WorldWideScience

Sample records for regiones organizadoras nucleares

  1. Cariotipo y regiones organizadoras del nucleolo del pez sapo marino Halobatrachus didactylus (Schneider, 1801) (Pisces: Batrachoididae)

    OpenAIRE

    Palazón, J. L.; Nirchio, M.; Sarasquete, C.

    2003-01-01

    Se estudió el cariotipo convencional (Giemsa) y las Regiones Organizadoras del Nucleolo (NOR) en el pez sapo marino Halobatrachus didactylus. El número diploide de cromosomas 2n = 46 estuvo compuesto de 8 elementos metacéntricos, 12 submetacéntricos y 26 acrocéntricos (NF = 66). No fueron observados cromosomas sexuales heteromórficos en esta especie. Los cromosomas metacéntricos fueron fácilmente clasificados como pares homólogos según su morfología y la relación longitud del brazo largo/long...

  2. Nuclear power regional analysis

    International Nuclear Information System (INIS)

    Parera, María Delia

    2011-01-01

    In this study, a regional analysis of the Argentine electricity market was carried out considering the effects of regional cooperation, national and international interconnections; additionally, the possibilities of insertion of new nuclear power plants in different regions were evaluated, indicating the most suitable areas for these facilities to increase the penetration of nuclear energy in national energy matrix. The interconnection of electricity markets and natural gas due to the linkage between both energy forms was also studied. With this purpose, MESSAGE program was used (Model for Energy Supply Strategy Alternatives and their General Environmental Impacts), promoted by the International Atomic Energy Agency (IAEA). This model performs a country-level economic optimization, resulting in the minimum cost for the modelling system. Regionalization executed by the Wholesale Electricity Market Management Company (CAMMESA, by its Spanish acronym) that divides the country into eight regions. The characteristics and the needs of each region, their respective demands and supplies of electricity and natural gas, as well as existing and planned interconnections, consisting of power lines and pipelines were taken into account. According to the results obtained through the model, nuclear is a competitive option. (author) [es

  3. Cooperation in regional nuclear training

    International Nuclear Information System (INIS)

    Newstead, C.M.; Lee, D.S.; Spitalnik, J.

    1985-01-01

    This paper presents an overview of the nuclear training currently being undertaken in the countries of the co-authors, and considers the degree to which training problems are amenable to common solutions such as cooperative regional training programs. Different types of cooperation are discussed including the development of regional and international training centers, cooperative bilateral and multilateral training, and the proposed US International Nuclear Safety Training Academy. The paper provides suggestions of ways for enhancing regional cooperation

  4. Nuclear safety in crisis regions

    International Nuclear Information System (INIS)

    Ustohalova, Veronika; Englert, Matthias

    2017-01-01

    The use of nuclear energy demands extensive institutional and material infrastructure upon a foundation of stable intrastate conditions and interstate relations. Conflicts can result in catastrophic accidents, either deliberately or unintentionally. If there are nuclear facilities located in a crisis region, the risk of a nuclear disaster is markedly heightened. This can be explained not only in terms of the strategic relevance of the energy supply in military conflicts, but also the increased accident risks and hazards arising from collateral damage, as well as the erosion of the safety culture and institutional control in crisis regions with a nuclear infrastructure. Even just the escalation of a political dispute or the persistence of low intensity conflicts can make it generally more difficult and complex to maintain nuclear safety, if intrastate safety mechanisms come under strain or even fail as a result. So far no instance of military escalation, past or present, has led to an accident in a civil nuclear facility. Nevertheless, questions are clearly raised about the vulnerability of nuclear facilities in crisis regions and the risks associated with this vulnerability. Despite the potentially far-reaching consequences, too little attention is currently being paid to the linkage between intra- and interstate conflicts and the safety of nuclear facilities in crisis regions. The aim of the research presented here was to explore this theme and, after laying the groundwork in this manner, to raise awareness among policy-makers and the wider public. In this context the escalation of conflicts in the Ukraine is a particular focus. The first part of the report begins with a systematic look at the link between crisis regions and/or conflicts and nuclear safety. The various impact pathways relating to nuclear facility safety and the associated risks are described in relation to potential hazards induced by crises and wars. A nuclear facility can itself become a theatre

  5. Nuclear safety in crisis regions

    Energy Technology Data Exchange (ETDEWEB)

    Ustohalova, Veronika; Englert, Matthias

    2017-04-12

    The use of nuclear energy demands extensive institutional and material infrastructure upon a foundation of stable intrastate conditions and interstate relations. Conflicts can result in catastrophic accidents, either deliberately or unintentionally. If there are nuclear facilities located in a crisis region, the risk of a nuclear disaster is markedly heightened. This can be explained not only in terms of the strategic relevance of the energy supply in military conflicts, but also the increased accident risks and hazards arising from collateral damage, as well as the erosion of the safety culture and institutional control in crisis regions with a nuclear infrastructure. Even just the escalation of a political dispute or the persistence of low intensity conflicts can make it generally more difficult and complex to maintain nuclear safety, if intrastate safety mechanisms come under strain or even fail as a result. So far no instance of military escalation, past or present, has led to an accident in a civil nuclear facility. Nevertheless, questions are clearly raised about the vulnerability of nuclear facilities in crisis regions and the risks associated with this vulnerability. Despite the potentially far-reaching consequences, too little attention is currently being paid to the linkage between intra- and interstate conflicts and the safety of nuclear facilities in crisis regions. The aim of the research presented here was to explore this theme and, after laying the groundwork in this manner, to raise awareness among policy-makers and the wider public. In this context the escalation of conflicts in the Ukraine is a particular focus. The first part of the report begins with a systematic look at the link between crisis regions and/or conflicts and nuclear safety. The various impact pathways relating to nuclear facility safety and the associated risks are described in relation to potential hazards induced by crises and wars. A nuclear facility can itself become a theatre

  6. Regional cooperation on nuclear safety

    International Nuclear Information System (INIS)

    Kato, W.Y.; Chen, J.H.; Kim, D.H.; Simmons, R.B.V.; Surguri, S.

    1985-01-01

    A review has been conducted of a number of multi-national and bilateral arrangements between governments and between utility-sponsored organizations which provide the framework for international cooperation in the field of nuclear safety. These arrangements include the routine exchange operational data, experiences, technical reports and regulatory data, provision of special assistance when requested, collaboration in safety research, and the holding of international conferences and seminars. Areas which may be better suited for cooperation on a regional basis are identified. These areas include: exchange of operational data and experience, sharing of emergency planning information, and collaboration in safety research. Mechanisms to initiate regional cooperation in these areas are suggested

  7. Regional cooperation in nuclear energy development

    International Nuclear Information System (INIS)

    Chung, K.; Muntzing, L.M.

    1987-01-01

    In November 1985, PBNCC (the Pacific Basin Nuclear Cooperation Committee) was formally established. Currently six Pacific Basin members have been participating in PBNCC: Canada, Japan, South Korea, Mexico, Taiwan of Chian, and the United States of America. The People's Republic of China has sent observes to the PBNCC meetings. The technical contents of PBWCC working groups are as follows: 1. Regional cooperative for pooled spare parts of nuclear power plants and inventory management; 2. Regional cooperation in nuclear training; 3. Regional cooperation on nuclear safety; 4. Regional cooperation in Codes and Standards; 5. Regional Cooperation in public acceptance; 6. Regional cooperation on radwaste management. (Liu)

  8. Regional conflicts and nuclear fears

    International Nuclear Information System (INIS)

    Subrahmanyam, K.

    1984-01-01

    The real danger of nuclear weapons in the Third World is not that developing countries will acquire them, but that advanced countries will intervene in Third World affairs with them. Nuclear weapons can play a part in Third World conflicts in two ways: a recognized nuclear weapon power can threaten to use the weapon in the conflict situation or a clandestine nuclear power may do so. In noting that most conflicts in the Third World can be sustained only through support from the developing countries, the author complains that the Non-Proliferation Treaty is pernicious because it legitimizes the use of nuclear weapons by a few weapon powers. He urges a two-step effort to pressure the North Atlantic Treaty Organization and the United Nations to make nuclear weapons illegal. 17 references

  9. Nuclear energy and comprehension of the region

    International Nuclear Information System (INIS)

    Kim, Gyeong Dong; Hong, Du Seung

    1992-12-01

    This book explains the comprehension of nuclear energy with making approaches to social science. So it deals with disposal of radiation active waste as an social issue, recognition to nuclear energy of people and understanding of the region and support for the development of the region. It introduces two Anti-nuclear energy movements happened in Anmyondo and Yeongdeok. It reports these two cases approached with the method of social science.

  10. Regional cooperation on nuclear instrument maintenance

    International Nuclear Information System (INIS)

    1991-04-01

    Proper nuclear instrument maintenance is the essential precondition for any experimental work in nuclear sciences and technology. With the rapidly increasing sophistication of nuclear instrumentation, and considering the rather specific conditions that prevail in many IAEA Member States, this topic is gaining in importance, and has a strong economic implication. There is a general opinion that a regional, and possibly interregional cooperation in the field might be advantageous, and economically beneficial to all participating parties. The experience in such cooperation is limited, but sufficient that some reliable observations can be made, some conclusion can be drawn, and some recommendation for the possible future development can be presented

  11. Regional analysis of the nuclear-electricity

    International Nuclear Information System (INIS)

    Parera, M. D.

    2011-11-01

    In this study was realized a regional analysis of the Argentinean electric market contemplating the effects of regional cooperation, the internal and international interconnections; and the possibilities of insert of new nuclear power stations were evaluated in different regions of the country, indicating the most appropriate areas to carry out these facilities to increase the penetration of the nuclear energy in the national energy matrix. Also was studied the interconnection of the electricity and natural gas markets, due to the existent linking among both energy forms. With this purpose the program Message (Model for energy supply strategy alternatives and their general environmental impacts) was used, promoted by the International Atomic Energy Agency. This model carries out an economic optimization level country, obtaining the minimum cost as a result for the modeling system. The division for regions realized by the Compania Administradora del Mercado Mayorista Electrico (CAMMESA) was used, which divides to the country in eight regions. They were considered the characteristics and necessities of each one of them, their respective demands and offers of electric power and natural gas, as well as their existent and projected interconnections, composed by the electric lines and gas pipes. According to the results obtained through the model, the nuclear-electricity is a competitive option. (Author)

  12. Regional economic impacts of nuclear power plants

    International Nuclear Information System (INIS)

    Isard, W.; Reiner, T.; Van Zele, R.; Stratham, J.

    1976-08-01

    This study of economic and social impacts of nuclear power facilities compares a nuclear energy center (NEC) consisting of three surrogate sites in Ocean County, New Jersey with nuclear facilities dispersed in the Pennsylvania - New Jersey - Maryland area. The NEC studied in this report is assumed to contain 20 reactors of 1200 MW(e) each, for a total NEC capacity of 24,000 MW(e). Following the Introductory chapter, Chapter II discusses briefly the methodological basis for estimating impacts. This part of the analysis only considers impacts of wages and salaries and not purchase of construction materials within the region. Chapters III and IV, respectively, set forth the scenarios of an NEC at each of three sites in Ocean County, N.J. and of a pattern of dispersed nuclear power plants of total equivalent generating capacity. In each case, the economic impacts (employment and income) are calculated, emphasizing the regional effects. In Chapter V these impacts are compared and some more general conclusions are reported. A more detailed analysis of the consequences of the construction of a nuclear power plant is given in Chapter VI. An interindustry (input-output) study, which uses rather finely disaggregated data to estimate the impacts of a prototype plant that might be constructed either as a component of the dispersed scenario or as part of an NEC, is given. Some concluding remarks are given in Chapter VII, and policy questions are emphasized

  13. US Nuclear Regulatory Commission region IV

    International Nuclear Information System (INIS)

    Vanderburch, C.

    1996-01-01

    The NRC has established a policy to provide for the timely through and systematic inspection of significant operational events at nuclear power plants. This includes the use of an Augmented Inspection Team to determine the causes, conditions, and circumstances relevant to an event and to communicate its findings and conclusions to NRC management. In accordance with NRC Inspection Manual Chapter 0325. The Region IV Regional Administrator dispatched an Augmented Inspection Team to the Wolf Creek Nuclear Generating Station to review the circumstances surrounding a manual reactor trip on January 30, 1996, with the failure of five control rods to fully insert into the core, a failure of the turbine-driven auxiliary feedwater pump, and the subsequent loss of one train of the essential service water system

  14. Climatic Effects of Regional Nuclear War

    Science.gov (United States)

    Oman, Luke D.

    2011-01-01

    We use a modern climate model and new estimates of smoke generated by fires in contemporary cities to calculate the response of the climate system to a regional nuclear war between emerging third world nuclear powers using 100 Hiroshima-size bombs (less than 0.03% of the explosive yield of the current global nuclear arsenal) on cities in the subtropics. We find significant cooling and reductions of precipitation lasting years, which would impact the global food supply. The climate changes are large and longlasting because the fuel loadings in modern cities are quite high and the subtropical solar insolation heats the resulting smoke cloud and lofts it into the high stratosphere, where removal mechanisms are slow. While the climate changes are less dramatic than found in previous "nuclear winter" simulations of a massive nuclear exchange between the superpowers, because less smoke is emitted, the changes seem to be more persistent because of improvements in representing aerosol processes and microphysical/dynamical interactions, including radiative heating effects, in newer global climate system models. The assumptions and calculations that go into these conclusions will be described.

  15. Centro Regional de Ciencias Nucleares (a Brazilian regional center for nuclear sciences) - activities report - 1999

    International Nuclear Information System (INIS)

    1999-12-01

    The annual activities report of 1999 of nuclear sciences regional center - Brazilian organization - introduces the next main topics: institutional relations; sectorial actions - logistic support and training, laboratory of radiation protection and dosimetry, laboratory of metrology, laboratory of chemical characterization; technical and scientific events; and financial resources and perspectives for 2000

  16. Regional nuclear fuel cycle centers study project

    International Nuclear Information System (INIS)

    Bennett, L.; Catlin, R.G.; Meckoni, V.

    1977-01-01

    The concept of regional fuel cycle centers (RFCC) has attracted wide interest. The concept was endorsed by many countries in discussions at the General Conference of the International Atomic Energy Agency and at the General Assembly of the United Nations. Accordingly, in 1975, the IAEA initiated a detailed study of the RFCC concept. The Agency study has concentrated on what is referred to as the ''back-end'' of the fuel cycle because that is the portion which is currently problematic. The study covers transport, storage, processing and recycle activities starting from the time the spent fuel leaves the reactor storage pools and through all steps until the recycled fuel is in finished fuel elements and shipped to the reactor. A detailed evaluation of the specific features of large regional fuel cycle centers established on a multinational basis vis-a-vis smaller dispersed fuel cycle facilities set up on a national basis has been carried out. The methodology for assessment of alternative strategies for fuel storage, reprocessing, and recycling of plutonium has been developed, characteristic data on material flows and cost factors have been generated, and an analytic system has been developed to carry out such evaluations including appropriate sensitivity analysis. Studies in related areas on institutional and legal, organizational, environmental, materials control and other essential aspects have also been made. The material developed during the course of this Study would enable any group of interested Member States to examine and work out alternative strategies pertinent to their present and projected nuclear fuel cycle needs, as well as evolve institutional, legal and other appropriate frameworks or agreements for the establishment of fuel cycle centers on a multinational cooperative basis

  17. A reference regional nuclear fuel centre

    International Nuclear Information System (INIS)

    1978-01-01

    A nuclear fuel centre groups the facilities for spent fuel reprocessing, plutonium fuel fabrication, waste conditioning, and interim storage on a single site. The technical aspects of safety and protection, and the socio-economic consequences of two types of centre have been studied. The reference centre has an initial reprocessing capacity of 1500 tonnes. This capacity is quadrupled by the construction of two new units in 15 years. The other centre considered is a quarter of this size. A description is given of the processes used, the personal and capital requirements for construction and operation of the plant, the transport of radioactive waste and products, and the quantities involved. The local radiological impact is low and could be further reduced to a level well below that of natural radioactivity. The resulting increase in economic activity, employment, income redistribution and the new infrastructure requirements are estimated for a rural or semi-rural region. Measures to prevent tension are proposed. The impact of the host country's balance of payments, finances, employment situation and technological knowhow is evaluated. The original centre is compared with equivalent facilities scattered geographically

  18. Fourth Regional Meeting: Nuclear Energy in Central Europe, Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Mavko, B; Cizelj, L [eds.; Nuclear Society of Slovenia (Slovenia)

    1997-07-01

    Fourth Regional Meeting for Nuclear Energy in Central Europe is an annual meeting of the Nuclear Society of Slovenia. The proceedings contain 89 articles from Slovenia, surrounding countries and countries of the Central and Eastern European Region. Topics are: Research Reactors, Reactor Physics, Probabilistic Safety Assessment, Severe Accidents, Ageing and Integrity, Thermal Hydraulics, NPP Operation Experiance, Radioactive Waste Management, Environment and Other Aspects, Public and Nuclear Energy, SG Replacement and Plant Uprating.

  19. Regional and global significance of nuclear energy

    International Nuclear Information System (INIS)

    Schilling, H.D.

    1995-01-01

    Measures to combat poverty and improve the standard of living in countries of the Third World will inevitably boost global demand for energy, and energy conservation measures will not be able to offset this increase. Nuclear energy will regain significance in the framework of approaches adopted to resolve the energy problem, which primarily is an ecologic problem created by an extremely large flow of materials. The extraordinarily high energy density of nuclear fuels can contribute to markedly reduce the flow of materials; and at that, electric energy is an efficient substitute for primary energy forms. Thus nuclear electricity generation is of double benefit to the ecology. Engineering goals in nuclear technology thus gain a service aspect, with progress in power plant engineering and design aiming not only at enhanced engineered safety, but also at regaining public acceptance of and confidence in nuclear power plant technology. (orig./UA) [de

  20. Present state of the perception gap of nuclear energy between Japanese nuclear energy supplying region and an energy consuming region

    International Nuclear Information System (INIS)

    Ohnishi, Teruaki

    2002-01-01

    Public opinion surveys have been carried out since 1998 on what phase and on what extent of the perception of nuclear energy differs between Japanese dwelling in energy supplying region and an energy-consuming region. Southern Fukui rural district where 15 nuclear reactors are now installed and Osaka urban region of about 100 km apart from Fukui were selected as the respective targets for the energy supplying and consuming regions. Analyses of the data of about 3000 samples have revealed the followings. (1) The public in the nuclear energy supplying region are very friendly to nuclear energy so that only about 20 and 39 of the public are resistive to the general promotion of nuclear energy in Japan and to the construction of another nuclear reactor in their dwelling region, respectively. (2) On the other hand, in the energy-consuming region those respective fractions are 41 and 70 implying strong resistance to nuclear energy in the urban region. (3) Both the degree of interest in and the degree of knowledge on nuclear energy are very low, whereas the extent of fear to nuclear is high for the urban public. (4) Not only the fraction of the public who are satisfied with their present life, but the public fraction who is eagerly support the thought of return-to-nature are very high in the urban region. (5) On the other hand, in the energy supplying region, many peoples eagerly want their life to become more convenient than it is now, and 6) all those trends (I)-(5) are revealed more pronouncedly in the woman than the man. The perception gap of nuclear energy thus became clear between Japanese dwelling in rural and urban regions. On the basis of this knowledge, discussions on the nature of the so-called NIMBY will be made from the socio-psychological viewpoint and propositions will also be made on the methods to dissolve the perception gap of that soft. (author)

  1. Nuclear developments in the Asia and Pacific region

    International Nuclear Information System (INIS)

    1990-07-01

    Countries in the Asia and Pacific region are engaged in many aspects of nuclear science and technology, often as part of national development plan. A number of them are members of the Regional Cooperative Agreement for Research, Development and Training Related to Nuclear Science and Technology which was developed under the auspices of the International Atomic Energy Agency to provide a basis for nuclear technical assistance and cooperation in the Asia and Pacific region. The report describes nuclear developments, from power and research reactors to reprocessing facilities, in these countries. The information was gathered from a range of sources, including relevant journals, publications of the International Atomic Energy Agency, the OECD/ Nuclear Energy Agen, and annual reports of national nuclear institutes. 4 tabs

  2. Coordination of nuclear developments in the Asia-Pacific region

    International Nuclear Information System (INIS)

    Wakabayashi, H.; An, S.

    1984-01-01

    Healthy, coordinated development of nuclear energy in the Asia-Pacific region requires the securing of human resources. This is an important component of development and should be well designed in advance, notwithstanding the fact that each country and area has its own unique system for nuclear research, education, and training. Differences are even more pronounced where preparedness for nuclear abnormal occurrences are concerned, despite the international impact of such incidents. From this point of view, we examine the current situation in international education and training of nuclear specialists, encompassing nuclear education and training systems, IAEA efforts, bilateral and multilateral transregional cooperation, and matters relating to national and transnational preparedness for nuclear abnormal occurrences. We present a proposal to create a regional center that would establish cooperation in nuclear research, education, training, and preparedness for abnormal occurrences. (author)

  3. A survey on the regional characteristics of public's nuclear recognition

    International Nuclear Information System (INIS)

    Ohnishi, Teruaki; Tsujimoto, Tadashi

    1999-03-01

    A public opinion survey was made to obtain fundamental data for the further enhancement of nuclear public acceptance. After processing and making insight into those obtained data, some proposals were made regarding the methodology of nuclear PRs activity to be taken hereafter. The survey was made in October 1998, for respective 1000 and 500 samples in the northern and southern regions of Fukui prefecture by the door-to-door method, and 1000 samples in the urban region of Kinki district and 350 nuclear specialists both by the mailing method. Questionnaires are to clarify the degree of public's recognition of nuclear energy relative to the other sciences and technologies, which include the degrees of contact with and reliance on the newsmedia, the degrees of interest in and attention to the science and technology along with nuclear technologies, the yes-or-no to the promotion of nuclear generation and so on. The obtained data were processed with the attributes of objects, from which data it became clear the remarkable difference of the extend to understanding of nuclear information between two genders, and the peculiarity of the degree of attention to nuclear news for the public in southern Fukui compared to the other public. It was also found the difference of the recognition of nuclear energy between the general public and nuclear specialists, indicating the clear estrangement between technical safety and social easiness in nuclear energy. Some proposals useful for the further acceptance of nuclear energy were made from the viewpoint of PRs activity. (author)

  4. Nuclear Power in the Asia-Pacific region

    International Nuclear Information System (INIS)

    Smith, K.R.

    1982-01-01

    To understand the role of nuclear energy in Asia today, it is important to recognize that nuclear technology has had a long period of development in the region and has helped shape present Asian political and economic patterns. Nuclear power shares with some of the renewable energy systems the problem of capital intensiveness and technological uncertainty, which tends to prevent both from becoming economically attractive during rapid changes in the oil market. The economic and physical risks associated with nuclear power expansion are likely to lead to low growth rates, although nuclear power will remain an important way to help reduce oil dependency. 156 references, 4 figures, 10 tables

  5. United States - Japanese nuclear relations: implications for the pacific region

    International Nuclear Information System (INIS)

    Suttmeier, R.P.

    1980-01-01

    The initiation of a new approach to non-proliferation policy by the United States in 1977 was the most upsetting development in the history of US-Japanese nuclear relations. The policy has seemingly altered Japanese views of its own nuclear future very little, yet it has altered the tone of the nuclear relationship with the United States. Recent Japanese nuclear power developments, both technical and administrative, are outlined and the prospects for the future of the United States-Japanese nuclear relationship and for Pacific regional cooperation assessed. Issues of importance in the relationship include reprocessing - enrichment, plutonium management, spent fuel and waste management and uranium supplies

  6. Inevitability of nuclear power in the Asian region

    International Nuclear Information System (INIS)

    Jain, S.K.

    2010-01-01

    The Asian region, most populous and fastest growing in terms of economic growth, has countries with lowest per capita energy/electricity consumption. Barring the Middle East, the rest of the region is, by and large, modest in conventional energy resources. This is also a region where large sections of population suffer from income inequality and inadequate economic development. Economic growth and quality of life of a population depend heavily on per capita availability of energy/electricity, and thus there is an urgent need to increase the per capita electricity production/consumption in the region. Unlike in the past, it is the Asian region that is poised to dwarf the today's developed world in new capacity addition in the coming years. This fact alone asks for sensible choices to be made. Also, the Asian region is quite vulnerable to the effects of climate change, given the geography and population distribution. Today, governments must seriously consider the environmental impact of electricity generation, in order to help mitigate global warming and its consequences. Nuclear power, being environmentally benign, affords sustainability at the very outset. But that's not all. The other compelling reasons in favour of nuclear power are its compact nature as a source of energy and the promise of long-term energy security. Nuclear power is, therefore, inevitable for the region. Recognising this, the rapidly developing countries in the region - such as India and China - are pursuing ambitious nuclear power programmes, while several other countries in the region are also planning to embark on the nuclear power route for electricity generation. As nuclear power is inherently technology-intensive, there is a need for greater cooperation, to reach out to countries that presently do not have the technology base for starting nuclear power programmes on their own. Even in the countries with established commercial nuclear power programmes, there is a need to reach out to the

  7. Nuclear developments in the Asia and Pacific region

    International Nuclear Information System (INIS)

    McMillan, M.J.; Silver, J.M.

    1993-07-01

    Countries in this part of the world are engaged in many aspects of nuclear science and technology, often as part of a national development plan. A number of them are members of the Regional Cooperative Agreement (RCA) for Research, Development and Training Related to Nuclear Science and Technology which was developed under the auspices of the International Atomic Energy Agency to provide a basis for nuclear technical assistance and cooperation in the Asia and Pacific region. In contrast to North America and most of western Europe, where growth in installed nuclear generating capacity has ceased, a number of regional countries are planning, ordering and building new power reactors to meet their increasing demands for electricity. Major fuel cycle facilities, such as commercial enrichment and reprocessing plants in Japan, are also being developed. This report describes nuclear developments from power and research reactors to reprocessing facilities in countries of the Asia and Pacific region listed in alphabetical order. Power Reactor and Research Reactors programs in the region as well as lists of regional centres with irradiation facilities are presented in the appendixes The information was gathered from a range of sources, including relevant journals, publications of the International Atomic Energy Agency (IAEA), the OECD/Nuclear Energy Agency(NEA), and annual reports of national nuclear institutes. 1 tab., ill

  8. Palo Verde Nuclear Generating Station: an example of the state role in regional nuclear projects

    International Nuclear Information System (INIS)

    Pasternak, A.

    1980-10-01

    A nuclear power plant siting policy which confines new construction to existing sites will lead to the formation of large regional power centers, each involving many utilities from several states. The Palo Verde Nuclear Project in Arizona has been examined in terms of the role state regulation plays in large regional nuclear projects. State regulatory processes do not reflect the regional nature of large power centers. Decisions and actions by individual state regulatory commissions create risk and uncertainty for all the utility participants in regional projects. A climate and mechanism to encourage and facilitate interstate cooperation are needed to enhance the viability of the confined siting policy and the regional power center concept

  9. Regional comparison of nuclear and fossil electric power generation costs

    International Nuclear Information System (INIS)

    Bowers, H.I.

    1984-01-01

    Nuclear's main disadvantages are its high capital investment cost and uncertainty in schedule compared with alternatives. Nuclear plant costs continue to rise whereas coal plant investment costs are staying relative steady. Based on average experience, nuclear capital investment costs are nearly double those of coal-fired generation plants. The capital investment cost disadvantage of nuclear is balanced by its fuel cost advantages. New base load nuclear power plants were projected to be competitive with coal-fired plants in most regions of the country. Nuclear power costs wre projected to be significantly less (10% or more) than coal-fired power costs in the South Atlantic region. Coal-fired plants were projected to have a significant economic advantage over nuclear plants in the Central and North Central regions. In the remaining seven regions, the levelized cost of power from either option was projected to be within 10%. Uncertainties in future costs of materials, services, and financing affect the relative economics of the nuclear and coal options significantly. 10 figures

  10. Reflections about nuclear power for the Asia-Pacific region

    International Nuclear Information System (INIS)

    Rose, D.J.; Wakabayashi, H.

    1984-01-01

    This introductory essay touches briefly on the following: fuel supply, energy security, cost, environment, health, prevention of nuclear war, lead time for construction of plants, size of reactors, nuclear wastes, finance, planning, economics, energy policy, CO 2 buildup from fossil fuels, what kind of reactor best in the circumstances, high technology, electric utilities, generating capacity, accidents, labour productivity, regional cooperation. (U.K.)

  11. Nuclear power developments in the Asia-Pacific region

    International Nuclear Information System (INIS)

    Irwin, T.

    2001-01-01

    There are 438 nuclear power reactors operating in the world. Of these, 95 are in the Asia-Pacific region. Of the 36 reactors currently under construction in the world, 19 are in the Asia-Pacific region. Of the 44 planned reactors in the world, 36 are in this region. At the start of the 'New Nuclear Century' the Asia-Pacific region has become the main area for growth and innovation in nuclear power. This paper describes the nuclear power developments in each country and examines the status of the construction programme and the planned projects. Countries included are China, India, Japan, Democratic People's Republic of Korea (DPRK), Republic of Korea, Pakistan and Taiwan. New projects include the HTR in China, Advance Breeder Water Reactors in Japan, KEDO in the DPRK and the Advance Pressurised Water Reactor in the Republic of Korea

  12. Variation of nuclear radii in the drip line regions

    CERN Document Server

    Beiner, M; Mas, D

    1976-01-01

    The authors are concerned with predictions of the energy density method with respect to the nuclear sizes (RMS radii). It is known that the commonly accepted A/sup 1/3/-type laws are only approximative and deviations are expected to grow significantly as one goes away from the beta -stability region. Particular attention is paid to the variation of nuclear radii in the drip line regions. Implications of the resulting large total Coulomb energy variations between neighbouring nuclei will be emphasized.

  13. Third Regional Meeting: Nuclear Energy in Central Europe, Proceedings

    International Nuclear Information System (INIS)

    Stritar, A.; Jencic, I.

    1996-01-01

    Third Regional Meeting for Nuclear Energy in Central Europe is an annual meeting of the Nuclear Society of Slovenia. The proceedings contain 71 articles from Slovenia, surrounding countries and countries of the Central and Eastern European Region. Topics are: Research Reactors, Reactor Physics, Probabilistic Safety Assessment, Severe Accident management, Thermal Hydraulics, NPP Operation, Radioactive Waste Management, Main Components Integrity, Environment and Other Aspects and Public Information

  14. Third Regional Meeting: Nuclear Energy in Central Europe, Proceedings

    Energy Technology Data Exchange (ETDEWEB)

    Stritar, A; Jencic, I [Nuclear Society of Slovenia (Slovenia); eds.

    1996-07-01

    Third Regional Meeting for Nuclear Energy in Central Europe is an annual meeting of the Nuclear Society of Slovenia. The proceedings contain 71 articles from Slovenia, surrounding countries and countries of the Central and Eastern European Region. Topics are: Research Reactors, Reactor Physics, Probabilistic Safety Assessment, Severe Accident management, Thermal Hydraulics, NPP Operation, Radioactive Waste Management, Main Components Integrity, Environment and Other Aspects and Public Information.

  15. Nuclear power as a regional energy supply

    International Nuclear Information System (INIS)

    MacLoon, Frank.

    1983-02-01

    The author describes the Point Lepreau nuclear power plant and its impact on the electric power grid and the economy of the small province of New Brunswick. The 600 MW CANDU reactor is considered suitable for small operations and has an excellent world record. Although nuclear energy has high capital costs, its fuel costs are low, thus rendering it comparatively inflation free. Its fuel costs of 3 to 4 mills are contrasted with 40 mills for oil-fuelled units. The cost advantage of uranium over coal and oil permits New Brunswick to put aside funds for waste management and decommissioning. Regulatory streamlining is needed to reduce both expense and time of construction. The CANDU system is ideally suited to providing base load, with coal as an intermediate load supply and hydro for peaking. There is room for tidal power as a future part of the mix

  16. Centro Regional de Ciencias Nucleares (a Brazilian regional center for nuclear sciences) - activities report - 1999; Centro Regional de Ciencias Nucleares - relatorio de atividades - 1999

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-12-01

    The annual activities report of 1999 of nuclear sciences regional center - Brazilian organization - introduces the next main topics: institutional relations; sectorial actions - logistic support and training, laboratory of radiation protection and dosimetry, laboratory of metrology, laboratory of chemical characterization; technical and scientific events; and financial resources and perspectives for 2000.

  17. Nuclear energy in Asia and regional co-operation

    International Nuclear Information System (INIS)

    Ishii, M.

    1997-01-01

    There is increasing concern in East Asia about regional cooperation in the field of nuclear power. At the APEC conference in Osaka in 1995, APEC (Asia Pacific Economic Cooperation) established an Energy Research Center. The center has started to perform joint research forecasts on energy supply and demand for the region. Japan proposed the inauguration of a Conference on Nuclear Safety in Asia at the Moscow Nuclear Energy Summit in 1996. The first conference was held in Tokyo that year. This year, the conference will be held in Seoul. Japan's Atomic Energy Commission sponsors the International Conference for Nuclear Cooperation in Asia every year. This year marks the eighth conference. The outstanding feature of this year's conference was that so many countries stressed regional cooperation. South Korea proposed the installation of a regional online radiation monitoring system. The Philippines asserted the need for a cooperative mechanism on the lines of ASIATOM. Why is so much concern now being focused on nuclear power cooperation in East Asia? What kind of regional cooperation is necessary, and what kind is possible? What are the unique features of nuclear power cooperation in East Asia? These are the points addressed in this paper. (author)

  18. Educational activity on nuclear energy in Aomori region

    International Nuclear Information System (INIS)

    Abe, Katsunori

    2008-01-01

    There are many nuclear industries and research facilities in Aomori Prefecture, Japan. Fuel cycle facilities and a LWR power station are now in operation. Another fuel cycle facilities and power stations will soon be under construction. Fusion research activity, ITER-BA, has started last year. We have launched nuclear-related education and research programs to teach nuclear engineering knowledge and skills to the local students. Hachinohe Institute of Technology is located on Pacific ocean side of Aomori Prefecture close to Rokkasho area, and has six undergraduate departments and three graduate courses. Hitherto, many alumni have engaged in nuclear-related companies in the area. In addition to previous subject on nuclear engineering, a new activity 'Challenge Nuclear-site Experience Program' started in 2007, as one of nuclear educational promotion programs in Japan. The students from various engineering departments learned the status and role of nuclear industries and researches. A curriculum course for nuclear engineering will be ready in 2009 for undergraduate students through various departments. In the summer of 2007, the introductory lesson on nuclear power generation and the technical tour to the power station were carried out for two days. In the autumn, the introductory lesson on nuclear fuel cycle and the tour to fuel cycle facilities were performed for three days, including one day tour to research facilities in the area. Its aim was to let the students recognize the role of regional nuclear activities and the attractiveness of nuclear-related industries. The program was supported by Ministry of Economy, Trade and Industry and was performed in cooperation with Tohoku Electric Power Company, Japan Nuclear Fuel Limited and Japan Atomic Energy Agency. (author)

  19. A survey on the regional characteristics of public's nuclear recognition

    International Nuclear Information System (INIS)

    Ohnishi, Teruaki; Okada, Osami; Tsujimoto, Tadashi

    2001-03-01

    Public opinion surveys were carried out to clarify the difference of nuclear perception of the public dwelling near the region of nuclear power station and the public in the urban region. A simulation model using the data obtained up to this time was developed to make clear the regional dependence of the public's perception of nuclear energy, and the secular variation of public opinion for nuclear energy corresponding to the two regions cited above was numerically studied by this model. In our surveys, a convenient method using the Internet, together with the ordinary mailing method were adopted to compare the two types of data thus obtained by the different methods and to study the feasibility of the Internet method. The questionnaires in these surveys are, for instance, the extent of the public recognition of energy in general and nuclear energy, the recognition of inhabitant's poll, and the public's attitude to the mass media, with the objective region of Reinan in Fukui prefecture and the urban region in Kinki district for the case of mailing method, and the whole region in our country for the Internet method. By the simulation model of multi-particle type with the input data obtained by our surveys, the behavior of secular variation of nuclear opinion and the effect of PA activity were numerically studied. The present status of public perception and recognition of nuclear energy became clear as a result of our surveys. It was found that the Internet is a quite useful mean to carry out the opinion survey with a low cost in a short time, and that the multi-particle model can be a useful tool to numerically evaluate the effect of PA activity. (author)

  20. Nuclear Medicine Imaging in the Dentomaxillofacial Region.

    Science.gov (United States)

    Wassef, Heidi R; Colletti, Patrick M

    2018-07-01

    Nuclear medicine studies evaluate physiology on a molecular level providing earlier detection of lesions before morphologic change is evident. 99m Tc-MDP and 18 F-fluoride bone scans detect osteomyelitis earlier than radiographs and computed tomography (CT); aid in diagnosis of temporomandibular joint disorder; and evaluate activity of condylar hyperplasia, extent of Paget disease, and viability of bone grafts. 18 F-FDG PET/CT distinguish between soft tissue and bone infections and diagnose osteomyelitis complicated by fracture or surgery. FDG PET is more accurate than CT alone and has a major role in staging, restaging, and assessing response to therapy for head and neck malignancies and in detecting sequelae of therapy. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. Some thoughts on nuclear cooperation in the Asia Pacific region

    International Nuclear Information System (INIS)

    Djaloeis, Azhar

    2001-01-01

    The paper describes some thoughts of the author on the importance of the role of nuclear cooperation in the Asia-Pacific region in giving significant contributions to the development of the individual countries and to the region as a whole. The paper focuses on the role of nuclear science and technology and the importance of nuclear cooperation in the Asia-Pacific region, in particular to meet the challenges and opportunities in the new millennium. The paper starts off with a brief discussion on some important aspects of the Asia-Pacific region in view of its strategic location and its vast potential in terms of human and natural resources. Some of the major needs, challenges and opportunities in association with a future vision are briefly presented in terms of areas of activities that can be supported by the application of nuclear science and technology. The paper then discusses some ideas on how to further strengthen the nuclear cooperation in the Asia-Pacific region, followed by some concluding remarks and suggestions. (author)

  2. Trends in radiopharmaceutical dispensing in a regional nuclear pharmacy

    International Nuclear Information System (INIS)

    Basmadjian, G.P.; Johnston, J.; Barker, K.; Ice, R.D.

    1982-01-01

    Dispensing trends for radiopharmaceuticals at a regional nuclear pharmacy over a 51-month period were studied. dispensing records of a regional nuclear pharmacy were analyzed with a forecasting procedure that uses univariate time data to produce time trends and autoregressive models. The overall number of prescriptions increased from 3500 to 5500 per quarter. Radiopharmaceuticals used in nuclear cardiology studies increased from less than 0.1% to 17.5% of total prescriptions dispensed, while radiopharmaceuticals used for brain imaging showed a steady decline from 29% to 11% of total prescriptions dispensed. The demand for other radiopharmaceuticals increased in areas such as renal studies, bone studies, lung studies, liver-function studies, and 67 Ga tumor-uptake studies, and declined slightly for static liver studies. Changes in dispensing trends for radiopharmaceuticals will continue as the practice of nuclear medicine concentrates more on functional studies and as newer imaging techniques become used for other purposes

  3. Energy options and regional cooperation on nuclear energy in the Asia-Pacific region

    International Nuclear Information System (INIS)

    Shin, Jae In

    1986-10-01

    This paper reviews the extensive forms of Asia-Pacific regional cooperation in nuclear power to develop and provide economical and reliable energy supply for sound economical growths of developing countries in this region, which has seen rapid growth of energy consumption more than anywhere else in recent years. Nuclear power has received keen attention from DCs because it can provide a self-reliable energy supply and promote development of high technology in the associated engineering and manufacturing industries locally. However, due to the particular characteristics in nuclear power technology, a close cooperation is required between the seller(industrialized) and buyer(developing) countries. The Asia-Pacific regional cooperation in nuclear power is a step toward providing mutual benefits to the countries involved in this region, and this paper explores potential ways in formulating basic and systematic approaches and areas of full scope cooperation. (author)

  4. Nuclear waste disposal: regional options for the Western Pacific

    International Nuclear Information System (INIS)

    Childs, I.

    1985-01-01

    The disposal of nuclear waste is a complex environmental problem involving the technology of containing a radiation hazard and the political problem of finding an acceptable site for a hazardous waste facility. The focus of discussion here is the degree to which Western Pacific countries are committed to nuclear power as an energy source, and the political and economic interdependencies in the region which will influence waste disposal options

  5. Nuclear-weapon-free zones in the Asia Pacific region

    International Nuclear Information System (INIS)

    Yamada, Eiji

    1997-01-01

    The Review and Extension Conference of the Parties to the Non-Proliferation Treaty decided on the indefinite extension of the Treaty, and adopted two documents 'principles and Objectives for Nuclear Non-Proliferation and Disarmament' and 'Strengthening the Review Process for the Treaty'. In the former document, the Conference encourages the establishment of nuclear-weapon-free zones, on the conviction that such zones will enhance global and regional peace and security. Besides the Rarotonga Treaty, ASEAN countries plan to establish a nuclear-weapon-free zone in the South-East Asia

  6. Regional projections of nuclear and fossil electric power generation costs

    International Nuclear Information System (INIS)

    Smolen, G.R.; Delene, J.G.; Fuller, L.C.; Bowers, H.I.

    1983-12-01

    The total busbar electric generating costs were estimated for locations in ten regions of the United States for base load nuclear and coal-fired power plants with a startup date of January 1995. A complete data set is supplied which specifies each parameter used to obtain the comparative results. When the comparison is based on reference cost parameters, nuclear- and coal-fired generation costs are found to be very close in most regions of the country. Nuclear power is favored in the South Atlantic region where coal must be transported over long distances, while coal-fired generation is favored in the Central and North Central regions where large reserves of cheaply mineable coal exist. The reference data set reflects recent electric utility construction experience. Significantly lower nuclear capital investment costs would result if regulatory reform and improved construction practices were instituted. The electric power generation costs for base load oil- and natural gas-fired plants were also estimated. These plants were found to be noncompetitive in all regions for those scenarios most likely to develop. Generation cost sensitivity to changes in various parameters was examined at a reference location. The sensitivity parameters included capital investment costs, lead times, capacity factors, costs of money, and coal and uranium prices. In addition to the levelized lifetime costs, year-by-year cash flows and revenue requirements are presented. The report concludes with an analysis of the economic merits of recycling spent fuel in light-water reactors

  7. Nuclear Hybrid Energy Systems Regional Studies: West Texas & Northeastern Arizona

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, Humberto E. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Chen, Jun [Idaho National Lab. (INL), Idaho Falls, ID (United States); Kim, Jong Suk [Idaho National Lab. (INL), Idaho Falls, ID (United States); McKellar, Michael George [Idaho National Lab. (INL), Idaho Falls, ID (United States); Deason, Wesley R [Idaho National Lab. (INL), Idaho Falls, ID (United States); Vilim, Richard B. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Bragg-Sitton, Shannon M. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Boardman, Richard D. [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2015-04-01

    The primary objective of this study is to conduct a preliminary dynamic analysis of two realistic hybrid energy systems (HES) including a nuclear reactor as the main baseload heat generator (denoted as nuclear HES or nuclear hybrid energy systems [[NHES]) and to assess the local (e.g., HES owners) and system (e.g., the electric grid) benefits attainable by the application of NHES in scenarios with multiple commodity production and high penetration of renewable energy. It is performed for regional cases not generic examples based on available resources, existing infrastructure, and markets within the selected regions. This study also briefly addresses the computational capabilities developed to conduct such analyses, reviews technical gaps, and suggests some research paths forward.

  8. Consequences of Regional Scale Nuclear Conflicts and Acts of Individual Nuclear Terrorism

    Science.gov (United States)

    Toon, O. B.; Turco, R. P.; Robock, A.; Bardeen, C.; Oman, L.; Stenchikov, G. L.

    2006-12-01

    The number of nuclear warheads in the world has fallen by about a factor of three since its peak in 1986. However, the potential exists for numerous regional nuclear arms races, and for a significant expansion in the number of nuclear weapons states. Eight countries are known to have nuclear weapons, 2 are constructing them, and an additional 32 nations already have the fissile material needed to build weapons if they so desire. Population and economic activity worldwide are congregated to an increasing extent in "megacities", which are ideal targets for nuclear weapons. We find that low yield weapons, which new nuclear powers are likely to construct, can produce 100 times as many fatalities and 100 times as much smoke from fires per kt yield as high-yield weapons, if they are targeted at city centers. A single low-yield nuclear detonation in an urban center could lead to more fatalities, in some cases by orders of magnitude, than have occurred in major historical conflicts. A regional war between the smallest current nuclear states involving 100 15-kt explosions (less than 0.1% of the explosive yield of the current global nuclear arsenal) could produce direct fatalities comparable to all of those worldwide in World War II (WW-II), or to those once estimated for a "counterforce" nuclear war between the superpowers. Portions of megacities attacked with nuclear devices or exposed to fallout of long-lived isotopes, through armed conflict or terrorism, would likely be abandoned indefinitely, with severe national and international implications. Smoke from urban firestorms in a regional war might induce significant climatic and ozone anomalies on global scales. While there are many uncertainties in the issues we discuss here, the major uncertainties are the type and scale of conflict that might occur. Each of these potential hazards deserves careful analysis by governments worldwide advised by a broad section of the world scientific community, as well as widespread

  9. The nuclear power industry in the Asia-Pacific region

    International Nuclear Information System (INIS)

    Lester, R.K.

    1984-01-01

    The development of the nuclear reactor industry in the Pacific Basin began in the United States and Canada and spread to Japan and, more recently, to South Korea and Taiwan. The American and Canadian industries face serious economic and political difficulties; indeed, their current plight is so severe that their survival no longer seems assured. Because of the key regional role played up to now by the North American industries, and by the U.S. industry in particular, the realization of this scenario would have important repercussions for nuclear trade and investment throughout the region. In the longer run some basic structural changes would seem likely, with the focal point of industrial strength and technological leadership in the region shifting to Northeast Asia, and to Japan in particular. Already there is evidence of this shift. But the prospect of a smooth, gradual transition toward a new regional industrial structure centered on Japan may be misleading. What is missing from this picture is a full measure of the extent to which nuclear industrial development elsewhere in the region is positively correlated with the trend in the United States. (author)

  10. Nuclear fuel cycle synergies and regional scenarios for Europe

    International Nuclear Information System (INIS)

    Salvadores, M.; Romanello, V.; Schwenk-Ferrero, A.; Boucher, L.; Meyer, M.

    2009-01-01

    Regional strategies can provide a useful framework for implementing innovative nuclear fuel cycles. The appropriate sharing of efforts and facilities among different countries is necessary in today's context, as is taking into account proliferation concerns and resource optimisation. The preliminary studies examined in this report show that the expected benefits deriving from partitioning and transmutation (P and T), notably the reduction of radiotoxicity and heat load in a shared repository, can bring advantages to all countries of the region concerned, even when different nuclear energy policies are pursued. The studies also demonstrate that regional strategies tend to favour a nuclear renaissance in some countries. A regional approach is proposed in order to implement the innovative fuel cycles associated with partitioning and transmutation in Europe. The impact of different deployment strategies and policies in various countries is addressed. Regional facilities characteristics and potential deployment schedules are also discussed. Further studies should be undertaken to investigate practical issues (fuel transport in particular) and institutional issues which will, without doubt, be very challenging. (authors)

  11. A Nuclear Third Party Liability Regime of a Multilateral Nuclear Approaches Framework in the Asian Region

    Directory of Open Access Journals (Sweden)

    Makiko Tazaki

    2014-01-01

    Full Text Available There are two primary challenges for establishing nuclear third party liability (TPL regimes within multilateral nuclear approaches (MNA to nuclear fuel cycle facilities in the Asian region. The first challenge is to ensure secure and prompt compensation, especially for transboundary damages, which is also a challenge for a nation-based facility. One possible solution is that in order to share common nuclear TPL principles, all states in the region participate in the same international nuclear TPL convention, such as the Convention on Supplementary Compensation for Nuclear Damage (CSC, with a view to its entry into force in the future. One problem with this approach is that many states in the Asian region need to raise their amount of financial security in order to be able to participate in the CSC. The second challenge lies with the multiple MNA member states and encompasses the question of how decisions are to be made and responsabilities of an installation state are to be shared in case of a nuclear incident. Principally, a host state of the MNA facility takes on this responsibility. However, in certain situations and in agreement with all MNA member states, such responsibilities can be indirectly shared among all MNA member states. This can be done through internal arrangements within the MNA framework, such as reimbursement to a host state based on pre-agreed shares in accordance with investment and/or making deposits on such reimbursements in case of an incident.

  12. A regional proposal for reinforcing nuclear and radiological security

    International Nuclear Information System (INIS)

    Puig, Diva

    2008-01-01

    This paper gives information about the phenomenon of globalization and the regional process of integration that have generated new and challenging characteristics in criminal actions, that has generated a trans national dimension. In this frame, the illicit trafficking of radioactive material is a matter of concern. After the terrorist attacks of September 11, 2001, it is a new reality that for certain terrorist groups, exposition to radiation ionizing with the purpose of committing a terrorist act is not more an obstacle. The use of a 'dirty bomb'. by terrorists is considered probable. The orphan sources represent a serious threat to security and must be: identified, located, recovered, and assured. Many radioactive materials with hundreds of applications in medicine, research and industry are lost or robbed. There are countries that have not a registry of such orphan sources. The IAEA Illicit Trafficking Data Base (ITDB) was established in 1993.There were 103 confirmed incidents of illicit trafficking and other unauthorized activities involving nuclear and radioactive materials in 2005. Nevertheless INTERPOL registers a much greater number of cases. The IAEA tries to increase the capacity of Member States to protect their facilities and nuclear fuels, storage and transport against acts of nuclear terrorism. In this paper I propose the creation of an Inter-American Committee Specialized in the Prevention and Control of the Illicit Trafficking of Radioactive and Nuclear Material at Pan-American level and within the framework of O.A.S., according to the Chart of the Organization of American States , and considering the respect to the sovereignty of the States and the principle of not intervention, with the purpose of developing the cooperation in order to prevent and to prevent and to control the illicit trafficking of radioactive and nuclear material. Its principal objective would be to develop a cooperation and a common approach of nuclear and radiological

  13. The Role of Nuclear Power in Hungary, a Regional Comparison

    International Nuclear Information System (INIS)

    Cserhati, A.

    2016-01-01

    The presentation and paper are giving the broad picture on the country's nuclear competence and the atomic electricity production in international appraisal. The Central and Eastern Europe (CEE) region nuclear statistics were compiled by the author and appear in compact, easily understandable graphical form: Worldwide and regional figures of nuclear share for electricity generation. Types of operating nuclear power plant units. Age and performance (cumulative load factors) of units. Power uprate history of affected units. Status of the long term operation (or by earlier name: lifetime extension) projects. The cycle length expansion is a transition from 12 to 15 month fuel cycle, as a pioneering initiative of Paks NPP for efficiency increase of VVER-440 type. New build trends will be outlined in general for the world, Europe and the CEE region. The last topic is the Hungarian path to Paks-5 and Paks-6 completion. Preparatory projects (Teller and Levai), establishment of the Paks II company. Potential suppliers and types for the new build (AREVA EPR, ATMEA Atmea1, KEPCO/KHNP APR1400, Rosatom AES-2006, Toshiba-Westinghouse AP1000). Intergovernmental agreement with Russian Federation for building of two 1200 MW units. Financing of 80 percent of the investment by Russian loan with moderate interest rates. Planned schedule of the new build. EC infringement procedures. Public acceptance. (author).

  14. Dynamic performance analysis of two regional Nuclear Hybrid Energy Systems

    International Nuclear Information System (INIS)

    Garcia, Humberto E.; Chen, Jun; Kim, Jong S.; Vilim, Richard B.; Binder, William R.; Bragg Sitton, Shannon M.; Boardman, Richard D.; McKellar, Michael G.; Paredis, Christiaan J.J.

    2016-01-01

    In support of more efficient utilization of clean energy generation sources, including renewable and nuclear options, HES (hybrid energy systems) can be designed and operated as FER (flexible energy resources) to meet both electrical and thermal energy needs in the electric grid and industrial sectors. These conceptual systems could effectively and economically be utilized, for example, to manage the increasing levels of dynamic variability and uncertainty introduced by VER (variable energy resources) such as renewable sources (e.g., wind, solar), distributed energy resources, demand response schemes, and modern energy demands (e.g., electric vehicles) with their ever changing usage patterns. HES typically integrate multiple energy inputs (e.g., nuclear and renewable generation) and multiple energy outputs (e.g., electricity, gasoline, fresh water) using complementary energy conversion processes. This paper reports a dynamic analysis of two realistic HES including a nuclear reactor as the main baseload heat generator and to assess the local (e.g., HES owners) and system (e.g., the electric grid) benefits attainable by their application in scenarios with multiple commodity production and high renewable penetration. It is performed for regional cases – not generic examples – based on available resources, existing infrastructure, and markets within the selected regions. This study also briefly addresses the computational capabilities developed to conduct such analyses. - Highlights: • Hybrids including renewables can operate as dispatchable flexible energy resources. • Nuclear energy can address high variability and uncertainty in energy systems. • Nuclear hybrids can reliably provide grid services over various time horizons. • Nuclear energy can provide operating reserves and grid inertia under high renewables. • Nuclear hybrids can greatly reduce GHG emissions and support grid and industry needs.

  15. Trends in radiopharmaceutical dispensing in a regional nuclear pharmacy

    International Nuclear Information System (INIS)

    Basmadjian, G.P.; Barker, K.; Johnston, J.; Stinchcomb, R.; Tarman, B.; Ice, R.D.

    1983-01-01

    In the last five years, the practice of nuclear medicine has undergone changes due to the advent of new imaging technologies and radiopharmaceuticals. These changes have had an impact upon the number and the type of radiopharmaceuticals dispensed in centralized nuclear pharmacies. With the advent of Computerized Axial Tomography Scanners (CAT), sophistication and wider acceptance of the Ultrasound imaging modality, nuclear medicine has had to change directions from utilizing radiopharmaceuticals for static organ imaging to functional type imaging and to resort to the use of new radiopharmaceuticals or to find other uses for the existing radiopharmaceuticals. The following trends in radiopharmaceutical dispensing in a regional nuclear pharmacy are evident: Brain procedures have declined by about 67% while nuclear cardiology studies have increased by over 2000%. Bone scans have increased by 72% while liver, renal and lung studies have shown no significant increase. These changes will continue as the practice of nuclear medicine concentrates more on functional studies and relegates other studies to newer imaging modalities

  16. Nucleopolis for promoting the nuclear excellence of the Normandy region

    International Nuclear Information System (INIS)

    2016-01-01

    Nucleopolis is the Norman economic pole dedicated to nuclear energy, nuclear medicine and nuclear safety, it gathers about 70 enterprises whatever their sizes, research laboratories and teaching or training units. Nucleopolis was founded in 2009 with the economic development of the region as a unique purpose. Nucleopolis will ease the access of its members to local, national and international markets through actions of networking and by promoting innovations and skill development. Nucleopolis proposes to its members a series of services around 4 departments: Nucleo'Network to promote networking between the members themselves and between the members and major contractors; Nucleo'Business to propose assistance in national and international business; Nucleo'Competence to propose adequate training to its members to upgrade their skills and Nucleo'Innovation to foster collaborative work between its members on innovative projects. (A.C.)

  17. Decadal reduction of Chinese agriculture after a regional nuclear war

    Science.gov (United States)

    Xia, Lili; Robock, Alan; Mills, Michael; Stenke, Andrea; Helfand, Ira

    2015-02-01

    A regional nuclear war between India and Pakistan could decrease global surface temperature by 1°C-2°C for 5-10 years and have major impacts on precipitation and solar radiation reaching Earth's surface. Using a crop simulation model forced by three global climate model simulations, we investigate the impacts on agricultural production in China, the largest grain producer in the world. In the first year after the regional nuclear war, a cooler, drier, and darker environment would reduce annual rice production by 30 megaton (Mt) (29%), maize production by 36 Mt (20%), and wheat production by 23 Mt (53%). With different agriculture management—no irrigation, auto irrigation, 200 kg/ha nitrogen fertilizer, and 10 days delayed planting date—simulated national crop production reduces 16%-26% for rice, 9%-20% for maize, and 32%-43% for wheat during 5 years after the nuclear war event. This reduction of food availability would continue, with gradually decreasing amplitude, for more than a decade. Assuming these impacts are indicative of those in other major grain producers, a nuclear war using much less than 1% of the current global arsenal could produce a global food crisis and put a billion people at risk of famine.

  18. Climate and chemistry effects of a regional scale nuclear conflict

    OpenAIRE

    Stenke A.; Hoyle C. R.; Luo B.; Rozanov E.; Groebner J.; Maag L.; Broennimann S.; Peter T.

    2013-01-01

    Previous studies have highlighted the severity of detrimental effects for life on Earth after an assumed regionally limited nuclear war. These effects are caused by climatic, chemical and radiative changes persisting for up to one decade. However, so far only a very limited number of climate model simulations have been performed, giving rise to the question how realistic previous computations have been. This study uses the coupled chemistry climate model (CCM) SOCOL, which belongs to a...

  19. Prospects for regional cooperation. Regional cooperation in remote monitoring for nuclear nonproliferation and transparency

    International Nuclear Information System (INIS)

    Olsen, John

    2006-01-01

    The JAEA and Sandia National Laboratories (SNL) have cooperated for a decade in development and testing of remote monitoring technologies in support of international safeguards. With this technology approaching maturity, the JAEA/SNL partnership now envisions regional cooperation to use these technologies to advance nuclear transparency and strengthen nonproliferation, as well. This presentation summarizes the technical evolution and notes the opportunity for regional cooperation to include institutions in the ROK, as well as Japan and the US. (author)

  20. Atmospheric effects and societal consequences of regional scale nuclear conflicts and acts of individual nuclear terrorism

    Science.gov (United States)

    Toon, O. B.; Turco, R. P.; Robock, A.; Bardeen, C.; Oman, L.; Stenchikov, G. L.

    2007-04-01

    We assess the potential damage and smoke production associated with the detonation of small nuclear weapons in modern megacities. While the number of nuclear warheads in the world has fallen by about a factor of three since its peak in 1986, the number of nuclear weapons states is increasing and the potential exists for numerous regional nuclear arms races. Eight countries are known to have nuclear weapons, 2 are constructing them, and an additional 32 nations already have the fissile material needed to build substantial arsenals of low-yield (Hiroshima-sized) explosives. Population and economic activity worldwide are congregated to an increasing extent in megacities, which might be targeted in a nuclear conflict. We find that low yield weapons, which new nuclear powers are likely to construct, can produce 100 times as many fatalities and 100 times as much smoke from fires per kt yield as previously estimated in analyses for full scale nuclear wars using high-yield weapons, if the small weapons are targeted at city centers. A single "small" nuclear detonation in an urban center could lead to more fatalities, in some cases by orders of magnitude, than have occurred in the major historical conflicts of many countries. We analyze the likely outcome of a regional nuclear exchange involving 100 15-kt explosions (less than 0.1% of the explosive yield of the current global nuclear arsenal). We find that such an exchange could produce direct fatalities comparable to all of those worldwide in World War II, or to those once estimated for a "counterforce" nuclear war between the superpowers. Megacities exposed to atmospheric fallout of long-lived radionuclides would likely be abandoned indefinitely, with severe national and international implications. Our analysis shows that smoke from urban firestorms in a regional war would rise into the upper troposphere due to pyro-convection. Robock et al. (2007) show that the smoke would subsequently rise deep into the stratosphere due

  1. Climatic Consequences and Agricultural Impact of Regional Nuclear Conflict

    Science.gov (United States)

    Toon, O. B.; Robock, A.; Mills, M. J.; Xia, L.

    2013-05-01

    A nuclear war between India and Pakistan, with each country using 50 Hiroshima-sized atom bombs as airbursts on urban areas, would inject smoke from the resulting fires into the stratosphere.This could produce climate change unprecedented in recorded human history and global-scale ozone depletion, with enhanced ultraviolet (UV) radiation reaching the surface.Simulations with the Whole Atmosphere Community Climate Model (WACCM), run at higher vertical and horizontal resolution than a previous simulation with the NASA Goddard Institute for Space Studies ModelE, and incorporating ozone chemistry for the first time, show a longer stratospheric residence time for smoke and hence a longer-lasting climate response, with global average surface air temperatures still 1.1 K below normal and global average precipitation 4% below normal after a decade.The erythemal dose from the enhanced UV radiation would greatly increase, in spite of enhanced absorption by the remaining smoke, with the UV index more than 3 units higher in the summer midlatitudes, even after a decade. Scenarios of changes in temperature, precipitation, and downward shortwave radiation from the ModelE and WACCM simulations, applied to the Decision Support System for Agrotechnology Transfer crop model for winter wheat, rice, soybeans, and maize by perturbing observed time series with anomalies from the regional nuclear war simulations, produce decreases of 10-50% in yield averaged over a decade, with larger decreases in the first several years, over the midlatitudes of the Northern Hemisphere. The impact of the nuclear war simulated here, using much less than 1% of the global nuclear arsenal, would be devastating to world agricultural production and trade, possibly sentencing a billion people now living marginal existences to starvation.The continued environmental threat of the use of even a small number of nuclear weapons must be considered in nuclear policy deliberations in Russia, the U.S., and the rest of

  2. Regional analysis of the nuclear-electricity; Analisis regional de la nucleoelectricidad

    Energy Technology Data Exchange (ETDEWEB)

    Parera, M. D., E-mail: dparera@cnea.gov.ar [CNEA, Gerencia de Planificacion, Coordinacion y Control, Subgerencia de Planificacion Estrategica, Av. Gral. Paz 1499, B1650KNA San Martin, Buenos Aires (Argentina)

    2011-11-15

    In this study was realized a regional analysis of the Argentinean electric market contemplating the effects of regional cooperation, the internal and international interconnections; and the possibilities of insert of new nuclear power stations were evaluated in different regions of the country, indicating the most appropriate areas to carry out these facilities to increase the penetration of the nuclear energy in the national energy matrix. Also was studied the interconnection of the electricity and natural gas markets, due to the existent linking among both energy forms. With this purpose the program Message (Model for energy supply strategy alternatives and their general environmental impacts) was used, promoted by the International Atomic Energy Agency. This model carries out an economic optimization level country, obtaining the minimum cost as a result for the modeling system. The division for regions realized by the Compania Administradora del Mercado Mayorista Electrico (CAMMESA) was used, which divides to the country in eight regions. They were considered the characteristics and necessities of each one of them, their respective demands and offers of electric power and natural gas, as well as their existent and projected interconnections, composed by the electric lines and gas pipes. According to the results obtained through the model, the nuclear-electricity is a competitive option. (Author)

  3. The regional income and employment impacts of nuclear power stations

    International Nuclear Information System (INIS)

    McGuire, A.

    1982-01-01

    This paper attempts quantitatively to assess the income and employment impacts associated with two nuclear establishments in Scotland: the United Kingdom Atomic Energy Authority (U.K.A.E.A.) nuclear power establishment at Dounreay in Caithness and the South of Scotland Electricity Board (S.S.E.B.) nuclear power station presently under construction at Torness in the Lothian region. The model used is a basic Keynesian income multiplier model refined to allow detailed analysis of income and employment impacts at a local level. As used in this study it allows the identification of the increase in income and the associated increase in employment relating to the siting of a nuclear power plant in a particular locality. Results are given. The employment multipliers are estimated to be in the range 1.236 to 1.535 for Dounreay and 1.294 to 1.675 for the operational phase of the Torness plant. It is concluded that although the absolute income increases in the respective subregions are significant, compared to the total annual expenditure of the establishments these figures indicate high leakage from the subregions. (UK)

  4. International nuclear proliferation: multilateral diplomacy and regional aspects

    Energy Technology Data Exchange (ETDEWEB)

    Kapur, A.

