attributes of advanced practice registered nurse care coordination for children with medical complexity.

    Science.gov (United States)

    Cady, Rhonda G; Kelly, Anne M; Finkelstein, Stanley M; Looman, Wendy S; Garwick, Ann W

    2014-01-01

    Care coordination is an essential component of the pediatric health care home. This study investigated the attributes of relationship-based advanced practice registered nurse care coordination for children with medical complexity enrolled in a tertiary hospital-based health care home. Retrospective review of 2,628 care coordination episodes conducted by telehealth over a consecutive 3-year time period for 27 children indicated that parents initiated the majority of episodes and the most frequent reason was acute and chronic condition management. During this period, care coordination episodes tripled, with a significant increase (p < .001) between years 1 and 2. The increased episodes could explain previously reported reductions in hospitalizations for this group of children. Descriptive analysis of a program-specific survey showed that parents valued having a single place to call and assistance in managing their child's complex needs. The advanced practice registered nurse care coordination model has potential for changing the health management processes for children with medical complexity. Copyright © 2014 National Association of Pediatric Nurse Practitioners. Published by Mosby, Inc. All rights reserved.

  14. Increasing Rates of Brain Tumours in the Swedish National Inpatient Register and the Causes of Death Register

    Directory of Open Access Journals (Sweden)

    Lennart Hardell

    2015-04-01

    Full Text Available Radiofrequency emissions in the frequency range 30 kHz–300 GHz were evaluated to be Group 2B, i.e., “possibly”, carcinogenic to humans by the International Agency for Research on Cancer (IARC at WHO in May 2011. The Swedish Cancer Register has not shown increasing incidence of brain tumours in recent years and has been used to dismiss epidemiological evidence on a risk. In this study we used the Swedish National Inpatient Register (IPR and Causes of Death Register (CDR to further study the incidence comparing with the Cancer Register data for the time period 1998–2013 using joinpoint regression analysis. In the IPR we found a joinpoint in 2007 with Annual Percentage Change (APC +4.25%, 95% CI +1.98, +6.57% during 2007–2013 for tumours of unknown type in the brain or CNS. In the CDR joinpoint regression found one joinpoint in 2008 with APC during 2008–2013 +22.60%, 95% CI +9.68, +37.03%. These tumour diagnoses would be based on clinical examination, mainly CT and/or MRI, but without histopathology or cytology. No statistically significant increasing incidence was found in the Swedish Cancer Register during these years. We postulate that a large part of brain tumours of unknown type are never reported to the Cancer Register. Furthermore, the frequency of diagnosis based on autopsy has declined substantially due to a general decline of autopsies in Sweden adding further to missing cases. We conclude that the Swedish Cancer Register is not reliable to be used to dismiss results in epidemiological studies on the use of wireless phones and brain tumour risk.

  15. The Effect of Perceiving a Calling on Pakistani Nurses' Organizational Commitment, Organizational Citizenship Behavior, and Job Stress.

    Science.gov (United States)

    Afsar, Bilal; Shahjehan, Asad; Cheema, Sadia; Javed, Farheen

    2018-03-01

    People differ considerably in the way in which they express and experience their nursing careers. The positive effects associated with having a calling may differ substantially based on individuals' abilities to live out their callings. In a working world where many individuals have little to no choice in their type of employment and thus are unable to live out a calling even if they have one, the current study examined how perceiving a calling and living a calling interacted to predict organizational commitment, organizational citizenship behavior, and job stress with career commitment mediating the effect of the interactions on the three outcome variables. The purpose of the study is to investigate the mediating effect of career commitment between the relationships of calling and (a) nurses' attitudes (organizational commitment), (b) behaviors (organizational citizenship behavior), and (c) subjective experiences regarding work (job stress). Using a descriptive exploratory design, data were collected from 332 registered nurses working in Pakistani hospitals. Descriptive analysis and hierarchical regression analysis were used for data analysis. Living a calling moderated the effect of calling on career commitment, organizational citizenship behavior, and job stress, and career commitment fully mediated the effect of calling on organizational commitment, organizational citizenship behavior, and job stress. Increasing the understanding of calling, living a calling, and career commitment may increase nurses' organizational commitment and organizational citizenship behavior and decrease job stress. The study provided evidence to help nursing managers and health policy makers integrate knowledge and skills related to calling into career interventions and help nurses discover their calling.

  16. The European Register of Specialists in Clinical Chemistry and Laboratory Medicine: guide to the Register, version 3-2010.

    LENUS (Irish Health Repository)

    McMurray, Janet

    2010-07-01

    In 1997, the European Communities Confederation of Clinical Chemistry and Laboratory Medicine (EC4) set up a Register for European Specialists in Clinical Chemistry and Laboratory Medicine. The operation of the Register is undertaken by a Register Commission (EC4RC). During the last 12 years, more than 2200 specialists in Clinical Chemistry and Laboratory Medicine have joined the Register. In 2007, EC4 merged with the Forum of European Societies of Clinical Chemistry and Laboratory Medicine (FESCC) to form the European Federation of Clinical Chemistry and Laboratory Medicine (EFCC). Two previous Guides to the Register have been published, one in 1997 and another in 2003. The third version of the Guide is presented in this article and is based on the experience gained and development of the profession since the last revision. Registration is valid for 5 years and the procedure and criteria for re-registration are presented as an Appendix at the end of the article.

  17. Catalog of 199 register-based definitions of chronic conditions

    DEFF Research Database (Denmark)

    Hvidberg, Michael F; Johnsen, Søren P; Glümer, Charlotte

    2016-01-01

    INTRODUCTION: The aim of the current study was to present and discuss a broad range of register-based definitions of chronic conditions for use in register research, as well as the challenges and pitfalls when defining chronic conditions by the use of registers. MATERIALS AND METHODS: The definit......INTRODUCTION: The aim of the current study was to present and discuss a broad range of register-based definitions of chronic conditions for use in register research, as well as the challenges and pitfalls when defining chronic conditions by the use of registers. MATERIALS AND METHODS......: The definitions were defined based on information from nationwide Danish public healthcare registers. Medical and epidemiological specialists identified and grouped relevant diagnosis codes that covered chronic conditions, using the International Classification System version 10 (ICD-10). Where relevant...... definitions were proposed based on record linkage between multiple registers, including registers of prescribed drugs and use of general practitioners' services. CONCLUSIONS THIS STUDY PROVIDED A CATALOG OF REGISTER-BASED DEFINITIONS FOR CHRONIC CONDITIONS FOR USE IN HEALTHCARE PLANNING AND RESEARCH, WHICH IS...

  18. The effectiveness of television advertising campaigns on generating calls to a national Quitline by Māori.

    Science.gov (United States)

    Wilson, N; Grigg, M; Graham, L; Cameron, G

    2005-08-01

    To examine the effectiveness of four mass media campaigns on calls to a national Quitline by Māori (the indigenous people of New Zealand). Monthly Quitline call data and calls within one hour of a television commercial (TVC) being shown were analysed for the 2002-2003 period. Data on target audience rating points (TARPs) and expenditure on TVCs were also used (n = 2319 TVC placements). Māori were found to register with the Quitline at higher rates during the most intense six campaign months (15% more registrations compared to less intense months). The most effective campaign generated 115 calls per 100 TARPs by Māori callers within one hour of TVC airing (the "Every cigarette" campaign). A more Māori orientated campaign with both health and cultural themes generated 91 calls per 100 TARPs from Māori callers. For these two campaigns combined, the advertising cost per new registration with the Quitline by a Māori caller was NZD 30-48. Two second hand smoke campaigns that did not show the Quitline number were much less effective at 25 and 45 calls per 100 TARPs. These television advertising campaigns were effective and cost effective in generating calls to a national Quitline by Māori. Health authorities should continue to explore the use of both "threat appeal" style media campaigns and culturally appropriate campaigns to support Quitline use by indigenous peoples.

  19. Registered Nurses' views on their professional role.

    Science.gov (United States)

    Furåker, Carina

    2008-11-01

    The aim is to study Registered Nurses' opinions and reflections about their work tasks, competence and organization in acute hospital care. The definition of the role of nurses has changed over time and it is often discussed whether Registered Nurses have a professional status or not. A qualitative research design was used. Data were derived from written reflections on diaries and from focus group interviews. All respondents had difficulties in identifying the essence of their work. It can be argued that being 'a spider in the web' is an important aspect of the nursing profession. Registered Nurses tend to regard their professional role as vague. Managers must be considered key persons in defining the professional role of Registered Nurses. This study contributes to an understanding of the managers' and the importance of nursing education in Registered Nurses professional development.

  20. The association between fluoride in drinking water and dental caries in Danish children. Linking data from health registers, environmental registers and administrative registers

    DEFF Research Database (Denmark)

    Kirkeskov, Lilli; Kristiansen, Eva; Bøggild, Henrik

    2010-01-01

    Kirkeskov L, Kristiansen E, Bøggild H, von Platen-Hallermund F, Sckerl H, Carlsen A, Larsen MJ, Poulsen S. The association between fluoride in drinking water and dental caries in Danish children. Linking data from health registers, environmental registers and administrative registers. Community...... Dent Oral Epidemiol 2010. (c) 2010 John Wiley & Sons A/S Abstract - Objectives: To study the association between fluoride concentration in drinking water and dental caries in Danish children. Methods: The study linked registry data on fluoride concentration in drinking water over a 10-year period...... with data on dental caries from the Danish National Board of Health database on child dental health for 5-year-old children born in 1989 and 1999, and for 15-year-old children born in 1979 and 1989. The number of children included in the cohorts varied between 41.000 and 48.000. Logistic regression was used...

  1. Blended call center with idling times during the call service

    NARCIS (Netherlands)

    Legros, Benjamin; Jouini, Oualid; Koole, Ger

    We consider a blended call center with calls arriving over time and an infinitely backlogged amount of outbound jobs. Inbound calls have a non-preemptive priority over outbound jobs. The inbound call service is characterized by three successive stages where the second one is a break; i.e., there is

  2. The role of the registered nurse in the marketing of primary healthcare services, as part of health promotion.

    Science.gov (United States)

    Rall, M; Meyer, S M

    2006-03-01

    Existing literature on the marketing of primary healthcare services was reviewed to determine the role of registered nurses in this regard. The systematic review included five searches and ensured wide coverage of the results of available primary research studies on the topic. The results were summarised and the role of registered nurses in the marketing of primary healthcare services was identified. Primary research sources on the topic included textbooks on marketing by experts in the field and relevant journal articles by authorities on healthcare marketing. The data were analysed and four main categories identified. To ensure the trustworthiness of the research, Lincoln and Guba's (1981: 215-216) criteria, as explained by Krefting (1991: 217), were applied. Because the population consisted of only literature, ethical considerations concerning human subjects were irrelevant. Results indicated that the basic commercial marketing principles (the so-called 4Ps--product, price, place, and promotion) could be adapted for the health sector. The conclusion was that registered nurses could contribute to the marketing of primary healthcare services by communicating with the community (promotion) and by ensuring effective service (product) delivery at the right price and place. Registered nurses could influence the community's perceptions of health care and facilitate behaviour changes, thereby promote health. The implementation of the findings and recommendations of this research could create a new awareness among registered nurses of their role in the marketing of primary healthcare services in South Africa and improve their skills in this regard.

  3. Procedure entry in the register of yachts

    Directory of Open Access Journals (Sweden)

    Zorana Kostović

    2011-01-01

    Full Text Available The procedure of ship registration is regulated in the Maritime Code of Croatia (2004. This procedure, in comparison with the recently suspended Maritime Code of Croatia (1994, includes substantial changes, especially in the domain of yacht registration. New Maritime Code has founded special yacht-register for yachts and yachts under construction. A yacht which is registered as a Croatian yacht is entitled to the benefits conffered by the Maritime Code of Croatia (right to fly a Croatian flag, etc.. There are two modes proscribed under the provisions of Maritime Code of Croatia (2004 for yacht-registration: 1 mandatory and 2 facultative. Yachts whose owners are Croatian citizens with residence i Republic Croatia or companies which are registered in the Republic of Croatia are obligated to register under the provisions of Maritime Code of Croatia (2004. On the other hand, yacht whose owners are not Croatian citizens or whose owners are Croatian citizens but without the residence in the Republic of Croatia, can be registered in the Republic of Croatia, depending on the will of the owner. Yachts under construction can be registered in special registers for such kind of vessels if they are built in Croatian shipyards (owners can be either Croatian citizens or foreigners. Jurisdiction in this matter belongs to port authorities and all procedure is carried out in accordance with the rules of administrative procedure.

  4. DEM4-26, Least Square Fit for IBM PC by Deming Method

    International Nuclear Information System (INIS)

    Rinard, P.M.; Bosler, G.E.

    1989-01-01

    1 - Description of program or function: DEM4-26 is a generalized least square fitting program based on Deming's method. Functions built into the program for fitting include linear, quadratic, cubic, power, Howard's, exponential, and Gaussian; others can easily be added. The program has the following capabilities: (1) entry, editing, and saving of data; (2) fitting of any of the built-in functions or of a user-supplied function; (3) plotting the data and fitted function on the display screen, with error limits if requested, and with the option of copying the plot to the printer; (4) interpolation of x or y values from the fitted curve with error estimates based on error limits selected by the user; and (5) plotting the residuals between the y data values and the fitted curve, with the option copying the plot to the printer. 2 - Method of solution: Deming's method

  5. Feeling like a nurse: re-calling the spirit of nursing.

    Science.gov (United States)

    Spence, Deborah; Smythe, Elizabeth

    2008-12-01

    To explore the essential meaning of being a nurse. Nine registered nurses were each asked to write a story of a time when they felt like a nurse. Analysis was informed by Heideggerian hermeneutic philosophy, seeking to reveal the phenomenon of "feeling like a nurse." As part of a workshop on phenomenological methodology, participants were invited to reflect on a personal experience of feeling like a nurse. These documents were analyzed according to the method of van Manen. Participants were kept informed throughout each phase. Feelings announce primordial meaning of feeling like a nurse. Nurses experience the call as mood attuned by an anxiety that creates possibilities for authentic caring. It is a way of being that encompasses watching and acting, doing to and caring for, and taking over and giving back. Moreover, it is after the encounter that the essential meaning is more clearly revealed. We argue that there is value in continuing to question the meaning of "being a nurse." Amid a complex and increasingly technological world, this calls the profession to remember the human encounter at the heart of all nursing.

  6. Effect of Registered Partnership on Labor Earnings and Fertility for Same-Sex Couples: Evidence From Swedish Register Data.

    Science.gov (United States)

    Aldén, Lina; Edlund, Lena; Hammarstedt, Mats; Mueller-Smith, Michael

    2015-08-01

    The expansion of legal rights to same-sex couples is a foot in a number of Western countries. The effects of this rollout are not only important in their own right but can also provide a window on the institution of marriage and the rights bundled therein. In this article, using Swedish longitudinal register data covering 1994-2007, we study the impact of the extension of rights to same-sex couples on labor earnings and fertility. In 1994, registered partnership for same-sex couples was introduced, which conferred almost all rights and obligations of marriage--a notable exception being joint legal parenting, by default or election. The latter was added in the 2002 adoption act. We find registered partnership to be important to both gays and lesbians but for different reasons. For gays, resource pooling emerges as the main function of registered partnerships. For lesbians, registered partnership appears to be an important vehicle for family formation, especially after the 2002 adoption act. In contrast to heterosexual couples (included for comparison), we find no evidence of household specialization among lesbians. The lack of specialization is noteworthy given similar fertility effects of registered partnership (after 2002) and the fact that lesbian couples were less assortatively matched (on education) than heterosexual couples--children and unequal earnings power being two factors commonly believed to promote specialization.

  7. A Synoptic of Software Implementation for Shift Registers Based on 16th Degree Primitive Polynomials

    Directory of Open Access Journals (Sweden)

    Mirella Amelia Mioc

    2016-08-01

    Full Text Available Almost all of the major applications in the specific Fields of Communication used a well-known device called Linear Feedback Shift Register. Usually LFSR functions in a Galois Field GF(2n, meaning that all the operations are done with arithmetic modulo n degree Irreducible  and especially  Primitive Polynomials. Storing data in Galois Fields allows effective and manageable manipulation, mainly in computer cryptographic applications. The analysis of functioning for Primitive Polynomials of 16th degree shows that almost all the obtained results are in the same time distribution.

  8. New course: “Lync – click to call and collaborate with others”

    CERN Multimedia

    2013-01-01

    The presentation will cover the main features of Lync: initiating and receiving phone calls from Lync, chatting (Instant Message), how to stay connected as you were in your office, creating and participating in online meetings, sharing presentations/desktops with other people, using the voice mailbox on Exchange, integration with Outlook, CERN Phone book, phone system etc.   General information about Lync can be found on http://cern.ch/lync, Softphone features of Lync are detailed on http://cern.ch/softphone. Next session: 17 June 2013, from 11 a.m. to 12 a.m. in French. Please register through the Training Catalogue. Lync service and Technical Training

  9. The role of the registered nurse in the marketing of primary healthcare services, as part of health promotion

    Directory of Open Access Journals (Sweden)

    M Rail

    2006-09-01

    Full Text Available Existing literature on the marketing of primary healthcare services was reviewed to determine the role of registered nurses in this regard. The systematic review included “— five searches and ensured wide coverage of the results of available primary research studies on the topic. The results were summarised and the role of registered nurses in the marketing of primary healthcare services was identified. Primary research sources on the topic included textbooks on marketing by experts in the field and relevant journal articles by authorities on healthcare marketing. The data were analysed and four main categories identified. To ensure the trustworthiness of the research, Lincoln and Guba’s (1981:215-216 criteria, as explained by Krefting (1991:217, were applied. Because the population consisted of only literature, ethical considerations concerning human subjects were irrelevant. Results indicated that the basic commercial marketing principles (the so-called 4Ps - product, price, place, and promotion could be adapted for the health sector. The conclusion was that registered nurses could contribute to the marketing of primary healthcare services by communicating with the community (promotion and by ensuring effective service (product delivery at the right price and place. Registered nurses could influence the community’s perceptions of health care and facilitate behaviour changes, thereby promote health. The implementation of the findings and recommendations of this research could create a new awareness among registered nurses of their role in the marketing of primary healthcare services in South Africa and improve their skills in this regard.

  10. Josephson shift register design and layout

    International Nuclear Information System (INIS)

    Przybysz, J.X.; Buttyan, J.; Blaugher, R.D.

    1989-01-01

    Integrated circuit chips were designed and fabricated, based on Josephson shift register circuit that simulated operation at 25 GHz using the SPICE program. The 6.25 mm square chip featured a twelve-gate, four-stage shift register fabricated with Nb/AlO/sub x//Nb Josephson junctions with a design value of 2000 A/cm/sup 2/ critical current density. SUPERCOMPACT, a general program for the design of monolithic microwave integrated circuits, was used to model the effects of layout geometry on the uniformity and phase coherence of logic gate bias currents. Gate bias resistors were treated as resistive transmission lines. A layout geometry for the superconductive transmission lines and thin film bias resistors was developed. The original SPICE-designed circuit was modified as a result of these calculations. Modeling indicated that bias current variations could be limited to 3% for all possible logic states of the shift register, and phase coherence of the gates could be maintained to within 2 degrees of 10 Ghz. The fundamental soundness of the circuit design was demonstrated by the proper operation of fabricated shift registers

  11. EU Transparency Register

    NARCIS (Netherlands)

    Mańko, R.; Thiel, M.; Bauer, E.

    2014-01-01

    Widespread lobbying in the EU institutions has led to criticism regarding the transparency and accountability of the EU's decision-making process. In response to these concerns, the Parliament set up its transparency register in 1995, followed by the Commission in 2008. The two institutions merged

  12. Registered nurses' perceptions of rewarding and its significance.

    Science.gov (United States)

    Seitovirta, Jaana; Lehtimäki, Aku-Ville; Vehviläinen-Julkunen, Katri; Mitronen, Lasse; Kvist, Tarja

    2017-11-07

    To examine reward type preferences and their relationships with the significance of rewarding perceived by registered nurses in Finland. Previous studies have found relationships between nurses' rewarding and their motivation at work, job satisfaction and organisational commitment. Data were collected in a cross-sectional, descriptive, questionnaire survey from 402 registered nurses using the Registered Nurses' Perceptions of Rewarding Scale in 2015, and analysed with descriptive and multivariate statistical methods. Registered nurses assigned slightly higher values to several non-financial than to financial rewards. The non-financial reward types appreciation and feedback from work community, worktime arrangements, work content, and opportunity to develop, influence and participate were highly related to the significance of rewarding. We identified various rewards that registered nurses value, and indications that providing an appropriate array of rewards, particularly non-financial rewards, is a highly beneficial element of nursing management. It is important to understand the value of rewards for nursing management. Nurse managers should offer diverse rewards to their registered nurses to promote excellent performance and to help efforts to secure and maintain high-quality, safe patient care. The use of appropriate rewards is especially crucial to improving registered nurses' reward satisfaction and job satisfaction globally in the nursing profession. © 2017 John Wiley & Sons Ltd.

  13. A study of so-called hypochondriasis.

    Science.gov (United States)

    von Scheele, C; Nordgren, L; Kempi, V; Hetta, J; Hallborg, A

    1990-01-01

    Twenty-four patients with unexplained somatic complaints were subjected to a thorough somatic examination. Only when the examination proved negative was the patient entered into the study. The patients were clinically appraised according to criteria given in DSM-III. Generalized anxiety disorder (GAD) was diagnosed in 12, somatization disorder (SD) in 8, and hypochondriasis in 4 patients. Seventeen of the 24 patients agreed to participate in biochemical investigations including a TRH load, a dexamethasone test, and a determination of the monoamine metabolites 5-HIAA and HVA in cerebrospinal fluid (CSF). A normal TSH increase and a normal suppression of cortisol were registered. The HVA values correlated significantly with the 5-HIAA values as well as with the alexithymia scores. Concerning alexithymia and maturity level, no difference as to social class was found. The patients filled in a Zung depression chart. The Zung scale and the 5-HIAA values were both inconsistent with depressive illness. In so-called hypochondriasis a long-term relationship, including selected somatic and biochemical examinations and thorough information, was crucial in abating the patient's distrust and thus the need for health care.

  14. Dynamic call center routing policies using call waiting and agent idle times

    NARCIS (Netherlands)

    Chan, W.; Koole, G.M.; L'Ecuyer, P.

    2014-01-01

    We study call routing policies for call centers with multiple call types and multiple agent groups. We introduce new weight-based routing policies where each pair (call type, agent group) is given a matching priority defined as an affine combination of the longest waiting time for that call type and

  15. The nuts and bolts of PROSPERO: an international prospective register of systematic reviews

    Directory of Open Access Journals (Sweden)

    Booth Alison

    2012-02-01

    Full Text Available Abstract Background Following publication of the PRISMA statement, the UK Centre for Reviews and Dissemination (CRD at the University of York in England began to develop an international prospective register of systematic reviews with health-related outcomes. The objectives were to reduce unplanned duplication of reviews and provide transparency in the review process, with the aim of minimizing reporting bias. Methods An international advisory group was formed and a consultation undertaken to establish the key items necessary for inclusion in the register and to gather views on various aspects of functionality. This article describes the development of the register, now called PROSPERO, and the process of registration. Results PROSPERO offers free registration and free public access to a unique prospective register of systematic reviews across all areas of health from all around the world. The dedicated web-based interface is electronically searchable and available to all prospective registrants. At the moment, inclusion in PROSPERO is restricted to systematic reviews of the effects of interventions and strategies to prevent, diagnose, treat, and monitor health conditions, for which there is a health-related outcome. Ideally, registration should take place before the researchers have started formal screening against inclusion criteria but reviews are eligible as long as they have not progressed beyond the point of completing data extraction. The required dataset captures the key attributes of review design as well as the administrative details necessary for registration. Submitted registration forms are checked against the scope for inclusion in PROSPERO and for clarity of content before being made publicly available on the register, rejected, or returned to the applicant for clarification. The public records include an audit trail of major changes to planned methods, details of when the review has been completed, and links to resulting

  16. Search for the Y via e(+)e(-) -> gamma phi J/psi at root s=4.23, 4.26 and 4.36 GeV

    NARCIS (Netherlands)

    Ablikim, M.; Achasov, M. N.; Ai, X. C.; Albayrak, O.; Albrecht, M.; Ambrose, D. J.; Amoroso, A.; An, F. F.; An, Q.; Bai, J. Z.; Ferroli, R. Baldini; Ban, Y.; Bennett, D. W.; Bennett, J. V.; Bertani, M.; Bettoni, D.; Bian, J. M.; Bianchi, F.; Boger, E.; Bondarenko, O.; Boyko, I.; Briere, R. A.; Cai, H.; Cai, X.; Cakir, O.; Calcaterra, A.; Cao, G. F.; Cetin, S. A.; Chang, J. F.; Chelkov, G.; Chen, G.; Chen, H. S.; Chen, H. Y.; Chen, J. C.; Chen, M. L.; Chen, S. J.; Chen, X.; Chen, X. R.; Chen, Y. B.; Cheng, H. P.; Chu, X. K.; Cibinetto, G.; Cronin-Hennessy, D.; Dai, H. L.; Dai, J. P.; Dbeyssi, A.; Dedovich, D.; Deng, Z. Y.; Denig, A.; Denysenko, I.; Destefanis, M.; De Mori, F.; Ding, Y.; Dong, C.; Dong, J.; Dong, L. Y.; Dong, M. Y.; Du, S. X.; Duan, P. F.; Fan, J. Z.; Fang, J.; Fang, S. S.; Fang, X.; Fang, Y.; Fava, L.; Feldbauer, F.; Felici, G.; Feng, C. Q.; Fioravanti, E.; Fritsch, M.; Fu, C. D.; Gao, Q.; Gao, Y.; Garzia, I.; Goetzen, K.; Gong, W. X.; Gradl, W.; Greco, M.; Gu, M. H.; Gu, Y. T.; Guan, Y. H.; Guo, A. Q.; Guo, L. B.; Guo, T.; Guo, Y.; Guo, Y. P.; Haddadi, Z.; Hafner, A.; Han, S.; Han, Y. L.; Harris, F. A.; He, K. L.; He, Z. Y.; Held, T.; Heng, Y. K.; Hou, Z. L.; Hu, C.; Hu, H. M.; Hu, J. F.; Hu, T.; Hu, Y.; Huang, G. M.; Huang, G. S.; Huang, H. P.; Huang, J. S.; Huang, X. T.; Huang, Y.; Hussain, T.; Ji, Q.; Ji, Q. P.; Ji, X. B.; Ji, X. L.; Jiang, L. L.; Jiang, L. W.; Jiang, X. S.; Jiao, J. B.; Jiao, Z.; Jin, D. P.; Jin, S.; Johansson, T.; Julin, A.; Kalantar-Nayestanaki, N.; Kang, X. L.; Kang, X. S.; Kavatsyuk, M.; Ke, B. C.; Kliemt, R.; Kloss, B.; Kolcu, O. B.; Kopf, B.; Kornicer, M.; Kuehn, W.; Kupsc, A.; Lai, W.; Lange, J. S.; Lara, M.; Larin, P.; Li, C. H.; Li, Cheng; Li, D. M.; Li, F.; Li, G.; Li, H. B.; Li, J. C.; Li, Jin; Li, K.; Li, K.; Li, P. R.; Li, T.; Li, W. D.; Li, W. G.; Li, X. L.; Li, X. M.; Li, X. N.; Li, X. Q.; Li, Z. B.; Liang, H.; Liang, Y. F.; Liang, Y. T.; Liao, G. R.; Lin, D. X.; Liu, B. J.; Liu, C. L.; Liu, C. X.; Liu, F. H.; Liu, Fang; Liu, Feng; Liu, H. B.; Liu, H. H.; Liu, H. H.; Liu, H. M.; Liu, J.; Liu, J. P.; Liu, J. Y.; Liu, K.; Liu, K. Y.; Liu, L. D.; Liu, P. L.; Liu, Q.; Liu, S. B.; Liu, X.; Liu, X. X.; Liu, Y. B.; Liu, Z. A.; Liu, Zhiqiang; Liu, Zhiqing; Loehner, H.; Lou, X. C.; Lu, H. J.; Lu, J. G.; Lu, R. Q.; Lu, Y.; Lu, Y. P.; Luo, C. L.; Luo, M. X.; Luo, T.; Luo, X. L.; Lv, M.; Lyu, X. R.; Ma, F. C.; Ma, H. L.; Ma, L. L.; Ma, Q. M.; Ma, S.; Ma, T.; Ma, X. N.; Ma, X. Y.; Maas, F. E.; Maggiora, M.; Malik, Q. A.; Mao, Y. J.; Mao, Z. P.; Marcello, S.; Messchendorp, J. G.; Min, J.; Min, T. J.; Mitchell, R. E.; Mo, X. H.; Mo, Y. J.; Morales, C. Morales; Moriya, K.; Muchnoi, N. Yu.; Muramatsu, H.; Nefedov, Y.; Nerling, F.; Nikolaev, I. B.; Ning, Z.; Nisar, S.; Niu, S. L.; Niu, X. Y.; Olsen, S. L.; Ouyang, Q.; Pacetti, S.; Patteri, P.; Pelizaeus, M.; Peng, H. P.; Peters, K.; Ping, J. L.; Ping, R. G.; Poling, R.; Pu, Y. N.; Qi, M.; Qian, S.; Qiao, C. F.; Qin, L. Q.; Qin, N.; Qin, X. S.; Qin, Y.; Qin, Z. H.; Qiu, J. F.; Rashid, K. H.; Redmer, C. F.; Ren, H. L.; Ripka, M.; Rong, G.; Ruan, X. D.; Santoro, V.; Sarantsev, A.; Savrie, M.; Schoenning, K.; Schumann, S.; Shan, W.; Shao, M.; Shen, C. P.; Shen, P. X.; Shen, X. Y.; Sheng, H. Y.; Shepherd, M. R.; Song, W. M.; Song, X. Y.; Sosio, S.; Spataro, S.; Spruck, B.; Sun, G. X.; Sun, J. F.; Sun, S. S.; Sun, Y. J.; Sun, Y. Z.; Sun, Z. J.; Sun, Z. T.; Tang, C. J.; Tang, X.; Tapan, I.; Thorndike, E. H.; Tiemens, M.; Toth, D.; Ullrich, M.; Uman, I.; Varner, G. S.; Wang, B.; Wang, B. L.; Wang, D.; Wang, D. Y.; Wang, K.; Wang, L. L.; Wang, L. S.; Wang, M.; Wang, P.; Wang, P. L.; Wang, Q. J.; Wang, S. G.; Wang, W.; Wang, X. F.; Wang, Y. D.; Wang, Y. F.; Wang, Y. Q.; Wang, Z.; Wang, Z. G.; Wang, Z. H.; Wang, Z. Y.; Weber, T.; Wei, D. H.; Wei, J. B.; Weidenkaff, P.; Wen, S. P.; Wiedner, U.; Wolke, M.; Wu, L. H.; Wu, Z.; Xia, L. G.; Xia, Y.; Xiao, D.; Xiao, Z. J.; Xie, Y. G.; Xu, G. F.; Xu, L.; Xu, Q. J.; Xu, Q. N.; Xu, X. P.; Yan, L.; Yan, W. B.; Yan, W. C.; Yan, Y. H.; Yang, H. X.; Yang, L.; Yang, Y.; Yang, Y. X.; Ye, H.; Ye, M.; Ye, M. H.; Yin, J. H.; Yu, B. X.; Yu, C. X.; Yu, H. W.; Yu, J. S.; Yuan, C. Z.; Yuan, W. L.; Yuan, Y.; Yuncu, A.; Zafar, A. A.; Zallo, A.; Zeng, Y.; Zhang, B. X.; Zhang, B. Y.; Zhang, C.; Zhang, C. C.; Zhang, D. H.; Zhang, H. H.; Zhang, H. Y.; Zhang, J. J.; Zhang, J. L.; Zhang, J. Q.; Zhang, J. W.; Zhang, J. Y.; Zhang, J. Z.; Zhang, K.; Zhang, L.; Zhang, S. H.; Zhang, X. J.; Zhang, X. Y.; Zhang, Y.; Zhang, Y. H.; Zhang, Z. H.; Zhang, Z. P.; Zhang, Z. Y.; Zhao, G.; Zhao, J. W.; Zhao, J. Y.; Zhao, J. Z.; Zhao, Lei; Zhao, Ling; Zhao, M. G.; Zhao, Q.; Zhao, Q. W.; Zhao, S. J.; Zhao, T. C.; Zhao, Y. B.; Zhao, Z. G.; Zhemchugov, A.; Zheng, B.; Zheng, J. P.; Zheng, W. J.; Zheng, Y. H.; Zhong, B.; Zhou, L.; Zhou, Li; Zhou, X.; Zhou, X. K.; Zhou, X. R.; Zhou, X. Y.; Zhu, K.; Zhu, K. J.; Zhu, S.; Zhu, X. L.; Zhu, Y. C.; Zhu, Y. S.; Zhu, Z. A.; Zhuang, J.; Zou, B. S.; Zou, J. H.

    2015-01-01

    Using data samples collected at center-of-mass energies root s = 4.23, 4.26, and 4.36 GeV with the BESIII detector operating at the BEPCII storage ring, we search for the production of the charmoniumlike state Y(4140) through a radiative transition followed by its decay to phi J/psi. No significant

  17. Validation of the danish national diabetes register

    DEFF Research Database (Denmark)

    Green, Anders; Sortsø, Camilla; Jensen, Peter Bjødstrup

    2015-01-01

    The Danish National Diabetes Register (NDR) was established in 2006 and builds on data from Danish health registers. We validated the content of NDR, using full information from the Danish National Patient Register and data from the literature. Our study indicates that the completeness in NDR...... is ≥95% concerning ascertainment from data sources specific for diabetes, ie, prescriptions with antidiabetic drugs and diagnoses of diabetes in the National Patient Register. Since the NDR algorithm ignores diabetes-related hospital contacts terminated before 1990, the establishment of the date...... of encounter, has been taken as the date of inclusion in NDR. We also find that some 20% of the registrations in NDR may represent false positive inclusions of persons with frequent measurements of blood glucose without having diabetes. We conclude that NDR is a novel initiative to support research...

  18. Estimating transfer of bovine virus-diarrhoea virus in Danish cattle by use of register data

    DEFF Research Database (Denmark)

    Alban, L.; Stryhn, H.; Kjeldsen, A.M.

    2001-01-01

    To study how routinely recorded data (also called "register data") might be used in disease monitoring on a regional or national level, a database for bovine virus-diarrhoea virus (BVDV) was made from existing databases, covering the period January 1995-November 1999. This paper includes a general...... in the same herd during gestation. Among the non-MRS herds, most new infections were associated with movement of a persistently infected animal. The monthly number of newly infected herds is presented; it is seen that the incidence declined substantially during the study period. (C) 2001 Elsevier Science B...

  19. The Danish Medical Birth Register

    DEFF Research Database (Denmark)

    Bliddal, Mette; Broe, Anne; Pottegård, Anton

    2018-01-01

    The Danish Medical Birth Register was established in 1973. It is a key component of the Danish health information system. The register enables monitoring of the health of pregnant women and their offspring, it provides data for quality assessment of the perinatal care in Denmark, and it is used...... on all births in Denmark and comprises primarily of data from the Danish National Patient Registry supplemented with forms on home deliveries and stillbirths. It contains information on maternal age provided by the Civil Registration System. Information on pre-pregnancy body mass index and smoking...

  20. Validity of dementia diagnoses in the danish hospital registers

    DEFF Research Database (Denmark)

    Phung, T.K.T.; Andersen, B.B.; Phung, T.K.T.

    2007-01-01

    .24-0.48). Conclusion: The validity of dementia syndrome in the Danish hospital registers was high and allows for epidemiological studies about dementia. Alzheimer's disease, although underregistered, also had a good validity once the diagnosis was registered. In general, other ICD-10 dementia subtypes in the registers......Background:The validity of dementia diagnoses in the Danish nationwide hospital registers was evaluated to determine the value of these registers in epidemiological research about dementia. Methods: Two hundred patients were randomly selected from 4,682 patients registered for the first time...... with a dementia diagnosis in the last 6 months of 2003. The patients' medical journals were reviewed to evaluate if they fulfilled ICD-10 and/or DSM-IV criteria for dementia and specific dementia subtypes. The patients who were still alive in 2006 were invited to an interview. Results: One hundred and ninety...

  1. Federal Register in XML

    Data.gov (United States)

    National Archives and Records Administration — The Federal Register is the official daily publication for rules, proposed rules, and notices of Federal agencies and organizations, as well as executive orders and...

  2. 7 CFR 3015.204 - Federal Register publications.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Federal Register publications. 3015.204 Section 3015.204 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF THE CHIEF FINANCIAL... Register publications. (a) Program regulations. Most grant programs have program-specific regulations...

  3. Comments from the Developmental Neurotoxicology Committee of the Japanese Teratology Society on the OECD Guideline for the Testing of Chemicals, Proposal for a New Guideline 426, Developmental Neurotoxicity Study, Draft Document (October 2006 version), and on the Draft Document of the Retrospective Performance Assessment of the Draft Test Guideline 426 on Developmental Neurotoxicity.

    Science.gov (United States)

    Ema, Makoto; Fukui, Yoshihiro; Aoyama, Hiroaki; Fujiwara, Michio; Fuji, Junichiro; Inouye, Minoru; Iwase, Takayuki; Kihara, Takahide; Oi, Akihide; Otani, Hiroki; Shinomiya, Mitsuhiro; Sugioka, Kozo; Yamano, Tsunekazu; Yamashita, Keisuke H; Tanimura, Takashi

    2007-06-01

    In October 2006, a new revision of the draft guideline (OECD Guideline for the Testing of Chemicals, Proposal for a New Guideline 426. Developmental Neurotoxicity Study) and Draft Document of the Retrospective Performance Assessment (RPA) of the Draft Test Guideline 426 on Developmental Neurotoxicity were distributed following incorporation of the results of the Expert Consultation Meeting in Tokyo on May 24-26, 2005. The draft guideline consists of 50 paragraphs and an appendix with 102 references; and the draft RPA consists of 37 paragraphs with 109 references. National coordinators were requested to arrange for national expert reviews of these draft documents in their member countries. Members of the Developmental Neurotoxicology (DNT) Committee of the Japanese Teratology Society (JTS) reviewed, discussed, and commented on the draft Test Guideline Proposal. The DNT Committee of the JTS also commented on the draft document of the RPA. These comments were sent to the OECD Secretariat. The DNT Committee of the JTS expects the comments to be useful for the finalization of these draft documents.

  4. The Danish multiple sclerosis treatment register

    DEFF Research Database (Denmark)

    Magyari, Melinda; Koch-Henriksen, Nils; Sørensen, Per Soelberg

    2016-01-01

    Aim of the database: The Danish Multiple Sclerosis Treatment Register (DMSTR) serves as a clinical quality register, enabling the health authorities to monitor the quality of the diseasemodifying treatment, and it is an important data source for epidemiological research. Study population: The DMSTR...... includes all patients with multiple sclerosis who had been treated with disease-modifying drugs since 1996. At present, more than 8,400 patients have been registered in this database. Data are continuously entered online into a central database from all sites in Denmark at start and at regular visits. Main...... variables: Include age, sex, onset year and year of the diagnosis, basic clinical information, and information about treatment, side effects, and relapses. Descriptive data: Notification is done at treatment start, and thereafter at every scheduled clinical visit 3 months after treatment start...

  5. A locus identified on chromosome18p11.31 is associated with hippocampal abnormalities in a family with mesial temporal lobe epilepsy

    Directory of Open Access Journals (Sweden)

    Claudia Vianna Maurer-Morelli

    2012-08-01

    Full Text Available We aimed to identify the region harboring a putative candidate gene associated with hippocampal abnormalities (HAb in a family with mesial temporal lobe epilepsy (MTLE. Genome-wide scan was performed in one large kindred with MTLE using a total of 332 microsatellite markers at ~12cM intervals. An additional 13 markers were genotyped in the candidate region. Phenotypic classes were defined according to the presence of hippocampal atrophy and/or hyperintense hippocampal T2 signal detected on magnetic resonance imaging. We identified a significant positive LOD score on chromosome 18p11.31 with a Zmax of 3.12 at D18S452. Multipoint LOD scores and haplotype analyses localized the candidate locus within a 6cM interval flanked by D18S976 and D18S967. We present here evidence that HAb, which were previously related mainly to environmental risk factors, may be influenced by genetic predisposition. This finding may have major impact in the study of the mechanisms underlying abnormalities in mesial temporal lobe structures and their relationship with MTLE.

  6. 30 CFR 45.4 - Independent contractor register.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Independent contractor register. 45.4 Section... ADMINISTRATIVE REQUIREMENTS INDEPENDENT CONTRACTORS § 45.4 Independent contractor register. (a) Each independent contractor shall provide the production-operator in writing the following information: (1) The independent...

  7. 47 CFR 22.921 - 911 call processing procedures; 911-only calling mode.

    Science.gov (United States)

    2010-10-01

    ... programming in the mobile unit that determines the handling of a non-911 call and permit the call to be... CARRIER SERVICES PUBLIC MOBILE SERVICES Cellular Radiotelephone Service § 22.921 911 call processing procedures; 911-only calling mode. Mobile telephones manufactured after February 13, 2000 that are capable of...

  8. 12 CFR 528.6 - Loan application register.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Loan application register. 528.6 Section 528.6 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY NONDISCRIMINATION... Mortgage Disclosure Act Loan Application Registers with the Office of Thrift Supervision in accordance with...

  9. Assessment of Human Pharmaceutical Products Registered in ...

    African Journals Online (AJOL)

    ... in order to determine the most common routes of administration and type of dosage forms that are used. Registered pharmaceutical products were categorized by route of administration and then sub-categorized by the dosage form. Oral dosage forms were the most common accounting for 73% of all registered products.

  10. NUHOMS registered - MP197 transport cask

    International Nuclear Information System (INIS)

    Shih, P.; Sicard, D.; Michels, L.

    2004-01-01

    The NUHOMS registered -MP197 cask is an optimized transport design which can be loaded in the spent fuel pool (wet loading) or loaded the canister from the NUHOMS concrete modules at the ISFSI site. With impact limiters attached, the package can be transported within the states or world-wide. The NUHOMS registered -MP197 packaging can be used to transport either BWR or PWR canisters. The NUHOMS registered -MP197 cask is designed to the ASME B and PV Code and meets the requirements of Section III, Division 3 for Transport Packaging. The cask with impact limiters has undergone drop testing to verify the calculated g loadings during the 9m drops. The test showed good correlation with analytical results and demonstrate that the impact limiters stay in place and protect the package and fuel during the hypothetical accidents

  11. 31 CFR 537.323 - U.S. registered money transmitter.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. registered money transmitter. 537.323 Section 537.323 Money and Finance: Treasury Regulations Relating to Money and Finance... General Definitions § 537.323 U.S. registered money transmitter. The term U.S. registered money...

  12. 31 CFR 538.319 - U.S. registered money transmitter.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false U.S. registered money transmitter. 538.319 Section 538.319 Money and Finance: Treasury Regulations Relating to Money and Finance... General Definitions § 538.319 U.S. registered money transmitter. The term U.S. registered money...

  13. Data register and processor for multiwire chambers

    International Nuclear Information System (INIS)

    Karpukhin, V.V.