    1979-01-01

    Confidential interviews with about 200 officials at 18 nuclear research sites around the world form the background for this discussion of the proliferation issues as they affect the Nuclear Non-Proliferation Treaty (NPT). Critics of the NPT cite its narrow focus on horizontal proliferation and its failures in the areas of vertical proliferation, nuclear technology transfers, heavy-water-reactor systems, and safeguards. The international negotiations necessary to resolve these issues and the difficulty of reaching a global consensus indicate a need to restructure the U.S. decision process before diplomacy can progress. The book discusses the history and nature of proliferation and its relationship to multinational diplomacy; the problems of permanent and workable safeguards; and regional political ramifications in the creeping dependencies of South Asia, apartheid in South Africa, militarization in Japan, and the nuclearization of Brazil and Argentina. The analysis concludes that central issues were not settled by the NPT and that U.S. failures to speak without consulting allies may mean that a bilateral rather than multinational approach should be tried. 105 references, 5 figures, 12 tables. (DCK)

  5. Proceedings of the Second Regional Meeting on Nuclear Energy in Central Europe

    Energy Technology Data Exchange (ETDEWEB)

    Stritar, A; Jencic, I [eds.; Nuclear Society of Slovenia (Slovenia)

    1996-12-31

    Second Regional Meeting for Nuclear Energy in Central Europe is an annual meeting of the Nuclear Society of Slovenia. The proceedings contains 75 articles from Slovenia, surrounding countries and countries of the Central and Eastern European Region

  6. Proceedings of the Second Regional Meeting on Nuclear Energy in Central Europe

    International Nuclear Information System (INIS)

    Stritar, A.; Jencic, I.

    1995-01-01

    Second Regional Meeting for Nuclear Energy in Central Europe is an annual meeting of the Nuclear Society of Slovenia. The proceedings contains 75 articles from Slovenia, surrounding countries and countries of the Central and Eastern European Region

  7. The IAEA hears about regional nuclear energy bodies

    International Nuclear Information System (INIS)

    1966-01-01

    Full text: During the early part of 1966, executive heads or senior officials of certain regional organizations working in atomic energy are visiting the Agency in order to give general talks on the activities of their organizations. The first to be arranged was Dr. Jules Gueron, Director General of Research and Training of Euratom, on 14 January 1966. These lectures are likely to be followed by others, given by the representatives of bodies such as the Council for Mutual Economic Aid (COMECON) the Inter-American Nuclear Energy Commission (IANEC), the European Nuclear Energy Agency (ENEA) of the Organization for Economic Cooperation and Development (OECD), and the Scientific and Technical Research Commission of the Organization of African Unity. (author)

  8. The IAEA hears about regional nuclear energy bodies

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1966-03-15

    Full text: During the early part of 1966, executive heads or senior officials of certain regional organizations working in atomic energy are visiting the Agency in order to give general talks on the activities of their organizations. The first to be arranged was Dr. Jules Gueron, Director General of Research and Training of Euratom, on 14 January 1966. These lectures are likely to be followed by others, given by the representatives of bodies such as the Council for Mutual Economic Aid (COMECON) the Inter-American Nuclear Energy Commission (IANEC), the European Nuclear Energy Agency (ENEA) of the Organization for Economic Cooperation and Development (OECD), and the Scientific and Technical Research Commission of the Organization of African Unity. (author)

  9. Availability of oncological nuclear medicine in the regions of Slovakia

    International Nuclear Information System (INIS)

    Lepej, J.; Kaliska, L.

    2004-01-01

    Full text: Nuclear medicine (NM) imaging technology, alone and in combination with other imaging modalities, provides clinically significant and useful information in the staging and treatment of the oncological diseases. The main objective of our study was to find out and present the situation vis-a-vis nuclear medicine facilities in the Central European country that soon becomes the new member of EU. For the purposes statistical data of WHO, Slovak Republic (SR) and nuclear medicine department (NMD) were evaluated for the period 1995-2001. Comparison with Czech Republic (CR) was done because of almost similar occurrence of the malignant diseases in these two republics that were a one country till separation in 1993. First nuclear medicine department in Czechoslovakia was established about 55 years ago. Comparing to CR the expenditures on health care per capita in SR is only 67% of CR. The number of gamma cameras, physicians and number of investigations are far from good standard of CR. The number NM departments are significantly low and growth of only 29% compared to CR is alarming. The one main reason is inadequate financial support to the health care and high debts of hospitals running nuclear medicine facilities. Providing radiology departments with new CT and MRI scanners is another reason of less nuclear medicine facilities. During the last five years, though the number of gamma cameras increased by 10%, but the number of investigations did not rise accordingly. Because of bad management of health care services in Slovakia, the latest facilities availability is greatly delayed. However, the exception is the installation of a new PET scanner in 2001. Of late, sentinel lymph node detection was started only with the help of IAEA. Data shows that most of the nuclear medicine centers are around the state capital. It is imperative to have sufficient diagnostic and therapeutic facilities in each region so as to make these available to patients living away from the

  10. Chemical, Biological, Radiological and Nuclear Regional Centres of Excellence Initiative

    International Nuclear Information System (INIS)

    Bril, L.V.

    2013-01-01

    This series of slides presents the initiative launched in May 2010 by the European Union to develop at national and regional levels the necessary institutional capacity to fight against the CBRN (Chemical, Biological, Radiological and Nuclear) risk. The origin of the risk can be: -) criminal (proliferation, theft, sabotage and illicit traffics), -) accidental (industrial catastrophes, transport accidents...) and -) natural (mainly pandemics). The initiative consists in the creation of Centres of Excellence for providing assistance and cooperation in the field of CBRN risk and the creation of experts networks for sharing best practices, reviewing laws and regulation, developing technical capacities in order to mitigate the CBRN risk. The initiative is complementary to the instrument for nuclear safety cooperation. Regional Centres of Excellence are being set up in 6 regions: South East Europe, South East Asia, North Africa, West Africa, Middle East, and Central Asia covering nearly 40 countries. A global budget of 100 million Euros will be dedicated to this initiative for the 2009-2013 period. (A.C.)

  11. Sustainable Nuclear Fuel Cycles and World Regional Issues

    Directory of Open Access Journals (Sweden)

    Aleksandra Schwenk-Ferrero

    2012-06-01

    Full Text Available In the present paper we have attempted to associate quantified impacts with a forecasted nuclear energy development in different world regions, under a range of hypotheses on the energy demand growth. It gives results in terms of availability of uranium resources, required deployment of fuel cycle facilities and reactor types. In particular, the need to achieve short doubling times with future fast reactors is investigated and quantified in specific world regions. It has been found that a crucial feature of any world scenario study is to provide not only trends for an idealized “homogeneous” description of the global world, but also trends for different regions in the world. These regions may be selected using rather simple criteria (mostly of a geographical type, in order to apply different hypotheses for energy demand growth, fuel cycle strategies and the implementation of various reactor types for the different regions. This approach was an attempt to avoid focusing on selected countries, in particular on those where no new significant energy demand growth is expected, but instead to provide trends and conclusions that account for the features of countries that will be major players in the world energy development in the future.

  12. Transitional region of phase transitions in nuclear models

    Energy Technology Data Exchange (ETDEWEB)

    Kotze, A A

    1988-01-01

    The phase transition in an exactly solvable nuclear model, the Lipkin model, is scrutinised, first using Hartree-Fock methods or the plain mean flield approximation, and then using projected wave functions. It turns out that the plain mean field is not reliable in the transitional region. Although the projection methods give better resutls in the transitional region, it leads to spurious singularities. While the energy of the projection before variation is slightly better than its projection after variation counterpart, the perfomance of the wave function is considerably worse in the transitional region. The model's wave function undergoes dramatic changes in the transitional region. The mechanism that brings about these changes is studied within a model Hamiltonian that can reproduce the Lipkin model mathematically. It turns out that the numerous exceptional points found in the transitional region, bring about the change of the ground state wave function. Exceptional points are associated with level crossings in the complex plane. These level crossings can be seen as level repulsions in the spectrum. Level repulsion and a sensitive dependence of the system on some external parameter are characteristics of chaotic behaviour. These two features are found in the transitional region of the Lipkin model. In order to study chaos, one has to resort to a statistical analysis. A measure of the chaotic behaviour of systems, the ..delta../sub 3/ statistic, is introduced. The results show that the Lipkin model is harmonic, even in the transitional region. For the Lipkin model the exceptional points are regularly distributed in the complex plane. In a total chaotic system the points would be randomly distributed.

  13. The transitional region of phase transitions in nuclear models

    International Nuclear Information System (INIS)

    Kotze, A.A.

    1988-01-01

    The phase transition in an exactly solvable nuclear model, the Lipkin model, is scrutinised, first using Hartree-Fock methods or the plain mean flield approximation, and then using projected wave functions. It turns out that the plain mean field is not reliable in the transitional region. Although the projection methods give better resutls in the transitional region, it leads to spurious singularities. While the energy of the projection before variation is slightly better than its projection after variation counterpart, the perfomance of the wave function is considerably worse in the transitional region. The model's wave function undergoes dramatic changes in the transitional region. The mechanism that brings about these changes is studied within a model Hamiltonian that can reproduce the Lipkin model mathematically. It turns out that the numerous exceptional points found in the transitional region, bring about the change of the ground state wave function. Exceptional points are associated with level crossings in the complex plane. These level crossings can be seen as level repulsions in the spectrum. Level repulsion and a sensitive dependence of the system on some external parameter are characteristics of chaotic behaviour. These two features are found in the transitional region of the Lipkin model. In order to study chaos, one has to resort to a statistical analysis. A measure of the chaotic behaviour of systems, the Δ 3 statistic, is introduced. The results show that the Lipkin model is harmonic, even in the transitional region. For the Lipkin model the exceptional points are regularly distributed in the complex plane. In a total chaotic system the points would be randomly distributed

  14. Towards a regional siting approach for canadian nuclear fuel waste

    International Nuclear Information System (INIS)

    Kuhn, R.G.

    1999-01-01

    The proposal to construct a nuclear fuel waste (NFW) disposal facility in Canada is fraught with difficulties, particularly with respect to gaining public acceptance and consent. Public perceptions of risk associated with a disposal facility are generally negative. Indeed, it was found that over 60% of residents in northern Ontario communities are opposed to the possibility of a disposal facility being constructed within 120 km of their community. Even after being offered the possibility of compensation and incentives, the majority of residents are strongly opposed. Canadian decision makers have generally endorsed a siting framework known as the open siting approach. The major characteristic of this approach is that it allows for substantial public participation in any siting process. It is premised on the notion that only communities where a majority of citizens favour the siting of a facility will be considered as potential hosts. However, given that the majority of residents on the Ontario portion of the Canadian Shield are strongly opposed to a NFW facility, the open approach will not be a panacea for a successful siting process. The major limitation of this approach is the fact that a single community cannot be isolated from its surrounding region and communities. The purpose of this paper is to work towards the development of a regional siting strategy for Canadian nuclear fuel waste management. There are no clear precedents of a regional siting approach to facility location in Canada. However, some analogous planning regimes and initiatives have been attempted. Common to these initiatives is the consideration of a large geographical region and attempts to integrate, at least formally, social, cultural, political and environmental concerns in a coherent and comprehensive manner. Under this type of 'siting strategy' NFW management would be considered within a broad array of resource management initiatives, social and cultural priorities, and institutional

  15. Report of the international forum on nuclear energy, nuclear non-proliferation and nuclear security. Measures to ensure nuclear non-proliferation and nuclear security for the back end of nuclear fuel cycle and regional cooperation in Asia

    International Nuclear Information System (INIS)

    Tazaki, Makiko; Yamamura, Tsukasa; Suzuki, Mitsutoshi; Kuno, Yusuke; Mochiji, Toshiro

    2013-03-01

    The Japan Atomic Energy Agency (JAEA) held 'International Forum on Nuclear Energy, Nuclear Non-proliferation and Nuclear Security - Measures to ensure nuclear non-proliferation and nuclear security for the back end of nuclear fuel cycle and regional cooperation in Asia-' on 12 and 13 December 2012, co-hosted by the Japan Institute of International Affairs (JIIA) and School of Engineering, The University of Tokyo. In the forum, keynote speakers from Japan, International Atomic Energy Agency (IAEA), the U.S., France and Republic of Korea (ROK), respectively explained their efforts regarding peaceful use of nuclear energy and nuclear non-proliferation. In two panel discussions, entitled 'Measures to ensure nuclear non-proliferation and nuclear security of nuclear fuel cycle back end' and 'Measures to ensure nuclear non-proliferation and nuclear security for nuclear energy use in the Asian region and a multilateral cooperative framework', active discussions were made among panelists from Japan, IAEA, the U.S., France, ROK, Russia and Kazakhstan. This report includes abstracts of keynote speeches, summaries of two panel discussions and materials of the presentations in the forum. The editors take full responsibility for the wording and content of this report except presentation materials. (author)

  16. Nuclear power in the Asia-Pacific region. Current status and future perspective

    International Nuclear Information System (INIS)

    Hao, Jia; Otsuki, Takashi; Irie, Kazutomo

    2017-01-01

    This paper presents the current status and future perspective of nuclear power in the APEC region. We design three scenarios, including Low-nuclear Scenario, Business-as-Usual Scenario (BAU) as well as High-nuclear Scenario, in order to quantitatively evaluate contribution of nuclear power to the low-carbon energy system. Preliminary results from the modeling are presented in the paper, and the drivers and challenges for nuclear power development in the APEC region are discussed. (author)

  17. Editorial das organizadoras do VI ENANCIB

    Directory of Open Access Journals (Sweden)

    Ligia Maria Arruda Café

    2006-07-01

    Full Text Available EDITORIAL A história das idéias, em um determinado campo do conhecimento, se faz por meio de seus cientistas e de suas instituições. Ela torna visível a produção intelectual deste campo, construída por seus atores individuais e coletivos. Neste sentido, o ENANCIB é um elemento-chave neste processo de construção, o momento por excelência da disseminação do conhecimento nesta área. Ele permite a continuidade da história, o desenvolvimento da Ciência da Informação que se faz no Brasil e a coesão de sua comunidade. Por meio de debates, da troca de idéias e de experiências, promovem a construção da identidade deste campo científico, sua visibilidade, a delimitação de suas fronteiras e sua interrelação com outras áreas do conhecimento. O ENANCIB permite, além disso, a construção de novas parcerias científicas e a consolidação dos grupos de trabalho existentes. Este evento vem se estabelecendo, desde 1994, como fundamental para a consolidação e estruturação da área da Ciência da Informação brasileira, influenciando o desenvolvimento dos cursos de pós-graduação do país. Um campo se constrói somente se compreender as especificidades dos processos que atravessam o seu caminho. Em sua evolução, a Ciência da Informação, nos últimos 50 anos, tem se caracterizado pela diversidade de suas abordagens buscando definir a sua essência, por diferentes estudos e teorias. Nestes estudos, inúmeros aportes conceituais vêm sendo apresentados por diferentes pensadores por meio da visão particular de cada um deles. Na realidade, cada um adota uma forma distinta de observar, representar e explicitar a realidade com base na sua visão de mundo. Alguns autores enfatizam os aspectos comunicacionais da Ciência da Informação; outros destacam sua função social; outros, ainda, ressaltam sua forte ligação com as tecnologias. Este número da revista Encontros Bibli traz quatorze artigos apresentados no VI ENANCIB, realizado em Florianópolis de 28 a 30 de novembro de 2005, selecionados em cada Grupo de Trabalho como os mais significativos de sua área. Destacamos do conjunto dos artigos apresentados aspectos relacionados às novas abordagens e métodos de trabalho, ao deslocamento do enfoque dos espaços tradicionais para novos ambientes, ao uso intensivo das tecnologias e sua relação com o ambiente em que estão inseridas, às aplicações de pesquisa em contextos específicos como, por exemplo, as agências de fomento, as bibliotecas digitais, o meio empresarial e as redes sociais, entre outros. Florianópolis, fevereiro de 2006. Ligia Café Miriam Vieira da Cunha Presidente da Comissão Científica Presidente do VI ENANCIB

  18. Nuclear power regional analysis; Análisis regional de la nucleoelectricidad

    Energy Technology Data Exchange (ETDEWEB)

    Parera, María Delia, E-mail: dparera@cnea.gov.ar [Comisión Nacional de Energía Atómica, San Martin (Argentina). Gerencia de Planificación Coordinación y Control, Subgerencia de Planificación Estratégica

    2011-07-01

    In this study, a regional analysis of the Argentine electricity market was carried out considering the effects of regional cooperation, national and international interconnections; additionally, the possibilities of insertion of new nuclear power plants in different regions were evaluated, indicating the most suitable areas for these facilities to increase the penetration of nuclear energy in national energy matrix. The interconnection of electricity markets and natural gas due to the linkage between both energy forms was also studied. With this purpose, MESSAGE program was used (Model for Energy Supply Strategy Alternatives and their General Environmental Impacts), promoted by the International Atomic Energy Agency (IAEA). This model performs a country-level economic optimization, resulting in the minimum cost for the modelling system. Regionalization executed by the Wholesale Electricity Market Management Company (CAMMESA, by its Spanish acronym) that divides the country into eight regions. The characteristics and the needs of each region, their respective demands and supplies of electricity and natural gas, as well as existing and planned interconnections, consisting of power lines and pipelines were taken into account. According to the results obtained through the model, nuclear is a competitive option. (author) [Spanish] En el presente estudio se realizó un análisis regional del mercado eléctrico argentino contemplando los efectos de cooperación regional, las interconexiones internas e internacionales; y se evaluó las posibilidades de inserción de nuevas centrales nucleares en diferentes regiones del país, indicando las zonas más adecuadas para realizar estas instalaciones para aumentar la penetración de la energía nuclear en la matriz energética nacional. Asimismo se estudió la interconexión de los mercados de electricidad y gas natural, debido a la vinculación existente entre ambas formas de energía. Con este fin se utilizó el programa

  19. Nuclear safety cooperation in Southeast Asia. Lessons from Asia's regional networks

    International Nuclear Information System (INIS)

    Trajano, Julius Cesar I.

    2017-01-01

    Debate has been ongoing among key stakeholders on whether South-east Asia should use or reject nuclear power. However, there are still significant regional concerns over nuclear safety and security in South-east Asia. As some ASEAN countries plan to pursue nuclear power, they need to create and maintain a pool of local nuclear professionals with actual relevant experience in the nuclear industry. While the IAEA does not influence a country's decision on introducing nuclear power, it supports Member States' efforts to evaluate all options towards making a knowledgeable decision. Nuclear safety is the responsibility of every nation that utilizes nuclear technology. National governments are responsible for regulations that govern how safety at nuclear facilities is maintained, as well as to reduce radiation risks, including emergency response and recovery actions. But nuclear energy has transboundary/ regional implications if nuclear safety in each member state is not strengthened. ASEAN countries share a common goal in achieving high level of public safety and confidence in nuclear and radiation related issues. Can regional cooperation help ASEAN Member-States strengthen nuclear safety? The paper examines the importance of regional cooperation on nuclear energy governance and the role of regional organisations in Asia in strengthening nuclear safety cooperation and emergency preparedness and response in Southeast Asia. (author)

  20. Regional cooperation based on multilateral international agreements in nuclear field

    International Nuclear Information System (INIS)

    Valcic, I.

    1996-01-01

    Multilateral international agreements have defined the framework of behavior and cooperation in various fields and aspects of peaceful use of nuclear energy. Thus, obligations have been defined in the following areas: nonproliferation of nuclear weapons, physical protection of nuclear material, liability for nuclear damage, nuclear safety, early notification about a nuclear accident and assistance in case of nuclear accident. Obligations regarding radioactive waste management should be defined soon. This paper gives a review of obligations from particular agreements with a special emphasis on those which are being realized through mutual cooperation of concerned countries and are important for safe use of nuclear energy. (author)

  1. New nuclear weapon states and their impact on Third World regional conflicts

    International Nuclear Information System (INIS)

    Mazrui, A.A.

    1986-01-01

    The paper examines the new nuclear weapon states and their impact on third world regional conflicts. Nuclear technology in South Africa, nuclear terrorism and the Arab/Israeli conflict, Islam and the nuclear age, Egypt and the Non-Proliferation Treaty, and the 'masculinity' of warfare, are all discussed. (UK)

  2. Massive global ozone loss predicted following regional nuclear conflict

    Science.gov (United States)

    Mills, Michael J.; Toon, Owen B.; Turco, Richard P.; Kinnison, Douglas E.; Garcia, Rolando R.

    2008-01-01

    We use a chemistry-climate model and new estimates of smoke produced by fires in contemporary cities to calculate the impact on stratospheric ozone of a regional nuclear war between developing nuclear states involving 100 Hiroshima-size bombs exploded in cities in the northern subtropics. We find column ozone losses in excess of 20% globally, 25–45% at midlatitudes, and 50–70% at northern high latitudes persisting for 5 years, with substantial losses continuing for 5 additional years. Column ozone amounts remain near or <220 Dobson units at all latitudes even after three years, constituting an extratropical “ozone hole.” The resulting increases in UV radiation could impact the biota significantly, including serious consequences for human health. The primary cause for the dramatic and persistent ozone depletion is heating of the stratosphere by smoke, which strongly absorbs solar radiation. The smoke-laden air rises to the upper stratosphere, where removal mechanisms are slow, so that much of the stratosphere is ultimately heated by the localized smoke injections. Higher stratospheric temperatures accelerate catalytic reaction cycles, particularly those of odd-nitrogen, which destroy ozone. In addition, the strong convection created by rising smoke plumes alters the stratospheric circulation, redistributing ozone and the sources of ozone-depleting gases, including N2O and chlorofluorocarbons. The ozone losses predicted here are significantly greater than previous “nuclear winter/UV spring” calculations, which did not adequately represent stratospheric plume rise. Our results point to previously unrecognized mechanisms for stratospheric ozone depletion. PMID:18391218

  3. Nuclear-weapon-free zones: Pursuing security, region by region. Conference of States Parties and Signatories of treaties that establish nuclear-weapon-free zones

    International Nuclear Information System (INIS)

    ElBaradei, M.

    2005-01-01

    The development of nuclear-weapon-free zones, over the past four decades, is a testament to what nations can do, region by region, to achieve common security objectives. In fact, when considering the history of nuclear non-proliferation efforts, it might be said that here in Mexico City is w here it all began . The 1967 Treaty of Tlatelolco was the first multilateral treaty to establish a region free of nuclear weapons and a requirement for comprehensive IAEA safeguards for its parties - and clearly gave impetus to the conclusion of the Treaty on the Non-Proliferation of Nuclear Weapons. Nuclear-weapon-free zones provide tangible security benefits. They help to reassure the larger international community of the peaceful nuclear intentions of countries in these regions. They provide their members with security assurances against the use, or threat of use, of nuclear weapons by a nuclear-weapon State. They include control mechanisms for dealing with non-compliance in a regional setting. And in all cases, they prohibit the development, stationing or testing of nuclear weapons in their respective regions. An important benefit of these zones is that they open a forum for expanded regional dialogue on issues of security. Because the causes of insecurity vary from region to region, security solutions do not come in a 'one-size-fits-all' package. It is for this reason that regional dialogues, as we see in the nuclear-weapon-free zones, are so beneficial. It is clear that such treaties, and such security dialogues, would be invaluable in other areas of the world, such as the Middle East and the Korean Peninsula. Since the end of the Cold War, the international security landscape has undergone dramatic changes. For example, the rise in terrorism, the discovery of clandestine nuclear programmes, and the emergence of covert nuclear procurement networks have heightened our awareness of vulnerabilities in the nuclear non-proliferation regime. This statement focuses on two issues

  4. Nuclear issues in the Asia-Pacific region: socio-political factors

    International Nuclear Information System (INIS)

    Tanaka, Y.

    1984-01-01

    This paper explores the prospect of peaceful use of nuclear power in the Asia-Pacific region, criteria for judging the acceptability of nuclear electric power in the region, and alternative worldviews on the basis of which a regional nuclear order should be established. First, current nuclear power issues in Japan are discussed. Secondly, the Asia-Pacific countries are classified according to their stages of civil nuclear development, Thirdly, the acceptability of civil nuclear power in the region is discussed, using nuclear nonproliferation, safety, and public acceptance as three major criteria. Fourthly, conflicts of interest that cut across North/South, East/West, nuclear/non-nuclear, and nuclear weapons states/non-nuclear weapons states boundaries are discussed. Lastly,it is proposed that an international forum be convened of all the countries concerned with nuclear issues in the region. Several major objectives of this forum are suggested, including construction of a rational model for a solution for non-zero-sum gain to everyone regarding use of nuclear power in the region. (author)

  5. American Nuclear Society 1994 student conference eastern region

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1994-12-31

    This report contains abstracts from the 1994 American Nuclear Society Student Conference. The areas covered by these abstracts are: fusion and plasma physics; nuclear chemistry; radiation detection; reactor physics; thermal hydraulics; and corrosion science and waste issues.

  6. American Nuclear Society 1994 student conference eastern region

    International Nuclear Information System (INIS)

    1994-01-01

    This report contains abstracts from the 1994 American Nuclear Society Student Conference. The areas covered by these abstracts are: fusion and plasma physics; nuclear chemistry; radiation detection; reactor physics; thermal hydraulics; and corrosion science and waste issues

  7. Proceedings of 1. Regional Meeting on Nuclear Applications

    International Nuclear Information System (INIS)

    1990-01-01

    This Meeting describes nuclear methods and techniques, emphasizing the development or adaptation of methodologies and instrumentations for national conditions. The works present here comprise several field of nuclear application as agronomy; industry; nuclear medicine; dosimetry; radiological protection and instrumentation. (C.G.C.)

  8. Climate and chemistry effects of a regional scale nuclear conflict

    Science.gov (United States)

    Stenke, A.; Hoyle, C. R.; Luo, B.; Rozanov, E.; Gröbner, J.; Maag, L.; Brönnimann, S.; Peter, T.

    2013-10-01

    Previous studies have highlighted the severity of detrimental effects for life on earth after an assumed regionally limited nuclear war. These effects are caused by climatic, chemical and radiative changes persisting for up to one decade. However, so far only a very limited number of climate model simulations have been performed, giving rise to the question how realistic previous computations have been. This study uses the coupled chemistry climate model (CCM) SOCOL, which belongs to a different family of CCMs than previously used, to investigate the consequences of such a hypothetical nuclear conflict. In accordance with previous studies, the present work assumes a scenario of a nuclear conflict between India and Pakistan, each applying 50 warheads with an individual blasting power of 15 kt ("Hiroshima size") against the major population centers, resulting in the emission of tiny soot particles, which are generated in the firestorms expected in the aftermath of the detonations. Substantial uncertainties related to the calculation of likely soot emissions, particularly concerning assumptions of target fuel loading and targeting of weapons, have been addressed by simulating several scenarios, with soot emissions ranging from 1 to 12 Tg. Their high absorptivity with respect to solar radiation leads to a rapid self-lofting of the soot particles into the strato- and mesosphere within a few days after emission, where they remain for several years. Consequently, the model suggests earth's surface temperatures to drop by several degrees Celsius due to the shielding of solar irradiance by the soot, indicating a major global cooling. In addition, there is a substantial reduction of precipitation lasting 5 to 10 yr after the conflict, depending on the magnitude of the initial soot release. Extreme cold spells associated with an increase in sea ice formation are found during Northern Hemisphere winter, which expose the continental land masses of North America and Eurasia to a

  9. Climate and chemistry effects of a regional scale nuclear conflict

    Directory of Open Access Journals (Sweden)

    A. Stenke

    2013-10-01

    Full Text Available Previous studies have highlighted the severity of detrimental effects for life on earth after an assumed regionally limited nuclear war. These effects are caused by climatic, chemical and radiative changes persisting for up to one decade. However, so far only a very limited number of climate model simulations have been performed, giving rise to the question how realistic previous computations have been. This study uses the coupled chemistry climate model (CCM SOCOL, which belongs to a different family of CCMs than previously used, to investigate the consequences of such a hypothetical nuclear conflict. In accordance with previous studies, the present work assumes a scenario of a nuclear conflict between India and Pakistan, each applying 50 warheads with an individual blasting power of 15 kt ("Hiroshima size" against the major population centers, resulting in the emission of tiny soot particles, which are generated in the firestorms expected in the aftermath of the detonations. Substantial uncertainties related to the calculation of likely soot emissions, particularly concerning assumptions of target fuel loading and targeting of weapons, have been addressed by simulating several scenarios, with soot emissions ranging from 1 to 12 Tg. Their high absorptivity with respect to solar radiation leads to a rapid self-lofting of the soot particles into the strato- and mesosphere within a few days after emission, where they remain for several years. Consequently, the model suggests earth's surface temperatures to drop by several degrees Celsius due to the shielding of solar irradiance by the soot, indicating a major global cooling. In addition, there is a substantial reduction of precipitation lasting 5 to 10 yr after the conflict, depending on the magnitude of the initial soot release. Extreme cold spells associated with an increase in sea ice formation are found during Northern Hemisphere winter, which expose the continental land masses of North

  10. Nuclear Wastes in the Arctic: An Analysis of Arctic and Other Regional Impacts from Soviet Nuclear Contamination

    National Research Council Canada - National Science Library

    1995-01-01

    ..., and from radioactive releases from both past and future nuclear activities in the region. The report presents what is known and unknown about this waste and contamination and how it may affect public health...

  11. Cost-benefit analysis of multi-regional nuclear energy systems deployment

    International Nuclear Information System (INIS)

    Van Den Durpel, L.G.G.; Wade, D.C.; Yacout, A.M.

    2007-01-01

    The paper describes the preliminary results of a cost/benefit-analysis of multi-regional nuclear energy system approaches with a focus on how multi-regional approaches may benefit a growing nuclear energy system in various world regions also being able to limit, or even reduce, the costs associated with the nuclear fuel cycle and facilitating the introduction of nuclear energy in various regions in the world. The paper highlights the trade-off one might envisage in deploying such multi-regional approaches but also the pay backs possible and concludes on the economical benefits one may associate to regional fuel cycle centres serving a world-fleet of STAR (small fast reactors of long refueling interval) where these STARs may be competitive compared to the LWRs (Light Water Reactors) as a base-case nuclear reactor option. (authors)

  12. Nuclear Education, Training and Outreach in Latin America and the Caribbean Region - LANENT

    International Nuclear Information System (INIS)

    Barrachina, R.O.; François, J.L.; Sbaffoni, M.

    2014-01-01

    The Latin American Network for Education in Nuclear Technology (LANENT) was set up to contribute to preserving, promoting and sharing nuclear knowledge as well as fostering the transfer of nuclear knowledge in the Latin American region. LANENT has been actively pursuing joint activities for networking educational institutions at a regional level, the creation of distance learning initiatives and the use of shared facilities. Let us hope that these initial endeavors in nuclear education and training would ultimately contribute to the common and cooperative development of a technology so essential for the present and the future of our region

  13. U.S. National and regional impacts nuclear plant life extension

    International Nuclear Information System (INIS)

    Makovick, L.; Fletcher, T.; Harrison, D.L.

    1987-01-01

    The purpose of this study was to evaluate the economic impacts of nuclear plant life extension on a national and regional level. Nuclear generating capacity is expected to reach 104 Gigawatts (119 units) in the 1994-1995 period. Nuclear units of the 1970 to 1980 vintage are expected to account for 96% of nuclear capacity. As operating licenses expire, a precipitous decline in nuclear capacity results, with an average of 5 gigawatts of capacity lost each year from 2010 to 2030. Without life extension, 95% of all nuclear capacity is retired between the years 2010 and 2030. Even with historically slow growth in electric demand and extensive fossil plant life extension, the need for new generating capacity in the 2010-2030 time period is eight times greater than installed nuclear capacity. Nuclear plant life extension costs and benefits were quantified under numerous scenarios using the DRI Electricity Market Model. Under a wide range of economic assumptions and investment requirements, nuclear plant life extension resulted in a net benefit to electricity consumers. The major source of net benefits from nuclear plant life extension results from the displacement of fossil-fired generating sources. In the most likely case, nuclear plant life extension provides a dollar 200 billion net savings through the year 2030. Regions with a large nuclear capacity share, newer nuclear units and relatively higher costs of alternative fuels benefit the most from life extension. This paper also discusses the importance of regulatory policies on nuclear plant life extension

  14. Behavioral Determinants of Russian Nuclear State-Owned Enterprises in Central and Eastern European Region

    OpenAIRE

    Vlcek, Tomas; Jirusek, Martin

    2015-01-01

    Rosatom State Nuclear Corporation play a substantial role in the energy sector of the Central and Eastern European region and the behavioral characteristics of the company forms the basis of this article. Rosatom is positioned as the dominant provider of nuclear technology and fuel supplies to the region, in large part stemming from the Soviet legacy in CEE countries. Compounding this challenge, nuclear energy is one of the major sources of power generation in CEE. Given the long-time, near m...

  15. Western Region American Nuclear Society regional student conference, April 12-14, 1985

    International Nuclear Information System (INIS)

    1985-01-01

    Abstracts of papers presented at the conference are contained in this proceedings. Topics of technical sessions included fusion and space reactors, numerical and computer modeling, nuclear medicine and radiation effects, and general nuclear technology

  16. Western Region American Nuclear Society regional student conference, April 12-14, 1985

    Energy Technology Data Exchange (ETDEWEB)

    1985-01-01

    Abstracts of papers presented at the conference are contained in this proceedings. Topics of technical sessions included fusion and space reactors, numerical and computer modeling, nuclear medicine and radiation effects, and general nuclear technology. (GHT)

  17. A perspective of the evolving nuclear power programs in the Asia-Pacific region

    International Nuclear Information System (INIS)

    Langmo, A.

    1994-01-01

    This paper reviews the issues related to the need for nuclear power in the Asia-Pacific region. It further discusses the benefits for nuclear power introduction, as they have been reported in countries with significant nuclear power programs and as they are now being computed and forecasted in this region. A large body of experience in commercializing and operating nuclear power plants bas been accumulated worldwide and some of the most significant nuclear power achievements have occurred in this region. Examples are the large nuclear plants standardisation program implemented in Japan, culminating in the construction of the two advanced boiling water reactors (ABWRs) in Kashiwakaki-Kariwa and the recent record short 48 months construction time for Hamaoka - 4 unit, the Korean standard nuclear plant design and the impressively high lifetime capacity factors achieved in the Korean and Taiwanese nuclear power programs. These and other examples enhance the confidence that further nuclear power expansion can be implemented successfully in the Asia-Pacific region, and provide the region with the benefits of large scale economic supply of electricity required for future economic development. 16 figs

  18. New computer simulation technology of WSPEEDI for local and regional environmental assessment during nuclear emergency

    International Nuclear Information System (INIS)

    Chino, Masamichi; Furuno, Akiko; Terada, Hiroaki; Kitabata, Hideyuki

    2002-01-01

    The increase of nuclear power plants in the Asian region necessitates the capability to predict long-range atmospheric dispersions of radionuclides and radiological impacts due to a nuclear accident. For this purpose, we have developed a computer-based emergency response system WSPEEDI. This paper aims to expanding the capability of WSPEEDI so that it can be applied to simultaneous multi-scale predictions of local and regional scales in the Asian region

  19. Nuclear power developments in the Asia-pacific region

    International Nuclear Information System (INIS)

    Kelly, J.F.

    2003-01-01

    Each Asia-Pacific country has a unique set of energy needs and capabilities: a). Some need large amounts of baseload power and have the political will to install nuclear capacity, but they have no funds b). Others have mature nuclear energy programs to which extra capacity needs to be planned-for. So there is no common Asian drive to install (or reject) nuclear power. However, the Asia-Pacific countries do all seem to have a long term view in regard to their future electricity supply. This paper will briefly discuss China, Japan, Korea, Taiwan and Vietnam. Indonesia remains an interesting prospect for the nuclear power industry, however, there is little real information about when a unit might be built

  20. Future regional nuclear fuel cycle cooperation in East Asia: Energy security costs and benefits

    International Nuclear Information System (INIS)

    Hippel, David von; Hayes, Peter; Kang, Jungmin; Katsuta, Tadahiro

    2011-01-01

    Economic growth in East Asia has rapidly increased regional energy, and especially, electricity needs. Many of the countries of East Asia have sought or are seeking to diversify their energy sources and bolster their energy supply and/or environmental security by developing nuclear power. Rapid development of nuclear power in East Asia brings with it concerns regarding nuclear weapons proliferation associated with uranium enrichment and spent nuclear fuel management. This article summarizes the development and analysis of four different scenarios of nuclear fuel cycle management in East Asia, including a scenario where each major nuclear power user develops uranium enrichment and reprocessing of spent fuel individually, scenarios featuring cooperation in the full fuel cycle, and a scenario where reprocessing is avoided in favor of dry cask storage of spent fuel. The material inputs and outputs and costs of key fuel cycle elements under each scenario are summarized. - Highlights: → We evaluate four scenarios of regional nuclear fuel cycle cooperation in East Asia and the Pacific. → The scenarios cover fuel supply, enrichment, transport, reprocessing, and waste management. → We evaluate nuclear material flows, energy use, costs, and qualitative energy security impacts. → Regional cooperation on nuclear fuel cycle issues can help to enhance energy security. → A regional scenario in which reprocessing is rapidly phased out shows security and cost advantages.

  1. Nuclear power in Northern Russia: A case study on future energy security in the Murmansk region

    International Nuclear Information System (INIS)

    Kinnunen, Miia; Korppoo, Anna

    2007-01-01

    The economy of the Murmansk region in Russia is based on energy intensive industry, mainly metallurgies, and consequently, the region is highly dependant on the ageing Kola nuclear power plant. This interdependence together with other weaknesses in the regional energy system creates threats to the energy supply security of the region. This paper analyses the internal and external threats influencing the region and presents potential solutions. Scenarios further illustrate possible future paths these potential solutions could deliver by the year 2025

  2. The socio-economic impacts on regional areas as a result of new nuclear construction and nuclear decommissioning

    International Nuclear Information System (INIS)

    Devine, J. Michael

    2010-01-01

    Large social and economic impacts are caused by new nuclear construction and eventual shutdown of operations and decommissioning. When new construction begins, the impact on the local area is enormous. The influx of construction workers and businesses to provide services and goods usually overwhelms the area which previously may have had a minimal amount of infrastructure and little population. Also, given that many of the current nuclear facilities worldwide are located in somewhat remote regions, they have become the primary source of jobs for those regions. When these facilities shut down and go into decommissioning, there can be several adverse effects upon the region or area. This paper will address some of the primary socio-economic influences of both new nuclear construction and subsequent decommissioning. (author)

  3. CO mapping of the nuclear region of NGC 6946 and IC 342 with Nobeyama millimeter array

    Science.gov (United States)

    Ishizuki, Sumio; Kawabe, Ryohei; Okumura, Sachiko K.; Morita, Koh-Ichiro; Ishiguro, Masato

    1990-01-01

    CO observations of nearby galaxies with nuclear active star forming regions (and starburst galaxies) with angular resolutions around 7 seconds revealed that molecular bars with a length of a few kiloparsecs have been formed in the central regions of the galaxies. The molecular bar is interpreted as part of shock waves induced by an oval or barred potential field. By shock dissipation or dissipative cloud-cloud collisions, the molecular gas gains an infall motion and the nuclear star formation activity is fueled. But the distribution and kinematics of the molecular gas in the nuclear regions, which are sites of active star formation, remain unknown. Higher angular resolutions are needed to investigate the gas in the nuclear regions. Researchers made aperture synthesis observations of the nuclear region of the late-type spiral galaxies NGC 6946 and IC 342 with resolutions of 7.6 seconds x 4.2 seconds (P.A. = 147 deg) and 2.4 seconds x 2.3 seconds (P.A. = 149 deg), respectively. The distances to NGC 6496 and IC 342 are assumed to be 5.5 Mpc and 3.9 Mpc, respectively. Researchers have found 100-300 pc nuclear gas disk and ring inside a few kpc molecular gas bars. Researchers present the results of the observations and propose a possible mechanism of active star formation in the nuclear region.

  4. Peaceful uses of nuclear energy. Address at the regional public information seminar, Bangkok, 1 February 2000

    International Nuclear Information System (INIS)

    ElBaradei, M.

    2000-01-01

    In his address at the Regional Public Information Seminar (Bangkok, 1 February 2000), the Director General of the IAEA offered a global perspective on the development of nuclear energy at the beginning of the 21st century. The views expressed are from the vantage point of the IAEA, and are structured around the three pillars of Agency's work: nuclear technology, nuclear and radiation safety, and security of material and safeguards

  5. Regional Cooperation for the Promotion of Nuclear Power Business

    International Nuclear Information System (INIS)

    Kim, Jong Sok

    1991-01-01

    In the early year of nuclear power business in Korea, it was proceeded smoothly under the good situation in general. But in mid-1987 on the way of democratization in the country, mass demonstration of residents around the nuclear power plant and unfavorable groundless attitude to nuclear power plant presented US great deal of adversities. Upon this historical turning point KEPCO and government could provide the law on support for areas surrounding power plant and we recognized that the nuclear power business is only possible under the good-established, mutual cooperation between the utility and the surrounding communities and the enhancement of public understanding is inevitable than before. In order to secure these goals with the present recognition heartily, we firstly have to operate the plant safely to lay up the trust foundation and secondly to enhance the common understanding by giving more information of nuclear power especially contribution on national economic growth and environment preservation and, thirdly to do our best for the establishment of new era of co-prosperity between the utility and surrounding communities by strengthening the rational supports. By implementing all of these without any problems, the communities become more affluent than before and the conversion of the image of our corporation as a national entity will become widespread, so that it will be easy to find the necessary construction sites, as well as to operate existing plants, smoothly. Eventually we, as the public corporation, could carryout he social responsibility and contribute to the national economic growth, which leads to the final goal of community cooperation

  6. Erratum to: Nuclear triaxiality in the A ∼ 160–170 mass region: the ...

    Indian Academy of Sciences (India)

    Erratum to: Nuclear triaxiality in the A ∼ 160–170 mass region: the story so far. S MUKHOPADHYAY1,∗ and W C MA2. 1Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai 400 085, India. 2Department of Physics, Mississippi State University, Mississippi State, Mississippi 39762, USA. ∗. Corresponding ...

  7. Regional geology, tectonic, geomorphology and seismology studies to interest to nuclear power plants at Itaorna beach

    International Nuclear Information System (INIS)

    Hasui, Y.; Almeida, F.F.M. de; Mioto, J.A.; Melo, M.S. de.

    1982-01-01

    The study prepared for the nuclear power plants to be located at Itaorna comprised, the analysis and integration of Geologic, tectonic, geomorphologic and seismologic information and satisfactory results of regional stability were obtained. (L.H.L.L.) [pt

  8. Population Health in Regions Adjacent to the Semipalatinsk Nuclear Test Site

    National Research Council Canada - National Science Library

    1998-01-01

    ...) of the Union of Soviet Socialist Republics (USSR). Inhabitants of several Kazakhstan regions were contaminated in different years by radioactive fallout from atmospheric nuclear tests at the Semipalatinsk test site...

  9. Transport code and nuclear data in intermediate energy region

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Akira; Odama, Naomitsu [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Maekawa, F.; Ueki, K.; Kosaka, K.; Oyama, Y.

    1998-11-01

    We briefly reviewed the problems of intermediate energy nuclear data file and transport codes in connection with processing of the data. This is a summary of our group in the task force on JENDL High Energy File Integral Evaluation (JHEFIE). In this article we stress the necessity of the production of intermediate evaluated nuclear data file up to 3 GeV for the application of accelerator driven transmutation (ADT) system. And also we state the necessity of having our own transport code system to calculate the radiation fields using these evaluated files from the strategic points of view to keep our development of the ADT technology completely free from other conditions outside of our own such as imported codes and data with poor maintenance or unknown accuracy. (author)

  10. Transport code and nuclear data in intermediate energy region

    International Nuclear Information System (INIS)

    Hasegawa, Akira; Odama, Naomitsu; Maekawa, F.; Ueki, K.; Kosaka, K.; Oyama, Y.

    1998-01-01

    We briefly reviewed the problems of intermediate energy nuclear data file and transport codes in connection with processing of the data. This is a summary of our group in the task force on JENDL High Energy File Integral Evaluation (JHEFIE). In this article we stress the necessity of the production of intermediate evaluated nuclear data file up to 3 GeV for the application of accelerator driven transmutation (ADT) system. And also we state the necessity of having our own transport code system to calculate the radiation fields using these evaluated files from the strategic points of view to keep our development of the ADT technology completely free from other conditions outside of our own such as imported codes and data with poor maintenance or unknown accuracy. (author)

  11. US national and regional impacts of nuclear plant life extension

    International Nuclear Information System (INIS)

    Makovich, L.; Forest, L.; Fletcher, T.

    1988-01-01

    The US will need new sources of electricity in the early 21st century due to retirement of much of the nation's generating capacity. Almost all of the US nuclear capacity would be included in those retirements if, as originally expected, the nuclear units were shut down and decommissioned as the operating licenses expired between 2005 and 2025. However, given the large demands for new capacity during that period, nuclear plant life extension (NUPLEX) -- the extension of operating life beyond the original license period -- needs to be considered as an electricity source. This study assesses the benefits and costs of NUPLEX relative to the anticipated competing sources of electricity supply in the early 21st century. We find that NUPLEX yields large net benefits under a wide range of plausible economic conditions. This study associates net benefits with electricity cost savings, thereby abstracting from speculative reliability considerations. To illustrate the effects of uncertainty, the study assesses NUPLEX net benefits under varying assumptions on NUPLEX investment costs and other future economic conditions

  12. Regional and international implications of the Iranian nuclear crisis

    International Nuclear Information System (INIS)

    Reveillard, Ch.

    2006-01-01

    Iran is distinguished in the Middle East and the world by its geopolitical situation, qualified Middle Empire of the crossed worlds, which are all among the most active zones of the planet on the geopolitical and strategic plans. It undergoes on the one hand, region-al influences and inevitably in return acts in-depth on economic, strategic, diplomatic and cultural reality of its regional space made up of the three wholes: Central Asia, The Middle East, Persian Gulf open on the Indian Ocean. In addition, the singularity of its national policy, that tries to make move back the Anglo-Saxon impregnation of re-modelling the Middle East and the containment of the regional powers. (author)

  13. Additional protocols and regional cooperation on peaceful uses of nuclear energy in northeast Asia

    Energy Technology Data Exchange (ETDEWEB)

    Choe, Kwan Kyoo [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    2004-07-01

    The main object of this article is to clarify the relations between the implementation of the Protocols Additional to Safeguards Agreement (hereinafter referred to as the Additional Protocols) and the feasibility of the regional cooperation on peaceful uses of nuclear energy in Northeast Asia (NEA). The regionalism has a strong tendency to be based in advance on regional cooperation. The regionalism has three main structural elements in its definition: geographical proximity, cultural resemblance, and cooperative attitudes among all the countries concerned. The Additional Protocols allow the IAEA to access to more detailed information and nuclear activities of a State party. The aspect that the Additional Protocols could increase the nuclear transparency will result in ultimately promoting the confidence among the regional nations concerned.

  14. Nuclear photo-meson productions in the 1 GeV energy region

    International Nuclear Information System (INIS)

    Maeda, Kazushige

    1991-01-01

    Experimental studies of nuclear photomeson productions in the 1 GeV energy region are discussed. In this energy region, π ± , K + and (η) mesons whose life time (or widths) are enough long (narrow) to use spectroscopic study can be produced. This report focuses a possibility of electro-magnetic K + . productions on nuclei. A preliminary result of a photo-kaon test experiment carried out at electron synchrotron laboratory, Institute for Nuclear Study, University of Tokyo are presented. In this experiment, the particle identification method to select Kaon events has been established. We have performed a first measurement of nuclear photo-kaon cross section. (author)

  15. Nuclear energy development in the 21st century: Global scenarios and regional trends

    International Nuclear Information System (INIS)

    2010-01-01

    The International Project on Innovative Nuclear Reactors and Fuel Cycles (INPRO) was launched in 2000, on the basis of a resolution of the IAEA General Conference (GC(44)/RES/21). INPRO helps ensure that sustainable nuclear energy is available in the twenty-first century and seeks to bring together all interested Member States - both technology holders and technology users - to consider joint actions to achieve desired innovations. As of July 2010, 30 countries and the European Commission are members of INPRO. Programme Area B of INPRO, Global Vision - Scenarios and Pathways to Sustainable Nuclear Power Development, is aimed at providing a better understanding of the role of nuclear energy in the context of long term sustainable development. Its objective is to develop global and regional nuclear energy scenarios on the basis of a scientific-technical pathway analysis that lead to a global vision on sustainable nuclear energy development in the twenty-first century, and to support Member States in working towards that vision. This report presents the results of a study undertaken under Programme Area B in INPRO on Nuclear Energy Development in the Twenty-first Century: Global Scenarios and Regional Trends Studies on Nuclear Capacity Growth and Material Flow between Regions. The report does not develop a global vision for nuclear deployment per se, but presents a limited set of technical scenarios of nuclear deployment and considers their implications. It considers a global energy supply system composed of several reactor and fuel cycle types available today and of fast reactors that may be developed in the future to illustrate a possible modelling approach to identify the potential role of interregional transfer of nuclear fuel resources in supporting the global growth of nuclear energy. The study was performed with the participation of sixteen experts from nine INPRO Member States and included a dynamic simulation of material flows in nuclear energy systems using

  16. Studies on Enhancing Nuclear Transparency in the Asia-Pacific Region

    International Nuclear Information System (INIS)

    Kawakubo, Y.; Tomikawa, H.

    2015-01-01

    Nuclear transparency is defined as ''a cooperative process of providing information to all interested parties so that they can independently assess the safety, security, and legitimate management of nuclear materials'' by Sandia National Laboratories (SNL). Since the Asia- Pacific region has a broad spectrum of nuclear development underway and planned in the future, nuclear transparency is recognized as essential to provide additional assurance and enhance confidence building in this area. It is expected that elevated nuclear transparency should also supplement International Atomic Energy Agency (IAEA) safeguards. With this recognition, JAEA has committed various studies and activities for enhancing regional nuclear transparency mainly with U.S. Department of Energy (DOE) and its national laboratories. The efforts include concept study, development of secure data transmission technologies at the Experimental Fast Reactor ''Joyo'' for the use of regional nuclear transparency, and support for Council for Security and Cooperation in Asia Pacific (CSCAP) to develop internet-based transparency tools. JAEA also organized several workshops to discuss with stakeholder organizations to build acceptance for transparency tools and activities. Based on the past studies, JAEA, jointly with SNL, Korea Institute of Nuclear Nonproliferation and Control (KINAC) and Korea Atomic Energy Research Institute (KAERI), initiated a new phase of study in 2011 to design and establish an Information Sharing Framework (ISF) which was defined as ''a communication platform on which nuclear nonproliferation experts can provide and/or receive relevant information in a practical and sustainable manner''. During the period of two-year study, partner organizations identified essential elements to establish ISF and developed the requirements. Currently, JAEA and KINAC are planning to implement demonstration of ISF under Asia Pacific

  17. Study of a conceptual nuclear energy center at Green River, Utah: regional considerations

    International Nuclear Information System (INIS)

    1982-01-01

    This document constitutes one segment of a feasibility study investigating the ramifications of constructing a nuclear energy center in an arid and remote Western region. This phase of the study discusses regional considerations involved in nuclear energy center development at Green River, Utah. Regional support for NEC development is assessed. In addition, possible regulatory constraints to NEC development are identified and analyzed. Possible resource allocation shortages resulting from NEC development are also considered. A comparison with a similar study on NEC development in the Southeastern United States is also included

  18. Criteria and application methodology of physical protection of nuclear materials within the national and regional boundaries

    International Nuclear Information System (INIS)

    Rodriguez, C.E.; Cesario, R.H.; Giustina, D.H.; Canibano, J.

    1998-01-01

    Full text: The physical protection against robbery, diversion of nuclear materials and sabotage of nuclear installations by individuals or groups, has been for long time the reason of national and international concern. Even though, the obligation to create and implement an effective physical protection system for nuclear materials and installations in the territory of a given State, fall entirely on the State's Government, whether this obligation is fulfilled or not, and if it does, in what measure or up to what extent, it also concerns the rest of the States. Therefore, physical protection has become the reason for a regional co-operation. It is evident the need of co-operation in those cases where the physical protection efficiency within the territory of a given State depends also on the appropriate measures other States are taken, specially when dealing with materials been transported through national borders. The above mentioned constitute an important framework for the regional co-operation for the physical protection of nuclear materials. For that reason, the Nuclear Regulatory Authority established criteria and conditions aimed at mitigate diversions, robberies and sabotage to nuclear installations. As a working philosophy, it was established a simplify physical protection model of application in Argentina who, through the ARCAL No. 23 project, will be extrapolated to the whole Latin-American region, concluding that the application of the appropriated physical protection systems at regional level will lead to the strengthening of it at national level. (author) [es

  19. Modeling Regional Seismic Waves from Underground Nuclear Explosion

    Science.gov (United States)

    1989-05-15

    source outside the basin, small solid box beneath Ama. Little waveform distortion is observed along the path towsrds Pasadena (upper four trames) while...effects not accounted for in the wed and analytical solutions were derived for soluble interpretations given (Nuttli 1973, 1978, 1981; Herman & special...in a trnition region of COUPLING lengh L. The hybrid method used in the present study allows the the layering. Several types of solutions for models

  20. The Brazilian-Argentine Agency for Accounting and Control of Nuclear Materials (ABACC) as safeguard regional agency

    International Nuclear Information System (INIS)

    Alvim, C.F.

    1994-01-01

    The Brazilian-Argentine Agency for Accounting and Control of Nuclear Materials - ABACC applies regional safeguards on nuclear materials in Brazil and Argentina. The framework of international agreements concerning ABACC is presented, and the characteristics and requirements that a regional nuclear safeguards organization must fulfill are discussed. (author). 2 refs, 1 tab

  1. The ‘Landscape’ of Nuclear Safeguards: A Comparative Analysis of the International and Regional Systems

    International Nuclear Information System (INIS)

    Colussi, I.A.

    2015-01-01

    The notion of “nuclear non-proliferation” is twofold. It refers to: (a) reduction of the number of existing arsenals (vertical non-proliferation), and (b) containment of the number of States that possess nuclear weapons, or control of non-state actors (horizontal non-proliferation). At the international law level, as vertical non-proliferation, there are bilateral or multilateral agreements that ban weapons of mass destruction in certain areas (e.g.: Nuclear–Weapon– Free Zones treaties). With respect to horizontal non-proliferation, beyond the Nuclear-Weapon-Free Zones approach, the main legal text for addressing the issue is the Treaty on the Non-Proliferation of Nuclear Weapons (NPT). For the implementation of the principles contained in the NPT, a “nuclear safeguards” system has been created, and the International Atomic Energy Agency (IAEA) has been assigned the role of the nuclear “watchdog” for the NPT. However, along with this international system of safeguards, there are regional safeguards bodies: (a) the European Atomic Energy Community (EURATOM) model is the cornerstone of non-proliferation in the EU, while (b) the Brazilian-Argentine Agency for Accounting for and Control of Nuclear Materials (ABACC) controls nuclear activities in Brazil and Argentina. Moreover, the existing nuclear weapons free-zone treaties contain safeguards provisions that are additional or complementary to IAEA safeguards. For instance, (a) the Agency for the Prohibition of Nuclear Weapons in Latin America and the Caribbean (OPANAL) works for the implementation of Tlatelolco Treaty, (b) the African Commission on Nuclear Energy relates to Pelindaba Treaty, and (c) a Consultative Committee of the Parties is appointed in the context of Raratonga Treaty. The paper aims at critically analysing the different safeguards systems adopted at the international and regional level, through the adoption of a comparative approach. (author)

  2. The wireless sensor network monitoring system for regional environmental nuclear radiation

    International Nuclear Information System (INIS)

    Liu Chong; Liu Dao; Wang Yaojun; Xie Yuxi; Song Lingling

    2012-01-01

    The wireless sensor network (WSN) technology has been utilized to design a new regional environmental radiation monitoring system based on the wireless sensor networks to meet the special requirements of monitoring the nuclear radiation in certain regions, and realize the wireless transmission of measurement data, information processing and integrated measurement of the nuclear radiation and the corresponding environmental parameters in real time. The system can be applied to the wireless monitoring of nuclear radiation dose in the nuclear radiation environment. The measured data and the distribution of radiation dose can be vividly displayed on the graphical interface in the host computer. The system has functioned with the wireless transmission and control, the data storage, the historical data inquiry, the node remote control. The experimental results show that the system has the advantages of low power consumption, stable performance, network flexibility, range of measurement and so on. (authors)

  3. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  4. Development of Nuclear Engineering Educational Program at Ibaraki University with Regional Collaboration

    Science.gov (United States)

    Matsumura, Kunihito; Kaminaga, Fumito; Kanto, Yasuhiro; Tanaka, Nobuatsu; Saigusa, Mikio; Kikuchi, Kenji; Kurumada, Akira

    The College of Engineering, Ibaraki University is located at the Hitachi city, in the north part of Ibaraki prefecture. Hitachi and Tokai areas are well known as concentration of advanced technology center of nuclear power research organizations. By considering these regional advantages, we developed a new nuclear engineering educational program for students in the Collage of Engineering and The Graduate School of Science and Engineering of Ibaraki University. The program is consisted of the fundamental lectures of nuclear engineering and nuclear engineering experiments. In addition, several observation learning programs by visiting cooperative organizations are also included in the curriculum. In this paper, we report about the progress of the new educational program for nuclear engineering in Ibaraki University.

  5. Nuclear photofissility in the quasi-deuteron energy region

    International Nuclear Information System (INIS)

    Paiva, E. de; Tavares, O.A.P.; Terranova, M.L.

    2001-04-01

    A two hundred experimental photofissility data obtained in the quasi-deuteron region (∼ 30 - 140 MeV) of photonuclear absorption covering the target nuclei 27 Al, n at Ti, 51 V, 154 Sm, 174 Yb, n at T Hf, 181 Ta, n a t W, nat Re, nat Os, n a t Pt, 197 Au, na t Tl, 208 Pb, nat Pb and 209 Bi have been analysed in the framework of the current, two-step model for intermediate-energy photofission reactions. The incoming photon is assumed to be absorber by a neutron-proton pair (Levinger's quasi-deuteron model), followed by a mechanism of evaporation-fission competition for the excited residual nuclei. The experimental features of photofissility have been reproduced successfully by the model. (author)

  6. Substantiation of the radiation monitoring scope in the region of nuclear power plant location

    Energy Technology Data Exchange (ETDEWEB)

    Zykova, A S; Zhakov, Yu A; Yambrovskii, Ya M

    1977-12-01

    To provide radiation safety of the population in the region of nuclear power plant location, it is necessary to define the character and quantity of radiation monitoring. On the basis of radiation monitoring of effluents from operating nuclear power plants it is found that the effluents can be registered at a distance of 5-7 km from the plant. The quantity of sample analysis of the main enviromental objectives must provide an exact definition of the content of radioactive substances produced by radioactive fallouts and effluents from nuclear power plants.

  7. Substantiation of the radiation monitoring scope in the region of nuclear power plant location

    International Nuclear Information System (INIS)

    Zykova, A.S.; Zhakov, Yu.A.; Jambrovskij, Ya.M.

    1977-01-01

    To provide radiation safety of the population in the region of nuclear power plant location, it is necessary to define the character and quantity of radiation monitoring. On the basis of radiation monitoring of flowouts from operating nuclear power plants it is found that the flowouts can be registered at a distance of 5-7 km from the plant. The quantity of sample analysis of the main enviromental objectives must provide an exact definition of the content of radioactive substances produced by radioactive fallouts and flowouts from nuclear power plants

  8. Economic feasibility study of regional centers for nuclear fuel reprocessing in the developing countries

    International Nuclear Information System (INIS)

    Bakeshloo, A.A.

    1977-01-01

    The fuel cycle costs for the following three different economic alternatives were studied: (1) Reprocessing in an industrialized country (such as the U.S.); (2) Reprocessing in the individual developing country; (3) Reprocessing in a regional center. The nuclear fuel cycle cost for the ''Throw-away'' fuel cycle was evaluated. Among the six regions which were considered in this study, region one (South America including Mexico) was selected for the economic analysis of the nuclear fuel cycle for the above three alternatives. For evaluation of the cases where the fuel is reprocessed in a regional center or in an individual developing country, a unit reprocessing cost equation was developed. An economic evaluation was developed to estimate the least expensive method for transporting radioactive nuclear material by either leased or purchased shipping casks. The necessary equations were also developed for estimating plutonium transportation and the safeguard costs. On the basis of nuclear material and services requirements and unit costs for each component, the levelized nuclear fuel cycle costs for each alternative were estimated. Finally, by a comparison of cost, among these three alternatives plus the ''Throw-away'' case,it was found that it is not at all economical to build individual reprocessing plants inside the developing countries in region one. However, it also was found that the economic advantage of a regional center with respect to the first alternative is less than a 4% difference between their total fuel cycle costs. It is concluded that there is no great economic advantage in any developing countries to seek to process their fuel in one of the advanced countries. Construction of regional reprocessing centers is an economically viable concept

  9. Economic impact of accelerated cleanup on regions surrounding the US DOE's major nuclear weapons sites

    International Nuclear Information System (INIS)

    Greenberg, M.; Solitare, L.; Frisch, M.; Lowrie, K.

    1999-01-01

    The regional economic impacts of the US Department of Energy's accelerated environmental cleanup plan are estimated for the major nuclear weapons sites in Colorado, Idaho, New Mexico, South Carolina, Tennessee, and Washington. The analysis shows that the impact falls heavily on the three relatively rural regions around the Savannah River (SC), Hanford (WA), and Idaho National Engineering and Environmental Laboratory (ID) sites. A less aggressive phase-down of environmental management funds and separate funds to invest in education and infrastructure in the regions helps buffer the impacts on jobs, personal income, and gross regional product. Policy options open to the federal and state and local governments are discussed

  10. ENTNEA: A concept for enhancing regional atomic energy cooperation for securing nuclear transparency in northeast Asia

    Energy Technology Data Exchange (ETDEWEB)

    Shin, S. T. [Korea Institute for Defence Analyses, Seoul (Korea)

    2000-11-01

    Nuclear energy continues to be a strong and growing component of economic development in Northeast Asia. A broad range of nuclear energy systems already exists across the region and vigorous growth is projected. Associated with these capabilities and plans are various concerns about operational safety, environmental protection, and accumulation of spent fuel and other nuclear materials. We consider cooperative measures that might address these concerns. The confidence building measures suggested here center on the sharing of information to lessen concerns about nuclear activities or to solve technical problems. These activities are encompassed by an Enhanced Nuclear Transparency in Northeast Asia (ENTNEA) concept that would be composed of near-term, information-sharing activities and an eventual regional institution. The near-term activities would address specific concerns and build a tradition of cooperation; examples include radiation measurements for public safety and emergency response, demonstration of safe operations at facilities and in transportation, and material security in the back end of the fuel cycle. Linkages to existing efforts and organizations would be sought to maximize the benefits of cooperation. In the longer term, the new cooperative tradition might evolve into an ENTNEA institution. In institutional form, ENTNEA could combine the near-term activities and new cooperative activities, which might require an institutional basis, for the mutual benefit and security of regional parties. 28 refs., 23 figs., 5 tabs. (Author)

  11. An analog computer method for solving flux distribution problems in multi region nuclear reactors

    Energy Technology Data Exchange (ETDEWEB)

    Radanovic, L; Bingulac, S; Lazarevic, B; Matausek, M [Boris Kidric Institute of Nuclear Sciences Vinca, Beograd (Yugoslavia)

    1963-04-15

    The paper describes a method developed for determining criticality conditions and plotting flux distribution curves in multi region nuclear reactors on a standard analog computer. The method, which is based on the one-dimensional two group treatment, avoids iterative procedures normally used for boundary value problems and is practically insensitive to errors in initial conditions. The amount of analog equipment required is reduced to a minimum and is independent of the number of core regions and reflectors. (author)

  12. Assessment of the impact of nuclear power plant construction and operation on small regions

    International Nuclear Information System (INIS)

    Johnson, M.H. Jr.