    1985-01-01

    A data register and a processor for data receiving and processing from drift chambers of a device for investigating relativistic positroniums are described. The data are delivered to the register input in the form of the Grey 8 bit code, memorized and transformed to a position code. The register information is delivered to the KAMAK trunk and to the front panel plug. The processor selects particle tracks in a horizontal plane of the facility. ΔY maximum coordinate divergence and minimum point quantity on the track are set from the processor front panel. Processor solution time is 16 μs maximum quantity of simultaneously analyzed coordinates is 16

  14. Quality control of portal imaging with PTW EPID QC PHANTOM registered

    International Nuclear Information System (INIS)

    Pesznyak, Csilla; Kiraly, Reka; Polgar, Istvan; Zarand, Pal; Mayer, Arpad; Fekete, Gabor; Mozes, Arpad; Kiss, Balazs

    2009-01-01

    Purpose: quality assurance (QA) and quality control (QC) of different electronic portal imaging devices (EPID) and portal images with the PTW EPID QC PHANTOM registered . Material and methods: characteristic properties of images of different file formats were measured on Siemens OptiVue500aSi registered , Siemens BeamView Plus registered , Elekta iView registered , and Varian PortalVision trademark and analyzed with the epidSoft registered 2.0 program in four radiation therapy centers. The portal images were taken with Kodak X-OMAT V registered and the Kodak Portal Localisation ReadyPack registered films and evaluated with the same program. Results: the optimal exposition both for EPIDs and portal films of different kind was determined. For double exposition, the 2+1 MU values can be recommended in the case of Siemens OptiVue500aSi registered , Elekta iView registered and Kodak Portal Localisation ReadyPack registered films, while for Siemens BeamView Plus registered , Varian PortalVision trademark and Kodak X-OMAT V registered film 7+7 MU is recommended. Conclusion: the PTW EPID QC PHANTOM registered can be used not only for amorphous silicon EPIDs but also for images taken with a video-based system or by using an ionization chamber matrix or for portal film. For analysis of QC tests, a standardized format (used at the acceptance test) should be applied, as the results are dependent on the file format used. (orig.)

  15. Socio-Economic Characteristics of Registered Cocoa Farmers in ...

    African Journals Online (AJOL)

    PROF HORSFALL

    ABSTRACT: This study examined the socio-economic characteristics of registered cocoa farmers in Edo State; ... Key words: socio-economics, characteristics, registered cocoa farmers. ... international exchange market in two world currencies ...

  16. 7 CFR 57.690 - Person required to register.

    Science.gov (United States)

    2010-01-01

    ... business will be required to register before they start operations. [69 FR 571688, Sept. 24, 2004... hatcheries, are required to register with the Department by furnishing their name, place of business, and...

  17. National Register of Historic Places - National Geospatial Data Asset (NGDA) NPS National Register Dataset

    Data.gov (United States)

    Federal Geographic Data Committee — A current, accurate spatial representation of all historic properties listed on the National Register of Historic Places is of interest to Federal agencies, the...

  18. Reuma.pt - the rheumatic diseases portuguese register.

    Science.gov (United States)

    Canhão, H; Faustino, A; Martins, F; Fonseca, J E

    2011-01-01

    Since June 2008, Portuguese rheumatologists have been collecting on a routine basis, data into the nationwide Reuma.pt, the Rheumatic Diseases Portuguese Register from the Portuguese Society of Rheumatology (SPR), which includes rheumatic patients (rheumatoid arthritis - RA, ankylosing spondylitis - AS, psoriatic arthritis - PsA and juvenile idiopathic arthritis - JIA) receiving biological therapies or patients receiving synthetic disease modifying anti-rheumatic drugs (DMARDs). The aim of this publication is to describe the structure of Reuma.pt and the population registered since June 2008. Demographic and anthropometric data, life style habits, work status, co-morbidities, disease activity and functional assessment scores, previous and current therapies, adverse events codified by the Medical Dictionary for Regulatory Activities (MedDRA), reasons for discontinuation and laboratory measurements are registered at each visit. The platform is based on a structured electronic medical record linked to a SQL Server database. All Rheumatology Departments assigned to the Portuguese National Health Service (n=21), 2 Military Hospitals (Lisboa and Porto), 1 public-private Institution and 6 private centers adhered to the Register. Until now, 18 centers have entered data into Reuma.pt. By January 2011, 3438 patients and 16130 visits had been registered. 2162 (63%) were RA patients, 700 of them treated with biological agents and 1462 with synthetic DMARDs. From the 515 (15%) AS patients, 297 were medicated with biological and 218 with non-biological therapies. 293 (8%) were PsA patients, 151 treated with biological drugs and 142 with other treatment strategies. 368 (11%) had the diagnosis of JIA, 68 were under biological treatment and 300 were managed with other treatment options. The register also includes 100 (3%) patients with other rheumatic diseases, submitted to treatments that required hospital day care infusions including 18 exposed to biological therapies. Registers

  19. Obesity research based on the Copenhagen School Health Records Register

    DEFF Research Database (Denmark)

    Baker, Jennifer L; Sørensen, Thorkild I A

    2011-01-01

    INTRODUCTION: To summarise key findings from research performed using data from the Copenhagen School Health Records Register over the last 30 years with a main focus on obesity-related research. The register contains computerised anthropometric information on 372,636 schoolchildren from the capi......INTRODUCTION: To summarise key findings from research performed using data from the Copenhagen School Health Records Register over the last 30 years with a main focus on obesity-related research. The register contains computerised anthropometric information on 372,636 schoolchildren from...... the capital city of Denmark. Additional information on the cohort members has been obtained via linkages with population studies and national registers. RESEARCH TOPICS: Studies using data from the register have made important contributions in the areas of the aetiology of obesity, the development...... of the obesity epidemic, and the long-term health consequences of birth weight as well as body size and growth in childhood. CONCLUSION: Research using this unique register is ongoing, and its contributions to the study of obesity as well as other topics will continue for years to come....

  20. Register-based statistics statistical methods for administrative data

    CERN Document Server

    Wallgren, Anders

    2014-01-01

    This book provides a comprehensive and up to date treatment of  theory and practical implementation in Register-based statistics. It begins by defining the area, before explaining how to structure such systems, as well as detailing alternative approaches. It explains how to create statistical registers, how to implement quality assurance, and the use of IT systems for register-based statistics. Further to this, clear details are given about the practicalities of implementing such statistical methods, such as protection of privacy and the coordination and coherence of such an undertaking. Thi

  1. The electronic register patients with hypertensia in Tomsk Region

    Directory of Open Access Journals (Sweden)

    O. S. Kobyakova

    2012-01-01

    Full Text Available Within the limits of the regional program «Prevention and treatment of an arterial hypertension for the period of 2004—2008» the electronic register of the patients with hypertensia inTomskRegion has been created.The electronic register is a two-level system where interaction of two kinds of databases is carried out: the first level is the databases of separate medical organization; the second level is the central integrated database.The basic information for the electronic register are documents confirmed by the Health service Ministry of the Russian Federation, that is the coupon of the out-patient patient and a card of dynamic supervision over the patient with hypertensia.All the data about the patients, included in the register are subdivided into unchangeable and changeable ones.The electronic register is an effective control system providing local leading of health service bodies with qualitative and high-grade information in processes of preparation of decision-making and measure taken for prevention and treatment of hypertensia.The electronic register is an effective monitoring system, providing medical authority of important information for taking decisions establishment measures for prevention and treatment of hypertensia.

  2. Validity of dementia diagnoses in the danish hospital registers

    DEFF Research Database (Denmark)

    Phung, T.K.T.; Andersen, B.B.; Phung, T.K.T.

    2007-01-01

    Background:The validity of dementia diagnoses in the Danish nationwide hospital registers was evaluated to determine the value of these registers in epidemiological research about dementia. Methods: Two hundred patients were randomly selected from 4,682 patients registered for the first time...... with a dementia diagnosis in the last 6 months of 2003. The patients' medical journals were reviewed to evaluate if they fulfilled ICD-10 and/or DSM-IV criteria for dementia and specific dementia subtypes. The patients who were still alive in 2006 were invited to an interview. Results: One hundred and ninety......-seven journals were available for review and 51 patients were interviewed. A registered diagnosis of dementia was found to be correct in 169 (85.8%) cases. Regarding dementia subtypes, the degree of agreement between the registers and the results of the validating process was low with a kappa of 0.36 (95% CI 0...

  3. 75 FR 44017 - Office of the Secretary; Submission for OMB review; Comment Request

    Science.gov (United States)

    2010-07-27

    ... the date of this publication in the Federal Register. In order to ensure the appropriate consideration...: Business or other for profits. Cost to Federal Government: $188,426. Total Burden Respondents: 457. Total... and financial resources) is minimized, collection instruments are clearly understood, and the impact...

  4. Registered Nurses' perceptions of their work and professional development.

    Science.gov (United States)

    Hallin, Karin; Danielson, Ella

    2008-01-01

    This paper is a report of a study to elucidate Registered Nurses' perceptions of their work and professional development 6 years after graduation. Nursing education and health care has rapidly changed in the last two decades. Education and experience are important components in Registered Nurses' ability to promote a high quality of care, but a great deal depends on their work circumstances. This study emphasizes Registered Nurses' view of their work in health care, at a time in their career when they have several years of experience. Data were collected in 2003 from in-depth interviews with 15 Registered Nurses 6 years after their graduation. The interviews were semi-structured and analysed with interpretive content analysis. The findings revealed two themes and five sub-themes. The first theme, An appropriate but demanding profession, consisted of two sub-themes: 'having found one's niche' and 'growing old in nursing may be difficult'. The second theme, A profession with opportunities and obstacles, consisted of three sub-themes: 'being aware of Registered Nurses' potential', 'having knowledge that is seldom made use of' and 'attaining professional growth is no matter of course'. Keeping Registered Nurses' satisfied and avoiding their dissatisfaction is crucial for both educators and employers. It is essential that employers give priority to Registered Nurses' time with patients and to motivate and support them in professional development. Further intervention studies regarding a change of the balance between obstacles and opportunities are needed.

  5. The Austrian Toxoplasmosis Register, 1992-2008.

    Science.gov (United States)

    Prusa, Andrea-Romana; Kasper, David C; Pollak, Arnold; Gleiss, Andreas; Waldhoer, Thomas; Hayde, Michael

    2015-01-15

    We aimed to determine the incidence of primary gestational infections with Toxoplasma gondii and congenital toxoplasmosis in Austria, a country with a nationwide prenatal serological screening program since 1974. We analyzed retrospective data from the Austrian Toxoplasmosis Register of pregnant women with Toxoplasma infection and their offspring with births between 1992 and 2008, identified by the prenatal mandatory screening program. Treatment was administered to women from diagnosis of a Toxoplasma infection until delivery. Infected infants were treated up to 1 year of life routinely. Clinical manifestations in infected infants were monitored at least for 1 year and documented in the register. The Austrian Toxoplasmosis Register included 2147 pregnant women with suspected Toxoplasma infection. Annually, 8.5 per 10 000 women acquired Toxoplasma infection during pregnancy, and 1.0 per 10 000 infants had congenital toxoplasmosis (13% mean transmission rate). Our data showed that women treated according to the Austrian scheme had a 6-fold decrease in the maternofetal transmission rate compared to women without treatment. Results from the Austrian Toxoplasmosis Register show the efficiency of the prenatal screening program. Our results are of clinical relevance for infants, healthcare systems, and policy makers to consider preventive Toxoplasma screening as a potential tool to reduce the incidence of congenital toxoplasmosis. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. Register for Suicide Attempts

    DEFF Research Database (Denmark)

    Christiansen, Erik; Jensen, Børge Frank

    2004-01-01

    The Register for Suicide Attempts (RSA) is a product of the WHO research project "WHO/Euro Multicentre Study on Parasuicide", which, among other things, had the purpose of collecting data on suicide attempts from 13 European countries. Data is collected in order to calculate trends and identify...

  7. Semi-automatic delineation using weighted CT-MRI registered images for radiotherapy of nasopharyngeal cancer

    Energy Technology Data Exchange (ETDEWEB)

    Fitton, I. [European Georges Pompidou Hospital, Department of Radiology, 20 rue Leblanc, 75015, Paris (France); Cornelissen, S. A. P. [Image Sciences Institute, UMC, Department of Radiology, P.O. Box 85500, 3508 GA Utrecht (Netherlands); Duppen, J. C.; Rasch, C. R. N.; Herk, M. van [The Netherlands Cancer Institute-Antoni van Leeuwenhoek Hospital, Department of Radiotherapy, Plesmanlaan 121, 1066 CX Amsterdam (Netherlands); Steenbakkers, R. J. H. M. [University Medical Center Groningen, Department of Radiation Oncology, Hanzeplein 1, 9713 GZ Groningen (Netherlands); Peeters, S. T. H. [UZ Gasthuisberg, Herestraat 49, 3000 Leuven, Belgique (Belgium); Hoebers, F. J. P. [Maastricht University Medical Center, Department of Radiation Oncology (MAASTRO clinic), GROW School for Oncology and Development Biology Maastricht, 6229 ET Maastricht (Netherlands); Kaanders, J. H. A. M. [UMC St-Radboud, Department of Radiotherapy, Geert Grooteplein 32, 6525 GA Nijmegen (Netherlands); Nowak, P. J. C. M. [ERASMUS University Medical Center, Department of Radiation Oncology,Groene Hilledijk 301, 3075 EA Rotterdam (Netherlands)

    2011-08-15

    Purpose: To develop a delineation tool that refines physician-drawn contours of the gross tumor volume (GTV) in nasopharynx cancer, using combined pixel value information from x-ray computed tomography (CT) and magnetic resonance imaging (MRI) during delineation. Methods: Operator-guided delineation assisted by a so-called ''snake'' algorithm was applied on weighted CT-MRI registered images. The physician delineates a rough tumor contour that is continuously adjusted by the snake algorithm using the underlying image characteristics. The algorithm was evaluated on five nasopharyngeal cancer patients. Different linear weightings CT and MRI were tested as input for the snake algorithm and compared according to contrast and tumor to noise ratio (TNR). The semi-automatic delineation was compared with manual contouring by seven experienced radiation oncologists. Results: A good compromise for TNR and contrast was obtained by weighing CT twice as strong as MRI. The new algorithm did not notably reduce interobserver variability, it did however, reduce the average delineation time by 6 min per case. Conclusions: The authors developed a user-driven tool for delineation and correction based a snake algorithm and registered weighted CT image and MRI. The algorithm adds morphological information from CT during the delineation on MRI and accelerates the delineation task.

  8. 20 CFR 325.2 - Procedure for registering for unemployment benefits.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Procedure for registering for unemployment... UNEMPLOYMENT INSURANCE ACT REGISTRATION FOR RAILROAD UNEMPLOYMENT BENEFITS § 325.2 Procedure for registering for unemployment benefits. (a) Registering as unemployed. To claim unemployment benefits for any day...

  9. The Book of Life: The South African population register and the invention of racial descent, 1950-1980

    Directory of Open Access Journals (Sweden)

    Keith Breckenridge

    Full Text Available This article examines the project of racial classification under Apartheid through the operations of the population register. It follows, in particular, a shift in the determination of race from the criterion of'community acceptance' in the early 1950s to a purely administrative and bureaucratic matter of descent derived from the paperwork in the late 1960s. The study shows that the project Eben Dönges called the 'Book of Life' was at the heart of the planning and practice of the Apartheid state, but that it took two contrasting forms. The first, associated with the green identity cards issued during the 1950s and early 1960s, derived identities and races for six million people, with surprising success, on the basis of the returns to the 1951 census. The second, associated with the inconvenient 50-page Book of Life that was issued after 1970, was a pure case of unrestrained panopticism and a simple failure, failing even to re-register the original population captured by the green identity cards.

  10. Labelling and optimization of PHOTOFRIN registered with 99mTc

    International Nuclear Information System (INIS)

    Fakhar-e-Alam, M.; Roohi, S.; Amir, N.; Zahoor, R.; Atif, M.; Firdous, S.

    2010-01-01

    PHOTOFRIN registered was labelled with 99m Tc using SnCl 2 .2H 2 O as reducing agent. Instant thin layer chromatography (ITLC-SG) in 0.05 M NaOH was used for evaluation of radiochemical purity. Labelling efficiency was dependent on various factors that include the ligand/reductant ratio, pH and time of incubation. Therefore, optimum conditions of labelling were also determined. The stability of 99m Tc-PHOTOFRIN registered in serum was checked by using fresh human serum. Tissue distribution of 99m Tc-PHOTOFRIN registered was evaluated in Sprague Dawley rats. PHOTOFRIN registered was labelled with an efficiency of > 95% under optimum conditions, which were PHOTOFRIN registered : 200 μg, pH: 3-4, SnCl 2 .2H 2 O: 15 μg and 30 min incubation at room temperature. The 99m Tc-labelled PHOTOFRIN registered remained stable in human serum for 24 h. Biodistribution study in rats revealed maximum concentration of the labelled compound in liver, lungs and spleen at 0.5 h, and significant activity was also seen in the bladder and urine, indicating the mode of urinary excretion of PHOTOFRIN registered . (orig.)

  11. Critical points based register-concurrency autotuning for GPUs

    NARCIS (Netherlands)

    Li, A.; Song, S.L.; Kumar, A.; Zhang, E.Z.; Chavarría-Miranda, D.; Corporaal, H.

    2016-01-01

    The unprecedented prevalence of GPGPU is largely attributed to its abundant on-chip register resources, which allow massively concurrent threads and extremely fast context switch. However, due to internal memory size constraints, there is a tradeoff between the per-thread register usage and the

  12. Perceiving a calling, living a calling, and job satisfaction: testing a moderated, multiple mediator model.

    Science.gov (United States)

    Duffy, Ryan D; Bott, Elizabeth M; Allan, Blake A; Torrey, Carrie L; Dik, Bryan J

    2012-01-01

    The current study examined the relation between perceiving a calling, living a calling, and job satisfaction among a diverse group of employed adults who completed an online survey (N = 201). Perceiving a calling and living a calling were positively correlated with career commitment, work meaning, and job satisfaction. Living a calling moderated the relations of perceiving a calling with career commitment and work meaning, such that these relations were more robust for those with a stronger sense they were living their calling. Additionally, a moderated, multiple mediator model was run to examine the mediating role of career commitment and work meaning in the relation of perceiving a calling and job satisfaction, while accounting for the moderating role of living a calling. Results indicated that work meaning and career commitment fully mediated the relation between perceiving a calling and job satisfaction. However, the indirect effects of work meaning and career commitment were only significant for individuals with high levels of living a calling, indicating the importance of living a calling in the link between perceiving a calling and job satisfaction. Implications for research and practice are discussed. (c) 2012 APA, all rights reserved.

  13. Call Center Capacity Planning

    DEFF Research Database (Denmark)

    Nielsen, Thomas Bang

    in order to relate the results to the service levels used in call centers. Furthermore, the generic nature of the approximation is demonstrated by applying it to a system incorporating a dynamic priority scheme. In the last paper Optimization of overflow policies in call centers, overflows between agent......The main topics of the thesis are theoretical and applied queueing theory within a call center setting. Call centers have in recent years become the main means of communication between customers and companies, and between citizens and public institutions. The extensively computerized infrastructure...... in modern call centers allows for a high level of customization, but also induces complicated operational processes. The size of the industry together with the complex and labor intensive nature of large call centers motivates the research carried out to understand the underlying processes. The customizable...

  14. Register of practices and teacher training: reflection, memory and authorship

    Directory of Open Access Journals (Sweden)

    Amanda Cristina Teagno Lopes Marques

    2011-07-01

    Full Text Available This article aims at analyzing the contribution of the register of practices in the process of inservice training and teacher development. It is organized in three parts: first, we elucidateconcepts of different authors about our object (FREIRE, 1996; GUARNIERI, 2001; SÁ-CHAVES, 2004, WARSCHAUER, 1993, 2001; ZABALZA, 1994, 2004, in the second part, we analyze some register of practices produced by a professor of early childhood education, seeking to highlight elements that indicate the relationship between register, reflection and training; inthe end, we indicate the need to move the register as individual attitude to the register as a collective process, as suggested by the perspective of pedagogical documentation describedin Italian literature (BALSAMO, 1998; BENZONI, 2001; BORGHI, APOSTOLI, 2001; GANDINI, GOLDHABER, 2002. The register of practices can contribute to the processes of professional and organizational development, in a reflective school (ALARCÃO, 2002, 2003 and trulypublic because it makes visible to society by documentation of the experiences that teachersand children build together (MALAGUZZI, 1999.

  15. REGISTER PERCAKAPAN ANGGOTA KESATUAN LALU LINTAS POLRESTA PONTIANAK: KAJIAN SOSIOLINGUISTIK

    Directory of Open Access Journals (Sweden)

    Wahyu Damayanti

    2017-10-01

    Full Text Available Register adalah variasi bahasa berdasarkan penggunaannya. Variasi bahasa merupakan wujud keanekaragaman bahasa yang ditampilkan berdasarkan konteks yang menyertainya, termasuk penutur dan penggunaannya. Tujuan penelitian ini adalah mendiskripsikan bentuk register yang terdapat pada percakapan anggota kesatuan lalu lintas Polresta Pontianak. Metode yang digunakan dalam penelitian ini adalah metode kualitatif. Teknik pengumpulan data dengan cara simak dan catat. Data penelitian ini berupa kata, abreviasi, kode, istilah, dan wacana yang termasuk register dalam percakapan komunitas Satlantas Polresta Pontianak melalui jejaring sosial WhatsApp pada bulan Agustus dan September 2016. Teknik analisis data menggunakan analisis interaktif. Hasil dan pembahasaan penelitian ini menunjukkan bahwa karakteristik bentuk register dalam percakapan anggota melalui jejaring sosial WhatsApp berupa bentuk dasar, bentuk berafiks, bentuk ulang, bentuk majemuk, pemendekan atau abreviasi, pemenggalan, singkatan, akronim, kontraksi, sapaan, kode, dan istilah khusus. Dengan demikian, penelitian register dalam percakapan anggota Satlantas merupakan satu di antara bentuk register yang terjadi di masyarakat, dalam hal ini kajian sosiolinguistik.

  16. New developments of the KOMPOFERM {sup registered} system. Lean gas management, SMARTFERM, double membrane roof; Neue Entwicklungen des KOMPOFERM {sup registered} -Systems. Schwachgasmanagement, SMARTFERM, Doppelmembrandach

    Energy Technology Data Exchange (ETDEWEB)

    Striewski, Sandra [KOMPOTEC Kompostierungsanlagen GmbH, Nieheim (Germany)

    2012-11-01

    The KOMPOFERM {sup registered} dry fermentation process is a mesophilic batch process for biogas production from solid biomass. The system is developed continuously for higher economic efficiency, emission reduction and environmental protection. The contribution describes the optimisations of the KOMPOFERM {sup registered} system and presents examples of its practical implementation, e.g. thermophilic process control, the KOMPOFERM {sup registered} double membrane roof for optimum gas utilisation and reduction of the lean gas volume, the KOMPOFERM {sup registered} plus process with a percolate fermenter below the fermenter tunnels, the automatic feeding system for the rotting and/or fermenter tunnels and SMARTFERM, the dry fermentation module for plants up to 4m000 Mg input. (org.) [German] Als mesophiles Batchverfahren hat sich das KOMPOFERM {sup registered} -Trockenvergaerungsverfahren zur Erzeugung von Biogas aus fester Biomasse am Markt etabliert. Das System wird stetig weiterentwickelt, um die Wirtschaftlichkeit wie auch den Emissions- und Umweltschutz der Anlagen zu verbessern. Die Optimierungen des KOMPOFERM {sup registered} -Systems werden in diesem Artikel erlaeutert und Beispiele fuer deren praktische Umsetzung gegeben, wie die thermophile Prozessfuehrung des Systems, das KOMPOFERM {sup registered} -Doppelmembrandach zur optimalen Gasnutzung und Reduzierung von Schwachgas, das KOMPOFERM {sup registered} plus-Verfahren mit einem Perkolatfermenter unterhalb der Fermentertunnel, das automatische Eintragungsgeraet fuer Rotte- und/oder Fermentertunnel sowie SMARTFERM, das Trockenfermentationsmodul fuer Anlagen bis 4.000 Mg Input. (org.)

  17. The Danish heart register

    DEFF Research Database (Denmark)

    Abildstrøm, Steen Z; Madsen, Mette

    2011-01-01

    Introduction: The Danish Heart Register (DHR) is a clinical database of invasive procedures within cardiology. Content: All providers of these procedures have been obliged to report to DHR since 2000. DHR is used to monitor the activity and quality of the procedures and serves as a data source...

  18. Calle Blanco

    Directory of Open Access Journals (Sweden)

    Gonzalo Cerda Brintrup

    1988-06-01

    Full Text Available Importante arteria, que comunica el sector del puerto con la plaza. Las más imponentes construcciones se sucedían de un modo continuo, encaramándose a ambos lados de la empinada calle. Antes del gran incendio de 1936 grandes casonas de madera destacaban en calle Irarrázabal y en la esquina de ésta con calle Blanco, la más hermosa construcción pertenecía a don Alberto Oyarzún y la casa vecina hacia Blanco era de don Mateo Miserda, limitada por arriba con la casa de don Augusto Van Der Steldt y ésta era seguida de la casa de don David Barrientos provista de cuatro cúpulas en las esquinas y de un amplio corredor en el frontis. Todas estas construcciones de madera fueron destruidas en el gran incendio de 1936.

  19. Bike2Work celebration in honour of the colleagues who registered most kilometers in 2013

    CERN Document Server

    Vigen, Jens

    2014-01-01

    Before the 2014 season was officially launched, the CERN bikers took time to celebrate the strong commitment of biking to work in 2013. The celebration took place in front of Restaurant 1. The president of the CERN Bike Club, Henrik Nissen, was the master of ceremonies and presented a set of prizes: The three first prizes, all corresponding to the so-called "Karma Level Sexy Bottom", went to Tim Smith (7182 km), Martial Dujardin (5109 km) and Gabriele Thiede (4326 km). For the remaining group of participants there were seven extra prizes, attributed from a prize draw - where each of their registered kilometers was used as lottery ticket. In addition all got a diploma stating their karma level .

  20. Homophobia in Registered Nurses: Impact on LGB Youth

    Science.gov (United States)

    Blackwell, Christopher W.; Kiehl, Ermalynn M.

    2008-01-01

    This study examined registered nurses' overall attitudes and homophobia towards gays and lesbians in the workplace. Homophobia scores, represented by the Attitudes Toward Lesbians and Gay Men (ATLG) Scale, was the dependent variable. Overall homophobia scores were assessed among a randomized stratified sample of registered nurses licensed in the…

  1. Quality control of portal imaging with PTW EPID QC PHANTOM {sup registered}

    Energy Technology Data Exchange (ETDEWEB)

    Pesznyak, Csilla; Kiraly, Reka; Polgar, Istvan; Zarand, Pal; Mayer, Arpad [Inst. of Oncoradiology, Uzsoki Hospital, Budapest (Hungary); Fekete, Gabor [Dept. of Oncotherapy, Univ. of Szeged (Hungary); Mozes, Arpad [Oncology Center, Kalman Pandy County Hospital, Gyula (Hungary); Kiss, Balazs [Dept. of Radiation Oncology, Markusovszky County Hospital, Szombathely (Hungary)

    2009-01-15

    Purpose: quality assurance (QA) and quality control (QC) of different electronic portal imaging devices (EPID) and portal images with the PTW EPID QC PHANTOM {sup registered}. Material and methods: characteristic properties of images of different file formats were measured on Siemens OptiVue500aSi {sup registered}, Siemens BeamView Plus {sup registered}, Elekta iView {sup registered}, and Varian PortalVision trademark and analyzed with the epidSoft {sup registered} 2.0 program in four radiation therapy centers. The portal images were taken with Kodak X-OMAT V {sup registered} and the Kodak Portal Localisation ReadyPack {sup registered} films and evaluated with the same program. Results: the optimal exposition both for EPIDs and portal films of different kind was determined. For double exposition, the 2+1 MU values can be recommended in the case of Siemens OptiVue500aSi {sup registered}, Elekta iView {sup registered} and Kodak Portal Localisation ReadyPack {sup registered} films, while for Siemens BeamView Plus {sup registered}, Varian PortalVision trademark and Kodak X-OMAT V {sup registered} film 7+7 MU is recommended. Conclusion: the PTW EPID QC PHANTOM {sup registered} can be used not only for amorphous silicon EPIDs but also for images taken with a video-based system or by using an ionization chamber matrix or for portal film. For analysis of QC tests, a standardized format (used at the acceptance test) should be applied, as the results are dependent on the file format used. (orig.)

  2. Register-based estimates of parents' coresidence in Sweden, 1969-2007

    Directory of Open Access Journals (Sweden)

    Elizabeth Thomson

    2013-12-01

    Full Text Available Background: Many of the dramatic changes in family formation and dissolution observed in wealthy countries over the past 60 years are tracked through vital statistics or censuses. The signature change in family behavior -- non-marital cohabitation -- is not, however, registered in most settings. Objective: We evaluate the quality of new register-based estimates of parents' union status at birth and of separation during the childrearing years. Methods: Parents of a common child are identified through the Multi-Generation Register that links each child to each parent and therefore each parent to each other. The Total Population Register identifies the property at which each parent is registered at the end of each year. We use the five-year censuses 1960-1990 as one standard of comparison because the censuses identify the dwelling unit for each parent on the census date. Results: Property-based estimates of parents' coresidence compare very well to census reports. Register-based estimates are virtually identical with those produced from the 1992 Swedish Fertility and Family Survey; differences between register estimates and those produced from the 1991 and 2000 Level of Living Survey can be explained by differences in measurement of marriage and cohabitation. Conclusions: Estimates of parents' cohabitation based on annual, property-level registration are of sufficient quality for their use in substantive analyses of union status at birth and parents' separation in Sweden. Comments: Although register-based estimates of parents' coresidence at a child's birth or afterwards can be generated only for a select group of countries, their use can be fruitful for understanding more general processes of family change. Centralized administrative registers exist in many countries but have not been made fully available for research therefore losing much of the potential value.

  3. Hello! Are You Registered?

    Science.gov (United States)

    Institute for Political/Legal Education, Sewell, NJ.

    Organizational procedures and appropriate forms for high school students to conduct a community survey of non-registered voters are provided. Duties for student coordinator, field staff, and clerical staff are described and a flow chart depicts the relationship of personnel to one another and to the community. Students are instructed to notify…

  4. Corrrective action decision document for the Cactus Spring Waste Trenches (Corrective Action Unit No. 426). Revision No. 1

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-06-01

    The Corrective Action Decision Document (CADD) for the Cactus Spring Waste Trenches (Corrective Action Unit [CAU] No. 426) has been prepared for the US Department of Energy`s (DOE) Nevada Environmental Restoration Project. This CADD has been developed to meet the requirements of the Federal Facility Agreement and Consent Order (FFACO) of 1996, stated in Appendix VI, {open_quotes}Corrective Action Strategy{close_quotes} (FFACO, 1996). The Cactus Spring Waste Trenches Corrective Action Site (CAS) No. RG-08-001-RG-CS is included in CAU No. 426 (also referred to as the {open_quotes}trenches{close_quotes}); it has been identified as one of three potential locations for buried, radioactively contaminated materials from the Double Tracks Test. The trenches are located on the east flank of the Cactus Range in the eastern portion of the Cactus Spring Ranch at the Tonopah Test Range (TTR) in Nye County, Nevada, on the northern portion of Nellis Air Force Range. The TTR is approximately 225 kilometers (km) (140 miles [mi]) northwest of Las Vegas, Nevada, by air and approximately 56 km (35 mi) southeast of Tonopah, Nevada, by road. The trenches were dug for the purpose of receiving waste generated during Operation Roller Coaster, primarily the Double Tracks Test. This test, conducted in 1963, involved the use of live animals to assess the biological hazards associated with non-nuclear detonation of plutonium-bearing devices (i.e., inhalation uptake of plutonium aerosol). The CAS consists of four trenches that received solid waste and had an overall impacted area of approximately 36 meters (m) (120 feet [ft]) long x 24 m (80 ft) wide x 3 to 4.5 m (10 to 15 ft) deep. The average depressions at the trenches are approximately 0.3 m (1 ft) below land surface.

  5. How registered nurses, licensed practical nurses and resident aides spend time in nursing homes: An observational study.

    Science.gov (United States)

    McCloskey, Rose; Donovan, Cindy; Stewart, Connie; Donovan, Alicia

    2015-09-01

    Calls for improved conditions in nursing homes have pointed to the importance of optimizing the levels and skills of care providers. Understanding the work of care providers will help to determine if staff are being used to their full potential and if opportunities exist for improved efficiencies. To explore the activities of care providers in different nursing homes and to identify if variations exist within and across homes and shifts. A multi-centre cross-sectional observational work flow study was conducted in seven different nursing homes sites in one Canadian province. Data were collected by a research assistant who conducted 368 h of observation. The research assistant collected data by following an identical route in each site and recording observations on staff activities. Findings indicate staff activities vary across roles, sites and shifts. Licensed practical nurses (nursing assistants) have the greatest variation in their role while registered nurses have the least amount of variability. In some sites both registered nurses and licensed practical nurses perform activities that may be safely delegated to others. Care providers spend as much as 53.7% of their time engaged in non-value added activities. There may be opportunities for registered nurses and licensed practical nurses to delegate some of their activities to non-regulated workers. The time care providers spend in non-value activities suggest there may be opportunities to improve efficiencies within the nursing home setting. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Perceiving a Calling, Living a Calling, and Job Satisfaction: Testing a Moderated, Multiple Mediator Model

    Science.gov (United States)

    Duffy, Ryan D.; Bott, Elizabeth M.; Allan, Blake A.; Torrey, Carrie L.; Dik, Bryan J.

    2012-01-01

    The current study examined the relation between perceiving a calling, living a calling, and job satisfaction among a diverse group of employed adults who completed an online survey (N = 201). Perceiving a calling and living a calling were positively correlated with career commitment, work meaning, and job satisfaction. Living a calling moderated…

  7. Corrosion behavior of Haynes registered 230 registered nickel-based super-alloys for integrated coal gasification combined cycle syngas plants. A plant exposure study

    International Nuclear Information System (INIS)

    Lee, Sungkyu; Lee, Jieun; Kang, Suk-Hwan; Lee, Seung-Jong; Yun, Yongseung; Kim, Min Jung

    2015-01-01

    The corrosion behavior of commercially available Haynes registered 230 registered nickel-based alloy samples was investigated by exposure to coal-gasifying integrated coal gasification combined cycle pilot plant facilities affiliated with the Institute for Advanced Engineering (2.005 MPa and 160-300 C). The morphological and microstructural analyses of the exposed samples were conducted using scanning electron microscopy and energy-dispersive X-ray spectroscopy analysis on the external surface of the recovered corrosion test samples to obtain information of the corrosion scale. These analyses based on the pre- and post-exposure corrosion test samples combined with thermodynamic Ellingham-Pourbaix stability diagrams provided preliminary insight into the mechanism of the observed corrosion behavior prevailing in the piping materials that connected the particulate removal unit and water scrubber of the integrated coal gasification combined cycle pilot plant. Uniform material wastage was observed after 46 hours of operation, and a preliminary corrosion mechanism was suggested: the observed material waste and corrosion behavior of the Haynes registered 230 registered nickel-based alloy samples cut off from the coal syngas integrated coal gasification combined cycle plant were explained by the formation of discontinuous (complex) oxide phases and subsequent chlorine-induced active oxidation under the predominantly reducing environment encountered. This contribution continues the already published studies of the Fe-Ni-Cr-Co alloy Haynes registered 556 registered .

  8. Behavioral Preferences for Individual Securities : The Case for Call Warrants and Call Options

    NARCIS (Netherlands)

    Ter Horst, J.R.; Veld, C.H.

    2002-01-01

    Since 1998, large investment banks have flooded the European capital markets with issues of call warrants.This has led to a unique situation in the Netherlands, where now call warrants, traded on the stock exchange, and long-term call options, traded on the options exchange, exist.Both entitle their

  9. The Danish registers of causes of death

    DEFF Research Database (Denmark)

    Juel, K; Helweg-Larsen, K

    1999-01-01

    In 1875 registration of causes of death in Denmark was established by the National Board of Health, and annual statistics of death have since been published. Until 1970 the national statistics were based upon punched cards with data collected from the death certificates. Since then the register has...... been fully computerized and includes individual based data of all deaths occurring among all residents in Denmark dying in Denmark. Furthermore, a microfilm of all death certificates from 1943 and onward is kept in the National Board of Health. The Danish Institute for Clinical Epidemiology (DICE) has...... established a computerized register of individual records of deaths in Denmark from 1943 and onwards. No other country covers computerized individual based data of death registration for such a long period, now 54 years. This paper describes the history of the registers, the data sources and access to data...

  10. Patient engagement with research: European population register study.

    Science.gov (United States)

    McKevitt, Christopher; Fudge, Nina; Crichton, Siobhan; Bejot, Yannick; Daubail, Benoît; Di Carlo, Antonio; Fearon, Patricia; Kolominsky-Rabas, Peter; Sheldenkar, Anita; Newbound, Sophie; Wolfe, Charles D A

    2015-12-01

    Lay involvement in implementation of research evidence into practice may include using research findings to guide individual care, as well as involvement in research processes and policy development. Little is known about the conditions required for such involvement. To assess stroke survivors' research awareness, use of research evidence in their own care and readiness to be involved in research processes. Cross sectional survey of stroke survivors participating in population-based stroke registers in six European centres. The response rate was 74% (481/647). Reasons for participation in register research included responding to clinician request (56%) and to 'give something back' (19%); however, 20% were unaware that they were participating in a stroke register. Research awareness was generally low: 57% did not know the purpose of the register they had been recruited to; 73% reported not having received results from the register they took part in; 60% did not know about any research on stroke care. Few participants (7.6%) used research evidence during their consultations with a doctor. The 34% of participants who were interested in being involved in research were younger, more highly educated and already research aware. Across Europe, stroke survivors already participating in research appear ill informed about stroke research. Researchers, healthcare professionals and patient associations need to improve how research results are communicated to patient populations and research participants, and to raise awareness of the relationship between research evidence and increased quality of care. © 2014 John Wiley & Sons Ltd.

  11. Register / Andri Ksenofontov

    Index Scriptorium Estoniae

    Ksenofontov, Andri, 1962-

    2007-01-01

    Näitused: Eesti Kujundusgraafikute Liidu aastanäitus "Register 2007" Kunstihoone galeriis, Signe Kivi "Võimuvaibad ja vaimukleidid" Arhitektuuri- ja Disainigaleriis, "Kehaturg / Sex market" (Dagmar Kase, Eveli Variku tööd) Tallinna Kunstihoones, Andrei Maksimjuki "Surematu klassika" Ühispanga galeriis, Katrin Veegeni "Varsti" A-galeriis, Eda Lõhmuse "Ülespoole" ja Rein Kelpmani "Grosso modo" ArtDepoo Galeriis, Jaan Elkeni "Valge valgus" Galeriis 008, Paul Rodgersi "Transplants" Hobusepea galeriis, Masayo Ave "Haptic Interface Design" Arhitektuuri- ja Disainigaleriis ja workshop Eesti Kunstiakadeemias

  12. Registered plant list - PGDBj Registered plant list, Marker list, QTL list, Plant DB link & Genome analysis methods | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us PGDBj Registered plant list, Marker list, QTL list, Plant DB link & Genome analysis methods ...the Plant DB link list in simple search page) Genome analysis methods Presence or... absence of Genome analysis methods information in this DB (link to the Genome analysis methods information ...base Site Policy | Contact Us Registered plant list - PGDBj Registered plant list, Marker list, QTL list, Plant DB link & Genome analysis methods | LSDB Archive ...

  13. Subdural hematoma cases identified through a Danish patient register

    DEFF Research Database (Denmark)

    Poulsen, Frantz Rom; Halle, Bo; Pottegård, Anton

    2016-01-01

    PURPOSE: This study aimed to assess the usefulness of Danish patient registers for epidemiological studies of subdural hematoma (SDH) and to describe clinical characteristics of validated cases. METHODS: Using a patient register covering a geographically defined area in Denmark, we retrieved...... use did not vary by SDH type (OR 0.9, 95%CI 0.6-1.2). CONCLUSIONS: Danish patient registers are a useful resource for SDH studies. However, choice of International Classification of Diseases code markedly influences diagnostic validity. Distinction between cSDH and aSDH is not possible based on SDH...

  14. Validation of hospital register-based diagnosis of Parkinson's disease

    DEFF Research Database (Denmark)

    Wermuth, Lene; Lassen, Christina Funch; Himmerslev, Liselotte

    2012-01-01

    Denmark has a long-standing tradition of maintaining one of the world's largest health science specialized register data bases as the National Hospital Register (NHR). To estimate the prevalence and incidence of diseases, the correctness of the diagnoses recorded is critical. Parkinson's disease...... (PD) is a neurodegenerative disorder and only 75-80% of patients with parkinsonism will have idiopathic PD (iPD). It is necessary to follow patients in order to determine if some of them will develop other neurodegenerative diseases and a one-time-only diagnostic code for iPD reported in the register...

  15. Registering Researchers in Authority Files

    NARCIS (Netherlands)

    Altman, M.; Conlon, M.; Cristan, A.L.; Dawson, L.; Dunham, J.; Hickey, T.; Hook, D.; Horstmann, W.; MacEwan, A.; Schreur, P.; Smart, L.; Smith-Yoshimura, K.; Wacker, M.; Woutersen, S.

    2014-01-01

    Registering researchers in some type of authority file or identifier system has become more compelling as both institutions and researchers recognize the need to compile their scholarly output. The report presents functional requirements and recommendations for six stakeholders: researchers,

  16. The contribution of staff call light response time to fall and injurious fall rates: an exploratory study in four US hospitals using archived hospital data

    Directory of Open Access Journals (Sweden)

    Tzeng Huey-Ming

    2012-03-01

    Full Text Available Abstract Background Fall prevention programs for hospitalized patients have had limited success, and the effect of programs on decreasing total falls and fall-related injuries is still inconclusive. This exploratory multi-hospital study examined the unique contribution of call light response time to predicting total fall rates and injurious fall rates in inpatient acute care settings. The conceptual model was based on Donabedian's framework of structure, process, and health-care outcomes. The covariates included the hospital, unit type, total nursing hours per patient-day (HPPDs, percentage of the total nursing HPPDs supplied by registered nurses, percentage of patients aged 65 years or older, average case mix index, percentage of patients with altered mental status, percentage of patients with hearing problems, and call light use rate per patient-day. Methods We analyzed data from 28 units from 4 Michigan hospitals, using archived data and chart reviews from January 2004 to May 2009. The patient care unit-month, defined as data aggregated by month for each patient care unit, was the unit of analysis (N = 1063. Hierarchical multiple regression analyses were used. Results Faster call light response time was associated with lower total fall and injurious fall rates. Units with a higher call light use rate had lower total fall and injurious fall rates. A higher percentage of productive nursing hours provided by registered nurses was associated with lower total fall and injurious fall rates. A higher percentage of patients with altered mental status was associated with a higher total fall rate but not a higher injurious fall rate. Units with a higher percentage of patients aged 65 years or older had lower injurious fall rates. Conclusions Faster call light response time appeared to contribute to lower total fall and injurious fall rates, after controlling for the covariates. For practical relevance, hospital and nursing executives should consider

  17. Socio-economic characteristics of registered cocoa farmers in Edo ...

    African Journals Online (AJOL)

    This study examined the socio-economic characteristics of registered cocoa farmers in Edo State; Nigeria. Primary data was collected using a well structured questionnaire administered to 180 registered cocoa farmers selected using a multi-stage sampling technique. Data were analyzed using descriptive statistics and ...

  18. Validity of a hospital-based obstetric register using medical records as reference

    DEFF Research Database (Denmark)

    Brixval, Carina Sjöberg; Thygesen, Lau Caspar; Johansen, Nanna Roed

    2015-01-01

    BACKGROUND: Data from hospital-based registers and medical records offer valuable sources of information for clinical and epidemiological research purposes. However, conducting high-quality epidemiological research requires valid and complete data sources. OBJECTIVE: To assess completeness...... and validity of a hospital-based clinical register - the Obstetric Database - using a national register and medical records as references. METHODS: We assessed completeness of a hospital-based clinical register - the Obstetric Database - by linking data from all women registered in the Obstetric Database...... Database therefore offers a valuable source for examining clinical, administrative, and research questions....

  19. Making Decisions about Workforce Development in Registered Training Organisations

    Science.gov (United States)

    Hawke, Geof

    2008-01-01

    The purpose of this research activity is to understand further how large and small registered training organisations (RTOs) make decisions about the allocation of resources for developing their workforces. Six registered training organisations--four technical and further education (TAFE) institutes and two private providers--were selected for…

  20. Australian Mining's product register 1990-91

    Energy Technology Data Exchange (ETDEWEB)

    1990-01-01

    The Australian Minings' Product Register 1990-91 contains an industry review, resource assessment, mineral industry statistics, directory of exploration and mining companies, buyers guide and directory of consultants.

  1. Registered Replication Report

    DEFF Research Database (Denmark)

    Bouwmeester, S.; Verkoeijen, P. P.J.L.; Aczel, B.

    2017-01-01

    and colleagues. The results of studies using time pressure have been mixed, with some replication attempts observing similar patterns (e.g., Rand et al., 2014) and others observing null effects (e.g., Tinghög et al., 2013; Verkoeijen & Bouwmeester, 2014). This Registered Replication Report (RRR) assessed...... the size and variability of the effect of time pressure on cooperative decisions by combining 21 separate, preregistered replications of the critical conditions from Study 7 of the original article (Rand et al., 2012). The primary planned analysis used data from all participants who were randomly assigned...

  2. The Pediatric Cataract Register (PECARE)

    DEFF Research Database (Denmark)

    Haargaard, Birgitte; Nyström, Alf; Rosensvärd, Annika

    2015-01-01

    examination with a pencil light at age 5 weeks, whereas newborn red reflex examination using a handheld ophthalmoscope is routine protocol in Swedish maternity wards. Data regarding age of referral were derived from the Pediatric Cataract Register (PECARE). All children operated on before 1 year of age...

  3. {sup 11}C-Choline PET/CT for restaging prostate cancer. Results from 4,426 scans in a single-centre patient series

    Energy Technology Data Exchange (ETDEWEB)

    Graziani, Tiziano; Ceci, Francesco; Polverari, Giulia; Lima, Giacomo Maria; Lodi, Filippo; Fanti, Stefano [S. Orsola-Malpighi Hospital, University of Bologna, Service of Nuclear Medicine, Bologna (Italy); Castellucci, Paolo [S. Orsola-Malpighi Hospital, University of Bologna, Service of Nuclear Medicine, Bologna (Italy); Azienda Ospedaliero-Universitaria di Bologna, Policlinico S. Orsola-Malpighi, UO Medicina Nucleare, Bologna (Italy); Morganti, Alessio Giuseppe [S. Orsola-Malpighi Hospital, University of Bologna, Department of Radiotherapy, Bologna (Italy); Ardizzoni, Andrea [S. Orsola-Malpighi Hospital, University of Bologna, Department of Oncology, Bologna (Italy); Schiavina, Riccardo [S. Orsola-Malpighi Hospital, University of Bologna, Department of Urology, Bologna (Italy)

    2016-10-15

    To evaluate {sup 11}C-choline PET/CT as a diagnostic tool for restaging prostate cancer (PCa), in a large, homogeneous and clinically relevant population of patients with biochemical recurrence (BCR) of PCa after primary therapy. The secondary aim was to assess the best timing for performing {sup 11}C-choline PET/CT during BCR. We retrospectively analysed 9,632 {sup 11}C-choline PET/CT scans performed in our institution for restaging PCa from January 2007 to June 2015. The inclusion criteria were: (1) proven PCa radically treated with radical prostatectomy (RP) or with primary external beam radiotherapy (EBRT); (2) PSA serum values available; (3) proven BCR (PSA >0.2 ng/mL after RP or PSA >2 ng/mL above the nadir after primary EBRT with rising PSA levels). Finally, 3,203 patients with recurrent PCa matching all the inclusion criteria were retrospectively enrolled and 4,426 scans were analysed. Overall, 52.8 % of the {sup 11}C-choline PET/CT scans (2,337/4,426) and 54.8 % of the patients (1,755/3,203) were positive. In 29.4 % of the scans, at least one distant finding was observed. The mean and median PSA values were, respectively, 4.9 and 2.1 ng/mL at the time of the scan (range 0.2 - 50 ng/mL). In our series, 995 scans were performed in patients with PSA levels between 1 and 2 ng/mL. In this subpopulation the positivity rate in the 995 scans was 44.7 %, with an incidence of distant findings of 19.2 % and an incidence of oligometastatic disease (one to three lesions) of 37.7 %. The absolute PSA value at the time of the scan and ongoing androgen deprivation therapy were associated with an increased probability of a positive {sup 11}C-choline PET/CT scan (p < 0.0001). In the ROC analysis, a PSA value of 1.16 ng/mL was the optimal cut-off value. In patients with a PSA value <1.16 ng/mL, 26.8 % of 1,426 {sup 11}C-choline PET/CT scans were positive, with oligometastatic disease in 84.7 % of positive scans. In a large cohort of patients, the feasibility of {sup 11}C

  4. Registered nurses' clinical reasoning skills and reasoning process: A think-aloud study.

    Science.gov (United States)

    Lee, JuHee; Lee, Young Joo; Bae, JuYeon; Seo, Minjeong

    2016-11-01

    As complex chronic diseases are increasing, nurses' prompt and accurate clinical reasoning skills are essential. However, little is known about the reasoning skills of registered nurses. This study aimed to determine how registered nurses use their clinical reasoning skills and to identify how the reasoning process proceeds in the complex clinical situation of hospital setting. A qualitative exploratory design was used with a think-aloud method. A total of 13 registered nurses (mean years of experience=11.4) participated in the study, solving an ill-structured clinical problem based on complex chronic patients cases in a hospital setting. Data were analyzed using deductive content analysis. Findings showed that the registered nurses used a variety of clinical reasoning skills. The most commonly used skill was 'checking accuracy and reliability.' The reasoning process of registered nurses covered assessment, analysis, diagnosis, planning/implementation, and evaluation phase. It is critical that registered nurses apply appropriate clinical reasoning skills in complex clinical practice. The main focus of registered nurses' reasoning in this study was assessing a patient's health problem, and their reasoning process was cyclic, rather than linear. There is a need for educational strategy development to enhance registered nurses' competency in determining appropriate interventions in a timely and accurate fashion. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Corrosion behavior of Haynes {sup registered} 230 {sup registered} nickel-based super-alloys for integrated coal gasification combined cycle syngas plants. A plant exposure study

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Sungkyu; Lee, Jieun; Kang, Suk-Hwan; Lee, Seung-Jong; Yun, Yongseung [Institute for Advanced Engineering (IAE), Gyeonggi-do (Korea, Republic of). Plant Engineering Center; Kim, Min Jung [Sungkyunkwan Univ, Gyeonggi-do (Korea, Republic of). Advanced Materials Technology Research Center

    2015-07-01

    The corrosion behavior of commercially available Haynes {sup registered} 230 {sup registered} nickel-based alloy samples was investigated by exposure to coal-gasifying integrated coal gasification combined cycle pilot plant facilities affiliated with the Institute for Advanced Engineering (2.005 MPa and 160-300 C). The morphological and microstructural analyses of the exposed samples were conducted using scanning electron microscopy and energy-dispersive X-ray spectroscopy analysis on the external surface of the recovered corrosion test samples to obtain information of the corrosion scale. These analyses based on the pre- and post-exposure corrosion test samples combined with thermodynamic Ellingham-Pourbaix stability diagrams provided preliminary insight into the mechanism of the observed corrosion behavior prevailing in the piping materials that connected the particulate removal unit and water scrubber of the integrated coal gasification combined cycle pilot plant. Uniform material wastage was observed after 46 hours of operation, and a preliminary corrosion mechanism was suggested: the observed material waste and corrosion behavior of the Haynes {sup registered} 230 {sup registered} nickel-based alloy samples cut off from the coal syngas integrated coal gasification combined cycle plant were explained by the formation of discontinuous (complex) oxide phases and subsequent chlorine-induced active oxidation under the predominantly reducing environment encountered. This contribution continues the already published studies of the Fe-Ni-Cr-Co alloy Haynes {sup registered} 556 {sup registered}.

  6. Are Local Registers the Solution?

    NARCIS (Netherlands)

    Baldwin, R.; English, C.; Lemmen, C.H.J.; Rose, I.; Smith, A.; Solovov, A.; Sullivan, T.

    2018-01-01

    This paper explores the possibility of using local registers to manage and update land rights. Secure land rights are largely taken for granted in the developed world. Yet for many people in developing nations, clear and enforceable land rights are not a reality. In the developed world, land rights

  7. Acceptability and perceived barriers and facilitators to creating a national research register to enable 'direct to patient' enrolment into research: the Scottish Health Research Register (SHARE).

    Science.gov (United States)

    Grant, Aileen; Ure, Jenny; Nicolson, Donald J; Hanley, Janet; Sheikh, Aziz; McKinstry, Brian; Sullivan, Frank

    2013-10-18

    Difficulties with recruitment pose a major, increasingly recognised challenge to the viability of research. We sought to explore whether a register of volunteers interested in research participation, with data linkage to electronic health records to identify suitable research participants, would prove acceptable to healthcare staff, patients and researchers. We undertook a qualitative study in which a maximum variation sampling approach was adopted. Focus groups and interviews were conducted with patients, general practitioners (GP), practice managers and health service researchers in two Scottish health boards. Analysis was primarily thematic to identify a range of issues and concerns for all stakeholder groups. The concept of a national research register was, in general, acceptable to all stakeholder groups and was widely regarded as beneficial for research and for society. Patients, however, highlighted a number of conditions which should be met in the design of a register to expedite confidence and facilitate recruitment. They also gave their perceptions on how a register should operate and be promoted, favouring a range of media. GPs and practice managers were primarily concerned with the security and confidentiality of patient data and the impact a register may have on their workload. Researchers were supportive of the initiative seeing advantages in more rapid access to a wider pool of patients. They did raise concerns that GPs may be able to block access to personal patient data held in general practice clinical systems and that the register may not be representative of the whole population. This work suggests that patients, healthcare staff and researchers have a favourable view of the potential benefits of a national register to identify people who are potentially eligible and willing to participate in health related research. It has highlighted a number of issues for the developers to incorporate in the design of research registers.

  8. Call cultures in orang-utans?

    Directory of Open Access Journals (Sweden)

    Serge A Wich

    Full Text Available BACKGROUND: Several studies suggested great ape cultures, arguing that human cumulative culture presumably evolved from such a foundation. These focused on conspicuous behaviours, and showed rich geographic variation, which could not be attributed to known ecological or genetic differences. Although geographic variation within call types (accents has previously been reported for orang-utans and other primate species, we examine geographic variation in the presence/absence of discrete call types (dialects. Because orang-utans have been shown to have geographic variation that is not completely explicable by genetic or ecological factors we hypothesized that this will be similar in the call domain and predict that discrete call type variation between populations will be found. METHODOLOGY/PRINCIPAL FINDINGS: We examined long-term behavioural data from five orang-utan populations and collected fecal samples for genetic analyses. We show that there is geographic variation in the presence of discrete types of calls. In exactly the same behavioural context (nest building and infant retrieval, individuals in different wild populations customarily emit either qualitatively different calls or calls in some but not in others. By comparing patterns in call-type and genetic similarity, we suggest that the observed variation is not likely to be explained by genetic or ecological differences. CONCLUSION/SIGNIFICANCE: These results are consistent with the potential presence of 'call cultures' and suggest that wild orang-utans possess the ability to invent arbitrary calls, which spread through social learning. These findings differ substantially from those that have been reported for primates before. First, the results reported here are on dialect and not on accent. Second, this study presents cases of production learning whereas most primate studies on vocal learning were cases of contextual learning. We conclude with speculating on how these findings might

  9. Turnover of registered nurses in Israel: characteristics and predictors.

    Science.gov (United States)

    Toren, Orly; Zelker, Revital; Lipschuetz, Michal; Riba, Shoshana; Reicher, Sima; Nirel, Nurit

    2012-05-01

    In an era of global and local nursing shortages, nursing turnover has negative consequences in terms of diminished quality of care, increased costs and economic losses and decreased job satisfaction. To examine the turnover rate of registered nurses in Israel by assessing the varying degree of turnover between economic sectors, between hospital and community facilities, and/or between types of hospitals; and by examining potential predicting factors of turnover among registered nurses. A national phone survey was undertaken in Israel consisting of a random sampling of registered nurses of working age (up to age 60). The subjects comprised 10% of a national database of 32,000 registered nurses. The turnover rate among working nurses in Israel currently stands at 23%. In addition, 13% of employed nurses have taken a temporary leave of absence for a period greater than 6 months in the past 10 years, most up to 1 year. While job satisfaction rates were relatively high (72%), Professional satisfaction rates were 60% with no significant difference between hospital and community nurses. The turnover rate of registered nurses from a hospital setting to the community was significantly higher (pcommunity registered nurses to hospitals. Predicting factors of turnover were found to be: young age, part-time work, lack of advanced professional education, academic education and low satisfaction with the nursing profession. The shift of nursing workforce is mainly from hospitals to community health settings. There is a need to monitor and understand the characteristics of job and professional satisfaction among hospital nurses in order to implement crucial organizational interventions and retain hospital nursing staffs. Since young nurses, nurses working part time and nurses with no advanced professional and academic education, tend to move more than others, efforts should be targeted at these specific groups. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  10. In-service education and training as experienced by registered nurses.

    Science.gov (United States)

    Norushe, T F; Van Rooyen, D; Strumpher, J

    2004-11-01

    Nursing is a dynamic profession that is subject to rapid changes in health care provision, hence the need for in-service training programmes for nurses. Newly employed registered nurses require in-service training in order to update them regarding the latest developments in nursing practice. The researcher noted that some newly appointed registered nurses were not competent in all aspects relating to their tasks. This could have been due to a knowledge deficit relating to either new developments or of the procedure relating to a specific task. In some institutions newly-appointed registered nurses on probation reported not receiving in-service training for six months or longer, yet they were still expected to perform their tasks efficiently. The objectives of the study were to, firstly, explore and describe the experiences of registered nurses regarding in-service training programmes in their institutions and, secondly, to make recommendations to Nursing Service Managers relating to the development of effective in-service training programmes in their institutions. A qualitative, exploratory, descriptive design was implemented. Data was analysed using Tesch's descriptive approach (in Creswell, 1994:155). Two main themes emerged, namely that registered nurses experienced in-service training programmes as inadequate and reacted negatively towards them. This article focuses on the experiences of registered nurses relating to in-service training programmes, as well as the formulation of guidelines to assist nursing service managers in the development of effective in-service training programmes.

  11. Validation of epilepsy diagnoses in the Danish National Hospital Register

    DEFF Research Database (Denmark)

    Christensen, Jakob; Vestergaard, Mogens; Olsen, Jørn

    2007-01-01

    PURPOSE: To validate the diagnosis of epilepsy in the Danish National Hospital Register. METHODS: We randomly selected 200 patients registered with epilepsy in the Danish National Hospital Register between 1977 and 2002 and validated the diagnosis according to the guidelines developed...... by the International League Against Epilepsy. RESULTS: We reviewed the medical records of 188 (94%) persons from 57 departments at 41 hospitals. The epilepsy diagnoses were confirmed in 153 patients, providing a positive predictive value for epilepsy of 81% (95% confidence interval (95% CI): 75-87%). Among the 35...... for syndrome classification was 60% (95% CI: 44-74%) for epilepsy with complex focal seizures and 35% (95% CI: 22-51%) for primary generalized epilepsy. CONCLUSION: The validity of the epilepsy diagnoses in the Danish National Hospital Register has a moderate to high positive predictive value for epilepsy...

  12. THE TRANSFER OF THE COMPANY’S REGISTERED OFFICE

    Directory of Open Access Journals (Sweden)

    Saša Prelič

    2016-01-01

    Full Text Available In the light of the relevant case law of The Court of Justice of the EU it is emphasized that the cross-border transfer of company’s registered office (and its real seat must be permitted in accordance with the Treaty on the Functioning of the EU. Nevertheless, the Fourteenth Company law Directive should be adopted for the reasons of legal certainty and it should determine, whether the transfer of the registered office (without transfer of company’s real seat to another Member State is admissible or not. Furthermore, the authors discuss the cross-border restructuring of the company, which in addition to relocation of the registered office also includes a change of its legal form. The Court of Justice of the EU has not yet decided on such cross-border restructuring, nevertheless it should be allowed based of the freedom of establishment (cross-border formal transformation.

  13. Acoustic and Perceptual Analysis of Modal and Falsetto Registers in Females with Dysphonia

    Science.gov (United States)

    Li, Nicole Y. K.; Yiu, Edwin M-L.

    2006-01-01

    Modal and falsetto registers are the basic vocal qualities used in female speaking voices. The purpose of this study was to identify the frequency at which modal register changed to falsetto register and the frequency range of each modal and falsetto register produced under three loudness levels: soft, comfortable and loud phonations in normal and…

  14. An open-access mobile compatible electronic patient register for rheumatic heart disease (‘eRegister’) based on the World Heart Federation’s framework for patient registers

    Science.gov (United States)

    van Dam, Joris; Tadmor, Brigitta; Spector, Jonathan; Musuku, John; Zühlke, Liesl J; Zühlke, Liesl J; Engel, Mark E; Mayosi, Bongani M; Nestle, Nick

    2015-01-01

    Summary Background Rheumatic heart disease (RHD) remains a major disease burden in low-resource settings globally. Patient registers have long been recognised to be an essential instrument in RHD control and elimination programmes, yet to date rely heavily on paper-based data collection and non-networked data-management systems, which limit their functionality. Objectives To assess the feasibility and potential benefits of producing an electronic RHD patient register. Methods We developed an eRegister based on the World Heart Federation’s framework for RHD patient registers using CommCare, an open-source, cloud-based software for health programmes that supports the development of customised data capture using mobile devices. Results The resulting eRegistry application allows for simultaneous data collection and entry by field workers using mobile devices, and by providers using computer terminals in clinics and hospitals. Data are extracted from CommCare and are securely uploaded into a cloud-based database that matches the criteria established by the WHF framework. The application can easily be tailored to local needs by modifying existing variables or adding new ones. Compared with traditional paper-based data-collection systems, the eRegister reduces the risk of data error, synchronises in real-time, improves clinical operations and supports management of field team operations. Conclusions The user-friendly eRegister is a low-cost, mobile, compatible platform for RHD treatment and prevention programmes based on materials sanctioned by the World Heart Federation. Readily adaptable to local needs, this paperless RHD patient register program presents many practical benefits. PMID:26444995

  15. Bangladesh Cerebral Palsy Register (BCPR): a pilot study to develop a national cerebral palsy (CP) register with surveillance of children for CP.

    Science.gov (United States)

    Khandaker, Gulam; Smithers-Sheedy, Hayley; Islam, Johurul; Alam, Monzurul; Jung, Jenny; Novak, Iona; Booy, Robert; Jones, Cheryl; Badawi, Nadia; Muhit, Mohammad

    2015-09-25

    The causes and pathogenesis of cerebral palsy (CP) are all poorly understood, particularly in low- and middle-income countries (LMIC). There are gaps in knowledge about CP in Bangladesh, especially in the spheres of epidemiological research, intervention and service utilization. In high-income countries CP registers have made substantial contributions to our understanding of CP. In this paper, we describe a pilot study protocol to develop, implement, and evaluate a CP population register in Bangladesh (i.e., Bangladesh Cerebral Palsy Register - BCPR) to facilitate studies on prevalence, severity, aetiology, associated impairments and risk factors for CP. The BCPR will utilise a modified version of the Australian Cerebral Palsy Register (ACPR) on a secured web-based platform hosted by the Cerebral Palsy Alliance Research Institute, Australia. A standard BCPR record form (i.e., data collection form) has been developed in consultation with local and international experts. Using this form, the BPCR will capture information about maternal health, birth history and the nature of disability in all children with CP aged CP will be identified by using the community based Key Informants Method (KIM). Data from the completed BPCR record together with details of assessment by a research physician will be entered into an online data repository. Once implemented, BCPR will be, to the best of our knowledge, the first formalised CP register from a LMIC. Establishment of the BCPR will enable estimates of prevalence; facilitate clinical surveillance and promote research to improve the care of individuals with CP in Bangladesh.

  16. BUSINESS MODELS FOR EXTENDING OF 112 EMERGENCY CALL CENTER CAPABILITIES WITH E-CALL FUNCTION INSERTION

    Directory of Open Access Journals (Sweden)

    Pop Dragos Paul

    2010-12-01

    Full Text Available The present article concerns present status of implementation in Romania and Europe of eCall service and the proposed business models regarding eCall function implementation in Romania. eCall system is used for reliable transmission in case of crush between In Vehicle System and Public Service Answering Point, via the voice channel of cellular and Public Switched Telephone Network (PSTN. eCall service could be initiated automatically or manual the driver. All data presented in this article are part of researches made by authors in the Sectorial Contract Implementation study regarding eCall system, having as partners ITS Romania and Electronic Solution, with the Romanian Ministry of Communication and Information Technology as beneficiary.

  17. National Sample Survey of Registered Nurses

    Data.gov (United States)

    U.S. Department of Health & Human Services — The National Sample Survey of Registered Nurses (NSSRN) Download makes data from the survey readily available to users in a one-stop download. The Survey has been...

  18. Registers of pressure ulcers in an international context

    Directory of Open Access Journals (Sweden)

    Andrea Pokorná

    2016-05-01

    Full Text Available Aim: The aim of the following review was to search for existing registers of pressure ulcer (PU incidence operating and collecting data on national level. Design: Type of study - review. Methods: Articles focusing on the subject of national PU registers were searched for by means of a systematic trawl through various databases using relevant terms. The search was limited to articles in English issued between 2010 and 2015 in the electronic databases SCOPUS and Nursing OVID. Articles focused on local datasets or registry as a part of local electronic health records were not included as well as studies which do not describe the dataset or the usability of data collection. Results: In total, six papers were found fulfilling the established criteria. Conclusion: According to information available from the literature review, it was recognised that only one register of PUs currently exists at the national level - the Registry of Ulcer Treatment (RUT in Sweden. It can be assumed that registers exist in other countries, but that the information is not available on electronic databases. After a detailed inspection of the articles, it appears the information derived from the studies could provide a useful picture of the data that should be collected, and at what time during the treatment period (initial and final assessment of the patients and local symptomatology of the wound/pressure ulcer it should be collected.

  19. High-speed test of SFQ-shift register files using PTL wiring

    International Nuclear Information System (INIS)

    Fujiwara, K.; Yamashiro, Y.; Yoshikawa, N.; Hashimoto, Y.; Yorozu, S.; Terai, H.; Fujimaki, A.

    2004-01-01

    We have been developing an SFQ shift register memory, which is one candidate to realize high-throughput and high-density superconductive memories. We have modified our memory architecture in order to adapt it to our SFQ microprocessor, CORE1. The new version of the shift register memory is composed of shift registers with non-destructive readout operation, which have an internal feedback. We have also studied the availability of passive transmission line (PTL) wiring in the memory system at high speed. The tested circuit is a 4-byte shift register file, where four kinds of wiring circuits are used between a decoder and shift registers. We have measured the dependences of the DC bias margin on the operating frequency for all wiring methods, and obtained almost the same dependences, which shows the availability of the PTL wiring in the memory system. We have used the NEC 2.5 kA/cm 2 Nb standard process and the CONNECT cell library

  20. RNA interference and Register Machines (extended abstract

    Directory of Open Access Journals (Sweden)

    Masahiro Hamano

    2012-11-01

    Full Text Available RNA interference (RNAi is a mechanism whereby small RNAs (siRNAs directly control gene expression without assistance from proteins. This mechanism consists of interactions between RNAs and small RNAs both of which may be single or double stranded. The target of the mechanism is mRNA to be degraded or aberrated, while the initiator is double stranded RNA (dsRNA to be cleaved into siRNAs. Observing the digital nature of RNAi, we represent RNAi as a Minsky register machine such that (i The two registers hold single and double stranded RNAs respectively, and (ii Machine's instructions are interpreted by interactions of enzyme (Dicer, siRNA (with RISC com- plex and polymerization (RdRp to the appropriate registers. Interpreting RNAi as a computational structure, we can investigate the computational meaning of RNAi, especially its complexity. Initially, the machine is configured as a Chemical Ground Form (CGF, which generates incorrect jumps. To remedy this problem, the system is remodeled as recursive RNAi, in which siRNA targets not only mRNA but also the machine instructional analogues of Dicer and RISC. Finally, probabilistic termination is investigated in the recursive RNAi system.

  1. Assessing call centers’ success:

    Directory of Open Access Journals (Sweden)

    Hesham A. Baraka

    2013-07-01

    This paper introduces a model to evaluate the performance of call centers based on the Delone and McLean Information Systems success model. A number of indicators are identified to track the call center’s performance. Mapping of the proposed indicators to the six dimensions of the D&M model is presented. A Weighted Call Center Performance Index is proposed to assess the call center performance; the index is used to analyze the effect of the identified indicators. Policy-Weighted approach was used to assume the weights with an analysis of different weights for each dimension. The analysis of the different weights cases gave priority to the User satisfaction and net Benefits dimension as the two outcomes from the system. For the input dimensions, higher priority was given to the system quality and the service quality dimension. Call centers decision makers can use the tool to tune the different weights in order to reach the objectives set by the organization. Multiple linear regression analysis was used in order to provide a linear formula for the User Satisfaction dimension and the Net Benefits dimension in order to be able to forecast the values for these two dimensions as function of the other dimensions

  2. Nursing career fulfillment: statistics and statements from registered nurses.

    Science.gov (United States)

    Reineck, Carol; Furino, Antonio

    2005-01-01

    A state-level survey of registered nurses confirmed national findings and raised new issues. Findings revealed that while nurses love the intrinsic reward of nursing, they report workplace, relationship, and stress issues which contribute to frustration and exhaustion. These issues may prevent registered nurses from giving the nursing care they desire to deliver, hastening preventable retirement and costly turnover decisions.

  3. 78 FR 76218 - Rural Call Completion

    Science.gov (United States)

    2013-12-17

    ... calls to rural areas, and enforce restrictions against blocking, choking, reducing, or restricting calls... to alert the Commission of systemic problems receiving calls from a particular originating long... associated with completing calls to rural areas. These rules will also enhance our ability to enforce...

  4. Registered indians and tobacco taxation: a culturally-appropriate strategy?

    Science.gov (United States)

    Wardman, A E Dennis; Khan, Nadia A

    2005-01-01

    Taxation of tobacco is a widely-used strategy that prompts smoking cessation among adults and reduces cigarette consumption among continuing smokers. Registered Indian tobacco use prevalence is at least double that of the rest of Canadians and is in part due to the lower cost of tobacco products purchased on reserve by Registered Indians (RIs) as they are tax exempt. Although registered Indian communities have the ability to collect tax on tobacco products and direct the use of these revenues, this strategy is rarely utilized. Tobacco taxation could have substantial health and economic benefits to RI communities, but perhaps is not culturally-appropriate. In order to better support RI communities, governments and other organizations need to examine this policy instrument in the context of RI populations.

  5. Long-distance calls in Neotropical primates

    Directory of Open Access Journals (Sweden)

    Oliveira Dilmar A.G.

    2004-01-01

    Full Text Available Long-distance calls are widespread among primates. Several studies concentrate on such calls in just one or in few species, while few studies have treated more general trends within the order. The common features that usually characterize these vocalizations are related to long-distance propagation of sounds. The proposed functions of primate long-distance calls can be divided into extragroup and intragroup ones. Extragroup functions relate to mate defense, mate attraction or resource defense, while intragroup functions involve group coordination or alarm. Among Neotropical primates, several species perform long-distance calls that seem more related to intragroup coordination, markedly in atelines. Callitrichids present long-distance calls that are employed both in intragroup coordination and intergroup contests or spacing. Examples of extragroup directed long-distance calls are the duets of titi monkeys and the roars and barks of howler monkeys. Considerable complexity and gradation exist in the long-distance call repertoires of some Neotropical primates, and female long-distance calls are probably more important in non-duetting species than usually thought. Future research must focus on larger trends in the evolution of primate long-distance calls, including the phylogeny of calling repertoires and the relationships between form and function in these signals.

  6. Assessment of Bonelike (registered) graft with a resorbable matrix using an animal model

    International Nuclear Information System (INIS)

    Lobato, J.V.; Hussain, N. Sooraj; Botelho, C.M.; Mauricio, A.C.; Afonso, A.; Ali, N.; Santos, J.D.

    2006-01-01

    Synthetic bone grafts have been developed to provide an alternative to autografts and allografts. Bonelike (registered) is a patented synthetic osteoconductive bone graft that mimics the mineral composition of natural bone. In the present preliminary animal studies a user-friendly version of synthetic bone graft Bonelike (registered) have been developed by using a resorbable matrix, Floseal (registered) , as a vehicle and raloxifene hydrochloride as a therapeutic molecule, that is known to decrease osteoclast activity and therefore enhanced bone formation. From histological and scanning electron microscopy evaluations, the use of Bonelike (registered) associated with Floseal (registered) and raloxifene hydrochloride showed that new bone was rapidly apposed on implanted granules and also that the presence of the matrix and therapeutic molecule does not alter the proven highly osteoconductivity properties of Bonelike (registered) . Therefore, this association may be one step-forward for the clinical applications of Bonelike (registered) scaffolds since it is much more easy-to-handle when compared to granular materials

  7. The Danish nationwide clinical register for patients with rheumatoid arthritis: DANBIO.

    Science.gov (United States)

    Ibfelt, Else Helene; Jensen, Dorte Vendelbo; Hetland, Merete Lund

    2016-01-01

    DANBIO is a research register and a data source for rheumatologic diseases (rheumatoid arthritis [RA], axial spondyloarthritis, and psoriatic arthritis) for monitoring clinical quality at the national, regional, and hospital levels. The register includes patients with rheumatologic diseases who are treated at a hospital or a private rheumatologic clinic. Registration is mandatory for all patients with RA regardless of treatment and also for patients with other diagnoses if treated with biological disease-modifying antirheumatic drugs. Since 2006, the registration has been done electronically, including patient-reported outcome measures registered electronically by the patients with the use of touch screens. Core variables such as diagnosis, year of diagnosis, age, and sex are registered at the beginning. Data entered at later visits included the following: patient-reported outcomes for disease activity, pain, fatigue, functional status, and physician-reported objective measures of disease activity, treatment, C-reactive protein, and, when indicated, imaging. For subgroups of patients, the variables such as quality of life, sociodemographic factors, lifestyle, and comorbidity are also registered. The DANBIO cohort comprised ∼26,000 patients with RA, 3,200 patients with axial spondyloarthritis, and 6,200 patients with psoriatic arthritis in 2015. DANBIO has high nationwide coverage and completeness on key data variables. More than 60 original papers as well as annual reports of clinical quality (since 2005) have been published. DANBIO is a powerful register for research in rheumatologic diseases and furthermore serves as a Clinical Quality Register with the aim of monitoring treatment quality in patients with RA in Denmark.

  8. Labelling and optimization of PHOTOFRIN {sup registered} with {sup 99m}Tc

    Energy Technology Data Exchange (ETDEWEB)

    Fakhar-e-Alam, M. [Pakistan Institute of Engineering and Applied Sciences, Islamabad (Pakistan); Roohi, S.; Amir, N.; Zahoor, R. [Pakistan Institute of Nuclear Science and Technology, Islamabad (Pakistan). Isotope Production Div.; Atif, M.; Firdous, S. [National Institute of Laser and Optronics, Islamabad (Pakistan). Biophotonics Lab.

    2010-07-01

    PHOTOFRIN {sup registered} was labelled with {sup 99m}Tc using SnCl{sub 2}.2H{sub 2}O as reducing agent. Instant thin layer chromatography (ITLC-SG) in 0.05 M NaOH was used for evaluation of radiochemical purity. Labelling efficiency was dependent on various factors that include the ligand/reductant ratio, pH and time of incubation. Therefore, optimum conditions of labelling were also determined. The stability of {sup 99m}Tc-PHOTOFRIN {sup registered} in serum was checked by using fresh human serum. Tissue distribution of {sup 99m}Tc-PHOTOFRIN {sup registered} was evaluated in Sprague Dawley rats. PHOTOFRIN {sup registered} was labelled with an efficiency of > 95% under optimum conditions, which were PHOTOFRIN {sup registered}: 200 {mu}g, pH: 3-4, SnCl{sub 2}.2H{sub 2}O: 15 {mu}g and 30 min incubation at room temperature. The {sup 99m}Tc-labelled PHOTOFRIN {sup registered} remained stable in human serum for 24 h. Biodistribution study in rats revealed maximum concentration of the labelled compound in liver, lungs and spleen at 0.5 h, and significant activity was also seen in the bladder and urine, indicating the mode of urinary excretion of PHOTOFRIN {sup registered}. (orig.)

  9. Prevalencia de apéndice preauricular en 129,426 nacimientos consecutivos ocurridos en el hospital Civil de Guadalajara (México) Dr. Juan I. Menchaca

    OpenAIRE

    J. Jesús Pérez M.; Noé Alfaro A.; Eusebio Angulo C.; Mireya Robledo A.

    2005-01-01

    Esta publicación muestra la prevalencia de apéndice preauricular y la frecuencia de algunas variables relevantes. Se estudió la de prevalencia en 254 neonatos con apéndice preauricular diagnosticada en el momento del nacimiento, en 129,426 nacimientos consecutivos ocurridos en el Hospital Civil de Guadalajara (México) Dr. Juan I Menchaca durante el período de 1990 a 2003. Con una entrevista directa a las madres se obtuvo información de las variables relevantes. Se midió la prevalenci...

  10. 17 CFR 403.1 - Application of part to registered brokers and dealers.

    Science.gov (United States)

    2010-04-01

    ... registered brokers and dealers. 403.1 Section 403.1 Commodity and Securities Exchanges DEPARTMENT OF THE... SECURITIES AND BALANCES § 403.1 Application of part to registered brokers and dealers. With respect to their activities in government securities, compliance by registered brokers or dealers with § 240.8c-1 of this...

  11. Statement of Agreements Registered with the Agency. Addendum

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1961-10-24

    This addendum is divided into two parts. Part I contains supplementary information on certain agreements which were registered with the Agency up to 30 June 1960; part II is a statement of all agreements so registered between July 1960 and 30 June 1961. In compliance with Article VI of the Regulations for the Registration of Agreements this document is hereby transmitted to all Members of the Agency for their information. A copy is also being sent to the Secretary-General of the United Nations.

  12. Statement of Agreements Registered with the Agency. Addendum

    International Nuclear Information System (INIS)

    1961-01-01

    This addendum is divided into two parts. Part I contains supplementary information on certain agreements which were registered with the Agency up to 30 June 1960; part II is a statement of all agreements so registered between July 1960 and 30 June 1961. In compliance with Article VI of the Regulations for the Registration of Agreements this document is hereby transmitted to all Members of the Agency for their information. A copy is also being sent to the Secretary-General of the United Nations

  13. A Descriptive Study of Registers Found in Spoken and Written Communication (A Semantic Analysis

    Directory of Open Access Journals (Sweden)

    Nurul Hidayah

    2016-07-01

    Full Text Available This research is descriptive study of registers found in spoken and written communication. The type of this research is Descriptive Qualitative Research. In this research, the data of the study is register in spoken and written communication that are found in a book entitled "Communicating! Theory and Practice" and from internet. The data can be in the forms of words, phrases and abbreviation. In relation with method of collection data, the writer uses the library method as her instrument. The writer relates it to the study of register in spoken and written communication. The technique of analyzing the data using descriptive method. The types of register in this term will be separated into formal register and informal register, and identify the meaning of register.

  14. Occupational radiation exposure in Germany in 2006. Report of the radiation protection register

    International Nuclear Information System (INIS)

    Frasch, G.; Fritzsche, E.; Kammerer, L.; Karofsky, R.; Spiesl, J.; Stegemann, R.

    2008-06-01

    In Germany, persons occupationally exposed to radiation are monitored by several official dosimetric services who transmit their records about individual radiation doses to the Radiation Protection Register of the Federal Office for Radiation Protection (BfS). The number of dose recordings reported to the Radiation Protection Register has annually increased to more than three million records per year and thus accumulated to more than 34 million dose records at the end of 2006. The purpose of the Radiation Protection Register is to supervise the keeping of the dose limits by each radiation worker and to monitor the compliance with the radiation protection principle ''optimisation'' by performing detailed annual statistical analyses of the monitored persons and their radiation exposure. Amongst others, the annual report of the Radiation Protection Register provides information about status and development of occupational radiation exposure in Germany. In 2006, about 312,000 workers were monitored with dosimeters for occupational radiation exposure. About 18 % of the monitored persons received a measurable personal dose. The average annual dose of these exposed workers was 0.75 mSv. This value is the lowest average annual dose since dose monitoring for occupational worker was introduced. It remains below the dose limit of 1 mSv for the general public and amounts only 4 % of the annual dose limit of 20 mSv for radiation workers. Since 2003 aircraft crew personnel is subject to dose monitoring if it is employed in accordance with the German employment act and likely to receive an effective dose of at least 1 mSv per year from cosmic radiation during flight operation. This accounts for about 33.000 pilots and flight attendants. 45 airlines report the monthly accumulated dose values of their personnel via the Federal Office for Civil Aviation (''Luftfahrt-Bundesamt, LBA'') to the BfS. The collective dose of the aircraft crew personnel is 71 Person-Sv and thus

  15. Measuring the Accuracy of Survey Responses using Administrative Register Data

    DEFF Research Database (Denmark)

    Kreiner, Claus Thustrup; Lassen, David Dreyer; Leth-Petersen, Søren

    2015-01-01

    This paper shows how Danish administrative register data can be combined with survey data at the person level and be used to validate information collected in the survey. Register data are collected by automatic third party reporting and the potential errors associated with the two data sources...

  16. Registered nurses' use of research findings in the care of older people.

    Science.gov (United States)

    Boström, Anne-Marie; Kajermo, Kerstin Nilsson; Nordström, Gun; Wallin, Lars

    2009-05-01

    To describe registered nurses' reported use of research in the care of older people and to examine associations between research use and factors related to the elements: the communication channels, the adopter and the social system. Research use among registered nurses working in hospital settings has been reported in many studies. Few studies, however, have explored the use of research among registered nurses working in the care of older people. A cross-sectional survey. In eight municipalities, all registered nurses (n = 210) working in older people care were invited to participate (response rate 67%). The Research Utilisation Questionnaire was adopted. Questions concerning the work organisation and research-related resources were sent to the Community Chief Nurse at each municipality. Descriptive statistics and logistic regression were applied. The registered nurses reported a relatively low use of research findings in daily practice, despite reporting a positive attitude to research. The registered nurses reported lack of access to research reports at the work place and that they had little support from unit managers and colleagues. Registered nurses working in municipalities with access to research-related resources reported more use of research than registered nurses without resources. The factors 'Access to research findings at work place', 'Positive attitudes to research' and 'Nursing programme at university level' were significantly associated with research use. There is a great potential to increase registered nurses' use of research findings in the care of older people. Factors which were linked to the communication channels and the adopter were associated with research use. Strategies to enhance research use should focus on access to and adequate training in using information sources, increased knowledge on research methodology and nursing science and a supportive organisation.

  17. Sleep Quality of Call Handlers Employed in International Call Centers in National Capital Region of Delhi, India.

    Science.gov (United States)

    Raja, J D; Bhasin, S K

    2016-10-01

    Call center sector in India is a relatively new and fast growing industry driving employment and growth in modern India today. Most international call centers in National Capital Region (NCR) of Delhi operate at odd work hours corresponding to a time suitable fortheir international customers. The sleep quality of call handlers employed in these call centers is in jeopardy owing to their altered sleep schedule. To assess the sleep quality and determine its independent predictors among call handlers employed in international call centers in NCR of Delhi. A cross-sectional questionnaire-based study was conducted on 375 call handlers aged 18-39 years employed in international call centers in NCR of Delhi. Sleep quality was assessed using Athens Insomnia scale along with a pre-tested, structured questionnaire. The mean age of respondents was 24.6 (SD 2.4) years. 78% of participants were male. 83.5% of respondents were unmarried. 44.3% of call handlers were cigarette smokers. Physical ailments were reported by 37% call handlers. 77.6% of call handlers had somesuspicion of insomnia or suspected insomnia; the rest had no sleep problem. Smoking, poor social support, heavy workload, lack of relaxation facility at office, and prolonged travel time to office were independent predictors of sleep quality (pSafeguarding their health becomes an occupational health challenge to public health specialists.

  18. Australian Mining's product register 1992-93

    Energy Technology Data Exchange (ETDEWEB)

    1993-01-01

    This annual product register contains an assessment of resources in Australia; statistical information on mine production of principal minerals; mineral industry statistics; directory of exploration and mining companies; buyers' guide; directory of consultants; list of services and a company index.

  19. Effects of long-term intake of a yogurt fermented with Lactobacillus delbrueckii subsp. bulgaricus 2038 and Streptococcus thermophilus 1131 on mice.

    Science.gov (United States)

    Usui, Yuki; Kimura, Yasumasa; Satoh, Takeshi; Takemura, Naoki; Ouchi, Yasuo; Ohmiya, Hiroko; Kobayashi, Kyosuke; Suzuki, Hiromi; Koyama, Satomi; Hagiwara, Satoko; Tanaka, Hirotoshi; Imoto, Seiya; Eberl, Gérard; Asami, Yukio; Fujimoto, Kosuke; Uematsu, Satoshi

    2018-05-15

    The gut is an extremely complicated ecosystem where microorganisms, nutrients and host cells interact vigorously. Although the function of the intestine and its barrier system weakens with age, some probiotics can potentially prevent age-related intestinal dysfunction. Lactobacillus delbrueckii subsp. bulgaricus 2038 and Streptococcus thermophilus 1131, which are the constituents of LB81 yogurt, are representative probiotics. However, it is unclear whether their long-term intake has a beneficial influence on systemic function. Here, we examined the gut microbiome, fecal metabolites and gene expression profiles of various organs in mice. Although age-related alterations were apparent in them, long-term LB81 yogurt intake led to an increased Bacteroidetes to Firmicutes ratio and elevated abundance of the bacterial family S24-7 (Bacteroidetes), which is known to be associated with butyrate and propanoate production. According to our fecal metabolite analysis to detect enrichment, long-term LB81 yogurt intake altered the intestinal metabolic pathways associated with propanoate and butanoate in the mice. Gene ontology analysis also revealed that long-term LB81 yogurt intake influenced many physiological functions related to the defense response. The profiles of various genes associated with antimicrobial peptides-, tight junctions-, adherens junctions- and mucus-associated intestinal barrier functions were also drastically altered in the LB81 yogurt-fed mice. Thus, long-term intake of LB81 yogurt has the potential to maintain systemic homeostasis, such as the gut barrier function, by controlling the intestinal microbiome and its metabolites.

  20. Callings and Organizational Behavior

    Science.gov (United States)

    Elangovan, A. R.; Pinder, Craig C.; McLean, Murdith

    2010-01-01

    Current literature on careers, social identity and meaning in work tends to understate the multiplicity, historical significance, and nuances of the concept of calling(s). In this article, we trace the evolution of the concept from its religious roots into secular realms and develop a typology of interpretations using occupation and religious…

  1. 17 CFR 404.1 - Application of part to registered brokers and dealers.

    Science.gov (United States)

    2010-04-01

    ... registered brokers and dealers. 404.1 Section 404.1 Commodity and Securities Exchanges DEPARTMENT OF THE... PRESERVATION OF RECORDS § 404.1 Application of part to registered brokers and dealers. Compliance by a registered broker or dealer with § 240.17a-3 of this title (pertaining to records to be made), § 240.17a-4 of...

  2. Uncertain call likelihood negatively affects sleep and next-day cognitive performance while on-call in a laboratory environment.