    1977-01-01

    This study addresses the problem of the comprehensive, quantitative evaluation of the environmental, economic, and social impacts of the construction and operation of nuclear power plant on a given region. A theoretical model of the regional impacts is constructed employing input-output methods that are extended to include ecologic as well as economic effects. Thus, the regional model explicitly incorporates environmental feedback as a consequence of economic activity. The model is then employed to estimate the impact of the construction and operation of a nuclear power facility on a small region in South Carolina. Measures of economic and environmental effects include estimates of changes in output, income, employment, local government revenue and expenditure, external costs of environmental decay, pollution loads, and common-property resource usage. Results indicate that, in the South Carolina case study, significant gains in social welfare accrued to the region due to the construction and operation of the nuclear power facility. Further, the theoretical method developed herein provides a comprehensive method of objectively assessing various types of impacts on a region as small as several contiguous counties or even a single county

  13. Nuclear Hybrid Energy Systems - Regional Studies. West Texas and Northeastern Arizona

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, Humberto E. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Chen, Jun [Idaho National Lab. (INL), Idaho Falls, ID (United States); Kim, Jong S. [Idaho National Lab. (INL), Idaho Falls, ID (United States); McKellar, Michael G. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Deason, Wesley R. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Vilim, Richard B. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Bragg-Sitton, Shannon M. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Boardman, Richard D. [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2015-04-01

    The primary objective of this study is to conduct a preliminary dynamic analysis of two realistic hybrid energy systems (HES) including a nuclear reactor as the main baseload heat generator (denoted as nuclear HES or nuclear hybrid energy systems [NHES]) and to assess the local (e.g., HES owners) and system (e.g., the electric grid) benefits attainable by the application of NHES in scenarios with multiple commodity production and high penetration of renewable energy. It is performed for regional cases - not generic examples - based on available resources, existing infrastructure, and markets within the selected regions. This study also briefly addresses the computational capabilities developed to conduct such analyses, reviews technical gaps, and suggests some research paths forward.

  14. Transactions of the 1982 Eastern Regional American Nuclear Society student conference

    International Nuclear Information System (INIS)

    1982-01-01

    The 1982 Eastern Region ANS Student Conference of the ANS Student Branch and the School of Nuclear Engineering and Health Physics was held at Georgia Tech., April 16-17, 1982. Almost all the papers have been entered individually into EDB and ERA

  15. Regional training course on state systems of accounting for and control of nuclear material

    International Nuclear Information System (INIS)

    2001-01-01

    The publication is an outline of the subjects that are included in a regional training course organized in Buenos Aires (Argentina) by the IAEA with the cooperation of the Argentine Government and the Brazilian-Argentine Agency for the Accounting and Control of Nuclear Materials (ABACC) from September 24 to October 5, 2001

  16. REGIONAL BINNING FOR CONTINUED STORAGE OF SPENT NUCLEAR FUEL AND HIGH-LEVEL WASTES

    Energy Technology Data Exchange (ETDEWEB)

    W. Lee Poe, Jr

    1998-10-01

    In the Continued Storage Analysis Report (CSAR) (Reference 1), DOE decided to analyze the environmental consequences of continuing to store the commercial spent nuclear fuel (SNF) at 72 commercial nuclear power sites and DOE-owned spent nuclear fuel and high-level waste at five Department of Energy sites by region rather than by individual site. This analysis assumes that three commercial facilities pairs--Salem and Hope Creek, Fitzpatrick and Nine-Mile Point, and Dresden and Moms--share common storage due to their proximity to each other. The five regions selected for this analysis are shown on Figure 1. Regions 1, 2, and 3 are the same as those used by the Nuclear Regulatory Commission in their regulatory oversight of commercial power reactors. NRC Region 4 was subdivided into two regions to more appropriately define the two different climates that exist in NRC Region 4. A single hypothetical site in each region was assumed to store all the SNF and HLW in that region. Such a site does not exist and has no geographic location but is a mathematical construct for analytical purposes. To ensure that the calculated results for the regional analyses reflect appropriate inventory, facility and material degradation, and radionuclide transport, the waste inventories, engineered barriers, and environmental conditions for the hypothetical sites were developed from data for each of the existing sites within the given region. Weighting criteria to account for the amount and types of SNF and HLW at each site were used in the development of the environmental data for the regional site, such that the results of the analyses for the hypothetical site were representative of the sum of the results of each actual site if they had been modeled independently. This report defines the actual site data used in development of this hypothetical site, shows how the individual site data was weighted to develop the regional site, and provides the weighted data used in the CSAR analysis. It is

  17. REGIONAL BINNING FOR CONTINUED STORAGE OF SPENT NUCLEAR FUEL AND HIGH-LEVEL WASTES

    International Nuclear Information System (INIS)

    W. Lee Poe, Jr.

    1998-01-01

    In the Continued Storage Analysis Report (CSAR) (Reference 1), DOE decided to analyze the environmental consequences of continuing to store the commercial spent nuclear fuel (SNF) at 72 commercial nuclear power sites and DOE-owned spent nuclear fuel and high-level waste at five Department of Energy sites by region rather than by individual site. This analysis assumes that three commercial facilities pairs--Salem and Hope Creek, Fitzpatrick and Nine-Mile Point, and Dresden and Moms--share common storage due to their proximity to each other. The five regions selected for this analysis are shown on Figure 1. Regions 1, 2, and 3 are the same as those used by the Nuclear Regulatory Commission in their regulatory oversight of commercial power reactors. NRC Region 4 was subdivided into two regions to more appropriately define the two different climates that exist in NRC Region 4. A single hypothetical site in each region was assumed to store all the SNF and HLW in that region. Such a site does not exist and has no geographic location but is a mathematical construct for analytical purposes. To ensure that the calculated results for the regional analyses reflect appropriate inventory, facility and material degradation, and radionuclide transport, the waste inventories, engineered barriers, and environmental conditions for the hypothetical sites were developed from data for each of the existing sites within the given region. Weighting criteria to account for the amount and types of SNF and HLW at each site were used in the development of the environmental data for the regional site, such that the results of the analyses for the hypothetical site were representative of the sum of the results of each actual site if they had been modeled independently. This report defines the actual site data used in development of this hypothetical site, shows how the individual site data was weighted to develop the regional site, and provides the weighted data used in the CSAR analysis. It is

  18. Penumbral imaging with multi-penumbral-apertures and its heuristic reconstruction for nuclear reaction region diagnostics

    International Nuclear Information System (INIS)

    Ueda, Tatsuki; Fujioka, Shinsuke; Nishimura, Hiroaki; Nozaki, Shinya; Chen Yenwei

    2010-01-01

    Imaging of nuclear reaction region is important to clarify heating mechanism in a fast-ignition plasma. The nuclear reaction region can be identified by hard x-ray and neutron images, which are emanated from the heated region. We proposed a novel penumbral imaging that is suitable for imaging quanta having strong penetrating power, such as hard x ray and neutron. Using multiple penumbral apertures arranged with M-sequence leads to two orders of magnitude higher detection efficiency than that with a single aperture. In addition, a heuristic method was introduced to a image reconstruction procedure for reducing artifacts caused by noise in a penumbral image. A proof-of-principle experiment indicates that the proposed imaging is superior to the conventional one.

  19. Regional Cooperation Agreement for Asia and the Pacific (RCA). A mechanism for nuclear technology transfer

    International Nuclear Information System (INIS)

    Bin Muslim, N.

    1993-01-01

    The paper presents the regional cooperation programs of the IAEA which have as purpose to promote the applications of peaceful uses of atomic energy and to transfer technology to the developing countries. The paper focusses on the (RCA) program for Asia and the Pacific, it is considered the most important mechanism for genuine technology transfer. The annex no 1 lists the full text of the Regional Cooperative Agreement for Research, Development and Training Related to Nuclear Science and Technology, 1987 (13 articles). The annex no.3 lists also the full text of the African Regional Cooperative Agreement for Research, Development and training Related to Nuclear Science and Technology (14 articles). 11 refs., 17 tabs

  20. Hydro - nuclear strategy in the expansion of the North and Northeast regions interconnected system

    International Nuclear Information System (INIS)

    Lima, J.O.V.

    1981-04-01

    The settlement of nuclear power plants in the North and Northeast Regions Interconnected System, taking into consideration merely economic analysis, is studied. Assuming that the system isn't connected with the Southeast Region, expansion alternatives were defined supported by an optimization model which mathematical formulation was based on a Linear Programming. The main model conditioning was the eletric energy market requirements evolution of the mentioned regions, estimated up to 2010, regarding tendencies presented by forecast elaborated by ELETROBRAS. The system was designed to assure its continuously attendance, even in the case of occurrence of a critical hidrological period, employing as generation sources hidroeletric plants and PWR nuclear power plants of 1245 MWe, similar to ANGRA II. (Author) [pt

  1. Analyzing the differences between Seoul versus other Regions in response to Nuclear Power Information

    Energy Technology Data Exchange (ETDEWEB)

    Roh, Seung Kook [KAERI, Daejeon (Korea, Republic of); Kim, Chul Min [KAIST, Daejeon (Korea, Republic of)

    2016-05-15

    Seoul citizens do not feel any seriousness about the recent issues related to NPP, since they do not have NPP in nearby region. Despite Seoul Metropolitan Government has been conducting 'reduce one NPP' campaign for 4 years with large budget, the awareness of Seoul citizens' NPP is very low. From this point of view, it can be seen that the campaign failed to increase the awareness of NPP. Besides, Seoul citizens are living in the most distant region from NPP so that they lack the opportunity to access the information about the safety of the facility in direct way. They formed overall image about nuclear power through information from the media and indirect experience. The public usually pay attention to negative or incendiary news more than the positive ones. They are more likely to have a simply negative image from incendiary news, such as the movement against radioactive waste disposal siting in Guleopdo and Buan, Fukushima accident, radioactive rain, Japanese seafood imports, nuclear scandal, etc. Even media that has positive nuances can raise doubts about nuclear power. In addition, the public usually have lower opportunity to feel an affinity for nuclear power, and show the problems related to nuclear power in the third party's stance. According to the mere exposure theory, it can be the cause of having negative stance.

  2. Inter-relations between regional and global approaches to nuclear non-proliferation

    International Nuclear Information System (INIS)

    Simpson, J.

    1995-01-01

    It is now becoming evident that the end of the East-West conflict has had a significant effect upon both global and regional security structures. From a situation where regional arrangements were, in the main, determined and driven by pressures arising from the bipolar division which permeated all aspects of the global political system, they increasingly have an independent existence. This has enabled such arrangements to be tailored to local circumstances in a manner which is not possible with global agreements. In particular, it has become apparent that enhanced constraints on peaceful nuclear activities and much more intrusive inspection and monitoring procedures, can more easily be negotiated on a regional basis than a global one. It also appears that nuclear weapon states are prepared to make unconditional commitments about nuclear weapon use on a regional basis, whereas they may not be prepared to do so on a global one. In short, regional approaches enable fine-tuning of the international non-proliferation regime to occur, and for measures to be taken on a regional level that would be politically unacceptable on the global level, due to their discriminatory nature. In the years ahead additional Nuclear-Weapon-Free Zone (NWFZ) agreements may be negotiated, covering more of the land area of the globe. In parallel, regional nuclear cooperation and safeguarding agreements might also be expected to develop along the lines of EURATOM and ABACC. This in turn may move the states which remain outside of the NPT to a similar position to Argentina and Brazil at the moment: to an acceptance that whatever their opposition in principle to the NPT and the system of supplier export guidelines, the commitments they have already accepted on a regional level are more intrusive and constraining than those they would incur if they were to have acceded to the Treaty. In these circumstances, accession to the NPT becomes a distinct possibility, and thus the regional approach to non

  3. Multi-Decadal Global Cooling and Unprecedented Ozone Loss Following a Regional Nuclear Conflict

    Science.gov (United States)

    Mills, M. J.; Toon, O. B.; Lee-Taylor, J. M.; Robock, A.

    2014-12-01

    We present the first study of the global impacts of a regional nuclear war with an Earth system model including atmospheric chemistry, ocean dynamics, and interactive sea-ice and land models (Mills et al., 2014). A limited, regional nuclear war between India and Pakistan in which each side detonates 50 15-kt weapons could produce about 5 Tg of black carbon. This would self-loft to the stratosphere, where it would spread globally, producing a sudden drop in surface temperatures and intense heating of the stratosphere. Using the Community Earth System Model with the Whole Atmosphere Community Climate Model (CESM1(WACCM)), we calculate an e-folding time of 8.7 years for stratospheric black carbon, compared to 4-6.5 years for previous studies (figure panel a). Our calculations show that global ozone losses of 20-50% over populated areas, levels unprecedented in human history, would accompany the coldest average surface temperatures in the last 1000 years (figure panel c). We calculate summer enhancements in UV indices of 30-80% over Mid-Latitudes, suggesting widespread damage to human health, agriculture, and terrestrial and aquatic ecosystems. Killing frosts would reduce growing seasons by 10-40 days per year for 5 years. Surface temperatures would be reduced for more than 25 years, due to thermal inertia and albedo effects in the ocean and expanded sea ice. The combined cooling and enhanced UV would put significant pressures on global food supplies and could trigger a global nuclear famine. Knowledge of the impacts of 100 small nuclear weapons should motivate the elimination of the more than 17,000 nuclear weapons that exist today. Mills, M. J., O. B. Toon, J. Lee-Taylor, and A. Robock (2014), Multidecadal global cooling and unprecedented ozone loss following a regional nuclear conflict, Earth's Future, 2(4), 161-176, doi:10.1002/2013EF000205.

  4. Quality control of radionuclide calibrators used in nuclear medicine services in the Brazilian northeast region

    International Nuclear Information System (INIS)

    Fragoso, Maria C.F.; Albuquerque, Antonio M.S.; Oliveira, Mercia L.; Lima, Ricardo A.; Lima, Fabiana F.

    2011-01-01

    The radionuclide calibrators are essential instruments in nuclear medicine services in order to activity determination of radiopharmaceuticals which will be administered to the patients. Inappropriate performance of these equipment could provide underestimation or overestimation of the activity, compromising the success of diagnosis or therapeutic procedures. To ensure the satisfactory performance of the radionuclide calibrators, quality control tests are recommended by national and international guides. The aim of this work was evaluate the establishment of the quality control program in the radionuclide calibrators at medicine nuclear services in the Brazilian northeast region, highlighting the tests and their frequencies. (author)

  5. Implantation of tomography qualities in Centro Regional de Ciencias Nucleares do Nordeste, Brazil

    International Nuclear Information System (INIS)

    Diniz, Osana F.; Silveira, Renata R.; Melo, Roberto T.; Oliveira, Marcia L.

    2016-01-01

    The quality guarantee of the service offered by a ionizing radiation metrology laboratory is deeply connected to the conformity to the radiation beams implanted to the determination and definition present in the international standards and adopted by the Brazilian National Commission of Nuclear Energy – CNEN. The objective of this work was the implementation of computerized tomography qualities, RQT 8, 9 e 10, in accordance with the IEC-61267 standard in the Metrology Laboratory of the Northeast Regional Center of Nuclear Sciences (CRCN-NE), PE, Brazil. (author)

  6. Nuclear power generation development and the people of the regional community concerned

    International Nuclear Information System (INIS)

    Anzai, Ikuro

    1978-01-01

    Though the nuclear power generation in Japan is planned to be developed with light water reactor power plants as its main stations, regional campaigns against their locations are nowadays evolved in various ways around the sites. In some regions, the problem has been carried into the court in the form of administrative litigation in which the revocation of permission for sites is demanded. Regional campaigns, though different depending upon the regional communities in the people taking leading parts in their activities, have been developed respectively, primarily beginning at simple questions and experiencing the meetings with the authorities concerned and related persons in electric power companies, and the occurrence of abnormalities and failures and the attitudes of persons concerned. It was in 1972 that the Japan Scientist Association proposed six criteria to check up the conditions of nuclear power development in Japan. It further has emphasized that security is to be watched from three points of view. At present, the problems are apt to be grasped as the public nuisance to the people of regional communities. However, in the author's opinion, it is important to recognize the problems essentially as political and economic ones in the global concern or the world history. In the latter half of the article, regional campaigns in various places in Japan are reported in detail. (Wakatsuki, Y.)

  7. New public commons and network of nuclear site regions for the post-Fukushima accident re-vitalization

    International Nuclear Information System (INIS)

    Sawada, Tetsuo

    2012-01-01

    Due to the Fukushima NPP accidents on 11 March 2011, we have deadly lost the regional ties among local people, electricity consumers, and people involved in the nuclear research, development and businesses. Now we need the method to reconstruct the ties and further the activation of locals in accordance to the concept of 'New Public Commons'. And it is the most important key to recover the people's confidence for the nuclear business and promote the new siting and replacement of nuclear power stations. More than forty years have past since the earliest stage of invitation of nuclear power stations to regional areas in Japan. For this period, the efforts for the development of regional industries and the improvement of regional life obtained a level of results. However, now a new turn is required in the regional development, as the perception of wealthy has been gradually changed. The primary objective of this study is to make a network among regional areas where nuclear power stations and related facilities are located. It should further the understanding for nuclear energy, stimulate the 'emergence' through the cooperative works among regional areas. As a result, such efforts will enhance the Social Responsibility of conducts related to the nuclear energy. i.e., Nuclear SR (NSR). The basic frame of the NSR should be re-estimated in the reflection of 3.11 Fukushima NPP accidents. (author)

  8. Nuclear Deformation and Neutron Excess as Competing Effects for Dipole Strength in the Pygmy Region

    Science.gov (United States)

    Massarczyk, R.; Schwengner, R.; Dönau, F.; Frauendorf, S.; Anders, M.; Bemmerer, D.; Beyer, R.; Bhatia, C.; Birgersson, E.; Butterling, M.; Elekes, Z.; Ferrari, A.; Gooden, M. E.; Hannaske, R.; Junghans, A. R.; Kempe, M.; Kelley, J. H.; Kögler, T.; Matic, A.; Menzel, M. L.; Müller, S.; Reinhardt, T. P.; Röder, M.; Rusev, G.; Schilling, K. D.; Schmidt, K.; Schramm, G.; Tonchev, A. P.; Tornow, W.; Wagner, A.

    2014-02-01

    The electromagnetic dipole strength below the neutron-separation energy has been studied for the xenon isotopes with mass numbers A =124, 128, 132, and 134 in nuclear resonance fluorescence experiments using the γELBE bremsstrahlung facility at Helmholtz-Zentrum Dresden-Rossendorf and the HIγS facility at Triangle Universities Nuclear Laboratory Durham. The systematic study gained new information about the influence of the neutron excess as well as of nuclear deformation on the strength in the region of the pygmy dipole resonance. The results are compared with those obtained for the chain of molybdenum isotopes and with predictions of a random-phase approximation in a deformed basis. It turned out that the effect of nuclear deformation plays a minor role compared with the one caused by neutron excess. A global parametrization of the strength in terms of neutron and proton numbers allowed us to derive a formula capable of predicting the summed E1 strengths in the pygmy region for a wide mass range of nuclides.

  9. Nuclear deformation and neutron excess as competing effects for dipole strength in the pygmy region.

    Science.gov (United States)

    Massarczyk, R; Schwengner, R; Dönau, F; Frauendorf, S; Anders, M; Bemmerer, D; Beyer, R; Bhatia, C; Birgersson, E; Butterling, M; Elekes, Z; Ferrari, A; Gooden, M E; Hannaske, R; Junghans, A R; Kempe, M; Kelley, J H; Kögler, T; Matic, A; Menzel, M L; Müller, S; Reinhardt, T P; Röder, M; Rusev, G; Schilling, K D; Schmidt, K; Schramm, G; Tonchev, A P; Tornow, W; Wagner, A

    2014-02-21

    The electromagnetic dipole strength below the neutron-separation energy has been studied for the xenon isotopes with mass numbers A=124, 128, 132, and 134 in nuclear resonance fluorescence experiments using the γELBE bremsstrahlung facility at Helmholtz-Zentrum Dresden-Rossendorf and the HIγS facility at Triangle Universities Nuclear Laboratory Durham. The systematic study gained new information about the influence of the neutron excess as well as of nuclear deformation on the strength in the region of the pygmy dipole resonance. The results are compared with those obtained for the chain of molybdenum isotopes and with predictions of a random-phase approximation in a deformed basis. It turned out that the effect of nuclear deformation plays a minor role compared with the one caused by neutron excess. A global parametrization of the strength in terms of neutron and proton numbers allowed us to derive a formula capable of predicting the summed E1 strengths in the pygmy region for a wide mass range of nuclides.

  10. Nuclear event time histories and computed site transfer functions for locations in the Los Angeles region

    Science.gov (United States)

    Rogers, A.M.; Covington, P.A.; Park, R.B.; Borcherdt, R.D.; Perkins, D.M.

    1980-01-01

    This report presents a collection of Nevada Test Site (NTS) nuclear explosion recordings obtained at sites in the greater Los Angeles, Calif., region. The report includes ground velocity time histories, as well as, derived site transfer functions. These data have been collected as part of a study to evaluate the validity of using low-level ground motions to predict the frequency-dependent response of a site during an earthquake. For this study 19 nuclear events were recorded at 98 separate locations. Some of these sites have recorded more than one of the nuclear explosions, and, consequently, there are a total of 159, three-component station records. The location of all the recording sites are shown in figures 1–5, the station coordinates and abbreviations are given in table 1. The station addresses are listed in table 2, and the nuclear explosions that were recorded are listed in table 3. The recording sites were chosen on the basis of three criteria: (1) that the underlying geological conditions were representative of conditions over significant areas of the region, (2) that the site was the location of a strong-motion recording of the 1971 San Fernando earthquake, or (3) that more complete geographical coverage was required in that location.

  11. Fracture analyses and test of regions with nozzle and hole and curvature influence in nuclear vessel

    International Nuclear Information System (INIS)

    Wang Baisong; Xu Dinggen; Ye Weijuan; Hu Yinbiao; Liang Xingyun; Gu Shaode; Zhou Peiying

    1993-08-01

    For the calculations of stress intensity factor K 1 of surface crack in the regions with nozzle and hole and the curvature influence on nuclear vessel, a improved 3-D collapsed isoparametric singular element with quarter-points was presented. The square root singularity in the vertical planes of crack was derived. The methods of transitional element and calculating K 1 from displacements were extensively used in 3- D case. The SIF K 1 of the corner crack in inner wall of the nozzle of RPV (reactor pressure vessel) for a typical 300 MW nuclear plant was calculated, and it was verified by 3-D photo-elastic test and diffusion of light test. The engineering fracture analysis and evaluation of the outside surface crack in the circular are transitional region of the head flange of RPV are also completed

  12. Problems on radioactive waste and spent nuclear fuel management in the European Arctic Region of Russia

    International Nuclear Information System (INIS)

    Krukov, Evgeny B.

    1999-01-01

    In the Arkhangelsk and Murmansk regions of Russia, radioactive wastes and spent nuclear fuel from the Northern Fleet and Mineconomiki, the technological repairing plant Atomflot and the Kola nuclear power plant and other activities is accumulating steadily and there is no adequate waste management system in the region. There is an action plan to remedy the situation, but it has been delayed because of insufficient funds. This presentation lists the volumes of liquid and solid radioactive wastes from these sources in 1996 and the expected volumes in 2020. It also lists the specific problems of the present waste management and main proposals of the action plan. In addition to federal funds, a number of projects are financed through international co-operation

  13. Realistic nuclear shell theory and the doubly-magic 132Sn region

    International Nuclear Information System (INIS)

    Vary, J.P.

    1978-01-01

    After an introduction discussing the motivation and interest in results obtained with isotope separators, the fundamental problem in realistic nuclear shell theory is posed in the context of renormalization theory. Then some of the important developments that have occurred over the last fifteen years in the derivation of the effective Hamiltonian and application of realistic nuclear shell theory are briefly reviewed. Doubly magic regions of the periodic table and the unique advantages of the 132 Sn region are described. Then results are shown for the ground-state properties of 132 Sn as calculated from the density-dependent Hartree-Fock approach with the Skyrme Hamiltonian. A single theoretical Hamiltonian for all nuclei from doubly magic 132 Sn to doubly magic 208 Pb is presented; single-particle energies are graphed. Finally, predictions of shell-model level-density distributions obtained with spectral distribution methods are discussed; calculated level densities are shown for 136 Xe. 10 figures

  14. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    Science.gov (United States)

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  15. Real-time detection and characterization of nuclear explosion using broadband analyses of regional seismic stations

    Science.gov (United States)

    Prastowo, T.; Madlazim

    2018-01-01

    This preliminary study aims to propose a new method of real-time detection and characterization of nuclear explosions by analyzing broadband seismic waveforms acquired from a network of regional seismic stations. Signal identification generated by a nuclear test was differentiated from natural sources of either earthquakes or other natural seismo-tectonic events by verifying crucial parameters, namely source depth, type of first motion, and P-wave domination of the broadband seismic wavesunder consideration. We examined and analyzed a recently hypothetical nuclear test performed by the North Koreangovernment that occurred on September 3, 2017 as a vital point to study. From spectral analyses, we found that the source of corresponding signals associated with detonations of the latest underground nuclear test was at a much shallower depth below the surface relatively compared with that of natural earthquakes, the suspected nuclear explosions produced compressional waves with radially directed outward from the source for their first motions, and the waves were only dominated by P-components. The results are then discussed in the context of potential uses of the proposed methodology for human-induced disaster early warning system and/or the need of rapid response purposes for minimizing the disaster risks.

  16. Possible applications of power from Temelin nuclear power plant in agriculture of the South Bohemian Region

    International Nuclear Information System (INIS)

    Hosek, V.

    1989-01-01

    The agricultural organizations in the South Bohemian Region have suggested the use of low-potential waste heat from the Temelin nuclear power plant in processing feed potatoes, fodder drying, mushroom production, heating greenhouses and agricultural buildings, drying corn and processing vegetables. Greenhouses should be built on an area of 30 hectares. Hydroponics is expected to be used. The location of the greenhouse area relative to the power plant is described. (M.D.). 6 tabs

  17. Regional and global environmental behaviour of radionuclides from the nuclear fuel cycle

    International Nuclear Information System (INIS)

    1983-02-01

    The operation of nuclear fuel cycle facilities entails the discharge of radioactive effluents to both the atmosphere and aquatic environment. These effluents may contain radionuclides which may be subject of concern for their long-range environmental consequences, in particular, in assessing the health detriment to populations in regions beyond the local environment. The present document reviews information on radionuclides, their environmental pathways and processes and related models and summarizes experiences and studies in this field

  18. Use of systematics in the interpretation of nuclear structure far from the beta-stable region

    International Nuclear Information System (INIS)

    Wood, J.L.

    1979-01-01

    The use of systematics in the interpretation of nuclear structure far from the beta-stable region is discussed. In particular, a set of rules for the use of systematics is presented together with some experimental criteria that need to be fulfilled for radioactive decay scheme studies in order that all states up to a given spin-parity and energy are located. Illustrative examples are taken from the region 180 < A < 210, with particular emphasis on the odd-mass Au and Hg nuclei. 6 figures

  19. Public participation and regional development at a nuclear waste disposal site

    International Nuclear Information System (INIS)

    Ipsen, D.

    2005-01-01

    The propositions brought forward in this article try to implement sociological aspects into the search for nuclear waste disposal sites based on two theses: Firstly without the willingness of public participation in the search and inspection processes the success of the process is severly put into question in a democratic state. Secondly the potential disposal site must not block the further economic development of the region. These two theses lead to socio-economic criteria for consideration or debarment, to a concept of active and intensive participation, and to considerations about long-term regional development. (orig.)

  20. Regularities of in-regional redistribution of the nuclear test products in the atmosphere

    International Nuclear Information System (INIS)

    Tsitskishvili, M.S.; Chkhartishvili, A.G.; Nozadze, M.R.; Intskirveli, L.N.; Buachidze, N.D.; Churguliya, E.R.; Shatberashvili, I.G.; Diasamidze, R.I.; Karchava, G.V.; Gugushvili, B.S.

    2003-01-01

    Regularities of artificial radionuclides redistribution in the Caucasus atmosphere are studied. The structure of global fallout in the region is considered. It is noted, that Caucasus is characterizing by a wide diversity of the landscapes and soils. This diversity results a different migration regime for radioisotopes in soils. Penetration of the nuclear tests products into the soils depends on the annual precipitation amount (soil humidification), and incoming level of the radioisotopes. At evaluation of external and internal irradiation doses on South Caucasus population the Caucasus was divided into regions by levels of the global reactive fallout

  1. Nuclear analytical techniques applied to characterization of atmospheric aerosols in Amazon Region

    International Nuclear Information System (INIS)

    Gerab, Fabio; Artaxo, Paulo

    1996-01-01

    This work presents the atmospheric aerosols characterization that exist in different regions of Amazon basin. The biogenic aerosol emission by forest, as well as the atmospheric emissions of particulate materials due to biomass burning, were analyzed. Samples of aerosol particles were collected during three years in two different locations of Amazon region using Stacked Unit Filters. In order to study these samples some analytical nuclear techniques were used. The high concentrations of aerosols as a result of biomass burning process were observed in the period of june-september

  2. Regional long-term co-operation in the field of nuclear and radiation emergency preparedness

    International Nuclear Information System (INIS)

    Sladek, V.; Metke, E.; Janko, K.; Hohenberg, J. K.; Hofer, P.

    2004-01-01

    Emergency preparedness is generally covered by methodical and coordinative activities of the International Atomic Energy Agency (IAEA) in Member States of the IAEA and by the European Commission (EC) in EU Member and EU Accession Countries. However, the regional harmonisation of emergency arrangements is an important trend of emergency preparedness. The present paper gives a couple of illustrative examples for a regional co-operation in the field of emergency preparedness in Central Europe and an overview on international exercises in this region. The penultimate section contains an outlook on future activities regarding regional co-operation in Central Europe. The following topics have been suggested inter alia: the harmonisation of intervention criteria and countermeasures, co-ordination in the field of information of the public, comprehensive bi lateral and multilateral exercises, exchange of experts between the national nuclear emergency centres and inter-comparison calculations of the computer codes. (authors)

  3. Analysis of sheltering and evacuation strategies for a national capital region nuclear detonation scenario.

    Energy Technology Data Exchange (ETDEWEB)

    Yoshimura, Ann S.; Brandt, Larry D.

    2011-12-01

    Development of an effective strategy for shelter and evacuation is among the most important planning tasks in preparation for response to a low yield, nuclear detonation in an urban area. Extensive studies have been performed and guidance published that highlight the key principles for saving lives following such an event. However, region-specific data are important in the planning process as well. This study examines some of the unique regional factors that impact planning for a 10 kT detonation in the National Capital Region. The work utilizes a single scenario to examine regional impacts as well as the shelter-evacuate decision alternatives at one exemplary point. For most Washington, DC neighborhoods, the excellent assessed shelter quality available make shelter-in-place or selective transit to a nearby shelter a compelling post-detonation strategy.

  4. Nuclear applications for the management of aquifers in the semi-arid region

    International Nuclear Information System (INIS)

    Simoes Filho, Fernando Lamego

    2005-01-01

    The semi-arid region of the Northeast of Brazil is characterized by a lack of superficial waters due to the low pluviometric precipitation and high evaporation rates. In addition to this, the precipitation events are irregular in time causing long periods of dryness or flooding with catastrophic consequences. Owing to adverse climatic conditions with recurrent droughts, intense pressure is being put on the use of groundwater resources. Groundwater occurrence on its turn depends on a series of geological and climatological characteristics that are very variable in the region. Because of this situation, groundwater is of strategical importance and represents a vital factor to its socioeconomic development. However, there is still insufficient knowledge of the basic aquifers characteristics leading to an over exploitation of the water resources. It is not surprising that, amongst other reasons, this situation contributes to the fact that areas with the lowest human development pattern are located in the semi-arid region of Brazil. Given the nature of hydrological problems that need to be addressed in semi-arid regions, nuclear/isotope techniques are increasingly recognized as indispensable tools for water resources assessment and development. However, information arising from these techniques has to cope with other hydrological methods in an integrated manner. The general objective was prospect nuclear technologies as tools for aquifer management, promoting sustainable use of groundwater in the semi-arid region. (author)

  5. Modification of the Japanese first nuclear ship reactor for a regional energy supply system

    International Nuclear Information System (INIS)

    Sato, K.; Shimazu, Y.; Narabayashi, T.; Tsuji, M.

    2008-01-01

    Nuclear Ship Mutsu was developed as the first experimental nuclear ship of Japan. It has several advantages as a prototype for regional energy supply system. Considering the attractive advantages of the Mutsu reactor, we investigated the feasibility of development of a small regional energy system by adopting the Mutsu reactor as a starting model. The system could supply with not only electricity but also heat. Heat could be used for hot-water supply, a heating system of a house, melting snow and so on, especially for those in northern part of Japan. The system should satisfy the requirements for GEN IV systems and the current regulations. From this point of view, the modification of the reactor was initiated by taking into improvements and technology of the state of arts to fulfill the requirements such as (1) Longer core life without refueling, (2) Reactivity adjustment for load change without control rods or soluble boron, (3) Simpler operations for load changes and (4) Ultimate safety with sufficient passive capability. Currently it is assumed to use basic standard 17x17 fuel assembly design for WH type PWRs. Nuclear design calculations are carried out by 'SRAC 2002 ', which has been developed in Japan Atomic Energy Agency. Several problems have not been solved yet, but we confirmed the proposed core has about 10 years life time. So the proposed core has a possibility to be used for a small regional energy system. (authors)

  6. Nuclear Data for Reactor Physics: Cross sections and level densities in the actinide region

    Directory of Open Access Journals (Sweden)

    Bernstein L.

    2010-03-01

    Full Text Available Nuclear data in the actinide region are particularly important because they are basis behind all simulations of nuclear reactor core behaviour over both long time scales (fuel depletion and waste production and short time scales (accident scenarios. Nuclear reaction cross sections must be known as precisely as possible so that core reaction rates can be accurately calculated. Although cross section measurements in this region have been widely performed, for certain nuclei, particularly those with short half lives, direct measurements are either very difficult or impossible and thus reactor simulations must rely on theoretical calculations or extrapolations from neighbouring nuclei. The greatest uncertainty in theoretical cross section calculations comes from the lack of knowledge of level densities, for which predicted values can often be incorrect by a factor of two or more. Therefore there is a strong case for a systematic experimental study of level densities in the actinide region for the purpose of a providing a stringent test of theoretical cross section calculations for nuclei where experimental cross section data are available and b for providing better estimations of cross sections for nuclei in which no cross section data are available.

  7. X-Ray Emission from the Nuclear Region of Arp 220

    Science.gov (United States)

    Paggi, Alessandro; Fabbiano, Giuseppina; Risaliti, Guido; Wang, Junfeng; Karovska, Margarita; Elvis, Martin; Maksym, W. Peter; McDowell, Jonathan; Gallagher, Jay

    2017-05-01

    We present an imaging and spectral analysis of the nuclear region of the ultraluminous infrared galaxy merger of Arp 220, using deep Chandra-ACIS observations summing up to ˜ 300 {{ks}}. Narrowband imaging with subpixel resolution of the innermost nuclear region reveals two distinct Fe-K emitting sources, coincident with the infrared and radio nuclear clusters. These sources are separated by 1‧ (˜380 pc). The X-ray emission is extended and elongated in the eastern (E) nucleus, like the disk emission observed in millimeter radio images, suggesting a starburst dominance in this region. We estimate an Fe-K equivalent width of ≳ 1 {keV} for both sources and observe 2-10 keV luminosities of ˜ 2× {10}40 {{erg}} {{{s}}}-1 (western, W) and ˜ 3× {10}40 {{erg}} {{{s}}}-1 (E). In the 6-7 keV band the emission from these regions is dominated by the 6.7 keV Fe xxv line, suggesting a contribution from collisionally ionized gas. The thermal energy content of this gas is consistent with the kinetic energy injection in the interstellar medium by SNe II. However, nuclear winds from a hidden active galactic nucleus (AGN) (\\upsilon ˜ 2000 {{km}} {{{s}}}-1) cannot be excluded. The 3σ upper limits on the neutral Fe-Kα flux of the nuclear regions correspond to the intrinsic AGN 2-10 keV luminosities of < 1× {10}42 {{erg}} {{{s}}}-1 (W) and < 0.4× {10}42 {{erg}} {{{s}}}-1 (E). For typical AGN spectral energy distributions the bolometric luminosities are < 3× {10}43 {{erg}} {{{s}}}-1 (W) and < 8× {10}43 {{erg}} {{{s}}}-1 (E), and black hole masses of < 1× {10}5 {M}⊙ (W) and < 5× {10}5 {M}⊙ (E) are evaluated for Eddington limited AGNs with a standard 10% efficiency.

  8. Multidecadal global cooling and unprecedented ozone loss following a regional nuclear conflict

    Science.gov (United States)

    Mills, Michael J.; Toon, Owen B.; Lee-Taylor, Julia; Robock, Alan

    2014-04-01

    We present the first study of the global impacts of a regional nuclear war with an Earth system model including atmospheric chemistry, ocean dynamics, and interactive sea ice and land components. A limited, regional nuclear war between India and Pakistan in which each side detonates 50 15 kt weapons could produce about 5 Tg of black carbon (BC). This would self-loft to the stratosphere, where it would spread globally, producing a sudden drop in surface temperatures and intense heating of the stratosphere. Using the Community Earth System Model with the Whole Atmosphere Community Climate Model, we calculate an e-folding time of 8.7 years for stratospheric BC compared to 4-6.5 years for previous studies. Our calculations show that global ozone losses of 20%-50% over populated areas, levels unprecedented in human history, would accompany the coldest average surface temperatures in the last 1000 years. We calculate summer enhancements in UV indices of 30%-80% over midlatitudes, suggesting widespread damage to human health, agriculture, and terrestrial and aquatic ecosystems. Killing frosts would reduce growing seasons by 10-40 days per year for 5 years. Surface temperatures would be reduced for more than 25 years due to thermal inertia and albedo effects in the ocean and expanded sea ice. The combined cooling and enhanced UV would put significant pressures on global food supplies and could trigger a global nuclear famine. Knowledge of the impacts of 100 small nuclear weapons should motivate the elimination of more than 17,000 nuclear weapons that exist today.

  9. Dealing with the regional challenge of physical protection of nuclear materials

    International Nuclear Information System (INIS)

    Paschoa, A.S.

    2002-01-01

    ) methodologies, technologies and guides for detection of and response to illegal activities involving nuclear and other radioactive materials. In addition there were projects on provision of consolidated information an illicit trafficking, and an international cooperation on the security of nuclear and other radioactive materials. Voluntary contributions by member states were required to implement most of those activities. However, despite the generous contributions of some countries, the IAEA's International Physical Protection Advisory Service (IPPAS) has experienced serious limitation of funds to advise a number of countries. One possible avenue to be followed to make the IPPAS more effective is to take advantage of the expertise already developed by regional systems of accounting for and control of nuclear materials, for example, ABACC in the Latin American region. Of course, changes would have to be made in the ABACC's chart in order to expand its role, and face today's challenge concerning potential nuclear terrorism. (author)

  10. Report of the joint seminar on heavy-ion nuclear physics and nuclear chemistry in the energy region of tandem accelerators (II)

    International Nuclear Information System (INIS)

    1986-04-01

    A meeting of the second joint seminar on Heavy-Ion Nuclear Physics and Nuclear Chemistry in the Energy Region of Tandem Accelerators was held after an interval of two years at the Tokai Research Establishment of the JAERI, for three days from January 9 to 11, 1986. In the seminar, about 70 nuclear physicists and nuclear chemists of JAERI and other Institutes participated, and 38 papers were presented. These include general reviews and topical subjects which have been developed intensively in recent years, as well as the new results obtained by using the JAERI tandem accelerator. This report is a collection of the papers presented to the seminar. (author)

  11. Regional waste treatment facilities with underground monolith disposal for all low-heat-generating nuclear wastes

    International Nuclear Information System (INIS)

    Forsberg, C.W.

    1982-01-01

    An alternative system for treatment and disposal of all ''low-heat-generating'' nuclear wastes from all sources is proposed. The system, Regional Waste Treatment Facilities with Underground Monolith Disposal (RWTF/UMD), integrates waste treatment and disposal operations into single facilities at regional sites. Untreated and/or pretreated wastes are transported from generation sites such as reactors, hospitals, and industries to regional facilities in bulk containers. Liquid wastes are also transported in bulk after being gelled for transport. The untreated and pretreated wastes are processed by incineration, crushing, and other processes at the RWTF. The processed wastes are mixed with cement. The wet concrete mixture is poured into large low-cost, manmade caverns or deep trenches. Monolith dimensions are from 15 to 25 m wide, and 20 to 60 m high and as long as required. This alternative waste system may provide higher safety margins in waste disposal at lower costs

  12. Several issues related to regional environmental investigation to inland nuclear power plant

    International Nuclear Information System (INIS)

    Tian Xinshan; Zhang Xiaofeng

    2010-01-01

    Based on the goal of carrying out regional environmental investigation and review of recent environmental investigations toward inland nuclear power plant(NPP) site, and combined with the characteristics between inland and coastal sites, this paper is to make deeply analysis on population distribution, environmental characteristics, feasibility of performing emergency plan, characteristics of received water and external human-induced incident of NPP vicinity, then advance several significant issues related regional environmental investigation to inland sites, and make comparison with the investigation to coastal sites. Meantime, on guarantee of the integrity of collected materials during investigation, this paper also makes several proposals to provide reference for carrying out regional environmental investigation to inland NPP site. (authors)

  13. Distance effects on regional discriminants along a seismic profile in Northwest Nevada; NPE and nuclear results

    Energy Technology Data Exchange (ETDEWEB)

    McCormack, D.A. [AWE Blacknest, Berkshire (United Kingdom); Priestley, K.F. [Univ. of Cambridge (United Kingdom); Patton, H.J. [Lawrence Livermore National Lab., CA (United States)

    1994-12-31

    To address questions of discriminant transportability, it is important to understand how discriminants based on regional seismic phases are affected by regional variations in velocity structure. To examine this issue, we have recorded two explosions, the nuclear explosion Kinibito and the Non-Proliferation Experiment along a 300 km-long profile through western Nevada. We use these data to investigate the stability with distance of several proposed seismic discriminants. In this study we first estimate the apparent attenuation of the regional phases. We compare attenuation corrected amplitude ratios for P{sub n}/L{sub g} and P{sub g}/L{sub g}, and spectral ratios for P{sub n}, P{sub g}, and L{sub g}, as a function of distance along the profile. We make these comparisons for the vertical component and for the total vector resultant using all three components of motion.

  14. Selection and construction of nuclear and radiation emergency medical center in a region

    International Nuclear Information System (INIS)

    Wang Guojun; He Xu; Liao Li; Gao Dong

    2014-01-01

    Three level of first-class comprehensive hospital is an important force of nuclear and radiation accident rescue, has a very rich experience in response to nuclear and radiation accidents and deal with large quantities of the sick and wounded. With the foundation and the ability of the construction and operation of medical emergency rescue center. This paper according to the median model location theory of emergency center, combined with the specific situation of the nuclear and radiation accident in Hunan Province, reference location, rescue experience, emergency allocation of resources, teaching and research capacity, establish regional medical emergency center of nuclear and radiation accidents based on three level of first-class comprehensive hospital, break the traditional concept that the center must be provincial capital,form a multi-level, three-dimensional, network of emergency hospital rescue system. The main duties of the center are accident emergency response, on-site treatment and technical guidance of accident, psychological grooming. The author propose building measures according to the duties of the center: increase national and provincial financial investment, carry out training, drills and first aid knowledge missionaries regularly, innovative materials management, speed up the construction of information platform, establish and improve the hospital rescue system, improve organization institution and system of plans, reengineering rescue process. (authors)

  15. The planetary nebulae population in the nuclear regions of M31: the SAURON view

    Science.gov (United States)

    Pastorello, Nicola; Sarzi, Marc; Cappellari, Michele; Emsellem, Eric; Mamon, Gary A.; Bacon, Roland; Davies, Roger L.; de Zeeuw, P. Tim

    2013-04-01

    The study of extragalactic planetary nebulae (PNe) in the optical regions of galaxies, where the properties of their stellar population can be best characterized, is a promising ground to better understand the late evolution of stars across different galactic environments. Following a first study of the central regions of M32 that illustrated the power of integral field spectroscopy (IFS) in detecting and measuring the [O III] λ5007 emission of PNe against a strong stellar background, we turn to the very nuclear PN population of M31, within ˜80 pc of its centre. We show that PNe can also be found in the presence of emission from diffuse gas, as commonly observed in early-type galaxies and in the bulge of spirals, and further illustrate the excellent sensitivity of IFS in detecting extragalactic PNe through a comparison with narrow-band images obtained with the Hubble Space Telescope. Contrary to the case of the central regions of M32, the nuclear PNe population of M31 is only marginally consistent with the generally adopted form of the PNe luminosity function (PNLF). In particular, this is due to a lack of PNe with absolute magnitude M5007 brighter than -3, which would only result from a rather unfortunate draw from such a model PNLF. The nuclear stellar population of M31 is quite different from that of the central regions of M32, which is characterized in particular by a larger metallicity and a remarkable ultraviolet (UV) upturn. We suggest that the observed lack of bright PNe in the nuclear regions of M31 is due to a horizontal-branch population that is more tilted towards less massive and hotter He-burning stars, so that its progeny consists mostly of UV-bright stars that fail to climb back up the asymptotic giant branch (AGB) and only a few, if any, bright PNe powered by central post-AGB stars. These results are also consistent with recent reports on a dearth of bright post-AGB stars towards the nucleus of M31, and lend further support to the idea that the

  16. Alimentary tract absorption (f1 values) for radionuclides in local and regional fallout from nuclear tests.

    Science.gov (United States)

    Ibrahim, Shawki A; Simon, Steven L; Bouville, André; Melo, Dunstana; Beck, Harold L

    2010-08-01

    This paper presents gastrointestinal absorption fractions (f1 values) for estimating internal doses from local and regional fallout radionuclides due to nuclear tests. The choice of f1 values are based on specific circumstances of weapons test conditions and a review of reported f1 values for elements in different physical and chemical states. Special attention is given to fallout from nuclear tests conducted at the Marshall Islands. We make a distinction between the f1 values for intakes of radioactive materials immediately after deposition (acute intakes) and intakes that occur in the course of months and years after deposition, following incorporation into terrestrial and aquatic foodstuffs (chronic intakes). Multiple f1 values for different circumstances where persons are exposed to radioactive fallout (e.g., local vs. regional fallout and coral vs. continental tests) are presented when supportive information is available. In some cases, our selected f1 values are similar to those adopted by the International Commission on Radiological Protection (ICRP) (e.g., iodine and most actinides). However, f1 values for cesium and strontium derived from urine bioassay data of the Marshallese population are notably lower than the generic f1 values recommended by ICRP, particularly for acute intakes from local fallout (0.4 and 0.05 for Cs and Sr, respectively). The f1 values presented here form the first complete set of values relevant to realistic dose assessments for exposure to local or regional radioactive fallout.

  17. Tennessee Valley region study: potential year 2000 radiological dose to population resulting from nuclear facility operations

    International Nuclear Information System (INIS)

    1978-06-01

    A companion report, DOE/ET-0064/1, presents a geographic, cultural, and demographic profile of the Tennessee Valley Region study area. This report describes the calculations of radionuclide release and transport and of the resultant dose to the regional population, assuming a projected installed capacity of 220,000 MW in the year 2000, of which 144,000 MW would be nuclear. All elements of the fuel cycle were assumed to be in operation. The radiological dose was calculated as a one-year dose based on ingestion of 35 different food types as well as for nine non-food pathways, and was reported as dose to the total body and for six specific organs for each of four age groups (infant, child, teen, and adult). Results indicate that the average individual would receive an incremental dose of 7 x 10 -4 millirems in the year 2000 from the operation of nuclear facilities within and adjacent to the region, five orders of magnitude smaller than the dose from naturally occurring radiation in the area. The major contributor to dose was found to be tritium, and the most significant pathways were immersion in air, inhalation of air, transpiration of tritium (absorption through the skin), and exposure radionuclide-containing soil. 60 references

  18. Flow of ideal fluid through a central region of a nuclear reactor wire-spaced fuel subassembly

    International Nuclear Information System (INIS)

    Schmid, J.

    1991-04-01

    The results are given of calculations of the flow of an ideal fluid through the central region of a nuclear reactor wire-spaced fuel subassembly. The computer code used is briefly described. (author). 10 figs., 4 refs

  19. RAF 7015: Strengthening Regional Capacities for Marine Risk Assessment Using Nuclear and Related Techniques

    International Nuclear Information System (INIS)

    Okuku, E.; Mwangi, S.

    2017-01-01

    To develop and implement harmonized and integrated regional sea food safety monitoring in the MS through the application of nuclear techniques for enhanced sustainability of marine resource. Rapid urbanization and industrialization are causing alterations of the characteristics of marine environment thus threatening the ecosystem health and sustainability of marine environment and Affects public health, recreational water quality and economic viability.Threats to marine ecosystem include Over-exploitation, habitat destruction, Global warming- rise in SST, HABs and invasive species, Ocean acidification and Marine pollution

  20. Valuation procedure for supra-regional siting of nuclear power plants

    International Nuclear Information System (INIS)

    Volwahsen, A.

    1977-01-01

    The entwinement of area planning and power policies is explained and conceivable effects of the selection of site for nuclear power stations on the regional economic and social structure as well as the housing development are discussed. A research project and its purposes are presented here, the project having been initiated in order to examine the siting concepts emerging from the discussion of deverging interests, and in order to elaborate a variety of concrete requirements to be made with regard to site examination and site selection. Large-scole valuation indicators and procedures are expected to lead to solutions acceptable for all parties concerned. (HP) 891 HP [de

  1. Input-output model of regional environmental and economic impacts of nuclear power plants

    International Nuclear Information System (INIS)

    Johnson, M.H.; Bennett, J.T.

    1979-01-01

    The costs of delayed licensing of nuclear power plants calls for a more-comprehensive method of quantifying the economic and environmental impacts on a region. A traditional input-output (I-O) analysis approach is extended to assess the effects of changes in output, income, employment, pollution, water consumption, and the costs and revenues of local government disaggregated among 23 industry sectors during the construction and operating phases. Unlike earlier studies, this model uses nonlinear environmental interactions and specifies environmental feedbacks to the economic sector. 20 references

  2. Proceedings of the 3. Regional Meeting on Radiological and Nuclear Safety, Regional Meeting on International Radiation Protection Association (IRPA)and 3. Peruvian Meeting on Radiological Protection

    International Nuclear Information System (INIS)

    1995-10-01

    There we show works of the Third Regional Meeting on Radiological and Nuclear Safety held on 23-27 October, 1995 in Cusco-Peru. Latin americans specialists talk about nuclear safety and radiological protection, radiation natural exposure, biological effect of radiation, radiotherapy and medical radiological safety, radiological safety in industry and research. Also we deal with subjects related to radiological safety of nuclear and radioactive facilities, radioactive waste management, radioactive material transport, environmental radiological monitoring program, radiological emergency and accidents, instruments and dosimetry, basic safety standards of protection against radiation. More than 225 works were presented on the meeting

  3. Economic efficiency of Nuclear Cell Mars with reference to different regions with the account cogenerating production

    International Nuclear Information System (INIS)

    Alekseev, P. N.; Kucharkin, N. E.; Udjanskiy, Y. N.; Schepetina, T. D.; Subbotin, S. A.

    2004-01-01

    The popular belief in a low economic efficiency NPP with nuclear reactors of small capacity (SNPP) is stipulated by the stereotyped approach to their role as a power source (PS) and absence of a system approach to an estimation of their role and place in economy of regions. Actually, the specific expenses of installed capacity for SNPP can be some times higher than those for ones with high-power reactors. As a rule, pay back of the SNPP projects is justified proceeding from only the income of sale produced electric power and heat. Poor economic efficiency of such variant of use forces the developers to consider variants cogeneration of useful production, for example, power-desalination complexes. But thus it is not taken into account, that only nuclear power source (NPS), due to quality of long-term autonomy can ensure in hard-to-reach regions ecologically safe, practically unbounded on time, reliable energy provision of unique production manufacture, which can be yielded only in a sectional place and due to presence of reliable and ecologically acceptable power supply. Examples of such exclusive symbiosis of technologies can be enough, especially taking into account the factor of an ecological acceptability, which acquires the increasing weight at definition of competitiveness of the projects. The factor of uniqueness at technologies combination in a sectional context does not contradict the strategy of seriality small capacity NPS application, as they are irreplaceable for long-time and reliable power supply of the independent removed or hard-to-reach consumers. In this their special applicability and their specific energy niche, which not busy while by any another PS. On land their role is similar nuclear submarines, which thanking NPS have got completely other quality of autonomy in the discharge of underwater kettles.The territory of Russia on the area both variety of resources and manufactures allows to implement different variants and combinations of

  4. Environment monitoring and residents health condition monitoring of nuclear power plant Bohunice region

    International Nuclear Information System (INIS)

    Letkovicova, M.; Rehak, R.; Stehlikova, B.; Celko, M.; Hraska, S.; Klocok, L.; Kostial, J.; Prikazsky, V.; Vidovic, J.; Zirko, M.; Beno, T.; Mitosinka, J.

    1998-01-01

    The report contents final environment evaluation and selected characteristic of residents health physics of nuclear power plant Bohunice region. Evaluated data were elaborated during analytical period 1993-1997.Task solving which results are documented in this final report was going on between 1996- 1998. The report deals in individual stages with the following: Information obtaining and completing which characterize demographic situation of the area for the 1993-1997 period; Datum obtaining and completing which contain selected health physics characteristics of the area residents; Database structures for individual data archiving from monitoring and collection; Brief description of geographic information system for graphic presentation of evaluation results based on topographic base; Digital mapping structure description; Results and evaluation of radionuclide monitoring in environment performed by Environmental radiation measurements laboratory by the nuclear power plant Bohunice for the 1993-1997 period. Demographic situation evaluation and selected health physics characteristics of the area of nuclear power plant residents for the 1993-1997 period are summarized in the final part of the document. Monitoring results and their evaluation is processed in graph, table, text description and map output forms. Map outputs are processed in the geographic information system Arc View GIS 3.0a environment

  5. Nuclear-waste isolation in the unsaturated zone of arid regions

    International Nuclear Information System (INIS)

    Wollenberg, H.A.; Wang, J.S.Y.; Korbin, G.

    1982-05-01

    The vadose zone in arid regions is considered as a possible environment for geologic isolation of nuclear waste. There are several topographic and lithologic combinations in the vadose zone of arid regions that may lend themselves to waste isolation considerations. In some cases, topographic highs such as mesas and interbasin ranges - comprised of several rock types, may contain essentially dry or partially saturated conditions favorable for isolation. The adjacent basins, especially in the far western and southwestern US, may have no surface or subsurface hydrologic connections with systems ultimately leading to the ocean. Some rock types may have the favorable characteristics of very low permeability and contain appropriate minerals for the strong chemical retardation of radionuclides. Environments exhibiting these hydrologic and geochemical attributes are the areas underlain by tuffaceous rocks, relatively common in the Basin and Range geomorphic province. Adjacent valley areas, where tuffaceous debris makes up a significant component of valley fill alluvium, may also contain thick zones of unsaturated material, and as such also lend themselves to strong consideration as respository environments. This paper summarizes the aspects of nuclear waste isolation in unsaturated regimes in alluvial-filled valleys and tuffaceous rocks of the Basin and Range province

  6. New aspects in distribution of population dose loads in Semipalatinsk Nuclear Test Site region

    International Nuclear Information System (INIS)

    Hill, P.; Pivovarov, S.; Rukhin, A.; Seredavina, T.; Sushkova, N.

    2008-01-01

    Full text: The question on dose loads of Semipalatinsk Nuclear Test Site (SNTS) region population is not fully solved till now. There is rather different estimations of doses, received by people of nearest to SNTS settlements. It may be explain by absence of individual dosimeters during and after nuclear weapon tests and also many various ways of radiation exposure receiving. During last some years we have done a people dose loads estimations by Electron Paramagnetic Resonance (EPR) tooth enamel dosimetry method - one of the best and reliable for retrospective dosimetry. It was studied tooth enamel people from settlements Dolon, Bodene, Cheremushki, Mostik, which was irradiated mainly by the first atomic explosion 1949, settlement Sarjal, irradiated by the first thermonuclear explosion in 1953, and control settlement Maysk, which is sited close to SNTS, but there was no any radioactive traces due to east wind. The results display a not expected rather surprising picture: in all settlements, including control one Maysk, the dose loads distribution was rather similar, it has ex fast bimodal form with rather high doses in the second one. The possible reasons of such situation is discussed. The results obtained is compared with last estimations of Semipalatinsk region dose loads of population, which were specially attentively discussed at International Symposiums in Hiroshima (Japan, 2005) and Bethesda (MD, USA, 2006). (author)

  7. JAEA's efforts for regional transparency in the area of nuclear nonproliferation

    International Nuclear Information System (INIS)

    Hoffheins, Barbara; Kawakubo, Yoko; Inoue, Naoko

    2014-03-01

    The Japan Atomic Energy Agency (JAEA) has undertaken a joint R and D project with the US Department of Energy's National Nuclear Security Administration (DOE/NNSA) for the purposes of developing an Information Sharing Framework (ISF) for regional nonproliferation cooperation since July 2011. This project builds on nearly twenty years of technical cooperation between JAEA, its predecessor organizations and the DOE including the activities to define, develop and test transparency technologies and other multilateral efforts. The objective of current project is to design a viable information sharing process to support the goals of building confidence in the peaceful nature of regional nuclear programs. At the end of a two-year-effort, project partners, JAEA and Sandia National Laboratories (SNL), have defined the comprehensive requirements for an ISF that will ensure nonproliferation transparency success and sustainability. In October 2011, a parallel project with the similar title and objective was launched under the arrangement between the US DOE/NNSA and the Republic of Korea Ministry of Education, Science and Technology (MEST). Since then, JAEA, SNL, the Korea Institute for Nuclear Nonproliferation and Control (KINAC) and Korea Atomic Energy Institute (KAERI) have jointly carried out the project in a form of informal, multilateral cooperation. The project partners have identified needs and audience for ISF, and initiated the discussion to develop requirements for ISF through workshops, meetings, regular telephone conferences, etc. The activities include conducting a survey to identify stakeholders' needs and requirements for an ISF, launching a website to practice information sharing concepts, and presenting papers. This paper provides the historical context of the current project to establish ISF, and reports the progress to date and speculates on future directions. (author)

  8. Climate effects of a hypothetical regional nuclear war: Sensitivity to emission duration and particle composition

    Science.gov (United States)

    Pausata, Francesco S. R.; Lindvall, Jenny; Ekman, Annica M. L.; Svensson, Gunilla

    2016-11-01

    Here, we use a coupled atmospheric-ocean-aerosol model to investigate the plume development and climate effects of the smoke generated by fires following a regional nuclear war between emerging third-world nuclear powers. We simulate a standard scenario where 5 Tg of black carbon (BC) is emitted over 1 day in the upper troposphere-lower stratosphere. However, it is likely that the emissions from the fires ignited by bomb detonations include a substantial amount of particulate organic matter (POM) and that they last more than 1 day. We therefore test the sensitivity of the aerosol plume and climate system to the BC/POM ratio (1:3, 1:9) and to the emission length (1 day, 1 week, 1 month). We find that in general, an emission length of 1 month substantially reduces the cooling compared to the 1-day case, whereas taking into account POM emissions notably increases the cooling and the reduction of precipitation associated with the nuclear war during the first year following the detonation. Accounting for POM emissions increases the particle size in the short-emission-length scenarios (1 day/1 week), reducing the residence time of the injected particle. While the initial cooling is more intense when including POM emission, the long-lasting effects, while still large, may be less extreme compared to the BC-only case. Our study highlights that the emission altitude reached by the plume is sensitive to both the particle type emitted by the fires and the emission duration. Consequently, the climate effects of a nuclear war are strongly dependent on these parameters.

  9. Reactor units for power supply to the Russian Arctic regions: Priority assessment of nuclear energy sources

    Directory of Open Access Journals (Sweden)

    Mel'nikov N. N.

    2017-03-01

    Full Text Available Under conditions of competitiveness of small nuclear power plants (SNPP and feasibility of their use to supply power to remote and inaccessible regions the competition occurs between nuclear energy sources, which is caused by a wide range of proposals for solving the problem of power supply to different consumers in the decentralized area of the Russian Arctic power complex. The paper suggests a methodological approach for expert assessment of the priority of small power reactor units based on the application of the point system. The priority types of the reactor units have been determined based on evaluation of the unit's conformity to the following criteria: the level of referentiality and readiness degree of reactor units to implementation; duration of the fuel cycle, which largely determines an autonomy level of the nuclear energy source; the possibility of creating a modular block structure of SNPP; the maximum weight of a transported single equipment for the reactor unit; service life of the main equipment. Within the proposed methodological approach the authors have performed a preliminary ranking of the reactor units according to various criteria, which allows quantitatively determining relative difference and priority of the small nuclear power plants projects aimed at energy supply to the Russian Arctic. To assess the sensitivity of the ranking results to the parameters of the point system the authors have observed the five-point and ten-point scales under variations of importance (weights of different criteria. The paper presents the results of preliminary ranking, which have allowed distinguishing the following types of the reactor units in order of their priority: ABV-6E (ABV-6M, "Uniterm" and SVBR-10 in the energy range up to 20 MW; RITM-200 (RITM-200M, KLT-40S and SVBR-100 in the energy range above 20 MW.

  10. High resolution radio observations of nuclear and circumnuclear regions of luminous infrared galaxies (LIRGs)

    Energy Technology Data Exchange (ETDEWEB)

    Alberdi, A; Perez-Torres, M A [Instituto de Astrofisica de Andalucia (IAA, CSIC), PO Box 3004, 18080-Granada (Spain); Colina, L [Instituto de Estructura de la Materia - IEM, CSIC, C, Serrano 115, 28005 Madrid (Spain); Torrelles, J M [Instituto de Ciencias del Espacio (ICE, CSIC) and IEEC, Gran Capita 2-4, 08034 Barcelona (Spain)], E-mail: antxon@iaa.es, E-mail: torres@iaa.es, E-mail: colina@damir.iem.csic.es, E-mail: torrelle@ieec.fcr.es

    2008-10-15

    High-resolution radio observations of the nuclear region of Luminous and Ultraluminous Infrared Galaxies (ULIRGs) have shown that its radio structure consists of a compact high surface-brightness central radio source immersed in a diffuse low brightness circumnuclear halo. While the central component could be associated with an AGN or compact star-forming regions where radio supernovae are exploding, it is well known that the circumnuclear regions host bursts of star-formation. The studies of radio supernovae can provide essential information about stellar evolution and CSM/ISM properties in regions hidden by dust at optical and IR wavelengths. In this contribution, we show results from radio interferometric observations from NGC 7469, IRAS 18293-3413 and IRAS 17138-1017 where three extremely bright radio supernovae have been found. High-resolution radio observations of these and other LIRGs would allow us to determine the core-collapse supernova rate in them as well as their star-formation rate.

  11. Assessment of nuclear energy embodied in international trade following a world multi-regional input–output approach

    International Nuclear Information System (INIS)

    Cortés-Borda, D.; Guillén-Gosálbez, G.; Jiménez, L.

    2015-01-01

    Nuclear power can contribute to cover the increasing demand of energy while keeping the carbon emissions within the desired limits. Many countries are reluctant to implement nuclear technologies in their territories, but might still use them through imports of products that embody nuclear energy in their life cycle. This work quantifies the difference between the production-based (territorial) and consumption-based (global) nuclear energy use in the main 40 economies of the world (85% of the world's GDP) through the application of a multi-regional environmentally extended input–output model. The mismatch between the direct (territorial) and total (global) use of nuclear energy varies from −237% to 44% in the top economies. From a consumption-based viewpoint, 10 out of the 40 countries reduced the per-capita use of nuclear energy in the period 1995–2009, and 7 when following a production-based approach. The per-capita nuclear energy use could differ in up to 26.2 GJ/inhabitant·year, depending on whether the assessment is consumption or production based. It was also found that around 3.5% of the world's nuclear energy production is trade-embodied and that this amount is growing along with the global production of nuclear energy. Our findings might help to develop more effective environmental regulations worldwide. - Highlights: • Global and territorial nuclear energy could differ up to 237% in the main economies. • Trade-embodied nuclear energy has increased from 1.4% to 2.5% in 15 years. • Nuclear energy production has rised in tandem with trade-embodied nuclear energy. • Nuclear production decrease in 7 countries does not counteract the increase in others.