    Science.gov (United States)

    Sprajcer, Madeline; Jay, Sarah M; Vincent, Grace E; Vakulin, Andrew; Lack, Leon; Ferguson, Sally A

    2018-05-11

    On-call working arrangements are employed in a number of industries to manage unpredictable events, and often involve tasks that are safety- or time-critical. This study investigated the effects of call likelihood during an overnight on-call shift on self-reported pre-bed anxiety, sleep and next-day cognitive performance. A four-night laboratory-based protocol was employed, with an adaptation, a control and two counterbalanced on-call nights. On one on-call night, participants were instructed that they would definitely be called during the night, while on the other on-call night they were told they may be called. The State-Trait Anxiety Inventory form x-1 was used to investigate pre-bed anxiety, and sleep was assessed using polysomnography and power spectral analysis of the sleep electroencephalographic analysis. Cognitive performance was assessed four times daily using a 10-min psychomotor vigilance task. Participants felt more anxious before bed when they were definitely going to be called, compared with the control and maybe conditions. Conversely, participants experienced significantly less non-rapid eye movement and stage two sleep and poorer cognitive performance when told they may be called. Further, participants had significantly more rapid eye movement sleep in the maybe condition, which may be an adaptive response to the stress associated with this on-call condition. It appears that self-reported anxiety may not be linked with sleep outcomes while on-call. However, this research indicates that it is important to take call likelihood into consideration when constructing rosters and risk-management systems for on-call workers.

  3. Are the Cochrane group registers comprehensive? A case study of Japanese psychiatry trials

    Directory of Open Access Journals (Sweden)

    McGuire Hugh

    2002-04-01

    Full Text Available Abstract Background Language bias is a form of publication bias and constitutes a serious threat to meta-analyses. The Cochrane Controlled Trials Register is one attempt to remedy this and now contains more than 300,000 citations. However we are still unsure if it provides comprehensive coverage, particularly for non-English trials. Methods We have recently established a comprehensive register of Japanese trials of psychotropic drugs through extensive personal contacts, electronic searches and handsearches. We examined two Cochrane psychiatry group registers against this Japanese database. Results The Japanese register contained 56 reports of randomized controlled trials (RCTs of antidepressants for depression but the Cochrane Depression, Anxiety and Neurosis group register contained 18, with an overlap of only nine. The Japanese register contained 61 reports of RCTs of neuroleptics for schizophrenia and the Cochrane Schizophrenia group register contained 36, with an overlap of only six. Taking account of some duplicate publications, only a quarter to a third of all relevant Japanese RCTs were retrievable from the Cochrane group registers. Conclusions Similar, or worse, yields may be expected with RCTs conducted in other East Asian countries, and in other fields of medicine. What evidence there is suggests that this situation may lead to a systematic over estimate of treatment effect.

  4. 37 CFR 2.99 - Application to register as concurrent user.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Application to register as concurrent user. 2.99 Section 2.99 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK... Proceedings § 2.99 Application to register as concurrent user. (a) An application for registration as a lawful...

  5. Building a population-based diabetes register: an Italian experience.

    Science.gov (United States)

    Ballotari, Paola; Chiatamone Ranieri, Sofia; Vicentini, Massimo; Caroli, Stefania; Gardini, Andrea; Rodolfi, Rossella; Crucco, Roberto; Greci, Marina; Manicardi, Valeria; Giorgi Rossi, Paolo

    2014-01-01

    To describe the methodology used to set up the Reggio Emilia (northern Italy) Diabetes Register. The prevalence estimates on December 31st, 2009 are also provided. The Diabetes Register covers all residents in the Reggio Emilia province. The register was created by deterministic linkage of six routinely collected data sources through a definite algorithm able to ascertain cases and to distinguish type of diabetes and model of care: Hospital Discharge, Drug Dispensation, Biochemistry Laboratory, Disease-specific Exemption, Diabetes Outpatient Clinics, and Mortality databases. Using these data, we estimated crude prevalence on December 31st, 2009 by sex, age groups, and type of diabetes. There were 25,425 ascertained prevalent cases on December 31st, 2009. Drug Dispensation and Exemption databases made the greatest contribution to prevalence. Analyzing overlapping sources, more than 80% of cases were reported by at least two sources. Crude prevalence was 4.8% and 5.9% for the whole population and for people aged 18 years and over, respectively. Males accounted for 53.6%. Type 1 diabetes accounted for 3.8% of cases, while people with Type 2 diabetes were the overriding majority (91.2%), and Diabetes Outpatient Clinics treated 75.4% of people with Type 2 diabetes. The Register is able to quantify the burden of disease, the first step in planning, implementing, and monitoring appropriate interventions. All data sources contributed to completeness and/or accuracy of the Register. Although all cases are identified by deterministic record linkage, manual revision and General Practitioner involvement are still necessary when information is insufficient or conflicting. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  6. Evironmental Tax. Are Vehicle Registers in the EU Prepared?

    Directory of Open Access Journals (Sweden)

    Petr David

    2017-01-01

    Full Text Available The market system is unavailable to reflect negative externalities, caused by road motor traffic, in the realized prices. For that purpose, it would be appropriate to implement a general environmental road tax in the European Union member states. The question is whether the national registers of vehicles are prepared for such a change. Whether this is the case at present, may be found out by means of analyses of the available national registers. The next step is synthetic: the data must be subsequently completed on the basis of the knowledge of needs of currently existing systems of road motor vehicles taxation. In the end, the identified results may be supplemented with the known data published by international institutions. The results of the research show that the present systems of road motor vehicles taxation are utterly different and distortive. Only 12 countries of the European Union have registers which were clearly identified as prepared for the application of the environmental tax. Registers of the remaining countries do not contain one or more data that are necessary for the implementation of the environmental tax. For this reason we may assume that regardless of other determinants, environmental road tax shall not be introduced throughout the European Union in the foreseeable future.

  7. Validation of sick leave measures: self-reported sick leave and sickness benefit data from a Danish national register compared to multiple workplace-registered sick leave spells in a Danish municipality.

    Science.gov (United States)

    Stapelfeldt, Christina Malmose; Jensen, Chris; Andersen, Niels Trolle; Fleten, Nils; Nielsen, Claus Vinther

    2012-08-15

    Previous validation studies of sick leave measures have focused on self-reports. Register-based sick leave data are considered to be valid; however methodological problems may be associated with such data. A Danish national register on sickness benefit (DREAM) has been widely used in sick leave research. On the basis of sick leave records from 3,554 and 2,311 eldercare workers in 14 different workplaces, the aim of this study was to: 1) validate registered sickness benefit data from DREAM against workplace-registered sick leave spells of at least 15 days; 2) validate self-reported sick leave days during one year against workplace-registered sick leave. Agreement between workplace-registered sick leave and DREAM-registered sickness benefit was reported as sensitivities, specificities and positive predictive values. A receiver-operating characteristic curve and a Bland-Altman plot were used to study the concordance with sick leave duration of the first spell. By means of an analysis of agreement between self-reported and workplace-registered sick leave sensitivity and specificity was calculated. Ninety-five percent confidence intervals (95% CI) were used. The probability that registered DREAM data on sickness benefit agrees with workplace-registered sick leave of at least 15 days was 96.7% (95% CI: 95.6-97.6). Specificity was close to 100% (95% CI: 98.3-100). The registered DREAM data on sickness benefit overestimated the duration of sick leave spells by an average of 1.4 (SD: 3.9) weeks. Separate analysis on pregnancy-related sick leave revealed a maximum sensitivity of 20% (95% CI: 4.3-48.1).The sensitivity of self-reporting at least one or at least 56 sick leave day/s was 94.5 (95% CI: 93.4 - 95.5) % and 58.5 (95% CI: 51.1 - 65.6) % respectively. The corresponding specificities were 85.3 (95% CI: 81.4 - 88.6) % and 98.9 (95% CI: 98.3 - 99.3) %. The DREAM register offered valid measures of sick leave spells of at least 15 days among eldercare employees. Pregnancy

  8. Validation of sick leave measures: self-reported sick leave and sickness benefit data from a Danish national register compared to multiple workplace-registered sick leave spells in a Danish municipality

    Directory of Open Access Journals (Sweden)

    Stapelfeldt Christina Malmose

    2012-08-01

    Full Text Available Abstract Background Previous validation studies of sick leave measures have focused on self-reports. Register-based sick leave data are considered to be valid; however methodological problems may be associated with such data. A Danish national register on sickness benefit (DREAM has been widely used in sick leave research. On the basis of sick leave records from 3,554 and 2,311 eldercare workers in 14 different workplaces, the aim of this study was to: 1 validate registered sickness benefit data from DREAM against workplace-registered sick leave spells of at least 15 days; 2 validate self-reported sick leave days during one year against workplace-registered sick leave. Methods Agreement between workplace-registered sick leave and DREAM-registered sickness benefit was reported as sensitivities, specificities and positive predictive values. A receiver-operating characteristic curve and a Bland-Altman plot were used to study the concordance with sick leave duration of the first spell. By means of an analysis of agreement between self-reported and workplace-registered sick leave sensitivity and specificity was calculated. Ninety-five percent confidence intervals (95% CI were used. Results The probability that registered DREAM data on sickness benefit agrees with workplace-registered sick leave of at least 15 days was 96.7% (95% CI: 95.6-97.6. Specificity was close to 100% (95% CI: 98.3-100. The registered DREAM data on sickness benefit overestimated the duration of sick leave spells by an average of 1.4 (SD: 3.9 weeks. Separate analysis on pregnancy-related sick leave revealed a maximum sensitivity of 20% (95% CI: 4.3-48.1. The sensitivity of self-reporting at least one or at least 56 sick leave day/s was 94.5 (95% CI: 93.4 – 95.5 % and 58.5 (95% CI: 51.1 – 65.6 % respectively. The corresponding specificities were 85.3 (95% CI: 81.4 – 88.6 % and 98.9 (95% CI: 98.3 – 99.3 %. Conclusions The DREAM register offered valid measures of sick

  9. The Policy Debate on Pseudonymous Health Registers in Norway

    Science.gov (United States)

    Andresen, Herbjørn

    Patient health data has a valuable potential for secondary use, such as decision support on a national level, reimbursement settlements, and research on public health or on the effects of various treatment methods. Unfortunately, extensive secondary use of data has disproportionate negative impact on the patients' privacy. The Norwegian health data processing regulation prescribes four different ways of organizing health registers (anonymous, de-identified, pseudonymous or fully identified data subjects). Pseudonymity is the most innovative of these methods, and it has been available as a legitimate means to achieve extensive secondary use of accurate and detailed data since 2001. Up to now, two different national health registers have been organized this way. The evidence from these experiences should be encouraging: Pseudonymity works as intended. Yet, there is still discernible reluctance against extending the pseudonymity principle to encompass other national health registers as well.

  10. SEU-hardened design for shift register in CMOS APS

    International Nuclear Information System (INIS)

    Meng Liya; Liu Zedong; Hu Dajiang; Wang Qingxiang

    2012-01-01

    The inverter-based quasi-static shift register in CMOS APS, which is used in ionizing radiation environment, is susceptible to single event upset (SEU), thus affecting the CMOS active pixel sensor (APS) working. The analysis of the SEU for inverter-based quasi-static shift register concludes that the most sensitive node to single event transient (SET) exists in the input of inverter, and the threshold voltage and capacitance of input node of inverter determine the capability of anti-SEU. A new method was proposed, which replaced the inverter with Schmitt trigger in shift register. Because there is a hysteresis on voltage transfer characteristic of Schmitt trigger, there is high flip threshold, thus better capability of anti-SEU can be achieved. Simulation results show that the anti-SEU capability of Schmitt trigger is 10 times more than that of inverter. (authors)

  11. Care and calls

    DEFF Research Database (Denmark)

    Paasch, Bettina Sletten

    -centred care through the use of tactile resources and embodied orientations while they attend to the phone call. Experienced nurses Thus perform multiactivity by distributing attention towards both the patient and the phone, and the analysis shows that their concrete ways of doing so depend on the complex...... they are telephoned during interactions with patients are not universal. Indeed different strategies have evolved in other hospital departments. Not only does this thesis contribute insights into the way nurses manage phone calls during interactions with patients, but by subscribing to a growing body of embodied...... of human interaction....

  12. Validation of the diagnosis 'prosthetic joint infection' in the Danish Hip Arthroplasty Register

    DEFF Research Database (Denmark)

    Gundtoft, P H; Pedersen, Alma Becic; Schønheyder, H C

    2016-01-01

    and followed them until first-time revision, death, emigration or until 31 December 2012. Revision for PJI, as registered in the DHR, was validated against a benchmark which included information from microbiology databases, prescription registers, clinical biochemistry registers and clinical records. We......AIMS: The purpose of this study was to validate the diagnosis of periprosthetic joint infection (PJI) in the Danish Hip Arthroplasty Register (DHR). PATIENTS AND METHODS: We identified a cohort of patients from the DHR who had undergone primary total hip arthroplasty (THA) since 1 January 2005...... the validity of the diagnosis of PJI and should enable future register-based studies. Cite this article: Bone Joint J 2016;98-B:320-5....

  13. The Danish Education Registers

    DEFF Research Database (Denmark)

    Jensen, Vibeke Myrup; Rasmussen, Astrid Würtz

    to adults continuing education and training stem from administrative education reports. Therefore, for cohorts born 1945-1990, 97 percent of the Danish population has a valid education identifier. For the immigrant population born in the same cohorts the coverage is 85-90 percent. Despite a higher level......Collection of systematic information on education is a long established practice in Denmark. Since 1910, the Danish Ministry of Education's annual reports collects information about individual-level test scores in e.g. compulsory schooling. Today, several registers from compulsory schooling...

  14. 17 CFR 404.5 - Securities counts by registered government securities brokers and dealers.

    Science.gov (United States)

    2010-04-01

    ... registered government securities brokers and dealers. 404.5 Section 404.5 Commodity and Securities Exchanges... AND PRESERVATION OF RECORDS § 404.5 Securities counts by registered government securities brokers and dealers. (a) Securities counts. Every registered government securities broker or dealer shall comply with...

  15. Comparison of Registered and Reported Outcomes in Randomized Clinical Trials Published in Anesthesiology Journals.

    Science.gov (United States)

    Jones, Philip M; Chow, Jeffrey T Y; Arango, Miguel F; Fridfinnson, Jason A; Gai, Nan; Lam, Kevin; Turkstra, Timothy P

    2017-10-01

    Randomized clinical trials (RCTs) provide high-quality evidence for clinical decision-making. Trial registration is one of the many tools used to improve the reporting of RCTs by reducing publication bias and selective outcome reporting bias. The purpose of our study is to examine whether RCTs published in the top 6 general anesthesiology journals were adequately registered and whether the reported primary and secondary outcomes corresponded to the originally registered outcomes. Following a prespecified protocol, an electronic database was used to systematically screen and extract data from RCTs published in the top 6 general anesthesiology journals by impact factor (Anaesthesia, Anesthesia & Analgesia, Anesthesiology, British Journal of Anaesthesia, Canadian Journal of Anesthesia, and European Journal of Anaesthesiology) during the years 2007, 2010, 2013, and 2015. A manual search of each journal's Table of Contents was performed (in duplicate) to identify eligible RCTs. An adequately registered trial was defined as being registered in a publicly available trials registry before the first patient being enrolled with an unambiguously defined primary outcome. For adequately registered trials, the outcomes registered in the trial registry were compared with the outcomes reported in the article, with outcome discrepancies documented and analyzed by the type of discrepancy. During the 4 years studied, there were 860 RCTs identified, with 102 RCTs determined to be adequately registered (12%). The proportion of adequately registered trials increased over time, with 38% of RCTs being adequately registered in 2015. The most common reason in 2015 for inadequate registration was registering the RCT after the first patient had already been enrolled. Among adequately registered trials, 92% had at least 1 primary or secondary outcome discrepancy. In 2015, 42% of RCTs had at least 1 primary outcome discrepancy, while 90% of RCTs had at least 1 secondary outcome discrepancy

  16. Creation of the uniform Chernobyl register of Russia and Belarus

    International Nuclear Information System (INIS)

    Sosnouskaya, Alena; Kotava, Aksana; Ivanov, Victor; Maksutov, Marat

    2008-01-01

    Creation of operation of uniform medical and dosimetric data banks for carrying out of collateral wide-scale radiation epidemiological researches and prediction of medical consequences of Chernobyl accident (ChA) in territory of Russia and Belarus. On the basis of medical and dosimetric data banks of the national registers of Russia and Belarus the uniform technology of collection personal of a state information of health of the population, injured from ChA . Three levels of observation are created. The first level - Bryansk area of Russia and Gomel area of Belarus, interests of research - radiation hazards of oncologic diseases of various localizations for the population living in these territories. The second level - Bryansk, Kaluga, Tula and Oryol area of Russia and Brest, Vitebsk, Gomel, Grodno, Minsk and Mogilyov area of Belarus, preferred direction of researches - thyroid cancer. The third level all territory of Russia and Belarus, area of research - medical consequences for health of the liquidators, their children and persons migrating from polluted territories. Personal uniform sub-registers are created and function on a stationary value to a basis. Is sub-registers containing information about diseases by a thyroid cancer, leukemia and breast cancer, uniform register of the liquidators and their children, uniform cancer-register of the liquidators and uniform cancer-register of the population living in territories with density of contamination on Cs 137 more than 185 kBq/m 2 . The personal information on 20440 cases of thyroid cancer, 5234 cases of a leukemia, 16679 cases of breast cancer, 252884 liquidators, 6882 cases of a cancer of various localizations among the liquidators, 35423 children of the liquidators, 11407 cases of oncologic diseases among the population living in territories with density of contamination on Cs 137 more than 185 kBq/m 2 is accumulated. (author)

  17. Characteristics of the Nafion (registered) - impregnated polycarbonate composite membranes for PEMFCs

    International Nuclear Information System (INIS)

    Kim, Ki-Hwan; Ahn, Sang-Yeoul; Oh, In-Hwan; Ha, Heung Yong; Hong, Seong-Ahn; Kim, Moon-Sun; Lee, Youngkwan; Lee, Yong-Chul

    2004-01-01

    In this work, polycarbonate composite membranes were prepared for proton exchange membrane fuel cells (PEMFCs). In the preparation of membranes, a small amount of poly(ethylene glycol) (PEG) was blended with polycarbonate (PC) solution and then cast to make membranes. PEG contained in the membrane was removed by the high solubility of supercritical CO 2 to afford porosity in the membrane. Then, porous PC membranes were soaked in Nafion (registered) solution to yield the PC/Nafion (registered) composite membranes. The PC composite membrane had lower ion conductivity but higher conductance than Nafion (registered)

  18. Association of schizophrenia and autoimmune diseases: linkage of Danish national registers

    DEFF Research Database (Denmark)

    Eaton, William W.; Byrne, Majella; Ewald, Henrik

    2006-01-01

    the association of schizophrenia with these disorders as well as a range of other autoimmune diseases in a single large epidemiologic study. METHOD: The Danish Psychiatric Register, the National Patient Register, and a register with socioeconomic information were linked to form a data file that included all 7......,704 persons in Denmark diagnosed with schizophrenia from 1981 to 1998 and their parents along with a sample of matched comparison subjects and their parents. The data linkage required that the autoimmune disease occur before the diagnosis of schizophrenia. RESULTS: A history of any autoimmune disease...

  19. An analysis of characteristics of post-authorisation studies registered on the ENCePP EU PAS Register [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Robert Carroll

    2017-11-01

    Full Text Available Background: The objective of this study was to investigate the study design characteristics of Post-Authorisation Studies (PAS requested by the European Medicines Agency which were recorded on the European Union (EU PAS Register held by the European Network of Centres for Pharmacoepidemiology and Pharmacovigilance (ENCePP. Methods: We undertook a cross-sectional descriptive analysis of all studies registered on the EU PAS Register as of 18th October 2016. Results: We identified a total of 314 studies on the EU PAS Register, including 81 (26% finalised, 160 (51% ongoing and 73 (23% planned. Of those studies identified, 205 (65% included risk assessment in their scope, 133 (42% included drug utilisation and 94 (30% included effectiveness evaluation. Just over half of the studies (175; 56% used primary data capture, 135 (43% used secondary data and 4 (1% used a hybrid design combining both approaches. Risk assessment and effectiveness studies were more likely to use primary data capture (60% and 85% respectively as compared to 39% and 14% respectively for secondary. The converse was true for drug utilisation studies where 59% were secondary vs. 39% for primary. For type 2 diabetes mellitus, database studies were more commonly used (80% vs 3% chart review, 3% hybrid and 13% primary data capture study designs whereas for studies in oncology, primary data capture were more likely to be used (85% vs 4% chart review, and 11% database study designs. Conclusions: Results of this analysis show that PAS design varies according to study objectives and therapeutic area.

  20. Registered partnerships

    CERN Multimedia

    Staff Association

    2015-01-01

    In recent decades, family patterns have changed significantly. National laws have taken these changes into account, recognizing new forms of unions, different to heterosexual marriage. Indeed, recently some countries have given the possibility to same-sex couples to enter into various forms of unions. Staff regulations of international organizations are not directly affected by national laws, but in the context of diversity policies, the lack of recognition of these new forms of unions, may appear to discriminate based on sexual orientation and to limit the freedom of choosing marital status. A study by the International Service for Remunerations and Pensions (iSRP) of the OECD in January 2015 (PROS Report (1015) 04) shows that in comparison with other international organizations, CERN offers the least favorable social conditions for its Staff with in a registered partnership. As part of the Five-year review in 2015, it is important that CERN aligns itself with the practice of these other organizations...

  1. The Danish Education Registers

    DEFF Research Database (Denmark)

    Jensen, Vibeke Myrup; Würtz Rasmussen, Astrid

    to adults continuing education and training stem from administrative education reports. Therefore, for cohorts born 1945-1990, 97 percent of the Danish population has a valid education identifier. For the immigrant population born in the same cohorts the coverage is 85-90 percent. Despite a higher level......Collection of systematic information on education is a long established practice in Denmark. Since 1910, the Danish Ministry of Education’s annual reports collects information about individual-level test scores in e.g. compulsory schooling. Today, several registers from compulsory schooling...

  2. The Danish Education Registers

    DEFF Research Database (Denmark)

    Jensen, Vibeke Myrup; Rasmussen, Astrid Würtz

    2011-01-01

    Collection of systematic information on education is a long established practice in Denmark. Since 1910, the Danish Ministry of Education’s annual reports collects information about individual-level test scores in e.g. compulsory schooling. Today, several registers from compulsory schooling...... to adults continuing education and training stem from administrative education reports. Therefore, for cohorts born 1945-1990, 97 percent of the Danish population has a valid education identifier. For the immigrant population born in the same cohorts the coverage is 85-90 percent. Despite a higher level...

  3. Constor registered full-scale prototype drop test and measuring program

    International Nuclear Information System (INIS)

    Koenig, S.; Diersch, R.; Quercetti, T.

    2004-01-01

    The CONSTOR registered steel-sandwich cask was developed as a cost-effective design by using conventional mechanical engineering technologies and commonly available materials. The CONSTOR registered consists of a cask body with an outer and an inner liner made of steel. At the upper end, the liners are welded to a ring made of forged steel. The space between the two liners is filled with heavy concrete named CONSTORIT for additional gamma and neutron shielding. The CONSTORIT consists of an iron aggregate frame and hardened cement paste. The liners of the cask and the forged head ring form the basis for the structural integrity, the CONSTORIT bears only a menial part of accident loads. The CONSTOR registered concept fulfils both the internationally valid IAEA criteria for transportation and the requirements for long-term intermediate storage in the US and various European countries. Since the beginning of the development of the CONSTOR registered design in the early nineties, two drop test series with half-scale models have already been performed. A full-scale model of a CONSTOR registered V for BWR inventory has been manufactured for the third drop test program starting in 2004, and will be presented in a first 9-meter drop test on the BAM drop test facility at Horstwalde near Berlin during the PATRAM 2004 Symposium. The transport package consists of a cask with a dummy basket, a puncture-resistant jacket and two impact limiters

  4. High-Speed Imaging Analysis of Register Transitions in Classically and Jazz-Trained Male Voices.

    Science.gov (United States)

    Dippold, Sebastian; Voigt, Daniel; Richter, Bernhard; Echternach, Matthias

    2015-01-01

    Little data are available concerning register functions in different styles of singing such as classically or jazz-trained voices. Differences between registers seem to be much more audible in jazz singing than classical singing, and so we hypothesized that classically trained singers exhibit a smoother register transition, stemming from more regular vocal fold oscillation patterns. High-speed digital imaging (HSDI) was used for 19 male singers (10 jazz-trained singers, 9 classically trained) who performed a glissando from modal to falsetto register across the register transition. Vocal fold oscillation patterns were analyzed in terms of different parameters of regularity such as relative average perturbation (RAP), correlation dimension (D2) and shimmer. HSDI observations showed more regular vocal fold oscillation patterns during the register transition for the classically trained singers. Additionally, the RAP and D2 values were generally lower and more consistent for the classically trained singers compared to the jazz singers. However, intergroup comparisons showed no statistically significant differences. Some of our results may support the hypothesis that classically trained singers exhibit a smoother register transition from modal to falsetto register. © 2015 S. Karger AG, Basel.

  5. How to call the Fire Brigade

    CERN Multimedia

    2003-01-01

    The telephone numbers for the CERN Fire Brigade are: 74444 for emergency calls 74848 for other calls Note The number 112 will stay in use for emergency calls from "wired" telephones, however, from mobile phones it leads to non-CERN emergency services.

  6. A Comparative Content Analysis of Vegetarian Food Blogs Written by Registered Dietitians and Non-Registered Dietitians.

    Science.gov (United States)

    Dumas, Audrée-Anne; Lemieux, Simone; Lapointe, Annie; Dugrenier, Marilyn; Desroches, Sophie

    2017-06-01

    This purpose of this study was to compare the nutritional content of vegetarian recipes published in food blogs written by registered dietitians (RDs) and by non-registered dietitians (non-RDs). Twelve food blogs written by RDs and 12 written by non-RDs were selected using a systematic approach. For each food blog, 2 vegetarian entrée recipes per season were selected (n = 192 recipes). Descriptive analyses were performed using Fisher's exact test. Median nutritional values per serving between RDs' and non-RDs' recipes were compared using Wilcoxon-Mann-Whitney tests. RDs' recipes were significantly lower in energy, non-heme iron, vitamin C, and sodium, contained significantly more vitamin D and had a higher protein proportion than non-RDs' recipes. Disparities were also observed across type of entrée and vegetarian dietary pattern. In conclusion, this study showed that RD and non-RD food bloggers provided vegetarian recipes with few nutritional differences. Whether expanding the comparative analysis between RDs and non-RDs' blogs targeting different nutrition-related topics would yield different results remains to be investigated.

  7. Three-Dimensional Analysis of the Curvature of the Femoral Canal in 426 Chinese Femurs

    Directory of Open Access Journals (Sweden)

    Xiu-Yun Su

    2015-01-01

    Full Text Available Purpose. The human femur has long been considered to have an anatomical anterior curvature in the sagittal plane. We established a new method to evaluate the femoral curvature in three-dimensional (3D space and reveal its influencing factors in Chinese population. Methods. 3D models of 426 femurs and the medullary canal were constructed using Mimics software. We standardized the positions of all femurs using 3ds Max software. After measuring the anatomical parameters, including the radius of femoral curvature (RFC and banking angle, of the femurs using the established femur-specific coordinate system, we analyzed and determined the relationships between the anatomical parameters of the femur and the general characteristics of the population. Results. Pearson’s correlation analyses showed that there were positive correlations between the RFC and height (r=0.339, p<0.001 and the femoral length and RFC (r=0.369, p<0.001 and a negative correlation between the femoral length and banking angle (r=-0.223, p<0.001. Stepwise linear regression analyses showed that the most relevant factors for the RFC and banking angle were the femoral length and gender, respectively. Conclusions. This study concluded that the banking angle of the femur was significantly larger in female than in male.

  8. The Danish nationwide clinical register for patients with rheumatoid arthritis: DANBIO

    Directory of Open Access Journals (Sweden)

    Ibfelt EH

    2016-10-01

    Full Text Available Else Helene Ibfelt,1 Dorte Vendelbo Jensen,2,3 Merete Lund Hetland2,4 1Registry Support Centre (East, Epidemiology and Biostatistics, Research Centre for Prevention and Health, Rigshospitalet, Glostrup University Hospital, 2DANBIO Registry and Copenhagen Center for Arthritis Research, Center for Rheumatology and Spine Diseases, Centre of Head and Orthopedics, Rigshospitalet, Glostrup, 3Department of Rheumatology, Herlev and Gentofte University Hospital, Hellerup, 4Department of Clinical Medicine, Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen, Denmark Introduction: DANBIO is a research register and a data source for rheumatologic diseases (rheumatoid arthritis [RA], axial spondyloarthritis, and psoriatic arthritis for monitoring clinical quality at the national, regional, and hospital levels. Study population: The register includes patients with rheumatologic diseases who are treated at a hospital or a private rheumatologic clinic. Registration is mandatory for all patients with RA regardless of treatment and also for patients with other diagnoses if treated with biological disease-modifying antirheumatic drugs. Since 2006, the registration has been done electronically, including patient-reported outcome measures registered electronically by the patients with the use of touch screens. Main variables: Core variables such as diagnosis, year of diagnosis, age, and sex are registered at the beginning. Data entered at later visits included the following: patient-reported outcomes for disease activity, pain, fatigue, functional status, and physician-reported objective measures of disease activity, treatment, C-reactive protein, and, when indicated, imaging. For subgroups of patients, the variables such as quality of life, sociodemographic factors, lifestyle, and comorbidity are also registered. Descriptive data: The DANBIO cohort comprised ~26,000 patients with RA, 3,200 patients with axial spondyloarthritis, and 6

  9. The Danish Multiple Sclerosis Treatment Register

    Directory of Open Access Journals (Sweden)

    Magyari M

    2016-10-01

    Full Text Available Melinda Magyari,1,3 Nils Koch-Henriksen,1,2 Per Soelberg Sørensen3 1Danish Multiple Sclerosis Registry, Department of Neurology, Rigshospitalet, Copenhagen, 2Department of Clinical Epidemiology, Clinical Institute, University of Aarhus, Aarhus, 3Danish Multiple Sclerosis Center, Department of Neurology, Rigshospitalet, University of Copenhagen, Copenhagen, Denmark Aim of the database: The Danish Multiple Sclerosis Treatment Register (DMSTR serves as a clinical quality register, enabling the health authorities to monitor the quality of the disease-modifying treatment, and it is an important data source for epidemiological research. Study population: The DMSTR includes all patients with multiple sclerosis who had been treated with disease-modifying drugs since 1996. At present, more than 8,400 patients have been registered in this database. Data are continuously entered online into a central database from all sites in Denmark at start and at regular visits. Main variables: Include age, sex, onset year and year of the diagnosis, basic clinical information, and information about treatment, side effects, and relapses. Descriptive data: Notification is done at treatment start, and thereafter at every scheduled clinical visit 3 months after treatment start, and thereafter every 6 months. The longitudinally collected information about the disease activity and side effects made it possible to investigate the clinical efficacy and adverse events of different disease-modifying therapies. Conclusion: The database contributed to a certain harmonization of treatment procedures in Denmark and will continue to be a major factor in terms of quality in clinical praxis, research and monitoring of adverse events, and plays an important role in research. Keywords: multiple sclerosis, epidemiology, immunomodulatory treatment, neutralizing antibodies, observational studies, registry research, disease modifying therapy

  10. The Fundamental Spatial Data in the Public Administration Registers

    Science.gov (United States)

    Čada, V.; Janečka, K.

    2016-06-01

    The system of basic registers was launched in the Czech Republic in 2012. The system provides a unique solution to centralize and keep actual most common and widely used information as a part of the eGovernment. The basic registers are the central information source for information systems of public authorities. In October 2014, the Czech government approved the conception of The Strategy for the Development of the Infrastructure for Spatial Information in the Czech Republic to 2020 (GeoInfoStrategy) that serves as a basis for the NSDI. The paper describes the challenges in building the National Spatial Data Infrastructure (NSDI) in the Czech Republic with focus on the fundamental spatial data and related basic registers. The GeoInfoStrategy should also contribute to increasing of the competitiveness of the economy. Therefore the paper also reflects the Directive 2014/61/EU of the European Parliament and of the Council on measures to reduce the cost of deploying high-speed electronic communication networks. The Directive states that citizens as well as the private and public sectors must have the opportunity to be part of the digital economy. A high quality digital infrastructure underpins virtually all sectors of a modern and innovative economy. To ensure a development of such infrastructure in the Czech Republic, the Register of passive infrastructure providing information on the features of passive infrastructure has to be established.

  11. Spiritual care perspectives of Danish Registered Nurses

    DEFF Research Database (Denmark)

    Christensen, Kirsten Haugaard; Turner, de Sales

    2008-01-01

    Spiritual care perspectives of Danish Nurses The purpose of this study was to explore how Danish registered nurses understand the phenomenon of spiritual care and how their understanding impacts on their interventions with their patients. Nurses are responsible for the provision of care which...... approach rooted in the philosophy of Gadamer was chosen as methodology. In-depth interviews were used as data collection tool, and six registered nurses who worked within hospital settings in Denmark were interviewed. The findings revealed that deep knowing of the patients were essential before nurses...... would engage in provision of spiritual care. The participants acknowledged that their understanding of spirituality influenced their provision of spiritual care, which was recognized as a challenge requiring the nurse’s initiative and courage. Spirituality was primarily understood as a patient’s private...

  12. 36 CFR 60.1 - Authorization and expansion of the National Register.

    Science.gov (United States)

    2010-07-01

    ..., DEPARTMENT OF THE INTERIOR NATIONAL REGISTER OF HISTORIC PLACES § 60.1 Authorization and expansion of the...., as amended, authorizes the Secretary of the Interior to expand and maintain a National Register of districts, sites, buildings, structures, and objects significant in American history, architecture...

  13. Using Semantic Similarity In Automated Call Quality Evaluator For Call Centers

    Directory of Open Access Journals (Sweden)

    Ria A. Sagum

    2015-08-01

    Full Text Available Conversation between the agent and client are being evaluated manually by a quality assurance officer QA. This job is only one of the responsibilities being done by a QA and particularly eat ups a lot of time for them which lead to late evaluation results that may cause untimely response of the company to concerns raised by their clients. This research developed an application software that automates and evaluates the quality assurance in business process outsourcing companies or customer service management implementing sentence similarity. The developed system includes two modules speaker diarization which includes transcription and question and answer extraction and similarity checker which checks the similarity between the extracted answer and the answer of the call center agent to a question. The system was evaluated for Correctness of the extracted answers and accurateness of the evaluation for a particular call. Audio conversations were tested for the accuracy of the transcription module which has an accuracy of 27.96. The Precision Recall and F-measure of the extracted answer was tested as 78.03 96.26 and 86.19 respectively. The Accuracy of the system in evaluating a call is 70.

  14. Co-registered photoacoustic, thermoacoustic, and ultrasound mouse imaging

    Science.gov (United States)

    Reinecke, Daniel R.; Kruger, Robert A.; Lam, Richard B.; DelRio, Stephen P.

    2010-02-01

    We have constructed and tested a prototype test bed that allows us to form 3D photoacoustic CT images using near-infrared (NIR) irradiation (700 - 900 nm), 3D thermoacoustic CT images using microwave irradiation (434 MHz), and 3D ultrasound images from a commercial ultrasound scanner. The device utilizes a vertically oriented, curved array to capture the photoacoustic and thermoacoustic data. In addition, an 8-MHz linear array fixed in a horizontal position provides the ultrasound data. The photoacoustic and thermoacoustic data sets are co-registered exactly because they use the same detector. The ultrasound data set requires only simple corrections to co-register its images. The photoacoustic, thermoacoustic, and ultrasound images of mouse anatomy reveal complementary anatomic information as they exploit different contrast mechanisms. The thermoacoustic images differentiate between muscle, fat and bone. The photoacoustic images reveal the hemoglobin distribution, which is localized predominantly in the vascular space. The ultrasound images provide detailed information about the bony structures. Superposition of all three images onto a co-registered hybrid image shows the potential of a trimodal photoacoustic-thermoacoustic-ultrasound small-animal imaging system.

  15. 17 CFR 270.30b1-1 - Semi-annual report for registered management investment companies.

    Science.gov (United States)

    2010-04-01

    ... registered management investment companies. 270.30b1-1 Section 270.30b1-1 Commodity and Securities Exchanges....30b1-1 Semi-annual report for registered management investment companies. Every registered management... management investment company that has filed a registration statement with the Commission registering its...

  16. Calling in Work: Secular or Sacred?

    Science.gov (United States)

    Steger, Michael F.; Pickering, N. K.; Shin, J. Y.; Dik, B. J.

    2010-01-01

    Recent scholarship indicates that people who view their work as a calling are more satisfied with their work and their lives. Historically, calling has been regarded as a religious experience, although modern researchers frequently have adopted a more expansive and secular conceptualization of calling, emphasizing meaning and personal fulfillment…

  17. Hornbills can distinguish between primate alarm calls.

    Science.gov (United States)

    Rainey, Hugo J.; Zuberbühler, Klaus; Slater, Peter J. B.

    2004-01-01

    Some mammals distinguish between and respond appropriately to the alarm calls of other mammal and bird species. However, the ability of birds to distinguish between mammal alarm calls has not been investigated. Diana monkeys (Cercopithecus diana) produce different alarm calls to two predators: crowned eagles (Stephanoaetus coronatus) and leopards (Panthera pardus). Yellow-casqued hornbills (Ceratogymna elata) are vulnerable to predation by crowned eagles but are not preyed on by leopards and might therefore be expected to respond to the Diana monkey eagle alarm call but not to the leopard alarm call. We compared responses of hornbills to playback of eagle shrieks, leopard growls, Diana monkey eagle alarm calls and Diana monkey leopard alarm calls and found that they distinguished appropriately between the two predator vocalizations as well as between the two Diana monkey alarm calls. We discuss possible mechanisms leading to these responses. PMID:15209110

  18. The value of registered nurses in ambulatory care settings: a survey.

    Science.gov (United States)

    Mastal, Margaret; Levine, June

    2012-01-01

    Ambulatory care settings employ 25% of the three million registered nurses in the United States. The American Academy of Ambulatory Care Nursing (AAACN) is committed to improving the quality of health care in ambulatory settings, enhancing patient outcomes, and realizing greater health care efficiencies. A survey of ambulatory care registered nurses indicates they are well positioned to lead and facilitate health care reform activities with organizational colleagues. They are well schooled in critical thinking, triage, advocating for patients, educating patients and families, collaborating with medical staff and other professionals, and care coordination. The evolving medical home concept and other health care delivery models reinforces the critical need for registered nurses to provide chronic disease management, care coordination, health risk appraisal, care transitions, health promotion, and disease prevention services. Recommendations are offered for organizational leaders, registered nurses, and AAACN to utilize nursing knowledge and skills in the pursuit of leading change and advancing health.

  19. Evaluating the use and limitations of the Danish National Patient Register in register-based research using an example of multiple sclerosis.

    Science.gov (United States)

    Mason, K; Thygesen, L C; Stenager, E; Brønnum-Hansen, H; Koch-Henriksen, N

    2012-03-01

    The Danish National Patient Register, Landspatientregistret (LPR), is a register of all hospital discharges and outpatient treatments in Denmark. It is increasingly used in research so it is important to understand to what extent this can be used as an accurate source of information. Virtually all patients in Denmark with multiple sclerosis (MS) are reported to the Combined MS Registry (DMSR), so this was used as the standard which the LPR was compared against. All residents of Denmark are assigned a unique Civil Register (CPR) number; this was used to compare data between registers. The LPR completeness was estimated by the proportion of cases from the DMSR that could be retrieved from the LPR. The LPR validity was estimated by the proportion of cases, listed in the LPR and DMSR, in whom the MS diagnosis could be confirmed as definite/probable/possible by the DMSR. We found that 86.9% of those who were DMSR listed with an approved MS diagnosis were also listed in the LPR with a MS diagnosis. The diagnosis was valid in 96.3% of patients listed in the LPR when compared against the DMSR. The low completeness reduces the usefulness of the LPR in epidemiological MS research, in particular incidence studies. The study also found that the completeness of the LPR could be increased to 92.8% by including LPR records from other departments in addition, but this reduced the validity of the LPR to 95.1%. However, these results cannot uncritically be applied to registration of other diseases in the LPR. © 2011 John Wiley & Sons A/S.

  20. Customer Perception of a Supermarket Nutrition Centre Staffed by a Registered Dietitian.

    Science.gov (United States)

    Evans, KATE; Taper, JANETTE; Quintal, DEBORAH

    2000-01-01

    The purpose of this study was to examine consumers' attitudes toward a supermarket nutrition centre staffed full time by a registered dietitian. A questionnaire was administered over three consecutive days in that store and in a control store that was similar to the experimental site in every way, except for the absence of a nutrition centre. Participants were chosen randomly at timed intervals in specific areas of the store. Of 428 customers approached, 232 agreed to participate in the survey. At the experimental site, 75% of the participants were extremely satisfied with the registered dietitian's services and 69% ranked having a registered dietitian on staff in any store as extremely important, compared to 31% at the control site (p importance of 13 required and optional services offered by the supermarkets, 15% of participants at the experimental site ranked having a registered dietitian on staff in the top five, compared with 4% at the control site (p service. There may therefore be an expanded role for registered dietitians in the supermarket setting.

  1. Job satisfaction of South African registered dietitians

    African Journals Online (AJOL)

    2012-01-25

    Jan 25, 2012 ... career growth,5,6,9 lack of respect from healthcare professionals,39 competition from ... a reminder was posted in the ADSA monthly newsletter, six weeks ..... research and conduct open interviews with registered dietitians or.

  2. National register of research projects

    Energy Technology Data Exchange (ETDEWEB)

    1985-03-01

    This Register is intended to serve as a source of information on research which is being conducted in all fields (both natural and human sciences) in the Republic of South Africa. New research projects commenced during 1983 or 1984, and significantly changed research projects, as well as project that were completed or terminated during this period, on which information was received by the compilers before December 1984, are included, with the exception of confidential projects.

  3. From nestling calls to fledgling silence: adaptive timing of change in response to aerial alarm calls.

    Science.gov (United States)

    Magrath, Robert D; Platzen, Dirk; Kondo, Junko

    2006-09-22

    Young birds and mammals are extremely vulnerable to predators and so should benefit from responding to parental alarm calls warning of danger. However, young often respond differently from adults. This difference may reflect: (i) an imperfect stage in the gradual development of adult behaviour or (ii) an adaptation to different vulnerability. Altricial birds provide an excellent model to test for adaptive changes with age in response to alarm calls, because fledglings are vulnerable to a different range of predators than nestlings. For example, a flying hawk is irrelevant to a nestling in a enclosed nest, but is dangerous to that individual once it has left the nest, so we predict that young develop a response to aerial alarm calls to coincide with fledging. Supporting our prediction, recently fledged white-browed scrubwrens, Sericornis frontalis, fell silent immediately after playback of their parents' aerial alarm call, whereas nestlings continued to calling despite hearing the playback. Young scrubwrens are therefore exquisitely adapted to the changing risks faced during development.

  4. A consumer register: an acceptable and cost-effective alternative for accessing patient populations

    Directory of Open Access Journals (Sweden)

    Jamie Bryant

    2016-10-01

    Full Text Available Abstract Background Population-based registries are increasingly used to recruit patient samples for research, however, they have several limitations including low consent and participation rates, and potential selection bias. To improve access to samples for research, the utility of a new model of recruitment termed the ‘Consumer Register’, that allows for direct patient recruitment from hospitals, was examined. This paper reports: (i consent rates onto the register; (ii preferred methods and frequency of contact; and (iii the feasibility of establishing the register, including: (a cost per person recruited to the register; (b the differential cost and consent rates of volunteer versus paid data collectors; and (c participant completion rates. Methods A cross-sectional survey was conducted in five outpatient clinics in Australia. Patients were approached by volunteers or paid data collectors and asked to complete a touch-screen electronic survey. Consenting individuals were asked to indicate their willingness and preferences for enrolment onto a research register. Descriptive statistics were used to examine patient preferences and linear regression used to model the success of volunteer versus paid data collectors. The opportunity and financial costs of establishing the register were calculated. Results A total of 1947 patients (80.6 % consented to complete the survey, of which, 1486 (76.3 % completed the questionnaire. Of the completers, the majority (69.4 %, or 1032 participants were willing to be listed on the register and preferred to be contacted by email (50.3 %. Almost 39 % of completers were willing to be contacted three or more times in a 12 month period. The annual opportunity cost of resources consumed by the register was valued at $37,187, giving an opportunity cost per person recruited to the register of $36. After amortising fixed costs, the annual financial outlay was $23,004 or $22 per person recruited to the

  5. Danish nationwide registers for public health and health-related research

    DEFF Research Database (Denmark)

    Erlangsen, Annette; Fedyszyn, Izabela

    2015-01-01

    AIMS: The Nordic countries have a strong tradition of using nationwide social and health registers for research purposes. The aim of the current paper is to provide an overview of the Danish population-based registers in public health and health-related research, and to discuss their strengths...... and limitations. METHODS: Danish registers on somatic and psychiatric hospital contacts as well as care provided by general practitioners were reviewed. The availability of demographic, individual-level variables of relevance for health-related research was summarized. RESULTS: Since 1968, every person living...... of prescribed medications, and a complete follow-up with respect to causes of death support public health studies surveying trends of prevalence and incidence. Historical data on psychiatric and somatic hospitalizations since 1969 and 1977, respectively, allow an in-depth assessment of the burden of disease...

  6. Staffing to Maximize Profit for Call Centers with Impatient and Repeat-Calling Customers

    Directory of Open Access Journals (Sweden)

    Jun Gong

    2015-01-01

    Full Text Available Motivated by call center practice, we study the optimal staffing of many-server queues with impatient and repeat-calling customers. A call center is modeled as an M/M/s+M queue, which is developed to a behavioral queuing model in which customers come and go based on their satisfaction with waiting time. We explicitly take into account customer repeat behavior, which implies that satisfied customers might return and have an impact on the arrival rate. Optimality is defined as the number of agents that maximize revenues net of staffing costs, and we account for the characteristic that revenues are a direct function of staffing. Finally, we use numerical experiments to make certain comparisons with traditional models that do not consider customer repeat behavior. Furthermore, we indicate how managers might allocate staffing optimally with various customer behavior mechanisms.

  7. EPA-Registered Repellents for Mosquitoes Transmitting Emerging Viral Disease.

    Science.gov (United States)

    Patel, Radha V; Shaeer, Kristy M; Patel, Pooja; Garmaza, Aleksey; Wiangkham, Kornwalee; Franks, Rachel B; Pane, Olivia; Carris, Nicholas W

    2016-12-01

    In many parts of the United States, mosquitoes were previously nuisance pests. However, they now represent a potential threat in the spread of viral diseases. The Aedes aegypti, Aedes albopictus, and Culex species mosquitoes are endemic to the United States and together may transmit a variety of viral diseases of growing concern, including West Nile virus, chikungunya, dengue fever, and Zika virus. The Centers for Disease Control and Prevention and the Environmental Protection Agency (EPA) recommend N,N-diethyl-meta-toluamide (DEET) as a first-line mosquito repellent, but for patients refusing to use DEET or other conventional repellents, guidance is limited to any EPA-registered product. Therefore, we conducted a systematic review of the literature to identify which EPA-registered personal mosquito repellent provides the best protection from A. aegypti, A. albopictus, and Culex spp. mosquitoes. We abstracted data from 62 published reports of EPA-registered mosquito repellents. The conventional repellent picaridin has the strongest data to support its use as a second-line agent, while IR3535 and oil of lemon eucalyptus are reasonably effective natural products. Citronella, catnip, and 2-undecanone offer limited protection or have limited data. These results can be used by pharmacists and other health care professionals to advise patients on the selection of an EPA-registered mosquito repellent. Regardless of the repellent chosen, it is vital for patients to follow all instructions/precautions in the product labeling to ensure safe and effective use. © 2016 Pharmacotherapy Publications, Inc.

  8. Short- and long-term risks of cardiovascular disease following radiotherapy in rectal cancer in four randomized controlled trials and a population-based register.

    Science.gov (United States)

    Chen, Lingjing; Eloranta, Sandra; Martling, Anna; Glimelius, Ingrid; Neovius, Martin; Glimelius, Bengt; Smedby, Karin E

    2018-03-01

    A population-based cohort and four randomized trials enriched with long-term register data were used to clarify if radiotherapy in combination with rectal cancer surgery is associated with increased risks of cardiovascular disease (CVD). We identified 14,901 rectal cancer patients diagnosed 1995-2009 in Swedish nationwide registers, of whom 9227 were treated with preoperative radiotherapy. Also, we investigated 2675 patients with rectal cancer previously randomized to preoperative radiotherapy or not followed by surgery in trials conducted 1980-1999. Risks of CVD overall and subtypes were estimated based on prospectively recorded hospital visits during relapse-free follow-up using multivariable Cox regression. Maximum follow-up was 18 and 33 years in the register and trials, respectively. We found no association between preoperative radiotherapy and overall CVD risk in the register (Incidence Rate Ratio, IRR = 0.99, 95% confidence interval (CI) 0.92-1.06) or in the pooled trials (IRR = 1.07, 95% CI 0.93-1.24). We noted an increased risk of venous thromboembolism among irradiated patients in both cohorts (IRR register  = 1.41, 95% CI 1.15-2.72; IRR trials  = 1.41, 95% CI 0.97-2.04), that remained during the first 6 months following surgery among patients treated 2006-2009, after the introduction of antithrombotic treatment (IRR 6 months  = 2.30, 95% CI 1.01-5.21). However, the absolute rate difference of venous thromboembolism attributed to RT was low (10 cases per 1000 patients and year). Preoperative radiotherapy did not affect rectal cancer patients' risk of CVD overall. Although an excess risk of short-term venous thromboembolism was noted, the small increase in absolute numbers does not call for general changes in routine prophylactic treatment, but might do so for patients already at high risk of venous thromboembolism. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Registered criminality and sanctioning of schizophrenia patients

    DEFF Research Database (Denmark)

    Munkner, Runa; Haastrup, Soeren; Joergensen, Torben

    2009-01-01

    BACKGROUND: Patients with schizophrenia have been shown to have an increased risk of criminality, especially violent crimes. AIMS: The aim of the current study was to describe the pattern of crimes committed by Danish patients with schizophrenia and examine the sanctions given for crimes...... in relation to the different periods in the patients' lives: not yet known to the psychiatric hospital system, known to the system but not yet diagnosed with schizophrenia, and after being diagnosed with schizophrenia. METHODS: Information from the Danish Psychiatric Central Research Register was correlated...... with data from the Danish National Crime Register. RESULTS: One of the more prominent findings was that 16% of patients diagnosed with schizophrenia receive a prison sentence or a suspended prison sentence, despite the fact that Denmark is a co-signatory of the European Prison Rules and should treat, rather...

  10. Registered nurse buddies: Educators by proxy?

    Science.gov (United States)

    Rebeiro, Geraldine; Evans, Alicia; Edward, Karen-Leigh; Chapman, Rose

    2017-08-01

    The informal clinical teaching role of the buddy nurse seems to be a uniquely Australian title, with little consistency in terminology for informal nurse educator roles internationally. Not all registered nurses are professionally developed for the informal role of facilitating the clinical learning of students in clinical settings, yet these roles are expected by nursing professional bodies. In Australia the registered nurses (RN) experience of being a buddy nurse has been reported as lacking clarity, being unsupported and structureless. Whist there is a plethora of literature published about formal RN educator roles, little is available on the informal buddy nurse role. A view of the buddy nurse role in reference to the limited but available literature in the Australian context is offered in this paper. International perspectives are also gathered describing informal clinical education RN's roles with similar responsibilities to the Australian buddy nurse. The significance of this dialogue is to ignite debate about the role, potentially informing policy for the improved support of the role within the Australian nursing landscape. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. 17 CFR 405.3 - Notification provisions for certain registered government securities brokers and dealers.

    Science.gov (United States)

    2010-04-01

    ... certain registered government securities brokers and dealers. 405.3 Section 405.3 Commodity and Securities... REPORTS AND AUDIT § 405.3 Notification provisions for certain registered government securities brokers and dealers. (a) Every registered government securities broker or dealer, other than a government securities...

  12. Time-to-event methodology improved statistical evaluation in register-based health services research.

    Science.gov (United States)

    Bluhmki, Tobias; Bramlage, Peter; Volk, Michael; Kaltheuner, Matthias; Danne, Thomas; Rathmann, Wolfgang; Beyersmann, Jan

    2017-02-01

    Complex longitudinal sampling and the observational structure of patient registers in health services research are associated with methodological challenges regarding data management and statistical evaluation. We exemplify common pitfalls and want to stimulate discussions on the design, development, and deployment of future longitudinal patient registers and register-based studies. For illustrative purposes, we use data from the prospective, observational, German DIabetes Versorgungs-Evaluation register. One aim was to explore predictors for the initiation of a basal insulin supported therapy in patients with type 2 diabetes initially prescribed to glucose-lowering drugs alone. Major challenges are missing mortality information, time-dependent outcomes, delayed study entries, different follow-up times, and competing events. We show that time-to-event methodology is a valuable tool for improved statistical evaluation of register data and should be preferred to simple case-control approaches. Patient registers provide rich data sources for health services research. Analyses are accompanied with the trade-off between data availability, clinical plausibility, and statistical feasibility. Cox' proportional hazards model allows for the evaluation of the outcome-specific hazards, but prediction of outcome probabilities is compromised by missing mortality information. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Swespine: the Swedish spine register : the 2012 report.

    Science.gov (United States)

    Strömqvist, Björn; Fritzell, Peter; Hägg, Olle; Jönsson, Bo; Sandén, Bengt

    2013-04-01

    Swespine, the Swedish National Spine Register, has existed for 20 years and is in general use within the country since over 10 years regarding degenerative lumbar spine disorders. Today there are protocols for registering all disorders of the entire spinal column. Patient-based pre- and postoperative questionnaires, completed before surgery and at 1, 2, 5 and 10 years postoperatively. Among patient-based data are VAS pain, ODI, SF-36 and EQ-5D. Postoperatively evaluation of leg and back pain as compared to preoperatively ("global assessment"), overall satisfaction with outcome and working conditions are registered in addition to the same parameters as preoperatively evaluation. A yearly report is produced including an analytic part of a certain topic, in this issue disc prosthesis surgery. More than 75,000 surgically treated patients are registered to date with an increasing number yearly. The present report includes 7,285 patients; 1-, 2- and 5-year follow-up data of previously operated patients are also included for lumbar disorders as well as for disc prosthesis surgery. For the degenerative lumbar spine disorders (disc herniation, spinal stenosis, spondylolisthesis and DDD) significant improvements are seen in all aspects as exemplified by pronounced improvement regarding EQ-5D and ODI. Results seem to be stable over time. Spinal stenosis is the most common indication for spine surgery. Disc prosthesis surgery yields results on a par with fusion surgery in disc degenerative pain. The utility of spine surgery is well documented by the results. Results of spine surgery as documented on a national basis can be utilized for quality assurance and quality improvement as well as for research purposes, documenting changes over time and bench marking when introducing new surgical techniques. A basis for international comparisons is also laid.

  14. State-Transition-Aware Spilling Heuristic for MLC STT-RAM-Based Registers

    Directory of Open Access Journals (Sweden)

    Yuanhui Ni

    2017-01-01

    Full Text Available Multilevel Cell Spin-Transfer Torque Random Access Memory (MLC STT-RAM is a promising nonvolatile memory technology to build registers for its natural immunity to electromagnetic radiation in rad-hard space environment. Unlike traditional SRAM-based registers, MLC STT-RAM exhibits unbalanced write state transitions due to the fact that the magnetization directions of hard and soft domains cannot be flipped independently. This feature leads to nonuniform costs of write states in terms of latency and energy. However, current SRAM-targeting register allocations do not have a clear understanding of the impact of the different write state-transition costs. As a result, those approaches heuristically select variables to be spilled without considering the spilling priority imposed by MLC STT-RAM. Aiming to address this limitation, this paper proposes a state-transition-aware spilling cost minimization (SSCM policy, to save power when MLC STT-RAM is employed in register design. Specifically, the spilling cost model is first constructed according to the linear combination of different state-transition frequencies. Directed by the proposed cost model, the compiler picks up spilling candidates to achieve lower power and higher performance. Experimental results show that the proposed SSCM technique can save energy by 19.4% and improve the lifetime by 23.2% of MLC STT-RAM-based register design.

  15. 20 CFR 655.1116 - Element VI-What notification must facilities provide to registered nurses?

    Science.gov (United States)

    2010-04-01

    ... provide to registered nurses? 655.1116 Section 655.1116 Employees' Benefits EMPLOYMENT AND TRAINING... Requirements Must a Facility Meet to Employ H-1C Nonimmigrant Workers as Registered Nurses? § 655.1116 Element VI—What notification must facilities provide to registered nurses? (a) The sixth attestation element...

  16. Registered manufacturers of renewable energy devices

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    Registered manufacturers of renewable energy devices in India are listed. The list is arranged under the headings : solar water heating system, solar cooker, solar still and water pumping wind mill. In all 38 manufacturers are listed. The list gives the postal address, name of the contact person and phone number of each manufacturer. (M.G.B.)

  17. Peafowl antipredator calls encode information about signalers.

    Science.gov (United States)

    Yorzinski, Jessica L

    2014-02-01

    Animals emit vocalizations that convey information about external events. Many of these vocalizations, including those emitted in response to predators, also encode information about the individual that produced the call. The relationship between acoustic features of antipredator calls and information relating to signalers (including sex, identity, body size, and social rank) were examined in peafowl (Pavo cristatus). The "bu-girk" antipredator calls of male and female peafowl were recorded and 20 acoustic parameters were automatically extracted from each call. Both the bu and girk elements of the antipredator call were individually distinctive and calls were classified to the correct signaler with over 90% and 70% accuracy in females and males, respectively. Females produced calls with a higher fundamental frequency (F0) than males. In both females and males, body size was negatively correlated with F0. In addition, peahen rank was related to the duration, end mean frequency, and start harmonicity of the bu element. Peafowl antipredator calls contain detailed information about the signaler and can potentially be used by receivers to respond to dangerous situations.

  18. Mobile applications of photovoltaic planar antennas - SOLPLANT {sup registered}; Mobile Anwendungen von Solaren Planarantennen - SOLPLANT {sup registered}

    Energy Technology Data Exchange (ETDEWEB)

    Bendel, C.; Kirchhof, J. [Institut fuer Solare Energieversorgungstechnik (ISET), Kassel (Germany); Henze, N. [Kassel Univ. (Gesamthochschule) (Germany). Fachgebiet Hochfrequenztechnik

    2005-07-01

    This paper describes the application of photovoltaic (PV) Solar Planar Antennas in mobile applications. The radiating patch element of a planar antenna is replaced by a solar cell. Furthermore radiating slots can be built due to the cell spacing in a solar cell array. The original feature of a solar cell (DC current generation) remains, but additionally the solar cell is now able to receive and transmit electromagnetic waves. Both single solar cells as well as solar cell arrays can be used as antennas. This new approach, the ''Solar Planar Antenna - SOLPLANT {sup registered} '', avoids disadvantages of conventional applications, when solar cells and antennas are used in combination. Based on these considerations, a product development concept was originated at whose basic idea has been registered as a patent in Germany, Europe, Japan and USA. Four applications are presented: a solar cell GPS antenna for vehicular applications, a solar cell slot antenna for mobile communications (GSM), an environmental metering station with GSM function and a Worldspace Satellite Radio, equipped with a SOLPLANT {sup registered} antenna. The aim of the first two products is to integrate these antennas into vehicular glass roofs which are covered with photovoltaic solar cells in order to deliver the electric power for the indoor ventilation of the car. The GPS antenna provides circular polarisation and a main lobe in zenith direction whereas the GSM antenna is vertically polarized and has a monopole-like radiation pattern. Both antennas are built up with commonly used solar cells. The comparison of measured and simulated antenna properties shows a good agreement. At last, some applications on high altitude platforms for wireless communication services and remote sensing are depicted. (ORIG.)

  19. BUFO PARDALIS (ANURA: BUFONIDAE): MATING CALL AND ...

    African Journals Online (AJOL)

    the calls of one of these species, Bufo pardalis. Hewitt, were not analysed by Tandy & Keith. (1972). Furthennore there is some confusion in the literature regarding the mating call of this species. For these reasons this mating call is here clarified. The mating call of B. pardaiis was first described by Ranger (in Hewitt 1935) as ...

  20. Impact of mobility on call block, call drops and optimal cell size in small cell networks

    OpenAIRE

    Ramanath , Sreenath; Voleti , Veeraruna Kavitha; Altman , Eitan

    2011-01-01

    We consider small cell networks and study the impact of user mobility. Assuming Poisson call arrivals at random positions with random velocities, we discuss the characterization of handovers at the boundaries. We derive explicit expressions for call block and call drop probabilities using tools from spatial queuing theory. We also derive expressions for the average virtual server held up time. These expressions are used to derive optimal cell sizes for various profile of velocities in small c...

  1. EVOLUTION {sup registered} BLUE. Designed for the needs of tomorrow; EVOLUTION {sup registered} BLUE. Entwickelt fuer die Anforderungen von morgen

    Energy Technology Data Exchange (ETDEWEB)

    Blessing, Carsten [ThyssenKrupp Aufzugswerke GmbH, Neuhausen (Germany). Product Service; Dangerfield, Nicola [ThyssenKrupp Aufzuege GmbH, Stuttgart (Germany). Sales Support/Marketing Communication

    2013-11-01

    The future needs innovation. The new elevator design concept EVOLUTION {sup registered} BLUE sets new standards for flexibility, shaft efficiency, energy saving and design. It uses materials of the highest quality. (orig.)

  2. The reliability of perinatal and neonatal mortality rates: Differential under-reporting in linked professional registers vs. Dutch civil registers

    NARCIS (Netherlands)

    Anthony, S.; Pal-de Bruin, K.M. van der; Graafmans, W.C.; Dorrepaal, C.A.; Borkent-Polet, M.; Hemel, O.J.S. van; Jansen, F.H.M.; Lya Ouden, A. den

    2001-01-01

    Official Dutch perinatal mortality rates are based on birth and death certificates. These civil registration data are not detailed enough for international comparisons or extensive epidemiological research. In this study, we linked and extrapolated three national incomplete, professional registers

  3. 17 CFR 270.17f-2 - Custody of investments by registered management investment company.

    Science.gov (United States)

    2010-04-01

    ... registered management investment company. 270.17f-2 Section 270.17f-2 Commodity and Securities Exchanges....17f-2 Custody of investments by registered management investment company. (a) The securities and similar investments of a registered management investment company may be maintained in the custody of such...

  4. Career Motivation in Newly Licensed Registered Nurses: What Makes Them Remain

    Science.gov (United States)

    Banks, Zarata Mann; Bailey, Jessica H.

    2010-01-01

    Despite vast research on newly licensed registered nurses (RNs), we don't know why some newly licensed registered nurses remain in their current jobs and others leave the nursing profession early in their career. Job satisfaction, the most significant factor emerging from the literature, plays a significant role in nurses' decisions to remain in…

  5. Registered nurses' attention to and perceptions of pressure ulcer prevention in hospital settings.

    Science.gov (United States)

    Sving, Eva; Gunningberg, Lena; Högman, Marieann; Mamhidir, Anna-Greta

    2012-05-01

    To describe how registered nurses perform, document and reflect on pressure ulcer prevention in a specific nurse-patient care situation, as well as generally, on hospital wards. Registered nurses should provide safe and qualified pressure ulcer prevention, but pressure ulcers remain a problem. Compliance with evidence-based guidelines impedes pressure ulcer formation. A descriptive design with a multimethods approach. Nine registered nurses at three wards and hospitals participated. The registered nurses were observed in a specific nurse-patient care situation with patients at risk for pressure ulcers. Interviews followed and patients' records were reviewed. Quantitative and qualitative data analysis methods were used. Pressure ulcer prevention performed by the registered nurses was dependent on the cultural care, which ranged from planned to unplanned prevention. Diversity was found in compliance with evidence-based guidelines across the wards. Although all patients involved were at risk and the nurses described pressure ulcer prevention as basic care, the nurses' attention to prevention was lacking. Few prevention activities and no structured risk assessments using risk assessment tools were observed, and few care plans were identified. The lack of attention was explained by registered nurses' trust in assistant nurses' knowledge, and prevention was seen as an assistant nurse task. Registered nurses paid little attention to pressure ulcer prevention among patients at risk. The planned and unplanned care structures affected the prevention. The nurses trusted and largely delegated their responsibility to the assistant nurses. Evidence-based pressure ulcer prevention is fundamental to patient safety. Care quality is created in situations where patients and care providers meet. How registered nurses work with pressure ulcer prevention, their role and communication, particularly with assistant nurses, should be of major concern to them as well as to healthcare

  6. Enhancing resilience in registered aged care nurses.

    Science.gov (United States)

    Cameron, Fiona; Brownie, Sonya

    2010-06-01

    To identify the factors that impact the resilience of registered aged care nurses, that is their capacity to adapt to the physical, mental and emotional demands of working in aged care facilities. This study explored the lived experience of nine registered nurses working in residential aged care facilities on the Sunshine Coast, Queensland, who were asked to reflect on the phenomenon of resilience in the workplace. This study found that clinical expertise, a sense of purpose in a holistic care environment, a positive attitude and work-life balance are important determinants of resilience in aged care nurses. Resilience in nurses in residential aged care facilities is enhanced when they are able to maintain long-term, meaningful relationships with residents. Collegial support that provides opportunities to debrief and validate experiences as well as the use of humour to defuse stress promotes well-being and builds resilience in the workplace.

  7. External GSM phone calls now made simpler

    CERN Multimedia

    2007-01-01

    On 2 July, the IT/CS Telecom Service introduced a new service making external calls from CERN GSM phones easier. A specific prefix is no longer needed for calls outside CERN. External calls from CERN GSM phones are to be simplified. It is no longer necessary to use a special prefix to call an external number from the CERN GSM network.The Telecom Section of the IT/CS Group is introducing a new system that will make life easier for GSM users. It is no longer necessary to use a special prefix (333) to call an external number from the CERN GSM network. Simply dial the number directly like any other Swiss GSM customer. CERN currently has its own private GSM network with the Swiss mobile operator, Sunrise, covering the whole of Switzerland. This network was initially intended exclusively for calls between CERN numbers (replacing the old beeper system). A special system was later introduced for external calls, allowing them to pass thr...

  8. Emotional intelligence levels in baccalaureate-prepared early career registered nurses.

    Science.gov (United States)

    Reemts, Glenda S

    2015-01-01

    The increasing complexity of the healthcare environment calls for increasing emotional intelligence (EI) competence in nurses. This study assessed the EI competence of 164 baccalaureate nursing alumni who graduated during the years 2007-2010 from three Benedictine institutions located in the Midwestern United States to see if there was growth of EI with experience as a registered nurse (RN), and to determine if age, gender, grade point average (GPA), and years of total healthcare work experience prior to graduation predicted EI. Participants completed the web-based Mayer-Salovey-Caruso Emotional Intelligence Test (MSCEIT) and a demographic survey. Findings indicated 79.4% of participants were competent or higher on the MSCEIT total EI score. Percentages of nurses scoring in the competent or higher range on each of the four branch scores of perceiving, using, understanding and managing emotions were 80.6%, 72.7%, 84.2%, and 84.9% respectively. There were no significant differences on EI scores between graduates with 1-2 years compared to 3-5 years of experience as a RN. Results of a linear stepwise regression indicated being female was a significant predictor on the MSCEIT total EI score ( P = 0.015) and using emotions branch ( P = 0.047). Findings also indicated GPA ( P nursing graduates. Continued research on the topic of EI and nursing is needed to build the knowledge base on how to promote positive patient outcomes.

  9. Mobile phones, cordless phones and rates of brain tumors in different age groups in the Swedish National Inpatient Register and the Swedish Cancer Register during 1998-2015.

    Directory of Open Access Journals (Sweden)

    Lennart Hardell

    Full Text Available We used the Swedish Inpatient Register (IPR to analyze rates of brain tumors of unknown type (D43 during 1998-2015. Average Annual Percentage Change (AAPC per 100,000 increased with +2.06%, 95% confidence interval (CI +1.27, +2.86% in both genders combined. A joinpoint was found in 2007 with Annual Percentage Change (APC 1998-2007 of +0.16%, 95% CI -0.94, +1.28%, and 2007-2015 of +4.24%, 95% CI +2.87, +5.63%. Highest AAPC was found in the age group 20-39 years. In the Swedish Cancer Register the age-standardized incidence rate per 100,000 increased for brain tumors, ICD-code 193.0, during 1998-2015 with AAPC in men +0.49%, 95% CI +0.05, +0.94%, and in women +0.33%, 95% CI -0.29, +0.45%. The cases with brain tumor of unknown type lack morphological examination. Brain tumor diagnosis was based on cytology/histopathology in 83% for men and in 87% for women in 1980. This frequency increased to 90% in men and 88% in women in 2015. During the same time period CT and MRI imaging techniques were introduced and morphology is not always necessary for diagnosis. If all brain tumors based on clinical diagnosis with CT or MRI had been reported to the Cancer Register the frequency of diagnoses based on cytology/histology would have decreased in the register. The results indicate underreporting of brain tumor cases to the Cancer Register. The real incidence would be higher. Thus, incidence trends based on the Cancer Register should be used with caution. Use of wireless phones should be considered in relation to the change of incidence rates.

  10. Verbal episodic memory in 426 multiple sclerosis patients: impairment in encoding, retrieval or both?

    Science.gov (United States)

    Brissart, H; Morele, E; Baumann, C; Debouverie, M

    2012-10-01

    Episodic memory is frequently impaired in multiple sclerosis (MS) patients but the exact nature of the disorder is controversial. It was initially thought to be due to a retrieval deficit but some studies have demonstrated an encoding deficit, which could be linked to a slowing of information processing speed or to a deficit in elaboration of strategies. The main objective of this study is to assess the prevalence and the nature of verbal episodic memory (VEM) impairment in MS patients. We retrieved memory performances of 426 patients [314 F-112 M; mean age: 46.1 years; median Expanded Disability Status Scale (EDSS) score: 3.1] from a neuropsychological data base. VEM was assessed using the 16 words RL-RI 16 test. 66% MS patients present at least one recall impaired in VEM (37.2% from 2 to 5 recall). 14.2% MS patients present an impairment in encoding phase. We observed that 5% of patients presented recognition difficulties. Correlations were observed between VEM performances and EDSS, and disease duration but no group effect (ANOVA) is observed between form of MS and VEM performances. These results confirm the high prevalence of VEM impairment in MS patients. Deficits affect mainly information retrieval in early stage MS patients and are then linked to encoding as disability increases. Storage disorders are infrequent, so cognitive rehabilitation with mental imaging could be effective in MS patients.

  11. Sharing programming resources between Bio* projects through remote procedure call and native call stack strategies.

    Science.gov (United States)

    Prins, Pjotr; Goto, Naohisa; Yates, Andrew; Gautier, Laurent; Willis, Scooter; Fields, Christopher; Katayama, Toshiaki

    2012-01-01

    Open-source software (OSS) encourages computer programmers to reuse software components written by others. In evolutionary bioinformatics, OSS comes in a broad range of programming languages, including C/C++, Perl, Python, Ruby, Java, and R. To avoid writing the same functionality multiple times for different languages, it is possible to share components by bridging computer languages and Bio* projects, such as BioPerl, Biopython, BioRuby, BioJava, and R/Bioconductor. In this chapter, we compare the two principal approaches for sharing software between different programming languages: either by remote procedure call (RPC) or by sharing a local call stack. RPC provides a language-independent protocol over a network interface; examples are RSOAP and Rserve. The local call stack provides a between-language mapping not over the network interface, but directly in computer memory; examples are R bindings, RPy, and languages sharing the Java Virtual Machine stack. This functionality provides strategies for sharing of software between Bio* projects, which can be exploited more often. Here, we present cross-language examples for sequence translation, and measure throughput of the different options. We compare calling into R through native R, RSOAP, Rserve, and RPy interfaces, with the performance of native BioPerl, Biopython, BioJava, and BioRuby implementations, and with call stack bindings to BioJava and the European Molecular Biology Open Software Suite. In general, call stack approaches outperform native Bio* implementations and these, in turn, outperform RPC-based approaches. To test and compare strategies, we provide a downloadable BioNode image with all examples, tools, and libraries included. The BioNode image can be run on VirtualBox-supported operating systems, including Windows, OSX, and Linux.

  12. Call Duration Characteristics based on Customers Location

    Directory of Open Access Journals (Sweden)

    Žvinys Karolis

    2014-05-01

    Full Text Available Nowadays a lot of different researches are performed based on call duration distributions (CDD analysis. However, the majority of studies are linked with social relationships between the people. Therefore the scarcity of information, how the call duration is associated with a user's location, is appreciable. The goal of this paper is to reveal the ties between user's voice call duration and the location of call. For this reason we analyzed more than 5 million calls from real mobile network, which were made over the base stations located in rural areas, roads, small towns, business and entertainment centers, residential districts. According to these site types CDD’s and characteristic features for call durations are given and discussed. Submitted analysis presents the users habits and behavior as a group (not an individual. The research showed that CDD’s of customers being them in different locations are not equal. It has been found that users at entertainment, business centers are tend to talk much shortly, than people being at home. Even more CDD can be distorted strongly, when machinery calls are evaluated. Hence to apply a common CDD for a whole network it is not recommended. The study also deals with specific parameters of call duration for distinguished user groups, the influence of network technology for call duration is considered.

  13. The Austrian breast implant register: recent trends in implant-based breast surgery.

    Science.gov (United States)

    Wurzer, Paul; Rappl, Thomas; Friedl, Herwig; Kamolz, Lars-Peter; Spendel, Stephan; Hoflehner, Helmut; Parvizi, Daryousch

    2014-12-01

    Due to the fact that the number of breast implant surgeries for cosmetic and medical purposes is rising yearly, a discussion about the quality of service for both patients and physicians is more important than ever. To this end, we reviewed the Austrian Breast Implant Register with one specific question in mind: What are the trends? In the statistical analysis of the Austrian Breast Implant Register, we were able to identify 13,112 registered breast implants between 2004 and 2012. The whole dataset was then divided into medical and cosmetic groups. We focused on device size, surface characteristics, filling material, device placement and incision site. All factors were considered for all examined years. In summary, the most used device had a textured surface (97 %) and silicone gel as the filling material (93 %). The mean size of implants for the cosmetic group was 240 cc, placement was submuscular (58 %) and the incision site was inframammary (67 %). In the medical group, the mean size was 250 cc. Yearly registrations had their peak in 2008 (1,898 registered devices); from this year on, registrations decreased annually. A slight trend away from subglandular placement in the cosmetic group was noted. Also, the usage of implants with polyurethane surface characteristics has increased since 2008. The smooth surface implants had a peak usage in 2006 and their usage decreased steadily from then on whereas the textured surface was steady over the years. Keeping the problems related to the quality of breast implants in mind, we could recommend an obligatory national register. Organisations of surgeons and governments should develop and establish these registers. Furthermore, an all-encompassing international register should be established by the European Union and the American FDA (Food and Drug Administration); this might be useful in comparing the individual country registers and also would help in delivering "evidence based" medicine in cosmetic and medical procedures

  14. VISUALIZATION OF REGISTERED SUBSURFACE ANATOMY

    DEFF Research Database (Denmark)

    2010-01-01

    A system and method for visualization of subsurface anatomy includes obtaining a first image from a first camera and a second image from a second camera or a second channel of the first camera, where the first and second images contain shared anatomical structures. The second camera and the secon....... A visual interface displays the registered visualization of the first and second images. The system and method are particularly useful for imaging during minimally invasive surgery, such as robotic surgery....

  15. Nurses On-Line: Career Mobility for Registered Nurses.

    Science.gov (United States)

    O'Brien, Barbara S.; Renner, Alice

    2000-01-01

    Describes how adult learning theory was used to restructure registered nurse courses for online instruction. Hardware/software needs, technical support, instructional model, teaching-learning considerations, and evaluation are discussed. (SK)

  16. PROBLEMS OF THE BURIAL REGISTERS IN TURKEY: A QUALITATIVE STUDY ON MATERNAL MORTALITY

    OpenAIRE

    ERGÖÇMEN, Banu Akadlı; YÜKSEL, İlknur

    2006-01-01

    In this article deficiencies of the burial registers in Turkey are discussed with specificemphasis on maternal mortality. The analysis is based on the qualitative data of “Turkey NationalMaternal Mortality Study, 2005”. This article aims to understand the reasons behind thedeficiencies in reporting and registering of the maternal deaths through interviews conducted withthe officers in charge of the burial registers in urban and rural settlements as well as the personsresponsible in recording ...

  17. Danish Register of chronic obstructive pulmonary disease

    DEFF Research Database (Denmark)

    Lange, Peter; Tøttenborg, Sandra Søgaard; Sorknæs, Anne Dichmann

    2016-01-01

    AIM OF DATABASE: The Danish Register of Chronic Obstructive Pulmonary Disease (DrCOPD) is a nationwide database aiming to describe the quality of treatment of all patients with chronic obstructive pulmonary disease (COPD) in Denmark. STUDY POPULATION: DrCOPD comprises data on all patients...

  18. Register-based studies of cancer screening effects

    DEFF Research Database (Denmark)

    Von Euler-Chelpin, My; Lynge, Elsebeth; Rebolj, Matejka

    2011-01-01

    INTRODUCTION: There are two organised cancer screening programmes in Denmark, against cervical and breast cancers. The aim with this study was to give an overview of the available register-based research regarding these two programmes, to demonstrate the usefulness of data from the national regis...

  19. Machine Directional Register System Modeling for Shaft-Less Drive Gravure Printing Machines

    Directory of Open Access Journals (Sweden)

    Shanhui Liu

    2013-01-01

    Full Text Available In the latest type of gravure printing machines referred to as the shaft-less drive system, each gravure printing roller is driven by an individual servo motor, and all motors are electrically synchronized. The register error is regulated by a speed difference between the adjacent printing rollers. In order to improve the control accuracy of register system, an accurate mathematical model of the register system should be investigated for the latest machines. Therefore, the mathematical model of the machine directional register (MDR system is studied for the multicolor gravure printing machines in this paper. According to the definition of the MDR error, the model is derived, and then it is validated by the numerical simulation and experiments carried out in the experimental setup of the four-color gravure printing machines. The results show that the established MDR system model is accurate and reliable.

  20. From challenges to advanced practice registered nursing role development: Qualitative interview study.

    Science.gov (United States)

    Jokiniemi, Krista; Haatainen, Kaisa; Pietilä, Anna-Maija

    2015-12-01

    The aim of this study is to describe the factors hindering and facilitating the implementation of the advanced practice registered nurses role at Finnish university hospitals, and to examine the implications for its future development. A descriptive qualitative approach, using thematic individual interviews, was conducted in 2011 with a sample of 11 advanced practice registered nurses. The data were analysed using qualitative content analysis. The advanced practice registered nurses role barriers had an impact on the role development needs. In turn, the facilitating factors helped encounter the challenges of the role, therefore having an impact on both the current role achievement, as well as contributing to the future role development. The factors hindering and facilitating the advanced practice registered nurses role need to be acknowledged to support the role implementation and planning of the future of the role. © 2014 Wiley Publishing Asia Pty Ltd.

  1. Active site loop conformation regulates promiscuous activity in a lactonase from Geobacillus kaustophilus HTA426.

    Directory of Open Access Journals (Sweden)

    Yu Zhang

    Full Text Available Enzyme promiscuity is a prerequisite for fast divergent evolution of biocatalysts. A phosphotriesterase-like lactonase (PLL from Geobacillus kaustophilus HTA426 (GkaP exhibits main lactonase and promiscuous phosphotriesterase activities. To understand its catalytic and evolutionary mechanisms, we investigated a "hot spot" in the active site by saturation mutagenesis as well as X-ray crystallographic analyses. We found that position 99 in the active site was involved in substrate discrimination. One mutant, Y99L, exhibited 11-fold improvement over wild-type in reactivity (kcat/Km toward the phosphotriesterase substrate ethyl-paraoxon, but showed 15-fold decrease toward the lactonase substrate δ-decanolactone, resulting in a 157-fold inversion of the substrate specificity. Structural analysis of Y99L revealed that the mutation causes a ∼6.6 Å outward shift of adjacent loop 7, which may cause increased flexibility of the active site and facilitate accommodation and/or catalysis of organophosphate substrate. This study provides for the PLL family an example of how the evolutionary route from promiscuity to specificity can derive from very few mutations, which promotes alteration in the conformational adjustment of the active site loops, in turn draws the capacity of substrate binding and activity.

  2. Pulsed laser deposition of antimicrobial silver coating on Ormocer (registered) microneedles

    Energy Technology Data Exchange (ETDEWEB)

    Gittard, S D; Narayan, R J; Jin, C; Monteiro-Riviere, N A [Joint Department of Biomedical Engineering, North Carolina State University, Raleigh, NC 27695 (United States); Ovsianikov, A; Chichkov, B N [Laser Zentrum Hannover, Hollerithallee 8, 30419 Hannover (Germany); Stafslien, S; Chisholm, B, E-mail: roger_narayan@msn.co [Center for Nanoscale Science and Engineering, North Dakota State University, 1805 Research Park Drive, Fargo, ND 58102 (United States)

    2009-12-15

    One promising option for transdermal delivery of protein- and nucleic acid-based pharmacologic agents involves the use of microneedles. However, microneedle-generated pores may allow microorganisms to penetrate the stratum corneum layer of the epidermis and cause local or systemic infection. In this study, microneedles with antimicrobial functionality were fabricated using two-photon polymerization-micromolding and pulsed laser deposition. The antibacterial activity of the silver-coated organically modified ceramic (Ormocer (registered) ) microneedles was demonstrated using an agar diffusion assay. Human epidermal keratinocyte viability on the Ormocer (registered) surfaces coated with silver was similar to that on uncoated Ormocer (registered) surfaces. This study indicates that coating microneedles with silver thin films using pulsed laser deposition is a useful and novel approach for creating microneedles with antimicrobial functionality. (communication)

  3. Pulsed laser deposition of antimicrobial silver coating on Ormocer (registered) microneedles

    International Nuclear Information System (INIS)

    Gittard, S D; Narayan, R J; Jin, C; Monteiro-Riviere, N A; Ovsianikov, A; Chichkov, B N; Stafslien, S; Chisholm, B

    2009-01-01

    One promising option for transdermal delivery of protein- and nucleic acid-based pharmacologic agents involves the use of microneedles. However, microneedle-generated pores may allow microorganisms to penetrate the stratum corneum layer of the epidermis and cause local or systemic infection. In this study, microneedles with antimicrobial functionality were fabricated using two-photon polymerization-micromolding and pulsed laser deposition. The antibacterial activity of the silver-coated organically modified ceramic (Ormocer (registered) ) microneedles was demonstrated using an agar diffusion assay. Human epidermal keratinocyte viability on the Ormocer (registered) surfaces coated with silver was similar to that on uncoated Ormocer (registered) surfaces. This study indicates that coating microneedles with silver thin films using pulsed laser deposition is a useful and novel approach for creating microneedles with antimicrobial functionality. (communication)

  4. Decoherence in large NMR quantum registers

    International Nuclear Information System (INIS)

    Krojanski, Hans Georg; Suter, Dieter

    2006-01-01

    Decoherence causes the decay of the quantum information that is stored in highly correlated states during quantum computation. It is thus a limiting factor for all implementations of a quantum computer. Because a scalable quantum computer with hundreds or thousands of qubits is not available yet, experimental data about decoherence rates was restricted to small quantum registers. With solid state nuclear magnetic resonance we create highly correlated multiqubit states that serve as a model quantum register and measure their decay. By measuring the decay as a function of the system size, we determined the scaling of the decoherence rate with the number of qubits. Using the same system, we also used decoupling techniques to reduce the coupling between system and environment and thereby the decoherence rate by more than an order of magnitude, independent of the system size. For the free decay as well as for the decoupled case, we found a relatively weak scaling with system size, which could be fitted to a power law ∝K p with an exponent p≅1/2. This raises the prospect for large-scale quantum computation

  5. Assessment of Veterinary Pharmaceutical Products Registered in ...

    African Journals Online (AJOL)

    Topical, intramammary, intrauterine and ophthalmic routes accounted for 4.7%, 3.3%, 1.0% and 0.1% of the registered products respectively. ... Dosage forms for oral administration included solids (53.4%) namely powders, tablets, boluses, freeze dried products, granules; liquids (46.3%) namely suspensions, solutions, ...

  6. Care and Calls

    DEFF Research Database (Denmark)

    Paasch, Bettina Sletten

    on the enactment of care but also on patient safety. Nurses working in various hospital departments have developed different strategies for handling mobile phone calls when with a patient. Additional research into the ways nurses successfully or unsuccessfully enact care and ensure patient safety when they answer......In Danish hospitals, nurses have been equipped with a mobile work phone to improve their availability and efficiency. On the phones nurses receive internal and external phone conversations, patient calls, and alarms from electronic surveillance equipment. For safety reasons the phones cannot...... be switched off or silenced; they consequently ring during all activities and also during interactions with patients. A possible tension thus arises when nurses have to be both caring and sensitive towards the patient and simultaneously be efficient and available and answer their phone. The present paper...

  7. Calling under pressure: short-finned pilot whales make social calls during deep foraging dives.

    Science.gov (United States)

    Jensen, Frants H; Perez, Jacobo Marrero; Johnson, Mark; Soto, Natacha Aguilar; Madsen, Peter T

    2011-10-22

    Toothed whales rely on sound to echolocate prey and communicate with conspecifics, but little is known about how extreme pressure affects pneumatic sound production in deep-diving species with a limited air supply. The short-finned pilot whale (Globicephala macrorhynchus) is a highly social species among the deep-diving toothed whales, in which individuals socialize at the surface but leave their social group in pursuit of prey at depths of up to 1000 m. To investigate if these animals communicate acoustically at depth and test whether hydrostatic pressure affects communication signals, acoustic DTAGs logging sound, depth and orientation were attached to 12 pilot whales. Tagged whales produced tonal calls during deep foraging dives at depths of up to 800 m. Mean call output and duration decreased with depth despite the increased distance to conspecifics at the surface. This shows that the energy content of calls is lower at depths where lungs are collapsed and where the air volume available for sound generation is limited by ambient pressure. Frequency content was unaffected, providing a possible cue for group or species identification of diving whales. Social calls may be important to maintain social ties for foraging animals, but may be impacted adversely by vessel noise.

  8. Do market participants learn from conference calls?

    NARCIS (Netherlands)

    Roelofsen, E.; Verbeeten, F.; Mertens, G.

    2014-01-01

    We examine whether market participants learn from the information that is disseminated during the Q-and-A section of conference calls. Specifically, we investigate whether stock prices react to information on intangible assets provided during conference calls, and whether conference calls

  9. ALMA view of RX J1131-1231: Sub-kpc CO (2-1) mapping of a molecular disk in a lensed star-forming quasar host galaxy

    Science.gov (United States)

    Paraficz, D.; Rybak, M.; McKean, J. P.; Vegetti, S.; Sluse, D.; Courbin, F.; Stacey, H. R.; Suyu, S. H.; Dessauges-Zavadsky, M.; Fassnacht, C. D.; Koopmans, L. V. E.

    2018-05-01

    We present ALMA 2-mm continuum and CO (2-1) spectral line imaging of the gravitationally lensed z = 0.654 star-forming/quasar composite RX J1131-1231 at 240-400 mas angular resolution. The continuum emission is found to be compact and coincident with the optical emission, whereas the molecular gas forms a complete Einstein ring, which shows strong differential magnification. The de-lensed source structure is determined on 400-parsec-scales resolution using a Bayesian pixelated visibility-fitting lens modelling technique. The reconstructed molecular gas velocity-field is consistent with a large rotating disk with a major-axis FWHM 9.4 kpc at an inclination angle of i = 54° and with a maximum rotational velocity of 280 km s-1. From dynamical model fitting we find an enclosed mass within 5 kpc of M(r conversion factor of α = 5.5 ± 2.0 M⊙ (K km s-1 pc2)-1. This suggests that the star-formation efficiency is dependent on the host galaxy morphology as opposed to the nature of the AGN. The far-infrared continuum spectral energy distribution shows evidence for heated dust, equivalent to an obscured star-formation rate of SFR = 69-25+41 × (7.3/μIR) M⊙ yr-1, which demonstrates the composite star-forming and AGN nature of this system.