  12. Nuclear installations in the baltic sea region and the stake holders cooperation: a crucial step towards energy security, environmental sustainability and political stability in the region

    Energy Technology Data Exchange (ETDEWEB)

    Zakaria, M.; Mandere, N.; Olsson, L. [Lund Univ., Centre for Sustainability Studies (LUCSUS) (Sweden)

    2006-07-01

    Radiation hazards are trans-boundary. The prevention of accidents must be managed locally. But the awareness, preparedness, and the responsibilities in the case of emergencies must be managed at the local and regional level, and must rely on close interaction between the local and regional levels. The Baltic Sea Region contains over 40 nuclear reactors contributing to energy security, but also posing a potential threat to human, environmental, and political security. The aim of this paper is to integrate the four fields of security: health, environment, energy, and political by analysing awareness, preparedness responsibility and decision making related to nuclear installations. With increasing political, economical, cultural and physical (in term of energy infrastructure) integration, the region needs to take a comprehensive approach to create adequate structure for managing risks and thereby promote security. (authors)

  13. Nuclear installations in the baltic sea region and the stake holders cooperation: a crucial step towards energy security, environmental sustainability and political stability in the region

    International Nuclear Information System (INIS)

    Zakaria, M.; Mandere, N.; Olsson, L.

    2006-01-01

    Radiation hazards are trans-boundary. The prevention of accidents must be managed locally. But the awareness, preparedness, and the responsibilities in the case of emergencies must be managed at the local and regional level, and must rely on close interaction between the local and regional levels. The Baltic Sea Region contains over 40 nuclear reactors contributing to energy security, but also posing a potential threat to human, environmental, and political security. The aim of this paper is to integrate the four fields of security: health, environment, energy, and political by analysing awareness, preparedness responsibility and decision making related to nuclear installations. With increasing political, economical, cultural and physical (in term of energy infrastructure) integration, the region needs to take a comprehensive approach to create adequate structure for managing risks and thereby promote security. (authors)

  14. THE OFF-CENTERED SEYFERT-LIKE COMPACT EMISSION IN THE NUCLEAR REGION OF NGC 3621

    Energy Technology Data Exchange (ETDEWEB)

    Menezes, R. B.; Steiner, J. E.; Silva, Patricia da, E-mail: robertobm@astro.iag.usp.br [Instituto de Astronomia Geofísica e Ciências Atmosféricas, Universidade de São Paulo, Rua do Matão 1226, Cidade Universitária, São Paulo, SP CEP 05508-090 (Brazil)

    2016-02-01

    We analyze an optical data cube of the nuclear region of NGC 3621, taken with the integral field unit of the Gemini Multi-object Spectrograph. We found that the previously detected central line emission in this galaxy actually comes from a blob, located at a projected distance of 2.″14 ± 0.″08 (70.1 ± 2.6 pc) from the stellar nucleus. Only diffuse emission was detected in the rest of the field of view, with a deficit of emission at the position of the stellar nucleus. Diagnostic diagram analysis reveals that the off-centered emitting blob has a Seyfert 2 spectrum. We propose that the line-emitting blob may be a “fossil” emission-line region or a light “echo” from an active galactic nucleus (AGN), which was significantly brighter in the past. Our estimates indicate that the bolometric luminosity of the AGN must have decreased by a factor of ∼13–500 during the past ∼230 yr. A second scenario to explain the morphology of the line-emitting areas in the nuclear region of NGC 3621 involves no decrease of the AGN bolometric luminosity and establishes that the AGN is highly obscured toward the observer but not toward the line-emitting blob. The third scenario proposed here assumes that the off-centered line-emitting blob is a recoiling supermassive black hole, after the coalescence of two black holes. Finally, an additional hypothesis is that the central X-ray source is not an AGN, but an X-ray binary. This idea is consistent with all the scenarios we proposed.

  15. Climate Impact of a Regional Nuclear Weapons Exchange: An Improved Assessment Based On Detailed Source Calculations

    Science.gov (United States)

    Reisner, Jon; D'Angelo, Gennaro; Koo, Eunmo; Even, Wesley; Hecht, Matthew; Hunke, Elizabeth; Comeau, Darin; Bos, Randall; Cooley, James

    2018-03-01

    We present a multiscale study examining the impact of a regional exchange of nuclear weapons on global climate. Our models investigate multiple phases of the effects of nuclear weapons usage, including growth and rise of the nuclear fireball, ignition and spread of the induced firestorm, and comprehensive Earth system modeling of the oceans, land, ice, and atmosphere. This study follows from the scenario originally envisioned by Robock, Oman, Stenchikov, et al. (2007, https://doi.org/10.5194/acp-7-2003-2007), based on the analysis of Toon et al. (2007, https://doi.org/10.5194/acp-7-1973-2007), which assumes a regional exchange between India and Pakistan of fifty 15 kt weapons detonated by each side. We expand this scenario by modeling the processes that lead to production of black carbon, in order to refine the black carbon forcing estimates of these previous studies. When the Earth system model is initiated with 5 × 109 kg of black carbon in the upper troposphere (approximately from 9 to 13 km), the impact on climate variables such as global temperature and precipitation in our simulations is similar to that predicted by previously published work. However, while our thorough simulations of the firestorm produce about 3.7 × 109 kg of black carbon, we find that the vast majority of the black carbon never reaches an altitude above weather systems (approximately 12 km). Therefore, our Earth system model simulations conducted with model-informed atmospheric distributions of black carbon produce significantly lower global climatic impacts than assessed in prior studies, as the carbon at lower altitudes is more quickly removed from the atmosphere. In addition, our model ensembles indicate that statistically significant effects on global surface temperatures are limited to the first 5 years and are much smaller in magnitude than those shown in earlier works. None of the simulations produced a nuclear winter effect. We find that the effects on global surface temperatures

  16. Public Participation and Regional Development at a Nuclear Waste Disposal Site

    International Nuclear Information System (INIS)

    Ipsen, Detlev

    2003-01-01

    One of the conditions for citizens to actively participate in the search for a final repository for radioactive waste is public involvement and the preparation of perspectives for a long-term development of those regions which are geologically eligible for a nuclear waste disposal site. Regional development is an integral part of public participation and ranking second, after safety factors, as the essential field of interest for the local residents of a region chosen for a potential disposal site. Therefore, this presentation will start with the discussion of those considerations referring to theoretical and empirical principles of public participation in long-long-term and high-risk projects. In a second step, the principles of public participation will be outlined. Afterwards, I will focus on the significance of the region as living space for people before I put up for discussion a few thoughts on regional development. The question why the public should be involved actively and intensively in the search for a permanent disposal site, can be answered easily. So far all attempts, not only in Germany, but in most countries where the search for a disposal site is on, have failed due to resistance by the civilian population. Behind this pragmatic reasoning, however, there is a complex societal process which should be understood in order to be able to classify the individual elements of 'active and intensive participation'. In the last decades, a rather informal and situational form of democratic decision making and realization of interests has evolved alongside of the representative and formalized democracy. On one side, the institutionalized and formalized democratic structure is at work: the system of parliaments and government, of independent jurisdiction and mediatory organizations such as trade unions, associations and lobbyists who communicate their specific interests to the decision-making process

  17. Characterization of crystalline rocks in the Lake Superior region, USA: implications for nuclear waste isolation

    International Nuclear Information System (INIS)

    Sood, M.K.; Flower, M.F.J.; Edgar, D.E.

    1984-01-01

    The Lake Superior region (Wisconsin, the Upper Peninsula of Michigan, and Minnesota) contains 41 Precambrian crystalline rock complexes comprising 64 individual but related rock bodies with known surface exposures. Each complex has a map area greater than 78 km 2 . About 54% of the rock complexes have areas of up to 500 km 2 , 15% fall between 500 km 2 and 1000 km 2 , 19% lie between 1000 km 2 and 2500 km 2 , and 12% are over 2500 km 2 . Crystalline rocks of the region vary widely in composition, but they are predominantly granitic. Repeated thermo-tectonic events have produced early Archean gneisses, migmatites, and amphibolites with highly tectonized fabrics that impart a heterogeneous and anisotropic character to the rocks. Late Archean rocks are usually but not invariably gneissose and migmatitic. Proterozoic rocks of the region include synorogenic (foliated) granitic rocks, anorogenic (non-foliated) granites, and the layered gabbro-anorthosite-troctolite intrusives of the rift-related Keweenawan igneous activity. Compared with the Archean rocks of the region, the Proterozoic bodies generally lack highly tectonized fabrics and have more definable contacts where visible. Anorogenic intrusions are relatively homogeneous and isotropic. On the basis of observed geologic characteristics, postorogenic and anorogenic crystalline rock bodies located away from recognized tectonic systems have attributes that make them relatively more desirable as a possible site for a nuclear waste repository in the region. This study was conducted at Argonne National Laboratory under the sponsorship of the US Department of Energy through the Office of Crystalline Repository Development at Battelle Memorial Institute, Columbus, Ohio. 84 references, 4 figures, 3 tables

  18. Characterization of crystalline rocks in the Lake Superior region, USA: implications for nuclear waste isolation

    International Nuclear Information System (INIS)

    Sood, M.K.; Edgar, D.E.; Flower, M.F.J.

    1984-01-01

    The Lake Superior region (Wisconsin, the Upper Peninsula of Michigan, and Minnesota) contains 41 Precambrian crystalline (medium- to coarse-grained igneous and high-grade metamorphic) rock complexes comprising 64 individual but related rock bodies with known surface exposures. Each complex has a map area greater than 78 km 2 . About 54% of the rock complexes have areas of up to 500 km 2 , 15% fall between 500 km 2 and 1000 km 2 , 19% lie between 1000 km 2 and 2500 km 2 , and 12% are over 2500 km 2 . Crystalline rocks of the region vary widely in composition, but they are predominantly granitic. Repeated thermo-tectonic events have produced early Archean gneisses, migmatites, and amphibolites with highly tectonized fabrics that impart a heterogeneous and anisotropic character to the rocks. Late Archean rocks are usually but not invariably gneissose an migmatitic. Proterozoic rocks of the region include synorogenic (foliated) granitic rocks, anorogenic (nonfoliated) granites, and the layered gabbro-anorthosite-troctolite intrusives of the rift-related Keweenawan igneous activity. Compared with the Archean rocks of the region, the Proterozoic bodies generally lack highly tectonized fabrics and have more definable contacts where visible. Anorogenic intrusions are relatively homogeneous and isotropic. On the basis of observed geologic characteristics, postorogenic and anorogenic crystalline rock bodies located away from recognized tectonic systems have attributes that make them relatively more desirable as a possible site for a nuclear waste repository in the region. This study was conducted at Argonne National Laboratory under the sponsorship of the US Department of Energy through the Office of Crystalline Repository Development at Battelle Memorial Institute, Columbus, Ohio

  19. The use of nuclear powered submarines for oceanographic research in ICE covered regions

    International Nuclear Information System (INIS)

    Sambrotto, Raymond; Chayes, Dale

    2000-01-01

    Nuclear powered submarines offer a variety of advantages as platforms for oceanographic research. Their speed and ability to remain submerged for extended periods greatly extends their spatial coverage and isolates them from surface ocean conditions as compared to conventional ships. These advantages are particularly obvious in ice covered oceans that remain among the least explored regions on the globe. Scientific research in these regions has been limited to selected seasons and places where ice conditions are favorable for available observational platforms. However, much broader scientific observations are needed to assess such impacts as pollutants and possible climate variations on polar regions. To overcome some of the observational limitations of surface ships in the Arctic, the U.S. Navy made available nuclear powered submarines for civilian oceanographic research during the Scientific Ice Expedition (Scicex) program from 1993 to 1999. Together, these cruises sampled along more than 85,000 km of track throughout the international waters of the Arctic Ocean during selected periods from March to October. This sampling forms the basis of the present analysis of the limitations and capabilities of nuclear submarines as observational platforms for scientific research. Scientific observations were made in four general disciplines: ocean physics; biology and chemistry; sea ice; and marine geology and geophysics. Sampling of ocean biology and chemistry was most constrained because the water samples typically required in such studies were limited to the operating depths of the submarine. However, the surface 250 m contains all of the biological production, as well as informative chemical tracers for the flow of Atlantic and Pacific water masses. Measurements of ocean physics were less constrained because in addition to the on-board measurements, expendable probes are available to sample water depths inaccessible to the submarine. The submarine proved to be an

  20. Japanese nuclear power cooperation enhancing nuclear safety culture for Asian regions, the former Soviet Union and other Eastern-Block Nations

    International Nuclear Information System (INIS)

    Yamazaki, Tadamasa; Abe, Hiroshi; Moriya, Fukashi

    1996-01-01

    Japanese electric power industry has versatile programs of international cooperation in the field of nuclear power generation. Japan Electric Power Information Center (JEPIC) has been playing an essential role in executing these programs. The core of such activities is the 'International Invitation Program for Safety Management at Nuclear Power Plant' (IPSNP). IPSNP is sponsored by Japanese Government and aims to enhance the nuclear safety culture for the Former Soviet Union and other Eastern-Block Nations, inclusive of China. The program is started since 1992, and every year we invite some 100 nuclear specialists, so as to let them familiarize with the Japanese nuclear safety management practice. We have already welcomed more than 360 nuclear specialists, and when this program lasts for 10 years, total number of participants will be reached to 1,000 in all. Another feature of our cooperative programs is the JICA's 'Training Course for Nuclear Power Generation.' Since 1985, we have already invited some 60 training participants from the regions in Asia and the Pacific rim. This course is to deliver lectures in English under a broader curriculum on the nuclear power production in general. Furthermore, we have been dispatching the experienced nuclear experts to the Asian nations, such as China, Indonesia, etc. since 1984. This is to expedite to propagate the importance of safety in developing the nuclear power generation. Some 190 experienced experts have already been dispatched and successfully have executed the lectures and seminars on: water chemistry, regular inspection scheduling, plant performance evaluation, preoperation during commissioning stage, etc... (author)

  1. An analysis of a regional nuclear safeguards organisation: the European Atomic Energy Community (EURATOM) and the development of nuclear safeguards in Western Europe

    International Nuclear Information System (INIS)

    Howlett, Darryl.

    1988-08-01

    This thesis argues that the nuclear safeguards system implemented by EURATOM in Western Europe has come to fruition as a result of a complex political process. This process has involved negotiations over the exact limits on safeguards interventions into the nuclear affairs of the European Community. There are two dimensions to these negotiations. On the one hand, they involve EURATOM and its member states over the necessary limits on safeguards intervention in member states' domestic nuclear affairs. On the other, there are negotiations between EURATOM and several actors outside the region, particularly the International Atomic Energy Agency. The thesis concludes by arguing that international safeguards organisations, of which EURATOM is a regional example, have made important contributions to arms control and international security. In the process, certain kinds of precedents and procedures which have potential for broader application have been established. (author)

  2. DISCOVERY OF TWO SUPERNOVAE IN THE NUCLEAR REGIONS OF THE LUMINOUS INFRARED GALAXY IC 883

    Energy Technology Data Exchange (ETDEWEB)

    Kankare, E.; Mattila, S.; Takalo, A. [Tuorla Observatory, Department of Physics and Astronomy, University of Turku, Vaeisaelaentie 20, FI-21500 Piikkioe (Finland); Ryder, S. [Australian Astronomical Observatory, P.O. Box 296, Epping, NSW 1710 (Australia); Vaeisaenen, P. [South African Astronomical Observatory, P.O. Box 9, Observatory 7935 (South Africa); Alberdi, A.; Perez-Torres, M.-A.; Romero-Canizales, C. [Instituto de Astrofsica de Andalucia, IAA-CSIC, Apartado 3004, 18080 Granada (Spain); Alonso-Herrero, A.; Colina, L. [Departamento de Astrofisica, Centro de Astrobiologia, CSIC/INTA, Carretera de Torrejon a Ajalvir, km 4, 28850, Torrejon de Ardoz, Madrid (Spain); Efstathiou, A. [School of Sciences, European University Cyprus, Diogenes Street, Engomi, 1516 Nicosia (Cyprus); Kotilainen, J. [Finnish Centre for Astronomy with ESO (FINCA), University of Turku, Vaeisaelaentie 20, FI-21500 Piikkioe (Finland); Melinder, J., E-mail: erkki.kankare@utu.fi [Department of Astronomy, Oskar Klein Centre, Stockholm University, AlbaNova University Centre, 106 91 Stockholm (Sweden)

    2012-01-10

    We report the discovery of two consecutive supernovae (SNe), 2010cu and 2011hi, located at 0.''37 (180 pc) and 0.''79 (380 pc) projected distance, respectively, from the center of the K-band nucleus of the luminous infrared galaxy (LIRG) IC 883. The SNe were discovered in an ongoing near-infrared K-band search for core-collapse SNe in such galaxies using the ALTAIR/NIRI adaptive optics system with laser guide star at the Gemini-North Telescope. These are thus the closest SNe yet discovered to an LIRG nucleus in optical or near-infrared wavelengths. The near-infrared light curves and colors of both SNe are consistent with core-collapse events. Both SNe seem to suffer from relatively low host galaxy extinction suggesting that regardless of their low projected galactocentric distances, they are not deeply buried in the nuclear regions of the host galaxy.

  3. Proton nuclear magnetic resonance imaging of regionally ischemic canine hearts: effects of paramagnetic proton signal enhancement

    International Nuclear Information System (INIS)

    Brady, T.J.; Goldman, M.R.; Pykett, I.L.; Buonanno, F.S.; Kistler, J.P.; Newhouse, J.H.; Burt, C.T.; Hinshaw, W.S.; Pohost, G.M.

    1982-01-01

    In a study to evaluate the potential of proton nuclear magnetic resonance (NMR) imaging with and without manganese contrast enhancement for detecting acute myocardial infarction, 12 dogs underwent 90-minute occlusion of the left circumflex coronary artery. Transverse-section NMR images of the excised, nonbeating heart were obtained at 1-cm intervals using the steady-state-free-precession (SSFP) technique. All NMR images revealed detailed structure of the heart. The three hearts without manganese showed no difference in intensity between the normal and the ischemic posterior regions, whereas those with manganese demonstrated a clearly demarcated zone of reduced signal intensity consistent with the ischemic zone. It is concluded that high-resolution tomograms of the excised canine myocardium can be obtained using proton NMR imaging. With the SSFP imaging technique, proton signal enhancement with manganese infusion is necessary to differentiate between ischemic and nonischemic myocardium after 90 minutes of coronary occlusion

  4. Regional probabilistic nuclear risk and vulnerability assessment by integration of mathematical modelling land GIS-analysis

    International Nuclear Information System (INIS)

    Rigina, O.; Baklanov, A.

    2002-01-01

    The Kola Peninsula, Russian Arctic exceeds all other regions in the world in the number of nuclear reactors. The study was aimed at estimating possible radiation risks to the population in the Nordic countries in case of a severe accident in the Kola Peninsula. A new approach based on probabilistic analysis of modelled possible pathways of radionuclide transport and precipitation was developed. For the general population, Finland is at most risk with respect to the Kola NPP, because of: high population density or proximity to the radiation-risk sites and relatively high probability of an airflow trajectory there, and precipitation. After considering the critical group, northern counties in Norway, Finland and Sweden appear to be most vulnerable. (au)

  5. RCA and its regional office for cooperative activities in the applications of nuclear techniques in Asia and the Pacific

    International Nuclear Information System (INIS)

    Lee, Jae-Sol

    2008-01-01

    The Regional Cooperative Agreement for Research, Development and Training Related to Nuclear Science and Technology (RCA) is an intergovernmental agreement among 17 Member States of the International Atomic Energy Agency (IAEA), in South Asia, South East Asia, Far East and the Pacific, established for promoting regional cooperation in the peaceful uses of nuclear science and technology. Established in 1972, the RCA is a unique development within the technical cooperation framework coordinated by IAEA is support of the regional cooperation in the applications of nuclear technology to the benefit of its Member States. It has a well established network of scientists trained in the use of nuclear technologies in the agricultural, medical, industrial, and environmental sectors, with a good potentiality to use its regional technical and scientific resources to contribute to the solution of some of the significant problems in the region. The achievements recorded in the several decades of RCA history cover a wide spectrum of areas and these achievements have been published a Success Stories. Having recognized a need to enhance ownership of the region, the RCA Member States had wished to establish its Regional Office (RCARO). The Regional Office which is hosted by the Government of Republic of Korea was established in 2002. Located in Daejeon, the RCARO has been active in its endeavors toward increasing visibility of the RCA and establishing cooperative partnership between RCA and other international organizations. The RCARO has also played a key role in successfully implementing an RCA Project on Post-Tsunami Environment Impact Assessment in partnership with UNDP (Republic of Korea) with the participation of 14 RCA Member States. A number of projects for capacity building in the region are also being implemented by RCARO, mostly by providing training opportunities for young professionals in the region. The RCA community welcomes any contacts from potential end-users or

  6. Emergency control center of the nuclear Regulatory Authority: a national, regional and international tool to coordinate the response to radiological and nuclear emergencies

    International Nuclear Information System (INIS)

    Jordan, Osvaldo; Hernandez, Daniel; Telleria, Diego; Bruno, Hector; Boutet, Luis; Kunst, Juan; Sadaniowski, Ivana; Rey, Hugo

    2008-01-01

    Full text: In the year 1998, with the regulation of the Nuclear Law, the Nuclear Regulatory Authority (ARN) is constituted as the national coordinator of the response in case of nuclear or radiological emergencies. The ARN builds his first operative center installed in his Head quarter in Buenos Aires. Likewise, from the obligations that come with the Convention of Early Notification of a Nuclear Accident and Convention on Assistance in the Case of a Nuclear Accident or Radiological Emergency, the ARN is the National Warning Point and the National Competent Authority. Therefore, the operative capacity of the center needs to be expanded to cover not only the national territory but also its link with the region and the IAEA, as an access point to the International community, as the conventions demand. For the purpose of giving ARN capacities which reflect the state of art at the international level on Nuclear Emergency Centers and warrant that its equipment and technology will be compatible with those abroad (mainly with IAEA), the ARN made an arrangements with Department of Energy of United States, in the framework of an existing bilateral Argentine Foreign Office/US Government agreement (Joint Standing Committee on Nuclear Cooperation). This agreement allows a deep experience exchange, high level specialists support and last generation equipment access. As a result, the center of ARN can be considerate as the most advanced civil nuclear emergency center in the region. This work describes the implementation process of the emergency center and the technical features, like the physical distribution, hardware and software resources, communication equipment, Geographic Information Systems, etc. (author)

  7. New public commons and network of nuclear site regions for the post-Fukushima accident re-vitalization

    International Nuclear Information System (INIS)

    Sawada, Tetsuo

    2011-01-01

    Due to the Fukushima Daiichi NPP accidents on March 11 2011, the landscape of the community of nuclear energy R and D and usage has been changing in various aspects here in Japan. With such recognition, the networking of nuclear site regions as well as consumer cities is proposed for obtaining novel-sense societal confidence, on the basis of on-going practice of atom-sports such as international MaxiMarathon and domestoic Tour de Atom. (author)

  8. Nuclear structure studies in A∼100 and A∼130 mass regions

    International Nuclear Information System (INIS)

    Sihotra, S.

    2012-01-01

    This paper reports the nuclear structure studies in the mass A∼ 100 and A∼130 regions. The investigations were performed in 98,99 Rh, 99 Pd, 96 Tc, 106,107 In, and 129,131 Cs nuclei near the proton (Z = 50) and neutron (N = 50, 64) shell closures with a view to understand the structural features that result from interplay between single particle and collective degrees of freedom. The nuclei in these regions are characterized by a small quadrupole deformation and soft to gamma deformation at low spins. In order to compare experimental results directly with the theoretical calculations, the experimental spins and level energies have been transformed into the rotating (intrinsic) frame of nucleus. The level schemes have been interpreted in the framework of theoretical model calculations. Configurations assigned to various bands are discussed in the framework of Principal/Tilted Axis Cranking (PAC/TAC) model and the deformed Hartree-Fock and angular momentum projection (PHF) calculations. Level energies and B(M1)/B(E2) ratios have, on the whole, been reproduced for the assigned configurations. Triaxial deformation in these mass regions has been inferred from the observed rotational-alignment frequencies, staggering behavior, M1 reduced transition probabilities and chiral-twin bands. Another important feature observed in these isotopes is the magnetic dipole bands generated through the shears mechanism. Observation of new E1 transitions linking the opposite-parity bands based on the proton/neutron h 11/2 and d 5/2 orbitals (Δl = 3, Δj = 1, Δπ = -1) in 131 Cs and 99 Pd provide fingerprints of possible octupole correlations in these mass-regions. (author)

  9. The contribution of the UNDP/RCA/IAEA programmes to the development of nuclear technology in the Asia Pacific Region

    International Nuclear Information System (INIS)

    Easey, J.F.

    1994-01-01

    The UNDP/RCA/IAEA Programmes are involving Member States in the Asia Pacific Region in projects to develop and increase the use of nuclear technologies. These efforts have already increased the level of awareness amongst the Region's scientists, engineers, technologists, and decision makers and has provided significant training to the scientists and engineers to enable them to play a role in technical back stopping at a national level. A new project has been started in 1993 and this will seek to expand the contribution of the nuclear technologies into further industrial and environmental fields. Much of the success of the programmes is credited to the high level of Regional Co-operative Agreement (RCA) for research, development and training related to nuclear science and technology in Asia and the Pacific

  10. Analysis of the Radio-Ecological State of Units and Installations Involved in Nuclear Submarine Decommissioning in the Northwest Region of Russia

    National Research Council Canada - National Science Library

    Sarkissov, A

    2003-01-01

    .... in the first section of the report, all nuclear-powered units and installations involved in the process of nuclear submarine utilization in the northwest region of Russia are listed and considered in detail...

  11. Nuclear analytical techniques applied to the large scale measurements of atmospheric aerosols in the amazon region

    International Nuclear Information System (INIS)

    Gerab, Fabio

    1996-03-01

    This work presents the characterization of the atmosphere aerosol collected in different places of the Amazon Basin. We studied both the biogenic emission from the forest and the particulate material which is emitted to the atmosphere due to the large scale man-made burning during the dry season. The samples were collected during a three year period at two different locations in the Amazon, namely the Alta Floresta (MT) and Serra do Navio (AP) regions, using stacked unit filters. These regions represent two different atmospheric compositions: the aerosol is dominated by the forest natural biogenic emission at Serra do Navio, while at Alta Floresta it presents an important contribution from the man-made burning during the dry season. At Alta Floresta we took samples in gold in order to characterize mercury emission to the atmosphere related to the gold prospection activity in Amazon. Airplanes were used for aerosol sampling during the 1992 and 1993 dry seasons to characterize the atmospheric aerosol contents from man-made burning in large Amazonian areas. The samples were analyzed using several nuclear analytic techniques: Particle Induced X-ray Emission for the quantitative analysis of trace elements with atomic number above 11; Particle Induced Gamma-ray Emission for the quantitative analysis of Na; and Proton Microprobe was used for the characterization of individual particles of the aerosol. Reflectancy technique was used in the black carbon quantification, gravimetric analysis to determine the total atmospheric aerosol concentration and Cold Vapor Atomic Absorption Spectroscopy for quantitative analysis of mercury in the particulate from the Alta Floresta gold shops. Ionic chromatography was used to quantify ionic contents of aerosols from the fine mode particulate samples from Serra do Navio. Multivariate statistical analysis was used in order to identify and characterize the sources of the atmospheric aerosol present in the sampled regions. (author)

  12. Contribution to the Proposal for the Formation of Regional Centres for Nuclear Physics in the Developing Countries

    Energy Technology Data Exchange (ETDEWEB)

    Alaga, G. [Institute ' ' Rudjer Bośković' ' , Zagreb, Yugoslavia (Croatia)

    1969-07-15

    The paper discusses the development of nuclear physics in developing countries, pointing out the difficulties of research in the future. A proposal for the formation of regional centres is put forward. Arguments justifying the formation of these regional centres are presented together with the suggestion that UNESCO and IAEA act as sponsors and financial supporters of the regional centres. The institutes in the developing countries could serve as a basis for such centres. Countries which are qualified and interested in having and using the facilities of the regional centres should also participate in the financing of them. (author)

  13. Assessing Detecting and Deterring the Threat of Maritime Nuclear and Radiological Smuggling in the Western Indian Ocean Region

    Energy Technology Data Exchange (ETDEWEB)

    Khan, M. Umer [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States). Cooperative Monitoring Center

    2017-03-01

    This paper proposes that current maritime smuggling routes in the western Indian Ocean region are similar to those in the past and that the motivations of terrorist groups and the presence of radioactive sources in the Indian Ocean littoral and other states present a significant security threat. The majority of regional terrorist groups have a hybrid structure, piggybacking on criminal activity to fund their terror activities. Additionally, states have used maritime routes in the Indian Ocean region to transport nuclear materials and missiles. Thus, the maritime dimension of such threats remains, and may be increasing. This paper focuses on issues, motivations, pathways, and methods to detect and interdict nuclear and radiological trafficking. It analyzes the potential use of maritime technology applications for radiation detection and presents recommendations for states and multinational nonproliferation advocacy organizations to address the threat in the Indian Ocean region.

  14. Radiological Protection in Nuclear Programmes in Latin America. Proceedings of a Regional Seminar

    International Nuclear Information System (INIS)

    1979-05-01

    The growth of nuclear power projected both in the industrial and developing Member States of the IAEA raises many problems which can be solved only by international collaboration. The present regional seminar was organized with the objective of bringing together radiological protection specialists from the Latin American countries to discuss recent advances in radiological protection of nuclear workers, the population and the environment around nuclear installations.The seminar was organized by the IAEA in collaboration with the Government of Venezuela and took place on 21-25 November 1977 in Caracas. The participants came from 10 countries and the United Nations Development Organisation (UNDP), the Pan-American Health Organization (PAHO) and the Organization of American States (OAS) were represented. One of the main tasks of the seminar was the identification of those local or regional problems which might be solved through international collaboration. Therefore, all of these notes and proposals were reflected and summarized in the chapter entitled ''Notes and Recommendations of the Participants''. It was also felt that the seminar had an educational, or training character, as many participants expressed the view that great differences exist in the organizational, instrumental and legislative levels of the radiation protection facilities provided, and thus the seminar provided an opportunity to exchange views, information and ideas on these subjects. As this seminar proved to be very useful and successful, special emphasis was put on the recommendation that similar meetings should be organized every two or three years. In this report the papers are reproduced as presented at the sessions. As the discussions following the papers contained only a few further clarifications on the data presented, no detailed list of questions and answers is included in this report. One of the main tasks of the seminar was the identification of those local or

  15. Role of youth of city Ozyorsk in creation of positive image of nuclear energy at the population of Chelyabinsk region

    International Nuclear Information System (INIS)

    Kostareva, T.; Teslov, A.

    2001-01-01

    At present Atomic Energy was confronted with the great problem of the negative attitude of population to its development. Consequently it is necessary to reorient public opinion in the side of the valid attitude to Atomic Energy as it is the basis of the further economic growth of the region. The young specialists of the modern factory of the Atomic Industry PA 'Mayak' should carry out the active work for creation positive image of Nuclear Energy in the Chelyabinsk region. (authors)

  16. Health of children living in Panfilov distract of Almaty region after Chernobyl accident and nuclear explosions at Lobnor test site

    International Nuclear Information System (INIS)

    Mit, A.A.; Chasnikov, I.Ya.; Chastnicova, S.S.; Mukhametzhanov, M.M.; Zhantagulova, T.K.

    1999-01-01

    It is known that Panfilov district of Almaty region was affected with radiation contamination during nuclear explosions at Lobnor test site and after Chernobyl accident, which impaired the health of its population [1]. In addition, the children's mortality rate was turned out to be the highest one among other districts of the region. This report presents some other information related to an increase of children's sickness rate in Panfilov district

  17. Proceedings of the 3. Regional Meeting on Radiological and Nuclear Safety, Regional Meeting on International Radiation Protection Association (IRPA)and 3. Peruvian Meeting on Radiological Protection; 3. Congreso Regional sobre Seguridad Radiologica y Nuclear, Congreso Regional IRPA y 3. Congreso Peruano de Proteccion Radiologica. Libro de Resumenes

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-10-01

    There we show works of the Third Regional Meeting on Radiological and Nuclear Safety held on 23-27 October, 1995 in Cusco-Peru. Latin americans specialists talk about nuclear safety and radiological protection, radiation natural exposure, biological effect of radiation, radiotherapy and medical radiological safety, radiological safety in industry and research. Also we deal with subjects related to radiological safety of nuclear and radioactive facilities, radioactive waste management, radioactive material transport, environmental radiological monitoring program, radiological emergency and accidents, instruments and dosimetry, basic safety standards of protection against radiation. More than 225 works were presented on the meeting.

  18. LLNL's Regional Model Calibration and Body-Wave Discrimination Research in the Former Soviet Union using Peaceful Nuclear Explosions (PNEs)

    International Nuclear Information System (INIS)

    Bhattacharyya, J.; Rodgers, A.; Swenson, J.; Schultz, C.; Walter, W.; Mooney, W.; Clitheroe, G.

    2000-01-01

    Long-range seismic profiles from Peaceful Nuclear Explosions (PNE) in the Former Soviet Union (FSU) provide a unique data set to investigate several important issues in regional Comprehensive Nuclear-Test-Ban Treaty (CTBT) monitoring. The recording station spacing (∼15 km) allows for extremely dense sampling of the propagation from the source to ∼ 3300 km. This allows us to analyze the waveforms at local, near- and far-regional and teleseismic distances. These data are used to: (1) study the evolution of regional phases and phase amplitude ratios along the profile; (2) infer one-dimensional velocity structure along the profile; and (3) evaluate the spatial correlation of regional and teleseismic travel times and regional phase amplitude ratios. We analyzed waveform data from four PNE's (m b = 5.1-5.6) recorded along profile KRATON, which is an east-west trending profile located in northern Sibertil. Short-period regional discriminants, such as P/S amplitude ratios, will be essential for seismic monitoring of the Comprehensive Nuclear-Test-Ban Treaty (CTBT) at small magnitudes (m b o and 10 o , respectively

  19. Estimation of the ripple effects on a regional community of the formation of the nuclear energy science complex in Gyeongju

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Byung-Sik [Dankook Univ., Chungnam (Korea, Republic of). Dept. of Nuclear Engineering; Moon, Joo Hyun [Dongguk Univ. Gyeongju, Gyeongbuk (Korea, Republic of). Dept. of Nuclear Energy Engineering

    2017-05-15

    Korea has developed advanced nuclear technologies, including those for future nuclear energy systems and the safe management of spent nuclear fuel, and is about to make a decision as to whether to make a massive investment in the development R and D for commercialization of them. There is no area large enough to accommodate all the development R and D-related facilities together at Korea Atomic Energy Research Institute (KAERI) to perform the development R and Ds. KAERI seeks solutions to the space problem, which includes the construction of a nuclear energy science complex (NESC). Gyeongju is one of the potential sites. This study estimated the ripple effects on the regional community if the NESC is to be formed in Gyeongju using inter-regional input-output analysis. The estimation shows that the ripple effects to the regional community of the formation of the NESC in Gyeongju would be 1,086,633 billion Korean Won (KRW) for regional production inducement, 455,299 billion KRW for value-added inducement, and 9,592 persons for employment inducement.

  20. Twenty Years of Regional Safeguards: the ABACC System and the Synergy with the National Nuclear Material Control Systems

    International Nuclear Information System (INIS)

    Dias, Fabio C.; Palhares, Lilia C.; De Mello, Luiz A.; Vicens, Hugo E.; Maceiras, Elena; Terigi, Gabriel

    2011-01-01

    As result of the nuclear integration between Brazil and Argentina, in July 1991 the Agreement for Peaceful Uses of the Nuclear Energy (Bilateral Agreement) was signed and the Brazilian Argentine Agency for Accountancy and Control of Nuclear Material (ABACC) was created [1]. The main role assigned to ABACC was the implementation and administration of the regional control system and the coordination with the International Atomic Energy Agency (IAEA) in order to apply safeguards to all nuclear material in all nuclear activities of Argentina and Brazil. In December 1991 the IAEA, ABACC, Argentina and Brazil signed the Quadripartite Agreement (INFCIRC/435) [2]. The agreement establishes obligations similar to those established by model INFCIRC/153 comprehensive agreements. The Bilateral Agreement establishes that the Parties should make available financial and technical capabilities to support ABACC activities. In order to accomplish this challenge, the National Systems had to improve their structure and capabilities. Through the close interaction with the IAEA and ABACC, the national systems have been enriched by adopting new methodologies, implementing innovative safeguards approaches and providing specialized training to the regional inspectors. All of this also resulted in relevant technical improvements to the regional system as a whole. The approach of both neighborhoods controlling each other increased the confidence between the partners and permitted a better knowledge of their potentialities. The recognized performance of the regional system in the implementation of innovative, efficient and credible safeguards measures increased the confidence of the international community on the implementation of nuclear safeguards in Argentina and Brazil. In this paper, after twenty years of the creation of the ABACC System, the view of the Brazilian and Argentine National Authorities is presented. (authors)

  1. Thermodynamic coupling of heat and matter flows in near-field regions of nuclear waste repositories

    International Nuclear Information System (INIS)

    Carnahan, C.L.

    1983-11-01

    In near-field regions of nuclear waste repositories, thermodynamically coupled flows of heat and matter can occur in addition to the independent flows in the presence of gradients of temperature, hydraulic potential, and composition. The following coupled effects can occur: thermal osmosis, thermal diffusion, chemical osmosis, thermal filtration, diffusion thermal effect, ultrafiltration, and coupled diffusion. Flows of heat and matter associated with these effects can modify the flows predictable from the direct effects, which are expressed by Fourier's law, Darcy's law, and Fick's law. The coupled effects can be treated quantitatively together with the direct effects by the methods of the thermodynamics of irreversible processes. The extent of departure of fully coupled flows from predictions based only on consideration of direct effects depends on the strengths of the gradients driving flows, and may be significant at early times in backfills and in near-field geologic environments of repositories. Approximate calculations using data from the literature and reasonable assumptions of repository conditions indicate that thermal-osmotic and chemical-osmotic flows of water in semipermeable backfills may exceed Darcian flows by two to three orders of magnitude, while flows of solutes may be reduced greatly by ultrafiltration and chemical osmosis, relative to the flows predicted by advection and diffusion alone. In permeable materials, thermal diffusion may contribute to solute flows to a smaller, but still significant, extent

  2. Application of nuclear technologies for growing of fruits which are of regional importance

    International Nuclear Information System (INIS)

    Sultanova, Z.K.; Kharlamova, N.A.; Aidarkhanova, G.S.; Kudabayev, A.B.; Andropenkov, S.A.; Maltseva, R.M.

    2002-01-01

    Application of recent achievements of nuclear techniques in different applied branches develops in such main directions as radiation-biological technologies under stimulation of plants, sterilization, increasing of storage terms, disinfestation of foodstuff, forage, raw material of animal and vegetable origin, dressing, instruments, which cannot be exposed to thermal and chemical processing. It is of practical interest the irradiation of fruits and berries cuttings, which are of regional importance and been growing in nurseries. This method is already widely introduced into practice as one of efficient methods. Aim of research was the optimal irradiation dose selection for stimulation of currant cuttings gemmas before bedding out. The sorts of black and goldish currants were used in the experiment. Irradiation was conducted in 60 Co gamma-ray source. As the study materials the black currant cuttings of the 'Katyusha' sort and goldish currants of the sort 'Uzbekistanskaya' were used. For each variant 20 cuttings were prepared.Cuttings were bedded out. Drop irrigation was employed. In the sequel agricultural monitoring was carried out. The results of rooting and development of irradiated samples will be presented in report

  3. Determining Bond Sodium Remaining in Plenum Region of Spent Nuclear Driver Fuel

    International Nuclear Information System (INIS)

    Vaden, D.; Li, S.X.

    2008-01-01

    The Fuel Conditioning Facility (FCF) at the Idaho National Laboratory (INL) treats spent nuclear fuel using an electro-chemical process that separates the uranium from the fission products, sodium thermal bond, and cladding materials (REF 1). Upon immersion into the ER electrolyte, the sodium used to thermally bond the fuel to the clad jacket chemically reacts with the UCl3 in the electrolyte producing NaCl and uranium metal. The uranium in the spent fuel is separated from the cladding and fission products by taking advantage of the electro-chemical potential differences between uranium and the other fuel components. Assuming all the sodium in the thermal bond is converted to NaCl in the ER, the difference between the cumulative bond sodium mass in the fuel elements and the cumulative sodium mass found in the driver ER electrolyte inventory provides an upper mass limit for the sodium that migrated to the upper gas region, or plenum section, of the fuel element during irradiation in the reactor. The plenums are to be processed as metal waste via melting and metal consolidation operations. However, depending on the amount of sodium in the plenums, additional processing may be required to remove the sodium before metal waste processing

  4. Nuclear Charge Radii in the Region of Shape Isomerism at Z $\\leq$ 80

    CERN Multimedia

    2002-01-01

    The determination of isotope shifts in the isotopic chain of Hg has led to quite a number of unexpected observations as the transition from slightly oblate to strongly prolate deformation below A~=~186, the shape coexistence in |1|8|5Hg and a huge odd-even staggering of the charge radii in the region 181~@$<$~ Until now it is quite open if the observed instability of the nuclear shape is an isolated and unique feature of the light Hg isotopes and how it changes with Z and depends on the shell and pairing energies.\\\\ \\\\ Therefore we propose to carry out a study of the isotope shifts in the neighbouring isotopes of the elements Au and Pt which can be obtained at ISOLDE as daughters of a primary Hg beam. Resonance ionization spectroscopy will be applied as a novel technique at ISOLDE. The time of flight of the photo ionized Au (or Pt) isotope in a drift tube will be used to get rid of any background events.

  5. The Highest Resolution X-ray View of the Nuclear Region of NGC 4151

    Science.gov (United States)

    Wang, Junfeng; Fabbiano, G.; Karovska, M.; Elvis, M.; Risaliti, G.; Zezas, A.; Mundell, C. G.

    2009-09-01

    We report high resolution imaging of the nucleus of the Seyfert 1 galaxy NGC 4151 obtained with a 50 ks Chandra HRC observation. The HRC image resolves the emission on spatial scales of 0.5 arcsec (30 pc), showing an extended X-ray morphology overall consistent with the narrow line region seen in optical line emission. Removal of the bright point-like nuclear source and image deconvolution technique both reveal X-ray enhancements that closely match the substructures seen in the HST [OIII] image and prominent knots in the radio jet. We find that most of the NLR clouds in NGC 4151 have [OIII] to soft X-ray ratio consistent with the values observed in NLRs of some Seyfert 2 galaxies, which indicates a uniform ionization parameter even at large radii and a density dependence ∝ r^{-2} as expected in the disk wind scenario. We examine various X-ray emission mechanisms of the radio jet and consider thermal emission from interaction between radio outflow and the NLR clouds the most probable origin for the X-ray emission associated with the jet.

  6. Identification of critical regions in human SAMHD1 required for nuclear localization and Vpx-mediated degradation.

    Science.gov (United States)

    Guo, Haoran; Wei, Wei; Wei, Zhenhong; Liu, Xianjun; Evans, Sean L; Yang, Weiming; Wang, Hong; Guo, Ying; Zhao, Ke; Zhou, Jian-Ying; Yu, Xiao-Fang

    2013-01-01

    The sterile alpha motif (SAM) and HD domain-containing protein-1 (SAMHD1) inhibits the infection of resting CD4+ T cells and myeloid cells by human and related simian immunodeficiency viruses (HIV and SIV). Vpx inactivates SAMHD1 by promoting its proteasome-dependent degradation through an interaction with CRL4 (DCAF1) E3 ubiquitin ligase and the C-terminal region of SAMHD1. However, the determinants in SAMHD1 that are required for Vpx-mediated degradation have not been well characterized. SAMHD1 contains a classical nuclear localization signal (NLS), and NLS point mutants are cytoplasmic and resistant to Vpx-mediated degradation. Here, we demonstrate that NLS-mutant SAMHD1 K11A can be rescued by wild-type SAMHD1, restoring its nuclear localization; consequently, SAMHD1 K11A became sensitive to Vpx-mediated degradation in the presence of wild-type SAMHD1. Surprisingly, deletion of N-terminal regions of SAMHD1, including the classical NLS, generated mutant SAMHD1 proteins that were again sensitive to Vpx-mediated degradation. Unlike SAMHD1 K11A, these deletion mutants could be detected in the nucleus. Interestingly, NLS-defective SAMHD1 could still bind to karyopherin-β1 and other nuclear proteins. We also determined that the linker region between the SAM and HD domain and the HD domain itself is important for Vpx-mediated degradation but not Vpx interaction. Thus, SAMHD1 contains an additional nuclear targeting mechanism in addition to the classical NLS. Our data indicate that multiple regions in SAMHD1 are critical for Vpx-mediated nuclear degradation and that association with Vpx is not sufficient for Vpx-mediated degradation of SAMHD1. Since the linker region and HD domain may be involved in SAMHD1 multimerization, our results suggest that SAMHD1 multimerization may be required for Vpx-mediation degradation.

  7. Establishment of data base of regional seismic recordings from earthquakes, chemical explosions and nuclear explosions in the Former Soviet Union

    Energy Technology Data Exchange (ETDEWEB)

    Ermolenko, N.A.; Kopnichev, Yu.F.; Kunakov, V.G.; Kunakova, O.K.; Rakhmatullin, M.Kh.; Sokolova, I.N.; Vybornyy, Zh.I. [AN SSSR, Moscow (Russian Federation). Inst. Fiziki Zemli

    1995-06-01

    In this report results of work on establishment of a data base of regional seismic recordings from earthquakes, chemical explosions and nuclear explosions in the former Soviet Union are described. This work was carried out in the Complex Seismological Expedition (CSE) of the Joint Institute of Physics of the Earth of the Russian Academy of Sciences and Lawrence Livermore National Laboratory. The recording system, methods of investigations and primary data processing are described in detail. The largest number of digital records was received by the permanent seismic station Talgar, situated in the northern Tien Shan, 20 km to the east of Almaty city. More than half of the records are seismograms of underground nuclear explosions and chemical explosions. The nuclear explosions were recorded mainly from the Semipalatinsk test site. In addition, records of the explosions from the Chinese test site Lop Nor and industrial nuclear explosions from the West Siberia region were obtained. Four records of strong chemical explosions were picked out (two of them have been produced at the Semipalatinsk test site and two -- in Uzbekistan). We also obtained 16 records of crustal earthquakes, mainly from the Altai region, close to the Semipalatinsk test site, and also from the West China region, close to the Lop Nor test site. In addition, a small number of records of earthquakes and underground nuclear explosions, received by arrays of temporary stations, that have been working in the southern Kazakhstan region are included in this report. Parameters of the digital seismograms and file structure are described. Possible directions of future work on the digitizing of unique data archive are discussed.

  8. Implantation of tomography qualities in Centro Regional de Ciencias Nucleares do Nordeste, Brazil; Implantacao das qualidades de tomografia no Centro Regional de Ciencias Nucleares do Nordeste, CNEN-PE, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Diniz, Osana F.; Silveira, Renata R.; Melo, Roberto T.; Oliveira, Marcia L., E-mail: osana.diniz@hotmail.com [Centro Regional de Ciencias Nucleares do Nordeste (CRCN-NE/CNEN-PE), Recife, PB (Brazil)

    2016-07-01

    The quality guarantee of the service offered by a ionizing radiation metrology laboratory is deeply connected to the conformity to the radiation beams implanted to the determination and definition present in the international standards and adopted by the Brazilian National Commission of Nuclear Energy – CNEN. The objective of this work was the implementation of computerized tomography qualities, RQT 8, 9 e 10, in accordance with the IEC-61267 standard in the Metrology Laboratory of the Northeast Regional Center of Nuclear Sciences (CRCN-NE), PE, Brazil. (author)

  9. Scheme of fault tectonic and tectonic activity manifestation in the region of the Crimea nuclear power plant construction

    International Nuclear Information System (INIS)

    Pasynkov, A.L.

    1989-01-01

    Characteristic of fault tectonics and tectonic activity manifestation in the region of the Crimea nuclear power plant construction is presented. Mosaic-block structure of the area, predetermined by the development of diagonal systems of activated tectonic dislocations with different displacement amplitudes and different stratigraphic ranges of manifestation, was established. Strained-stressed state of the region is determined by the presence of the South-Azov zone of deep fault and Krasnogorsk-Samarlinks fault system. The presented scheme can be used as tectonic basis of seismogenic activity of the region

  10. A High-definition View Of The Circum-nuclear Regions In Nearby Seyferts With Chandra And HST

    Science.gov (United States)

    Wang, Junfeng; Fabbiano, G.; Elvis, M.; Risaliti, G.; Karovska, M.; Zezas, A.; Mundell, C. G.

    2011-09-01

    To improve our understanding of AGN feedback, it is crucial to evaluate the true role of outflows on galaxy evolution observationally. I will present new results from the CHandra survey of Extended Emission-line Regions in nearby Seyfert galaxies (CHEERS), which aims to examine feedback in action in much greater detail than at high redshift. Findings from Chandra studies of the circum-nuclear region in the archetypal Seyfert 1 galaxy NGC 4151 will be discussed in detail. Exploiting Chandra's highest possible resolution, we find evidence for X-ray emission from interaction between radio outflow and the optical narrow-line region clouds, in addition to the emission from photoionized gas.

  11. An Approach to Building Capacity for Nuclear Security and Safeguards in Thailand and the Southeast Asian Region

    International Nuclear Information System (INIS)

    Pengvanich, P.; Chanyotha, S.; Nilsuwankosit, S.

    2016-01-01

    Full text: A master’s degree programme in nuclear security and safeguards has been developed and offered at Chulalongkorn University for the first time in 2013 in order to develop necessary human resources in the fields of nuclear security and safeguards who can continue to work, conduct research, or serve as educators in these fields in Thailand and the Southeast Asian region. The first group of 20 students joined the programme in 2013 and recently graduated. The programme was one-of-its-kind, as there have not been many similar specialized programmes in nuclear security and safeguards in the past. In this paper, challenges and lessons learned throughout the programme are reported. Experience from the pilot programme will be used to improve the next round of the programme which is expected to start in 2017. With this program, more nuclear knowledge can be shared and maintained among the Association of South East Asian Nations (ASEAN) countries to ensure the peaceful utilization of nuclear technology in the region. (author

  12. Mapping of nuclear import signal and importin {alpha}3 binding regions of 52K protein of bovine adenovirus-3

    Energy Technology Data Exchange (ETDEWEB)

    Paterson, Carolyn P.; Ayalew, Lisanework E. [Vaccine and Infectious Disease Organization-International Vaccine Center (VIDO-InterVac), University of Saskatchewan, Saskatoon, SK S7N 5E3 Canada (Canada); Veterinary Microbiology, University of Saskatchewan, Saskatoon, SK S7N 5E3 S7N 5B4 Canada (Canada); Tikoo, Suresh K., E-mail: suresh.tik@usask.ca [Vaccine and Infectious Disease Organization-International Vaccine Center (VIDO-InterVac), University of Saskatchewan, Saskatoon, SK S7N 5E3 Canada (Canada); Veterinary Microbiology, University of Saskatchewan, Saskatoon, SK S7N 5E3 S7N 5B4 Canada (Canada); School of Public Health, University of Saskatchewan, Saskatoon, SK S7N 5E5 Canada (Canada)

    2012-10-10

    The L1 region of bovine adenovirus (BAdV)-3 encodes a non-structural protein designated 52K. Anti-52K serum detected a protein of 40 kDa, which localized to the nucleus but not to the nucleolus in BAdV-3-infected or transfected cells. Analysis of mutant 52K proteins suggested that three basic residues ({sup 105}RKR{sup 107}) of the identified domain (amino acids {sup 102}GMPRKRVLT{sup 110}) are essential for nuclear localization of 52K. The nuclear import of a GST-52K fusion protein utilizes the classical importin {alpha}/{beta}-dependent nuclear transport pathway. The 52K protein is preferentially bound to the cellular nuclear import receptor importin {alpha}3. Although deletion of amino acid 102-110 is sufficient to abrogate the nuclear localization of 52K, amino acid 90-133 are required for interaction with importin-{alpha}3 and localizing a cytoplasmic protein to the nucleus. These results suggest that 52K contains a bipartite NLS, which preferentially utilize an importin {alpha}3 nuclear import receptor-mediated pathway to transport 52K to the nucleus.

  13. Mapping of nuclear import signal and importin α3 binding regions of 52K protein of bovine adenovirus-3

    International Nuclear Information System (INIS)

    Paterson, Carolyn P.; Ayalew, Lisanework E.; Tikoo, Suresh K.

    2012-01-01

    The L1 region of bovine adenovirus (BAdV)-3 encodes a non-structural protein designated 52K. Anti-52K serum detected a protein of 40 kDa, which localized to the nucleus but not to the nucleolus in BAdV-3-infected or transfected cells. Analysis of mutant 52K proteins suggested that three basic residues ( 105 RKR 107 ) of the identified domain (amino acids 102 GMPRKRVLT 110 ) are essential for nuclear localization of 52K. The nuclear import of a GST-52K fusion protein utilizes the classical importin α/β-dependent nuclear transport pathway. The 52K protein is preferentially bound to the cellular nuclear import receptor importin α3. Although deletion of amino acid 102–110 is sufficient to abrogate the nuclear localization of 52K, amino acid 90–133 are required for interaction with importin-α3 and localizing a cytoplasmic protein to the nucleus. These results suggest that 52K contains a bipartite NLS, which preferentially utilize an importin α3 nuclear import receptor-mediated pathway to transport 52K to the nucleus.

  14. Nuclear power in the Baltic Sea region: the history of emergence and the political and economic features of its development

    Directory of Open Access Journals (Sweden)

    Kretinin Gennady

    2013-06-01

    Full Text Available This article focuses on the development of peaceful nuclear power. The author draws attention to the fact that nuclear power is a rather young branch of national economy. However, over recent decades, it has already seen rises and falls, and a number of states have had tragic experiences of nuclear emergencies. Nevertheless, many countries — including the three Baltic States of Estonia, Latvia and Lithuania — express a strong interest in development, generation, and application of nuclear power. In the Baltic States, nuclear power dates back to the Soviet times, but its development was suspended pursuant to the EU regulations (the Ignalina NPP. Lithuania, Latvia, and Estonia have been striving for energy independence from Russia — the principal supplier of energy carriers to these countries. For a long time, the three Baltic States have been proclaiming their unanimity on the general European path of development. However, the reality proved to be different. The touchstone for achieving common goals was the idea of constructing a new NPP at the site of the closed Ignalina NPP. The author concludes that the joint construction of a new NPP is quite questionable. When it comes to politics, each of the three Baltic States is ready to build its own NPP. Thus, the development of nuclear power in the Baltic Sea region requires joint coordinated actions independent of any bloc-inspired interests of the states involved. Moreover, this success may prove sustainable if the actions are based on innovative decisions and modern technologies.

  15. Role of a national system of accounting and control of nuclear material under ABACC's (Brazilian-Argentine Agency) regional system

    International Nuclear Information System (INIS)

    Fernandez Moreno, Sonia; Estrada Oyuela, Miguel E.

    2000-01-01

    The Brazilian-Argentine Agency (ABACC) and the 'Common System of Accounting and Control of Nuclear Materials' (SCCC) are the result of a process started with nuclear cooperation between Argentina and Brazil. The SCCC reflects a common policy of transparency established by a Bilateral Agreement. Its insertion in the global context was made through a Quadripartite Agreement (Argentina, Brazil, ABBAC, IAEA). This paper describes the role of the State System of Accounting and Control (SSAC) in the framework established in the Bilateral and the Quadripartite Safeguards Agreements and in the context of new trends and perspectives in international safeguards. It could also serve as a example for initiatives in other regions. (author)

  16. Sub-regional Workshop on Illicit Nuclear Trafficking Information Management and Coordination

    International Nuclear Information System (INIS)

    2010-01-01

    The workshop was organized to; have a comprehensive set of information which effectively supports implementation of the Nuclear Security Plan; understand nuclear security needs on a global scale to identify areas of cooperation between and among the Agency and Member States; determine illicit global trafficking trends and patterns, including theft and other malicious acts involving radioactive material; fully protect sensitive nuclear security information from disclosure; coordinate the nuclear security support programmes of Member States and international organizations with those of the Agency and have effective mechanisms of interaction with other international organizations

  17. Seismic risk control of nuclear power plants using seismic protection systems in stable continental regions: The UK case

    Energy Technology Data Exchange (ETDEWEB)

    Medel-Vera, Carlos, E-mail: cbmedel@uc.cl; Ji, Tianjian, E-mail: tianjian.ji@manchester.ac.uk

    2016-10-15

    Highlights: • Strategies to reduce seismic risk for nuclear power stations in the UK are analysed. • Efficiency of devices to reduce risk: viscous-based higher than hysteretic-based. • Scenario-based incremental dynamic analysis is introduced for use in nuclear stations. • Surfaces of seismic unacceptable performance for nuclear stations are proposed. - Abstract: This article analyses three different strategies on the use of seismic protection systems (SPS) for nuclear power plants (NPPs) in the UK. Such strategies are based on the experience reported elsewhere of seismically protected nuclear reactor buildings in other stable continental regions. Analyses are conducted using an example of application based on a 1000 MW Pressurised Water Reactor building located in a representative UK nuclear site. The efficiency of the SPS is probabilistically assessed to achieve possible risk reduction for both rock and soil sites in comparison with conventionally constructed NPPs. Further analyses are conducted to study how the reduction of risk changes when all controlling scenarios of the site are included. This is done by introducing a scenario-based incremental dynamic analysis aimed at the generation of surfaces for unacceptable performance of NPPs as a function of earthquake magnitude (M{sub w}) and distance-to-site (R{sub epi}). General guidelines are proposed to potentially use SPS in future NPPs in the UK. Such recommendations can be used by the British nuclear industry in the future development of 12 new reactors to be built in the next two decades to generate 16 GWe of new nuclear capacity.

  18. Regional, national and international security requirements for the transport of nuclear cargo by sea

    International Nuclear Information System (INIS)

    Booker, P.A.; Barnwell, I.

    2004-01-01

    Since the beginning of the nuclear age in the 1940's, the world has focused on the immense possibilities of nuclear power with both its destructive and productive capabilities. The civil nuclear industry in the UK, as in most nuclear weapons states, grew from the military facilities built in the post war years under the political climate of the Cold War. In the early years of the industry, civil and defence nuclear facilities were inextricably linked both in public perceptions and the regulatory infrastructure under which they operated. The nuclear arms race and the spread of communism overshadowed people's perceptions of there being two separate uses of nuclear material. This was a double edged sword which initially allowed the industry to develop largely unhindered by public concerns but latterly meant the industry could not break away from its roots and to many is still perceived as a dangerous and destructive force. Regulatory frameworks governing all aspects of the industry have developed both nationally and internationally driven by valid public concerns, political agendas and an international consensus that the unregulated use of nuclear material has catastrophic possibilities on an international scale. With the internationalisation of the civil nuclear industry and the costs associated with developing facilities to fully support each stage of the fuel cycle, from enrichment, fuel manufacturing, reprocessing and waste remediation, it became inevitable that a transport infrastructure would develop to make best use of the facilities. Regulations, both national and international are implicit in ensuring the security of nuclear material in transit. Due to the physical size of many of the irradiated fuel packages and implications of the changes to transport safety regulations, international transports of nuclear material, other than within mainland Europe, is predominantly carried out by sea

  19. Regional, national and international security requirements for the transport of nuclear cargo by sea

    Energy Technology Data Exchange (ETDEWEB)

    Booker, P.A.; Barnwell, I. [Marine Operations, BNFL International Transport and British Nuclear Group Security (United Kingdom)

    2004-07-01

    Since the beginning of the nuclear age in the 1940's, the world has focused on the immense possibilities of nuclear power with both its destructive and productive capabilities. The civil nuclear industry in the UK, as in most nuclear weapons states, grew from the military facilities built in the post war years under the political climate of the Cold War. In the early years of the industry, civil and defence nuclear facilities were inextricably linked both in public perceptions and the regulatory infrastructure under which they operated. The nuclear arms race and the spread of communism overshadowed people's perceptions of there being two separate uses of nuclear material. This was a double edged sword which initially allowed the industry to develop largely unhindered by public concerns but latterly meant the industry could not break away from its roots and to many is still perceived as a dangerous and destructive force. Regulatory frameworks governing all aspects of the industry have developed both nationally and internationally driven by valid public concerns, political agendas and an international consensus that the unregulated use of nuclear material has catastrophic possibilities on an international scale. With the internationalisation of the civil nuclear industry and the costs associated with developing facilities to fully support each stage of the fuel cycle, from enrichment, fuel manufacturing, reprocessing and waste remediation, it became inevitable that a transport infrastructure would develop to make best use of the facilities. Regulations, both national and international are implicit in ensuring the security of nuclear material in transit. Due to the physical size of many of the irradiated fuel packages and implications of the changes to transport safety regulations, international transports of nuclear material, other than within mainland Europe, is predominantly carried out by sea.

  20. Artificial radionuclides in oils from the underground nuclear test site (Perm region, Russia)

    International Nuclear Information System (INIS)

    Kalmykov, S.N.; Sapozhnikov, Yu.A.; Goloubov, B.N.

    1998-01-01

    Underground nuclear tests (UNT) are one of the possible sources of radioactive contamination of environment. About 2500 UNTs were carried out both for military and industrial (peaceful) purposes. In the former Soviet Union most of peaceful UNTs were oriented to the needs of the gas- and oil-extracting industry. Earlier it was considered that the holes of UNT are hermetic and the leakage of radionuclides is negligible. In this work nine oil samples from Gezh oil deposit in Perm region of Russia collected from different holes both where the explosion took part and from distant holes were analyzed for 3 H and 14 C and such fission products as 90 Sr and 134,137 Cs. For the determination of gamma-emitting radionuclides the gamma spectrometry with HPGe detector was used. For 90 Sr determination the measurements of Cherenkov radiation generated by daughter 90 Y were carried out with liquid scintillation equipment. It showed that even in the oil samples from the hole where the explosion took place no measurable 134,137 Cs and 90 Sr activities were detected. For 3 H and 14 C determination the oil samples were fractionated by distillation. For each sample 10-12 fractions were taken. Liquid scintillation spectrometry was used for 3 H and 14 C simultaneous determination. It was shown that in all samples the 3 H and 14 C concentrations are higher than the background level and for the hole where the explosion took place reached the value of about 1.3 x 10 5 Bq/L for low boiling fraction (40-750C). The 3 H and 14 C enrichment of oils from distant holes shows that UNT cavities are not hermetic and the radionuclide migration is not negligible. (author)

  1. Russian Federation [National and regional programmes on the production of hydrogen using nuclear energy

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-03-15

    The Russian Federation, one of the world's big energy superpowers, is rich in natural energy resources. It has the largest known natural gas reserves of any country on earth, representing 32% of the world's proven reserves. Furthermore, it has, with 157 billion t, the world's second largest coal reserves (10% of the explored coal reserves). The Russian Federation is the largest oil producer of the non-OPEC countries, and the second largest in the world after Saudi Arabia. It has the biggest oil shale reserves in Europe, equal to 35.47 billion t of shale oil. Last but not least, it possesses 8% of the proven uranium reserves. In recent years, the Russian Federation has identified the gas sector as being of key strategic importance. The share of natural gas as a primary energy source is remarkably high compared with the rest of world. Gazprom has a monopoly for the natural gas pipelines and has the exclusive rights to export natural gas, and thus controls their access to the European market. The total primary energy consumption in the Russian Federation was 665 Mtoe in 2007, down from 871 Mtoe in 1990, with 55% covered by natural gas, 20% by oil and 15% by coal. It is the world's fourth largest electricity producer after the USA, China and Japan. In 2007, it produced 1013 TW.h of electricity. Roughly 67% of the Russian Federation's electricity is generated by thermal plants, 17% by hydropower and 17% by nuclear reactors. The Russian Federation is the world's leading net energy exporter and a major supplier to the European Union. In the Russian Federation, about 40% of electric power and 85% of heat supply, mainly in cogeneration, is covered by regional power industries with power plant units of {approx}300 MW(th).