  10. Implementing conventional logic unconventionally: photochromic molecular populations as registers and logic gates.

    Science.gov (United States)

    Chaplin, J C; Russell, N A; Krasnogor, N

    2012-07-01

    In this paper we detail experimental methods to implement registers, logic gates and logic circuits using populations of photochromic molecules exposed to sequences of light pulses. Photochromic molecules are molecules with two or more stable states that can be switched reversibly between states by illuminating with appropriate wavelengths of radiation. Registers are implemented by using the concentration of molecules in each state in a given sample to represent an integer value. The register's value can then be read using the intensity of a fluorescence signal from the sample. Logic gates have been implemented using a register with inputs in the form of light pulses to implement 1-input/1-output and 2-input/1-output logic gates. A proof of concept logic circuit is also demonstrated; coupled with the software workflow describe the transition from a circuit design to the corresponding sequence of light pulses. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  11. HOW TO CALL THE CERN FIRE BRIGADE

    CERN Multimedia

    2002-01-01

    The telephone numbers of the CERN Fire Brigade are: 74444 for emergency calls 74848 for other calls Note The number 112 will stay in use for emergency calls from 'wired' telephones, however, from mobile phones it leads to non-CERN emergency services.  

  12. HOW TO CALL THE CERN FIRE BRIGADE

    CERN Multimedia

    2002-01-01

    The telephone numbers of the CERN Fire Brigade are: 74444 for emergency calls 74848 for other calls Note The number 112 will stay in use for emergency calls from 'wired' telephones, however, from mobile phones it leads to non-CERN emergency services.

  13. HOW TO CALL THE CERN FIRE BRIGADE

    CERN Multimedia

    2001-01-01

    The telephone numbers of the CERN Fire Brigade are: 74444 for emergency calls 74848 for other calls Note The number 112 will stay in use for emergency calls from 'wired' telephones, however, from mobile phones it leads to non-CERN emergency services.

  14. HOW TO CALL THE CERN FIRE BRIGADE

    CERN Multimedia

    2001-01-01

    The telephone numbers of the CERN Fire Brigade are: 74444 for emergency calls 74848 for other calls Note: the number 112 will stay in use for emergency calls from 'wired' telephones, however, from mobile phones it leads to non-CERN emergency services.

  15. 17 CFR 210.3-18 - Special provisions as to registered management investment companies and companies required to be...

    Science.gov (United States)

    2010-04-01

    ... registered management investment companies and companies required to be registered as management investment... Financial Statements § 210.3-18 Special provisions as to registered management investment companies and companies required to be registered as management investment companies. (a) For filings by registered...

  16. Register Variation in Electronic Business Correspondence

    Directory of Open Access Journals (Sweden)

    Rosa Giménez Moreno

    2011-06-01

    Full Text Available Electronic correspondence is a highly dynamic genre within the business world in which Register Variation (RV is frequently used as a tool to improve communication but it often can lead to misunderstanding. In order to shed some light on this still unexplored area, the present study firstly offers a practical approach to classify and analyse RV within professional communication. After this, it reviews previous studies on email writing to apply their findings to this approach and, in the third part of the study, a corpus of recent business emails in English is analysed to examine how the key parameters of RV are currently used within this genre. The results will show that, not only the context, but also the roles and intentions of the senders influence an email’s register, often causing internal oscillations between different registers within the same text.La correspondencia electrónica es un género comunicativo de especial dinamismo dentro del mundo empresarial en el que la variación de registros se utiliza como herramienta para mejorar la interacción y las relaciones entre los interlocutores, pero que a menudo también genera confusión y malentendidos. Para aportar luz a esta área, el presente trabajo ofrece una aproximación práctica para la clasificación y el análisis de los registros lingüísticos dentro de la comunicación profesional. A continuación, revisa los estudios previos sobre este género con el fin de adaptar sus resultados a la teoría propuesta. Finalmente, se analiza un corpus de mensajes escritos en inglés para examinar el funcionamiento de los registros dentro de este género. Los resultados mostrarán que, no solo el contexto situacional, sino sobre todo los roles e intenciones de los emisores determinan el registro de un mensaje, provocando a menudo oscilación interna entre varios registros dentro del mismo texto.

  17. The Norwegian National Reporting System and Register of Severe Allergic Reactions to Food

    Directory of Open Access Journals (Sweden)

    Martinus Løvik

    2009-10-01

    Full Text Available The Norwegian National Reporting System and Register of Severe Allergic Reactions to Food, or the Food Allergy Register, is a nation-wide, government-funded permanent reporting and registration system for severe allergic reactions to food. The Food Allergy Register collects information based on a one-page reporting form, serum samples for specific IgE analysis, and food samples for food allergen analysis. Reporting physicians receive in return an extensive commentary on the reported case and the relevant allergies, and results of the specific IgE analysis and food allergen analysis.The Food Allergy Register has, after being active for a little more than four years, given valuable information about several important aspects of food allergy in Norway. The Food Allergy Register has revealed food safety problems in relation to allergy that probably could be discovered only with the help of a systematic, nation-wide registration of cases. The reactions of peanut allergic individuals to lupine flour in bakery products is an example of how the Food Allergy Register is able to reveal potentially serious problems that would otherwise probably have gone unnoticed and certainly unexplained. The amount and the value of the information from the Food Allergy Register are increasing as new reports of more cases are added. The typical Norwegian patient with a severe allergic reaction to food appears to be a young adult, female rather than male. The offending meal is consumed at a restaurant or fast-food stand or in a private party away from home, and peanuts, nuts and shellfish are among the most common offending foods, while fish allergy appears to be rather rare.

  18. REVIEW: Towards a risk register for natural capital.

    Science.gov (United States)

    Mace, Georgina M; Hails, Rosemary S; Cryle, Philip; Harlow, Julian; Clarke, Stewart J

    2015-06-01

    Natural capital is essential for goods and services on which people depend. Yet pressures on the environment mean that natural capital assets are continuing to decline and degrade, putting such benefits at risk. Systematic monitoring of natural assets is a major challenge that could be both unaffordable and unmanageable without a way to focus efforts. Here we introduce a simple approach, based on the commonly used management tool of a risk register, to highlight natural assets whose condition places benefits at risk.We undertake a preliminary assessment using a risk register for natural capital assets in the UK based solely on existing information. The status and trends of natural capital assets are assessed using asset-benefit relationships for ten kinds of benefits (food, fibre (timber), energy, aesthetics, freshwater (quality), recreation, clean air, wildlife, hazard protection and equable climate) across eight broad habitat types in the UK based on three dimensions of natural capital within each of the habitat types (quality, quantity and spatial configuration). We estimate the status and trends of benefits relative to societal targets using existing regulatory limits and policy commitments, and allocate scores of high, medium or low risk to asset-benefit relationships that are both subject to management and of concern.The risk register approach reveals substantial gaps in knowledge about asset-benefit relationships which limit the scope and rigour of the assessment (especially for marine and urban habitats). Nevertheless, we find strong indications that certain assets (in freshwater, mountain, moors and heathland habitats) are at high risk in relation to their ability to sustain certain benefits (especially freshwater, wildlife and climate regulation). Synthesis and applications . With directed data gathering, especially to monitor trends, improve metrics related to asset-benefit relationships, and improve understanding of nonlinearities and thresholds, the

  19. The Prosody of Topic Transition in Interaction: Pitch Register Variations.

    Science.gov (United States)

    Riou, Marine

    2017-12-01

    In conversation, speakers can mobilize a variety of prosodic cues to signal a switch in topics. This paper uses a mixed-methods approach combining Conversation Analysis and Instrumental Prosody to investigate the prosody of topic transition in American English, and analyzes the ways in which speakers can play on register level and on register span. A cluster of three prosodic parameters was found to be predictive of transitions: a higher maximum fundamental frequency (F0), a higher median F0 (key), and an expanded register span. Relative to speakers' habitual profiles, the mobilization of such prosodic cues corresponds to a marked upgraded prosodic design. This finding is consistent with the general assumption that continuation constitutes the norm in conversation, and that departing from it, as in the case of a topic transition, requires a marked action and marked linguistic design. The disjunctive action of opening a new topic corresponds to the use of a marked prosodic cue.

  20. Registering Names and Addresses for Information Technology.

    Science.gov (United States)

    Knapp, Arthur A.

    The identification of administrative authorities and the development of associated procedures for registering and accessing names and addresses of communications data systems are considered in this paper. It is noted that, for data communications systems using standards based on the Open Systems Interconnection (OSI) Reference Model specified by…

  1. Single memory with multiple shift register functionality

    NARCIS (Netherlands)

    2010-01-01

    The present invention relates to a memory device comprising a memory (EM) having at least two predetermined register memory sections addressable by respective address ranges AS1-ASz) and at least one access port (P1-PZ) for providing access to said memory (EM). Furthermore, access control means (A)

  2. Telephone calls by individuals with cancer.

    Science.gov (United States)

    Flannery, Marie; McAndrews, Leanne; Stein, Karen F

    2013-09-01

    To describe symptom type and reporting patterns found in spontaneously initiated telephone calls placed to an ambulatory cancer center practice. Retrospective, descriptive. Adult hematology oncology cancer center. 563 individuals with a wide range of oncology diagnoses who initiated 1,229 telephone calls to report symptoms. Raw data were extracted from telephone forms using a data collection sheet with 23 variables obtained for each phone call, using pre-established coding criteria. A literature-based, investigator-developed instrument was used for the coding criteria and selection of which variables to extract. Symptom reporting, telephone calls, pain, and symptoms. A total of 2,378 symptoms were reported by telephone during the four months. At least 10% of the sample reported pain (38%), fatigue (16%), nausea (16%), swelling (12%), diarrhea (12%), dyspnea (10%), and anorexia (10%). The modal response was to call only one time and to report only one symptom (55%). Pain emerged as the symptom that most often prompted an individual to pick up the telephone and call. Although variation was seen in symptom reporting, an interesting pattern emerged with an individual reporting on a solitary symptom in a single telephone call. The emergence of pain as the primary symptom reported by telephone prompted educational efforts for both in-person clinic visit management of pain and prioritizing nursing education and protocol management of pain reported by telephone. Report of symptoms by telephone can provide nurses unique insight into patient-centered needs. Although pain has been an important focus of education and research for decades, it remains a priority for individuals with cancer. A wide range in symptom reporting by telephone was evident.

  3. 78 FR 69539 - Removal of Attestation Process for Facilities Using H-1A Registered Nurses

    Science.gov (United States)

    2013-11-20

    ... of Attestation Process for Facilities Using H-1A Registered Nurses AGENCY: Employment and Training... registered nurses under the H-1A visa program. These subparts became obsolete after the authorizing statute... nonimmigrant classification exclusively for the temporary admission and employment of registered nurses, which...

  4. Outsourcing an Effective Postdischarge Call Program

    Science.gov (United States)

    Meek, Kevin L.; Williams, Paula; Unterschuetz, Caryn J.

    2018-01-01

    To improve patient satisfaction ratings and decrease readmissions, many organizations utilize internal staff to complete postdischarge calls to recently released patients. Developing, implementing, monitoring, and sustaining an effective call program can be challenging and have eluded some of the renowned medical centers in the country. Using collaboration with an outsourced vendor to bring state-of-the-art call technology and staffed with specially trained callers, health systems can achieve elevated levels of engagement and satisfaction for their patients postdischarge. PMID:29494453

  5. Calling to Nursing: Concept Analysis.

    Science.gov (United States)

    Emerson, Christie

    The aims of this article are (a) to analyze the concept of a calling as it relates nursing and (b) to develop a definition of calling to nursing with the detail and clarity needed to guide reliable and valid research. The classic steps described by Walker and Avant are used for the analysis. Literature from several disciplines is reviewed including vocational psychology, Christian career counseling, sociology, organizational management, and nursing. The analysis provides an operational definition of a calling to nursing and establishes 3 defining attributes of the concept: (a) a passionate intrinsic motivation or desire (perhaps with a religious component), (b) an aspiration to engage in nursing practice, as a means of fulfilling one's purpose in life, and (c) the desire to help others as one's purpose in life. Antecedents to the concept are personal introspection and cognitive awareness. Positive consequences to the concept are improved work meaningfulness, work engagement, career commitment, personal well-being, and satisfaction. Negative consequences of having a calling might include willingness to sacrifice well-being for work and problems with work-life balance. Following the concept analysis, philosophical assumptions, contextual factors, interdisciplinary work, research opportunities, and practice implications are discussed.

  6. EMERGENCY CALLS

    CERN Multimedia

    Medical Service

    2001-01-01

    IN URGENT NEED OF A DOCTOR GENEVA EMERGENCY SERVICES GENEVA AND VAUD 144 FIRE BRIGADE 118 POLICE 117 CERN FIREMEN 767-44-44 ANTI-POISONS CENTRE Open 24h/24h 01-251-51-51 Patient not fit to be moved, call family doctor, or: GP AT HOME, open 24h/24h 748-49-50 Association Of Geneva Doctors Emergency Doctors at home 07h-23h 322 20 20 Patient fit to be moved: HOPITAL CANTONAL CENTRAL 24 Micheli-du-Crest 372-33-11 ou 382-33-11 EMERGENCIES 382-33-11 ou 372-33-11 CHILDREN'S HOSPITAL 6 rue Willy-Donzé 372-33-11 MATERNITY 32 bvd.de la Cluse 382-68-16 ou 382-33-11 OPHTHALMOLOGY 22 Alcide Jentzer 382-33-11 ou 372-33-11 MEDICAL CENTRE CORNAVIN 1-3 rue du Jura 345 45 50 HOPITAL DE LA TOUR Meyrin EMERGENCIES 719-61-11 URGENCES PEDIATRIQUES 719-61-00 LA TOUR MEDICAL CENTRE 719-74-00 European Emergency Call 112 FRANCE EMERGENCY SERVICES 15 FIRE BRIGADE 18 POLICE 17 CERN FIREMEN AT HOME 00-41-22-767-44-44 ANTI-POISONS CENTRE Open 24h/24h 04-72-11-69-11 All doctors ...

  7. Identifying patients with myasthenia for epidemiological research by linkage of automated registers

    DEFF Research Database (Denmark)

    Pedersen, Emil Greve; Hallas, Jesper; Hansen, Klaus

    2011-01-01

    We validated a new method of identifying patients with incident myasthenia in automated Danish registers for the purpose of conducting epidemiological studies of the disorder.......We validated a new method of identifying patients with incident myasthenia in automated Danish registers for the purpose of conducting epidemiological studies of the disorder....

  8. TPMG Northern California appointments and advice call center.

    Science.gov (United States)

    Conolly, Patricia; Levine, Leslie; Amaral, Debra J; Fireman, Bruce H; Driscoll, Tom

    2005-08-01

    Kaiser Permanente (KP) has been developing its use of call centers as a way to provide an expansive set of healthcare services to KP members efficiently and cost effectively. Since 1995, when The Permanente Medical Group (TPMG) began to consolidate primary care phone services into three physical call centers, the TPMG Appointments and Advice Call Center (AACC) has become the "front office" for primary care services across approximately 89% of Northern California. The AACC provides primary care phone service for approximately 3 million Kaiser Foundation Health Plan members in Northern California and responds to approximately 1 million calls per month across the three AACC sites. A database records each caller's identity as well as the day, time, and duration of each call; reason for calling; services provided to callers as a result of calls; and clinical outcomes of calls. We here summarize this information for the period 2000 through 2003.

  9. Configurable multi-step linear feedback shift register

    NARCIS (Netherlands)

    2010-01-01

    The state transition of a linear feedback shift register (LFSR) controlled by a clock (310) with length N and step size W, W being at least two, is accomplished via a next-state function (320). The next-state function deploys a state transition matrix (350). The state vector (330), which represents

  10. Evolution of advertisement calls in African clawed frogs

    Science.gov (United States)

    Tobias, Martha L.; Evans, Ben J.; Kelley, Darcy B.

    2014-01-01

    Summary For most frogs, advertisement calls are essential for reproductive success, conveying information on species identity, male quality, sexual state and location. While the evolutionary divergence of call characters has been examined in a number of species, the relative impacts of genetic drift or natural and sexual selection remain unclear. Insights into the evolutionary trajectory of vocal signals can be gained by examining how advertisement calls vary in a phylogenetic context. Evolution by genetic drift would be supported if more closely related species express more similar songs. Conversely, a poor correlation between evolutionary history and song expression would suggest evolution shaped by natural or sexual selection. Here, we measure seven song characters in 20 described and two undescribed species of African clawed frogs (genera Xenopus and Silurana) and four populations of X. laevis. We identify three call types — click, burst and trill — that can be distinguished by click number, call rate and intensity modulation. A fourth type is biphasic, consisting of two of the above. Call types vary in complexity from the simplest, a click, to the most complex, a biphasic call. Maximum parsimony analysis of variation in call type suggests that the ancestral type was of intermediate complexity. Each call type evolved independently more than once and call type is typically not shared by closely related species. These results indicate that call type is homoplasious and has low phylogenetic signal. We conclude that the evolution of call type is not due to genetic drift, but is under selective pressure. PMID:24723737

  11. Balanced Bipartite Graph Based Register Allocation for Network Processors in Mobile and Wireless Networks

    Directory of Open Access Journals (Sweden)

    Feilong Tang

    2010-01-01

    Full Text Available Mobile and wireless networks are the integrant infrastructure of mobile and pervasive computing that aims at providing transparent and preferred information and services for people anytime anywhere. In such environments, end-to-end network bandwidth is crucial to improve user's transparent experience when providing on-demand services such as mobile video playing. As a result, powerful computing power is required for networked nodes, especially for routers. General-purpose processors cannot meet such requirements due to their limited processing ability, and poor programmability and scalability. Intel's network processor IXP is specially designed for fast packet processing to achieve a broad bandwidth. IXP provides a large number of registers to reduce the number of memory accesses. Registers in an IXP are physically partitioned as two banks so that two source operands in an instruction have to come from the two banks respectively, which makes the IXP register allocation tricky and different from conventional ones. In this paper, we investigate an approach for efficiently generating balanced bipartite graph and register allocation algorithms for the dual-bank register allocation in IXPs. The paper presents a graph uniform 2-way partition algorithm (FPT, which provides an optimal solution to the graph partition, and a heuristic algorithm for generating balanced bipartite graph. Finally, we design a framework for IXP register allocation. Experimental results demonstrate the framework and the algorithms are efficient in register allocation for IXP network processors.

  12. Perceptions of the clinical competence of newly registered nurses in the North West province

    Directory of Open Access Journals (Sweden)

    M.R. Moeti

    2004-09-01

    Full Text Available The clinical competence of newly registered nurses relating to the care of individual Clients, depends on their ability to correlate theoretical knowledge learned in the classroom with practice and the development of clinical skills. Its foundation lies in the ability to identify and solve problems that emanate from critical thinking, analytical reasoning and reflective practice. It is clear that the quality of clinical exposure plays a leading role in the development of nursing professionals. Nursing skills alone cannot ensure quality care of clients without the application of theory. Facilitation of this theory to practice therefore remains an essential component of nursing education. This study was aimed at identifying areas of incompetence of newly registered nurses (1998- 2001 in the clinical area by determining the newly registered nurses1 and professional nurses1 perceptions of the competence of the newly registered nurses. A quantitative, non-experimental, descriptive survey was used to collect the data regarding the clinical competence of newly registered nurses (1998-2001.

  13. 18 CFR 367.106 - Accounts 426.1, 426.2, 426.3, 426.4, and 426.5, Miscellaneous expense accounts.

    Science.gov (United States)

    2010-04-01

    ... PUBLIC UTILITY HOLDING COMPANY ACT OF 2005, FEDERAL POWER ACT AND NATURAL GAS ACT UNIFORM SYSTEM OF ACCOUNTS FOR CENTRALIZED SERVICE COMPANIES SUBJECT TO THE PROVISIONS OF THE PUBLIC UTILITY HOLDING COMPANY... miscellaneous expense items which are nonoperating in nature but which are properly deductible before...

  14. Ca teos report in register N 13377

    International Nuclear Information System (INIS)

    Pena, S; Arrighetti, R.

    2011-01-01

    This work is about a report about ca teos carried out in register N 13377 in the department of Canelones to know the depth of the field. The drilling done allowed to identify granite and clay. This granite outcrops are developed in the east of the middle course of the stream Pando

  15. The Danish nationwide clinical register for patients with rheumatoid arthritis

    DEFF Research Database (Denmark)

    Ibfelt, Else Helene; Jensen, Dorte Vendelbo; Hetland, Merete Lund

    2016-01-01

    the following: patient-reported outcomes for disease activity, pain, fatigue, functional status, and physician-reported objective measures of disease activity, treatment, C-reactive protein, and, when indicated, imaging. For subgroups of patients, the variables such as quality of life, sociodemographic factors...... original papers as well as annual reports of clinical quality (since 2005) have been published. Conclusion: DANBIO is a powerful register for research in rheumatologic diseases and furthermore serves as a Clinical Quality Register with the aim of monitoring treatment quality in patients with RA in Denmark....

  16. Predictive value of stroke discharge diagnoses in the Danish National Patient Register.

    Science.gov (United States)

    Lühdorf, Pernille; Overvad, Kim; Schmidt, Erik B; Johnsen, Søren P; Bach, Flemming W

    2017-08-01

    To determine the positive predictive values for stroke discharge diagnoses, including subarachnoidal haemorrhage, intracerebral haemorrhage and cerebral infarction in the Danish National Patient Register. Participants in the Danish cohort study Diet, Cancer and Health with a stroke discharge diagnosis in the National Patient Register between 1993 and 2009 were identified and their medical records were retrieved for validation of the diagnoses. A total of 3326 records of possible cases of stroke were reviewed. The overall positive predictive value for stroke was 69.3% (95% confidence interval (CI) 67.8-70.9%). The predictive values differed according to hospital characteristics, with the highest predictive value of 87.8% (95% CI 85.5-90.1%) found in departments of neurology and the lowest predictive value of 43.0% (95% CI 37.6-48.5%) found in outpatient clinics. The overall stroke diagnosis in the Danish National Patient Register had a limited predictive value. We therefore recommend the critical use of non-validated register data for research on stroke. The possibility of optimising the predictive values based on more advanced algorithms should be considered.

  17. Shine on: achieving career satisfaction as a registered nurse.

    Science.gov (United States)

    Perry, Beth

    2008-01-01

    This phenomenological study focuses on the experience of career satisfaction among registered nurses. Potential participants were asked, "Do you love your work as a nurse?" A random sample of eight nurses who answered yes to this question was questioned further during semistructured conversations. Conversations were recorded and transcribed. Data collected were in the form of descriptions of times during the participants' careers when they felt most professionally fulfilled. Through narrative and poetic analysis, themes of "upholding the vulnerable," "going the extra mile," and "attending to the essential ordinary" were identified. Nurse educators play an important role facilitating career satisfaction for registered nurses. Practical implications for continuing education for educators and practicing nurses are addressed.

  18. Workplace violence experienced by registered nurses: a concept analysis.

    Science.gov (United States)

    Ventura-Madangeng, Judee; Wilson, Denise

    2009-11-01

    Workplace violence toward nurses has increased during the last decade with serious consequences that may extend beyond individual nurses to an entire health care organisation. The variety of definitions of workplace violence experienced by registered nurses contribute to a lack of clarity about what it constitutes, which in turn jeopardizes the reporting of incidences by nurses. Drawing on the relevant literature from 1990 to 2005, a concept analysis using Walker and Avant's framework was undertaken to develop an operational definition of this phenomenon as experienced by registered nurses (excluding mental health nurses). Having a clear understanding of workplace violence assists with the creation of strategies aimed at preventing and/or resolving this problem.

  19. Measuring Certified Registered Nurse Anesthetist Organizational Climate: Instrument Adaptation.

    Science.gov (United States)

    Boyd, Donald; Poghosyan, Lusine

    2017-08-01

    No tool exists measuring certified registered nurse anesthetist (CRNA) organizational climate. The study's purpose is to adapt a validated tool to measure CRNA organizational climate. Content validity of the Certified Registered Nurse Anesthetist Organizational Climate Questionnaire (CRNA-OCQ) was established. Pilot testing was conducted to determine internal reliability consistency of the subscales. Experts rated the tool as content valid. The subscales had high internal consistency reliability (with respective Cronbach's alphas): CRNA-Anesthesiologist Relations (.753), CRNA-Physician Relations (.833), CRNA-Administration Relations (.895), Independent Practice (.830), Support for CRNA Practice (.683), and Professional Visibility (.772). Further refinement of the CRNA-OCQ is necessary. Measurement and assessment of CRNA organizational climate may produce evidence needed to improve provider and patient outcomes.

  20. 29 CFR 785.17 - On-call time.

    Science.gov (United States)

    2010-07-01

    ... On-call time. An employee who is required to remain on call on the employer's premises or so close... employee who is not required to remain on the employer's premises but is merely required to leave word at his home or with company officials where he may be reached is not working while on call. (Armour & Co...

  1. CALLING AQUARIUM LOVERS...

    CERN Multimedia

    2002-01-01

    CERN's anemones will soon be orphans. We are looking for someone willing to look after the aquarium in the main building, for one year. If you are interested, or if you would like more information, please call 73830. (The anemones living in the aquarium thank you in anticipation.)

  2. Calling 911! What role does the pediatrician play?

    Science.gov (United States)

    Grossman, Devin; Kunkov, Sergey; Kaplan, Carl; Crain, Ellen F

    2013-06-01

    The objective of this study was to compare admission rates and medical interventions among children whose caregivers called their child's primary care provider (PCP) before taking an ambulance to the pediatric emergency department (PED) versus those who did not. This was a prospective cohort study of patients brought to an urban, public hospital PED via emergency medical system (EMS). Children were included if the caregiver called 911 to have them transported via EMS and was present in the PED. The main variable was whether the child's PCP was called before EMS utilization. Study outcomes were medical interventions, such as intravenous line insertion or laboratory tests, and hospital admission. χ Test and logistic regression were used to evaluate the relationship of the main variable to the study outcomes. Six hundred fourteen patients met inclusion criteria and were enrolled. Five hundred eighty-five patients (95.3%) were reported to have a PCP. Seventy-four caregivers (12.1%) called their child's PCP before calling EMS. Two hundred seventy-seven patients (45.1%) had medical interventions performed; of these, 42 (15.2%) called their PCP (P = 0.03). Forty-two patients (6.8%) were admitted; among these, 14 (33.3%) called their PCP (P < 0.01). Adjusting for triage level, patients whose caregiver called the PCP before calling EMS were 3.2 times (95% confidence interval, 1.9-5.2 times) more likely to be admitted and 1.7 times (95% confidence interval, 1.1-2.9 times) more likely to have a medical intervention compared with patients whose caregivers did not call their child's PCP. Children were more likely to be admitted or require a medical intervention if their caregiver called their PCP before calling EMS. The availability of a PCP for telephone triage may help to optimize EMS utilization.

  3. 17 CFR 270.30b1-2 - Semi-annual report for totally-owned registered management investment company subsidiary of...

    Science.gov (United States)

    2010-04-01

    ...-owned registered management investment company subsidiary of registered management investment company...-owned registered management investment company subsidiary of registered management investment company... subsidiary of a registered management investment company need not file a semi-annual report on Form N-SAR if...

  4. The central dose register for the nuclear industry in Sweden

    International Nuclear Information System (INIS)

    Widell, C.-O.

    1978-06-01

    The central dose register for the nuclear industry in Sweden has been in operation since 1974. The system contains today about 18 000 persons in the register. The dose information is stored on discs on a CDC Cyber 172 computer and all information to and from the system is handled by terminals at the different nuclear sites. The terminals are connected to the computer by normal telephone lines. Most doses are recorded on TLD. The data from the TLD readers is automatically transferred to the computer via punched tape and the local computer terminal. The dose results are stored under the person's unique social security number. It is also possible to use social security number systems of other countries. The dose register system also supervises the condition of the readers and their calibration by circulation dosimeters which have been given a reference dose. The information from the system can be obtained on many different types of lists, for example, annual, quarterly, monthly, departementally, personal history, job number. (author)

  5. 20 years TraumaRegister DGU(®): development, aims and structure.

    Science.gov (United States)

    2014-10-01

    The TraumaRegister DGU(®) organisational and technical development has undergone an evolution process, which started 20 years ago. Currently, the management of the registry is under the management of the "AUC - Academy for Trauma Surgery" (infrastructure) and the "Sektion NIS" (scientific responsibility). The aim of the registry was to establish an inter-hospital quality assessment tool with the option to use the increasing database for scientific evaluations of acute care. Year after year and most recently with the obligatory participation of certified hospitals the number of participating hospitals has grown as well as the registered cases per annum. Recently, even hospitals from other countries joined the registry too. Starting with six German hospitals and 260 cases in 1993, 20 years later more than 600 hospitals from eleven countries deliver over 30,000 trauma cases per year resulting in over 150,000 reported cases until 2013. In this article a historical perspective is presented of the evolution and current status of the TraumaRegister DGU(®). Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Sharing programming resources between Bio* projects through remote procedure call and native call stack strategies

    DEFF Research Database (Denmark)

    Prins, Pjotr; Goto, Naohisa; Yates, Andrew

    2012-01-01

    Open-source software (OSS) encourages computer programmers to reuse software components written by others. In evolutionary bioinformatics, OSS comes in a broad range of programming languages, including C/C++, Perl, Python, Ruby, Java, and R. To avoid writing the same functionality multiple times...... for different languages, it is possible to share components by bridging computer languages and Bio* projects, such as BioPerl, Biopython, BioRuby, BioJava, and R/Bioconductor. In this chapter, we compare the two principal approaches for sharing software between different programming languages: either by remote...... procedure call (RPC) or by sharing a local call stack. RPC provides a language-independent protocol over a network interface; examples are RSOAP and Rserve. The local call stack provides a between-language mapping not over the network interface, but directly in computer memory; examples are R bindings, RPy...

  7. Indico CONFERENCE: Define the Call for Abstracts

    CERN Multimedia

    CERN. Geneva; Ferreira, Pedro

    2017-01-01

    In this tutorial, you will learn how to define and open a call for abstracts. When defining a call for abstracts, you will be able to define settings related to the type of questions asked during a review of an abstract, select the users who will review the abstracts, decide when to open the call for abstracts, and more.

  8. Call for Research

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marie-Isabelle Beyer

    2014-10-03

    Oct 3, 2014 ... 5.Submission process. 6.Eligibility criteria. 7.Selection Process. 8. Format and requirements. 9.Evaluation criteria. 10.Country clearance requirements. 11. .... It is envisaged that through this call a single consortium will undertake 6-8 projects within a total budget of up to ... principle qualify for IDRC's support.

  9. EURISOL-DS Multi-MW Target: Risk Register

    CERN Document Server

    C. Kharoua and Y. Kadi (CERN)

    The purpose of the risk register is to identify and rank the risk inherent to the installation, operation, maintenance, dismantling and disposal of each item of the facility and to propose ways of mitigating such risks.It is an important input for the safety report which will be mandatory for the study towards the construction of the EURISOL Facility.

  10. A Disease Register for ME/CFS: Report of a Pilot Study

    Directory of Open Access Journals (Sweden)

    Featherstone Valerie

    2011-05-01

    Full Text Available Abstract Background The ME/CFS Disease Register is one of six subprojects within the National ME/CFS Observatory, a research programme funded by the Big Lottery Fund and sponsored by Action for ME. A pilot study in East Anglia, East Yorkshire, and London aimed to address the problem of identifying representative groups of subjects for research, in order to be able to draw conclusions applicable to the whole ME/CFS population. While not aiming for comprehensive population coverage, this pilot register sought to recruit participants with ME/CFS in an unbiased way from a large population base. Those recruited are constituting a cohort for long-term follow-up to shed light on prognosis, and a sampling frame for other studies. Findings Patients with unidentified chronic fatigue were identified in GP databases using a READ-code based algorithm, and conformity to certain case definitions for ME/CFS determined. 29 practices, covering a population aged 18 to 64 of 143,153, participated. 510 patients with unexplained chronic fatigue were identified. 265 of these conformed to one or more case definitions. 216 were invited to join the register; 160 agreed. 96.9% of participants conformed to the CDC 1994 (Fukuda definition; the Canadian definition defined more precisely a subset of these. The addition of an epidemiological case definition increased case ascertainment by approximately 4%. A small-scale study in a specialist referral service in East Anglia was also undertaken. There was little difference in pattern of conformity to case definitions, age or sex among disease register participants compared with subjects in a parallel epidemiological study who declined to participate. One-year follow-up of 50 subjects showed little change in pain or fatigue scores. There were some changes in conformity to case definitions. Conclusions Objective evaluation indicated that the aim of recruiting participants with ME/CFS to a Disease Register had been fulfilled, and

  11. A Disease Register for ME/CFS: Report of a Pilot Study.

    Science.gov (United States)

    Pheby, Derek; Lacerda, Eliana; Nacul, Luis; Drachler, Maria de Lourdes; Campion, Peter; Howe, Amanda; Poland, Fiona; Curran, Monica; Featherstone, Valerie; Fayyaz, Shagufta; Sakellariou, Dikaios; Leite, José Carlos de Carvalho

    2011-05-09

    The ME/CFS Disease Register is one of six subprojects within the National ME/CFS Observatory, a research programme funded by the Big Lottery Fund and sponsored by Action for ME. A pilot study in East Anglia, East Yorkshire, and London aimed to address the problem of identifying representative groups of subjects for research, in order to be able to draw conclusions applicable to the whole ME/CFS population.While not aiming for comprehensive population coverage, this pilot register sought to recruit participants with ME/CFS in an unbiased way from a large population base. Those recruited are constituting a cohort for long-term follow-up to shed light on prognosis, and a sampling frame for other studies. Patients with unidentified chronic fatigue were identified in GP databases using a READ-code based algorithm, and conformity to certain case definitions for ME/CFS determined. 29 practices, covering a population aged 18 to 64 of 143,153, participated.510 patients with unexplained chronic fatigue were identified. 265 of these conformed to one or more case definitions. 216 were invited to join the register; 160 agreed. 96.9% of participants conformed to the CDC 1994 (Fukuda) definition; the Canadian definition defined more precisely a subset of these. The addition of an epidemiological case definition increased case ascertainment by approximately 4%. A small-scale study in a specialist referral service in East Anglia was also undertaken.There was little difference in pattern of conformity to case definitions, age or sex among disease register participants compared with subjects in a parallel epidemiological study who declined to participate.One-year follow-up of 50 subjects showed little change in pain or fatigue scores. There were some changes in conformity to case definitions. Objective evaluation indicated that the aim of recruiting participants with ME/CFS to a Disease Register had been fulfilled, and confirmed the feasibility of our approach to case identification

  12. The function of migratory bird calls

    DEFF Research Database (Denmark)

    Reichl, Thomas; Andersen, Bent Bach; Larsen, Ole Næsbye

    The function of migratory bird calls: do they influence orientation and navigation?   Thomas Reichl1, Bent Bach Andersen2, Ole Naesbye Larsen2, Henrik Mouritsen1   1Institute of Biology, University of Oldenburg, Oldenburg, D-26111 Oldenburg, Germany 2Institute of Biology, University of Southern...... migration and to stimulate migratory restlessness in conspecifics. We wished to test if conspecific flight calls influence the flight direction of a nocturnal migrant, the European Robin (Erithacus rubecula), i.e. if flight calls help migrants keeping course. Wild caught birds showing migratory restlessness...... the experimental bird could be activated successively to simulate a migrating Robin cruising E-W, W-E, S-N or N-S at a chosen height (mostly about 40 m), at 10 m/s and emitting Robin flight calls of 80 dB(A) at 1 m. The simulated flight of a "ding" sound served as a control. During an experiment the bird was first...

  13. Plagiarism and registered health professionals: navigating the borderlands between scholarly and professional misconduct.

    Science.gov (United States)

    Wardle, Jon

    2013-12-01

    As access to published materials becomes more readily available, the ability to plagiarise material, deliberately or unwittingly has become easier than ever. This article explores important recent decisions in Australia and the United Kingdom regarding registered health practitioners who have engaged in plagiarism, both related and unrelated to their clinical practice, and explores the ways in which regulatory authorities in these countries have viewed scholarly misconduct committed by registered health professionals. This article also examines the implications of plagiarism for the registered health professions, and makes suggestions for strategies to reduce its influence and incidence in modern clinical practice.

  14. An empirical analysis of the corporate call decision

    International Nuclear Information System (INIS)

    Carlson, M.D.

    1998-01-01

    An economic study of the the behaviour of financial managers of utility companies was presented. The study examined whether or not an option pricing based model of the call decision does a better job of explaining callable preferred share prices and call decisions compared to other models. In this study, the Rust (1987) empirical technique was extended to include the use of information from preferred share prices in addition to the call decisions. Reasonable estimates were obtained from data of shares of the Pacific Gas and Electric Company (PGE) for the transaction costs associated with a call. It was concluded that the managers of the PGE clearly take into account the value of the option to delay the call when making their call decisions

  15. Perceived Calling and Work Engagement Among Nurses.

    Science.gov (United States)

    Ziedelis, Arunas

    2018-03-01

    The purpose of this study was to explore the relationship of perceived calling and work engagement in nursing over and above major work environment factors. In all, 351 nurses from various health care institutions completed the survey. Data were collected about the most demanding aspects of nursing, major job resources, the degree to which nursing is perceived as a meaningful calling, work engagement, and main demographic information. Hierarchical linear regression was applied to assess the relation between perceived calling and work engagement, while controlling for demographic and work environment factors, and perceived calling was significantly related to two out of three components of nurses' work engagement. The highest association was found with dedication component, and vigor component was related insignificantly. Results have shown that perceived calling might motivate nurses to engage in their work even in burdensome environment, although possible implications for the occupational well-being of nurses themselves remains unclear.

  16. Semi-Automatic Electronic Stent Register: a novel approach to preventing ureteric stents lost to follow up.

    Science.gov (United States)

    Macneil, James W H; Michail, Peter; Patel, Manish I; Ashbourne, Julie; Bariol, Simon V; Ende, David A; Hossack, Tania A; Lau, Howard; Wang, Audrey C; Brooks, Andrew J

    2017-10-01

    Ureteric stents are indispensable tools in modern urology; however, the risk of them not being followed-up once inserted poses medical and medico-legal risks. Stent registers are a common solution to mitigate this risk; however, manual registers are logistically challenging, especially for busy units. Western Sydney Local Health District developed a novel Semi-Automatic Electronic Stent Register (SAESR) utilizing billing information to track stent insertions. To determine the utility of this system, an audit was conducted comparing the 6 months before the introduction of the register to the first 6 months of the register. In the first 6 months of the register, 457 stents were inserted. At the time of writing, two of these are severely delayed for removal, representing a rate of 0.4%. In the 6 months immediately preceding the introduction of the register, 497 stents were inserted, and six were either missed completely or severely delayed in their removal, representing a rate of 1.2%. A non-inferiority analysis found this to be no worse than the results achieved before the introduction of the register. The SAESR allowed us to improve upon our better than expected rate of stents lost to follow up or severely delayed. We demonstrated non-inferiority in the rate of lost or severely delayed stents, and a number of other advantages including savings in personnel costs. The semi-automatic register represents an effective way of reducing the risk associated with a common urological procedure. We believe that this methodology could be implemented elsewhere. © 2017 Royal Australasian College of Surgeons.

  17. Factors contributing to registered nurse medication administration error: a narrative review.

    Science.gov (United States)

    Parry, Angela M; Barriball, K Louise; While, Alison E

    2015-01-01

    To explore the factors contributing to Registered Nurse medication administration error behaviour. A narrative review. Electronic databases (Cochrane, CINAHL, MEDLINE, BNI, EmBase, and PsycINFO) were searched from 1 January 1999 to 31 December 2012 in the English language. 1127 papers were identified and 26 papers were included in the review. Data were extracted by one reviewer and checked by a second reviewer. A thematic analysis and narrative synthesis of the factors contributing to Registered Nurses' medication administration behaviour. Bandura's (1986) theory of reciprocal determinism was used as an organising framework. This theory proposes that there is a reciprocal interplay between the environment, the person and their behaviour. Medication administration error is an outcome of RN behaviour. The 26 papers reported studies conducted in 4 continents across 11 countries predominantly in North America and Europe, with one multi-national study incorporating 27 countries. Within both the environment and person domain of the reciprocal determinism framework, a number of factors emerged as influencing Registered Nurse medication administration error behaviour. Within the environment domain, two key themes of clinical workload and work setting emerged, and within the person domain the Registered Nurses' characteristics and their lived experience of work emerged as themes. Overall, greater attention has been given to the contribution of the environment domain rather than the person domain as contributing to error, with the literature viewing an error as an event rather than the outcome of behaviour. The interplay between factors that influence behaviour were poorly accounted for within the selected studies. It is proposed that a shift away from error as an event to a focus on the relationships between the person, the environment and Registered Nurse medication administration behaviour is needed to better understand medication administration error. Copyright © 2014

  18. Experiences of registered nurses from a refugee background: A scoping review.

    Science.gov (United States)

    Ng Chok, Harrison; Mannix, Judy; Dickson, Cathy; Wilkes, Lesley

    2018-04-01

    This scoping review presents an exploration of international literature on the factors that impact refugees' personal and professional experiences during their journey to being registered nurses in a new host country. Governments of host countries receiving refugees seek to develop strategies that facilitate the successful resettlement, employment and enculturation of refugees that arrive as skilled professionals. There is a scarcity of studies focussing on issues faced by refugees that are RNs or those pursuing nursing registration and employment in a new host country. This study is relevant for resettlement services, nursing registration authorities and education providers and informs the international nursing workforce. Scoping review. Databases such as MEDLINE, EMBASE, Cochrane Library, CINAHL; Google Scholar; PubMed; Scopus and Web of Science were searched for qualitative studies published up to and including 2017. Articles that did not specify explicitly the participants as registered nurses and/or refugees were excluded. All eligible articles were analysed for collective findings, and impact factors were extracted, synthesised and illustrated diagrammatically. This review explored six eligible articles and six impact factors were identified. The challenging impacts were as follows: loss of control; shock in a new environment and bleak employment prospects. Equally three impact factors: reconciling new reality; establishing a new identity and hope for the future, facilitate positive experiences for nurses in their successful transition into society and the nursing workplace. This scoping review reports the small number of international studies on the experiences of refugees seeking to become registered and employed as registered nurses. The six impact factors identified influence the lives of the nurse participants socio-economically in and out of the workplace. Policymakers, managers and educators providing resettlement, registration and employment services

  19. On-call work and health: a review

    Directory of Open Access Journals (Sweden)

    Botterill Jackie S

    2004-12-01

    Full Text Available Abstract Many professions in the fields of engineering, aviation and medicine employ this form of scheduling. However, on-call work has received significantly less research attention than other work patterns such as shift work and overtime hours. This paper reviews the current body of peer-reviewed, published research conducted on the health effects of on-call work The health effects studies done in the area of on-call work are limited to mental health, job stress, sleep disturbances and personal safety. The reviewed research suggests that on-call work scheduling can pose a risk to health, although there are critical gaps in the literature.

  20. Systems configured to distribute a telephone call, communication systems, communication methods and methods of routing a telephone call to a service representative

    Science.gov (United States)

    Harris, Scott H.; Johnson, Joel A.; Neiswanger, Jeffery R.; Twitchell, Kevin E.

    2004-03-09

    The present invention includes systems configured to distribute a telephone call, communication systems, communication methods and methods of routing a telephone call to a customer service representative. In one embodiment of the invention, a system configured to distribute a telephone call within a network includes a distributor adapted to connect with a telephone system, the distributor being configured to connect a telephone call using the telephone system and output the telephone call and associated data of the telephone call; and a plurality of customer service representative terminals connected with the distributor and a selected customer service representative terminal being configured to receive the telephone call and the associated data, the distributor and the selected customer service representative terminal being configured to synchronize, application of the telephone call and associated data from the distributor to the selected customer service representative terminal.

  1. No Call for Action? Why There Is No Union (Yet in Philippine Call Centers

    Directory of Open Access Journals (Sweden)

    Niklas Reese

    2013-01-01

    Full Text Available This contribution presents findings from a qualitative study which focused on young urban professionals in the Philippines who work(ed in international call centers – workplaces usually characterized by job insecurity and other forms of precarity, factory-like working conditions, and disembeddedness. Nevertheless, trade unions in these centers have not come into existence. Why collective action is not chosen by call center agents as an option to tackle the above mentioned problems – this is what the research project this article is based on tried to understand. After outlining some workrelated problems identified by Filipino call center agents, the article will focus on the strategies the agents employ to counter these problems (mainly accommodation and everyday resistance. By highlighting five objective and five subjective reasons (or reasons by circumstances and reasons by framing, we conclude that it is not repressive regulation policies, but rather the formative power and the internalization of discourses of rule within individual life strategies that are preventing the establishment of unions and other collective action structures.

  2. Reflections on Distributive Leadership for Work-Based Mobile Learning of Canadian Registered Nurses

    Science.gov (United States)

    Fahlman, Dorothy

    2017-01-01

    The ubiquity, flexibility, and accessibility of mobile devices can transform how registered nurses in Canada learn beyond the confines of traditional education/training boundaries in their work settings. Many Canadian registered nurses have actively embraced mobile technologies for their work-based learning to meet their competency requirements…

  3. A register-based study of variations in services received among dental care attenders

    DEFF Research Database (Denmark)

    Rosing, Kasper; Hede, Børge; Christensen, Lisa Bøge

    2016-01-01

    . Materials and methods . This retrospective register-based study followed two Danish cohorts, aged 25 and 40, with a dental examination in 2009 (n = 32,351). The dental service data were registered during 2005–2009. The number of dental examinations, individual preventive services (IPS), tooth extractions...

  4. ULTOR(Registered TradeMark) Passive Pose and Position Engine For Spacecraft Relative Navigation

    Science.gov (United States)

    Hannah, S. Joel

    2008-01-01

    The ULTOR(Registered TradeMark) Passive Pose and Position Engine (P3E) technology, developed by Advanced Optical Systems, Inc (AOS), uses real-time image correlation to provide relative position and pose data for spacecraft guidance, navigation, and control. Potential data sources include a wide variety of sensors, including visible and infrared cameras. ULTOR(Registered TradeMark) P3E has been demonstrated on a number of host processing platforms. NASA is integrating ULTOR(Registerd TradeMark) P3E into its Relative Navigation System (RNS), which is being developed for the upcoming Hubble Space Telescope (HST) Servicing Mission 4 (SM4). During SM4 ULTOR(Registered TradeMark) P3E will perform realtime pose and position measurements during both the approach and departure phases of the mission. This paper describes the RNS implementation of ULTOR(Registered TradeMark) P3E, and presents results from NASA's hardware-in-the-loop simulation testing against the HST mockup.

  5. The Riks-Stroke story: building a sustainable national register for quality assessment of stroke care.

    Science.gov (United States)

    Asplund, Kjell; Hulter Åsberg, Kerstin; Appelros, Peter; Bjarne, Daniela; Eriksson, Marie; Johansson, Asa; Jonsson, Fredrik; Norrving, Bo; Stegmayr, Birgitta; Terént, Andreas; Wallin, Sari; Wester, Per-Olov

    2011-04-01

    Riks-Stroke, the Swedish Stroke Register, is the world's longest-running national stroke quality register (established in 1994) and includes all 76 hospitals in Sweden admitting acute stroke patients. The development and maintenance of this sustainable national register is described. Riks-Stroke includes information on the quality of care during the acute phase, rehabilitation and secondary prevention of stroke, as well as data on community support. Riks-Stroke is unique among stroke quality registers in that patients are followed during the first year after stroke. The data collected describe processes, and medical and patient-reported outcome measurements. The register embraces most of the dimensions of health-care quality (evidence-based, safe, provided in time, distributed fairly and patient oriented). Annually, approximately 25,000 patients are included. In 2009, approximately 320,000 patients had been accumulated (mean age 76-years). The register is estimated to cover 82% of all stroke patients treated in Swedish hospitals. Among critical issues when building a national stroke quality register, the delicate balance between simplicity and comprehensiveness is emphasised. Future developments include direct transfer of data from digital medical records to Riks-Stroke and comprehensive strategies to use the information collected to rapidly implement new evidence-based techniques and to eliminate outdated methods in stroke care. It is possible to establish a sustainable quality register for stroke at the national level covering all hospitals admitting acute stroke patients. Riks-Stroke is fulfilling its main goals to support continuous quality improvement of Swedish stroke services and serve as an instrument for following up national stroke guidelines. © 2010 The Authors. International Journal of Stroke © 2010 World Stroke Organization.

  6. Reducing juvenile delinquency with automated cell phone calls.

    Science.gov (United States)

    Burraston, Bert O; Bahr, Stephen J; Cherrington, David J

    2014-05-01

    Using a sample of 70 juvenile probationers (39 treatment and 31 controls), we evaluated the effectiveness of a rehabilitation program that combined cognitive-behavioral training and automated phone calls. The cognitive-behavioral training contained six 90-min sessions, one per week, and the phone calls occurred twice per day for the year following treatment. Recidivism was measured by whether they were rearrested and the total number of rearrests during the 1st year. To test the impact of the phone calls, those who received phone calls were divided into high and low groups depending on whether they answered more or less than half of their phone calls. Those who completed the class and answered at least half of their phone calls were less likely to have been arrested and had fewer total arrests.

  7. Educators' expectations of roles, employability and career pathways of registered and enrolled nurses in Australia.

    Science.gov (United States)

    Jacob, Elisabeth R; McKenna, Lisa; D'Amore, Angelo

    2016-01-01

    In Australia, like other countries, two levels of nurse are registered for entry to practice. Educational changes for second level nurses in Australia have led to questions regarding roles and career options. This paper reports on interviews with nursing course coordinators to examine educator expectations of roles and career pathways of registered and enrolled nurses. Coordinators of eight degree (registered) and diploma (enrolled) nursing programs were interviewed to determine their opinions on roles and careers that students were prepared for. Transcripts were thematically analysed. Educators reported similar graduate roles, although high acuity care was primarily the role of registered nurses. Career expectations differed with enrolled nurses having limited advancement opportunity, and registered nurses greater career options. Health organisations were unprepared to accommodate increased practice scope of enrolled nurses and limited work practice through policies stipulating who could perform procedures. Organisational health policies need to accommodate increased enrolled nurse skill base. Education of practising nurses is necessary regarding increased scope of enrolled nurse practice to ensure they are used to their full potential. Increasing patient acuity requires more registered nurses, as enrolled nurses are unprepared to care for complex or deteriorating patients. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Using the software to registers of health problems and management in health care herds of cattle

    Directory of Open Access Journals (Sweden)

    Tomáš Frejlach

    2016-11-01

    Full Text Available The registers of the use of veterinary medicines are obliged breeder and veterinarians by Decree 344/2008 Coll. law 378/2007 Coll. In the Czech Republic there are still farms where the registers of used medicaments and performed veterinary care done by hand in notebooks or in paper form. As a result of the multiple data overwriting thus leads to introducing additional errors and the process information processing is considerably extended. Software for healthcare registers of animals using the same technology as the system of registration of animals Skotsoft. The introduction of the new system would facilitate the whole zootechnical registers and accelerate the entire data processing. In the event, that a customer used the registers of animals and healthcare registers, there is mutually exchanged information between systems. It is not necessary, for example, to enter basic information about the animal (identification number, date of birth, gender, etc. into each system separately. The advantage of both systems is the same graphical interface and control.

  9. A register-based study of the antimicrobial usage in Danish veal calves and young bulls

    DEFF Research Database (Denmark)

    Fertner, Mette Ely; Toft, Nils; Martin, Henrik Læssøe

    2016-01-01

    High antimicrobial usage and multidrug resistance have been reported in veal calves in Europe. This may be attributed to a high risk of disease as veal calves are often purchased from numerous dairy herds, exposed to stress related to the transport and commingling of new animals, and fed a new...... ration. In this study, we used national register data to characterize the use of antimicrobials registered for large Danish veal calf and young bull producing herds in 2014. A total of 325 herds with veal calf and potentially young bull production were identified from the Danish Cattle database....... According to the national Danish database on drugs for veterinary use (VetStat), a total of 537,399 Animal Daily Doses (ADD200) were registered for these 325 herds during 2014. The amount of antimicrobials registered in 2014 varied throughout the year, with the highest amounts registered in autumn...

  10. The Staff Nurse Clinical Leader at the Bedside: Swedish Registered Nurses’ Perceptions

    Directory of Open Access Journals (Sweden)

    Inga E. Larsson

    2016-01-01

    Full Text Available Registered nurses at the bedside are accountable for and oversee completion of patient care as well as directly leading and managing the provision of safe patient care. These nurses have an informal leadership role that is not associated with any given position. Leadership is a complex and multifaceted concept and its meaning is unclear, especially in the staff nurse context. The aim was to describe registered nurses’ perceptions of what it entails to be the leader at the bedside in inpatient physical care. A phenomenographic approach was employed. Interviews were performed with Swedish registered nurses (n=15. Five descriptive categories were identified: demonstrating clinical knowledge, establishing a good atmosphere of collaboration, consciously structuring the work in order to ensure patients’ best possible nursing care, customized presence in the practical work with patients according to predetermined prerequisites, and monitoring coworkers’ professional practice. Registered nurses informal role as leader necessitates a social process of deliberate effort to attain and maintain leader status and authority. Participants used deliberate communicative approaches and interactive procedures. Leader principles grounded in the core values of the nursing profession that ensure nursing values and person-centered attributes were a key aspect.

  11. Factors that facilitate registered nurses in their first-line nurse manager role.

    Science.gov (United States)

    Cziraki, Karen; McKey, Colleen; Peachey, Gladys; Baxter, Pamela; Flaherty, Brenda

    2014-11-01

    To determine the factors that attract and retain Registered Nurses in the first-line nurse manager role. The first-line nurse manger role is pivotal in health-care organisations. National demographics suggest that Canada will face a first-line nurse manager shortage because of retirement in the next decade. Determination of factors that attract and retain Registered Nurses will assist organisations and policy makers to employ strategies to address this shortage. The study used an exploratory, descriptive qualitative approach, consisting of semi-structured individual interviews with 11 Registered Nurses in first-line nurse manager roles. The findings revealed a discrepancy between the factors that attract and retain Registered Nurses in the first-line nurse manager role, underscored the importance of the mentor role and confirmed the challenges encountered by first-line nurse managers practicing in the current health-care environment. The first-line nurse manager role has been under studied. Further research is warranted to understand which strategies are most effective in supporting first-line nurse managers. Strategies to support nurses in the first-line nurse manager role are discussed for the individual, programme, organisation and health-care system/policy levels. © 2013 John Wiley & Sons Ltd.

  12. CO-Dark Star Formation and Black Hole Activity in 3C 368 at z = 1.131: Coeval Growth of Stellar and Supermassive Black Hole Masses

    Energy Technology Data Exchange (ETDEWEB)

    Lamarche, C.; Stacey, G.; Riechers, D.; Vishwas, A. [Department of Astronomy, Cornell University, Ithaca, NY 14853 (United States); Brisbin, D. [Núcleo de Astronomía, Facultad de Ingeniería y Ciencias, Universidad Diego Portales, Avenida Ejército 441, 8370191 Santiago (Chile); Ferkinhoff, C. [Department of Physics, Winona State University, Winona, MN, 55987 (United States); Hailey-Dunsheath, S. [California Institute of Technology, Mail Code 301-17, 1200 East California Boulevard, Pasadena, CA 91125 (United States); Nikola, T.; Spoon, H. [Cornell Center for Astrophysics and Planetary Science, Cornell University, Ithaca, NY 14853 (United States); Sharon, C. E., E-mail: cjl272@cornell.edu [Department of Physics and Astronomy, McMaster University, 1280 Main Street West, Hamilton, ON L85-4M1 (Canada)

    2017-02-10

    We present the detection of four far-infrared fine-structure oxygen lines, as well as strong upper limits for the CO(2–1) and [N ii] 205 μ m lines, in 3C 368, a well-studied radio-loud galaxy at z = 1.131. These new oxygen lines, taken in conjunction with previously observed neon and carbon fine-structure lines, suggest a powerful active galactic nucleus (AGN), accompanied by vigorous and extended star formation. A starburst dominated by O8 stars, with an age of ∼6.5 Myr, provides a good fit to the fine-structure line data. This estimated age of the starburst makes it nearly concurrent with the latest episode of AGN activity, suggesting a link between the growth of the supermassive black hole and stellar population in this source. We do not detect the CO(2–1) line, down to a level twelve times lower than the expected value for star-forming galaxies. This lack of CO line emission is consistent with recent star formation activity if the star-forming molecular gas has low metallicity, is highly fractionated (such that CO is photodissociated throughout much of the clouds), or is chemically very young (such that CO has not yet had time to form). It is also possible, although we argue it is unlikely, that the ensemble of fine-structure lines is emitted from the region heated by the AGN.

  13. 75 FR 15402 - Information Collection; Minority Farm Register

    Science.gov (United States)

    2010-03-29

    ... notice. In your comments, include date, volume, and page number of this issue of the Federal Register... farming or agriculture. The registrant's name, address, email, phone number, race, ethnicity, gender, farm... information collected with these organizations for outreach purposes. The race, ethnicity, and gender of...

  14. Call for volunteers

    CERN Document Server

    2008-01-01

    CERN is calling for volunteers from all members of the Laboratory for organizing the two exceptional Open days.CERN is calling for volunteers from all members of the Laboratory’s personnel to help with the organisation of these two exceptional Open Days, for the visits of CERN personnel and their families on the Saturday and above all for the major public Open Day on the Sunday. As for the 50th anniversary in 2004, the success of the Open Days will depend on a large number of volunteers. All those working for CERN as well as retired members of the personnel can contribute to making this event a success. Many guides will be needed at the LHC points, for the activities at the surface and to man the reception and information points. The aim of these major Open Days is to give the local populations the opportunity to discover the fruits of almost 20 years of work carried out at CERN. We are hoping for some 2000 volunteers for the two Open Days, on the Saturday from 9 a.m. to ...

  15. 13 CFR 120.651 - Claim to FTA by Registered Holder to replace Certificate.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Claim to FTA by Registered Holder to replace Certificate. 120.651 Section 120.651 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION BUSINESS LOANS Secondary Market Miscellaneous Provisions § 120.651 Claim to FTA by Registered...

  16. Conscientious objection: a call to nursing leadership.

    Science.gov (United States)

    Ford, Natalie J; Fraser, Kimberly D; Marck, Patricia B

    2010-09-01

    In this paper we argue that nurse leaders need to work actively to create morally supportive environments for nurses in Canada that provide adequate room to exercise conscientious objection. Morally supportive environments engender a safe atmosphere to engage in open dialogue and action regarding conflict of conscience. The CNA's 2008 Code of Ethics for Registered Nurses has recognized the importance of conscientious objection in nursing and has created key guidelines for the registered nurse to follow when a conflict in conscience is being considered or declared. Nurse leaders need to further develop the understanding of conflicts of conscience through education, well-written guidelines for conscientious objection in workplaces and engagement in research to uncover underlying barriers to the enactment of conscientious objections. With advancements in technology, changing healthcare policies and increasing scope of practice, both reflection and dialogue on conscientious objection are critical for the continuing moral development of nurses in Canada.

  17. 75 FR 26278 - The Register of Copyrights’ and the Copyright Royalty Judges’ authority to determine the...

    Science.gov (United States)

    2010-05-11

    ... law were referred to the Register of Copyrights concerning the authority of the Register of Copyrights... questions of substantive law for her consideration: Does the Register of Copyrights have the authority under... law. That motion was denied by the Copyright Royalty Judges on March 30, 2010. Order Denying Motion...

  18. 17 CFR 270.17g-1 - Bonding of officers and employees of registered management investment companies.

    Science.gov (United States)

    2010-04-01

    ... employees of registered management investment companies. 270.17g-1 Section 270.17g-1 Commodity and... ACT OF 1940 § 270.17g-1 Bonding of officers and employees of registered management investment companies. (a) Each registered management investment company shall provide and maintain a bond which shall...

  19. New graduate registered nurses' knowledge of patient safety and practice: A literature review.

    Science.gov (United States)

    Murray, Melanie; Sundin, Deborah; Cope, Vicki

    2018-01-01

    To critically appraise available literature and summarise evidence pertaining to the patient safety knowledge and practices of new graduate registered nurses. Responsibility for patient safety should not be limited to the practice of the bedside nurses, rather the responsibility of all in the healthcare system. Previous research identified lapses in safety across the health care, more specifically with new practitioners. Understanding these gaps and what may be employed to counteract them is vital to ensuring patient safety. A focused review of research literature. The review used key terms and Boolean operators across a 5-year time frame in CINAHL, Medline, psycINFO and Google Scholar for research articles pertaining to the area of enquiry. Eighty-four articles met the inclusion criteria, 39 discarded due to irrelevant material and 45 articles were included in the literature review. This review acknowledges that nursing has different stages of knowledge and practice capabilities. A theory-practice gap for new graduate registered nurses exists, and transition to practice is a key learning period setting new nurses on the path to becoming expert practitioners. Within the literature, there was little to no acknowledgement of patient safety knowledge of the newly registered nurse. Issues raised in the 1970s remain a concern for today's new graduate registered nurses. Research has recognised several factors affecting transition from nursing student to new graduate registered nurse. These factors are leaving new practitioners open to potential errors and risking patient safety. Understanding the knowledge of a new graduate registered nurse upon entering clinical practice may assist in organisations providing appropriate clinical and theoretical support to these nurses during their transition. © 2017 John Wiley & Sons Ltd.

  20. Registered error between PET and CT images confirmed by a water model

    International Nuclear Information System (INIS)

    Chen Yangchun; Fan Mingwu; Xu Hao; Chen Ping; Zhang Chunlin

    2012-01-01

    The registered error between PET and CT imaging system was confirmed by a water model simulating clinical cases. A barrel of 6750 mL was filled with 59.2 MBq [ 18 F]-FDG and scanned after 80 min by 2 dimension model PET/CT. The CT images were used to attenuate the PET images. The CT/PET images were obtained by image morphological processing analyses without barrel wall. The relationship of the water image centroids of CT and PET images was established by linear regression analysis, and the registered error between PET and CT image could be computed one slice by one slice. The alignment program was done 4 times following the protocol given by GE Healthcare. Compared with centroids of water CT images, centroids of PET images were shifted to X-axis (0.011slice+0.63) mm, to Y-axis (0.022×slice+1.35) mm. To match CT images, PET images should be translated along X-axis (-2.69±0.15) mm, Y-axis (0.43±0.11) mm, Z-axis (0.86±0.23) mm, and X-axis be rotated by (0.06±0.07)°, Y-axis by (-0.01±0.08)°, and Z-axis by (0.11±0.07)°. So, the systematic registered error was not affected by load and its distribution. By finding the registered error between PET and CT images for coordinate rotation random error, the water model could confirm the registered results of PET-CT system corrected by Alignment parameters. (authors)

  1. Job satisfaction of registered dental practitioners.

    Science.gov (United States)

    Luzzi, L; Spencer, A J; Jones, K; Teusner, D

    2005-09-01

    This study was designed to measure job satisfaction among registered clinical dentists so as to identify issues which may influence recruitment and retention of dentists in active clinical practice. A questionnaire measuring dimensions of job satisfaction was mailed to a stratified random sample of 80 private and 80 public sector dentists selected from the 1999 Victorian Dental Register. An adjusted response rate of 60 per cent was achieved (n = 87). Analyses showed significant differences (ANOVA; p satisfaction for various dimensions of job satisfaction by gender, age group and practice type. Differences in job satisfaction between male and female dentists related to the personal time dimension. Differences in satisfaction between dentists of different age groups were attributable to six dimensions: relationships with colleagues, relationships with patients, relationships with staff, personal time, community and administrative responsibilities. Differences between levels of satisfaction among private and public dentists related to the autonomy, relationships with patients, pay and resources dimensions. There are various dimensions of job satisfaction that may be pertinent to issues influencing recruitment and retention of dentists. Differences that exist between levels of job satisfaction among private and public sector dentists, between male and female dentists and dentists of different age groups need to be addressed in order to improve recruitment and retention rates of dentists in active clinical practice in different sectors of the dental care system.

  2. Interpersonal relationships between registered nurses and student nurses in the clinical setting--A systematic integrative review.

    Science.gov (United States)

    Rebeiro, Geraldine; Edward, Karen-leigh; Chapman, Rose; Evans, Alicia

    2015-12-01

    A significant proportion of undergraduate nursing education occurs in the clinical setting in the form of practising skills and competencies, and is a requirement of all nursing curriculum for registration to practice. Education in the clinical setting is facilitated by registered nurses, yet this interpersonal relationship has not been examined well. To investigate the experience of interpersonal relationships between registered nurses and student nurses in the clinical setting from the point of view of the registered nurse. Integrative review Review methods: The databases of MEDLINE, CINAHL and OVID were searched. Key words used included: Registered Nurse, Preceptor, Buddy Nurse, Clinical Teacher, Mentor, Student Nurse, Nursing Student, Interpersonal Relationships, Attitudes and Perceptions. Additional review of the literature was manually undertaken through university library textbooks. 632 abstracts were returned after duplicates were removed. Twenty one articles were identified for full text read (quantitative n=2, mixed n=6, qualitative n=14); of these, seven articles addressed the experience of interpersonal relationships between registered nurses and student nurses in the clinical setting from the point of view of the registered nurse and these were reviewed. Providing education for registered nurses to enable them to lead student education in the clinical setting communicates the organizational value of the role. Registered nurses identified being supported in having the time-to-teach were considered important in facilitation of the clinical teaching role. The integrative review did not provide evidence related to the impact diverse clinical settings can have on the relationships between registered nurses and student nurses revealing an area for further examination. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

  3. Perpetual Cancellable American Call Option

    OpenAIRE

    Emmerling, Thomas J.

    2010-01-01

    This paper examines the valuation of a generalized American-style option known as a Game-style call option in an infinite time horizon setting. The specifications of this contract allow the writer to terminate the call option at any point in time for a fixed penalty amount paid directly to the holder. Valuation of a perpetual Game-style put option was addressed by Kyprianou (2004) in a Black-Scholes setting on a non-dividend paying asset. Here, we undertake a similar analysis for the perpetua...

  4. Leveraging management information in improving call centre productivity

    Directory of Open Access Journals (Sweden)

    Manthisana Mosese

    2016-04-01

    Objectives: This research explored the use of management information and its impact on two fundamental functions namely, improving productivity without compromising the quality of service, in the call centre of a well-known South African fashion retailer, Edcon. Following the implementation of the call centre technology project the research set out to determine how Edcon can transform their call centre to improve productivity and customer service through effective utilisation of their management information. Method: Internal documents and reports were analysed to provide the basis of evaluation between the measures of productivity prior to and post the implementation of a technology project at Edcon’s call centre. Semi-structured in-depth and group interviews were conducted to establish the importance and use of management information in improving productivity and customer service. Results: The results indicated that the availability of management information has indeed contributed to improved efficiency at the Edcon call centre. Although literature claims that there is a correlation between a call centre technology upgrade and improvement in performance, evident in the return on investment being realised within a year or two of implementation, it fell beyond the scope of this study to investigate the return on investment for Edcon’s call centre. Conclusion: Although Edcon has begun realising benefits in improved productivity in their call centre from their available management information, information will continue to play a crucial role in supporting management with informed decisions that will improve the call centre operations. [pdf to follow

  5. Smart Grid Technology and Consumer Call Center Readiness

    OpenAIRE

    Schamber, Kelsey L.

    2010-01-01

    The following reasearch project deals with utility call center readiness to address customer concerns and questions about the Smart Grid and smart meter technology. Since consumer engagement is important for the benefits of the Smart Grid to be realized, the readiness and ability of utilities to answer consumer questions is an important issue. Assessing the readiness of utility call centers to address pertinant customer concerns was accomplished by calling utility call centers with Smart Grid...

  6. 17 CFR 270.12b-1 - Distribution of shares by registered open-end management investment company.

    Science.gov (United States)

    2010-04-01

    ... registered open-end management investment company. 270.12b-1 Section 270.12b-1 Commodity and Securities... 1940 § 270.12b-1 Distribution of shares by registered open-end management investment company. (a)(1... the printing and mailing of sales literature; (b) A registered, open-end management investment company...

  7. Exploring Preferences of Mentoring Activities among Generational Groups of Registered Nurses in Florida

    Science.gov (United States)

    Posey-Goodwin, Patricia Ann

    2013-01-01

    The purpose of this study was to explore differences in perceptions of mentoring activities from four generations of registered nurses in Florida, using the Alleman Mentoring Activities Questionnaire ® (AMAQ ®). Statistical procedures of analysis of variance (ANOVA) were employed to explore differences among 65 registered nurses in Florida from…

  8. Occupancy-driven smart register for building energy saving (Conference Presentation)

    Science.gov (United States)

    Chen, Zhangjie; Wang, Ya S.

    2017-04-01

    The new era in energy-efficiency building is to integrate automatic occupancy detection with automated heating, ventilation and cooling (HVAC), the largest source of building energy consumption. By closing off some air vents, during certain hours of the day, up to 7.5% building energy consumption could be saved. In the past, smart vent has received increasing attention and several products have been developed and introduced to the market for building energy saving. For instance, Ecovent Systems Inc. and Keen Home Inc. have both developed smart vent registers capable of turning the vent on and off through smart phone apps. However, their products do not have on-board occupancy sensors and are therefore open-loop. Their vent control was achieved by simply positioning the vent blade through a motor and a controller without involving any smart actuation. This paper presents an innovative approach for automated vent control and automatic occupancy (human subjects) detection. We devise this approach in a smart register that has polydimethylsiloxane (PDMS) frame with embedded Shape memory alloy (SMA) actuators. SMAs belong to a class of shape memory materials (SMMs), which have the ability to `memorise' or retain their previous form when subjected to certain stimulus such as thermomechanical or magnetic variations. And it can work as actuators and be applied to vent control. Specifically, a Ni-Ti SMA strip will be pre-trained to a circular shape, wrapped with a Ni-Cr resistive wire that is coated with thermally conductive and electrically isolating material. Then, the SMA strip along with an antagonistic SMA strip will be bonded with PZT sensor and thermal sensors, to be inserted into a 3D printed mould which will be filled with silicone rubber materials. In the end, a demoulding process yields a fully integrated blade of the smart register. Several blades are installed together to form the smart register. The PZT sensors can feedback the shape of the actuator for precise

  9. Mobile telephones: a comparison of radiated power between 3G VoIP calls and 3G VoCS calls.

    Science.gov (United States)

    Jovanovic, Dragan; Bragard, Guillaume; Picard, Dominique; Chauvin, Sébastien

    2015-01-01

    The purpose of this study is to assess the mean RF power radiated by mobile telephones during voice calls in 3G VoIP (Voice over Internet Protocol) using an application well known to mobile Internet users, and to compare it with the mean power radiated during voice calls in 3G VoCS (Voice over Circuit Switch) on a traditional network. Knowing that the specific absorption rate (SAR) is proportional to the mean radiated power, the user's exposure could be clearly identified at the same time. Three 3G (High Speed Packet Access) smartphones from three different manufacturers, all dual-band for GSM (900 MHz, 1800 MHz) and dual-band for UMTS (900 MHz, 1950 MHz), were used between 28 July and 04 August 2011 in Paris (France) to make 220 two-minute calls on a mobile telephone network with national coverage. The places where the calls were made were selected in such a way as to describe the whole range of usage situations of the mobile telephone. The measuring equipment, called "SYRPOM", recorded the radiation power levels and the frequency bands used during the calls with a sampling rate of 20,000 per second. In the framework of this study, the mean normalised power radiated by a telephone in 3G VoIP calls was evaluated at 0.75% maximum power of the smartphone, compared with 0.22% in 3G VoCS calls. The very low average power levels associated with use of 3G devices with VoIP or VoCS support the view that RF exposure resulting from their use is far from exceeding the basic restrictions of current exposure limits in terms of SAR.

  10. Impact of ancestry categorisations on residential segregation measures using Swedish register data.

    Science.gov (United States)

    Jarvis, Benjamin; Kawalerowicz, Juta; Valdez, Sarah

    2017-07-01

    Country-of-birth data contained in registers are often aggregated to create broad ancestry group categories. We examine how measures of residential segregation vary according to levels of aggregation. We use Swedish register data to calculate pairwise dissimilarity indices from 1990 to 2012 for ancestry groups defined at four nested levels of aggregation: (1) micro-groups containing 50 categories, (2) meso-groups containing 16 categories, (3) macro-groups containing six categories and (4) a broad Western/non-Western binary. We find variation in segregation levels between ancestry groups that is obscured by data aggregation. This study demonstrates that the practice of aggregating country-of-birth statistics in register data can hinder the ability to identify highly segregated groups and therefore design effective policy to remedy both intergroup and intergenerational inequalities.

  11. Operative Complications During Pregnancy After Gastric Bypass—a Register-Based Cohort Study

    DEFF Research Database (Denmark)

    Andreasen, Lisbeth A; Nilas, Lisbeth; Kjær, Mette M

    2014-01-01

    the puerperium. CONCLUSIONS: The incidence of internal herniation during pregnancy was 1 % in our study. Internal herniation may be a serious complication in pregnant women, and both the diagnosis and treatment requires handling by experienced obstetrical, radiological, and surgical staff....... during pregnancy in a national cohort of women with a history of gastric bypass surgery. METHODS: A national, register-based cohort study of all Danish women with a history of gastric bypass surgery who had given birth from 2004 to 2010 was conducted. Surgical codes registered during pregnancy and until...... 120 days postpartum were identified in national registers, and the individual charts were reviewed in relevant cases. RESULTS: Of 286 women giving birth, fourteen women underwent procedures that might be related to the earlier gastric bypass surgery. Three women were operated on suspicion of internal...

  12. Oxygen Plasma Modification of Poss-Coated Kapton(Registered TradeMark) HN Films

    Science.gov (United States)

    Wohl, C. J.; Belcher, M. A.; Ghose, S.; Connell, J. W.

    2008-01-01

    The surface energy of a material depends on both surface composition and topographic features. In an effort to modify the surface topography of Kapton(Registered TradeMark) HN film, organic solutions of a polyhedral oligomeric silsesquioxane, octakis(dimethylsilyloxy)silsesquioxane (POSS), were spray-coated onto the Kapton(Registered TradeMark) HN surface. Prior to POSS application, the Kapton(Registered TradeMark) HN film was activated by exposure to radio frequency (RF)-generated oxygen plasma. After POSS deposition and solvent evaporation, the films were exposed to various durations of RF-generated oxygen plasma to create a topographically rich surface. The modified films were characterized using optical microscopy, attenuated total reflection infrared (ATR-IR) spectroscopy, and high-resolution scanning electron microscopy (HRSEM). The physical properties of the modified films will be presented.

  13. Knowledge of Diabetes Mellitus among Registered Nurses in Benin ...

    African Journals Online (AJOL)

    Knowledge of Diabetes Mellitus among Registered Nurses in Benin City. ... Although, nurses knew that diet plays a great role in management of diabetes mellitus, they were ... Keywords: Nurses, Health education, Understanding of diabetes.

  14. Prenatal Maternal Smoking and Tourette Syndrome: A Nationwide Register Study.

    Science.gov (United States)

    Leivonen, Susanna; Chudal, Roshan; Joelsson, Petteri; Ekblad, Mikael; Suominen, Auli; Brown, Alan S; Gissler, Mika; Voutilainen, Arja; Sourander, Andre

    2016-02-01

    This is the first nationwide register-based study to examine the relationship between prenatal maternal smoking and Tourette syndrome. A total of 767 children diagnosed with Tourette syndrome were identified from the Finnish Hospital Discharge Register. Each case was matched to four controls. Information on maternal smoking during pregnancy was obtained from the Finnish Medical Birth Register. Conditional logistic regression models were used for statistical analyses. Prenatal maternal smoking was associated with Tourette syndrome when comorbid with ADHD (OR 4.0, 95 % CI 1.2-13.5, p = 0.027 for exposure during first trimester, OR 1.7, 95 % CI, 1.05-2.7, p = 0.031 for exposure for the whole pregnancy). There was no association between maternal smoking during pregnancy and Tourette syndrome without comorbid ADHD (OR 0.5, 95 % CI 0.2-1.3, p = 0.166, OR 0.9, 95 % CI 0.7-1.3, p = 0.567). Further research is needed to elucidate the mechanisms behind the association between prenatal maternal smoking and Tourette syndrome with comorbid ADHD.

  15. The Wireless Nursing Call System

    DEFF Research Database (Denmark)

    Jensen, Casper Bruun

    2006-01-01

    This paper discusses a research project in which social scientists were involved both as analysts and supporters during a pilot with a new wireless nursing call system. The case thus exemplifies an attempt to participate in developing dependable health care systems and offers insight into the cha......This paper discusses a research project in which social scientists were involved both as analysts and supporters during a pilot with a new wireless nursing call system. The case thus exemplifies an attempt to participate in developing dependable health care systems and offers insight...

  16. Integrating heterogeneous healthcare call centers.

    Science.gov (United States)

    Peschel, K M; Reed, W C; Salter, K

    1998-01-01

    In a relatively short period, OHS has absorbed multiple call centers supporting different LOBs from various acquisitions, functioning with diverse standards, processes, and technologies. However, customer and employee satisfaction is predicated on OHS's ability to thoroughly integrate these heterogeneous call centers. The integration was initiated and has successfully progressed through a balanced program of focused leadership and a defined strategy which includes site consolidation, sound performance management philosophies, and enabling technology. Benefits have already been achieved with even more substantive ones to occur as the integration continues to evolve.

  17. The renewal of hydroelectric concessions in competitive call

    International Nuclear Information System (INIS)

    2013-01-01

    This document discusses various issues associated with the planned competitive call on the French hydraulic power plants. The principles of this competitive call for hydroelectric concessions are first addressed: administrative regime of concessions, competitive call process, criteria of selection of the concession holder, case of 'concession of valleys', potential competitors. It outlines and discusses the difficulties of this competitive call: France is the single country to implement this procedure; it concerns a national asset; it questions the guarantee of a future use of equipment at best for the energy benefits of French consumers; the competitive call is a nice idea indeed but extremely complex. A note discusses the profitability aspects of Plants for Transfer of Energy by Pumping

  18. Human Resource Management in Australian Registered Training Organisations

    Science.gov (United States)

    Smith, Andrew; Hawke Geof

    2008-01-01

    This report forms part of a comprehensive research program that has examined issues related to building the organisational capability of vocational education and training providers. In particular, this report focuses on the current state of human resource management practice in both technical and further education and private registered training…

  19. 76 FR 72619 - User Fee To Take the Registered Tax Return Preparer Competency Examination

    Science.gov (United States)

    2011-11-25

    ..., 2011)), provide that only attorneys, certified public accountants, enrolled agents, and registered tax... Fee To Take the Registered Tax Return Preparer Competency Examination AGENCY: Internal Revenue Service... regulations. The final regulations redesignate rules pertaining to fees for obtaining a preparer tax...

  20. Exploring sources of knowledge utilized in practice among Jordanian registered nurses.

    Science.gov (United States)

    Al-Ghabeesh, Suhair Husni; Abu-Moghli, Fathieh; Salsali, Mahvash; Saleh, Mohammad

    2013-10-01

    Understanding sources of knowledge used in everyday practice is very helpful in improving the quality of health care services. There is a consensus in the literature that nurses mostly relied in their practice on experiential knowledge gained through their interactions with other members of health care professionals and patients. The general aim of this study is to explore the sources of knowledge Jordanian registered nurses use during their practice. A descriptive correlational design was used to collect data from 539 Jordanian registered nurses from 10 hospitals using a self-administered questionnaire. The mean year of experience of the sample was 7.08 years. Of the 615 questionnaires distributed, 555 were returned. This yields a response rate of 87.6%. Results revealed that the top five ranked sources used by Jordanian registered nurses include: the information that nurses learned during nursing education, personal experience in nursing over time, what was learned through providing care to patients, information gained through discussion between physicians and nurses about patients, and information from policy and procedure manuals. Jordanian registered nurses recognize the value of research and that research utilization (RU) is an important issue and must not be ignored. The study has many implications for practice, education and research. Health care managers and decision makers need to play a more visible and instrumental role in encouraging RU to improve patients' quality of life. © 2012 John Wiley & Sons Ltd.

  1. Epilepsy in Individuals with a History of Asperger's Syndrome: A Danish Nationwide Register-Based Cohort Study

    Science.gov (United States)

    Mouridsen, Svend Erik; Rich, Bente; Isager, Torben

    2013-01-01

    We performed a nationwide, register-based retrospective follow-up study of epilepsy in all people who were born between January 1, 1980 and June 29, 2006 and registered in the Danish Psychiatric Central Register with Asperger's syndrome on February 7, 2011. All 4,180 identified cases with AS (3,431 males and 749 females) were screened through the…

  2. Registered nurse intent to promote physical activity for hospitalised liver transplant recipients.

    Science.gov (United States)

    Pearson, Jocelyn A; Mangold, Kara; Kosiorek, Heidi E; Montez, Morgan; Smith, Diane M; Tyler, Brenda J

    2017-12-26

    To describe how registered nurse work motivation, attitudes, subjective norm and perceived behavioural control influence intention to promote physical activity in hospitalised adult liver transplant recipients. Descriptive study of clinical registered nurses caring for recipients of liver transplant at a tertiary medical centre. Intent to Mobilise Liver Transplant Recipient Scale, Work Extrinsic and Intrinsic Motivation Scale, and demographics were used to explore registered nurses' work motivation, attitudes, subjective norms, perceived behavioural control and intention to promote physical activity of hospitalised adult liver transplant recipients during the acute postoperative phase. Data analysis included demographics, comparison between scale items and analysis of factors predicting intent to mobilise. Factors predictive of intention to promote physical activity after liver transplant included appropriate knowledge to mobilise patients (R 2  = .40) and identification of physical activity as nursing staff priority (R 2  = .15) and responsibility (R 2  = .03). When implementing an early mobilisation protocol after the liver transplant, education on effects of physical activity in the immediate postoperative period are essential to promote implementation in practice. Nursing care environment and leadership must be supportive to ensure mobility is a registered nurse priority and responsibility. Nursing managers can leverage results to implement a mobility protocol. © 2017 John Wiley & Sons Ltd.

  3. Prevention by lactic acid bacteria of the oxidation of human LDL.

    Science.gov (United States)

    Terahara, M; Kurama, S; Takemoto, N

    2001-08-01

    Ether extracts of lactic acid bacteria were analyzed for prevention of the oxidation of erythrocyte membrane and human low-density lipoprotein in vivo. Streptococcus thermophilus 1131 and Lactobacillus delbrueckii subsp. bulgaricus 2038, yogurt starters, were chosen as test-strains, and ether extracts of these cultures were used as samples. Both strain 1131 and strain 2038 produced radical scavengers and inhibited oxidation of erythrocyte membranes and low-density lipoproteins. The antioxidative activity of strain 2038 was higher than that of strain 1131.

  4. Hepatitis C prevalence in Denmark -an estimate based on multiple national registers

    DEFF Research Database (Denmark)

    Christensen, Peer Brehm; Hay, Gordon; Jepsen, Peter

    2012-01-01

    ABSTRACT: BACKGROUND: A national survey for chronic hepatitis C has not been performed in Denmark and the prevalence is unknown. Our aim was to estimate the prevalence of chronic hepatitis C from public registers and the proportion of these patients who received specialized healthcare. METHODS...... by capture-recapture analysis. The population with undiagnosed hepatitis C was derived from the national register of drug users by comparing diagnosed and tested persons. RESULTS: A total of 6,935 patients diagnosed with chronic hepatitis C were identified in the four registers and the estimated population.......37-0.42) of the population over 15 years of age. CONCLUSIONS: The estimated prevalence of chronic hepatitis C in Denmark was 0.38%. Less than half of the patients with chronic hepatitis C in Denmark have been identified and among these patients, one in three has attended specialised care....

  5. Linking Calling Orientations to Organizational Attachment via Organizational Instrumentality

    Science.gov (United States)

    Cardador, M. Teresa; Dane, Erik; Pratt, Michael G.

    2011-01-01

    Despite an emerging interest in callings, researchers know little about whether calling orientations matter in the workplace. We explore the under-examined relationship between a calling orientation and employees' attachment to their organizations. Although some theory suggests that callings may be negatively related to organizational attachment,…

  6. The Danish National Health Service Register (NHSR) as a Source for Research on Primary Care

    DEFF Research Database (Denmark)

    Andersen, John Sahl; Olivarius, Niels de Fine; Krasnik, Allan

    . The data is easy accessible from the Danish National Board of Health. Conclusion: The register's strengths include completeness, size and long follow-up period. It is useful for research purposes especially when linked with other registers. However, grave reservations must be made regarding the validity...... of the register as no studies of this point have been made. Knowledge of the working conditions in general practice is necessary in order to use the NHSR for research purposes.......Aim: To describe NHSR in relation to research. Content: The data in the register from general practice is generated through the GPs’ electronic invoices to the Regional Health Administration. Data from 1990 onwards is available covering more than 600 million patient contacts. For each service...

  7. Patient safety: numerical skills and drug calculation abilities of nursing students and registered nurses.

    Science.gov (United States)

    McMullan, Miriam; Jones, Ray; Lea, Susan

    2010-04-01

    This paper is a report of a correlational study of the relations of age, status, experience and drug calculation ability to numerical ability of nursing students and Registered Nurses. Competent numerical and drug calculation skills are essential for nurses as mistakes can put patients' lives at risk. A cross-sectional study was carried out in 2006 in one United Kingdom university. Validated numerical and drug calculation tests were given to 229 second year nursing students and 44 Registered Nurses attending a non-medical prescribing programme. The numeracy test was failed by 55% of students and 45% of Registered Nurses, while 92% of students and 89% of nurses failed the drug calculation test. Independent of status or experience, older participants (> or = 35 years) were statistically significantly more able to perform numerical calculations. There was no statistically significant difference between nursing students and Registered Nurses in their overall drug calculation ability, but nurses were statistically significantly more able than students to perform basic numerical calculations and calculations for solids, oral liquids and injections. Both nursing students and Registered Nurses were statistically significantly more able to perform calculations for solids, liquid oral and injections than calculations for drug percentages, drip and infusion rates. To prevent deskilling, Registered Nurses should continue to practise and refresh all the different types of drug calculations as often as possible with regular (self)-testing of their ability. Time should be set aside in curricula for nursing students to learn how to perform basic numerical and drug calculations. This learning should be reinforced through regular practice and assessment.

  8. The Influence of Judgment Calls on Meta-Analytic Findings.

    Science.gov (United States)

    Tarrahi, Farid; Eisend, Martin

    2016-01-01

    Previous research has suggested that judgment calls (i.e., methodological choices made in the process of conducting a meta-analysis) have a strong influence on meta-analytic findings and question their robustness. However, prior research applies case study comparison or reanalysis of a few meta-analyses with a focus on a few selected judgment calls. These studies neglect the fact that different judgment calls are related to each other and simultaneously influence the outcomes of a meta-analysis, and that meta-analytic findings can vary due to non-judgment call differences between meta-analyses (e.g., variations of effects over time). The current study analyzes the influence of 13 judgment calls in 176 meta-analyses in marketing research by applying a multivariate, multilevel meta-meta-analysis. The analysis considers simultaneous influences from different judgment calls on meta-analytic effect sizes and controls for alternative explanations based on non-judgment call differences between meta-analyses. The findings suggest that judgment calls have only a minor influence on meta-analytic findings, whereas non-judgment call differences between meta-analyses are more likely to explain differences in meta-analytic findings. The findings support the robustness of meta-analytic results and conclusions.