  2. Open letter to Mr Christian Bataille, Deputy of Nord region, France. Open letter on nuclear energy

    International Nuclear Information System (INIS)

    Delacroix P

    2007-02-01

    The author, by means of a letter to the deputy Christian Bataille, presents arguments to the shutdown of old nuclear power plants. He points out the environmental and economical arguments in favor of a decrease of the nuclear power use in France. (A.L.B.)

  3. Functional analysis of the C-terminal region of human adenovirus E1A reveals a misidentified nuclear localization signal

    Energy Technology Data Exchange (ETDEWEB)

    Cohen, Michael J.; King, Cason R.; Dikeakos, Jimmy D. [Department of Microbiology and Immunology, The University of Western Ontario, A4-833 London Regional Cancer Centre, 800 Commissioners Road E., London, Ontario, N6A 4L6 Canada (Canada); Mymryk, Joe S., E-mail: jmymryk@uwo.ca [Department of Microbiology and Immunology, The University of Western Ontario, A4-833 London Regional Cancer Centre, 800 Commissioners Road E., London, Ontario, N6A 4L6 Canada (Canada); Department of Oncology, The University of Western Ontario, London Regional Cancer Centre, Ontario (Canada)

    2014-11-15

    The immortalizing function of the human adenovirus 5 E1A oncoprotein requires efficient localization to the nucleus. In 1987, a consensus monopartite nuclear localization sequence (NLS) was identified at the C-terminus of E1A. Since that time, various experiments have suggested that other regions of E1A influence nuclear import. In addition, a novel bipartite NLS was recently predicted at the C-terminal region of E1A in silico. In this study, we used immunofluorescence microscopy and co-immunoprecipitation analysis with importin-α to verify that full nuclear localization of E1A requires the well characterized NLS spanning residues 285–289, as well as a second basic patch situated between residues 258 and 263 ({sup 258}RVGGRRQAVECIEDLLNEPGQPLDLSCKRPRP{sup 289}). Thus, the originally described NLS located at the C-terminus of E1A is actually a bipartite signal, which had been misidentified in the existing literature as a monopartite signal, altering our understanding of one of the oldest documented NLSs. - Highlights: • Human adenovirus E1A is localized to the nucleus. • The C-terminus of E1A contains a bipartite nuclear localization signal (NLS). • This signal was previously misidentified to be a monopartite NLS. • Key basic amino acid residues within this sequence are highly conserved.

  4. Functional analysis of the C-terminal region of human adenovirus E1A reveals a misidentified nuclear localization signal

    International Nuclear Information System (INIS)

    Cohen, Michael J.; King, Cason R.; Dikeakos, Jimmy D.; Mymryk, Joe S.

    2014-01-01

    The immortalizing function of the human adenovirus 5 E1A oncoprotein requires efficient localization to the nucleus. In 1987, a consensus monopartite nuclear localization sequence (NLS) was identified at the C-terminus of E1A. Since that time, various experiments have suggested that other regions of E1A influence nuclear import. In addition, a novel bipartite NLS was recently predicted at the C-terminal region of E1A in silico. In this study, we used immunofluorescence microscopy and co-immunoprecipitation analysis with importin-α to verify that full nuclear localization of E1A requires the well characterized NLS spanning residues 285–289, as well as a second basic patch situated between residues 258 and 263 ( 258 RVGGRRQAVECIEDLLNEPGQPLDLSCKRPRP 289 ). Thus, the originally described NLS located at the C-terminus of E1A is actually a bipartite signal, which had been misidentified in the existing literature as a monopartite signal, altering our understanding of one of the oldest documented NLSs. - Highlights: • Human adenovirus E1A is localized to the nucleus. • The C-terminus of E1A contains a bipartite nuclear localization signal (NLS). • This signal was previously misidentified to be a monopartite NLS. • Key basic amino acid residues within this sequence are highly conserved

  5. France [National and regional programmes on the production of hydrogen using nuclear energy

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-03-15

    Consumption of primary energy in France amounted to 278 Mtoe in 2005, with an average increase of 1.3%/a between 1990 and 2005. The breakdown of primary energy is 42% nuclear energy, 33% oil, 15% natural gas, 6% renewables and 4% coal. France is comparatively poor in domestic energy resources. French coal production, which was still around 40 million t/a at the end of the 1970s, was terminated in 2004. Also, domestic natural gas contributes not more than 2% of France's primary energy production. With the general objectives being to control energy demand, diversify sources of energy, increase research into energy, and provide methods of transporting and storing energy, the French energy policy has given priority to the development of a national energy supply with a strong focus on nuclear energy and renewable energies. These energies are seen to provide a reliable long term supply without GHG emissions and to ensure stable electricity prices. The first nuclear power plants built in France were gas cooled reactors and the country also participated in the OECD Dragon project. Today France is the world's second largest producer of nuclear energy (after the USA) with an electricity share of 78%. France operates 58 nuclear power stations with a total capacity of 63.2 GW. One Gen- III reactor (EPR) is currently under construction. Since nuclear energy is not always fully used, interest is growing in using excess nuclear electricity, apart from export, for hydrogen production to regulate the electricity production.

  6. Implementation process and deployment initiatives for the regionalized storage of DOE-owned spent nuclear fuel

    International Nuclear Information System (INIS)

    Dearien, J.A.; Smith, N.E.L.

    1995-01-01

    This report describes how DOE-owned spent nuclear fuel (SNF) will be stored in the interim 40-year period from 1996 to 2035, by which time it is expected to be in a National Nuclear Repository. The process is described in terms of its primary components: fuel inventory, facilities where it is stored, how the fuel will be moved, and legal issues associated with the process. Tools developed to deploy and fulfill the implementation needs of the National Spent Nuclear Fuel Program are also discussed

  7. Central nuclear almirante Alvaro Alberto: study on the phytoplanktonic variation in the region of unity 1 - Angra dos Reis - RJ

    International Nuclear Information System (INIS)

    Souza, C.A.F. de; Pessoa, M.A.R.; Utchitel, S.

    1988-01-01

    By according of ''staff'' which has elaborated the first works in phitoplankton, in initial phasis (before operation) of Central Nuclear Almirante Alvaro Alberto - CNAAA Unidade 1, Angra dos Reis, Rio de Janeiro, Brazil we carry out a search about physic - chemicals parameters at same area, during the times of 11 months, too. The efluent region presents a phytoplanktonic comunity of reasonable environmental conditions. The evaluation of biological parameters, or in the words, a natural environment in equilibrium. (author) [pt

  8. Phylogenetic Analysis of a ?Jewel Orchid? Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions

    OpenAIRE

    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen

    2016-01-01

    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal th...

  9. Reactive inspection response of NRC Region III to potential technical deficiencies identified in recent Nuclear Air Cleaning Conference papers

    International Nuclear Information System (INIS)

    Gill, C.F.

    1987-01-01

    In order to effectively meet its responsibility to protect the public health and safety, the Nuclear Regulatory Commission (NRC) nuclear power plant licensing and inspection programs respond to potential technical deficiencies identified by conference and professional society meeting papers when deemed appropriate. The NRC staff's response mechanisms for such technical deficiencies include: generic letters, Bulletins, Information Notices, Standard Review Plan (NUREG-0800) revisions, docketed Final Safety Analysis Report (FSAR) questions, special studies, special (reactive) inspection, and inspection program revisions. This paper describes reactive inspection efforts by Region III in response to potential technical deficiencies identified in recent air cleaning conference papers, including: post-accident effluent sample line deposition losses; failure to implement good engineering practices in the design, construction, and testing of Nuclear Air Treatment Systems (NATS); filter bypass via filter housing drain lines; spinster carbon degradation; use of silicone sealants and other temporary patching material in NATS; filter housing fire protection deluge system problems; lack of charcoal batch traceability; Quality Assurance records problems involving equipment, vendor, filter, and personnel qualifications; inadequate ANSI/ASME N510 acceptance criteria and tests; and failure to adequately demonstrate control room habitability per 10 CFR 50, Appendix A, General Design Criterion-19. Region III inspections indicate that many of these deficiencies appear to be prevalent. Inspection findings and utility responses to the findings are discussed. NRC Region III and Headquarters programmatic reactions to the identified generic problem areas are also discussed

  10. Nuclear and Condensed Matter Physics: VI Regional CRRNSM Conference. AIP Conference Proceedings, No. 513 [APCPCS

    International Nuclear Information System (INIS)

    Messina, A.

    2000-01-01

    This book contains 102 scientific contributions in the areas of nuclear and condensed matter physics. The conference was attended by 144 physicists, most of them belonging to the Sicilian Universities of Palermo, Catania and Messina

  11. Action to counter illegal trafficking in nuclear materials in the northern region

    International Nuclear Information System (INIS)

    Reistad, O.; Maerli, M.

    1998-01-01

    Norway has not traditionally maintained any defence against smuggling of nuclear material. The 1993/94 report to Parliament on nuclear activities in areas adjacent to Norway mentioned the risk of such smuggling in the context of non-proliferation. In the light of this perceived risk a contact group was established with representatives from the Norwegian customs administration, police, armed forces and National Protection Authority. The group today has responsibility for the introduction of countermeasures against nuclear material smuggling in Norway. Another measure was establishment of Norwegian measurement facilities to combat smuggling of nuclear material. There arrangements are based on three lines of defence. The first will typically be the individual officer, the second, the special staff deployed following warnings or other indicators of smuggling, and the third would be any laboratory examination of specimens carried out in Norway or abroad

  12. Nuclear

    International Nuclear Information System (INIS)

    2014-01-01

    This document proposes a presentation and discussion of the main notions, issues, principles, or characteristics related to nuclear energy: radioactivity (presence in the environment, explanation, measurement, periods and activities, low doses, applications), fuel cycle (front end, mining and ore concentration, refining and conversion, fuel fabrication, in the reactor, back end with reprocessing and recycling, transport), the future of the thorium-based fuel cycle (motivations, benefits and drawbacks), nuclear reactors (principles of fission reactors, reactor types, PWR reactors, BWR, heavy-water reactor, high temperature reactor of HTR, future reactors), nuclear wastes (classification, packaging and storage, legal aspects, vitrification, choice of a deep storage option, quantities and costs, foreign practices), radioactive releases of nuclear installations (main released radio-elements, radioactive releases by nuclear reactors and by La Hague plant, gaseous and liquid effluents, impact of releases, regulation), the OSPAR Convention, management and safety of nuclear activities (from control to quality insurance, to quality management and to sustainable development), national safety bodies (mission, means, organisation and activities of ASN, IRSN, HCTISN), international bodies, nuclear and medicine (applications of radioactivity, medical imagery, radiotherapy, doses in nuclear medicine, implementation, the accident in Epinal), nuclear and R and D (past R and D programmes and expenses, main actors in France and present funding, main R and D axis, international cooperation)

  13. State and regional systems of accounting for and control of nuclear materials cooperation between international, regional and states safeguards organizations: An evolving issue

    International Nuclear Information System (INIS)

    Fernández Moreno, Sonia

    2011-01-01

    Cooperation between the IAEA, States and regional organizations is increasingly important to ensure effective accountancy and control of nuclear material in peaceful uses. The IAEA, SAGSI2 and institutions such INMM3 and ESARDA4 have recognized the relevance and the evolving role that SSAC5 and regional organizations play to this aim. In this context, it is important to take steps to ensure the effectiveness of the system and the optimal level of relationship between these organizations so as to maximize the benefits for each party, particularly in those cases where well developed systems exist. Moreover, expansion of nuclear energy requires concerted efforts towards building competence in safeguards in all relevant States. This is also important with respect to other aspects of nonproliferation. In this scenario there is agreement on the need to have effective state organizations that fulfill international safeguards and other security obligations. However, the roles and duties of SSAC and the possible scope of cooperation between the IAEA and SSAC are still under evolution. This paper discusses possible ways and means to build competence in safeguards and how the international community could be more proactive in establishing a framework including the various dimensions of the cooperation in safeguards and other security matters between all parties concerned. The establishment of a forum and a network of interested parties under the auspice of interested organizations could be one mechanism to exchange best practices and experiences. (authors)

  14. Multilateral nuclear approaches (MNAs), factors and issues lessons from IAEA study to regional cooperation

    International Nuclear Information System (INIS)

    Hwang, Yong Soo

    2005-01-01

    In response to the increasing emphasis being placed on the importance of international cooperation as part of global efforts to cope with growing non proliferation, and security concerns in the nuclear field, the Director General of the International Atomic Energy Agency (IAEA), Mohammed Elbaradei, appointed an international group of experts to consider possible multilateral approaches to the nuclear fuel cycle. The mandate of the Expert Group was three fold: · To identify and provide an analysis of issues and options relevant to multilateral approaches to the front and back ends of the nuclear fuel cycle; · To provide an overview of the policy, legal, security, economic, institutional and technological incentives and disincentives for cooperation in multilateral arrangements for the front and back ends of the nuclear fuel cycle; and · To provide a brief review of the historical and current experiences and analyses relating to multilateral fuel cycle arrangements relevant to the work of the Expert Group. The overall purpose was to assess MNAs in the framework of a double objective: strengthening the international nuclear non proliferation regime and making the peaceful uses of nuclear energy more economical and attractive. The Group identifies options for MNAs - options in terms of policy, institutional and legal factors - for those parts of the nuclear fuel cycle of greatest sensitivity from the point of view of proliferation risk. It also reflects the Groups deliberations on the corresponding benefits and disadvantages (pros and cons) of the various options and approaches. Although the Expert Group was able to agree to forward the resulting report to the Director General, it is important to note that the report does not reflect agreement by all of the experts on any of the options, nor a consensus assessment of their respective value. It is intended only to present options for MNAs, and to reflect on the range of considerations which could impact on the

  15. Role of proper response schemes, legislation and regional cooperation in combating illicit trafficking of nuclear materials in developing countries

    International Nuclear Information System (INIS)

    Sterzov, A.

    2002-01-01

    proper model scheme for the developing countries is important for starting the initial process of preventing and combating the illicit traffic of nuclear materials. There is a need of reinforcing strategy to control the existing stockpiles of fissile material and to lower the future production and use of such materials. The illicit traffic of nuclear materials is a new threat, which requires rapid implementation of comprehensive, mutually measures and efforts, new approaches, coordination of services and institutions and even new legislation. IV. Action Scheme for illicit radioactive or nuclear material It was felt that the application of a new model scheme would allow better and quicker response of Bulgarian capabilities for combating illicit nuclear trafficking. First Step 1. Health physics analysis (gamma and neutron dose) 2. Preservation of evidence (proper protocols adopted by the law enforcement forces) Second Step 1. NDA analysis to categorize the radioactive material on site: radioactive, non-fissile material; nuclear fuel ( 235 U content less 20 %); Pu and/or enriched U ( 235 U content higher 20 %) 2. Ge(Li) high Resolution Gamma Spectroscopy 3. Passive Neutron interrogation for Pu Third Step 1. In-Depth Analysis by Specialized laboratory: Analysis of the matrix, of packaging material; element composition of nuclear material; impurities, traces etc. V. Setting up a Legal and Administrative Frame. The creation and proposition of a model scheme procedure for the developing countries is important for starting the initial process of preventing and combating the illicit traffic of nuclear materials. The proposition of a model procedure will allow better and quicker upgrade of developing countries capabilities for combating illicit nuclear trafficking. It is also important to initiate the contacts between neighbouring countries by regional collaboration of law enforcement authorities, customs, analytical laboratories etc. which will make combating illicit trafficking

  16. South Africa [National and regional programmes on the production of hydrogen using nuclear energy

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-03-15

    South Africa has only small deposits of oil and natural gas and relies on coal production for most of its energy needs. South Africa's economy is structured around large scale, energy-intensive mining and primary minerals industries having a high commercial primary energy intensity. The supply of primary energy in 2007 was 128 Mtoe at a growth rate of 4.4 %/a. The main shares were given by coal (68%), crude oil (19%), renewables (8%), nuclear (3%) and natural gas (2%). South Africa accounts for a major fraction of the CO{sub 2} emissions of the whole continent. Due to its large coal deposits, South Africa is one of the cheapest electricity suppliers in the world. The main reason is its coal based power generating capacity, whose share is 79% (of {approx}40 GW(e)), followed by crude oil (10%), renewables (6%), nuclear (3%) and natural gas (2%). Eskom Holdings Ltd, the State owned power utility that supplies 95% of South Africa's electricity, is planning to increase the current generation capacity of 40 GW by 4%/a to 80 GW by 2025. The power supply crisis in January 2008, which forced shutdowns at mines, has accelerated recognition of the need to diversify the energy mix, such as with nuclear power and natural gas, as well as various forms of renewable energy. Starting in 1984, the national utility ESKOM has been successfully operating the Koeberg nuclear power station consisting of two 900 MW(e) PWR units which generated {approx}6.5% of the electricity needs. In addition, ESKOM has been pursuing the project of modular HTGRs for electricity production to meet the demand of its growing economy. In 2007-2008, the demand for electricity in South Africa started to exceed supply when the economy was growing and, at the same time, existing plants went out for maintenance. As a result, ESKOM and the South African Government decided to request proposals for new nuclear capacity and to expand the nuclear component in the energy supply mix of the country. In the strategic plan

  17. The role of the youth of Ozersk in creation of positive image of nuclear energy in the Chelyabinsk region

    International Nuclear Information System (INIS)

    Kostareva, T.; Teslov, A.

    2000-01-01

    The town of Ozyorsk is situated in the picturesque place of South Ural. This is the land of mountains, pure lakes and beautiful forests. The main factory of Ozyorsk is the Production Association MAYAK. It was founded for aims of Russian defenses in the beginning of the nuclear industry's development. In first years of existence the activity of Production Association MAYAK led to large-scale incidents, causing great harm to the environment and to the health of the population of Chelyabinsk region. There are two large factories of the nuclear industry apart from Production Association MAYAK in Chelyabinsk region. The activity of all these factories causes the specification of the ecological situation in the region. Evidently one of the main problems of the atomic industry in the region is to orient public opinion to have a good attitude about objects of the atomic industry and to their development. The Youth has to taken an active participation in such work. It is possible to organize the work with pupils, students and young specialists. (authors)

  18. Multi-region fuzzy logic controller with local PID controllers for U-tube steam generator in nuclear power plant

    Directory of Open Access Journals (Sweden)

    Puchalski Bartosz

    2015-12-01

    Full Text Available In the paper, analysis of multi-region fuzzy logic controller with local PID controllers for steam generator of pressurized water reactor (PWR working in wide range of thermal power changes is presented. The U-tube steam generator has a nonlinear dynamics depending on thermal power transferred from coolant of the primary loop of the PWR plant. Control of water level in the steam generator conducted by a traditional PID controller which is designed for nominal power level of the nuclear reactor operates insufficiently well in wide range of operational conditions, especially at the low thermal power level. Thus the steam generator is often controlled manually by operators. Incorrect water level in the steam generator may lead to accidental shutdown of the nuclear reactor and consequently financial losses. In the paper a comparison of proposed multi region fuzzy logic controller and traditional PID controllers designed only for nominal condition is presented. The gains of the local PID controllers have been derived by solving appropriate optimization tasks with the cost function in a form of integrated squared error (ISE criterion. In both cases, a model of steam generator which is readily available in literature was used for control algorithms synthesis purposes. The proposed multi-region fuzzy logic controller and traditional PID controller were subjected to broad-based simulation tests in rapid prototyping software - Matlab/Simulink. These tests proved the advantage of multi-region fuzzy logic controller with local PID controllers over its traditional counterpart.

  19. Nuclear deformations, level assignments and static nuclear moments of isotopes in the region 72Hf-77Ir

    International Nuclear Information System (INIS)

    Ekstroem, C.; Rubinsztein, H.; Moeller, P.

    1976-01-01

    A comparison is made between experimental and theoretical level assignments and static electromagnetic moments of nuclei in the region 72 Hf- 77 Ir. The theoretical calculations are based on the modified oscillator model. Equilibrium deformation values, epsilon and epsilon 4 , are determined for doubly-even and odd-mass nuclei from the minima in the potential energy surfaces. The influence of the different parameters entering the expressions for the magnetic dipole moment is analysed. The electric quadrupole and hexadecapole moments are calculated on the assumption that the nucleus is a homogeneously charged body with a sharp surface and a shape corresponding to that of an equipotential surface. In some selected cases, the electric multipole moments are evaluated by use of the single-particle wave functions. (Auth.)

  20. Sensitivity study on the parameters of the regional hydrology model for the Nevada nuclear waste storage investigations

    International Nuclear Information System (INIS)

    Iman, R.L.; Davenport, J.M.; Waddell, R.K.; Stephens, H.P.; Leap, D.I.

    1979-01-01

    Statistical methodology has been applied to the investigation of the regional hydrologic systems of a large area encompassing the Nevada Test Site (NTS) as a part of the overall evaluation of the NTS for deep geologic disposal of nuclear waste. Statistical techniques including Latin hypercube sampling were used to perform a sensitivity analysis on a two-dimensional finite-element code of 16 geohydrologic zones used to model the regional ground-water flow system. The Latin hypercube sample has been modified to include correlations between corresponding variables from zone to zone. From the results of sensitivity analysis it was found that: (1) the ranking of the relative importance of input variables between locations within the same geohydrologic zone were similar, but not identical; and (2) inclusion of a correlation structure for input variables had a significant effect on the ranking of their relative importance. The significance of these results is discussed with respect to the hydrology of the region

  1. Nuclear microanalysis of 16O and 18O in near-surface regions of solids. Applications

    International Nuclear Information System (INIS)

    Amsel, G.

    The best suited nuclear technique for 18 O analysis is the direct observation of nuclear reactions. Here, instead of measuring an induced radioactivity, one observes the particles emitted as a result of the O 18 (p,α)N 15 reaction. The α particles which are produced may be detected with surface barrier semiconductor detectors; they present unit detection efficiency and allow one to realize large solid angles of detection, while their energy resolution is excellent. For getting O 18 /O 16 ratios, 16 O must also be measured. This is achieved in a similar way, using the O 16 (d,p) 17 O reaction [fr

  2. Meeting report on third regional workshop on quality assurance and quality control of nuclear analytical techniques

    International Nuclear Information System (INIS)

    2002-01-01

    Over the last 20 years, the Agency, through its Technical Co-operation Programme, has helped to establish many nuclear analytical laboratories in nuclear institutions and universities of Member States. The project RER/2/004 has been approved in 1999 for a period of two years aiming at the implementation of a comprehensive QA/QC protocol in laboratories of Member States following the ISO guide 17025. The project involved 13 laboratories from 12 countries. This report presents the project setup, intended outputs and outcomes, achievements and conclusions. It also contains reports from participating laboratories. Each of the reports has been provided with an abstract and indexed separately

  3. Fire protection devices in the controlled region of GKN nuclear power station

    International Nuclear Information System (INIS)

    Bernhardt, S.; Grauf, E.

    1976-01-01

    In the GKN nuclear power station ('Neckar reactor'), an 805 MW PWR reactor whose start-up is scheduled for the near future, fire protection measures have been realized that go far beyond those realized in other German nuclear power stations until now. One of the main reasons is that the authorities have been sensibilized by a fire in the refuelling cavity during construction and by the Browns Ferry fire and are therefore extremely thorough in their examination. Further subsections have been added to the fire prevention sections in order to provide better quenching devices for potential fire sites. (orig./AK) [de

  4. Basic amino acid residues located in the N-terminal region of BEND3 are essential for its nuclear localization

    Energy Technology Data Exchange (ETDEWEB)

    Shiheido, Hirokazu, E-mail: shiheido@ak.med.kyoto-u.ac.jp; Shimizu, Jun

    2015-02-20

    BEN domain-containing protein 3 (BEND3) has recently been reported to function as a heterochromatin-associated protein in transcriptional repression in the nucleus. BEND3 should have nuclear localization signals (NLSs) to localize to the nucleus in light of its molecular weight, which is higher than that allowed to pass through nuclear pore complexes. We here analyzed the subcellular localization of deletion/site-directed mutants of human BEND3 by an immunofluorescence assay in an attempt to identify the amino acids essential for its nuclear localization. We found that three basic amino acid residues located in the N-terminal region of BEND3 (BEND3{sub 56–58}, KRK) are essential, suggesting that these residues play a role as a functional NLS. These results provide valuable information for progressing research on BEND3. - Highlights: • BEND3 localizes to the nucleus. • The N-terminal 60 amino acids region of BEND3 contains NLS. • Amino acids located between 56 and 58 of BEND3 (KRK) are part of NLS. • KRK motif is highly conserved among BEND3 homologs.

  5. Nuclear proteins interacting with the promoter region of the human granulocyte/macrophage colony-stimulating factor gene

    International Nuclear Information System (INIS)

    Shannon, M.F.; Gamble, J.R.; Vadas, M.A.

    1988-01-01

    The gene for human granulocyte/macrophage colony-stimulating factor (GM-CSF) is expressed in a tissue-specific as well as an activation-dependent manner. The interaction of nuclear proteins with the promoter region of the GM-CSF gene that is likely to be responsible for this pattern of GM-CSF expression was investigated. The authors show that nuclear proteins interact with DNA fragments from the GM-CSF promoter in a cell-specific manner. A region spanning two cytokine-specific sequences, cytokine 1 (CK-1, 5', GAGATTCCAC 3') and cytokine 2 (CK-2, 5' TCAGGTA 3') bound two nuclear proteins from GM-CSF-expressing cells in gel retardation assays. NF-GMb was inducible with phorbol 12-myristate 13-acetate and accompanied induction of GM-CSF message. NF-GMb was absent in cell lines not producing GM-CSF, some of which had other distinct binding proteins. NF-GMa and NF-GMb eluted from a heparin-Sepharose column at 0.3 and 0.6 M KCl, respectively. They hypothesize that the sequences CK-1 and CK-2 bind specific proteins and regulate GM-CSF transcription

  6. Floating nuclear heat. And power station 'Pevec' with KLT-40S type reactor plant for remote regions of Russia

    International Nuclear Information System (INIS)

    Veshnyakov, K.B.; Kiryushin, A.I.; Panov, Yu.K.; Polunichev, V.I.

    2000-01-01

    Floating small nuclear power plants power for local energy systems of littoral regions of Russia, located far from central energy system, open a new line in nuclear power development. Designing a floating power unit of a lead nuclear heat and power generating station for port Pevec at the Chuckchee national district is currently nearing completion. Most labor-intensive components are being manufactured. The co-generation NPP Pevec is to be created on the basis of a floating power unit with KLT-40S type reactor plant. KLT-40S reactor plant is based on similar propulsion plants, verified at operation of Russia's nuclear-powered civil ships, evolutionary improved by elimination of 'weak points' revealed during its prototypes operation or on the basis of safety analysis. KLT-40S reactor plant uses the most wide-spread and developed in the world practice PWR-type reactor. KLT-40S meets contemporary national and international requirements imposed to future reactor plants. The NHPS description, its main technical-economic data, environmental safety indices, basic characteristics of KLT-40S reactor plant are presented. Prospects of small NPPs utilization outside Russia, particularly as an energy source for sea water desalination, are considered. (author)

  7. Nuclear power-related facilities and neighboring land price: a case study on the Mutsu-Ogawara region, Japan.

    Science.gov (United States)

    Yamane, Fumihiro; Ohgaki, Hideaki; Asano, Kota

    2011-12-01

    From the perspective of risk, nuclear-power-related facilities (NPRFs) are often regarded as locally undesirable land use. However, construction of NPRFs contributes to social infrastructural improvement and job creation in the host communities. This raises a question: How large are these positive and negative effects? To approach this question from an economic viewpoint, we estimated the hedonic land price function for the Mutsu-Ogawara region of Japan from 1976 to 2004 and analyzed year-by-year fluctuations in land prices around the NPRFs located there. Land prices increased gradually in the neighborhood of the nuclear fuel cycle facilities (NFCFs) in Rokkasho Village, except for some falling (i) from 1982 to 1983 (the first official announcement of the project of construction came in 1983), (ii) from 1987 to 1988 (in 1988, the construction began and opposition movements against the project reached their peak), and (iii) from 1998 to 1999 (the pilot carry-in of spent fuels into the reprocessing plant began in 1998). Land prices around the Higashidori Nuclear Power Plant decreased during the period 1981-1982, when the Tohoku Electric Power Corp. and Tokyo Electric Power Corp. announced their joint construction plan. On the other hand, we obtained some results, even though not significant, indicating that land prices around Ohminato and Sekinehama harbors changed with the arrival and departure of the nuclear ship Mutsu, which suffered a radiation leak in 1974. © 2011 Society for Risk Analysis.

  8. Nuclear triaxiality in the A ∼ 160–170 mass region: the story so far

    Indian Academy of Sciences (India)

    2014-11-01

    Nov 1, 2014 ... 1Nuclear Physics Division, Bhabha Atomic Research Centre, Mumbai 400 085, India ... According to the calculated shell gaps, among Lu isotopes, 165Lu94 and 168Lu97 .... Based on a systematic investigation of the .... A brief review of recent discoveries and ongoing experimental and theoretical investi-.

  9. Issue update: a regional settlement proposal to resolve the Washington Nuclear Plant No. 3 lawsuit

    International Nuclear Information System (INIS)

    1985-08-01

    The Bonneville Power Administration (BPA) announced on August 2, 1985, that a number of substantive changes suggested by public comment on the Washington Nuclear Plant No. 3 settlement had been agreed to in principle by BPA and four private utilities. Since that date the details of these changes have been resolved, and the proposed settlement is now being offered for public review and comment

  10. Investigation of the seismicity at regional and teleseismic distances following underground nuclear detonations. Final technical report

    International Nuclear Information System (INIS)

    Willis, D.E.; Stubenrauch, A.; Willis, M.E.

    1977-01-01

    The main emphasis of the investigation was to determine the seismicity of the Nevada Test Site area during a time period which encompassed a lull in the testing program. The time period studied extends from April 1, 1973 to October 1, 1975. The aftershock sequence of nuclear shots fired on Pahute Mesa during late 1975 and early 1976 were also included

  11. Study of sea surface temperature distribution, in Angra dos Reis Nuclear Plant region - Mission Angra 01

    International Nuclear Information System (INIS)

    Stevenson, M.R.; Steffen, C.A.; Villagra, H.M.I.

    1982-03-01

    A study of spectral and temporal variations of sea surface temperature, using data obtained from level of satellite, aircraft and surface, with the purpose of evaluate and plot the small scale variations of sea surface temperature, due to thermal discharge from a nuclear the results of the first mission called Angra 1. (maps). (C.G.C.)

  12. Republic of Korea [National and regional programmes on the production of hydrogen using nuclear energy

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-03-15

    The total primary energy consumption of the Republic of Korea in 2006 was 233 Mtoe (ranking ninth in the world), with 43% petroleum, 24% coal, 16% nuclear, 14% LNG, 2% renewables and 1% hydro. Energy consumption is expected to grow significantly in the future. The country lacks domestic energy resources and currently has to import 97% of its primary energy demand. The Republic of Korea is the sixth largest and fastest growing CO{sub 2} emitter of the OECD countries. The total installed electrical generation capacity is 61.4 GW(e), of which 17.5 GW(e) is from nuclear. As of 2006, 36% of the electricity was generated by nuclear, 38% by coal, 20% by LNG, 5% by petroleum and 1% by hydropower. The Republic of Korea is a small country with a high population density where the use of low-density renewable energies is limited and not a practicable solution. Commercial scale nuclear power generation started at the Kori-1 plant in 1978, and another 19 reactor units have since been built using a mixture of CANDU (4 reactors) and PWR (16 reactors) technologies. The total nuclear capacity amounts to 17.7 GW. Eight more plants are planned to come on-line in the period from 2010 to 2016, adding another 9.4 GW. According to the 'National Energy Basic Plan' of 2008, the share of nuclear in the primary energy should grow to 33% provided by 32 units. Nuclear power research in the Republic of Korea is very active with investigation into a variety of advanced reactors, including the Korea Atomic Energy Research Institute (KAERI) small system-integrated modular advanced reactor (SMART), a 330 MW(th) pressurized water reactor with integral steam generators and advanced safety features, and designed for generating electricity (up to 100 MW(e)) and/or for thermal applications such as seawater desalination. Other advanced reactor concepts under development are a liquid metal fast/transmutation reactor and a high temperature hydrogen generation design.

  13. GUMAP: A GUPIXWIN-compatible code for extracting regional spectra from nuclear microbeam list mode files

    Science.gov (United States)

    Russell, John L.; Campbell, John L.; Boyd, Nicholas I.; Dias, Johnny F.

    2018-02-01

    The newly developed GUMAP software creates element maps from OMDAQ list mode files, displays these maps individually or collectively, and facilitates on-screen definitions of specified regions from which a PIXE spectrum can be built. These include a free-hand region defined by moving the cursor. The regional charge is entered automatically into the spectrum file in a new GUPIXWIN-compatible format, enabling a GUPIXWIN analysis of the spectrum. The code defaults to the OMDAQ dead time treatment but also facilitates two other methods for dead time correction in sample regions with count rates different from the average.

  14. Tennessee Valley region study: potential year 2000 radiological dose to population resulting from nuclear facility operations. [Includes glossary

    Energy Technology Data Exchange (ETDEWEB)

    None

    1978-06-01

    A companion report, DOE/ET-0064/1, presents a geographic, cultural, and demographic profile of the Tennessee Valley Region study area. This report describes the calculations of radionuclide release and transport and of the resultant dose to the regional population, assuming a projected installed capacity of 220,000 MW in the year 2000, of which 144,000 MW would be nuclear. All elements of the fuel cycle were assumed to be in operation. The radiological dose was calculated as a one-year dose based on ingestion of 35 different food types as well as for nine non-food pathways, and was reported as dose to the total body and for six specific organs for each of four age groups (infant, child, teen, and adult). Results indicate that the average individual would receive an incremental dose of 7 x 10/sup -4/ millirems in the year 2000 from the operation of nuclear facilities within and adjacent to the region, five orders of magnitude smaller than the dose from naturally occurring radiation in the area. The major contributor to dose was found to be tritium, and the most significant pathways were immersion in air, inhalation of air, transpiration of tritium (absorption through the skin), and exposure radionuclide-containing soil. 60 references.

  15. The text of an African regional co-operative agreement for research, development and training related to nuclear science and technology

    International Nuclear Information System (INIS)

    1990-04-01

    The document reproduces the text of an African Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology among African Member States that was endorsed by the Board of Governors on 21 February 1990

  16. Water and earth uses, habits and nutritional diets in adjacent regions of places selected to site 4 and 5 nuclear power plants

    International Nuclear Information System (INIS)

    Damasceno, M.A.P.; Coelho, C.P.

    1982-01-01

    A way of life study on adjacent region of 4 and 5 Nuclear Power Plants aiming at environmental impacts evaluation, development environmental monitoring programs and safety analysis report of the area is presented. (C.M.) [pt

  17. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    Science.gov (United States)

    Six DNA regions were evaluated in a multi-national, multi-laboratory consortium as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it...

  18. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    NARCIS (Netherlands)

    Schoch, C.L.; Seifert, K.A.; Huhndorf, S.; Robert, V.; Spouge, J.L.; Levesque, C.A.; Chen, W.; Crous, P.W.; Boekhout, T.; Damm, U.; Hoog, de G.S.; Eberhardt, U.; Groenewald, J.Z.; Groenewald, M.; Hagen, F.; Houbraken, J.; Quaedvlieg, W.; Stielow, B.; Vu, T.D.; Walther, G.

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it

  19. Enhancement of international cooperation and experience exchange: international and regional cooperation in nuclear technology

    International Nuclear Information System (INIS)

    Henderson, R.R.

    1987-01-01

    This paper will explore methods that have been effective in accomplishing broad-based technology transfer relationships between international commercial nuclear organizations, and have enhanced the benefits from such relationships through mutual participation in the development of new technology. The factors involved in accomplishing technology transfer will be examined based on the 25 years of Westinghouse experience in establishing successful nuclear technology relationships with over 20 different associates world-wide. This will include information pertaining to organization, training, consultation, technical information transmission, and other important aspects of technology transfer. Additionally, the methodology of enhancing and increasing the benefits of technology transfer through cooperative development programs as produced and promoted by Weatinghouse with its associates will be examined. This will include reviews of several significant copperative programs, such as the programs for the Advanced Pressurized Water Reactor and the Integrated Protection and Control Systems for future plants. (author)

  20. Northwest power gamble: Washington utilities go for broke on nuclear; region's citizens make conservation bid

    International Nuclear Information System (INIS)

    Brummer, J.

    1981-01-01

    The Washington Public Power Supply System (WPPSS) is asking for a reactor construction moratorium in an effort to get fast relief from the Bonneville Power Administration (BPA), which is authorized to guarantee power purchases from new power plants. Supporters of nuclear power plants as well as those of the soft energy path are watching to see how BPA will handle its mandate against acquiring new thermal plants until conservation and renewable energy potentials are exhausted. BPA can subvert the Pacific Northwest Power Act with 20-year contracts based on conventional forecasts despite evidence that new plants are unneeded. There is also evidence that the public rejects the idea of a moral obligation to bail out nuclear power cost overruns at taxpayer expense. The negotiations involve not only WPPSS and BPA, but Moody's Investor Service and environmental groups

  1. High energy nuclear collisions in the few GeV/nucleon region: projectile and target fragmentation

    International Nuclear Information System (INIS)

    Schroeder, L.S.

    1980-06-01

    A general review of nucleon-nucleus and nucleus-nucleus collisions for incident energies <10 GeV/nucleon is presented. The division of these interactions into peripheral and central collisions is briefly discussed. Subjects treated include the following: target and projectile fragmentation systematics, production of exotic nuclear fragments, studies of multiparticle final states, total cross section measurements, results from an experiment that indicate the production of projectile fragments with an anomalously short reaction mean free path, high-energy particle production at backward angles beyond simple N-N kinematic limits, and recent results on backward particle emission in studies with the Berkeley streamer chamber. Both the particle and nuclear physics aspects that are present are considered. A brief discussion of future trends in this energy range ends the presentation. 65 references, 37 figures

  2. Regional co-operation in the nuclear field: The Nordic experience

    International Nuclear Information System (INIS)

    Marcus, F.R.

    1983-01-01

    Experience from 25 years of co-operation in the nuclear field between the Nordic countries is described. A pragmatic approach with a minimum of formalism is used. The co-operation takes place mainly through ''horizontal'' channels between corresponding bodies in the different countries - safety authorities, research institutions, electricity producers, etc. In addition, a ''vertical'' co-ordination between these different circles is accomplished through a Nordic Liaison Committee. The experience shows that valuable results can be obtained, mainly through rationalization and improved use of resources. Difficulties, which are inherent in international co-operation, can be reduced, provided that there is a strong political will, an efficient system to promote contacts, and a flexible financing scheme. Apart from the benefits obtained in each of the countries - whether or not it has its own nuclear power - particular advantages accrue when a ''Nordic group'' can present co-ordinated viewpoints on the international scene. (author)

  3. Enhancement of international cooperation and experience exchange - international and regional cooperation in nuclear technology

    International Nuclear Information System (INIS)

    Henderson, R.R.

    1988-01-01

    This paper will explore methods that have been effective in accomplishing broad-based technology transfer relationships between international commercial nuclear organizations, and have enhanced the benefits from such relationships through mutual participation in the development of new technology. The factors involved in accomplishing technology transfer will be examined based on the 25 years of Westinghouse experience in establishing successful nuclear technology relationships with over 20 different associates world-wide. This will include information pertaining to organization, training, consultation, technical information transmission, and other important aspects of technology transfer. Additionally, the methodology of enhancing and increasing the benefits of technology transfer through cooperative development programs as produced and promoted by Westinghouse with its associates will be examined. This will include reviews of several significant cooperative programs, such as the programs for the Advanced Pressurized Water Reactor and the Integrated Protection and Control Systems for future plants

  4. A cosmic-ray nuclear event with an anomalously strong concentration of energy and particles in the central region

    International Nuclear Information System (INIS)

    Amato, N.M.; Arata, N.; Maldonado, R.H.C.

    1987-01-01

    A cosmic-ray-induced nuclear event detected in an emulsion chamber is described. The event consist of 217 shower cores with ΣEγ=1.275 TeV. In a logarithmic scale, energy and particles are emitted most densely at the small lateral distance corresponding to 0.5 mm; 77% of the total energy and 61% of the total multiplicity are inside a radius of 0.65 cm. The shower cores in the central region show exponential-type energy distribution and nonisotropic azimuthal distribution

  5. Yield Estimation for Semipalatinsk Underground Nuclear Explosions Using Seismic Surface-wave Observations at Near-regional Distances

    Science.gov (United States)

    Adushkin, V. V.

    - A statistical procedure is described for estimating the yields of underground nuclear tests at the former Soviet Semipalatinsk test site using the peak amplitudes of short-period surface waves observed at near-regional distances (Δ Semipalatinsk explosions, including the Soviet JVE explosion of September 14, 1988, and it is demonstrated that it provides seismic estimates of explosion yield which are typically within 20% of the yields determined for these same explosions using more accurate, non-seismic techniques based on near-source observations.

  6. Text of an African regional co-operative agreement for research, development and training related to nuclear science and technology

    International Nuclear Information System (INIS)

    1994-01-01

    As of 1 September 1994, notifications of acceptance of the African Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology (see INFCIRC/377), in accordance with Article XIII thereof, had been received by the Director General from the Governments of: Tunisia, Egypt, Algeria, Nigeria, Madagascar, Libya, Morocco, Kenya, Sudan, Ghana, Tanzania, Mauritius, Cameroon, South Africa, Zaire, Ethiopia, Zambia, Niger. The Agreement entered into force on 4 April 1990, the date of receipt of the third notification of acceptance

  7. United States of America [National and regional programmes on the production of hydrogen using nuclear energy

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-03-15

    The USA uses more energy than any other country in the world. Energy consumption exceeds domestic supply, which continuously declines. Currently, 27% of the energy needs are imported, a share which will rise to 31% by 2020. In 2007, the USA consumed in total 2337 Mtoe of primary energy. An estimate of the energy use in 2008 is given. The country's largest source representing 39% of the energy demand is crude oil, of which 60% must be imported. About 66% of the oil is consumed in the transportation sector and 24% in the industrial sector, while the remainder is used for residential and commercial heating. The USA is also the largest consumer of natural gas, with 27% of the world's annual production. Natural gas is increasingly used for electricity production (almost doubled to 21% in 2007 compared to 1990) and will remain in the nearer term the fuel of choice for new electric power plants. About 16% of the natural gas consumed is imported, partly in the form of LNG. Regasification of LNG is a growing industry. Coal is the most abundantly available energy resource in the USA. About 50% of the electricity production is from coal, which is responsible for a relatively high level of pollutant emissions. The USA will need approximately 400 GW of new power generation capacity by 2020. In 2007, nuclear energy accounted for 837 TW-h or 19% of the total electricity production from the operation of 104 nuclear reactors with a capacity of 101.2 GW(e). To maintain this nuclear share, the equivalent of 30 1000 MW nuclear reactors will have to be built. Renewables are basically used for electricity production with a share of 9% (with 6% from hydro and 3% from other renewables).

  8. RPA spin-isospin nuclear response in the deep inelastic region

    International Nuclear Information System (INIS)

    Alberico, W.M.; Molinari, A.; De Pace, A.; Johnson, M.B.; Ericson, M.

    1985-11-01

    The spin-isospin volume responses of a finite nucleus are evaluated in the RPA frame, utilizing a harmonic oscillator basis. Particular emphasis is given to the mixing between the longitudinal and transverse couplings, which arise at the nuclear surface. We show that it reduces somewhat the contrast between the two spin responses. We compare the calculated transverse response with the experimental one extracted from deep inelastic electron scattering

  9. Japan [National and regional programmes on the production of hydrogen using nuclear energy

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-03-15

    Japan has shown tremendous economic growth in the post-war period and is now one of the world's leading industrial countries. Japan has virtually no domestic oil or natural gas reserves and is the second-largest net importer of crude oil and largest net importer of liquefied natural gas in the world. Including nuclear power, Japan is only 16% energy self-sufficient (neglecting uranium imports). Japan's total primary energy demand in 2007 was 514 Mtoe. Oil is the most consumed energy resource in Japan (45% as of 2007), although its share of total energy consumption has strongly declined from 57% in 1990. Coal, with 22% (versus 17% in 1990), continues to account for a significant share of total energy consumption, although 99% of the coal must be imported. Natural gas (16%) and nuclear power (13%) are increasingly important sources. Total electricity production in Japan amounted to 1123 TW.h in 2007, with the largest share of 35% (up from 20% in 1990) from natural gas. The share of nuclear power is 32%, followed by coal (28%), oil (19%), hydro (9%) and other renewables (3%).

  10. Nuclear source of district heating in the north-east region of Russia

    International Nuclear Information System (INIS)

    Dolgov, V.V.

    1998-01-01

    The operation of the Bilibin Nuclear Co-generation Plant (BNCP) as a local district heating source is reviewed in this paper. Specific features of the BNCP power unit are given with special emphases on the components of the technological scheme, which are involved in the heat production and supply to the consumers. The scheme of steam extraction from the turbine, the flow diagram of steam in the turbine, as well as the three circuit heat removal system are described. The numerical characteristics of the nuclear heat supply system in various operating modes are presented. The real information characterizing current radiological conditions in the vicinity of the heat generation and distribution equipment is also presented in the paper. The BNCP technical and economical characteristics are compared with those of conventional energy sources. Both advantages and some problems revealed during the twenty-year experience of the BNCP nuclear heat utilization are generally assessed. Safety and reliability characteristics of the reactor and the heat supply system are also described. (author)

  11. An overview of the RCA/IAEA activities in the Australasian region using nuclear analysis techniques for monitoring air pollution

    International Nuclear Information System (INIS)

    Markwitz, Andreas

    2005-01-01

    The International Atomic Energy Agency (IAEA) via the Regional Co-operative Agreement (RCA) has identified air particulate matter pollution as a major transboundary environmental issue in the Australasian region. Sixteen countries in the region spanning from Pakistan to the Philippines and from China to New Zealand are participating in the regional programme RAS/7/013-Improved information of urban air quality management in the RCA region' that started in 1997. New Zealand is the lead-country for this programme in which nuclear analytical techniques, such as particle induced X-ray emission (PIXE), neutron activation analysis (NAA) and X-ray fluorescence spectrometry (XRF) are used to measure key elements in PM 2.5-0 and PM 10-2.5 filters from GENT stacked samplers collected twice weekly. Major sources of air particulate matter pollution are identified using statistical source apportionment techniques. To identify transboundary air particulate matter pollution events, the data is collated in a large database. Additionally, the data is used by end-users of the participating countries in the programme. An overview is presented. (author)

  12. Radiation heat transfer calculations for the uranium fuel-containment region of the nuclear light bulb engine.

    Science.gov (United States)

    Rodgers, R. J.; Latham, T. S.; Krascella, N. L.

    1971-01-01

    Calculation results are reviewed of the radiant heat transfer characteristics in the fuel and buffer gas regions of a nuclear light bulb engine based on the transfer of energy by thermal radiation from gaseous uranium fuel in a neon vortex, through an internally cooled transparent wall, to seeded hydrogen propellant. The results indicate that the fraction of UV energy incident on the transparent walls increases with increasing power level. For the reference engine power level of 4600 megw, it is necessary to employ space radiators to reject the UV radiated energy absorbed by the transparent walls. This UV energy can be blocked by employing nitric oxide and oxygen seed gases in the fuel and buffer gas regions. However, this results in increased UV absorption in the buffer gas which also requires space radiators to reject the heat load.

  13. Energy coupling of nuclear bursts in and above the ocean surface: source region calculations and experimental validation

    International Nuclear Information System (INIS)

    Clarke, D.B.; Harben, P.E.; Rock, D.W.; White, J.W.; Piacsek, A.

    1997-01-01

    In support of the Comprehensive Test Ban, research is under way on the long range propagation of signals from nuclear explosions in deep underwater sound (SOFAR) channel. Initially our work at LLNL on signals in the source region considered explosions in or above deep ocean. We studied the variation of wave properties and source region energy coupling as a function of height or depth of burst. Initial calculations on the CALE hydrodynamics code were linked at a few hundred milliseconds to a version of NRL's weak code, NPE, which solves the nonlinear progressive wave equation. The simulation of the wave propagation was carried down to 5000 m depth and out to 10,000 m range. We have completed ten such simulations at a variety of heights and depths below the ocean surface

  14. Geologic studies on the Rio Una region (Iguape - Sao Paulo County), Brazil, for the construction of nuclear power plants

    International Nuclear Information System (INIS)

    Hassano, S.; Mueller, M.; Stein, J.H.

    1984-01-01

    The main objective of the project was the geological and seismological characterization of 230 Km 2 along the coastal region between the Barro Branco and Jureia massifs in order to pinpoint one or more local areas showing adequate geological, morphological and geotechnical conditions suitable for construction of nuclear power plants. Results of the investigations, as well as the methodology used for determination of main interesting areas are presented. The best areas for construction are believed to be situated along the coast where Precambrian basement rocks crop out close to the shoreline. The Tertiary-Quaternary sedimentary cover reaches a thickness of 50 or more meters and the character of the sediments does not allow direct emplacement of foundations for heavy-weight constructions. Historical analysis of seismic activity of the region, as well as the study of faults and fracture zones identified in the area demonstrate the absence of active faults such as defined by internationally accepted safety criteria. (Author) [pt

  15. Working group 4a: Regional aspects. Nuclear power plants siting in the dutch speaking part of the country

    International Nuclear Information System (INIS)

    Willems, M.; Medart, R.; Vanneste, O.

    1976-01-01

    The problems due to nuclear plant siting in the northern region of Belgium are reviewed with an emphasis on economical, environmental and esthetical aspects. Three types of sitings were analysed: inland, coastal and off-shore. For the in-land siting, Doel, where already two units are in operation (780 MWe) and a third in construction (900 MWe), is supposed to be able to receive a fourth unit of 1000 MWe. The coastal siting is practically impossible for two reasons: the lack of cooling water when a coastal inland region of 5 km is considered and the strong density of tourists on the 66 km coast. For artificial island siting the different aspects are considered: type of soil, marine environment, construction factors, security, construction time, costs, etc. A comparative study for 9 off-shore sites is presented. (A.F.)

  16. Understanding of the characteristics of the local newspapers providing media coverage on the matters of nuclear energy in the regions where nuclear facilities are located. Based on analysis of the media reports and interviews with journalists

    International Nuclear Information System (INIS)

    Tsuchida, Tatsuro; Kimura, Hiroshi

    2011-01-01

    Taking into consideration the influence of the media coverage, this research aims to analyze the characteristics of the local newspapers that cover diverse events relevant to nuclear energy in regional areas where nuclear facilities are located (hereinafter called the 'region'). According to the previous surveys, local residents in the region are more interested in the nuclear energy matters than those who live in urban areas. Plus, the local newspapers turn out to report more events of nuclear energy from a variety of angles. Through interviews with executives and journalists of the local newspaper companies in the regions, it is revealed that the local newspapers tend not to report news sensationally, but they would rather take a supportive stance toward the development in their regions. The interviewees hope that various activities of the nuclear industry will promote education, employment and cooperation among government, industry and academia. They also desire that the industry's activities will help to increase benefits in their regions. It appears that the interviewees' awareness reflects articles of the local newspapers. As a result of the surveys conducted for this research, it is considered that the journalists expect that their region will make particularly qualitative progress in the future. (author)

  17. Problems of radio-nuclear risks and radioecological safety, caused by migration and contamination of seas and Arctic Ocean waters in Northern regions

    International Nuclear Information System (INIS)

    Koupri, K.

    1997-01-01

    Northern Russian radio-ecological and nuclear risks are connected with several objective factors: disposal, exploitation, supplying of the cycle of atomic military and ice-breaking fleets; disposal of enterprises and bases for maintenance of ships with nuclear-power installations (NPI) in Murmansk and Archangel regions; place the State Atomic Shipbuilding Center (RSASBC) enterprises in Archangel and partly in Murmansk regions; exploitation of the Kola Atomic Station (APS); functioning of the Novaya Zemlya archipelago nuclear range; functioning Russian Plesetsk cosmo-drome. Technical proposals and projects for radio-ecology in the North are outlined. (R.P.)

  18. The N-terminal region of eukaryotic translation initiation factor 5A signals to nuclear localization of the protein

    International Nuclear Information System (INIS)

    Parreiras-e-Silva, Lucas T.; Gomes, Marcelo D.; Oliveira, Eduardo B.; Costa-Neto, Claudio M.

    2007-01-01

    The eukaryotic translation initiation factor 5A (eIF5A) is a ubiquitous protein of eukaryotic and archaeal organisms which undergoes hypusination, a unique post-translational modification. We have generated a polyclonal antibody against murine eIF5A, which in immunocytochemical assays in B16-F10 cells revealed that the endogenous protein is preferentially localized to the nuclear region. We therefore analyzed possible structural features present in eIF5A proteins that could be responsible for that characteristic. Multiple sequence alignment analysis of eIF5A proteins from different eukaryotic and archaeal organisms showed that the former sequences have an extended N-terminal segment. We have then performed in silico prediction analyses and constructed different truncated forms of murine eIF5A to verify any possible role that the N-terminal extension might have in determining the subcellular localization of the eIF5A in eukaryotic organisms. Our results indicate that the N-terminal extension of the eukaryotic eIF5A contributes in signaling this protein to nuclear localization, despite of bearing no structural similarity with classical nuclear localization signals

  19. Regional energy-environment system analysis and the role of low-temperature nuclear heat in North China

    International Nuclear Information System (INIS)

    Lu Yingyun

    1984-01-01

    The consumption of commercial energy in China in 1980 amounted to 603 million tonnes of coal equivalent (tce). By the end of this century, according to preliminary forecasting, it will reach some 1200 million tce at least, but there may still be some gaps in the energy supply. Within the structure of China's current energy supply, coal is the dominating fuel, most of which is burned directly, thus causing serious air pollution particularly in urban areas during the winter season. To take into consideration the environmental impacts in formulating appropriate energy policies and carrying out rational energy planning, a practical regional energy system model in connection with environment impacts has been developed. It is essentially a linear programme model. The model has already been used to evaluate the role of alternative energies and technologies including the nuclear option in North China's future urban energy system. The preliminary results thus obtained have shown that nuclear energy, particularly low-temperature nuclear heat, must be introduced to reduce air pollution and fill the gaps in the energy supply. Since small- or medium-sized heat-only reactors have already been reported to be economical, safe and non-polluting, that will be developed in urban areas in North China to a certain extent by the end of this century. (author)

  20. Relationship of Genetics and Cs-137 in Asian Green Mussel (Perna viridis from Nuclear Activities in Asia-Pacific Region

    Directory of Open Access Journals (Sweden)

    Wanwiwa Tumnoi

    2017-03-01

    Full Text Available This study focuses on the relationship of genetics and Cs-137 radiation doses in Asian green mussel (Perna viridis collected from Chonburi province, Thailand. They might accumulate the radiocaesium from the nuclear power plants in the Asia-Pacific region including the Fukushima-Daiichi nuclear power plant via their routine or accidental releases. The radiation doses, estimated using ERICA Tool in the bivalves categorized into 3 different size classes including 4-6, 6-8, and 8-10 cm, were below 0.02 nGy/h. In parallel, Micronucleus test and Comet assay were used to investigate genetic responses in the mussels. They revealed minimum micronucleus frequency (MNF and %Tail DNA varying from 1.80-2.90% and 1.36-1.70%, respectively. The result indicates that neither particular accumulation of Cs-137 nor genetic responses among different size classes of the animals were observed. Furthermore, the radiation doses in the mussels were below the dose limit of 10 µGy/h. Therefore, no radiation effect caused by Cs-137 was found and it was also confirmed by minimal genetic damages. Data obtained can be used as site-specific data for radiological dose and impact assessment and as baseline data to establish the national radiation safety levels to protect Thai marine biota from any possible future nuclear accidents.

  1. Radiotherapy and Nuclear Medicine Project for an Integral Oncology Center at the Oaxaca High Specialization Regional Hospital

    International Nuclear Information System (INIS)

    De Jesus, M.; Trujillo-Zamudio, F. E.

    2010-01-01

    A building project of Radiotherapy and Nuclear Medicine services (diagnostic and therapy), within an Integral Oncology Center (IOC), requires interdisciplinary participation of architects, biomedical engineers, radiation oncologists and medical physicists. This report focus on the medical physicist role in designing, building and commissioning stages, for the final clinical use of an IOC at the Oaxaca High Specialization Regional Hospital (HRAEO). As a first step, during design stage, the medical physicist participates in discussions about radiation safety and regulatory requirements for the National Regulatory Agency (called CNSNS in Mexico). Medical physicists propose solutions to clinical needs and take decisions about installing medical equipment, in order to fulfill technical and medical requirements. As a second step, during the construction stage, medical physicists keep an eye on building materials and structural specifications. Meanwhile, regulatory documentation must be sent to CNSNS. This documentation compiles information about medical equipment, radioactivity facility, radiation workers and nuclear material data, in order to obtain the license for the linear accelerator, brachytherapy and nuclear medicine facilities. As a final step, after equipment installation, the commissioning stage takes place. As the conclusion, we show that medical physicists are essentials in order to fulfill with Mexican regulatory requirements in medical facilities.

  2. A registry for exposure and population health in the Altai region affected by fallout from the Semipalatinsk nuclear test site.

    Science.gov (United States)

    Shoikhet, Y N; Kiselev, V I; Zaitsev, E V; Kolyado, I B; Konovalov, B Y; Bauer, S; Grosche, B; Burkart, W

    1999-09-01

    A registry of the rural population in the Altai region exposed to fallout from nuclear tests at the Semipalatinsk test site (STS) was established more than four decades after the first Soviet nuclear explosion on August 29, 1949. Information about individuals living in an exposed and a control area was collected using all available local sources, such as kolkhoz documentation, school registries, medical treatment records and interviews with residents. As a result, a database comprising an exposed group of 39 179 individuals from 53 Altai region villages, 6769 external and 3303 internal controls was compiled. For several settlements, effective dose estimates reached the level of 1.5 Sv, while the average effective dose estimate in the exposed group was 340 mSv. Dosimetric data, vital status information and health records gathered at rayon and village medical facilities are held in the registry. Cause-of-death information for deceased residents is obtained from death registration forms archived at the Altai region vital statistics office. At present, a follow-up of approximately 40% of the population exposed in 1949 has been done. More will be added by searching for migrants to the larger towns of the Altai region, i.e. Barnaul, Rubtsovsk and Biisk. In order to assess the influence of radiation exposure, analytical studies with a case-control design for stomach and lung cancer are currently being prepared. The number of known cases is sufficient to detect an odds ratio of 1.5 at the 95% confidence level. Epidemiological studies in populations affected by fallout from STS may be equally important to the atomic bomb survivors' study for the direct quantification of radiation effects. The range of exposure rates experienced will extend the acute high-dose-rate findings from Hiroshima/Nagasaki towards acute and protracted lower exposures, which are more relevant for radiation protection issues.

  3. A registry for exposure and population health in the Altai region affected by fallout from the Semipalatinsk nuclear test site

    International Nuclear Information System (INIS)

    Shoikhet, Ya.N.; Kiselev, V.I.; Zaitsev, E.V.; Kolyado, I.B.; Konovalov, B.Yu.; Bauer, S.; Grosche, B.; Burkart, W.

    1999-01-01

    A registry of the rural population in the Altai region exposed to fallout from nuclear tests at the Semipalatinsk test site (STS) was established more than four decades after the first Soviet nuclear explosion on August 29, 1949. Information about individuals living in an exposed and a control area was collected using all available local sources, such as kolkhoz documentation, school registries, medical treatment records and interviews with residents. As a result, a database comprising an exposed group of 39 179 individuals from 53 Altai region villages, 6769 external and 3303 internal controls was compiled. For several settlements, effective dose estimates reached the level of 1.5 Sv, while the average effective dose estimate in the exposed group was 340 mSv. Dosimetric data, vital status information and health records gathered at rayon and village medical facilities are held in the registry. Cause-of-death information for deceased residents is obtained from death registration forms archived at the Altai region vital statistics office. At present, a follow-up of approximately 40% of the population exposed in 1949 has been done. More will be added by searching for migrants to the larger towns of the Altai region, i.e. Barnaul, Rubtsovsk and Biisk. In order to assess the influence of radiation exposure, analytical studies with a case-control design for stomach and lung cancer are currently being prepared. The number of known cases is sufficient to detect an odds ratio of 1.5 at the 95% confidence level. Epidemiological studies in populations affected by fallout from STS may be equally important to the atomic bomb survivors' study for the direct quantification of radiation effects. The range of exposure rates experienced will extend the acute high-dose-rate findings from Hiroshima/Nagasaki towards acute and protracted lower exposures, which are more relevant for radiation protection issues. (orig.)

  4. Regional technical cooperation model project, IAEA - RER/2/2004 ''quality control and quality assurance for nuclear analytical techniques'

    International Nuclear Information System (INIS)

    Arikan, P.

    2002-01-01

    An analytical laboratory should produce high quality analytical data through the use of analytical measurements that is accurate, reliable and adequate for the intended purpose. This objective can be accomplished in a cost-effective manner under a planned and documented quality system of activities. It is well-known that serious deficiencies can occur in laboratory operations when insufficient attention is given to the quality of the work. It requires not only a thorough knowledge of the laboratory's purpose and operation, but also the dedication of the management and operating staff to standards of excellence. Laboratories employing nuclear and nuclear-related analytical techniques are sometimes confronted with performance problems which prevent them from becoming accepted and respected by clients, such as industry, government and regulatory bodies, and from being eligible for contracts. The International Standard ISO 17025 has been produced as the result of extensive experience in the implementation of ISO/IEC Guide 25:1990 and EN 45001:1989, which replaces both of them now. It contains all of the requirements that testing and calibration laboratories must meet if they wish to demonstrate that they operate a quality system that is technically competent, and are able to generate technically valid results. The use of ISO 17025 should facilitate cooperation between laboratories and other bodies to assist in the exchange of information and experience, and in the harmonization of standards and procedures. IAEA model project RER/2/004 entitled 'Quality Assurance/Quality Control in Nuclear Analytical Techniques' was initiated in 1999 as a Regional TC project in East European countries to assist Member State laboratories in the region to install a complete quality system according to the ISO/IEC 17025 standard. 12 laboratories from 11 countries plus the Agency's Laboratories in Seibersdorf have been selected as participants to undergo exercises and training with the

  5. Development of regional atmospheric dynamic and air pollution models for nuclear emergency response system WSPEEDI

    International Nuclear Information System (INIS)

    Furuno, Akiko; Yamazawa, Hiromi; Lee, Soon-Hwan; Tsujita, Yuichi; Takemiya, Hiroshi; Chino, Masamichi

    2000-01-01

    WSPEEDI (Worldwide version of System for Prediction of Environmental Emergency Dose Information) is a computer-based emergency response system to predict long-range atmospheric dispersion of radionuclides discharged into the atmosphere due to a nuclear accident. WSPEEDI has been applied to several international exercises and real events. Through such experiences, the new version of WSPEEDI aims to employ a combination of an atmospheric dynamic model and a particle random walk model for more accurate predictions. This paper describes these models, improvement of prediction and computational techniques for quick responses. (author)

  6. Nuclear DNA content in 20 species of Siluriformes (Teleostei: Ostariophysi from the Neotropical region

    Directory of Open Access Journals (Sweden)

    Paulo César Fenerich

    2004-01-01

    Full Text Available In the present study, 20 species of Siluriformes fish were analyzed in order to determine their nuclear DNA content and compare these data with their diploid number. In addition, the extension and importance of the changes that occurred during the process of diversification in the group of Neotropical freshwater catfish were investigated. The only species studied of the family Doradidae, Rhinodoras d'orbignyi (2n = 58, presented 3.46 ± 0.13 pg of DNA. Among the species of the family Heptapteridae, the values of nuclear DNA content and the diploid numbers ranged from 1.13 ± 0.09 pg of DNA in Pimelodella sp. (2n = 46 to 2.38 ± 0.07 pg of DNA in Imparfinis mirini (2n = 58. The family Loricariidae showed the widest variation in diploid number and nuclear DNA content values, ranging from 2n = 52 and 3.96 ± 0.22 pg of DNA in Liposarcus anisitsi to 2n = 76 and 4.90 ± 0.12 pg of DNA in Hypostomus sp. 4. In this group, two local samples of Pimelodus maculatus (Pimelodidae were analyzed, and both exhibited 2n = 56, but different nuclear DNA content values (2.68 ± 0.22 pg and 2.82 ± 0.20 pg, respectively. Among the Pseudopimelodidae species analyzed, Pseudopimelodus mangurus (2n = 54 showed 2.23 ± 0.15 pg and Microglanis cottoides (2n = 54 exhibited 2.50 ± 0.18 pg of DNA. Two species of Trichomycterus (Trichomycteridae also presented the same diploid number, 2n = 54 chromosomes, but, while the species from the Quinta stream presented a DNA content of 2.62 ± 0.19 pg, in the sample from the Capivara river this value was 2.30 ± 0.23 pg. In the analyzed species, the results showed that the changes in DNA content were frequently not followed by changes in the diploid number. This fact permits to suggest that, in addition to structural chromosome rearrangements, other mechanisms, including deletions, duplications and polyploidy, could be involved in the process of species differentiation in the representatives of the fish order Siluriformes.

  7. Meteorological and engineering approach to the regionalization of tornado wind criteria for nuclear power plant design

    International Nuclear Information System (INIS)

    1975-01-01

    Data on general meteorological factors governing tornado frequency and intensity in various locations throughout the USA are revised. A climatological model of multiple outbreak and long track tornadoes and the relation between the speed of a hurricane and the frequency of tornado occurrence over land and sea are discussed. Data from a structural engineering assessment of tornado damage are summarized and applications of the data for the development of design criteria for buildings and nuclear power plants to minimize tornado damage are suggested. It was concluded that it is very difficult to predict tornado risk and alternate methods and areas of study are presented for consideration

  8. Photon nuclear scattering on lead and bismuth in the region of the giant resonance

    International Nuclear Information System (INIS)

    Tamas, Gabriel.

    1976-01-01

    The results of monochromatic photon nuclear scattering studies on natural lead and bismuth targets are presented. The cross sections for the inelastic scattering leading to the first excited levels of 204 Pb, 206 Pb and 207 Pb are important, in agreement with theoretical predictions. The elastic scattering amplitude is related to the total photon absorption by dispersion relations. It is then possible to determine the spin of resonances excited by the reaction studied. Precise measurements carried out between 14 and 20MeV revealed that the angular distribution cannot be explained by a single dipolar resonance. A quadrupolar resonance at E 2 =14MeV must be introduced [fr

  9. A changing world: Using nuclear techniques to investigate the impact of climate change on polar and mountainous regions

    International Nuclear Information System (INIS)

    Henriques, Sasha

    2015-01-01

    Nuclear techniques are being used in polar and mountainous regions to study climate change and its impact on the quality of land, water and ecosystems in order to better conserve and manage these resources. Researchers from around the world will be using data from 13 benchmark sites to draw conclusions about the effects of the rapidly changing climate on the Arctic, mountains and the western part of Antarctica, which have alarmed communities, environmentalists, scientists and policy makers. Between July 2015 and July 2016 they will be using isotopic and nuclear techniques, as well as geochemical and biological analytical methods from other scientific disciplines. This will enable them to track soil and water, to monitor the movement of soil and sediment and to assess the effects of melting permafrost on the atmosphere, as well as on the land, water and fragile ecosystems of mountainous and polar regions. The measurements follow numerous on-site tests carried out since November 2014 to perfect the sampling technique.

  10. Estimation of the Altai region population exposure resulting from the nuclear tests at the Semipalatinsk test site

    International Nuclear Information System (INIS)

    Djachenko, V.I.; Gabbasov, M.N.; Laborev, V.M.; Markovtsev, A.S.; Sudakov, V.V.; Volobuyev, N.M.; Zelenov, V.I.; Lagutin, A.A.; Shoikher, J.N.

    1998-01-01

    The historical roots of reconstruction of doses received by populations from nuclear tests date back to the 60''s, when the world faced a problem of growing radioactive contamination by radioactive fallout resulting from atmospheric nuclear tests. Since then, only one aspect of this problem has been properly developed, namely: public-exposure doses resulting from the global radioactive fallout have been estimated. Local fallout, which occurred mainly in the territories of the test sites and regions adjacent to their boundaries, was considered and studied as an internal affair of the states. The first steps in creating the above-mentioned methodological basis were taken in Russia, where, by now, the methodology of dose estimation in regions of local radioactive fallout has been determined and acknowledged nationwide as a standard document (Federal Committee on Sanitay Epidemiological Control of RF, 1994). It was this methodology that was used for calculations and dose estimation of the exposure of the Altai population from the Semipalatinsk Test Site (STS). (orig./GL)

  11. Technical cooperation for the pacific uses of nuclear technology in Latin America and Caribbean: the experience of regional agreement ARCAL

    International Nuclear Information System (INIS)

    Rondinelli Junior, Francisco

    2017-01-01

    This thesis studies the international technical cooperation in the field of peaceful applications of the nuclear technology, focusing on the experience of Latin American countries, where the Cooperation Agreement for the Promotion of Nuclear Science and Technology in Latin America and the Caribbean, also known as ARCAL, is in force. The study adopts as theoretical approach the concept of state capacities, particularly with regard to the institutional capacities applicable to the ARCAL Agreement. Within this approach, three dimensions of analysis are adopted: the institutional dimension, the governance dimension and the focus on outcomes. The evaluation of the ARCAL Agreement is carried out in order to confirm if the intended role to promote regional technical cooperation in the nuclear sector is being implemented. The methodological approach adopted the case study model. It starts with the analysis of the institutional evolution of the Agreement, and identifies variables articulating with the three dimensions above mentioned. The empirical data were collected in two stages. In the first stage it were performed 29 interviews carried out by the author with the technical and staff members of the Department of Technical Cooperation of IAEA, in Vienna, Austria, headquarter of IAEA. The other stage involved an electronic questionnaire submitted to the national coordinator of ARCAL in 14 countries, in a universe of 21 member states. The conclusion of the research points to the fact that the ARCAL Agreement has incorporated, throughout its trajectory, elements of the institutional capacities which are still in the process of development. They give to the Agreement the potential to induce the development of the state capacities of the respective countries in the field of peaceful applications of nuclear technology. (author)

  12. Canada [National and regional programmes on the production of hydrogen using nuclear energy

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-03-15

    Canada has considerable natural resources and is one of the world's largest producers (ranking 5th) and exporters of energy. Since 1980, Canada's total energy production has almost doubled, reaching 486 Mtoe in 2006, while its total energy consumption has increased by only 44%. Almost all of Canada's energy exports go to the USA. In 2006, the largest source of energy consumption in Canada was oil (32%), followed by hydroelectricity (25%) and natural gas (24%). Both coal (10%) and nuclear (7%) constitute a smaller share of the country's overall energy mix. Electricity production in Canada has been dominated by hydroelectricity, with nuclear and fossil fuels holding a 15-25% share each over the past two decades. Canada has the second-largest petroleum deposits in the world (after Saudi Arabia). Its oil sands produce 1.3 million bbl/d of oil today, up from 600 000 bbl/d in 2000. But the development of oil sands projects has been sharply criticized for its impact on the environment and its intensive use of both water and natural gas. The growth in oil sands exploitation is one of the reasons that Canada has failed to contain its GHG emissions in recent years despite its commitment to do so.

  13. The health status of population in the regions boarding to Semipalatinsk nuclear test site

    International Nuclear Information System (INIS)

    Balmukhanov, S.B.; Raisova, G.K.; Balmukhanov, T.S.; Voronin, A.M.; Sandybaev, M.N.

    2002-01-01

    It is performed the detailed investigation the health status of Semipalatinsk region population affected by constant radioactive irradiation during 40 years. The special attention attached to such pathologies as cancer, congenial defects of development and pathologies of cardio-vascular and nervous systems. It is also characterized the children health status. (author)

  14. The socio-economic monitoring of the Ignalina Nuclear Power Plant region: methodology, programme, implementation

    International Nuclear Information System (INIS)

    Baubinas, R.; Burneika, D.; Daugirdas, V.

    2002-01-01

    The article is devoted to the argumentation of the main principles of socio-economic monitoring of the Ignalina NPP region. The programme and the territorial levels of the monitoring as well as the main results of the trial of the programme are presented. (author)

  15. Nuclear

    International Nuclear Information System (INIS)

    Anon.

    2000-01-01

    The first text deals with a new circular concerning the collect of the medicine radioactive wastes, containing radium. This campaign wants to incite people to let go their radioactive wastes (needles, tubes) in order to suppress any danger. The second text presents a decree of the 31 december 1999, relative to the limitations of noise and external risks resulting from the nuclear facilities exploitation: noise, atmospheric pollution, water pollution, wastes management and fire prevention. (A.L.B.)

  16. European Union [National and regional programmes on the production of hydrogen using nuclear energy

    International Nuclear Information System (INIS)

    2013-01-01

    The European Union comprises highly industrialized countries with extended urban agglomerations, and therefore needs to rely on a secure and economically competitive supply of energy. As of 2007 the European Union, with 7.5% (or 496 million) of the world population, consumed 15% (1757 Mtoe) of the total energy and 18% (3325 TW-h) of the total electricity, and was responsible for 14% (4100 million t) of the total CO 2 emissions. Primary energy by fuel share is 19% coal (down from 28% in 1990), 35% oil, 25% natural gas, 14% nuclear and 8% renewables. The respective electricity shares are 31% coal, 28% nuclear, 22% natural gas, 9% hydro, 6% other renewables and 3% oil. The production of oil and natural gas in the European Union has been decreasing for a few years. The situation in the European Union as projected for the next 30 years is characterized by a growing demand for energy by 2 %/a and, at the same time (after 2010), decreasing domestic energy production. In 2030, if no additional measures are taken, 70% of the energy demand will have to be covered by imports. In addition, this development will push CO 2 emissions up 14% compared to the 1990 level, far off the Kyoto commitment of an 8% reduction. For these reasons, all energy options should be left open for the future. In 2007, principal energy and climate policy targets for the European Union were redefined by the European Council (the decision making organ of the European Union) to be attained by the year 2020, which are characterized by the 'three twenties': - A 20% reduction of GHGs compared to the 1990 level; - A 20% share of renewable energies of end use (compared to 8.5% at present); - A 20% efficiency of energy use.

  17. European Union [National and regional programmes on the production of hydrogen using nuclear energy

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-03-15

    The European Union comprises highly industrialized countries with extended urban agglomerations, and therefore needs to rely on a secure and economically competitive supply of energy. As of 2007 the European Union, with 7.5% (or 496 million) of the world population, consumed 15% (1757 Mtoe) of the total energy and 18% (3325 TW-h) of the total electricity, and was responsible for 14% (4100 million t) of the total CO{sub 2} emissions. Primary energy by fuel share is 19% coal (down from 28% in 1990), 35% oil, 25% natural gas, 14% nuclear and 8% renewables. The respective electricity shares are 31% coal, 28% nuclear, 22% natural gas, 9% hydro, 6% other renewables and 3% oil. The production of oil and natural gas in the European Union has been decreasing for a few years. The situation in the European Union as projected for the next 30 years is characterized by a growing demand for energy by 2 %/a and, at the same time (after 2010), decreasing domestic energy production. In 2030, if no additional measures are taken, 70% of the energy demand will have to be covered by imports. In addition, this development will push CO{sub 2} emissions up 14% compared to the 1990 level, far off the Kyoto commitment of an 8% reduction. For these reasons, all energy options should be left open for the future. In 2007, principal energy and climate policy targets for the European Union were redefined by the European Council (the decision making organ of the European Union) to be attained by the year 2020, which are characterized by the 'three twenties': - A 20% reduction of GHGs compared to the 1990 level; - A 20% share of renewable energies of end use (compared to 8.5% at present); - A 20% efficiency of energy use.

  18. Estimation of environmental situation in Tashkent region using nuclear-physical methods

    International Nuclear Information System (INIS)

    Danilova, E.A.; Kist, A.A.; Mukhina, A.V.; Osinskaya, N.S.; Khusniddinova, S.Kh.; Zaredinov, D.A.; Ten, O.L.

    2012-01-01

    Task of the present study is elaboration of strategy and methodology for creation of the ecological portrait of the Tashkent region. For estimation of everage values of contamination of surface waters, soils etc., the neutron activation analysis has been used due to its advantages, especially of multi- element s determination, high sensitivity, and independence of the types of studied samples. Multielemental analysis of samples of atmospheric air, soils, drinking water, and human hair as the indicators of the body elemental status allows us to estimate the environmental ecological situation in the Tashkent region, to detect districts with the higher concentration of elements, to make maps of distribution and to compare with medical statistics of diseases. (authors)

  19. Calculations for nuclear data evaluation for Nb, Zr and W in the high energy region

    Energy Technology Data Exchange (ETDEWEB)

    Kitsuki, Hirohiko; Maruyama, Shin-ichi; Ishibashi, Kenji [Kyushu Univ., Fukuoka (Japan)

    1998-03-01

    Neutron total cross sections on Nb, Zr and W were calculated in the high energy region. In this calculation, we used the neutron optical-model potentials derived from those for proton incidence with introducing the symmetry term. Proton-induced activation yields for Nb and Zr was calculated by means of HETC/KFA2 and QMD plus SDM at incident energies up to 5 GeV. (author)

  20. Radiation workers of nuclear power stations and a method of regional economic development

    International Nuclear Information System (INIS)

    Nakagawa, Haruo

    2003-01-01

    In Japan, most of the electric power companies depend on radiation works to the external labor, but the employment of radiation works lacks its' stability. From the analysis on the mobility of radiation workers, we can see the stability of employment increases in proportion to the number of reactors. The radiation work is legally classified to harmful in Japan. And many health control systems for radiation workers are applied strictly. If we apply the health records registration system to the health control systems and involve them to the regional health care system, we can get more effective plan for regional economic development. It is therefore, very important to strive for employee controls, radiation controls, health examinations and data control. Furthermore, it is necessary to establish a total data management system that processes numerous amounts of data concerning radiation employees. This paper proposes the need for such a registration system to set up the system within regional medical information systems, and proposes the establishment of a radiation work market on the web using a total data management system. The system will include radiation employee control information service for members who are planning new employment contracts. (author)

  1. Taxonomy and phylogeny of the genus citrus based on the nuclear ribosomal dna its region sequence

    International Nuclear Information System (INIS)

    Sun, Y.L.

    2015-01-01

    The genus Citrus (Aurantioideae, Rutaceae) is the sole source of the citrus fruits of commerce showing high economic values. In this study, the taxonomy and phylogeny of Citrus species is evaluated using sequence analysis of the ITS region of nrDNA. This study is based on 26 plants materials belonging to 22 Citrus species having wild, domesticated, and cultivated species. Through DNA alignment of the ITS sequence, ITS1 and ITS2 regions showed relatively high variations of sequence length and nucleotide among these Citrus species. According to previous six-tribe discrimination theory by Swingle and Reece, the grouping in our ITS phylogenetic tree reconstructed by ITS sequences was not related to tribe discrimination but species discrimination. However, the molecular analysis could provide more information on citrus taxonomy. Combined with ITS sequences of other subgenera in then true citrus fruit tree group, the ITS phylogenetic tree indicated subgenera Citrus was monophyletic and nearer to Fortunella, Poncirus, and Clymenia compared to Microcitrus and Eremocitrus. Abundant sequence variations of the ITS region shown in this study would help species identification and tribe differentiation of the genus Citrus. (author)

  2. Progress in study of Prespa Lake using nuclear and related techniques (IAEA Regional Project RER/8/008)

    International Nuclear Information System (INIS)

    Anovski, Todor

    2001-09-01

    One of the main objective of the IAEA - Regional project RER/8/008 entitled Study of Prespa Lake Using Nuclear and Related Techniques was to provide a scientific basis for sustainable and environmental management of the Lake Prespa (Three lakes: Ohrid, Big Prespa and Small Prespa are on the borders between Albania, Republic of Macedonia and Greece, and are separated by the Mali i Thate and Galichica, mostly Carstificated mountains), see Fig. 1. In this sense investigations connected with the hydrogeology, water quality (Physics-chemical, biological and radiological characteristics) and water balance determination by application of Environmental isotopes ( i.e. H,D,T,O-18,O-18 etc.,) distribution, artificial water tracers and other relevant analytical techniques such as: AAS, HPLC, Total α and β-activity, α and γ-spectrometry as well as ultra sonic measurements (defining of the Lake bottom profile) through regional cooperation / Scientists from Albania, Greece and Republic of Macedonia, participated in the implementation of the Project/ during one hydrological year, had been initiated and valuable results obtained, a part of which are presented in this report. This cooperation was the only way for providing necessary data for better understanding beside the other, of the water quality of the Prespa Lake and its hydrological relationship to Ohrid Lake too, representing a unique regional hydro system in the world. (Author)

  3. India [National and regional programmes on the production of hydrogen using nuclear energy

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-03-15

    India's energy consumption has been increasing at a rapid pace in recent years due to population growth and economic development. In terms of primary energy consumption, at 595 Mtoe in 2007, despite a low per capita energy consumption rate, India ranks fifth in the world, accounting for about 3.5% of the global commercial energy demand in 2003. Until the end of the 1980s, India's energy policy was mainly based on the availability of indigenous resources. Coal, oil and natural gas are the three primary commercial energy sources. India has the world's third largest coal reserves after the USA and China; still, the existing demand exceeds the supply. Coal accounts for 41% (as of 2007) of India's total energy consumption, followed by renewables including hydroelectric power (29%), oil (24%) and natural gas (6%). Although nuclear power comprises only 1% of total energy consumption, it is expected to increase in the future. A large share of the total energy requirement is met by non-commercial energy sources, which include wood, crop residue and animal waste. But commercial energy of a much higher quality and efficiency are steadily replacing the traditional energy resources being consumed mainly in the rural sector. Of India's total energy needs, 30% are met through imports.

  4. China [National and regional programmes on the production of hydrogen using nuclear energy

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-03-15

    Due to its large population and its strong economic growth in recent years, China's demand for energy is rising rapidly. Since 2003, China ranks second after the USA in the consumption of primary energy and also in the consumption of oil. China is the third largest energy producer in the world, after the USA and the Russian Federation. In 2007, China's total energy consumption was 1970 Mtoe, up from 872 Mtoe in 1990. In the period 2000-2007, the average growth rate of energy consumption was 8.9% per year. Coal makes up the bulk of China's primary energy consumption (66% in 2007) and will remain the dominant energy source in the next decades. Other energies consumed are oil (18%) and hydropower (12%). Natural gas production currently accounts for only 3%, with most reserves located far away from the demand sites. China is the largest producer and consumer of coal in the world, which has made the country one of the world's largest emitter of GHGs. The present energy policy calls for greater energy conservation measures and a move away from coal toward cleaner energy sources including oil, natural gas, renewable energy, nuclear power and hydroelectric resources. A new energy law calls for 10% of its energy to come from renewable energy sources by 2020. China has abundant cellulosic biomass resources, with an estimated 220-380 Mtoe available for bioenergy production (e.g. ethanol, synthetic liquid fuels) each year.

  5. Safety assurance in radioactive waste management at nuclear power plants of the Northwest region of Russia

    Energy Technology Data Exchange (ETDEWEB)

    Safonov, Igor

    1999-07-01

    This presentation describes the two large operating nuclear power plants (NPP) in Northwest Russia, the Kola NPP and the Leningrad NPP. The four units at Kola are tank-type pressurised water reactors of 440 MW (electric) while the four Leningrad reactors are 1000 MW (electric) of RBMK type. Gosatomnadzor of Russia regularly conducts so-called target inspections on safety assurance for radioactive waste management at NNP. Among the many items checked during such inspections are the existence and realisation of an action plan for waste reduction, the technical state of equipment and the compliance with previous directions. The management of liquid, solid and gaseous radioactive wastes is described in some detail, and so are the violations revealed at both sites. There is also some discussion of modernisation plans for waste management. It is stated that the ecological impact of the plants is negligible and there is no hazard to people or environment. The presentation concludes with some suggestions for improving the licensing requirements for waste management.

  6. Safety assurance in radioactive waste management at nuclear power plants of the Northwest region of Russia

    International Nuclear Information System (INIS)

    Safonov, Igor

    1999-01-01

    This presentation describes the two large operating nuclear power plants (NPP) in Northwest Russia, the Kola NPP and the Leningrad NPP. The four units at Kola are tank-type pressurised water reactors of 440 MW (electric) while the four Leningrad reactors are 1000 MW (electric) of RBMK type. Gosatomnadzor of Russia regularly conducts so-called target inspections on safety assurance for radioactive waste management at NNP. Among the many items checked during such inspections are the existence and realisation of an action plan for waste reduction, the technical state of equipment and the compliance with previous directions. The management of liquid, solid and gaseous radioactive wastes is described in some detail, and so are the violations revealed at both sites. There is also some discussion of modernisation plans for waste management. It is stated that the ecological impact of the plants is negligible and there is no hazard to people or environment. The presentation concludes with some suggestions for improving the licensing requirements for waste management

  7. Nuclear structure investigations of neutron deficient nuclei in the region Z=103 to 105

    International Nuclear Information System (INIS)

    Hessberger, F. P.; Hofmann, S.; Armbruster, P.; Muenzenberg, G.; Stodel, Ch.; Ackermann, D.; Lavrentev, A. Yu.; Popeko, A. G.; Yeremin, A. V.; Saro, S.; Leino, M.

    1999-01-01

    The isotopes 257,255 Rf, 257,256 Db, 253,252 Lr have been produced in bombardments of 207,208 Pb and 209 Bi target nuclei with 50 Ti and identified by their α-decay. New or improved decay data could be obtained. Analysis of the fine structure of the α-decay pattern of 257 Rf allowed the construction of a first tentative level scheme for the daughter nucleus 253 No and also the identification of a low lying high spin isomeric state, while from α-γ- coincidence measurements for 255 Rf a first tentative level scheme of the daughter nucleus 251 No was derived. For 257 Db we found that two nuclear levels decay by α-emission and populate also different levels in the daughter nucleus 253 Lr. The levels are produced by the reaction process. In bombardments of 209 Bi with 50 Ti at E CN *=26.4 MeV and 30.8 MeV the previously unknown isotopes 256 Db and 252 Lr were identified

  8. Contribution of International and Regional Networks in Developing and Maintaining Human Capacity Building for Nuclear Power Programmes

    International Nuclear Information System (INIS)

    Osman, O. E.

    2015-01-01

    Capacity is defined as; the ability of individuals and organizations or organizational units to perform functions effectively, efficiently and sustainably. Capacity building is an evidence-driven process of strengthening the abilities of individuals, organizations, and systems to perform core functions sustainably, and to continue to improve and develop over time. This article will explain the contributions of knowledge networks at the national, regional and international level in developing the existing capacity building and human resources for regulatory body in Sudan, to confront the future challenges regarding to nuclear power program- safety and security. The article will compare the advantages and effectiveness of these knowledge networks (IAEA, ANNuR, FNRBA) in capacity building and enhance the infrastructure of national regulatory body. And how these networks contribute to enable the regulatory bodies in Africa and Arab countries, to establish and strengthen their regulatory infrastructure for nuclear power programme consistent with international standards and recommendations. As well as the recommendations resulting and deduced from comparative study to promote the exchange of knowledge, experience and information among its members. (author)

  9. Nuclear data evaluation for 239Pu in the energy region 100 075. ev - 15 MeV

    International Nuclear Information System (INIS)

    Antsipov, G.V.; Bakhanovich, L.A.; Zharkov, V.F.

    1981-06-01

    The present work incorporates the results of the new nuclear data evaluation for 239 Pu. The complete file compiled by the authors in 1974 was practically completely re-examined. The most substantial changes were made above 0.5 keV. In the region of unresolved resonances (0.3-100 keV), the channel contribution to the process widths for a given state and some other aspects were taken into account. The fission cross section and the α-value were evaluated with regard for the correlation of experimental errors. The non-spherical potential with optimized parameters was used to make calculations by the optical and statistical models. The contribution of pre-equilibrium emission was taken into account in calculations of secondary neutron spectra. The new standard anti nusub(sp)( 252 Csub(f)) was used to calculate anti nusub(p). The 26-group constants and g-Westcott factors were obtained from the evaluated data. The complete file of the evaluated data for 239 Pu is presented in the ENDF/B format and conveyed to the Nuclear Data Section of the IAEA. (author)

  10. Estimating the size of the cavity and surrounding failed region for underground nuclear explosions from scaling rules

    Energy Technology Data Exchange (ETDEWEB)

    Rogers, Leo A [El Paso Natural Gas Company (United States)

    1970-05-01

    The fundamental physical principles involved in the formation of an underground cavity by a nuclear explosion and breakage of the rock surrounding the cavity are examined from the point of view of making preliminary estimates of their sizes where there is a limited understanding of the rock characteristics. Scaling equations for cavity formation based on adiabatic expansion are reviewed and further developed to include the strength of the material surrounding the shot point as well as the overburden above the shot point. The region of rock breakage or permanent distortion surround ing the explosion generated cavity is estimated using both the Von Mises and Coulomb-Mohr failure criteria. It is found that the ratio of the rock failure radius to the cavity radius for these two criteria becomes independent of yield and dependent only on the failure mechanics of the rock. The analytical solutions developed for the Coulomb-Mohr and Von Mises criteria are presented in graphical form. (author)

  11. Hydrogeological modelling of the eastern region of Areco river locally detailed on Atucha I and II nuclear power plants area

    International Nuclear Information System (INIS)

    Grattone, Natalia I.; Fuentes, Nestor O.

    2009-01-01

    Water flow behaviour of Pampeano aquifer was modeled using Visual Mod-flow software Package 2.8.1 with the assumption of a free aquifer, within the region of the Areco river and extending to the rivers of 'Canada Honda' and 'de la Cruz'. Steady state regime was simulated and grid refinement allows obtaining locally detailed calculation in the area of Atucha I and II Nuclear power plants, in order to compute unsteady situations as the consequence of water flow variations from and to the aquifer, enabling the model to study the movement of possible contaminant particles in the hydrogeologic system. In this work the effects of rivers action, the recharge conditions and the flow lines are analyzed, taking always into account the range of reliability of obtained results, considering the incidence of uncertainties introduced by data input system, the estimates and interpolation of parameters used. (author)

  12. A cosmic-ray nuclear event with an anomalously strong concentration of energy and particles in the central region

    International Nuclear Information System (INIS)

    Amato, N.M.; Arata, N.; Maldonado, R.H.C.

    1986-01-01

    A cosmic-ray induced nuclear event detected in the emulsion chamber is described. The event consists of 217 shower cores with ΣEγ = 1,275 TeV. In log scale, energy and particles are emitted most densely at the small lateral distance corresponding to 0.5 mm; 77 % of the total energy and 61 % of the total multiplicity are inside the radius of 0.65 cm. The shower cores in the central region show exponential-type energy distribution and non-isotropic azimuthal distribution. This event indicates a possibility that phenomena of large transverse momentum could happen to produce a strong concentration of energy and particles in the very forward direction. (Authors) [pt

  13. Molecular phylogeny of Acer monspessulanum L. subspecies from Iran inferred using the ITS region of nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    HANIF KHADEMI

    2016-04-01

    Full Text Available Abstract. Khademi H, Mehregan I, Assadi M, Nejadsatari T, Zarre S. 2015. Molecular phylogeny of Acer monspessulanum L. subspecies from Iran inferred using the ITS region of nuclear ribosomal DNA. Biodiversitas 17: 16-23. This study was carried out on the Acer monspessulanum complex growing wild in Iran. Internal transcribed spacer (ITS sequences for 75 samples representing five different subspecies of Acer monspessulanum were analyzed. Beside this, 86 previously published ITS sequences from GenBank were used to test the monophyly of the complex worldwide. Phylogenetic analyses were conducted using Bayesian inference and maximum parsimony. The results indicate that most samples of A. monspessulanum species from Iran were part of a monophyletic clade with 8 samples of A. ibericum from Georgia, A. hyrcanum from Iran and one of A. sempervirens from Greece (PP= 1; BS= 79%. Our results indicate that use of morphological characteristics coupled with molecular data will be most effective.

  14. Phylogenetic Analysis of a 'Jewel Orchid' Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions.

    Science.gov (United States)

    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen

    2016-01-01

    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1) Goodyera is not monophyletic; 2) Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3) sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection.

  15. Phylogenetic Analysis of a 'Jewel Orchid' Genus Goodyera (Orchidaceae Based on DNA Sequence Data from Nuclear and Plastid Regions.

    Directory of Open Access Journals (Sweden)

    Chao Hu

    Full Text Available A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae based on the nuclear ribosomal internal transcribed spacer (ITS region and two chloroplast loci (matK and trnL-F was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1 Goodyera is not monophyletic; 2 Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3 sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection.

  16. Prospects and challenges of nuclear science and technology education in secondary schools in the Asia-pacific region

    International Nuclear Information System (INIS)

    Iimoto, Takeshi; Takaki, Rieko; Kakefu, Tomohisa; Toda, Takehiro; Takahashi, Itaru

    2017-01-01

    The progress and results of the Technical Cooperation Programme on nuclear science and technology education for the secondary schools in the Asia-Pacific region by the IAEA over five years from 2012 were introduced. Assembling laboratory instruments accompanying the observation of trajectories of radiation in the classroom, the history of the discovery of radiation and radioactivity timely described in the process, the mechanism and the concept of radiation measurement etc., which were explained and introduced by Team Japan, were all really effective. It is concluded that further development of these activities will become one of the cores of STEM education in Asian countries and play an important role in the expansion and deepening of NST education. (author)

  17. THE CHANDRA HRC VIEW OF THE SUBARCSECOND STRUCTURES IN THE NUCLEAR REGION OF NGC 1068

    Energy Technology Data Exchange (ETDEWEB)

    Wang Junfeng; Fabbiano, Giuseppina; Karovska, Margarita; Elvis, Martin; Risaliti, Guido, E-mail: juwang@cfa.harvard.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

    2012-09-10

    We have obtained a high spatial resolution X-ray image of the nucleus of NGC 1068 using the High Resolution Camera (HRC-I) on board the Chandra X-ray Observatory, which provides an unprecedented view of the innermost 1 arcsec radius region of this galaxy. The HRC image resolves the narrow-line region into X-ray emission clumps matching bright emission-line clouds in the HST [OIII] {lambda}5007 images and allows comparison with subarcsecond-scale radio jet for the first time. Two distinct X-ray knots are revealed at 1.3-1.4 arcsec northeast and southwest of the nucleus. Based on the combined X-ray, [O III], and radio continuum morphology, we identify the locations of intense radio jet-cloud interaction. The [O III] to soft X-ray ratios show that some of these clouds are strongly affected by shock heating, whereas in other locations the jet simply thrusts through with no signs of strong interaction. This is further strengthened by the presence of a kT {approx} 1 keV collisionally ionized component in the ACIS spectrum of a shock-heated cloud HST-G. We estimate that the kinematic luminosity of the jet-driven shocks is 6 Multiplication-Sign 10{sup 38} erg s{sup -1}, a negligible fraction (10{sup -4}) of the estimated total jet power.

  18. The Chandra HRC View of the Subarcsecond Structures in the Nuclear Region of NGC 1068

    Science.gov (United States)

    Wang, Junfeng; Fabbiano, Giuseppina; Karovska, Margarita; Elvis, Martin; Risaliti, Guido

    2012-09-01

    We have obtained a high spatial resolution X-ray image of the nucleus of NGC 1068 using the High Resolution Camera (HRC-I) on board the Chandra X-ray Observatory, which provides an unprecedented view of the innermost 1 arcsec radius region of this galaxy. The HRC image resolves the narrow-line region into X-ray emission clumps matching bright emission-line clouds in the HST [OIII] λ5007 images and allows comparison with subarcsecond-scale radio jet for the first time. Two distinct X-ray knots are revealed at 1.3-1.4 arcsec northeast and southwest of the nucleus. Based on the combined X-ray, [O III], and radio continuum morphology, we identify the locations of intense radio jet-cloud interaction. The [O III] to soft X-ray ratios show that some of these clouds are strongly affected by shock heating, whereas in other locations the jet simply thrusts through with no signs of strong interaction. This is further strengthened by the presence of a kT ~ 1 keV collisionally ionized component in the ACIS spectrum of a shock-heated cloud HST-G. We estimate that the kinematic luminosity of the jet-driven shocks is 6 × 1038 erg s-1, a negligible fraction (10-4) of the estimated total jet power.

  19. THE CHANDRA HRC VIEW OF THE SUBARCSECOND STRUCTURES IN THE NUCLEAR REGION OF NGC 1068

    International Nuclear Information System (INIS)

    Wang Junfeng; Fabbiano, Giuseppina; Karovska, Margarita; Elvis, Martin; Risaliti, Guido

    2012-01-01

    We have obtained a high spatial resolution X-ray image of the nucleus of NGC 1068 using the High Resolution Camera (HRC-I) on board the Chandra X-ray Observatory, which provides an unprecedented view of the innermost 1 arcsec radius region of this galaxy. The HRC image resolves the narrow-line region into X-ray emission clumps matching bright emission-line clouds in the HST [OIII] λ5007 images and allows comparison with subarcsecond-scale radio jet for the first time. Two distinct X-ray knots are revealed at 1.3-1.4 arcsec northeast and southwest of the nucleus. Based on the combined X-ray, [O III], and radio continuum morphology, we identify the locations of intense radio jet-cloud interaction. The [O III] to soft X-ray ratios show that some of these clouds are strongly affected by shock heating, whereas in other locations the jet simply thrusts through with no signs of strong interaction. This is further strengthened by the presence of a kT ∼ 1 keV collisionally ionized component in the ACIS spectrum of a shock-heated cloud HST-G. We estimate that the kinematic luminosity of the jet-driven shocks is 6 × 10 38 erg s –1 , a negligible fraction (10 –4 ) of the estimated total jet power.

  20. Sociological researches in the region of Ignalina nuclear power plant: stages and content

    International Nuclear Information System (INIS)

    Chiuzhas, A.

    1998-01-01

    The article examines the sociological researches made by the scientific researchers of the Lithuanian Institute of Philosophy and Sociology during the period of 1989-1997. The investigation in this region was started on the eve of Lithuanian independence restoration. The scientists wanted to find out the integration problems and difficulties of Visaginas population to the transformational life of Lithuania. Another reason of the research set for the first time in Lithuania was the investigation of the attitudes of Visaginas inhabitants to the influence of Ignalina NPP upon people and environment, economic and social development. In 1993 the research was started in accordance with the State's program T he Atomic Energetic and Environment a nd last up to 1997. It included three stages. In the first place the examination of the experts a survey about the evaluation of living environment, ecological and social state was done. The second stage surveyed the work conditions and the social psychological atmosphere in the Ignalina NPP. The investigation of the living and activity conditions of the regional population was done in the third stage. (author)

  1. Regulatory Practices on Ageing Management and Long Term Operation of Nuclear Power Plants in the Ibero-American Region. Results of the FORO/IAEA Programme on Nuclear and Radiation Safety in Ibero-America

    International Nuclear Information System (INIS)

    2014-09-01

    Although the operating lifetime of a nuclear power plant was originally anticipated to be in the range of 30-40 years, 200 of the 434 currently in operation are over 30 years old. In this context, Member States have assigned high priority to continuing the operation of nuclear power plants beyond the lifetime initially planned - while also maintaining the highest safety conditions possible. It is thus essential to encourage international cooperative efforts in the development of safety regulatory practices on ageing management and long term operation. Established in 1997, the Ibero-American Forum of Radiological and Nuclear Regulatory Agencies (FORO) aims to strengthen its members' radiological and nuclear safety regulatory organizations. Through a regional network of radiological and nuclear safety regulators, States in the Ibero-American region have worked together to strengthen radiation protection for patients, to improve safety at radiation installations, to tightten controls on radioactive sources used in medicine, agriculture and industry, and to improve safety and security at nuclear power plants. Since FORO's creation, it has cooperated with the IAEA in areas of mututal interest, and a technical programme administered by the IAEA was established in 2003 and formalized in Practical Arrangements signed in 2010. This publication presents the results of the 2009-2010 FORO/IAEA project on regulatory practices on ageing management and safety considerations for extending the operating lifetime of nuclear power plants. The purpose of the project was to provide nuclear regulators in the region with guidance on regulatory criteria, assessment, regulatory inspection and periodic safety reviews relating to ageing management and long term operation of nuclear power plants. The results are presented in a set of four reports, with guidelines for FORO members and a summary report of the project. These reports contain valuable information for the development of future

  2. Basic concept of the nuclear emergency preparedness and response in Japan after the accident of the Fukushima Dai-ichi Nuclear Power Station. The plain explanation for regional officials and emergency workers

    International Nuclear Information System (INIS)

    Sato, Sohei; Yamamoto, Kazuya

    2013-07-01

    After the accident of TEPCO's Fukushima Dai-ichi Nuclear Power Station occurred on March 11, 2011, actions for controlling the accident and protective actions for the residents like evacuation were taken. In parallel with this, it has been developed to reform the nuclear regulatory systems and the emergency preparedness and response systems in Japan. Especially the Nuclear Regulation Authority's Nuclear Emergency Preparedness and Response Guidelines were adopted with the introducing the basic concepts and the criteria on the basis of the IAEA's safety standards and differed greatly from the prior guidelines. Thus the arrangement of emergency response systems, resources and the operational procedures will be developed complying with according to the guidelines in municipalities around the nuclear power station sites. This work attempts to provide a plain explanation as possible for the regional officials and emergency workers about the basic concepts of the new guidelines. (author)

  3. Analysis of world experience in constructing underground small nuclear power plants and assessment of its potential use in the Russian Arctic regions

    Directory of Open Access Journals (Sweden)

    Smirnov Yu. G.

    2016-03-01

    Full Text Available The paper considers the common ideology and main idea of locating underground nuclear plants. Specific examples in domestic and foreign experience have been analyzed. It has been established that underground small nuclear power plants can be used as an alternative source of electric and thermal energy for solving defense-strategic and social-economic tasks particularly when developing mineral raw material resources in the Russian Arctic regions

  4. A 60-year record of 129I in Taal Lake sediments (Philippines): Influence of human nuclear activities at low latitude region

    DEFF Research Database (Denmark)

    Zhang, Luyuan; Hou, Xiaolin; Li, Hong-chun

    2017-01-01

    in the Taal Lake core appears to be the signal of the Chernobyl accident in 1986. In addition, volcanic activities are reflected in the iodine isotope profiles in the sediment core, suggesting the potential of using iodine isotopes as an indicator of volcanic eruptions.......The influence of human nuclear activities on environmental radioactivity is not well known at low latitude region that are distant from nuclear tests sites and nuclear facilities. A sediment core collected from Taal Lake in the central Philippines was analyzed for 129I and 127I to investigate...

  5. Proceedings of the 3. Regional Meeting on Radiological and Nuclear Safety. Radiological protection in Latin America and the Caribbean. Vol. 1,2

    International Nuclear Information System (INIS)

    1996-08-01

    Two volumes contain more than 183 complete papers presented during the Third Regional Meeting on Radiological Protection and Nuclear Safety held on 23-27 October, 1995 in Cusco-Peru. Latin american specialist talk about nuclear safety and radiological protection, radiation natural exposure, biological effect of radiation, radiotherapy and medical radiological safety, radiological safety in industry and research. Also we deal with subjects related to radiological safety of nuclear and radioactive facilities, radioactive waste management, radioactive material transport, environmental radiological monitoring program, radiological emergency and accidents, instruments and dosimetry, basic safety standards of protection against radiation

  6. Nuclear law in motion. Report on the 15th regional meeting of the German section of AIDN/INLA e.V

    International Nuclear Information System (INIS)

    Feldmann, Ulrike

    2017-01-01

    For the 15th time the German National Group of the Association Internationale du Droit Nucleaire/International Nuclear Law Association (AIDN/IN-LA) e.V. organised a regional conference. 90 participants from 15 countries, including representatives of Euratom and OECD/NEA, met in Bonn on 28 and 29 September to exchange views on current issues of nuclear law. The Rhine, which was in sight of the conference centre and connects countries, provided an excellent backdrop not only for the conference that connects nations, but also for the title of the conference ''Atomic Energy Law in Motion'' and for various lectures on nuclear transport.

  7. Microscopical study of K isomers in the nuclear region A ∼ 180

    International Nuclear Information System (INIS)

    Libert, J.; Quentin, P.; Pillet, N.; Ponsa, A.

    1997-01-01

    At present the K isomers are the best candidates for high density energy storage, although one of the major problems resides in the availability of simple and fast storage mechanisms. To respond to this question it is necessary to know thoroughly the structure of the concerned isomers and low energy modes of excitation. Particularly, proper to this type of studies is the region of A ∼ 180, where a large number of K isomers are known at present ( 178 Hf, 179 Hf and 180 Ta). Microscopic calculations using Skyrme SIII plus a simple pairing interaction lead to a good reproduction of certain single particle and collective spectroscopic properties of 178 Hf. In this region the spectroscopic properties are governed by three single proton states (5/2 - , 7/2 - and 9/2 + ) and by two single neutron states (7/2 + , 9/2 - ). The computed quasi-particle spectrum reproduces within 100 keV the energies of the isomeric states 16 + , 14 - , 25/2 - and 9 - . Based on this agreement one can predict a band spectroscopy rich in high K values due to a plenty of possible single particle combinations which have themselves high K value. Particularly, one have to stress the quasi-degeneracy of a K π = 15 + with the 16 + configuration in 178 Hf. Should this prediction experimentally be confirmed interesting consequences have to be expected on the spectroscopy above the 16 + isomer of 178 Hf as well as on the states implied in the decay of this storage state. Actually, 1 MeV above the 16 + state one can note isolated states reachable by parity breaking (or not breaking) transitions which could be mixture of K = 15, 14, 13, etc structures due to Coriolis interaction. The calculation reported are although simple (the approximation of the free quasi-particles on the BCS vacuum of 178 Hf). Under current study are the quantitative consequences of the Coriolis coupling, the decrease of pairing gaps with increasing quasi-particle number, the Hartree-Fock polarization (even and odd under time

  8. Political Aspects of Nuclear Energy Market Development in the Countries of South Asia. NSG Factor in Promoting Nuclear Energy in the Region

    Directory of Open Access Journals (Sweden)

    Boyko Aleksandr Aleksandrovich

    2016-04-01

    Full Text Available South Asian geopolitical face-off of Delhi and Islamabad revealed breaches of the nuclear nonproliferation. This encouraged the greatest nuclear powers to create a mechanism for additional regulation of the nuclear technology and materials export, which is now known as “Nuclear Suppliers’ Group”. This mechanism aims to impose restrictions for the nuclear technology and materials export to the countries that are not members of NPT. These are nuclear programs of India and Pakistan that are pressing challenge on the agenda. India has been a very attractive market for nuclear suppliers, especially the United States, so the restrictions were lifted from Delhi in 2008. However, they remained valid for Pakistan, which wasn’t an appealing market for the American nuclear exporters. As a result, China, which has been a member of NSG since 2004, has initiated building new NPPs in Pakistan getting mixed reaction of the international community. Despite the clearly contradicting Guidelines, the members of NSG haven’t reached common ground on how to restore its supporting role in maintaining the non-proliferation regime. Thus, the Asian nuclear market develops mostly spontaneously, and its future is shaped primarily by the international relations between importers and exporters. Russia isn’t able to influence all the NSG members to change the position, however it can take advantage of the situation for developing nuclear cooperation with the Asian countries to support sustainable development of the South Asian energy market.

  9. The decommissioning of WWER type nuclear power plants. Final report on an IAEA regional technical co-operation project

    International Nuclear Information System (INIS)

    2000-01-01

    Numerous WWER-440 nuclear power plants are in operation in central and eastern Europe and a small number have already been shut down. In addition to reactors already shut down, many other reactors will reach the end of their design lifetime in a few years and become candidates for decommissioning. It is unfortunate that little consideration was devoted to decommissioning of WWER-440 reactors at the plant design and construction stage, and little emphasis was placed on planning for decommissioning. It is within this context that the IAEA launched a regional technical co-operation project in 1994 with the aim of providing guidance on planning and management of decommissioning for WWERs. The project, which had a duration of four years (1995-1998), included the organization of workshops and scientific visits to countries having WWERs and other countries where active decommissioning projects were under way. Eventually, participants suggested the consolidation of expert guidance and collective opinions into a TECDOC, which was drafted by both designated participants from project recipient countries and invited experts. The TECDOC has the aim of serving as a stimulus for all concerned parties in central and eastern European countries to initiate concrete decommissioning planning, including assessment of existing and required resources for the eventual implementation of decommissioning plans. In addition, the regional technical co-operation project has managed to bring together in this TECDOC a number of good practices that could be useful in WWER-440 decommissioning

  10. Nuclear fusion as new energy option in a global single-regional energy system model

    International Nuclear Information System (INIS)

    Eherer, C.; Baumann, M.; Dueweke, J.; Hamacher, T.

    2005-01-01

    Is there a window of opportunity for fusion on the electricity market under 'business as usual' conditions, and if not, how do the boundary conditions have to look like to open such a window? This question is addressed within a subtask of the Socio-Economic Research on Fusion (SERF) programme of the European Commission. The most advanced energy-modelling framework, the TIMES model generator developed by the Energy Technology System Analysis Project group of the IEA (ETSAP) has been used to implement a global single-regional partial equilibrium energy model. Within the current activities the potential role of fusion power in various future energy scenarios is studied. The final energy demand projections of the baseline of the investigations are based on IIASA-WEC Scenario B. Under the quite conservative baseline assumptions fusion only enters the model solution with 35 GW in 2100 and it can be observed that coal technologies dominate electricity production in 2100. Scenario variations show that the role of fusion power is strongly affected by the availability of GEN IV fission breeding technologies as energy option and by CO 2 emission caps. The former appear to be a major competitor of fusion power while the latter open a window of opportunity for fusion power on the electricity market. An interesting outcome is furthermore that the possible share of fusion electricity is more sensitive to the potential of primary resources like coal, gas and uranium, than to the share of solar and wind power in the system. This indicates that both kinds of technologies, renewables and fusion power, can coexist in future energy systems in case of CO 2 emission policies and/or resource scarcity scenarios. It is shown that Endogenous Technological Learning (ETL), a more consistent description of technological progress than mere time series, has an impact on the model results. (author)

  11. Modification of Japanese first nuclear ship reactor for a regional energy supply system using gadolinia as a burnable poison

    International Nuclear Information System (INIS)

    Sato, Kotaro; Shimazu, Yoichiro; Narabayashi, Tadashi; Tsuji, Masashi

    2009-01-01

    In our laboratory, a small regional energy supply system which uses a small nuclear reactor has been studied for a long time. This system could supply not only heat but also electricity. Heat could be used for hot-water supply, a heating system of a house, melting snow and so on. In this point, this system seems to be useful for the places like northern part of Japan where it snows in winter. This reactor is based on Nuclear Ship Mutsu which was developed as the first nuclear ship of Japan about 40 years ago. It has several advantages for a small reactor. For example, its moderator temperature coefficient is always to be deeply negative because boric acid solution is not used in moderator and coolant. This can lead to a self-controlled operation without control rod maneuvering for load change. But some modifications have been performed in order to satisfy requirements such as (1) longer core life without refueling and reshuffling, (2) reactivity adjustment for load change without control rods or soluble boron, (3) simpler operations for load changes and (4) ultimate safety with sufficient passive capability. In our previous study, we confirmed the core based on Mutsu core had longer core life (about 10 years) using high uranium enrichment fuel (more than 5wt%) and current 17x17 fuel assemblies. We also confirmed excess reactivity during the cycle could be suppressed using combination of erbium oxide (Er 2 O 3 ) and gadolinium oxide (Gd 2 O 3 ) as burnable poisons. Er 2 O 3 has advantages such that criticality safety can be kept even if uranium enrichment is more than 5wt% and burnup characteristics of the core can be gradual. But at this time there are 2 problems to apply for the core using Er 2 O 3 in Japan. First problem is that more than 5wt% enrichment fuel is not yet accepted in Japan. Second problem is that there are no experiences of using Er 2 O 3 in commercial reactors in Japan. Considering these problems, we have to modify the design of the core, using

  12. The Highest Resolution Chandra View of Photoionization and Jet-Cloud Interaction in the Nuclear Region of NGC 4151

    Science.gov (United States)

    Wang, Junfeng; Fabbiano, G.; Karovska, M.; Elvis, M.; Risaliti, G.; Zezas, A.; Mundell, C. G.

    2009-10-01

    We report high resolution imaging of the nucleus of the Seyfert 1 galaxy NGC 4151 obtained with a 50 ks Chandra High Resolution Camera (HRC) observation. The HRC image resolves the emission on spatial scales of 0farcs5, ~30 pc, showing an extended X-ray morphology overall consistent with the narrow-line region (NLR) seen in optical line emission. Removal of the bright point-like nuclear source and image deconvolution techniques both reveal X-ray enhancements that closely match the substructures seen in the Hubble Space Telescope [O III] image and prominent knots in the radio jet. We find that most of the NLR clouds in NGC 4151 have [O III]/soft X-ray ratio ~10, despite the distance of the clouds from the nucleus. This ratio is consistent with the values observed in NLRs of some Seyfert 2 galaxies, which indicates a uniform ionization parameter even at large radii and a density decreasing as r -2 as expected for a nuclear wind scenario. The [O III]/X-ray ratios at the location of radio knots show an excess of X-ray emission, suggesting shock heating in addition to photoionization. We examine various mechanisms for the X-ray emission and find that, in contrast to jet-related X-ray emission in more powerful active galactic nucleus, the observed jet parameters in NGC 4151 are inconsistent with synchrotron emission, synchrotron self-Compton, inverse Compton of cosmic microwave background photons or galaxy optical light. Instead, our results favor thermal emission from the interaction between radio outflow and NLR gas clouds as the origin for the X-ray emission associated with the jet. This supports previous claims that frequent jet-interstellar medium interaction may explain why jets in Seyfert galaxies appear small, slow, and thermally dominated, distinct from those kpc-scale jets in the radio galaxies.

  13. THE HIGHEST RESOLUTION CHANDRA VIEW OF PHOTOIONIZATION AND JET-CLOUD INTERACTION IN THE NUCLEAR REGION OF NGC 4151

    International Nuclear Information System (INIS)

    Wang Junfeng; Fabbiano, G.; Karovska, M.; Elvis, M.; Risaliti, G.; Zezas, A.; Mundell, C. G.

    2009-01-01

    We report high resolution imaging of the nucleus of the Seyfert 1 galaxy NGC 4151 obtained with a 50 ks Chandra High Resolution Camera (HRC) observation. The HRC image resolves the emission on spatial scales of 0.''5, ∼30 pc, showing an extended X-ray morphology overall consistent with the narrow-line region (NLR) seen in optical line emission. Removal of the bright point-like nuclear source and image deconvolution techniques both reveal X-ray enhancements that closely match the substructures seen in the Hubble Space Telescope [O III] image and prominent knots in the radio jet. We find that most of the NLR clouds in NGC 4151 have [O III]/soft X-ray ratio ∼10, despite the distance of the clouds from the nucleus. This ratio is consistent with the values observed in NLRs of some Seyfert 2 galaxies, which indicates a uniform ionization parameter even at large radii and a density decreasing as r -2 as expected for a nuclear wind scenario. The [O III]/X-ray ratios at the location of radio knots show an excess of X-ray emission, suggesting shock heating in addition to photoionization. We examine various mechanisms for the X-ray emission and find that, in contrast to jet-related X-ray emission in more powerful active galactic nucleus, the observed jet parameters in NGC 4151 are inconsistent with synchrotron emission, synchrotron self-Compton, inverse Compton of cosmic microwave background photons or galaxy optical light. Instead, our results favor thermal emission from the interaction between radio outflow and NLR gas clouds as the origin for the X-ray emission associated with the jet. This supports previous claims that frequent jet-interstellar medium interaction may explain why jets in Seyfert galaxies appear small, slow, and thermally dominated, distinct from those kpc-scale jets in the radio galaxies.

  14. A 60-year record of 129I in Taal Lake sediments (Philippines): Influence of human nuclear activities at low latitude regions.

    Science.gov (United States)

    Zhang, Luyuan; Hou, Xiaolin; Li, Hong-Chun; Xu, Xiaomei

    2018-02-01

    The influence of human nuclear activities on environmental radioactivity is not well known at low latitude regions that are distant from nuclear test sites and nuclear facilities. A sediment core collected from Taal Lake in the central Philippines was analyzed for 129 I and 127 I to investigate this influence in a low-latitude terrestrial system. A baseline of 129 I/ 127 I atomic ratios was established at (2.04-5.14) × 10 -12 in the pre-nuclear era in this region. Controlled by the northeasterly equatorial trade winds, increased 129 I/ 127 I ratios of (20.1-69.3) × 10 -12 suggest that atmospheric nuclear weapons tests at the Pacific Proving Grounds in the central Pacific Ocean was the major source of 129 I in the sediment during 1956-1962. The 129 I/ 127 I ratios, up to 157.5 × 10 -12 after 1964, indicate a strong influence by European nuclear fuel reprocessing plants. The East Asian Winter Monsoon is found to be the dominant driving force in the atmospheric dispersion of radioactive iodine ( 129 I) from the European nuclear fuel reprocessing plants to Southeast Asia, which is also important for dispersion of other airborne pollutants from the middle-high to low latitude regions. A significant 129 I/ 127 I peak at 42.8 cm in the Taal Lake core appears to be the signal of the Chernobyl accident in 1986. In addition, volcanic activities are reflected in the iodine isotope profiles in the sediment core, suggesting the potential of using iodine isotopes as an indicator of volcanic eruptions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. The text of the third agreement to extend the regional co-operative agreement for research, development and training related to nuclear science and technology of 1972

    International Nuclear Information System (INIS)

    1987-09-01

    The full text of the third agreement to extend the regional co-operative agreement for research, development and training related to nuclear science and technology of 1972 (INFCIRC/167) (extended first in 1977 and then in 1982) for a further period of five years with effect from 12 June 1987, is reproduced

  16. ARCAL. Regional co-operative arrangements for the promotion of nuclear science and technology in Latin America, Phase I (1985-1990)

    International Nuclear Information System (INIS)

    Gillen, V.A.

    1990-09-01

    The Regional Co-operative Arrangement for the Promotion of Nuclear Science and Technology in Latin America, ARCAL, has completed its first five-year phase (1985-1989). This booklet summarizes the first phase of the ARCAL programme and contains descriptions of projects in the fields of agriculture, medicine, industry and energy

  17. The Text of a Regional Co-operative Agreement for Research, Development and Training related to Nuclear Science and Technology. Acceptance of the Agreement by Bangladesh

    International Nuclear Information System (INIS)

    1974-01-01

    On 23 October 1974 the Government of Bangladesh notified the Agency of its acceptance of the Regional Cooperative Agreement for Research, Development and Training Related to Nuclear Science and Technology between the Agency and Member States, in accordance with Section 9 thereof. Pursuant to Section 10, the Agreement consequently entered into force with respect to the Government of Bangladesh on that date

  18. The Text of the Third Agreement to Extend the Regional Co-operative Agreement for Research, Development and Training related to Nuclear Science and Technology of 1972

    International Nuclear Information System (INIS)

    1987-09-01

    The text of the Third Agreement to Extend the Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology of 1972 the RCA Agreement, extended first in 1977 and then in 1982, for a further period of five years with effect from 12 June 1987, is reproduced herein for the information of all Members [fr

  19. Element Production in the S-Cl Region During Carbon Burning in Massive Stars. Using Computer Systems for Modeling of the Nuclear-Reaction Network

    CERN Document Server

    Szalanski, P; Marganeic, A; Gledenov, Yu M; Sedyshev, P V; Machrafi, R; Oprea, A; Padureanu, I; Aranghel, D

    2002-01-01

    This paper presents results of calculations for nuclear network in S-Cl region during helium burning in massive stars (25 M_{\\odot}) using integrated mathematical systems. The authors also examine other application of presented method in different physical tasks.

  20. Element production in the S - Cl region during carbon burning in massive stars. Using computer systems for modeling of the nuclear-reaction network

    International Nuclear Information System (INIS)

    Szalanski, P.; Stepinski, M.; Marganiec, A.; Gledenov, Yu.M.; Sedyshev, P.V.; Machrafi, R.; Oprea, A.; Padureanu, I.; Aranghel, D.

    2002-01-01

    This paper presents results of calculations for nuclear network in S - Cl region during helium burning in massive stars (25 solar mass) using integrated mathematical systems. The authors also examine other application of the presented method in different physical tasks. (author)

  1. The Text of a Regional Co-operative Agreement for Research, Development and Training related to Nuclear Science and Technology. Latest Status. Declarations/Reservations

    International Nuclear Information System (INIS)

    1972-01-01

    The text of a Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology between the Agency and Member States is reproduced herein for the information of all Members. Section 9 thereof specifies the Members that may become party to it [es

  2. The Text of a Regional Co-operative Agreement for Research, Development and Training related to Nuclear Science and Technology. Latest Status. Declarations/Reservations

    International Nuclear Information System (INIS)

    1972-01-01

    The text of a Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology between the Agency and Member States is reproduced herein for the information of all Members. Section 9 thereof specifies the Members that may become party to it

  3. The text of the second agreement to extend the 1987 Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology

    International Nuclear Information System (INIS)

    1998-03-01

    The document reproduces the text of the Second Agreement to Extend the 1987 Regional Co-operative Agreement for Research, development and Training Related to Nuclear Science and Technology for a further period of five years with effect from 12 june 1997, i.e., through 11 June 2002

  4. The Text of a Regional Co-operative Agreement for Research, Development and Training related to Nuclear Science and Technology. Latest Status. Declarations/Reservations

    International Nuclear Information System (INIS)

    1972-01-01

    The text of a Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology between the Agency and Member States is reproduced herein for the information of all Members. Section 9 thereof specifies the Members that may become party to it [fr

  5. Validity of M-3Y force equivalent G-matrix elements for calculations of the nuclear structure in heavy mass region

    International Nuclear Information System (INIS)

    Cheng Lan; Huang Weizhi; Zhou Baosen

    1996-01-01

    Using the matrix elements of M-3Y force as the equivalent G-matrix elements, the spectra of 210 Pb, 206 Pb, 206 Hg and 210 Po are calculated in the framework of the Folded Diagram Method. The results show that such equivalent matrix elements are suitable for microscopic calculations of the nuclear structure in heavy mass region

  6. The text of the Agreement establishing the Asian Regional Co-operative Project on Medical and Biological Applications of Nuclear Techniques

    International Nuclear Information System (INIS)

    1987-04-01

    The full text of the Agreement establishing the Asian Regional Co-operative Project on Medical and Biological Applications of Nuclear Techniques between the Agency and Member States is reproduced. The Agreement entered into force on 20 May 1986 after the Governments of Japan, Bangladesh and the Philippines had notified the Agency of their acceptance of the Agreement

  7. Peaceful uses of nuclear energy in the 21st century. Opening remarks at the regional public information seminar, Bangkok, 1 February 2000

    International Nuclear Information System (INIS)

    ElBaradei, M.

    2000-01-01

    In his opening remarks at the Regional Public Information Seminar (Bangkok, 1 February 2000), the Director General of the IAEA presented the aim of the seminar as a means to enhance understanding of the peaceful uses of nuclear energy, and the main thrusts of the IAEA's current activities

  8. The Text of the Second Agreement to Extend the Regional Co-operative Agreement for Research, Development and Training related to Nuclear Science and Technology of 1972

    International Nuclear Information System (INIS)

    1982-12-01

    The text of the Second Agreement to Extend the Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology of 1972 the RCA Agreement, fist extended in 1977, for a further period of five years with effect from 12 June 1982, is reproduced herein for the information of all Members

  9. Optical and near-infrared IFU spectroscopy of the nuclear region of the AGN-starburst galaxy NGC 7582

    Science.gov (United States)

    Ricci, T. V.; Steiner, J. E.; May, D.; Garcia-Rissmann, A.; Menezes, R. B.

    2018-02-01

    NGC 7582 is an SB(s)ab galaxy which displays evidences of simultaneous nuclear activity and star formation in its centre. Previous optical observations revealed, besides the H II regions, an ionization cone and a gas disc in its central part. Hubble Space Telescope (HST) images in both optical and infrared bands show the active galactic nuclei (AGNs) and a few compact structures that are possibly associated with young stellar clusters. In order to study in detail both the AGN and evidence for star formation, we analyse optical (Gemini Multi-Object Spectrograph) and near-infrared (Spectrograph for Integral Field Observations in the Near Infrared) archival data cubes. We detected five nebulae with strong He II λ4686 emission in the same region where an outflow is detected in the [O III] λ5007 kinematic map. We interpreted this result as clouds that are exposed to high-energy photons emerging from the AGN throughout the ionization cone. We also detected Wolf-Rayet features which are related to emission of one of the compact clusters seen in the HST image. Broad Hα and Br γ components are detected at the position of the nucleus. [Fe II] λ1.644 μm, H2λ2.122 μm and Br γ flux maps show two blobs, one north and the other south from the nucleus, that seem to be associated with five previously detected mid-infrared sources. Two of the five He II nebulae are partially ionized by photons from starbursts. However, we conclude that the main source of excitation of these blobs is the AGN jet/disc. The jet orientation indicates that the accretion disc is nearly orthogonal to the dusty torus.

  10. A Thorough View of the Nuclear Region of NGC 253: Combined Herschel, SOFIA, and APEX Data Set

    Science.gov (United States)

    Pérez-Beaupuits, J. P.; Güsten, R.; Harris, A.; Requena-Torres, M. A.; Menten, K. M.; Weiß, A.; Polehampton, E.; van der Wiel, M. H. D.

    2018-06-01

    We present a large set of spectral lines detected in the 40″ central region of the starburst galaxy NGC 253. Observations were obtained with the three instruments SPIRE, PACS, and HIFI on board the Herschel Space Observatory, upGREAT on board the SOFIA airborne observatory, and the ground-based Atacama Pathfinder EXperiment telescope. Combining the spectral and photometry products of SPIRE and PACS, we model the dust continuum spectral energy distribution (SED) and the most complete 12CO line SED reported so far toward the nuclear region of NGC 253. The properties and excitation of the molecular gas were derived from a three-component non-LTE radiative transfer model, using the SPIRE 13CO lines and ground-based observations of the lower-J 13CO and HCN lines, to constrain the model parameters. Three dust temperatures were identified from the continuum emission, and three components are needed to fit the full CO line SED. Only the third CO component (fitting mostly the HCN and PACS 12CO lines) is consistent with a shock-/mechanical-heating scenario. A hot core chemistry is also argued as a plausible scenario to explain the high-J 12CO lines detected with PACS. The effect of enhanced cosmic-ray ionization rates, however, cannot be ruled out and is expected to play a significant role in the diffuse and dense gas chemistry. This is supported by the detection of ionic species like OH+ and H2O+, as well as the enhanced fluxes of the OH lines with respect to those of H2O lines detected in both PACS and SPIRE spectra.