  9. The Long Road to Partnership: Conflict Resolution of Register 45 Mesuji Lampung

    Directory of Open Access Journals (Sweden)

    Komang Jaka Ferdian

    2017-08-01

    Full Text Available A known agrarian issue took place in Indonesia, particularly in the area of Register 45 Mesuji Lampung. The granting of natural forest management permit by the government to PT. Silva Inhutani, thus eliminating public access around Register 45 to manage the forest, subsequently lead to conflict in the region. The objectives of this research are, namely: 1 to explain the grounds for partnership in the Register 45 area; and 2 to analyze the partnership program undertaken in Register 45 as an effort of resolving conflict. This research used a descriptive qualitative approach that describes the results of research, assessment and other references reinforced with empirical data through interviews and observations. This study found a number of issues in the partnership agreement formation process, wherein the community was not being involved in the formation process of the partnership provisions, such as the planting process and the profit sharing scheme. The issues found in the implementation stage of the partnership agreement can be observed from an internal factor perspective, which was the unfulfilled expectation to increase acacia planting. Regarding the external factor, there were still many acts of thuggery in the area of Register 45 that interfered with the partnership process. There was also a fundamental problem in the partnership implementation, which was the prevalent lack of aptness in the mapping of community entitled to the partnership, as well as the lack of trust among collaborating parties.

  10. Optimal scheduling in call centers with a callback option

    OpenAIRE

    Legros , Benjamin; Jouini , Oualid; Koole , Ger

    2016-01-01

    International audience; We consider a call center model with a callback option, which allows to transform an inbound call into an outbound one. A delayed call, with a long anticipated waiting time, receives the option to be called back. We assume a probabilistic customer reaction to the callback offer (option). The objective of the system manager is to characterize the optimal call scheduling that minimizes the expected waiting and abandonment costs. For the single-server case, we prove that ...

  11. Flight calls and orientation

    DEFF Research Database (Denmark)

    Larsen, Ole Næsbye; Andersen, Bent Bach; Kropp, Wibke

    2008-01-01

    flight calls was simulated by sequential computer controlled activation of five loudspeakers placed in a linear array perpendicular to the bird's migration course. The bird responded to this stimulation by changing its migratory course in the direction of that of the ‘flying conspecifics' but after about......  In a pilot experiment a European Robin, Erithacus rubecula, expressing migratory restlessness with a stable orientation, was video filmed in the dark with an infrared camera and its directional migratory activity was recorded. The flight overhead of migrating conspecifics uttering nocturnal...... 30 minutes it drifted back to its original migration course. The results suggest that songbirds migrating alone at night can use the flight calls from conspecifics as additional cues for orientation and that they may compare this information with other cues to decide what course to keep....

  12. RRS Discovery Cruise 312, 11-31 Oct 2006. The extended Ellett Line 2006

    OpenAIRE

    Allen, J.T.

    2007-01-01

    UK oceanographers have been making repeated measurements on a short section across the Rockall Trough, since 1975. The section consists of a series of stations from the Scottish continental shelf to Rockall. The time series was established by David Ellett and was thus called the "Ellett Line". The Ellett line is one of a relatively small number of high quality physical time series in the North Atlantic Ocean and is important for monitoring oceanic climate variability.Since 1996 NOCS and SAMS ...

  13. 17 CFR 274.130 - Form N-Q, quarterly schedule of portfolio holdings of registered management investment company.

    Science.gov (United States)

    2010-04-01

    ... of portfolio holdings of registered management investment company. 274.130 Section 274.130 Commodity... INVESTMENT COMPANY ACT OF 1940 Forms for Reports § 274.130 Form N-Q, quarterly schedule of portfolio holdings of registered management investment company. This form shall be used by registered management...

  14. Lunar phases and crisis center telephone calls.

    Science.gov (United States)

    Wilson, J E; Tobacyk, J J

    1990-02-01

    The lunar hypothesis, that is, the notion that lunar phases can directly affect human behavior, was tested by time-series analysis of 4,575 crisis center telephone calls (all calls recorded for a 6-month interval). As expected, the lunar hypothesis was not supported. The 28-day lunar cycle accounted for less than 1% of the variance of the frequency of crisis center calls. Also, as hypothesized from an attribution theory framework, crisis center workers reported significantly greater belief in lunar effects than a non-crisis-center-worker comparison group.

  15. Correlates of Gay-Related Name-Calling in Schools

    Science.gov (United States)

    Slaatten, Hilde; Hetland, Jørn; Anderssen, Norman

    2015-01-01

    The aim of this study was to examine whether attitudes about gay-related name-calling, social norms concerning gay-related name-calling among co-students, teacher intervention, and school-related support would predict whether secondary school pupils had called another pupil a gay-related name during the last month. A total of 921 ninth-grade…

  16. 47 CFR 90.241 - Radio call box operations.

    Science.gov (United States)

    2010-10-01

    ... remains on for a period in excess of three minutes. The automatic cutoff system must be designed so the... Public Safety Pool for highway call box systems subject to the following requirements: (1) Call box... effective radiated power (ERP). (3) The height of a call box antenna may not exceed 6.1 meters (20 feet...

  17. Statistics available for site studies in registers and surveys at Statistics Sweden

    Energy Technology Data Exchange (ETDEWEB)

    Haldorson, Marie [Statistics Sweden, Oerebro (Sweden)

    2000-03-01

    Statistics Sweden (SCB) has produced this report on behalf of the Swedish Nuclear Fuel and Waste Management Company (SKB), as part of the data to be used by SKB in conducting studies of potential sites. The report goes over the statistics obtainable from SCB in the form of registers and surveys. The purpose is to identify the variables that are available, and to specify their degree of geographical detail and the time series that are available. Chapter two describes the statistical registers available at SCB, registers that share the common feature that they provide total coverage, i.e. they contain all 'objects' of a given type, such as population, economic activities (e.g. from statements of employees' earnings provided to the tax authorities), vehicles, enterprises or real estate. SCB has exclusive responsibility for seven of the nine registers included in the chapter, while two registers are ordered by public authorities with statistical responsibilities. Chapter three describes statistical surveys that are conducted by SCB, with the exception of the National Forest Inventory, which is carried out by the Swedish University of Agricultural Sciences. In terms of geographical breakdown, the degree of detail in the surveys varies, but all provide some possibility of reporting data at lower than the national level. The level involved may be county, municipality, yield district, coastal district or category of enterprises, e.g. aquaculture. Six of the nine surveys included in the chapter have been ordered by public authorities with statistical responsibilities, while SCB has exclusive responsibility for the others. Chapter four presents an overview of the statistics on land use maintained by SCB. This chapter does not follow the same pattern as chapters two and three but instead gives a more general account. The conclusion can be drawn that there are good prospects that SKB can make use of SCB's data as background information or in other ways when

  18. Statistics available for site studies in registers and surveys at Statistics Sweden

    International Nuclear Information System (INIS)

    Haldorson, Marie

    2000-03-01

    Statistics Sweden (SCB) has produced this report on behalf of the Swedish Nuclear Fuel and Waste Management Company (SKB), as part of the data to be used by SKB in conducting studies of potential sites. The report goes over the statistics obtainable from SCB in the form of registers and surveys. The purpose is to identify the variables that are available, and to specify their degree of geographical detail and the time series that are available. Chapter two describes the statistical registers available at SCB, registers that share the common feature that they provide total coverage, i.e. they contain all 'objects' of a given type, such as population, economic activities (e.g. from statements of employees' earnings provided to the tax authorities), vehicles, enterprises or real estate. SCB has exclusive responsibility for seven of the nine registers included in the chapter, while two registers are ordered by public authorities with statistical responsibilities. Chapter three describes statistical surveys that are conducted by SCB, with the exception of the National Forest Inventory, which is carried out by the Swedish University of Agricultural Sciences. In terms of geographical breakdown, the degree of detail in the surveys varies, but all provide some possibility of reporting data at lower than the national level. The level involved may be county, municipality, yield district, coastal district or category of enterprises, e.g. aquaculture. Six of the nine surveys included in the chapter have been ordered by public authorities with statistical responsibilities, while SCB has exclusive responsibility for the others. Chapter four presents an overview of the statistics on land use maintained by SCB. This chapter does not follow the same pattern as chapters two and three but instead gives a more general account. The conclusion can be drawn that there are good prospects that SKB can make use of SCB's data as background information or in other ways when undertaking future

  19. Statistics available for site studies in registers and surveys at Statistics Sweden

    Energy Technology Data Exchange (ETDEWEB)

    Haldorson, Marie [Statistics Sweden, Oerebro (Sweden)

    2000-03-01

    Statistics Sweden (SCB) has produced this report on behalf of the Swedish Nuclear Fuel and Waste Management Company (SKB), as part of the data to be used by SKB in conducting studies of potential sites. The report goes over the statistics obtainable from SCB in the form of registers and surveys. The purpose is to identify the variables that are available, and to specify their degree of geographical detail and the time series that are available. Chapter two describes the statistical registers available at SCB, registers that share the common feature that they provide total coverage, i.e. they contain all 'objects' of a given type, such as population, economic activities (e.g. from statements of employees' earnings provided to the tax authorities), vehicles, enterprises or real estate. SCB has exclusive responsibility for seven of the nine registers included in the chapter, while two registers are ordered by public authorities with statistical responsibilities. Chapter three describes statistical surveys that are conducted by SCB, with the exception of the National Forest Inventory, which is carried out by the Swedish University of Agricultural Sciences. In terms of geographical breakdown, the degree of detail in the surveys varies, but all provide some possibility of reporting data at lower than the national level. The level involved may be county, municipality, yield district, coastal district or category of enterprises, e.g. aquaculture. Six of the nine surveys included in the chapter have been ordered by public authorities with statistical responsibilities, while SCB has exclusive responsibility for the others. Chapter four presents an overview of the statistics on land use maintained by SCB. This chapter does not follow the same pattern as chapters two and three but instead gives a more general account. The conclusion can be drawn that there are good prospects that SKB can make use of SCB's data as background information or in other ways when undertaking future

  20. Wavefunctions for topological quantum registers

    International Nuclear Information System (INIS)

    Ardonne, E.; Schoutens, K.

    2007-01-01

    We present explicit wavefunctions for quasi-hole excitations over a variety of non-abelian quantum Hall states: the Read-Rezayi states with k ≥ 3 clustering properties and a paired spin-singlet quantum Hall state. Quasi-holes over these states constitute a topological quantum register, which can be addressed by braiding quasi-holes. We obtain the braid properties by direct inspection of the quasi-hole wavefunctions. We establish that the braid properties for the paired spin-singlet state are those of 'Fibonacci anyons', and thus suitable for universal quantum computation. Our derivations in this paper rely on explicit computations in the parafermionic conformal field theories that underly these particular quantum Hall states

  1. 29 CFR Appendix I to Part 1918 - Cargo Gear Register and Certificates (Non-mandatory)

    Science.gov (United States)

    2010-07-01

    ...: This register is the standard international form as recommended by the International Labour Office in... establish periodically that they continue to be in safe working order to the satisfaction of a competent... recommended by the International Labour Office. This Register and related certificates shall be kept available...

  2. Coaching "Callings" throughout the Adult Life Cycle.

    Science.gov (United States)

    Hudson, Frederic M.

    2001-01-01

    The process of "callings" continues throughout life. Coaching can connect the present to the future in a meaningful way. Callings represent a value shift requiring revision of the nature and scope of one's central purpose in life and meaningful activities. (JOW)

  3. Exploring Droughts and Floods and Their Association with Cholera Outbreaks in Sub-Saharan Africa: A Register-Based Ecological Study from 1990 to 2010.

    Science.gov (United States)

    Rieckmann, Andreas; Tamason, Charlotte C; Gurley, Emily S; Rod, Naja Hulvej; Jensen, Peter Kjær Mackie

    2018-03-05

    An increased risk for cholera was witnessed during both droughts and floods in sub-Saharan Africa; these findings call for increased preparedness and surveillance during droughts in addition to floods. Cholera outbreaks in Africa have been attributed to both droughts and floods, but whether the risk of a cholera outbreak is elevated during droughts is unknown. We estimated the risk of cholera outbreaks during droughts and floods compared with drought- and flood-free periods in 40 sub-Saharan African countries during 1990-2010 based on data from EM-DAT: the OFDA/CRED International Disaster Database (www.emdat.be). A cholera outbreak was registered in one of every three droughts and one of every 15 floods. We observed an increased incidence rate of cholera outbreaks during drought periods (IRR = 4.3, 95% confidence interval [CI] = 2.9-7.2) and during flood periods (IRR = 144, 95% CI = 101-208) when compared with drought/flood-free periods. Floods are more strongly associated with cholera outbreaks, yet the prevalence of cholera outbreaks is higher during droughts because of droughts' long durations. The results suggest that droughts in addition to floods call for increased cholera preparedness.

  4. 17 CFR 249.332 - Form N-Q, quarterly schedule of portfolio holdings of registered management investment company.

    Science.gov (United States)

    2010-04-01

    ... of portfolio holdings of registered management investment company. 249.332 Section 249.332 Commodity... management investment company. This form shall be used by registered management investment companies, other than small business investment companies registered on Form N-5 (§§ 239.24 and 274.5 of this chapter...

  5. The Italian START-Register on Anticoagulation with Focus on Atrial Fibrillation

    Science.gov (United States)

    2015-01-01

    START-Register – Survey on anTicoagulated pAtients RegisTer – is an independent, inception-cohort, observational, collaborative database aimed at recording prospectively the clinical history of adult patients starting anticoagulant treatment for any reason and using whatever drug. In this article we present the START-Register and give cross section baseline data focusing on non valvular atrial fibrillation (NVAF). Participants are asked to insert prospectively consecutive patients recorded as electronic file on the web-site of the registry. Required data are: demographic and clinical characteristics of patients, associated risk factors for stroke and bleeding, laboratory routine data, clinical indication for treatment, expected therapeutic range (in cases of treatment with vitamin K antagonists -VKAs). The follow-up is carried out to record: quality of treatment (for patients on VKAs), bleeding complications, thrombotic events, and the onset of any type of associated disease. To date 5252 patients have been enrolled; 97.6% were on VKAs because direct oral anticoagulants (DOAC) have been available in Italy only recently. The median age was 74 years [interquartile range (IQR) 64-80]; males 53.7%. This analysis is focused on the 3209 (61.1%) NVAF patients. Mean CHADS2 score was 2.1±1.1, CHADSVASc score was 3.1±1.3;median age was 76 years (IQR 70-81); 168 patients (5.3%) had severe renal failure [Creatinine clearance (CrCl) START-Register data shows that two-third of patients who started chronic anticoagulant treatment had NVAF, one-third of them was > 80 years with high prevalence of renal failure. PMID:26001109

  6. Cross-Cultural Register Differences in Infant-Directed Speech: An Initial Study.

    Directory of Open Access Journals (Sweden)

    Lama K Farran

    Full Text Available Infant-directed speech (IDS provides an environment that appears to play a significant role in the origins of language in the human infant. Differences have been reported in the use of IDS across cultures, suggesting different styles of infant language-learning. Importantly, both cross-cultural and intra-cultural research suggest there may be a positive relationship between the use of IDS and rates of language development, underscoring the need to investigate cultural differences more deeply. The majority of studies, however, have conceptualized IDS monolithically, granting little attention to a potentially key distinction in how IDS manifests across cultures during the first two years. This study examines and quantifies for the first time differences within IDS in the use of baby register (IDS/BR, an acoustically identifiable type of IDS that includes features such as high pitch, long duration, and smooth intonation (the register that is usually assumed to occur in IDS, and adult register (IDS/AR, the type of IDS that does not include such features and thus sounds as if it could have been addressed to an adult. We studied IDS across 19 American and 19 Lebanese mother-infant dyads, with particular focus on the differential use of registers within IDS as mothers interacted with their infants ages 0-24 months. Our results showed considerable usage of IDS/AR (>30% of utterances and a tendency for Lebanese mothers to use more IDS than American mothers. Implications for future research on IDS and its role in elucidating how language evolves across cultures are explored.

  7. Cross-Cultural Register Differences in Infant-Directed Speech: An Initial Study.

    Science.gov (United States)

    Farran, Lama K; Lee, Chia-Cheng; Yoo, Hyunjoo; Oller, D Kimbrough

    2016-01-01

    Infant-directed speech (IDS) provides an environment that appears to play a significant role in the origins of language in the human infant. Differences have been reported in the use of IDS across cultures, suggesting different styles of infant language-learning. Importantly, both cross-cultural and intra-cultural research suggest there may be a positive relationship between the use of IDS and rates of language development, underscoring the need to investigate cultural differences more deeply. The majority of studies, however, have conceptualized IDS monolithically, granting little attention to a potentially key distinction in how IDS manifests across cultures during the first two years. This study examines and quantifies for the first time differences within IDS in the use of baby register (IDS/BR), an acoustically identifiable type of IDS that includes features such as high pitch, long duration, and smooth intonation (the register that is usually assumed to occur in IDS), and adult register (IDS/AR), the type of IDS that does not include such features and thus sounds as if it could have been addressed to an adult. We studied IDS across 19 American and 19 Lebanese mother-infant dyads, with particular focus on the differential use of registers within IDS as mothers interacted with their infants ages 0-24 months. Our results showed considerable usage of IDS/AR (>30% of utterances) and a tendency for Lebanese mothers to use more IDS than American mothers. Implications for future research on IDS and its role in elucidating how language evolves across cultures are explored.

  8. Performance indicators for call centers with impatience

    NARCIS (Netherlands)

    Jouini, O.; Koole, G.M.; Roubos, A.

    2013-01-01

    An important feature of call center modeling is the presence of impatient customers. This article considers single-skill call centers including customer abandonments. A number of different service-level definitions are structured, including all those used in practice, and the explicit computation of

  9. Calling, is there anything special about it?

    African Journals Online (AJOL)

    2016-07-15

    Jul 15, 2016 ... when a pastor is installed or a new candidate is ordained, 'The one who calls you is faithful .... extension to secular work of the dignity of a calling' (Fowler ... For Luther, therefore, the private life of devotion exercised in the.

  10. 76 FR 73521 - Statutory Bar to Appointment of Persons Who Fail To Register Under Selective Service Law

    Science.gov (United States)

    2011-11-29

    ... 3206-AM06 Statutory Bar to Appointment of Persons Who Fail To Register Under Selective Service Law... statutory bar on employment in an Executive agency of an individual who was required to register with the... as follows: Subpart G--Statutory Bar to Appointment of Persons Who Fail To Register Under the...

  11. Ultrasound call detection in capybara

    Directory of Open Access Journals (Sweden)

    Selene S.C. Nogueira

    2012-07-01

    Full Text Available The vocal repertoire of some animal species has been considered a non-invasive tool to predict distress reactivity. In rats ultrasound emissions were reported as distress indicator. Capybaras[ vocal repertoire was reported recently and seems to have ultrasound calls, but this has not yet been confirmed. Thus, in order to check if a poor state of welfare was linked to ultrasound calls in the capybara vocal repertoire, the aim of this study was to track the presence of ultrasound emissions in 11 animals under three conditions: 1 unrestrained; 2 intermediately restrained, and 3 highly restrained. The ultrasound track identified frequencies in the range of 31.8±3.5 kHz in adults and 33.2±8.5 kHz in juveniles. These ultrasound frequencies occurred only when animals were highly restrained, physically restrained or injured during handling. We concluded that these calls with ultrasound components are related to pain and restraint because they did not occur when animals were free of restraint. Thus we suggest that this vocalization may be used as an additional tool to assess capybaras[ welfare.

  12. Student Registered Nurse Anesthetists' Atittudes toward and Perceptions of Teamwork in the Operating Room

    Science.gov (United States)

    Heiner, Jeremy S.

    2013-01-01

    Student registered nurse anesthetists are an important part of an operating room team, yet little research has investigated how they perceive teamwork or approach team related issues specific to the operating room. This mixed methods study evaluated junior and senior student registered nurse anesthetists' attitudes toward and perceptions of…

  13. Spirit at work and hope among the ruins: registered nurses' covenant of care.

    Science.gov (United States)

    Wagner, Joan I J; Gregory, David M

    2015-09-01

    To explore registered nurses' (RNs) perspectives about the health care system, management/leadership, patients and spirit at work (SAW). Researchers investigating RNs experiences of reduced job satisfaction and diminishing organisational commitment are looking carefully at spirit at work as a means to foster healthier workplaces. A descriptive, cross-sectional mixed methods design was used to measure and explore the relationships between spirit at work, job satisfaction and organisational commitment. A 2012 postal survey sent by the provincial licensing body to a random sample of 217 surgical and 158 home care registered nurses' in western Canada returned 179 surveys. Seventy-five respondents answered the open-ended survey question. Their responses warrant further content analysis and serve as the foundation of this article. Participants noted that organisational structures and policies, combined with unsupportive leadership, were associated with a reduced sense of community, lack of trust and diminished accountability. Spirit at work was described as sustaining registered nurses' and providing them with hope as they fulfilled their covenant of care with patients. Leadership attention to the advancement of SAW may support the covenant of care between the registered nurses and patient while fostering healthier workplaces. © 2014 John Wiley & Sons Ltd.

  14. Relabeling the Medications We Call Antidepressants

    Directory of Open Access Journals (Sweden)

    David Antonuccio

    2012-01-01

    Full Text Available This paper raises the question about whether the data on the medications we call antidepressants justify the label of antidepressant. The authors argue that a true antidepressant should be clearly superior to placebo, should offer a risk/benefit balance that exceeds that of alternative treatments, should not increase suicidality, should not increase anxiety and agitation, should not interfere with sexual functioning, and should not increase depression chronicity. Unfortunately, these medications appear to fall short on all of these dimensions. Many of the “side effects” of these medications have larger effect sizes than the antidepressant effect size. To call these medications antidepressants may make sense from a marketing standpoint but may be misleading from a scientific perspective. Consumers deserve a label that more accurately reflects the data on the largest effects and helps them understand the range of effects from these medications. In other words, it may make just as much sense to call these medications antiaphrodisiacs as antidepressants because the negative effects on libido and sexual functioning are so common. It can be argued that a misleading label may interfere with our commitment to informed consent. Therefore, it may be time to stop calling these medications antidepressants.

  15. Position statement. Restructuring, work redesign, and the job and career security of registered nurses. American Nurses Association.

    Science.gov (United States)

    1996-01-01

    The American Nurses Association (ANA) is committed to safeguarding the public, protecting and advancing the careers of professional nurses, supporting individual and collective efforts by registered nurses to protect their clients and enhancing the professional development and job security of registered nurses. As the nation's health care system is restructured, ANA is actively engaged in initiatives to strengthen the economic and general welfare of registered nurses, the safety and care for the public, and, in partnership with the state nurses associations (SNAs), oppose efforts to replace registered nurses with inappropriate substitutes.

  16. Competence of newly qualified registered nurses from a nursing college

    Directory of Open Access Journals (Sweden)

    BG Morolong

    2005-09-01

    Full Text Available The South African education and training system, through its policy of outcomesbased education and training, has made competency a national priority. In compliance to this national requirement of producing competent learners, the South African Nursing Council ( 1999 B require that the beginner professional nurse practitioners and midwives have the necessary knowledge, skills, attitudes and values which will enable them to render efficient professional service. The health care system also demands competent nurse practitioners to ensure quality in health care. In the light of competency being a national priority and a statutory demand, the research question that emerges is, how competent are the newly qualified registered nurses from a specific nursing college in clinical nursing education? A quantitative, non-experimental contextual design was used to evaluate the competence of newly qualified registered nurses from a specific nursing college. The study was conducted in two phases. The first phase dealt with the development of an instrument together with its manual through the conceptualisation process. The second phase focused on the evaluation of the competency of newly qualified nurses using the instrument based on the steps of the nursing process. A pilot study was conducted to test the feasibility of the items of the instrument. During the evaluation phase, a sample of twenty-six newly qualified nurses was selected by simple random sampling from a target population of thirty-six newly qualified registered nurses. However, six participants withdrew from the study. Data was collected in two general hospitals where the newly qualified registered nurses were working. Observation and questioning were used as data collection techniques in accordance with the developed instrument. Measures were taken to ensure internal validity and reliability of the results. To protect the rights of the participants, the researcher adhered to DENOSA’S (1998

  17. Comparison of early socialization practices used for litters of small-scale registered dog breeders and nonregistered dog breeders.

    Science.gov (United States)

    Korbelik, Juraj; Rand, Jacquie S; Morton, John M

    2011-10-15

    OBJECTIVE-To compare early socialization practices between litters of breeders registered with the Canine Control Council (CCC) and litters of nonregistered breeders advertising puppies for sale in a local newspaper. DESIGN-Retrospective cohort study. Animals-80 litters of purebred and mixed-breed dogs from registered (n = 40) and non-registered (40) breeders. PROCEDURES-Registered breeders were randomly selected from the CCC website, and nonregistered breeders were randomly selected from a weekly advertising newspaper. The litter sold most recently by each breeder was then enrolled in the study. Information pertaining to socialization practices for each litter was obtained through a questionnaire administered over the telephone. RESULTS-Registered breeders generally had more breeding bitches and had more litters than did nonregistered breeders. Litters of registered breeders were more likely to have been socialized with adult dogs, people of different appearances, and various environmental stimuli, compared with litters of nonregistered breeders. Litters from registered breeders were also much less likely to have been the result of an unplanned pregnancy. CONCLUSIONS AND CLINICAL RELEVANCE-Among those breeders represented, litters of registered breeders received more socialization experience, compared with litters of nonregistered breeders. People purchasing puppies from nonregistered breeders should focus on socializing their puppies between the time of purchase and 14 weeks of age. Additional research is required to determine whether puppies from nonregistered breeders are at increased risk of behavioral problems and are therefore more likely to be relinquished to animal shelters or euthanized, relative to puppies from registered breeders.

  18. Assisted reproductive technology in Europe, 2006: results generated from European registers by ESHRE

    DEFF Research Database (Denmark)

    de Mouzon, J; Goossens, V; Bhattacharya, S

    2010-01-01

    In this 10th European IVF-monitoring (EIM) report, the results of assisted reproductive techniques from treatments initiated in Europe during 2006 are presented. Data were mainly collected from existing national registers.......In this 10th European IVF-monitoring (EIM) report, the results of assisted reproductive techniques from treatments initiated in Europe during 2006 are presented. Data were mainly collected from existing national registers....

  19. Epidemiological and birth weight characteristics of triplets: a study from the Dutch twin register

    NARCIS (Netherlands)

    Orlebeke, J.F.; Boomsma, D.I.; Eriksson, A.W.

    1993-01-01

    From 112 triplet sets, born in The Netherlands from the end of 1986 to the beginning of 1991 and registered in the Dutch Twin Register, several details such as birth weight, gestational age, zygosity, and etiology were assessed by questionnaire, which was filled out by the mother. For 33 triplet

  20. 13 CFR 102.23 - Publication in the Federal Register-Notices of systems of records.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Publication in the Federal Register-Notices of systems of records. 102.23 Section 102.23 Business Credit and Assistance SMALL BUSINESS... Federal Register upon establishment or revision a notice of the existence and character of any new or...

  1. Overview of registered studies in orthodontics: Evaluation of the ClinicalTrials.gov registry.

    Science.gov (United States)

    Allareddy, Veerasathpurush; Rampa, Sankeerth; Masoud, Mohamed I; Lee, Min Kyeong; Nalliah, Romesh; Allareddy, Veerajalandhar

    2014-11-01

    The Food and Drug Administration Modernization Act of 1997 made it mandatory for all phase II through IV trials regulated by this Act to be registered. After this, the National Institutes of Health created ClinicalTrials.gov, which is a registry of publicly and privately supported clinical studies of human participants. The objective of this study was to examine the characteristics of registered studies in orthodontics. The ClinicalTrials.gov Web site was used to query all registered orthodontic studies. The search term used was "orthodontics." No limitations were placed for the time period. All registered studies regardless of their recruitment status, study results, and study type were selected for analysis. A total of 64 orthodontic studies were registered as of January 1, 2014. Of these, 52 were interventional, and 12 were observational. Close to 60% of the interventional studies and 66.7% of the observational studies had sample sizes of 50 or fewer subjects. About 21.2% of the interventional studies and 16.7% of the observational studies had sample sizes greater than 100. Only 1 study was funded by the National Institutes of Health, and the rest were funded by "other" or "industry" sources. Close to 87.7% of the interventional studies were randomized. Interventional model assignments included factorial assignment (3.9%), parallel assignments (74.5%), crossover assignment (7.8%), and single-group assignment (13.7%). Most studies were treatment oriented (80.4%). The types of masking used by the interventional studies included open label (28.9%), single blind (44.2%), and double blind (26.9%). Outcome assessors were blinded in only 6 studies. Orthodontic studies registered in ClinicalTrials.gov are dominated by small single-center studies. There are wide variations with regard to treatment allocation approaches and randomization methods in the studies. These results also indicate the need for multicenter clinical studies in orthodontics. Copyright © 2014

  2. The Barbados Emergency Ambulance Service: High Frequency of Nontransported Calls

    Directory of Open Access Journals (Sweden)

    Sherwin E. Phillips

    2012-01-01

    Full Text Available Objectives. There are no published studies on the Barbados Emergency Ambulance Service and no assessment of the calls that end in nontransported individuals. We describe reasons for the nontransport of potential clients. Methods. We used the Emergency Medical Dispatch (Medical Priority Dispatch System instrument, augmented with five local call types, to collect information on types of calls. The calls were categorised under 7 headings. Correlations between call types and response time were calculated. Results. Most calls were from the category medical (54%. Nineteen (19% percent of calls were in the non-transported category. Calls from call type Cancelled accounted for most of these and this was related to response time, while Refused service was inversely related (. Conclusions. The Barbados Ambulance Service is mostly used by people with a known illness and for trauma cases. One-fifth of calls fall into a category where the ambulance is not used often due to cancellation which is related to response time. Other factors such as the use of alternative transport are also important. Further study to identify factors that contribute to the non-transported category of calls is necessary if improvements in service quality are to be made.

  3. Electronic shift register memory based on molecular electron-transfer reactions

    Science.gov (United States)

    Hopfield, J. J.; Onuchic, Jose Nelson; Beratan, David N.

    1989-01-01

    The design of a shift register memory at the molecular level is described in detail. The memory elements are based on a chain of electron-transfer molecules incorporated on a very large scale integrated (VLSI) substrate, and the information is shifted by photoinduced electron-transfer reactions. The design requirements for such a system are discussed, and several realistic strategies for synthesizing these systems are presented. The immediate advantage of such a hybrid molecular/VLSI device would arise from the possible information storage density. The prospect of considerable savings of energy per bit processed also exists. This molecular shift register memory element design solves the conceptual problems associated with integrating molecular size components with larger (micron) size features on a chip.

  4. Volkswagen's new modular TDI {sup registered} generation; Die neue modulare TDI {sup registered} -Generation von Volkswagen

    Energy Technology Data Exchange (ETDEWEB)

    Neusser, Heinz-Jakob; Kahrstedt, Joern; Jelden, Hanno; Engler, Hermann-Josef; Dorenkamp, Richard; Jauns-Seyfried, Stefanie; Krause, Andreas [Volkswagen AG, Wolfsburg (Germany)

    2012-11-01

    The new generation of TDI {sup registered} engines is an extension of the Volkswagen brand's modular strategy. The power train development focused closely on engine properties, fuel consumption and performance. The modular design concept provides the foundation for meeting challenges of the future, including new legislation and regional and state requirements. The new and enhanced modules for this new engine generation are presented, together with component combinations and including the engine management functions developed specially for the purpose. (orig.)

  5. Clinical leadership, structural empowerment and psychological empowerment of registered nurses working in an emergency department.

    Science.gov (United States)

    Connolly, Megan; Jacobs, Stephen; Scott, Karyn

    2018-04-19

    To examine clinical leadership of registered nurses in an emergency department, based on evidence that it is important for nurses to feel psychologically and structurally empowered in order to act as clinical leaders. Every registered nurse has the ability to act as a clinical leader. Clinical leadership is the registered nurse's behaviours that provide direction and support to patients and the team in the delivery of patient care. This study explores the connection between the need for structural and psychological empowerment and clinical leadership behaviours. A mixed method, non-experimental survey design was used to examine the psychological empowerment, structural empowerment and clinical leadership of registered nurses working in an emergency department. Emergency department nurses believe they show clinical leadership behaviours most of the time, even though their sense of being psychologically empowered is only moderate. While registered nurses believe they perform clinical leadership behaviours, it is also clear that improvements in structural and psychological empowerment would improve their ability to act as clinical leaders. The results show that for nurses to be able to provide clinical leadership to their patients and colleagues, management must create empowering environments. © 2018 John Wiley & Sons Ltd.

  6. An International Comparison of the Instigation and Design of Health Registers in the Epidemiological Response to Major Environmental Health Incidents.

    Science.gov (United States)

    Behbod, Behrooz; Leonardi, Giovanni; Motreff, Yvon; Beck, Charles R; Yzermans, Joris; Lebret, Erik; Muravov, Oleg I; Bayleyegn, Tesfaye; Wolkin, Amy Funk; Lauriola, Paolo; Close, Rebecca; Crabbe, Helen; Pirard, Philippe

    Epidemiological preparedness is vital in providing relevant, transparent, and timely intelligence for the management, mitigation, and prevention of public health impacts following major environmental health incidents. A register is a set of records containing systematically collected, standardized data about individual people. Planning for a register of people affected by or exposed to an incident is one of the evolving tools in the public health preparedness and response arsenal. We compared and contrasted the instigation and design of health registers in the epidemiological response to major environmental health incidents in England, France, Italy, the Netherlands, and the United States. Consultation with experts from the 5 nations, supplemented with a review of gray and peer-reviewed scientific literature to identify examples where registers have been used. Populations affected by or at risk from major environmental health incidents in England, France, Italy, the Netherlands, and the United States. Nations were compared with respect to the (1) types of major incidents in their remit for considering a register; (2) arrangements for triggering a register; (3) approaches to design of register; (4) arrangements for register implementation; (5) uses of registers; and (6) examples of follow-up studies. Health registers have played a key role in the effective public health response to major environmental incidents, including sudden chemical, biological, radiological, or nuclear, as well as natural, more prolonged incidents. Value has been demonstrated in the early and rapid deployment of health registers, enabling the capture of a representative population. The decision to establish a health register must ideally be confirmed immediately or soon after the incident using a set of agreed criteria. The establishment of protocols for the instigation, design, and implementation of health registers is recommended as part of preparedness activities. Key stakeholders must be

  7. 17 CFR 274.129 - Form N-PX, annual report of proxy voting record of registered management investment company.

    Science.gov (United States)

    2010-04-01

    ... proxy voting record of registered management investment company. 274.129 Section 274.129 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) FORMS PRESCRIBED UNDER THE INVESTMENT... registered management investment company. This form shall be used by registered management investment...

  8. How indicative is a self-reported driving behaviour profile of police registered traffic law offences?

    DEFF Research Database (Denmark)

    Martinussen, Laila Marianne; Møller, Mette; Prato, Carlo Giacomo

    2017-01-01

    of reliable predictors of safe or unsafe driving behaviour. Given this background, the aim of this study was to test whether driver sub-groups identified based on self-reported driving behaviour and skill differed in registered traffic law offences and accidents, and whether group membership was predictive...... from the Danish Driving License Register. Results show that the driver sub-groups differed significantly in registered traffic offences but not in registered accidents. In a logistic regression analysis, the sub-group “Violating unsafe drivers” was found predictive of having a traffic offence, even...... when socio-demographic variables and exposure were controlled for. The most important predictive factor, however, was having a criminal record for non-traffic offences, while gender, living without a partner, and being self-employed also had a significant effect. The study confirms the use of the DBQ...

  9. Supporting child witnesses during identification lineups: Exploring the effectiveness of registered intermediaries.

    Science.gov (United States)

    Wilcock, Rachel; Crane, Laura; Hobson, Zoe; Nash, Gilly; Kirke-Smith, Mimi; Henry, Lucy A

    2018-01-01

    Performance at identification lineup was assessed in eighty-five 6- to 11-year-old typically developing children. Children viewed a live staged event involving 2 male actors, and were asked to identify the perpetrators from 2 separate lineups (one perpetrator-present lineup and one perpetrator-absent lineup). Half the children took part in lineups adapted by a registered intermediary (an impartial, trained professional who facilitates understanding and communication between vulnerable witnesses and members of the justice system), and half took part in "best-practice" lineups, according to the current guidance for eyewitness identification in England and Wales. Children receiving assistance from a registered intermediary (relative to children who received best-practice lineups) were more accurate in their identifications for perpetrator-present lineups, and there was some evidence that they were also more accurate for perpetrator-absent lineups. This provides the first empirical evidence for the effectiveness of registered intermediary support during identification lineups.

  10. Levelling-out and register variation in the translations of experienced and inexperienced translators: a corpus-based study

    Directory of Open Access Journals (Sweden)

    Karien Redelinghuys

    2016-07-01

    Full Text Available Explicitation, simplification, normalisation and levelling-out, the four features of translation proposed by Baker (1996, have attracted considerable attention in translation studies. Although the first three have been studied extensively, levelling-out has been the subject of less empirical investigation. Furthermore, there are no studies to date that have investigated the extent to which levelling-out occurs in translations by experienced translators and inexperienced translators. In this study, levelling-out is operationalised in terms of register. It is hypothesised that less register variation will be apparent in translations by inexperienced translators and, in keeping with the features of translation hypothesis, it is predicted that select linguistic features will demonstrate less register variation in translations than in non-translations. A custom-built corpus was compiled to test these hypotheses. While some light is shed on how translation expertise contributes to register sensitivity and the distribution of certain features across different registers, little evidence could be found for levelling-out as register variation is evident in the translation corpora.

  11. Development of a CCD based system called DIGITRACK for automatic track counting and evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Molnar, J.; Somogyi, G.; Szilagyi, S.; Sepsy, K. (Magyar Tudomanyos Akademia, Debrecen. Atommag Kutato Intezete)

    1984-01-01

    We have developed, to the best of our knowledge, the first automatic track analysis system (DIGITRACK) in which the video signals are processed by a new type of video-receiver called charge-coupled device (CCD). The photosensitive semi-conductor device is a 2.5 cm long line imager of type Fairchild CCD 121HC which converts one row of the picture seen through a low magnification microscope into 1728 binary signals by a thresholding logic. The picture elements are analysed by a microcomputer equipped with two INTEL 8080 microprocessors and interfaced to a PDP-11/40 computer. The microcomputer also controls the motion of the stage of microscope. For pattern recognition and analysis a software procedure is developed which is able to differentiate between overlapping tracks and to determine the number, surface opening and x-y coordinates of the tracks occurring in a given detector area. The distribution of track densities and spot areas on the detector surface can be visualized on a graphic display. The DIGITRACK system has been tested for analysis of alpha-tracks registered in CR-39 and LR-115 detectors.

  12. Antimicrobial Products Registered for Disinfection Use against Avian Influenza on Poultry Farms and Other Facilities

    Science.gov (United States)

    EPA registers disinfectants against Avian Influenza A. Although there are no antimicrobial products registered for the H5N2 subtype of Avian Influenza A virus, based on available scientific information these products will work against other HPAI strains.

  13. Sleep Quality of Call Handlers Employed in International Call Centers in National Capital Region of Delhi, India

    Directory of Open Access Journals (Sweden)

    JD Raja

    2016-10-01

    suspicion of insomnia or suspected insomnia; the rest had no sleep problem. Smoking, poor social support, heavy workload, lack of relaxation facility at office, and prolonged travel time to office were independent predictors of sleep quality (p<0.05. Conclusion: Call handlers have to compromise upon their sleep owing to the contemporary work settings in call centers. Safeguarding their health becomes an occupational health challenge to public health specialists.

  14. Consumer Experiences Calling Toll-Free Corporate Hotlines.

    Science.gov (United States)

    Martin, Charles L.; Smart, Denise T.

    1994-01-01

    Finds that dimensions that contribute to caller satisfaction (of toll-free corporate hotlines) included operator characteristics such as knowledge, courtesy, and interest; specific behaviors such as apologizing for a problem, thanking the consumer for calling, and encouraging them to call again; and reducing time placed on "hold." (SR)

  15. Call center performance with direct response advertising

    NARCIS (Netherlands)

    M. Kiygi Calli (Meltem); M. Weverbergh (Marcel); Ph.H.B.F. Franses (Philip Hans)

    2017-01-01

    textabstractThis study investigates the manpower planning and the performance of a national call center dealing with car repairs and on the road interventions. We model the impact of advertising on the capacity required. The starting point is a forecasting model for the incoming calls, where we take

  16. Knowledge, attitude, and preventive practice survey regarding AIDS comparing registered to freelance commercial sex workers in Iloilo City, Philippines.

    Science.gov (United States)

    Liu, T I; So, R

    1996-12-01

    A survey of female commercial sex workers (CSW) in Iloilo City, Philipines, was conducted in October and November 1995 to determine the level of knowledge, attitudes, and preventive practices regarding HIV/AIDS to guide future education programs. CSWs in the Philippines were categorized as registered or freelance. Registered CSWs included "hospitality girls" from licensed bars, night clubs, and massage parlors who have registered with the local social hygiene clinic (SHC). Freelance CSWs are not registered. 110 registered and 46 freelance CSWs were surveyed. We compared demographic data, scores from a basic knowledge test, and preventive practices between registered and freelance CSWs. Demographic data indicate that registered CSWs often originate from provinces outside of the Visayan Islands (25%) and most have never been married (93%). Freelance CSWs included more married (11%) and separated (11%) women from nearby cities. Knowledge test scores of registered and freelance CSWs were not significantly different. 90-96% of CSWs correctly answered questions regarding modes of transmission. However, 25% still believed it is possible to contract AIDS from using a public restroom. Registered and freelance CSWs believed their risks for AIDS to be equally great. However, 38% of freelance CSWs admit to never or almost never using condoms compared to 15% of registered CSWs. Licensed establishments and a support staff at the social hygiene clinic may provide a relatively structured working environment, giving registered CSWs security and confidence to insist on condom use. In most cases, condom use seems to depend on male customer compliance, and CSWs, especially freelancers, cannot afford to insist on condom use. The CSWs indicated that they learned most about AIDS through health personnel and television.

  17. 17 CFR 240.19g2-1 - Enforcement of compliance by national securities exchanges and registered securities associations...

    Science.gov (United States)

    2010-04-01

    ... national securities exchanges and registered securities associations with the Act and rules and regulations... Enforcement of compliance by national securities exchanges and registered securities associations with the Act... associated with its members, a national securities exchange or registered securities association is not...

  18. 78 FR 79298 - Securities Exempted; Distribution of Shares by Registered Open-End Management Investment Company...

    Science.gov (United States)

    2013-12-30

    ...] Securities Exempted; Distribution of Shares by Registered Open- End Management Investment Company...) 551-6792, Investment Company Rulemaking Office, Division of Investment Management, U.S. Securities and... Distribution of shares by registered open-end management investment company. * * * * * (g) If a plan covers...

  19. Establishing a Twin Register : An Invaluable Resource for (Behavior) Genetic, Epidemiological, Biomarker, and 'Omics' Studies

    NARCIS (Netherlands)

    Odintsova, Veronika V; Willemsen, Gonneke; Dolan, Conor V; Hottenga, Jouke-Jan; Martin, Nicholas G; Slagboom, P Eline; Ordoñana, Juan R; Boomsma, Dorret I

    2018-01-01

    Twin registers are wonderful research resources for research applications in medical and behavioral genetics, epidemiology, psychology, molecular genetics, and other areas of research. New registers continue to be launched all over the world as researchers from different disciplines recognize the

  20. 49 CFR 592.6 - Duties of a registered importer.

    Science.gov (United States)

    2010-10-01

    ... marking requirements of the theft prevention standard (part 541 of this chapter); or (ii) The vehicle... SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION (CONTINUED) REGISTERED IMPORTERS OF VEHICLES NOT ORIGINALLY MANUFACTURED TO CONFORM TO THE FEDERAL MOTOR VEHICLE SAFETY STANDARDS § 592.6 Duties of a...