  11. Modeled Neutron Induced Nuclear Reaction Cross Sections for Radiochemsitry in the region of Thulium, Lutetium, and Tantalum I. Results of Built in Spherical Symmetry in a Deformed Region

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, R. D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2013-09-06

    We have developed a set of modeled nuclear reaction cross sections for use in radiochemical diagnostics. Systematics for the input parameters required by the Hauser-Feshbach statistical model were developed and used to calculate neutron induced nuclear reaction cross sections for targets ranging from Terbium (Z = 65) to Rhenium (Z = 75). Of particular interest are the cross sections on Tm, Lu, and Ta including reactions on isomeric targets.

  12. Radionuclide content and hydrodynamic characterization of the area in the vicinity of the Centro Regional de Ciencias Nucleares

    International Nuclear Information System (INIS)

    Brandao, Yana B.; Borges, Edvane

    2008-01-01

    In order to comply with the Brazilian environmental laws, a survey of the radiation levels in the site of construction of the Centro Regional de Ciencias Nucleares (CRCN), in the urban area of Recife, state of Pernanbuco, Brazil, was conducted, for further assessment of the impact caused by the center activities. Concentration level of 238 U and 210 Po were determined in soil and water samples were in the vicinity of the CRCN. The 238 U content in soil samples varied from 7 to 44.4 Bq.kg -1 . For water samples, the measured values for 210 Po ranged from 12 to 19.6 mBq.L -1 . Soil samples were collected to determine the hydrodynamic characteristic of the area. In order to determine the soil-water retention curves, samples were collected from the surface and at depths of 20-25 cm, 40-45 cm, 60-65 cm, 80-85 cm and 100-105 cm. The results of soil-water retention curves showed that the soil of the center, compounded by various embankments, presented several textural classifications, which ranged from loam sandy, loamy sand, loam and sand clay earth within the same profile 0-100 cm. (author)

  13. Inferring Invasion History of Red Swamp Crayfish (Procambarus clarkii) in China from Mitochondrial Control Region and Nuclear Intron Sequences

    Science.gov (United States)

    Li, Yanhe; Guo, Xianwu; Chen, Liping; Bai, Xiaohui; Wei, Xinlan; Zhou, Xiaoyun; Huang, Songqian; Wang, Weimin

    2015-01-01

    Identifying the dispersal pathways of an invasive species is useful for adopting the appropriate strategies to prevent and control its spread. However, these processes are exceedingly complex. So, it is necessary to apply new technology and collect representative samples for analysis. This study used Approximate Bayesian Computation (ABC) in combination with traditional genetic tools to examine extensive sample data and historical records to infer the invasion history of the red swamp crayfish, Procambarus clarkii, in China. The sequences of the mitochondrial control region and the proPOx intron in the nuclear genome of samples from 37 sites (35 in China and one each in Japan and the USA) were analyzed. The results of combined scenarios testing and historical records revealed a much more complex invasion history in China than previously believed. P. clarkii was most likely originally introduced into China from Japan from an unsampled source, and the species then expanded its range primarily into the middle and lower reaches and, to a lesser extent, into the upper reaches of the Changjiang River in China. No transfer was observed from the upper reaches to the middle and lower reaches of the Changjiang River. Human-mediated jump dispersal was an important dispersal pathway for P. clarkii. The results provide a better understanding of the evolutionary scenarios involved in the rapid invasion of P. clarkii in China. PMID:26132567

  14. Inferring Invasion History of Red Swamp Crayfish (Procambarus clarkii in China from Mitochondrial Control Region and Nuclear Intron Sequences

    Directory of Open Access Journals (Sweden)

    Yanhe Li

    2015-06-01

    Full Text Available Identifying the dispersal pathways of an invasive species is useful for adopting the appropriate strategies to prevent and control its spread. However, these processes are exceedingly complex. So, it is necessary to apply new technology and collect representative samples for analysis. This study used Approximate Bayesian Computation (ABC in combination with traditional genetic tools to examine extensive sample data and historical records to infer the invasion history of the red swamp crayfish, Procambarus clarkii, in China. The sequences of the mitochondrial control region and the proPOx intron in the nuclear genome of samples from 37 sites (35 in China and one each in Japan and the USA were analyzed. The results of combined scenarios testing and historical records revealed a much more complex invasion history in China than previously believed. P. clarkii was most likely originally introduced into China from Japan from an unsampled source, and the species then expanded its range primarily into the middle and lower reaches and, to a lesser extent, into the upper reaches of the Changjiang River in China. No transfer was observed from the upper reaches to the middle and lower reaches of the Changjiang River. Human-mediated jump dispersal was an important dispersal pathway for P. clarkii. The results provide a better understanding of the evolutionary scenarios involved in the rapid invasion of P. clarkii in China.

  15. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  16. Thermoelastic analysis for the fuel claddings of the nuclear power reactor at Atucha in the skid's region

    International Nuclear Information System (INIS)

    Sanchez Sarmiento, Gustavo; Basombrio, F.G.

    1979-01-01

    For the fuel elements of the Nuclear Power Reactor at Atucha, a two-dimensional thermoelastic analysis has been made in the region of the skids of the fuel cladding, when the gap between them and the fuel rod separator's support becomes zero. In such a case the latter forces exert on the skids an elastic reaction opposite to the cladding's expansion. The internal pressure reaching the yield stress for the cladding material has been calculated, as a function of the initial gap; for several possible fuel rod locations within the separator; for the actual dimensions and also for reduced thickness of the cladding; with a given external pressure and, with a known temperature spatial distribution. The latter has been calculated by solving the heat conduction equation along the fuel element for a certain power level in the reactor. The calculations are made with two FORTRAN IV computer codes developed at C.A.B., using the finite-element method: the NOLICUARM, to solve the nonlinear quasi-harmonic equation, and the ELASTEF 3, for the solution of thermoelastic problems with plane symmetry. (author) [es

  17. Identification of a nuclear matrix attachment region like sequence in the last intron of PI3Kγ

    International Nuclear Information System (INIS)

    Dai Bingbing; Ying Lei; Cai Rong; Li Ying; Zhang Xingqian; Lu Jian; Qian Guanxiang

    2006-01-01

    MARs are not only the structure bases of chromatin higher order structure but also have much biological significance. In this study, the whole sequence of about 100 kb in length from BAC clone of GS1-223D4 (GI: 5931478), in which human PI3Kγ gene is localized, was analyzed by two online-based computer programs, MARFinder and SMARTest. A strong potential MAR was predicted in the last and largest intron of PI3Kγ. The predicted 2 kb MAR, we refer to PIMAR, was further analyzed through biochemical methods in vitro and in vivo. The results showed that the PIMAR could be associated with nuclear matrices from HeLa cells both in vitro and in vivo. Further reporter gene analysis showed that in the transient transfection the expression of reporter gene linked with reversed PIMAR was repressed slightly, while in stably integrated state, the luciferase reporter both linked with reversed and orientated PIMAR was enhanced greatly in NIH-3T3 and K-562. These results suggest that the PIMAR maybe has the capacity of shielding integrated heterogeneous gene from chromatin position effect. Through combination of computer program analysis with confirmation by biochemical methods, we identified, for First time, a 2 kb matrix attachment region like sequence in the last intron of human PI3Kγ

  18. The in-situ testing of high efficiency particulate filters in the CEGB south eastern region nuclear power stations

    International Nuclear Information System (INIS)

    Powell, A.W.; Wilkinson, B.A.

    1977-01-01

    High efficiency air filters are installed in the CEGB's Nuclear Power Stations to prevent discharge of radioactive material to the environment should the ventilation air become contaminated. The Board has determined that these filter units should be tested in-situ to ensure that the stringent design specifications are met. This paper describes the rig work comparing the British Standard method using sodium chloride aerosol with other test methods, such as Dioctyl Phthalate, naturally occurring dust aerosols and artificially produced condensation nuclei. This work led to the development of an in-situ test method using condensation nuclei and a Pollak-Nolan nucleus counter. The advantages and disadvantages of this method over other methods for in-situ testing is discussed. The test method has been used in the South Eastern Region for several years and considerable experience has been gained in its use on a wide variety of filter systems. The method adopted for each system is detailed including the injection, sampling and interpretation of the results obtained. Numerous faults and difficulties have been highlighted from the design, installation and filter changing aspects

  19. Nuclear Asia

    National Research Council Canada - National Science Library

    Ferguson, Joseph; Tarleton, Gael

    2004-01-01

    .... This event was an opportunity for policy makers, security analysts, nuclear scientists and engineers, regional experts, and military planners to share perspectives and identify those issues requiring...

  20. Nuclear power and the Canadian public. A national and regional assessment of public attitudes and perceptions of the use of nuclear power for the production of electricity

    Energy Technology Data Exchange (ETDEWEB)

    Greer-Wootten, B; Mitson, L [York Univ., Toronto, Ontario (Canada)

    1976-06-01

    Over 2,100 persons from the Canadian public aged 18 years and over were interviewed to ascertain the opinions and attitudes of Canadians toward the use of nuclear power for generating electricity. The results of this survey are presented.

  1. Baltic region going nuclear

    Index Scriptorium Estoniae

    2011-01-01

    Läti keskkonnaminister Raimonds Vejonis leiab, et Läti ei peaks investeerima Leetu rajatava tuumaelektrijaama ehitusse ja võiks panustada hoopis taastuvenergiale. Venemaa peaminister Vladimir Putin ja Valgevene president Aleksandr Lukašenko allkirjastasid kokkuleppe Valgevene ja Leedu piiri lähistele uue tuumajaama ehitamise kohta. Leedu ei ole selle projektiga nõus

  2. 6. Regional Congress on Radiation Protection and Safety; 3. Iberian and Latin American Congress on Radiological Protection Societies; Regional IRPA Congress. Book of abstracts; 6. Congreso Regional sobre Seguridad Radiologica y Nuclear; 3. Congreso Iberolatinoamericano de Sociedades de Proteccion Radiologica; Congreso Regional IRPA. Libro de resumenes

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2003-11-15

    The 6th Regional Congress on Radiation Protection and Safety was organized by the Peruvian Radiation Protection Society and the Peruvian Institute of Nuclear Energy, held in Lima, Peru, between 9 and 13 of november of 2003. In this event, were presented 227 papers that were articulated in the following sessions: radiation natural exposure, biological effects of ionizing radiation, instruments and dosimetry, radiological emergency and accidents, occupational radiation protection, radiological protection in medical exposure, radiological environmental protection, legal aspects, standards and regulations, training, education and communication, radioactive waste management, radioactive material transport, nuclear safety and biological effects of non-ionizing radiation. (APC)

  3. Karyopherin-mediated nuclear import of the homing endonuclease VMA1-derived endonuclease is required for self-propagation of the coding region.

    Science.gov (United States)

    Nagai, Yuri; Nogami, Satoru; Kumagai-Sano, Fumi; Ohya, Yoshikazu

    2003-03-01

    VMA1-derived endonuclease (VDE), a site-specific endonuclease in Saccharomyces cerevisiae, enters the nucleus to generate a double-strand break in the VDE-negative allelic locus, mediating the self-propagating gene conversion called homing. Although VDE is excluded from the nucleus in mitotic cells, it relocalizes at premeiosis, becoming localized in both the nucleus and the cytoplasm in meiosis. The nuclear localization of VDE is induced by inactivation of TOR kinases, which constitute central regulators of cell differentiation in S. cerevisiae, and by nutrient depletion. A functional genomic approach revealed that at least two karyopherins, Srp1p and Kap142p, are required for the nuclear localization pattern. Genetic and physical interactions between Srp1p and VDE imply direct involvement of karyopherin-mediated nuclear transport in this process. Inactivation of TOR signaling or acquisition of an extra nuclear localization signal in the VDE coding region leads to artificial nuclear localization of VDE and thereby induces homing even during mitosis. These results serve as evidence that VDE utilizes the host systems of nutrient signal transduction and nucleocytoplasmic transport to ensure the propagation of its coding region.

  4. Rapid allopolyploid radiation of moonwort ferns (Botrychium; Ophioglossaceae) revealed by PacBio sequencing of homologous and homeologous nuclear regions.

    Science.gov (United States)

    Dauphin, Benjamin; Grant, Jason R; Farrar, Donald R; Rothfels, Carl J

    2018-03-01

    Polyploidy is a major speciation process in vascular plants, and is postulated to be particularly important in shaping the diversity of extant ferns. However, limitations in the availability of bi-parental markers for ferns have greatly limited phylogenetic investigation of polyploidy in this group. With a large number of allopolyploid species, the genus Botrychium is a classic example in ferns where recurrent polyploidy is postulated to have driven frequent speciation events. Here, we use PacBio sequencing and the PURC bioinformatics pipeline to capture all homeologous or allelic copies of four long (∼1 kb) low-copy nuclear regions from a sample of 45 specimens (25 diploids and 20 polyploids) representing 37 Botrychium taxa, and three outgroups. This sample includes most currently recognized Botrychium species in Europe and North America, and the majority of our specimens were genotyped with co-dominant nuclear allozymes to ensure species identification. We analyzed the sequence data using maximum likelihood (ML) and Bayesian inference (BI) concatenated-data ("gene tree") approaches to explore the relationships among Botrychium species. Finally, we estimated divergence times among Botrychium lineages and inferred the multi-labeled polyploid species tree showing the origins of the polyploid taxa, and their relationships to each other and to their diploid progenitors. We found strong support for the monophyly of the major lineages within Botrychium and identified most of the parental donors of the polyploids; these results largely corroborate earlier morphological and allozyme-based investigations. Each polyploid had at least two distinct homeologs, indicating that all sampled polyploids are likely allopolyploids (rather than autopolyploids). Our divergence-time analyses revealed that these allopolyploid lineages originated recently-within the last two million years-and thus that the genus has undergone a recent radiation, correlated with multiple independent

  5. AHM1, a Novel Type of Nuclear Matrix–Localized, MAR Binding Protein with a Single AT Hook and a J Domain–Homologous Region

    Science.gov (United States)

    Morisawa, Gaku; Han-yama, Atsushi; Moda, Ichiro; Tamai, Atsushi; Iwabuchi, Masaki; Meshi, Tetsuo

    2000-01-01

    Interactions between the nuclear matrix and special regions of chromosomal DNA called matrix attachment regions (MARs) have been implicated in various nuclear functions. We have identified a novel protein from wheat, AT hook–containing MAR binding protein1 (AHM1), that binds preferentially to MARs. A multidomain protein, AHM1 has the special combination of a J domain–homologous region and a Zn finger–like motif (a J-Z array) and an AT hook. For MAR binding, the AT hook at the C terminus was essential, and an internal portion containing the Zn finger–like motif was additionally required in vivo. AHM1 was found in the nuclear matrix fraction and was localized in the nucleoplasm. AHM1 fused to green fluorescent protein had a speckled distribution pattern inside the nucleus. AHM1 is most likely a nuclear matrix component that functions between intranuclear framework and MARs. J-Z arrays can be found in a group of (hypothetical) proteins in plants, which may share some functions, presumably to recruit specific Hsp70 partners as co-chaperones. PMID:11041885

  6. Psychological factors affecting public acceptance of nuclear energy. Comparative analysis focusing on regional characteristics and degree of knowledge

    International Nuclear Information System (INIS)

    Kimura, Hiroshi; Suzuki, Atsuyuki; Furuta, Kazuo

    2003-01-01

    The purpose of this research is to clarify how psychological factors' impact on public acceptance of nuclear energy varies with where they live and their degree of knowledge. For this purpose, we carried out questionnaire survey about nuclear energy at three urban areas and two nuclear power plant siting areas. After collecting data, we applied factor analysis to the data, and found four factors which construct cognitive structure of nuclear energy. Using multiple regression analysis, we evaluated the impact of the four factors on two issues: the decision for or against nuclear policy and the reaction to nuclear power plant siting, and compared changes of the impact by where respondents live and their degree of knowledge. Consequently, we found that the impact of all four factors on the two issues varies with where respondents live. We also found that the impact of respondents' degree of knowledge to four factors varies with where they live. (author)

  7. The Next Generation Fornax Survey (NGFS). IV. Mass and Age Bimodality of Nuclear Clusters in the Fornax Core Region

    Science.gov (United States)

    Ordenes-Briceño, Yasna; Puzia, Thomas H.; Eigenthaler, Paul; Taylor, Matthew A.; Muñoz, Roberto P.; Zhang, Hongxin; Alamo-Martínez, Karla; Ribbeck, Karen X.; Grebel, Eva K.; Ángel, Simón; Côté, Patrick; Ferrarese, Laura; Hilker, Michael; Lançon, Ariane; Mieske, Steffen; Miller, Bryan W.; Rong, Yu; Sánchez-Janssen, Ruben

    2018-06-01

    We present the analysis of 61 nucleated dwarf galaxies in the central regions (≲R vir/4) of the Fornax galaxy cluster. The galaxies and their nuclei are studied as part of the Next Generation Fornax Survey using optical imaging obtained with the Dark Energy Camera mounted at Blanco/Cerro Tololo Inter-American Observatory and near-infrared data obtained with VIRCam at VISTA/ESO. We decompose the nucleated dwarfs in nucleus and spheroid, after subtracting the surface brightness profile of the spheroid component and studying the nucleus using point source photometry. In general, nuclei are consistent with colors of confirmed metal-poor globular clusters, but with significantly smaller dispersion than other confirmed compact stellar systems in Fornax. We find a bimodal nucleus mass distribution with peaks located at {log}({{ \\mathcal M }}* /{M}ȯ )≃ 5.4 and ∼6.3. These two nucleus subpopulations have different stellar population properties: the more massive nuclei are older than ∼2 Gyr and have metal-poor stellar populations (Z ≤ 0.02 Z ⊙), while the less massive nuclei are younger than ∼2 Gyr with metallicities in the range 0.02 < Z/Z ⊙ ≤ 1. We find that the nucleus mass ({{ \\mathcal M }}nuc}) versus galaxy mass ({{ \\mathcal M }}gal}) relation becomes shallower for less massive galaxies starting around 108 M ⊙, and the mass ratio {η }n={{ \\mathcal M }}nuc}/{{ \\mathcal M }}gal} shows a clear anticorrelation with {{ \\mathcal M }}gal} for the lowest masses, reaching 10%. We test current theoretical models of nuclear cluster formation and find that they cannot fully reproduce the observed trends. A likely mixture of in situ star formation and star cluster mergers seems to be acting during nucleus growth over cosmic time.

  8. From Regional Hazard Assessment to Nuclear-Test-Ban Treaty Support - InSAR Ground Motion Services

    Science.gov (United States)

    Lege, T.; Kalia, A.; Gruenberg, I.; Frei, M.

    2016-12-01

    There are numerous scientific applications of InSAR methods in tectonics, earthquake analysis and other geologic and geophysical fields. Ground motion on local and regional scale measured and monitored via the application of the InSAR techniques provide scientists and engineers with plenty of new insights and further understanding of subsurface processes. However, the operational use of InSAR is not yet very widespread. To foster the operational utilization of the Copernicus Sentinel Satellites in the day-to-day business of federal, state and municipal work and planning BGR (Federal Institute for Geosciences and Natural Resources) initiated workshops with potential user groups. Through extensive reconcilement of interests and demands with scientific, technical, economic and governmental stakeholders (e.g. Ministries, Mining Authorities, Geological Surveys, Geodetic Surveys and Environmental Agencies on federal and state level, SMEs, German Aerospace Center) BGR developed the concept of the InSAR based German National Ground Motion Service. One important backbone for the nationwide ground motion service is the so-called Persistent Scatterer Interferometry Wide Area Product (WAP) approach developed with grants of European research funds. The presentation shows the implementation of the ground motion service and examples for product developments for operational supervision of mining, water resources management and spatial planning. Furthermore the contributions of Copernicus Sentinel 1 radar data in the context of CTBT are discussed. The DInSAR processing of Sentinel 1 IW (Interferometric Wide Swath) SAR acquisitions from January 1st and 13th Jan. 2016 allow for the first time a near real time ground motion measurement of the North Korean nuclear test site. The measured ground displacements show a strong spatio-temporal correlation to the calculated epicenter measured by teleseismic stations. We are convinced this way another space technique will soon contribute even

  9. Nuclear Overhauser Enhancement imaging of glioblastoma at 7 Tesla: region specific correlation with apparent diffusion coefficient and histology.

    Science.gov (United States)

    Paech, Daniel; Burth, Sina; Windschuh, Johannes; Meissner, Jan-Eric; Zaiss, Moritz; Eidel, Oliver; Kickingereder, Philipp; Nowosielski, Martha; Wiestler, Benedikt; Sahm, Felix; Floca, Ralf Omar; Neumann, Jan-Oliver; Wick, Wolfgang; Heiland, Sabine; Bendszus, Martin; Schlemmer, Heinz-Peter; Ladd, Mark Edward; Bachert, Peter; Radbruch, Alexander

    2015-01-01

    To explore the correlation between Nuclear Overhauser Enhancement (NOE)-mediated signals and tumor cellularity in glioblastoma utilizing the apparent diffusion coefficient (ADC) and cell density from histologic specimens. NOE is one type of chemical exchange saturation transfer (CEST) that originates from mobile macromolecules such as proteins and might be associated with tumor cellularity via altered protein synthesis in proliferating cells. For 15 patients with newly diagnosed glioblastoma, NOE-mediated CEST-contrast was acquired at 7 Tesla (asymmetric magnetization transfer ratio (MTRasym) at 3.3ppm, B1 = 0.7 μT). Contrast enhanced T1 (CE-T1), T2 and diffusion-weighted MRI (DWI) were acquired at 3 Tesla and coregistered. The T2 edema and the CE-T1 tumor were segmented. ADC and MTRasym values within both regions of interest were correlated voxelwise yielding the correlation coefficient rSpearman (rSp). In three patients who underwent stereotactic biopsy, cell density of 12 specimens per patient was correlated with corresponding MTRasym and ADC values of the biopsy site. Eight of 15 patients showed a weak or moderate positive correlation of MTRasym and ADC within the T2 edema (0.16≤rSp≤0.53, pcorrelations were statistically insignificant (p>0.05, n = 4) or yielded rSp≈0 (pcorrelation between MTRasym and ADC was found in CE-T1 tumor (-0.310.05, n = 6). The biopsy-analysis within CE-T1 tumor revealed a strong positive correlation between tumor cellularity and MTRasym values in two of the three patients (rSppatient3 = 0.69 and rSppatient15 = 0.87, pcorrelation of ADC and cellularity was heterogeneous (rSppatient3 = 0.545 (p = 0.067), rSppatient4 = -0.021 (p = 0.948), rSppatient15 = -0.755 (p = 0.005)). NOE-imaging is a new contrast promising insight into pathophysiologic processes in glioblastoma regarding cell density and protein content, setting itself apart from DWI. Future studies might be based on the assumption that NOE-mediated CEST visualizes

  10. Proceedings of the 3. Regional Meeting on Radiological and Nuclear Safety. Radiological protection in Latin America and the Caribbean. Vol. 1,2; Actas del 3. Congreso Regional sobre Seguridad Radiologica y Nuclear. Proteccion Radiologica en America Latina y el Caribe. Vol. 1,2

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-08-01

    Two volumes contain more than 183 complete papers presented during the Third Regional Meeting on Radiological Protection and Nuclear Safety held on 23-27 October, 1995 in Cusco-Peru. Latin american specialist talk about nuclear safety and radiological protection, radiation natural exposure, biological effect of radiation, radiotherapy and medical radiological safety, radiological safety in industry and research. Also we deal with subjects related to radiological safety of nuclear and radioactive facilities, radioactive waste management, radioactive material transport, environmental radiological monitoring program, radiological emergency and accidents, instruments and dosimetry, basic safety standards of protection against radiation.

  11. Nuclear pores and perinuclear expression sites of var and ribosomal DNA genes correspond to physically distinct regions in Plasmodium falciparum.

    Science.gov (United States)

    Guizetti, Julien; Martins, Rafael Miyazawa; Guadagnini, Stéphanie; Claes, Aurélie; Scherf, Artur

    2013-05-01

    The human malaria parasite Plasmodium falciparum modifies the erythrocyte it infects by exporting variant proteins to the host cell surface. The var gene family that codes for a large, variant adhesive surface protein called P. falciparum erythrocyte membrane protein 1 (PfEMP1) plays a particular role in this process, which is linked to pathogenesis and immune evasion. A single member of this gene family is highly transcribed while the other 59 members remain silenced. Importantly, var gene transcription occurs at a spatially restricted, but yet undefined, perinuclear site that is distinct from repressed var gene clusters. To advance our understanding of monoallelic expression, we investigated whether nuclear pores associate with the var gene expression site. To this end, we studied the nuclear pore organization during the asexual blood stage using a specific antibody directed against a subunit of the nuclear pore, P. falciparum Nup116 (PfNup116). Ring and schizont stage parasites showed highly polarized nuclear pore foci, whereas in trophozoite stage nuclear pores redistributed over the entire nuclear surface. Colocalization studies of var transcripts and anti-PfNup116 antibodies showed clear dissociation between nuclear pores and the var gene expression site in ring stage. Similar results were obtained for another differentially transcribed perinuclear gene family, the ribosomal DNA units. Furthermore, we show that in the poised state, the var gene locus is not physically linked to nuclear pores. Our results indicate that P. falciparum does form compartments of high transcriptional activity at the nuclear periphery which are, unlike the case in yeast, devoid of nuclear pores.

  12. The Text of a Regional Co-operative Agreement for Research, Development and Training related to Nuclear Science and Technology. Latest Status. Declarations/Reservations; Texto de un Acuerdo de Cooperacion Regional Para la Investigacion, el Desarrollo y la Capacitacion en Materia de Ciencias y Tecnologia Nucleares

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1972-08-18

    The text of a Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology between the Agency and Member States is reproduced herein for the information of all Members. Section 9 thereof specifies the Members that may become party to it [Spanish] Para conocimiento de todos los Estados Miembros en el presente documento se transcribe el texto de un Acuerdo de Cooperacion Regional para la investigacion, el desarrollo y la capacitacion en materia de ciencias y tecnologia nucleares entre el Organismo y los Estados Miembros. En la Seccion 9 se especifican los Estados Miembros que pueden ser partes en el Acuerdo.

  13. Penning-trap mass spectrometry and mean-field study of nuclear shape coexistence in the neutron-deficient lead region

    Science.gov (United States)

    Manea, V.; Ascher, P.; Atanasov, D.; Barzakh, A. E.; Beck, D.; Blaum, K.; Borgmann, Ch.; Breitenfeldt, M.; Cakirli, R. B.; Cocolios, T. E.; Day Goodacre, T.; Fedorov, D. V.; Fedosseev, V. N.; George, S.; Herfurth, F.; Kowalska, M.; Kreim, S.; Litvinov, Yu. A.; Lunney, D.; Marsh, B.; Neidherr, D.; Rosenbusch, M.; Rossel, R. E.; Rothe, S.; Schweikhard, L.; Wienholtz, F.; Wolf, R. N.; Zuber, K.

    2017-05-01

    We present a study of nuclear shape coexistence in the region of neutron-deficient lead isotopes. The midshell gold isotopes 180,185,188,190Au (Z =79 ), the two long-lived nuclear states in 197At (Z =85 ), and the neutron-rich nuclide 219At were produced by the ISOLDE facility at CERN and their masses were determined with the high-precision Penning-trap mass spectrometer ISOLTRAP. The studied gold isotopes address the trend of binding energies in a region of the nuclear chart where the nuclear charge radii show pronounced discontinuities. Significant deviations from the atomic-mass evaluation were found for Au,190188. The new trend of two-neutron separation energies is smoother, although it does reveal the onset of deformation. The origin of this effect is interpreted in connection to the odd-even staggering of binding energies, as well as theoretically by Hartree-Fock-Bogoliubov calculations including quasiparticle blocking. The role of blocking for reproducing the large odd-even staggering of charge radii in the mercury isotopic chain is illustrated.

  14. Performance analysis of fusion nuclear-data benchmark experiments for light to heavy materials in MeV energy region with a neutron spectrum shifter

    International Nuclear Information System (INIS)

    Murata, Isao; Ohta, Masayuki; Miyamaru, Hiroyuki; Kondo, Keitaro; Yoshida, Shigeo; Iida, Toshiyuki; Ochiai, Kentaro; Konno, Chikara

    2011-01-01

    Nuclear data are indispensable for development of fusion reactor candidate materials. However, benchmarking of the nuclear data in MeV energy region is not yet adequate. In the present study, benchmark performance in the MeV energy region was investigated theoretically for experiments by using a 14 MeV neutron source. We carried out a systematical analysis for light to heavy materials. As a result, the benchmark performance for the neutron spectrum was confirmed to be acceptable, while for gamma-rays it was not sufficiently accurate. Consequently, a spectrum shifter has to be applied. Beryllium had the best performance as a shifter. Moreover, a preliminary examination of whether it is really acceptable that only the spectrum before the last collision is considered in the benchmark performance analysis. It was pointed out that not only the last collision but also earlier collisions should be considered equally in the benchmark performance analysis.

  15. NKS - The Nordic region's cooperative network for addressing challenges in nuclear safety and emergency preparedness

    Energy Technology Data Exchange (ETDEWEB)

    Andersson, K.G. [NKS/Technical University of Denmark (Denmark); Andgren, K. [NKS/Vattenfall R and D (Sweden); Leino, K. [NKS/Fortum Power and Heat Oy (Finland); Magnusson, S. [NKS/Icelandic Radiation Safety Authority (Iceland); Physant, F. [NKS/FRIT, Roskilde (Denmark)

    2014-07-01

    Based on the foundation of a common cultural and historical heritage and a long tradition of collaboration, NKS aims to facilitate a common Nordic view on nuclear and radiation safety. A common understanding of rules, practice and measures, and national differences in this context, is here an essential requirement. Problems can generally be tackled quicker, more efficiently, more consistently and at a lower cost through collaboration, bearing in mind that key competencies are not equally distributed in the different Nordic countries. For instance common Nordic challenges emerge in relation to nuclear installations, where nuclear power plants are in operation in Finland and Sweden, and research reactors have been operated in Denmark, Finland, Norway and Sweden. There is an obvious benefit in exchanging ideas and technologies in relation to plant operation, and since a number of reactors in different Nordic countries are under decommissioning, a collaborative benefit can also be realised in that context. Sweden also has a nuclear fuel production plant, and its collaboration with other Nordic nuclear installations can also be beneficial. Further, a number of large radiological installations are projected in Nordic areas (e.g., the MAX-LAB/MAX IV synchrotron radiation source and the European spallation source ESS), where Nordic organisations are collaborating in addressing, e.g., potential environmental implications. On the emergency preparedness side, the Fukushima accident in March 2011 was a reminder that large accidents at nuclear installations can lead to widespread radioactive contamination in the environment. In order to respond to nuclear or radiological emergencies, should they affect Nordic populations, it is necessary to maintain an operational emergency preparedness. By continuously improving detection, response and decision aiding tools while maintaining an informal collaborative network between relevant stakeholders in the Nordic countries (including

  16. Study of the nuclear potential in the mass region of supercritical systems by means of phenomenological models

    International Nuclear Information System (INIS)

    Seiwert, M.

    1985-01-01

    In the present thesis different potential models were extended up to deformed nuclei. The influence of the deformations, orientations, and the nuclear atmosphere on the nuclear potential were analyzed. The double-folding integral was also solved for adiabatic nuclear shapes. The unrealistic binding-energy contributions occurring in the double-folding model were replaced by realistic binding energies by a renormalization procedure. The extended proximity potential, the renormalized double-folding model, and the Yukawa-plus-exponential model were applied to the calculation of the potential of supercritical systems. The resulting potentials of the different models are nonuniform. (orig./HSI) [de

  17. Reality and prospects of harmonization of nuclear legislation - the point of view of a regional international organization

    International Nuclear Information System (INIS)

    Strohl, P.

    1986-01-01

    What are the origins, the legitimate motivations and the methods applied for harmonising legislation on nuclear energy. Is it desirable to go further in certain fields and for what reasons. The replies to both questions help to better define harmonisation as opposed to unification of nuclear law and highlight the great flexibility of the methods used. The main reasons justifying such harmonisation - settlement of international relations and amelioration of nuclear law - should also serve as guidelines for continuing this work rationally, as regards certain judiciously selected aspects. (orig.) [de

  18. Experiences with IAEA project: TC Regional Project on Quality Control and Quality Assurance for Nuclear Analytical Techniques (RER/2/004)

    International Nuclear Information System (INIS)

    Glavic-Cindro, Denis; Korun, Matjaz

    2002-01-01

    In the TC Regional Project on Quality Control and Quality Assurance for Nuclear Analytical Techniques RER/2/004, 12 laboratories from east and central European countries participated. Within this project 4 workshops, 2 audit inspections and 2 proficiency tests were organized. The aim of this project was to help these laboratories to implement quality assurance system based on the ISO 17025 standard and to help them on the way towards accreditation. (author)

  19. The text of an African regional co-operative agreement for research, development and training related to nuclear science and technology

    International Nuclear Information System (INIS)

    1993-02-01

    The document informs that as of 31 January 1993, the following states sent to the Director General notifications of acceptance of the African Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology: Tunisia, Egypt, Algeria, Nigeria, Madagascar, Libyan Arab Jamahiriya, Morocco, Kenya, Sudan, Ghana, Tanzania, Mauritius, Cameroon, South Africa and Zaire. The Agreement entered into force on 4 April 1990

  20. The text of the agreement to extend the regional co-operative agreement for research, development and training related to nuclear science and technology, 1987

    International Nuclear Information System (INIS)

    1992-09-01

    The document reproduces the text of the Agreement to Extend the Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology, 1987, for a further period of five years with effect from 12 June 1992. Australia, Bangladesh, the People's Republic of China, India, Indonesia, Japan, the Republic of Korea, Malaysia, Pakistan, the Philippines, Singapore, Sri Lanka, Thailand and Viet Nam are parties of this Agreement

  1. The conserved 12-amino acid stretch in the inter-bromodomain region of BET family proteins functions as a nuclear localization signal.

    Science.gov (United States)

    Fukazawa, Hidesuke; Masumi, Atsuko

    2012-01-01

    The bromodomain and extraterminal (BET) family is a group of chromatin-binding proteins characterized by two bromodomains, an extraterminal (ET) domain, and several other conserved regions of unknown function. In humans, the BET family consists of four members, BRD2, BRD3, BRD4 and BRDT, that all normally localize to the nucleus. We identified a 12-amino acid stretch in the inter-bromodomain region that is perfectly conserved among the BET family members. We deleted these residues and expressed the mutant proteins in HEK293T cells to investigate the function of this motif. We found that the deletion of this motif alters the localization of BET proteins. Mutated BRD3 and BRD4 were excluded from the nucleus, and BRDT was found to be diffused throughout the nucleus and cytoplasm. Although the mutant BRD2 remained predominantly in the nucleus, a punctate distribution was also observed in the cytosol. It has been reported that a conserved motif between the second bromodomain and the ET domain serves as a nuclear localization signal for BRD2. Nevertheless, BET mutants lacking the reported nuclear localization signal motif but retaining the 12-amino acid stretch resided in the nucleus. Furthermore, these mutants were diffused throughout the cytoplasm when the 12 residues were removed. These results indicate that the conserved amino acid stretch in the inter-bromodomain region of the BET family functions as a nuclear localization signal.

  2. Nucleolar organizer regions and a new chromosome number for Rhea americana (Aves: Rheiformes

    Directory of Open Access Journals (Sweden)

    Ricardo José Gunski

    1998-06-01

    Full Text Available Sequential banding analysis (Giemsa-C-banding-Ag NOR of chromosomes of the common rhea (Rhea americana was performed. Metaphases were obtained by peripheral blood lymphocyte culture and monolayer embryo cell culture. The diploid chromosome number was 80, different from the 2n = 82 in previous reports. Macrochromosome pairs 1, 2 and 5 were submetacentric and pair 3, subacrocentric. The 4th pair was acrocentric and all of the microchromosomes appeared to be acrocentric, with the exception of a clearly metacentric pair which was fully heterochromatic. The Z was slightly larger than the W, both being acrocentric and C-band negative. Nucleolar organizer regions were observed in the secondary constriction of a microchromosome pair. Correct identification of the NOR-bearing pair was possible only by sequential analyses, Giemsa staining followed by the Ag-NOR technique.Foram efetuadas análises seqüenciais de bandeamento cromossômico (Giemsa-banda-C-AgNOR em material da espécie Rhea americana (ema com o objetivo de identificar os cromossomos portadores de regiões organizadoras de nucléolos e confirmar o cariótipo desta espécie. As metáfases foram obtidas de culturas de leucócitos e de células de embrião. O número diplóide de cromossomos, determinado pela análise de metáfases oriundas de 19 espécimes, foi de 80 (2n = 80, NF = 95, o que difere da literatura. Os pares de macrocromossomos números 1, 2 e 5 eram submetacêntricos e o par 3 era sub-acrocêntrico, confirmado pelo bandeamento C. O par 4 era acrocêntrico, bem como todos os microcromossomos, com exceção de um metacêntrico inteiramente heterocromático. O cromossomo Z era ligeiramente maior que o W, sendo ambos acrocêntricos e banda-C negativos. A região organizadora de nucléolos foi observada na constrição secundária de um par de microcromossomos. A correta identificação do par portador da NOR só foi possível com a utilização da análise seqüencial de colora

  3. Radiation monitoring and dosimetry near the semipalatinsk nuclear test site. Radioecological situation, exposure of the population of the semipalatinsk region

    International Nuclear Information System (INIS)

    Stepanenko, V.F.; Tsyb, A.F.; Bogatyriova, T.I.

    1993-01-01

    Evaluation of radioecological situation around the nuclear test site as well as estimation of radioecological situation after the underground nuclear test of July 8, 1989 has been carried out. Radiation doses received by the public for the period of surface and atmospheric nuclear tests conducted from 1949 until 1963 about 10000 individuals received additional external and internal doses. The highest accumulated effective doses were estimated in the residuals of Dolon (1.6 Gy the first nuclear test of 1949), Karaul (0.37 Gy), Sarzhal (0.20 Gy). Semenovka (0.02 Gy). Yearly effective doses for the residents of Semipalatinsk during that period did not exceed 0.0056 Gy (maximum value). Collective doses were estimated for different periods from 1949 to 1989 too. Results of measuring of the environmental exposure gamma dose rates in the inspected areas and soil, plants, water, milk, meat radioactive contamination are presented too

  4. Avoiding Armageddon: The US Military’s Response to Trans-Regional Nuclear Proliferation in a Post-Soviet World

    Science.gov (United States)

    2016-05-26

    decreased the role of the central government’s economic policies.8 Kryuchokov, as paranoid as westerners would expect the head of the KGB to be, bugged...extremist organizations must overcome to acquire nuclear material. His work approaches the study using a systems analysis, and consequently...nuclear weapons. Understanding the institutional frameworks that have historically succeeded in overcoming actors’ self-interests, we can then extrapolate

  5. Nuclear interaction study around beam pipe region in the Tracker system at CMS with 13 TeV data

    CERN Document Server

    CMS Collaboration

    2015-01-01

    Analysis is presented to study the material in the Tracker system with nuclear interactions from proton-proton collisions recorded by the CMS experiment at the CERN LHC. The data correspond to an integrated luminosity of 7.3 pb$^{-1}$ at a centre-of-mass energy of 13 TeV collected at 3.8 Tesla magnetic field. With reconstructed nuclear interactions we observe the structure of the material, including beam pipe, in the Tracker system.

  6. Long term simulation of {sup 137}Cs radioactivity in the regional ocean following the Fukushima Daiichi nuclear power plant accident

    Energy Technology Data Exchange (ETDEWEB)

    Tsumune, D.; Tsubono, T.; Misumi, K.; Yoshida, Y.; Hayami, H. [Central Research Institute of Electric Power Industry (Japan); Aoyama, M. [Meteorological Research Institute (Japan); Uematsu, M. [University of Tokyo (Japan); Maeda, Y. [CERES, Inc. (Japan)

    2014-07-01

    A series of accidents at the Fukushima Dai-ichi Nuclear Power Plant following the earthquake and tsunami of 11 March 2011 resulted in the release of radioactive materials to the ocean by two major pathways, direct release from the accident site and atmospheric deposition. A regional-scale simulation of {sup 137}Cs activity in the ocean offshore of Fukushima was carried out, the sources of radioactivity being direct release, atmospheric deposition, and the inflow of {sup 137}Cs deposited on the ocean by atmospheric deposition outside the domain of the model for more than two years. Direct releases of {sup 131}I, {sup 134}Cs, and {sup 137}Cs were estimated for 1 year after the accident by comparing simulated results and measured activities. The estimated total amounts of directly released {sup 131}I, {sup 134}Cs, and {sup 137}Cs were 11.1±2.2 PBq, 3.5±0.7 PBq, and 3.6±0.7 PBq, respectively. The contributions of each source were estimated by analysis of {sup 131}I/{sup 137}Cs and {sup 134}Cs/{sup 137}Cs activity ratios and comparisons between simulated results and measured activities of {sup 137}Cs. Simulated {sup 137}Cs activities attributable to direct release were in good agreement with measured activities close to the accident site, a result that implies that the estimated direct release rate was reasonable, while simulated {sup 137}Cs activities attributable to atmospheric deposition were low compared to measured activities. The rate of atmospheric deposition onto the ocean was underestimated because of a lack of measurements of deposition onto the ocean when atmospheric deposition rates were being estimated. Measured {sup 137}Cs activities attributable to atmospheric deposition helped to improve the accuracy of simulated atmospheric deposition rates. Simulated {sup 137}Cs activities attributable to the inflow of {sup 137}Cs deposited onto the ocean outside the domain of the model were in good agreement with measured activities in the open ocean within the

  7. A map of nuclear matrix attachment regions within the breast cancer loss-of-heterozygosity region on human chromosome 16q22.1

    DEFF Research Database (Denmark)

    Shaposhnikov, Sergey A.; Akopov, Sergey B.; Chernov, Igor P.

    2007-01-01

    There is abundant evidence that the DNA in eukaryotic cells is organized into loop domains that represent basic structural and functional units of chromatin packaging. To explore the DNA domain organization of the breast cancer loss-of-heterozygosity region on human chromosome 16q22.1, we have...... in the region are regulated and of how the structural architecture and functional organization of the DNA are related....... identified a significant portion of the scaffold/matrix attachment regions (S/MARs) within this region. Forty independent putative S/MAR elements were assigned within the 16q22.1 locus. More than 90% of these S/MARs are AT rich, with GC contents as low as 27% in 2 cases. Thirty-nine (98%) of the S...

  8. Contribution of the C-terminal tri-lysine regions of human immunodeficiency virus type 1 integrase for efficient reverse transcription and viral DNA nuclear import

    Directory of Open Access Journals (Sweden)

    Fowke Keith R

    2005-10-01

    Full Text Available Abstract Background In addition to mediating the integration process, HIV-1 integrase (IN has also been implicated in different steps during viral life cycle including reverse transcription and viral DNA nuclear import. Although the karyophilic property of HIV-1 IN has been well demonstrated using a variety of experimental approaches, the definition of domain(s and/or motif(s within the protein that mediate viral DNA nuclear import and its mechanism are still disputed and controversial. In this study, we performed mutagenic analyses to investigate the contribution of different regions in the C-terminal domain of HIV-1 IN to protein nuclear localization as well as their effects on virus infection. Results Our analysis showed that replacing lysine residues in two highly conserved tri-lysine regions, which are located within previously described Region C (235WKGPAKLLWKGEGAVV and sequence Q (211KELQKQITK in the C-terminal domain of HIV-1 IN, impaired protein nuclear accumulation, while mutations for RK263,4 had no significant effect. Analysis of their effects on viral infection in a VSV-G pseudotyped RT/IN trans-complemented HIV-1 single cycle replication system revealed that all three C-terminal mutant viruses (KK215,9AA, KK240,4AE and RK263,4AA exhibited more severe defect of induction of β-Gal positive cells and luciferase activity than an IN class 1 mutant D64E in HeLa-CD4-CCR5-β-Gal cells, and in dividing as well as non-dividing C8166 T cells, suggesting that some viral defects are occurring prior to viral integration. Furthermore, by analyzing viral DNA synthesis and the nucleus-associated viral DNA level, the results clearly showed that, although all three C-terminal mutants inhibited viral reverse transcription to different extents, the KK240,4AE mutant exhibited most profound effect on this step, whereas KK215,9AA significantly impaired viral DNA nuclear import. In addition, our analysis could not detect viral DNA integration in each C

  9. The effects of the final disposal facility for spent nuclear fuel on regional economy; Kaeytetyn ydinpolttoaineen loppusijoituslaitoksen aluetaloudelliset vaikutukset

    Energy Technology Data Exchange (ETDEWEB)

    Laakso, S. [Seppo Laakso Urban Research (Finland)

    1999-03-01

    The study deals with the economic effects of the final disposal facility for spent nuclear fuel on the alternative location municipalities - Eurajoki, Kuhmo, Loviisa and Aeaenekoski - and their neighbouring areas (in Finland). The economic influence of the facility on industrials, employment, population, property markets, community structure and local public economics are analysed applying the approach of regional economics. The evaluation of the facility`s effects on employment is based on the input-output analysis. Both the direct and indirect effects of the construction and the functioning of the facility are taken into account in the analysis. According to the results the total increase in employment caused by the construction of the facility is about 350 persons annually, at national level. Some 150 persons of this are estimated to live in the wider region and 100-150 persons in the facility`s influence area consisting of the location municipality and neighbouring municipalities. This amount is reached at the top stage of construction (around the year 2018). At the production stage - after the year 2020 - the facility`s effects on employment will be concentrated significantly more on the location municipality and the rest of the influence area than on the rest of the country, compared with the construction stage. The estimated employment growth in the production stage is approximately 160 persons at national level of which 100-120 persons live in the candidate municipality and in the rest of the influence area. There is a direct link between local employment and population development. The growth of jobs attracts immigrants affecting the development of both the number and the structure of population. The facility`s effects on population development in the alternative location municipalities are analysed using comparative population forecasts based on demographic population projection methods. According to the results the job growth caused by the facility will

  10. Report on the 14{sup th} regional conference of the German Branch of the International Nuclear Law Association; Aus der Werkstatt des Nuklearrechts. Bericht ueber die 14. Regionaltagung der Deutschen Landesgruppe der AIDN/INLA

    Energy Technology Data Exchange (ETDEWEB)

    Feldmann, Ulrike

    2015-12-15

    The 14th Regional Conference of the German National Group of the Association Internationale du Droit Nucleaire/International Nuclear Law Association was held in Nuremberg on 28 and 29 September 2015. About 100 participants from Germany and abroad participated the conference. The topics of the five Working sessions were: - Turnkey - a viable contractual concept for nuclear new build and decommissioning?; - Access to justice in environmental law and related to international investments disputes; - Nuclear Liability - Latest Developments; - Legal requirements on the final disposal of nuclear waste - a Global overview; - Nuclear Safety in the EU.

  11. A status and strategy for nuclear technical cooperation with the U.S.A and other countries in the region

    International Nuclear Information System (INIS)

    Kim, Kyoung Pyo; Kim, Young Min

    1998-12-01

    The seven Joint Coordination Committee between R.O.K. and other countries, including U.S. and Canada are currently in operation for peaceful use of atomic energy. Among these, the most amicable and fruitful committees are the R.O.K-U.S.A joint standing committee on nuclear energy cooperation (JSCNEC) and R.O.K-Canada joint coordinated committee. Various matters encompassing 8 policy matters, 14 technological cooperation matters, 13 nuclear safety cooperation matters and 6 safeguards matters were discussed at the 19th R.O.K.-U.S.A. JSCNEC held June 22-26 in Seoul and Taejon. Among these, matters related to KAERI are the 13 technical cooperation and 2 nuclear safety cooperation concerns. (author). 10 refs., 5 tabs., 2 figs

  12. Papers of the Fifth Annual Congress of the Sociedad Mexicana de Seguridad Radiologica, A.C., 2. Regional Congress on Radiological and Nuclear Safety. Vol. 2 (pt.2)

    International Nuclear Information System (INIS)

    1993-11-01

    The fulfillment of the Fifth Annual Congress of the Sociedad Mexicana de Seguridad Radiologica, A.C., this time inside the frame of the Second Regional Congress of Radiological and Nuclear Safety, is no doubt an event that approach us to make of this forum the most important for the exchange of ideas and the approaching among the members of our nuclear community. This time, the beautiful colonial city of Zacatecas, welcome us for this event, gathering fifty works in the areas of fuel cycle, power reactor operation, reactor physics, research reactors, transient analysis and instrumentation and experimental techniques. This significant number of works reaffirm the great interest of the nuclear community in to take part, presenting its most recent developments. The reporting belongs to seven of the main institutions of the country who dedicate, or are related with the technological development of the nuclear area and its different branches. With regard to participants of foreign countries, papers representing to Argentina, Brazil, Chile, United States of North America and Peru are included. The efforts of all the members of the Sociedad Mexicana de Seguridad Radiologica, A.C. has been addressed to do of the event a mean to make easy the exchange of ideas and to get acquainted with the work of other colleagues, in an ambient of warmth and surmounting. (Author)

  13. Thyroid abnormality trend over time in northeastern regions of Kazakstan, adjacent to the Semipalatinsk nuclear test site. A case review of pathological findings for 7271 patients

    International Nuclear Information System (INIS)

    Zhumadilov, Z.; Gusev, B.I.; Takada, Jun; Hoshi, Masaharu; Kimura, Akiro; Hayakawa, Norihiko; Takeichi, Nobuo

    2000-01-01

    From 1949 through 1989 nuclear weapons testing carried out by the former Soviet Union at the Semipalatinsk Nuclear Test Site (SNTS) resulted in local fallout affecting the residents of Semipalatinsk, Ust-Kamenogorsk and Pavlodar regions of Kazakstan. To investigate the possible relationship between radiation exposure and thyroid gland abnormalities, we conducted a case review of pathological findings of 7271 urban and rural patients who underwent surgery from 1966-96. Of the 7271 patients, 761 (10.5%) were men, and 6510 (89.5%) were women. The age of the patients varied from 15 to 90 years. Overall, a diagnosis of adenomatous goiter (most frequently multinodular) was found in 1683 patients (63.4%) of Semipalatinsk region, in 2032 patients (68.6%) of Ust-Kamenogorsk region and in 1142 patients (69.0%) of Pavlodar region. In the period 1982-96, as compared before, there was a noticeable increase in the number of cases of Hashimoto's thyroiditis and thyroid cancer. Among histological forms of thyroid cancer, papillary (48.1%) and follicular (33.1%) predominated in the Semipalatinsk region. In later periods (1987-96), an increased frequency of abnormal cases occurred among patients less than 40 years of age, with the highest proportion among patients below 20 in Semipalatinsk and Ust-Kamenogorsk regions of Kazakstan. Given the positive findings of a significant cancer-period interaction, and a significant trend for the proportion of cancer to increase over time, we recommend more detailed and etiologic studies of thyroid disease among populations exposed to radiation fallout from the SNTS in comparison to non-exposed population. (author)

  14. Thyroid abnormality trend over time in northeastern regions of Kazakstan, adjacent to the Semipalatinsk nuclear test site. A case review of pathological findings for 7271 patients

    Energy Technology Data Exchange (ETDEWEB)

    Zhumadilov, Z. [Semipalatinsk State Medical Academy (Kazakstan); Gusev, B.I.; Takada, Jun; Hoshi, Masaharu; Kimura, Akiro; Hayakawa, Norihiko; Takeichi, Nobuo

    2000-03-01

    From 1949 through 1989 nuclear weapons testing carried out by the former Soviet Union at the Semipalatinsk Nuclear Test Site (SNTS) resulted in local fallout affecting the residents of Semipalatinsk, Ust-Kamenogorsk and Pavlodar regions of Kazakstan. To investigate the possible relationship between radiation exposure and thyroid gland abnormalities, we conducted a case review of pathological findings of 7271 urban and rural patients who underwent surgery from 1966-96. Of the 7271 patients, 761 (10.5%) were men, and 6510 (89.5%) were women. The age of the patients varied from 15 to 90 years. Overall, a diagnosis of adenomatous goiter (most frequently multinodular) was found in 1683 patients (63.4%) of Semipalatinsk region, in 2032 patients (68.6%) of Ust-Kamenogorsk region and in 1142 patients (69.0%) of Pavlodar region. In the period 1982-96, as compared before, there was a noticeable increase in the number of cases of Hashimoto's thyroiditis and thyroid cancer. Among histological forms of thyroid cancer, papillary (48.1%) and follicular (33.1%) predominated in the Semipalatinsk region. In later periods (1987-96), an increased frequency of abnormal cases occurred among patients less than 40 years of age, with the highest proportion among patients below 20 in Semipalatinsk and Ust-Kamenogorsk regions of Kazakstan. Given the positive findings of a significant cancer-period interaction, and a significant trend for the proportion of cancer to increase over time, we recommend more detailed and etiologic studies of thyroid disease among populations exposed to radiation fallout from the SNTS in comparison to non-exposed population. (author)

  15. Population structure of the African savannah elephant inferred from mitochondrial control region sequences and nuclear microsatellite loci

    DEFF Research Database (Denmark)

    Nyakaana, S; Arctander, P; Siegismund, H R

    2002-01-01

    Two hundred and thirty-six mitochondrial DNA nucleotide sequences were used in combination with polymorphism at four nuclear microsatellite loci to assess the amount and distribution of genetic variation within and between African savannah elephants. They were sampled from 11 localities in easter...

  16. SOX9 is an astrocyte-specific nuclear marker in the adult brain outside the neurogenic regions

    DEFF Research Database (Denmark)

    Sun, Wei; Cornwell, Adam; Li, Jiashu

    2017-01-01

    transporter 1 (GLT1), aquaporin-4, aldehyde dehydrogenase 1 family member L1, and other proteins. However, these proteins may all be regulated both developmentally and functionally, restricting their utility. To identify a nuclear marker pathognomonic of astrocytic phenotype, we assessed differential RNA...

  17. The nuclear research in Mexico (1986-1994). Bibliometrics of papers published in journals outside of the Latin American region; La investigacion nuclear en Mexico (1986-1994). Bibliometria de trabajos publicados en revistas fuera de la region latinoamericana

    Energy Technology Data Exchange (ETDEWEB)

    Garrido R, S A

    2007-07-01

    Mexican research in nuclear science during 1986-1994 has been studied through the bibliometric analysis of the output of scientific papers published by Mexican institutions in non Latin American journals of international circulation. Bibliographic references were compiled from the International Nuclear Information System (INIS) database as well as from proceedings and annual reports of Mexican research institutions within the field of interest. After careful normalization, data from the 920 detected papers were keyboarded and checked in a database used for the evaluation of the number of papers by discipline, source institutions and departments, authors, coauthors, publication year as well as publishing journals and their geographic origin, language of publication and the interactions of all these parameters. Results were expressed in reports, and summarized in tables and figures to visualize the state of this research field in Mexico. (Author)

  18. Nuclear safety assessment of nuclear power plants and nuclear risk in Eastern Europe and other regions. Scientific-technical cooperation with nuclear regulatory authorities and technical support organizations (TSOs); Einschaetzung der nuklearen Sicherheit von Kernkraftwerken sowie nuklearer Risiken in Osteuropa und anderen Regionen. Wissenschaftlich-technische Zusammenarbeit mit atomrechtlichen Behoerden und deren Sachverstaendigenorganisationen (TSO)

    Energy Technology Data Exchange (ETDEWEB)

    Wolff, Holger

    2014-09-15

    The BMUB/BfS project 3611I01512 formed the frame of the GRS for the scientifictechnical cooperation with Technical Support Organisations and Nuclear Regulatory Authorities in the field of nuclear safety of NPPs and for the evaluation of nuclear risks in Eastern Europe and other regions for the period from September 2011 till June 2014. In the present final report main results of the project are described. The project comprised the following technical topics: - Record status of NPP modernisation programs, Monitoring and evaluation of modernisation programs; - Design basis and severe accident analyses for NPP with PWR (WWER-440, WWER-1000); - Cooperation with INSC partner countries on DBA, BDBA and severe accident analyses for WWER plants of generation 3+ and on building NRA and safety evaluation capacities; - Decommissioning of nuclear facilities and disposal of radioactive waste; - Evaluation of new reactor concepts and their safety design; Panels at regulatory level. The work results are preceded by a summary on the activities related to the project management and to the planning of the bilateral work.

  19. The Penly nuclear power plant, at the service of a safe, competitive and CO2-free power generation in the heart of the Haute Normandie region

    International Nuclear Information System (INIS)

    2010-01-01

    In less than 20 years, Electricite de France (EDF) has built up a competitive park of 58 nuclear power plants, with no equivalent elsewhere, which represents an installed power of 63.1 GW (85% of EDF's power generation). Inside this nuclear park, the national power generation centre of Penly comprises 2 production units of 1300 MW each (2600 MW as a whole). The facility generated 18.5 billion kWh in 2009, i.e. 3.57% of the French national power generation and 80% of the energy consumed in the Haute-Normandie region. This brochure presents the life of the power plant under various aspects: power generation, safety priority and culture, maintenance investments, respect of the environment, long-term fuel and wastes management, local economical involvement, transparency and public information, key figures and dates. (J.S.)

  20. The Blayais nuclear power plant, at the service of a safe, competitive and CO2-free power generation in the heart of the Aquitaine region

    International Nuclear Information System (INIS)

    2010-01-01

    In less than 20 years, Electricite de France (EDF) has built up a competitive park of 58 nuclear power plants, with no equivalent elsewhere, which represents an installed power of 63.1 GW (85% of EDF's power generation). Inside this nuclear park, the national power generation centre of Blayais comprises 4 production units of 900 MW each (3600 MW as a whole). The facility generated 21.3 billion kWh in 2009, i.e. 5.5% of the French national power generation and 1.2 times the energy consumed in the Aquitaine region. This brochure presents the life of the power plant under various aspects: power generation, safety priority and culture, maintenance investments, respect of the environment, long-term fuel and wastes management, local economical involvement, transparency and public information, key figures and dates. (J.S.)

  1. The Paluel nuclear power plant, at the service of a safe, competitive and CO2-free power generation in the heart of the Haute Normandie region

    International Nuclear Information System (INIS)

    2010-01-01

    In less than 20 years, Electricite de France (EDF) has built up a competitive park of 58 nuclear power plants, with no equivalent elsewhere, which represents an installed power of 63.1 GW (85% of EDF's power generation). Inside this nuclear park, the national power generation centre of Paluel comprises 4 production units of 1300 MW each (5200 MW as a whole). The facility generated 29.5 billion kWh in 2009, i.e. about 7% of the French national power generation and 35% of the energy produced in the Normandie region. This brochure presents the life of the power plant under various aspects: power generation, safety priority and culture, maintenance investments, respect of the environment, long-term fuel and wastes management, local economical involvement, transparency and public information, key figures and dates. (J.S.)

  2. The Bugey nuclear power plant, at the service of a safe, competitive and CO2-free power generation in the heart of the Rhone-Alpes region

    International Nuclear Information System (INIS)

    2010-01-01

    In less than 20 years, Electricite de France (EDF) has built up a competitive park of 58 nuclear power plants, with no equivalent elsewhere, which represents an installed power of 63.1 GW (85% of EDF's power generation). Inside this nuclear park, the national power generation centre of Bugey comprises 4 production units of 900 MW each (3600 MW as a whole). The facility generated 20.87 billion kWh in 2009, i.e. 5% of the French national power generation and 40% of the energy consumed in the Rhone-Alpes region. This brochure presents the life of the power plant under various aspects: power generation, safety priority and culture, maintenance investments, respect of the environment, long-term fuel and wastes management, local economical involvement, transparency and public information, key figures and dates. (J.S.)

  3. The Fessenheim nuclear power plant, at the service of a safe, competitive and CO2-free power generation in the heart of the Alsace region

    International Nuclear Information System (INIS)

    2010-01-01

    In less than 20 years, Electricite de France (EDF) has built up a competitive park of 58 nuclear power plants, with no equivalent elsewhere, which represents an installed power of 63.1 GW (85% of EDF's power generation). Inside this nuclear park, the national power generation centre of Fessenheim comprises two production units of 900 MW each (1800 MW as a whole). The facility generated 8.7 billion kWh in 2009, i.e. 70% of the energy consumed in the Alsace region. This brochure presents the life of the power plant under various aspects: power generation, safety priority and culture, maintenance investments, respect of the environment, long-term fuel and wastes management, local economical involvement, transparency and public information, key figures and dates. (J.S.)

  4. The Golfech nuclear power plant, at the service of a safe, competitive and CO2-free power generation in the heart of the Midi-Pyrenees region

    International Nuclear Information System (INIS)

    2010-01-01

    In less than 20 years, Electricite de France (EDF) has built up a competitive park of 58 nuclear power plants, with no equivalent elsewhere, which represents an installed power of 63.1 GW (85% of EDF's power generation). Inside this nuclear park, the national power generation centre of Golfech comprises two production units of 1300 MW each (2600 MW as a whole). The facility generated 19.7 billion kWh in 2009, i.e. more than 5% of the French national power generation and 100% of the energy consumed in the Midi-Pyrenees region. This brochure presents the life of the power plant under various aspects: power generation, safety priority and culture, maintenance investments, respect of the environment, long-term fuel and wastes management, local economical involvement, transparency and public information, key figures and dates. (J.S.)

  5. The Text of the Third Agreement to Extend the 1987 Regional Co-operative Agreement for Research, Development and Training related to Nuclear Science and Technology (RCA). Latest Status. Extension of Agreement

    International Nuclear Information System (INIS)

    2002-01-01

    The text of the Third Agreement to Extend the 1987 Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology, t he 1987 RCA , is reproduced herein for the information of all Members [es

  6. The Text of the Fifth Agreement to Extend the 1987 Regional Cooperative Agreement for Research, Development and Training Related to Nuclear Science and Technology (RCA). Extension of Agreement. Latest Status

    International Nuclear Information System (INIS)

    2012-01-01

    The Text of the Fifth Agreement to Extend the 1987 Regional Cooperative Agreement for Research, Development and Training Related to Nuclear Science and Technology (RCA). Extension of Agreement. Latest Status [es

  7. The Text of the Fourth Agreement to Extend the 1987 Regional Co-operative Agreement for Research, Development and Training related to Nuclear Science and Technology (RCA). Extension of Agreement. Latest Status

    International Nuclear Information System (INIS)

    2007-01-01

    The text of the Fourth Agreement to Extend the 1987 Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology, 'the 1987 RCA', is reproduced herein for the information of all Members [es

  8. The Text of the Fourth Agreement to Extend the 1987 Regional Co-operative Agreement for Research, Development and Training related to Nuclear Science and Technology (RCA). Extension of Agreement. Latest Status

    International Nuclear Information System (INIS)

    2007-01-01

    The text of the Fourth Agreement to Extend the 1987 Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology, 'the 1987 RCA', is reproduced herein for the information of all Members

  9. The text of the Agreement to Extend the Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology, 1987. Status of acceptances as of 28 February 1993

    International Nuclear Information System (INIS)

    1993-04-01

    The document gives the status of acceptances as of 28 February 1993 of the agreement to extend regional co-operative agreement for research, development and training related to nuclear science and technology from 1987

  10. Siting and Transportation for Consolidated Used Nuclear Fuel Management Facilities: A Proposed Approach for a Regional Initiative to Begin the Dialogue - 13562

    Energy Technology Data Exchange (ETDEWEB)

    Thrower, Alex W. [The Thrower Group LLC, Richmond, VA (United States); Janairo, Lisa [Council of State Governments-Midwestern Office, Sheboygan, WI (United States)

    2013-07-01

    The Blue Ribbon Commission on America's Nuclear Future (BRC) was formed in January 2010 to conduct a comprehensive review of policies for managing the back end of the nuclear fuel cycle, and to develop a new national strategy. Over two years, the BRC held dozens of meetings and heard from hundreds of Federal, State, Tribal, and local officials, as well as representatives of trade and labor organizations, technical groups, non-governmental organizations, and other stakeholders. The Commission's final report (issued January 26, 2012) offers a strategy to resolve longstanding challenges to responsible management of the United States' nuclear waste legacy. The Commission recommended Congressional action to rewrite parts of the Nuclear Waste Policy Act (NWPA); however, a comprehensive legislative overhaul will likely take years to fully implement. The nature and characteristics of nuclear waste, the activities that generated it, and the past history of federal efforts to manage the waste make it virtually certain that finding workable solutions will be controversial and difficult. As the BRC report suggests, this difficulty can be made insurmountable if top-down, federally-mandated efforts are forced upon unwilling States, Tribes, and local communities. Decades of effort and billions of ratepayer and taxpayer dollars have been spent attempting to site and operate spent fuel storage and disposal facilities in this manner. The experience thus far indicates that voluntary consent and active partnership of States, Tribes, and local governments in siting, designing, and operating such facilities are critical. Some States, Tribes, and local communities have indicated that, given adequate scientific and technical information, along with appropriate incentives, assurances, and authority, they might be willing to consider hosting facilities for consolidated storage and disposal of spent nuclear fuel. The authors propose a new regional approach to identifying and

  11. Siting and Transportation for Consolidated Used Nuclear Fuel Management Facilities: A Proposed Approach for a Regional Initiative to Begin the Dialogue - 13562

    International Nuclear Information System (INIS)

    Thrower, Alex W.; Janairo, Lisa

    2013-01-01

    The Blue Ribbon Commission on America's Nuclear Future (BRC) was formed in January 2010 to conduct a comprehensive review of policies for managing the back end of the nuclear fuel cycle, and to develop a new national strategy. Over two years, the BRC held dozens of meetings and heard from hundreds of Federal, State, Tribal, and local officials, as well as representatives of trade and labor organizations, technical groups, non-governmental organizations, and other stakeholders. The Commission's final report (issued January 26, 2012) offers a strategy to resolve longstanding challenges to responsible management of the United States' nuclear waste legacy. The Commission recommended Congressional action to rewrite parts of the Nuclear Waste Policy Act (NWPA); however, a comprehensive legislative overhaul will likely take years to fully implement. The nature and characteristics of nuclear waste, the activities that generated it, and the past history of federal efforts to manage the waste make it virtually certain that finding workable solutions will be controversial and difficult. As the BRC report suggests, this difficulty can be made insurmountable if top-down, federally-mandated efforts are forced upon unwilling States, Tribes, and local communities. Decades of effort and billions of ratepayer and taxpayer dollars have been spent attempting to site and operate spent fuel storage and disposal facilities in this manner. The experience thus far indicates that voluntary consent and active partnership of States, Tribes, and local governments in siting, designing, and operating such facilities are critical. Some States, Tribes, and local communities have indicated that, given adequate scientific and technical information, along with appropriate incentives, assurances, and authority, they might be willing to consider hosting facilities for consolidated storage and disposal of spent nuclear fuel. The authors propose a new regional approach to identifying and resolving issues

  12. Role of proper response schemes, legislation and regional co-operation in combating illicit trafficking of nuclear materials in developing countries

    International Nuclear Information System (INIS)

    Sterzov, A.

    2003-01-01

    Bulgaria's geographical location - between Europe, the former Soviet Union, and the Middle East - exposes it to much illegal trafficking: of people, arms, drugs, etc. The trafficking of nuclear and radioactive materials in Bulgaria can be divided in two main parts - internal and transit. Internal trafficking consists of stolen radioactive sources such as counters and densitometers, irradiation devices, tools for removing static electricity, and smoke detectors, which mainly contain the isotopes 137 Cs, 60 Co, 192 Ir, 226 Ra and 241 Am. The external trafficking of illicit nuclear materials is connected with transfer of raw materials and expensive metals from the former Soviet Union to countries in Western Europe and the Middle East, including aluminium, osmium, caesium, scandium, rare earth elements, red mercury, plutonium and enriched uranium. Detecting internal and external trafficking poses serious problems for the Bulgarian authorities, in terms of equipment and qualified personnel at the borders and inside the country. Developing countries need protocols for detecting and responding to illicit trafficking of nuclear materials, which is a new threat that requires rapid implementation of comprehensive measures and efforts, novel approaches, coordination of services and institutions, and even new legislation. The paper describes a three step model for better and more rapid responses for combating illicit nuclear trafficking in Bulgaria.The steps involve developing first response protocols, using nondestructive analytical means to categorize materials on-site, followed by in-depth analysis. It is also important to initiate contacts with neighbouring countries to foster regional collaboration among law enforcement agencies, customs authorities, analytical laboratories, etc., to improve efficiency in combating illicit trafficking of nuclear materials. (author)

  13. The regional co-operative agreement for research, development and training related to nuclear science and technology

    International Nuclear Information System (INIS)

    Fowler, E.

    1978-01-01

    The history of the Agreement, known as the RCA, is given and the operation of the Agreement, its achievements and current projects are described. The Agreement entered into force in 1972 for a period of five years and has been extended for an additional five years. Any IAEA Member State in the area of South Asia, South East Asia, the Pacific and the Far East may become a party to the Agreement. The purpose of the Agreement is to promote and co-ordinate research, development and training projects in nuclear science and technology through co-operation between the appropriate national institutions and with the assistance of the IAEA. The current RCA co-operative projects cover a broad spectrum of technologies and interests, among which are: food and agriculture, medicine, environmental research, industrial applications, training, research reactor use including radioisotope production, and physical research such as nuclear data programs

  14. The nuclear research in Mexico (1986-1994). Bibliometrics of papers published in journals outside of the Latin American region

    International Nuclear Information System (INIS)

    Garrido R, S.A.

    2007-01-01

    Mexican research in nuclear science during 1986-1994 has been studied through the bibliometric analysis of the output of scientific papers published by Mexican institutions in non Latin American journals of international circulation. Bibliographic references were compiled from the International Nuclear Information System (INIS) database as well as from proceedings and annual reports of Mexican research institutions within the field of interest. After careful normalization, data from the 920 detected papers were keyboarded and checked in a database used for the evaluation of the number of papers by discipline, source institutions and departments, authors, coauthors, publication year as well as publishing journals and their geographic origin, language of publication and the interactions of all these parameters. Results were expressed in reports, and summarized in tables and figures to visualize the state of this research field in Mexico. (Author)

  15. Elastic pp scattering in the Coulomb-nuclear interference region and low energy behaviour of p-barp scattering partial amplitudes

    International Nuclear Information System (INIS)

    Kudryavtsev, A.E.; Markushin, V.E.

    1985-01-01

    The experimental data on the low energy elastic p-barp scattering in the Coulomb-nuclear interference region and on the shift and width of the 1s level of p-barp-atom are analysed. The partial wave amplitudes for l=0.1 are extracted. The p-wave amplitude is in fair agreement with the atomic data for the 2p state and exhibits some energy structure. It is shown that the real-to-imaginary ratio of the p-barp forward elastic-scattering amplitude becomes negative in an energy interval just near p-barp-threshold

  16. Extension of the African Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology (AFRA)

    International Nuclear Information System (INIS)

    1998-01-01

    As of 4 May 1998, notifications of acceptance of the extension of the African Regional Co-operative Agreement for Research, development and Training Related to Nuclear Science and Technology (INFCIRC/377), had been received by the Director General of the IAEA from the Governments of 22 African States. Zimbabwe is added to the list of 21 States reported in the previous edition (add. 9) to this document. Extension entered into force on 4 April 1995, upon expiration of the original Agreement, and will remain in force for an additional period of 5 years, i.e. through 3 April 2000

  17. Extension of the African Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology (AFRA)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-05-15

    As of 4 May 1998, notifications of acceptance of the extension of the African Regional Co-operative Agreement for Research, development and Training Related to Nuclear Science and Technology (INFCIRC/377), had been received by the Director General of the IAEA from the Governments of 22 African States. Zimbabwe is added to the list of 21 States reported in the previous edition (add. 9) to this document. Extension entered into force on 4 April 1995, upon expiration of the original Agreement, and will remain in force for an additional period of 5 years, i.e. through 3 April 2000

  18. Proceedings of International monitoring conference 'Development of rehabilitation methodology of environment of the Semipalatinsk region polluted by nuclear tests'

    International Nuclear Information System (INIS)

    2002-01-01

    The aim of the monitoring conference is draw an attention of government, national and international agencies, scientific societies, and local administrations to the ecological problems of Semipalatinsk nuclear test site, to combine the efforts of scientists to solve problems of soil disinfection, purification of surface and ground water from radioactive and heavy metals. It is expected that the knowledge, experience and methodology accumulated on the monitoring conference might be successfully transferred to solve analogous environmental problems of Kazakhstan

  19. Main internal dose-forming factors for inhabitants of contaminated regions at current phase of the Chernobyl nuclear power plant accident (Kyiv region as an example)

    International Nuclear Information System (INIS)

    Vasilenko, V.V.; Nechajev, S.Yu.; Tsigankov, M.Ya.; And others

    2015-01-01

    Objective of this work is revealing of main dose"forming factors of internal doses for inhabitants of contaminated regions of Kyiv region relying on the results of integral dosimetric monitoring. Three villages have been chosen for the investigation. They are: Raghivka, Zelena Poliana (Poliske district), Karpylivka (Ivankiv district). Twice a year, in May and in October those villages' residents were inspected for content of incorporated "1"3"7Cs. They were measured by direct method at the place of residence with the help of whole body counters (WBC). The principal food samples were collected for detection of "9"0Sr and "1"3"7Cs content. Those villages' inhabitants were interviewed about food consumption levels. Mathematical, dosimetric and radio-chemical methods were used in this work. The estimation of internal doses due to intake of "1"3"7Cs by ingestion of milk and potatoes are in the range 0.3-34% of doses estimated on the base of WBC data. The contribution to the dose of internal exposure from intake of "1"3"7Cs with the milk consumption is no more than two times higher than the contribution of potatoes consumption in the case of equal consumption levels of these products. Contributions to the dose of internal exposure from intake of "9"0Sr with milk and potatoes consumptions are approximately similar. Consumption of mushrooms and other wild nature products by inhabitants from the inspected settlements is the main forming factor of internal dose due to "1"3"7Cs intake

  20. Regional and international implications of the Iranian nuclear crisis; Les implications regionales et internationales de la crise nucleaire iranienne

    Energy Technology Data Exchange (ETDEWEB)

    Reveillard, Ch

    2006-07-15

    Iran is distinguished in the Middle East and the world by its geopolitical situation, qualified Middle Empire of the crossed worlds, which are all among the most active zones of the planet on the geopolitical and strategic plans. It undergoes on the one hand, region-al influences and inevitably in return acts in-depth on economic, strategic, diplomatic and cultural reality of its regional space made up of the three wholes: Central Asia, The Middle East, Persian Gulf open on the Indian Ocean. In addition, the singularity of its national policy, that tries to make move back the Anglo-Saxon impregnation of re-modelling the Middle East and the containment of the regional powers. (author)

  1. Analyzing power measurement of pp elastic scattering in the Coulomb-nuclear interference region with the 200-GeV/c polarized-proton beam at Fermilab

    International Nuclear Information System (INIS)

    Akchurin, N.; Langland, J.; Onel, Y.; Bonner, B.E.; Corcoran, M.D.; Cranshaw, J.; Nessi-Tedaldi, F.; Nessi, M.; Nguyen, C.; Roberts, J.B.; Skeens, J.; White, J.L.; Bravar, A.; Giacomich, R.; Penzo, A.; Schiavon, P.; Zanetti, A.; Bystricky, J.; Lehar, F.; de Lesquen, A.; van Rossum, L.; Cossairt, J.D.; Read, A.L.; Derevschikov, A.A.; Matulenko, Y.A.; Meschanin, A.P.; Nurushev, S.B.; Patalakha, D.I.; Rykov, V.L.; Solovyanov, V.L.; Vasiliev, A.N.; Grosnick, D.P.; Hill, D.A.; Laghai, M.; Lopiano, D.; Ohashi, Y.; Shima, T.; Spinka, H.; Stanek, R.W.; Underwood, D.G.; Yokosawa, A.; Funahashi, H.; Goto, Y.; Imai, K.; Itow, Y.; Makino, S.; Masaike, A.; Miyake, K.; Nagamine, T.; Saito, N.; Yamashita, S.; Iwatani, K.; Kuroda, K.; Michalowicz, A.; Luehring, F.C.; Miller, D.H.; Maki, T.; Pauletta, G.; Rappazzo, G.F.; Salvato, G.; Takashima, R.

    1993-01-01

    The analyzing power A N of proton-proton elastic scattering in the Coulomb-nuclear interference region has been measured using the 200-GeV/c Fermilab polarized proton beam. A theoretically predicted interference between the hadronic non-spin-flip amplitude and the electromagnetic spin-flip amplitude is shown for the first time to be present at high energies in the region of 1.5x10 -3 to 5.0x10 -2 (GeV/c) 2 four-momentum transfer squared, and our results are analyzed in connection with theoretical calculations. In addition, the role of possible contributions of the hadronic spin-flip amplitude is discussed

  2. Nuclear ribosomal internal transcribed spacer 1 (ITS1) variation in the Anastrepha fraterculus cryptic species complex (Diptera, Tephritidae) of the Andean region

    Science.gov (United States)

    Sutton, Bruce D.; Steck, Gary J.; Norrbom, Allen L.; Rodriguez, Erick J.; Srivastava, Pratibha; Alvarado, Norma Nolazco; Colque, Fredy; Landa, Erick Yábar; Sánchez, Juan José Lagrava; Quisberth, Elizabeth; Peñaranda, Emilio Arévalo; Clavijo, P. A. Rodriguez; Alvarez-Baca, Jeniffer K.; Zapata, Tito Guevara; Ponce, Patricio

    2015-01-01

    Abstract The nuclear ribosomal internal transcribed spacer 1 (ITS1) was sequenced for Anastrepha fraterculus (Wiedemann, 1830) originating from 85 collections from the northern and central Andean countries of South America including Argentina (Tucumán), Bolivia, Perú, Ecuador, Colombia, and Venezuela. The ITS1 regions of additional specimens (17 collections) from Central America (México, Guatemala, Costa Rica, and Panamá), Brazil, Caribbean Colombia, and coastal Venezuela were sequenced and together with published sequences (Paraguay) provided context for interpretation. A total of six ITS1 sequence variants were recognized in the Andean region comprising four groups. Type I predominates in the southernmost range of Anastrepha fraterculus. Type II predominates in its northernmost range. In the central and northern Andes, the geographic distributions overlap and interdigitate with a strong elevational effect. A discussion of relationships between observed ITS1 types and morphometric types is included. PMID:26798259

  3. Effect of nuclear explosions at Lobnor test site and after Chernobyl accident on the environment and population health in Almaty region

    International Nuclear Information System (INIS)

    Zhilkaidarova, A.Zh.; Pozdnyakova, A.P.; Mit, A.A.; Chastnikov, I.Ya.; Sadukov, A.A.; Khusainova, Sh.N.

    1999-01-01

    This paper [1] presents correlation of infantile death rate, oncologic sickness children and nuclear explosions at Lobnor test site and Chernobyl accident.Figure 1 presents information about accumulation of radionuclides (α-emitter) in poplar-tree of Dzharkent-city within the last 15 years [2].Figure 2 presents the relation of infantile death rate in districts of Almaty region, located at different distances from the boundary with China. (Data were obtained from the regional children's hospital of Almaty).Figure 3 presents values of oncologic sickness rate for children living in Almaty, who are 0-14 years old.Numerous observations of irradiated people show that malignant tumours, induced by ionizing radiation, emerge in several years after the irradiation

  4. Potential for Worldwide Displacement of Fossil-Fuel Electricity by Nuclear Energy in Three Decades Based on Extrapolation of Regional Deployment Data

    Science.gov (United States)

    Qvist, Staffan A.; Brook, Barry W.

    2015-01-01

    There is an ongoing debate about the deployment rates and composition of alternative energy plans that could feasibly displace fossil fuels globally by mid-century, as required to avoid the more extreme impacts of climate change. Here we demonstrate the potential for a large-scale expansion of global nuclear power to replace fossil-fuel electricity production, based on empirical data from the Swedish and French light water reactor programs of the 1960s to 1990s. Analysis of these historical deployments show that if the world built nuclear power at no more than the per capita rate of these exemplar nations during their national expansion, then coal- and gas-fired electricity could be replaced worldwide in less than a decade. Under more conservative projections that take into account probable constraints and uncertainties such as differing relative economic output across regions, current and past unit construction time and costs, future electricity demand growth forecasts and the retiring of existing aging nuclear plants, our modelling estimates that the global share of fossil-fuel-derived electricity could be replaced within 25–34 years. This would allow the world to meet the most stringent greenhouse-gas mitigation targets. PMID:25970621

  5. Potential for worldwide displacement of fossil-fuel electricity by nuclear energy in three decades based on extrapolation of regional deployment data.

    Science.gov (United States)

    Qvist, Staffan A; Brook, Barry W

    2015-01-01

    There is an ongoing debate about the deployment rates and composition of alternative energy plans that could feasibly displace fossil fuels globally by mid-century, as required to avoid the more extreme impacts of climate change. Here we demonstrate the potential for a large-scale expansion of global nuclear power to replace fossil-fuel electricity production, based on empirical data from the Swedish and French light water reactor programs of the 1960s to 1990s. Analysis of these historical deployments show that if the world built nuclear power at no more than the per capita rate of these exemplar nations during their national expansion, then coal- and gas-fired electricity could be replaced worldwide in less than a decade. Under more conservative projections that take into account probable constraints and uncertainties such as differing relative economic output across regions, current and past unit construction time and costs, future electricity demand growth forecasts and the retiring of existing aging nuclear plants, our modelling estimates that the global share of fossil-fuel-derived electricity could be replaced within 25-34 years. This would allow the world to meet the most stringent greenhouse-gas mitigation targets.

  6. A unique nuclear receptor direct repeat 17 (DR17) is present within the upstream region of Schistosoma mansoni female-specific p14 gene

    International Nuclear Information System (INIS)

    Fantappie, Marcelo Rosado; Furtado, Daniel Rodrigues; Rumjanek, Franklin David; LoVerde, Philip T.

    2008-01-01

    The eggs produced by sexually mature female Schistosma mansoni are responsible for the pathogenesis of the disease. The eggshell precursor gene p14 is expressed only in the vitelline cells of sexually mature female worms in response to a yet unidentified male stimulus. Herein, we report the identification of a novel nuclear receptor response element in the upstream region of the p14 gene. This element contains the canonical hexameric DNA core motif, 5'-PuGGTCA, composed of an atypically spaced direct repeat (DR17). Schistosome nuclear receptors SmRXR1 and SmNR1 specifically bound to the p14-DR17 element as a heterodimer. SmRXR1, but not SmNR1, bound to the motif as a monomer. Introduction of mutations in the TCA core sequence completely abolished the binding by SmRXR1/SmNR1 heterodimer. This finding supports our hypothesis that the expression of Schistosoma mansonip14 gene is regulated through the nuclear receptor signaling pathway

  7. Potential for worldwide displacement of fossil-fuel electricity by nuclear energy in three decades based on extrapolation of regional deployment data.

    Directory of Open Access Journals (Sweden)

    Staffan A Qvist

    Full Text Available There is an ongoing debate about the deployment rates and composition of alternative energy plans that could feasibly displace fossil fuels globally by mid-century, as required to avoid the more extreme impacts of climate change. Here we demonstrate the potential for a large-scale expansion of global nuclear power to replace fossil-fuel electricity production, based on empirical data from the Swedish and French light water reactor programs of the 1960s to 1990s. Analysis of these historical deployments show that if the world built nuclear power at no more than the per capita rate of these exemplar nations during their national expansion, then coal- and gas-fired electricity could be replaced worldwide in less than a decade. Under more conservative projections that take into account probable constraints and uncertainties such as differing relative economic output across regions, current and past unit construction time and costs, future electricity demand growth forecasts and the retiring of existing aging nuclear plants, our modelling estimates that the global share of fossil-fuel-derived electricity could be replaced within 25-34 years. This would allow the world to meet the most stringent greenhouse-gas mitigation targets.

  8. A novel chromosome region maintenance 1-independent nuclear export signal of the large form of hepatitis delta antigen that is required for the viral assembly.

    Science.gov (United States)

    Lee, C H; Chang, S C; Wu, C H; Chang, M F

    2001-03-16

    Hepatitis delta virus (HDV) is a satellite virus of hepatitis B virus, as it requires hepatitis B virus for virion production and transmission. We have previously demonstrated that sequences within the C-terminal 19-amino acid domain flanking the isoprenylation motif of the large hepatitis delta antigen (HDAg-L) are important for virion assembly. In this study, site-directed mutagenesis and immunofluorescence staining demonstrated that in the absence of hepatitis B virus surface antigen (HBsAg), the wild-type HDAg-L was localized in the nuclei of transfected COS7 cells. Nevertheless, in the presence of HBsAg, the HDAg-L became both nuclei- and cytoplasm-distributed in about half of the cells. An HDAg-L mutant with a substitution of Pro-205 to alanine could neither form HDV-like particles nor shift the subcellular localization in the presence of HBsAg. In addition, nuclear trafficking of HDAg-L in heterokaryons indicated that HDAg-L is a nucleocytoplasmic shuttling protein. A proline-rich HDAg peptide spanning amino acid residues 198 to 210, designated NES(HDAg-L), can function as a nuclear export signal (NES) in Xenopus oocytes. Pro-205 is critical for the NES function. Furthermore, assembly of HDV is insensitive to leptomycin B, indicating that the NES(HDAg-L) directs nuclear export of HDAg-L to the cytoplasm via a chromosome region maintenance 1-independent pathway.

  9. Diagnosis of regional cerebral blood flow abnormalities using SPECT: agreement between individualized statistical parametric maps and visual inspection by nuclear medicine physicians with different levels of expertise in nuclear neurology

    Energy Technology Data Exchange (ETDEWEB)

    Rocha, Euclides Timoteo da, E-mail: euclidestimoteo@uol.com.b [Fundacao Pio XII, Barretos, SP (Brazil). Hospital de Cancer. Dept. de Medicina Nuclear; Buchpiguel, Carlos Alberto [Hospital do Coracao, Sao Paulo, SP (Brazil). Dept. de Medicina Nuclear; Nitrini, Ricardo [Universidade de Sao Paulo (USP), SP (Brazil). Faculdade de Medicina. Dept. de Neurologia; Tazima, Sergio [Hospital Alemao Oswaldo Cruz (HAOC), Sao Paulo, SP (Brazil). Dept. de Medicina Nuclear; Peres, Stela Verzinhase [Fundacao Pio XII, Barretos, SP (Brazil). Hospital de Cancer; Busatto Filho, Geraldo [Universidade de Sao Paulo (USP), SP (Brazil). Faculdade de Medicina. Div. de Medicina Nuclear

    2009-07-01

    Introduction: visual analysis is widely used to interpret regional cerebral blood flow (rCBF) SPECT images in clinical practice despite its limitations. Automated methods are employed to investigate between-group rCBF differences in research studies but have rarely been explored in individual analyses. Objectives: to compare visual inspection by nuclear physicians with the automated statistical parametric mapping program using a SPECT dataset of patients with neurological disorders and normal control images. Methods: using statistical parametric mapping, 14 SPECT images from patients with various neurological disorders were compared individually with a databank of 32 normal images using a statistical threshold of p<0.05 (corrected for multiple comparisons at the level of individual voxels or clusters). Statistical parametric mapping results were compared with visual analyses by a nuclear physician highly experienced in neurology (A) as well as a nuclear physician with a general background of experience (B) who independently classified images as normal or altered, and determined the location of changes and the severity. Results: of the 32 images of the normal databank, 4 generated maps showing rCBF abnormalities (p<0.05, corrected). Among the 14 images from patients with neurological disorders, 13 showed rCBF alterations. Statistical parametric mapping and physician A completely agreed on 84.37% and 64.28% of cases from the normal databank and neurological disorders, respectively. The agreement between statistical parametric mapping and ratings of physician B were lower (71.18% and 35.71%, respectively). Conclusion: statistical parametric mapping replicated the findings described by the more experienced nuclear physician. This finding suggests that automated methods for individually analyzing rCBF SPECT images may be a valuable resource to complement visual inspection in clinical practice. (author)

  10. Endogenous RGS14 is a cytoplasmic-nuclear shuttling protein that localizes to juxtanuclear membranes and chromatin-rich regions of the nucleus

    Science.gov (United States)

    Hepler, John R.

    2017-01-01

    Regulator of G protein signaling 14 (RGS14) is a multifunctional scaffolding protein that integrates G protein and H-Ras/MAPkinase signaling pathways to regulate synaptic plasticity important for hippocampal learning and memory. However, to date, little is known about the subcellular distribution and roles of endogenous RGS14 in a neuronal cell line. Most of what is known about RGS14 cellular behavior is based on studies of tagged, recombinant RGS14 ectopically overexpressed in unnatural host cells. Here, we report for the first time a comprehensive assessment of the subcellular distribution and dynamic localization of endogenous RGS14 in rat B35 neuroblastoma cells. Using confocal imaging and 3D-structured illumination microscopy, we find that endogenous RGS14 localizes to subcellular compartments not previously recognized in studies of recombinant RGS14. RGS14 localization was observed most notably at juxtanuclear membranes encircling the nucleus, at nuclear pore complexes (NPC) on both sides of the nuclear envelope and within intranuclear membrane channels, and within both chromatin-poor and chromatin-rich regions of the nucleus in a cell cycle-dependent manner. In addition, a subset of nuclear RGS14 localized adjacent to active RNA polymerase II. Endogenous RGS14 was absent from the plasma membrane in resting cells; however, the protein could be trafficked to the plasma membrane from juxtanuclear membranes in endosomes derived from ER/Golgi, following constitutive activation of endogenous RGS14 G protein binding partners using AlF4¯. Finally, our findings show that endogenous RGS14 behaves as a cytoplasmic-nuclear shuttling protein confirming what has been shown previously for recombinant RGS14. Taken together, the findings highlight possible cellular roles for RGS14 not previously recognized that are distinct from the regulation of conventional GPCR-G protein signaling, in particular undefined roles for RGS14 in the nucleus. PMID:28934222

  11. Fluctuations of nuclear cross sections in the region of strong overlapping resonances and at large number of open channels

    International Nuclear Information System (INIS)

    Kun, S.Yu.

    1985-01-01

    On the basis of the symmetrized Simonius representation of the S matrix statistical properties of its fluctuating component in the presence of direct reactions are investigated. The case is considered where the resonance levels are strongly overlapping and there is a lot of open channels, assuming that compound-nucleus cross sections which couple different channels are equal. It is shown that using the averaged unitarity condition on the real energy axis one can eliminate both resonance-resonance and channel-channel correlations from partial r transition amplitudes. As a result, we derive the basic points of the Epicson fluctuation theory of nuclear cross sections, independently of the relation between the resonance overlapping and the number of open channels, and the validity of the Hauser-Feshbach model is established. If the number of open channels is large, the time of uniform population of compound-nucleus configurations, for an open excited nuclear system, is much smaller than the Poincare time. The life time of compound nucleus is discussed

  12. The Effects of Travel Path and Source Structure on the Character of Regional Distance Seismograms from Nuclear Explosions

    Science.gov (United States)

    1991-12-27

    and had a ML of 6.4. The earthquake sequence was very energetic, having a foreshock with a ML of 5.9 and three large aftershocks measuring 5.8, 5.6...regional data-A review, Bull. Seism. Soc. Am. 72, S89-S129. Smith, K. D., and K. F. Priestley (1988). The foreshock sequence of the 1986 Chalfant

  13. Reactor waste heat utilization and district heating reactors. Nuclear district heating in Sweden - Regional reject heat utilization schemes and small heat-only reactors

    International Nuclear Information System (INIS)

    Hannerz, K.; Larsson, Y.; Margen, P.

    1977-01-01

    A brief review is given of the current status of district heating in Sweden. In future, district heating schemes will become increasingly interesting as a means of utilizing heat from nuclear reactors. Present recommendations in Sweden are that large reactors should not be located closer than about 20 km from large population centres. Reject heat from such reactors is cheap at source. To minimize the cost of long distance hot water transmission large heat rates must be transmitted. Only areas with large populations can meet this requirement. The three areas of main interest are Malmoe/Lund/Helsingborg housing close to 0.5 million; Greater Stockholm housing 1 to 1.5 million and Greater Gothenburg housing about 0.5 million people. There is an active proposal that the Malmoe/Lund/Helsingborg region would be served by a third nuclear unit at Barsebaeck, located about 20 km from Malmoe/Lund and supplying 950 MW of base load heat. Preliminary proposals for Stockholm involve a 2000 MW heat supply; proposals for Gothenburg are more tentative. The paper describes progress on these proposals and their technology. It also outlines technology under development to increase the economic range of large scale heat transport and to make distribution economic even for low heat-density family housing estates. Regions apart from the few major urban areas mentioned above require the adoption of a different approach. To this end the development of a small, simple low-temperature reactor for heat-only production suitable for urban location has been started in Sweden in close contact with Finland. Some results of the work in progress are presented, with emphasis on the safety requirements. An outline is given in the paper as to how problems of regional heat planning and institutional and legislative issues are being approached

  14. Interaction study of rice stripe virus proteins reveals a region of the nucleocapsid protein (NP) required for NP self-interaction and nuclear localization.

    Science.gov (United States)

    Lian, Sen; Cho, Won Kyong; Jo, Yeonhwa; Kim, Sang-Min; Kim, Kook-Hyung

    2014-04-01

    Rice stripe virus (RSV), which belongs to the genus Tenuivirus, is an emergent virus problem. The RSV genome is composed of four single-strand RNAs (RNA1-RNA4) and encodes seven proteins. We investigated interactions between six of the RSV proteins by yeast-two hybrid (Y2H) assay in vitro and by bimolecular fluorescence complementation (BiFC) in planta. Y2H identified self-interaction of the nucleocapsid protein (NP) and NS3, while BiFC revealed self-interaction of NP, NS3, and NCP. To identify regions(s) and/or crucial amino acid (aa) residues required for NP self-interaction, we generated various truncated and aa substitution mutants. Y2H assay showed that the N-terminal region of NP (aa 1-56) is necessary for NP self-interaction. Further analysis with substitution mutants demonstrated that additional aa residues located at 42-47 affected their interaction with full-length NP. These results indicate that the N-terminal region (aa 1-36 and 42-47) is required for NP self-interaction. BiFC and co-localization studies showed that the region required for NP self-interaction is also required for NP localization at the nucleus. Overall, our results indicate that the N-terminal region (aa 1-47) of the NP is important for NP self-interaction and that six aa residues (42-47) are essential for both NP self-interaction and nuclear localization. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Feasibility of nuclear ribosomal region ITS1 over ITS2 in barcoding taxonomically challenging genera of subtribe Cassiinae (Fabaceae

    Directory of Open Access Journals (Sweden)

    Priyanka Mishra

    2016-12-01

    Full Text Available Premise of the Study The internal transcribed spacer (ITS region is situated between 18S and 26S in a polycistronic rRNA precursor transcript. It had been proved to be the most commonly sequenced region across plant species to resolve phylogenetic relationships ranging from shallow to deep taxonomic levels. Despite several taxonomical revisions in Cassiinae, a stable phylogeny remains elusive at the molecular level, particularly concerning the delineation of species in the genera Cassia, Senna and Chamaecrista. This study addresses the comparative potential of ITS datasets (ITS1, ITS2 and concatenated in resolving the underlying morphological disparity in the highly complex genera, to assess their discriminatory power as potential barcode candidates in Cassiinae. Methodology A combination of experimental data and an in-silico approach based on threshold genetic distances, sequence similarity based and hierarchical tree-based methods was performed to decipher the discriminating power of ITS datasets on 18 different species of Cassiinae complex. Lab-generated sequences were compared against those available in the GenBank using BLAST and were aligned through MUSCLE 3.8.31 and analysed in PAUP 4.0 and BEAST1.8 using parsimony ratchet, maximum likelihood and Bayesian inference (BI methods of gene and species tree reconciliation with bootstrapping. DNA barcoding gap was realized based on the Kimura two-parameter distance model (K2P in TaxonDNA and MEGA. Principal Findings Based on the K2P distance, significant divergences between the inter- and intra-specific genetic distances were observed, while the presence of a DNA barcoding gap was obvious. The ITS1 region efficiently identified 81.63% and 90% of species using TaxonDNA and BI methods, respectively. The PWG-distance method based on simple pairwise matching indicated the significance of ITS1 whereby highest number of variable (210 and informative sites (206 were obtained. The BI tree-based methods

  16. 137Cs, 60Co and 125I bioaccumulation by seaweeds from the Angra dos Reis nuclear power plant region

    International Nuclear Information System (INIS)

    Guimaraes, J.R.; Penna-Franca, E.

    1985-01-01

    As part of a broad research program on the behaviour of critical radionuclides to be discharged into the sea by the first Brazilian nuclear power plant, the uptake, accumulation and loss of 137 Cs, 60 Co and 125 I by locally abundant seaweed species was studied. Uptake in static 12 liter aquarium experiments reached apparent steady-state in 2 to 7 days ( 60 Co and 125 I), or 2 to 3 weeks ( 137 Cs). Elimination followed a reverse pattern, being comparatively fast for 137 Cs and slow for 60 Co and 125 I. Dry weight bioaccumulation factors (BFs) were variable, falling in the 10 1 range for 137 Cs, 10 3 for 125 I and 10 3 to 10 4 for 60 Co. Various short-term experiments, performed over a 16 month period, showed marked temporal variations of 60 Co BFs for all species. The results demonstrated that the studied species may play an important role in the transfer of the critical radionuclides through local food webs and can be employed as useful monitors for routine or accidental radionuclide releases. (author)

  17. The methylation of the C-terminal region of hnRNPQ (NSAP1) is important for its nuclear localization

    International Nuclear Information System (INIS)

    Passos, Dario O.; Quaresma, Alexandre J.C.; Kobarg, Joerg

    2006-01-01

    Protein arginine methylation is an irreversible post-translational protein modification catalyzed by a family of at least nine different enzymes entitled PRMTs (protein arginine methyl transferases). Although PRMT1 is responsible for 85% of the protein methylation in human cells, its substrate spectrum has not yet been fully characterized nor are the functional consequences of methylation for the protein substrates well understood. Therefore, we set out to employ the yeast two-hybrid system in order to identify new substrate proteins for human PRMT1. We were able to identify nine different PRMT1 interacting proteins involved in different aspects of RNA metabolism, five of which had been previously described either as substrates for PRMT1 or as functionally associated with PRMT1. Among the four new identified possible protein substrates was hnRNPQ3 (NSAP1), a protein whose function has been implicated in diverse steps of mRNA maturation, including splicing, editing, and degradation. By in vitro methylation assays we were able to show that hnRNPQ3 is a substrate for PRMT1 and that its C-terminal RGG box domain is the sole target for methylation. By further studies with the inhibitor of methylation Adox we provide evidence that hnRNPQ1-3 are methylated in vivo. Finally, we demonstrate by immunofluorescence analysis of HeLa cells that the methylation of hnRNPQ is important for its nuclear localization, since Adox treatment causes its re-distribution from the nucleus to the cytoplasm

  18. A Measurement of Nuclear Structure Functions in the Large $X$ Large $Q^{2}$ Kinematic Region in Neutrino Deep Inelastic Scattering

    Energy Technology Data Exchange (ETDEWEB)

    Vakili, Masoud [Cincinnati U.

    1997-01-01

    Data from the CCFR E770 Neutrino Deep Inelastic Scatter- ing (DIS) experiment at Fermilab contain large Bjorken x, high $Q^2$ events. A comparison of the data with a model, based on no nuclear effects at large $x$, shows an excess of events in the data. Addition of Fermi gas motion of the nucleons in the nucleus to the model does not explain the model's deficit. Adding higher momentum tail due to the formation of "quasi-deuterons" makes the agreement better. Certain models based on "multi- quark clusters" and "few-nucleon correlations" predict an exponentially falling behavior for $F_2$ as $F_2 \\sim e^{s(x -x_0)}$ at large $x$. We measure a $s$ = 8.3 $\\pm$ 0.8 for the best fit to our data. This corresponds to a value of $F_2$($x = 1, Q^2 > 50) \\approx 2$ x $10^{-3}$ in neutrino DIS. These values agree with results from theoretical models and the $SLAC$ $E133$ experiment but seem to be different from the result of the BCDMS experiment

  19. Nuclear reactor

    International Nuclear Information System (INIS)

    Mysels, K.J.; Shenoy, A.S.

    1976-01-01

    A nuclear reactor is described in which the core consists of a number of fuel regions through each of which regulated coolant flows. The coolant from neighbouring fuel regions is combined in a manner which results in an averaging of the coolant temperature at the outlet of the core. By this method the presence of hot streaks in the reactor is reduced. (UK)

  20. Population exposure due to nuclear medical diagnosis and therapy in the Munich and Rottal/Inn regions in 1978

    International Nuclear Information System (INIS)

    Beer, C.

    1983-01-01

    The cases are systematically evaluated with a view to the number of examinations, applied activities, gonadal doses and genetically significant dose. sup(99m)Tc-pertechnetate was applied in more than 50% of the cases. 131 I-iodide examinations were carried out only in Munich. sup(99m)Tc-pertechnetate and sup(99m)Tc-methylen disphosphonate account for 3/4 of the total GSD. Of the organ examinations, bone scintiscanning contributes most to the GSD. The Munich region has the highest total GSD value (0.907 mrem). (DG) [de

  1. On-line testing of nuclear plant temperature and pressure instrumentation and other critical plant equipment. IAEA regional workshop. Working material

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-12-31

    Under European regional TC project RER/4/011, IAEA and VUJE Training centre organized a workshop on On-line Testing of Nuclear Power Plant Temperature and Pressure Instrumentation and Other Critical Plant Equipment in Trnava, Slovak Republic, from 25 to 29 May 1998. The objective of the workshop was to review the state-of-the-art in NPP instrumentation, cover typical instrumentation problems and solutions, describe technical and regulatory requirements for verifying the performance of nuclear power plant instrumentation, describe new methods developed and applied in NPPs for on-line verification and performance of instrumentation and present new techniques using existing instrumentation to identify the on-set problems in the plant electrical, mechanical and thermal hydraulic systems. Particular emphasis was placed on temperature measurements by Resistance Temperature Detectors (RTDs) and thermocouples and pressure measurements using motion-balanced and forced-balanced pressure transmitters. This proceedings includes papers presented by the invited speakers and the participants each with an abstract as wells as a summary of the Round-Table discussions Refs, figs, tabs

  2. HYGIENIC AND SANITARY-EDUCATIONAL BASICS OF THE RADIATION ANXIETY PREVENTION AMONG THE POPULATION IN THE REGIONS WITH NUCLEAR-ENERGY COMPLEX ENTERPRISES

    Directory of Open Access Journals (Sweden)

    Shevchenko O. A.

    2017-12-01

    Full Text Available Background. The development of nuclear power in the countries affected by the Chernobyl accident is accompanied by a high level of radiation anxiety among the local population. The purpose of the work is the scientific substantiation of methodological approaches to determine the level and prevalence of radiation anxiety among residents of regions with enterprises of the nuclear power complex, and the development of a system of measures for their prevention. Material and methods. The features of the subjective assessment of the health and psychological status of residents of the cities of Kirovograd, ZholtyeVody (n = 387 and Volnogorsk (control group, n = 208 were studied. An original method was developed to determine the level of radiation anxiety by qualitative characteristics. Results. A low level of radiation anxiety was found in 52.5% of respondents, an average – in 27.6%, a high level – in 3.9%, it directly correlated with self-esteem of the state of health (rs = 0.134; p <0.10, presence of oncological pathologies in family (rs = 0.209, p <0.001 and the respondent's conviction that there is a direct relationship between cancer and radiation (rs = 0.302, p <0.001. Conclusions. The developed method makes it possible to determine the respondents' attitude to the problem of the effect of ionizing radiation on the health status and group people according to the level of anxiety for further planning of health improvement measures.

  3. On-line testing of nuclear plant temperature and pressure instrumentation and other critical plant equipment. IAEA regional workshop. Working material

    International Nuclear Information System (INIS)

    1998-01-01

    Under European regional TC project RER/4/011, IAEA and VUJE Training centre organized a workshop on On-line Testing of Nuclear Power Plant Temperature and Pressure Instrumentation and Other Critical Plant Equipment in Trnava, Slovak Republic, from 25 to 29 May 1998. The objective of the workshop was to review the state-of-the-art in NPP instrumentation, cover typical instrumentation problems and solutions, describe technical and regulatory requirements for verifying the performance of nuclear power plant instrumentation, describe new methods developed and applied in NPPs for on-line verification and performance of instrumentation and present new techniques using existing instrumentation to identify the on-set problems in the plant electrical, mechanical and thermal hydraulic systems. Particular emphasis was placed on temperature measurements by Resistance Temperature Detectors (RTDs) and thermocouples and pressure measurements using motion-balanced and forced-balanced pressure transmitters. This proceedings includes papers presented by the invited speakers and the participants each with an abstract as wells as a summary of the Round-Table discussions

  4. Extension of the African regional co-operative agreement for research, development and training related to nuclear science and technology (AFRA)

    International Nuclear Information System (INIS)

    1998-01-01

    As of 31 January 1998, notifications of acceptance of the extension of the African Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology(INFCIRC/377), has been received by the Director General of the IAEA from the Governments of 21 African States. Uganda is added at the at the list of 20 African States reported in the previous addition to the document (INFCIRC/377/Add.8). Pursuant to Article XIV.2 of the original Agreement the extension entered into force on 4 April 1995, upon expiration of the original Agreement, and will remain in force for an additional period of 5 years, i.e. through 3 April 2000

  5. Extension of the African regional co-operative agreement for research, development and training related to nuclear science and technology (AFRA)

    International Nuclear Information System (INIS)

    1997-01-01

    As of 31 December 1996, notifications of acceptance of the extension of the African Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology (AFRA) (see INFCIRC/377), had been received by the Director General from the Governments of 20 African countries. Niger, Libya and Mali are added at the list of 17 countries reported in the previous addition of the document (INFCIRC/377/Add.7). Pursuant to Article XIV.2 of the original Agreement, the extension entered into force on 4 April 1995, upon expiration of the original Agreement, and will remain in force for an additional period of 5 years, i.e. through 3 April 2000

  6. Phylogenetic Analysis of a ‘Jewel Orchid’ Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions

    Science.gov (United States)

    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen

    2016-01-01

    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1) Goodyera is not monophyletic; 2) Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3) sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection. PMID:26927946

  7. Extension of the African regional co-operative agreement for research, development and training related to nuclear science and technology (AFRA)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-02-24

    As of 31 January 1998, notifications of acceptance of the extension of the African Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology(INFCIRC/377), has been received by the Director General of the IAEA from the Governments of 21 African States. Uganda is added at the at the list of 20 African States reported in the previous addition to the document (INFCIRC/377/Add.8). Pursuant to Article XIV.2 of the original Agreement the extension entered into force on 4 April 1995, upon expiration of the original Agreement, and will remain in force for an additional period of 5 years, i.e. through 3 April 2000.

  8. Extension of the African regional co-operative agreement for research, development and training related to nuclear science and technology (AFRA)

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-02-28

    As of 31 December 1996, notifications of acceptance of the extension of the African Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology (AFRA) (see INFCIRC/377), had been received by the Director General from the Governments of 20 African countries. Niger, Libya and Mali are added at the list of 17 countries reported in the previous addition of the document (INFCIRC/377/Add.7). Pursuant to Article XIV.2 of the original Agreement, the extension entered into force on 4 April 1995, upon expiration of the original Agreement, and will remain in force for an additional period of 5 years, i.e. through 3 April 2000.

  9. Localization of Daucus carota NMCP1 to the nuclear periphery: the role of the N-terminal region and an NLS-linked sequence motif, RYNLRR, in the tail domain

    Directory of Open Access Journals (Sweden)

    Yuta eKimura

    2014-02-01

    Full Text Available Recent ultrastructural studies revealed that a structure similar to the vertebrate nuclear lamina exists in the nuclei of higher plants. However, plant genomes lack genes for lamins and intermediate-type filament proteins, and this suggests that plant-specific nuclear coiled-coil proteins make up the lamina-like structure in plants. NMCP1 is a protein, first identified in Daucus carota cells, that localizes exclusively to the nuclear periphery in interphase cells. It has a tripartite structure comprised of head, rod, and tail domains, and includes putative nuclear localization signal (NLS motifs. We identified the functional NLS of DcNMCP1 (carrot NMCP1 and determined the protein regions required for localizing to the nuclear periphery using EGFP-fused constructs transiently expressed in Apium graveolens epidermal cells. Transcription was driven under a CaMV35S promoter, and the genes were introduced into the epidermal cells by a DNA-coated microprojectile delivery system. Of the NLS motifs, KRRRK and RRHK in the tail domain were highly functional for nuclear localization. Addition of the N-terminal 141 amino acids from DcNMCP1 shifted the localization of a region including these NLSs from the entire nucleus to the nuclear periphery. Using this same construct, the replacement of amino acids in RRHK or its preceding sequence, YNL, with alanine residues abolished localization to the nuclear periphery, while replacement of KRRRK did not affect localization. The sequence R/Q/HYNLRR/H, including YNL and the first part of the sequence of RRHK, is evolutionarily conserved in a subclass of NMCP1 sequences from many plant species. These results show that NMCP1 localizes to the nuclear periphery by a combined action of a sequence composed of R/Q/HYNLRR/H, NLS, and the N-terminal region including the head and a portion of the rod domain, suggesting that more than one binding site is implicated in localization of NMCP1.

  10. Analysing the Air: Experiences and Results of Long Term Air Pollution Monitoring in the Asia-Pacific Region Using Nuclear Analysis Techniques

    International Nuclear Information System (INIS)

    Atanacio, Armand J.

    2015-01-01

    Particles present in the air we breathe are now recognized as a major cause of disease and premature death globally. In fact, a World Health Organization (WHO) report recently ranked ambient air pollution as one of the top 10 causes of death in the world, directly contributing annually to around 3.7 million premature deaths worldwide 65% of which occurred in the Asian region alone. Airborne particulate matter (PM) can be generated from natural sources such as windblown soil or coastal sea-spray; as well as anthropogenic sources such as power stations, industry, vehicles and domestic biomass burning. At low concentration these fine pollution particles are too small to be seen by eye, but penetrate deep into our lungs and even our blood stream as our nose and throat are inefficient at filtering them out. At large concentrations, they can also have wider regional effects including reduced visibility, acid rain and even climate variability. The International Atomic Energy Agency (IAEA) in 2000, recognizing air pollution as a significant local, national and global challenge, initiated a collaborative air pollution study involving 14 countries across the greater Asia-pacific region from 2000 to 2015. This has amassed a database containing more than 14,000 data lines of PM mass concentration and the concentration of up to 40 elements using nuclear analytical techniques. It represents the most comprehensive and long-term airborne PM data set compiled to date for the Asia-Pacific region and as will be discussed, can be used to statistically resolve individual source fingerprints and their contributions to total air pollution using Positive Matrix Factorization (PMF). This sort of data necessary for implementing or reviewing the effectiveness of policy level changes aimed at targeted air pollution reduction. (author)

  11. Nuclear law in motion. Report on the 15th regional meeting of the German section of AIDN/INLA e.V; Atomrecht in Bewegung. Bericht ueber die 15. Regionaltagung der Deutschen Landesgruppe der AIDN/INLA e.V.

    Energy Technology Data Exchange (ETDEWEB)

    Feldmann, Ulrike

    2017-11-15

    For the 15th time the German National Group of the Association Internationale du Droit Nucleaire/International Nuclear Law Association (AIDN/IN-LA) e.V. organised a regional conference. 90 participants from 15 countries, including representatives of Euratom and OECD/NEA, met in Bonn on 28 and 29 September to exchange views on current issues of nuclear law. The Rhine, which was in sight of the conference centre and connects countries, provided an excellent backdrop not only for the conference that connects nations, but also for the title of the conference ''Atomic Energy Law in Motion'' and for various lectures on nuclear transport.

  12. AAV8 capsid variable regions at the two-fold symmetry axis contribute to high liver transduction by mediating nuclear entry and capsid uncoating

    International Nuclear Information System (INIS)

    Tenney, Rebeca M.; Bell, Christie L.; Wilson, James M.

    2014-01-01

    Adeno-associated virus serotype 8 (AAV8) is a promising vector for liver-directed gene therapy. Although efficient uncoating of viral capsids has been implicated in AAV8's robust liver transduction, much about the biology of AAV8 hepatotropism remains unclear. Our study investigated the structural basis of AAV8 liver transduction efficiency by constructing chimeric vector capsids containing sequences derived from AAV8 and AAV2 – a highly homologous yet poorly hepatotropic serotype. Engineered vectors containing capsid variable regions (VR) VII and IX from AAV8 in an AAV2 backbone mediated near AAV8-like transduction in mouse liver, with higher numbers of chimeric genomes detected in whole liver cells and isolated nuclei. Interestingly, chimeric capsids within liver nuclei also uncoated similarly to AAV8 by 6 weeks after administration, in contrast with AAV2, of which a significantly smaller proportion were uncoated. This study links specific AAV capsid regions to the transduction ability of a clinically relevant AAV serotype. - Highlights: • We construct chimeric vectors to identify determinants of AAV8 liver transduction. • An AAV2-based vector with 17 AAV8 residues exhibited high liver transduction in mice. • This vector also surpassed AAV2 in cell entry, nuclear entry and onset of expression. • Most chimeric vector particles were uncoated at 6 weeks, like AAV8 and unlike AAV2. • Chimera retained heparin binding and was antigenically distinct from AAV2 and AAV8

  13. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  14. AAV8 capsid variable regions at the two-fold symmetry axis contribute to high liver transduction by mediating nuclear entry and capsid uncoating

    Energy Technology Data Exchange (ETDEWEB)

    Tenney, Rebeca M.; Bell, Christie L.; Wilson, James M., E-mail: wilsonjm@mail.med.upenn.edu

    2014-04-15

    Adeno-associated virus serotype 8 (AAV8) is a promising vector for liver-directed gene therapy. Although efficient uncoating of viral capsids has been implicated in AAV8's robust liver transduction, much about the biology of AAV8 hepatotropism remains unclear. Our study investigated the structural basis of AAV8 liver transduction efficiency by constructing chimeric vector capsids containing sequences derived from AAV8 and AAV2 – a highly homologous yet poorly hepatotropic serotype. Engineered vectors containing capsid variable regions (VR) VII and IX from AAV8 in an AAV2 backbone mediated near AAV8-like transduction in mouse liver, with higher numbers of chimeric genomes detected in whole liver cells and isolated nuclei. Interestingly, chimeric capsids within liver nuclei also uncoated similarly to AAV8 by 6 weeks after administration, in contrast with AAV2, of which a significantly smaller proportion were uncoated. This study links specific AAV capsid regions to the transduction ability of a clinically relevant AAV serotype. - Highlights: • We construct chimeric vectors to identify determinants of AAV8 liver transduction. • An AAV2-based vector with 17 AAV8 residues exhibited high liver transduction in mice. • This vector also surpassed AAV2 in cell entry, nuclear entry and onset of expression. • Most chimeric vector particles were uncoated at 6 weeks, like AAV8 and unlike AAV2. • Chimera retained heparin binding and was antigenically distinct from AAV2 and AAV8.

  15. Some cirad activities and perspectives in water and nutrient management in arid and semi-arid regions using nuclear techniques

    International Nuclear Information System (INIS)

    Maraux, F.; Affholder, F.; Forest, F.; Ganry, F.; N'diaye, M.; Oliver, R.; Scopel, E.

    1998-01-01

    The Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement has conducted collaborative research with national agricultural research services in several semi-arid regions that has led to a general understanding of the relationship between water consumption and growth, and crop responses to fertilizers. However, farmers' adoption of practices arising from the research has been minimal. Current effort is directed at overcoming limits to adoption, firstly by understanding the interaction of fertilizer response and water supply, especially through modelling, in order to quantify risk criteria from the farmer's point of view. Secondly, research now takes account of the whole cropping system, including labour availability, access to credit, livestock management, etc., with a multidisciplinary approach. Approaches that offer sustainability are improved intercropping systems, retention of crop residues, increased plant cover, and agroforestry. There are important technical gaps in understanding of how these systems should operate. The allocation of nutrients and water among the components of intercropped or agroforestry systems is not understood and solutions could lead to improved spatial arrangements. The integrated effects of residues on runoff, soil evaporation, crop transpiration and N mineralization are not quantified. In these and other problems, the full range of risks as well as benefits need to be evaluated. (author)

  16. Multielemental analysis of soil samples from the Assin District of Central Region in Ghana using nuclear and related techniques

    International Nuclear Information System (INIS)

    Agyemang, O.

    2008-06-01

    Macronutrients, micronutrients, pH, salinity and moisture content were determined in soil samples from six farms in two farming towns in Assin North District in the Central Region of Ghana namely Assin Akonfudi and Assin Bereku. Soil samples were taken from cocoa farms, orange farms and palm oil plantations at three different depths. The nutrients determined were Primary macronutrients that was K, Secondary macronutrients that were Ca, Mg and Micronutrients that were, Cl, Co, Cu, Fe, Mn, Mo, Zn, Na and Se and Neutron Activation method and Atomic Absorption Spectrometry were used for the elemental analysis. The pHs were within the acidic range, ranging from 4.50-6.44. The top soil (0-5cm) had the higher pH followed by soil at the depth of 5-30cm and then soil at the depth of 30-40cm that is the pH decreased with depth. The salinity rather increased with depth ranging from 0.3l-2.98dS/m and the moisture content also ranged from 0.5-2.04%. For the soil samples taken from the cocoa farms, K recorded the highest concentration and Mo recorded the lowest concentration in the soil. For soil samples taken from orange farms, Ca recorded the highest concentration and Se recorded the lowest concentration in the soil and for soil samples taken from the palm oil plantations, Fe recorded the highest concentration and Mo recorded the lowest concentration in soil. The macronutrients ranged from 28591.19-6.49 mg/kg and the micronutrients ranged from <0.0004-20344.50 mg/kg. Soils in the cocoa farms were found to be more rich in nutrients and the soils in the palm oil plantations were found to be least rich in nutrients

  17. Risk-communication issues in radiation safety: еvaluation of public awareness in St. Petersburg and the Leningrad region on the activities of the nuclear industry and public understanding of the hazards

    Directory of Open Access Journals (Sweden)

    G. V. Arkhangelskaya

    2017-01-01

    Full Text Available In 2016, St. Petersburg Research Institute of Radiation Hygiene named after Professor P.V. Ramzaev developed a Program for the radiation risk communication management for the adequate perception risks associated with the use of various technologies in the nuclear industry by the public. Carrying out sociological research is one of the stages of this program. The aim of the analysis presented in the article is to study the population’s awareness of radiation safety issues and its attitude to further development of the nuclear industry. The data used in this analysis is a part of a large sociological survey conducted in St. Petersburg and the Leningrad Region The sociological research was conducted by the method of a selective questionnaire survey among the adult population permanently residing in the territory of St. Petersburg and the Leningrad Region. The volume of the sample studied was 2369 respondents: 1006 in St. Petersburg and 1363 in the Leningrad Region, including Sosnovy Bor – 401. The analysis showed that the population of all the studied territories estimates the environmental situation as being mainly favorable. The residents consider the main environmental problems in all areas studied to be a collection, removal, storage, disposal of garbage, as well as air and water pollution. The population of the region is relatively poorly informed about the current projects in the nuclear industry. One-third of the inhabitants of the region perceives the Leningrad nuclear power plant as a source of danger. Respondents see the main danger in the possibility of an accident on it. There is a sharply negative attitude of the population towards the construction of radioactive waste disposal sites anywhere in the region. According to the results of the study, it can be concluded that the population of the studied region is poorly informed about the existing radiation situation and the nuclear industry projects. It requires an optimization of the

  18. Genetic variation among the Mapuche Indians from the Patagonian region of Argentina: mitochondrial DNA sequence variation and allele frequencies of several nuclear genes.

    Science.gov (United States)

    Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C

    1993-01-01

    DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)

  19. Nuclear reactor

    International Nuclear Information System (INIS)

    Sasaki, Tomozo.

    1987-01-01

    Purpose: To improve the nuclear reactor availability by enabling to continuously exchange fuels in the natural-slightly enriched uranium region during operation. Constitution: A control rod is withdrawn to the midway of a highly enriched uranium region by means of control rod drives and the highly enriched uranium region is burnt to maintain the nuclear reactor always at a critical state. At the same time, fresh uranium-slightly enriched uranium is continuously supplied gravitationally from a fresh fuel reservoir through fuel reservoir to each of fuel pipes in the natural-slightly enriched uranium region. Then, spent fuels reduced with the reactivity by the burn up are successively taken out from the bottom of each of the fuel pipes through an exit duct and a solenoid valve to the inside of a spent fuel reservoir and the burn up in the natural-slightly enriched uranium region is conducted continuously. (Kawakami, Y.)

  20. Nuclear questions

    International Nuclear Information System (INIS)

    Hohlfeld, W.

    1977-01-01

    This brochure 'nuclear problems' deals with the attitude of the protestant church in the region around the northern Elbe towards further quantitative economic growth, esp. nuclear energy, with the following essays: preaching the Gospel in an environment in danger: the Christian occident and the problems of the third world, facing the problems of exhausted supplies, the role of the prophet, problem of environment - a problem of theology, the political dimension, against ATW, signal Brokdorf, strange effects (defense of the church from unqualified teachings by non-professionals), Christian liberty, church and nuclear energy, violence and robes. (HP) [de

  1. Predictions of local, regional and global radiation doses from iodine-129 for four different disposal methods and an all-nuclear future

    International Nuclear Information System (INIS)

    Wuschke, D.M.; Barnard, J.W.; O'Connor, P.A.; Johnson, J.R.

    1985-01-01

    The radioactive isotope 129 I produced by nuclear fission becomes globally distributed if released to the environment. The consequences of several options for management of 129 I are discussed. Estimates are presented of radiation doses from the 129 I produced in generating 1000 GW(e).a of nuclear electricity, the total production expected in Canada up to about 2040. Individual thyroid dose rates from 129 I, and accumulated collective effective dose equivalents to three groups are compared for four 129 I management strategies. These groups are: local persons living in the immediate vicinity of a discharge zone from a fuel reprocessing facility or waste disposal vault in the Canadian Shield, regional persons living in the lower Great Lakes basin, and average global persons. The four management strategies studied were: atmospheric discharge from a reprocessing facility, ocean dumping, subseabed disposal, and isolation in a deep vault in plutonic rock in the Canadian Shield. Doses associated with each of these options are compared with each other and with proposed Canadian regulatory limits. Estimates are also presented of doses to the same groups from fission-product 129 I, if fission supplied all future world energy needs. The two management options considered were geological disposal in vaults that would each eventually discharge 129 I at the rate estimated for a disposal vault in the Canadian Shield, and ocean dumping. Again, doses arising from these options are compared with each other and with proposed regulatory limits. The second comparison allows estimates to be made of the time at which such intensive use of fission could produce unacceptable levels of 129 I in the environment

  2. Validation of dose-response curve of CRCN-NE - Regional Center for Nuclear Sciences from Northeast Brazil for 60Co: preliminary results

    International Nuclear Information System (INIS)

    Mendonca, Julyanne C.G.; Mendes, Mariana E.; Hwang, Suy F.; Lima, Fabiana F.; Santos, Neide

    2014-01-01

    The cytogenetic study has the chromosomal alterations as biomarkers in absorbed dose estimation by the body of individuals involved in exposure to ionizing radiation by interpreting a dose response calibration curve. Since the development of the technique to the analysis of data, you can see protocol characteristics, leading the International Atomic Energy Agency indicate that any laboratory with intention to carry out biological dosimetry establish their own calibration curves. The Biological Dosimetry Laboratory of the Centro Regional de Ciencias Nucleares (CRCN-NE/CNEN), Brazil, recently established the calibration curve related to gamma radiation ( 60 Co). Thus, this work aimed to start the validation of this calibration curve from samples of three different blood donors which were irradiated with an absorbed known single dose of 1 Gy. Samples were exposed to 60 Co source (Glaucoma 220) located in the Department of Nuclear Energy (DEN/UFPE). After fixation with methanol and acetic acid and 5% Giemsa staining, the frequency of chromosomal alterations (dicentric chromosomes, acentric rings and fragments) were established from reading of 500 metaphases per sample and doses were estimated using Dose Estimate program. The results showed that, using the dose-response curve calibration for dicentrics, the dose absorbed estimated for the three individuals ranged from 0.891 - 1,089Gy, taking into account the range of confidence of 95%. By using the dose-response curve for dicentrics added to rings and for the same interval of confidence the doses ranged from 0,849 - 1,081Gy. Thus, the estimative encompassed known absorbed dose the three individuals in confidence interval of 95%. These preliminary results seems to demonstrate that dicentric dose-response curves and dicentrics plus rings established by CRCN-NE / CNEN are valid for dose estimation in exposed individuals. This validation will continue with samples from different individuals at different doses

  3. Technical cooperation for the pacific uses of nuclear technology in Latin America and Caribbean: the experience of regional agreement ARCAL; Cooperacao tecnica para os usos pacificos da tecnologia nuclear na America Latina e no Caribe: a experiencia do acordo regional ARCAL

    Energy Technology Data Exchange (ETDEWEB)

    Rondinelli Junior, Francisco

    2017-11-01

    This thesis studies the international technical cooperation in the field of peaceful applications of the nuclear technology, focusing on the experience of Latin American countries, where the Cooperation Agreement for the Promotion of Nuclear Science and Technology in Latin America and the Caribbean, also known as ARCAL, is in force. The study adopts as theoretical approach the concept of state capacities, particularly with regard to the institutional capacities applicable to the ARCAL Agreement. Within this approach, three dimensions of analysis are adopted: the institutional dimension, the governance dimension and the focus on outcomes. The evaluation of the ARCAL Agreement is carried out in order to confirm if the intended role to promote regional technical cooperation in the nuclear sector is being implemented. The methodological approach adopted the case study model. It starts with the analysis of the institutional evolution of the Agreement, and identifies variables articulating with the three dimensions above mentioned. The empirical data were collected in two stages. In the first stage it were performed 29 interviews carried out by the author with the technical and staff members of the Department of Technical Cooperation of IAEA, in Vienna, Austria, headquarter of IAEA. The other stage involved an electronic questionnaire submitted to the national coordinator of ARCAL in 14 countries, in a universe of 21 member states. The conclusion of the research points to the fact that the ARCAL Agreement has incorporated, throughout its trajectory, elements of the institutional capacities which are still in the process of development. They give to the Agreement the potential to induce the development of the state capacities of the respective countries in the field of peaceful applications of nuclear technology. (author)

  4. Nuclear Energy Center: upper St. Lawrence region. Part I. Siting. Part II. Fort Drum surrogate site, description and impact assessment. Part III. Dispersed sites impact assessment and comparison with the NEC

    Energy Technology Data Exchange (ETDEWEB)

    Merry, P.A.; Luner, C.; Hong, S.W.; Canham, H.O.; Boggs, J.F.; McCool, T.P.

    1976-12-01

    This report is one of many supporting documents used by the Nuclear Regulatory commission in the preparation of the Nuclear Energy Center Site Survey (NECSS) mandated by Congress. While the overall study focuses on the feasibility and practicability of nuclear energy centers (NECs), this report is directed towards choosing a suitable surrogate site in the upper St. Lawrence region of New York State, assessing the probable impacts associated with construction and operation of the NEC, and comparing these impacts with those associated with small dispersed nuclear power stations. The upper St. Lawrence region is surveyed to identify a specific site that might be suitable for a surrogate NEC. Several assumptions about the basic design of an NEC are delineated, and a general overview of the characteristics of the region is given. The Fort Drum Military Reservation is chosen as a suitable surrogate site. Fort Drum and the surrounding area are described in terms of land use and population patterns, terrestrial and aquatic ecology, water use and quality, meteorology, institutional framework, and socioeconomic structure. The impacts associated with NEC development are assessed. Then the impacts associated with smaller dispersed nuclear power stations located throughout New York State are assessed and compared with the impacts associated with the NEC. Finally, the impacts due to development of the transmission line networks associated with the NEC and with the dispersed power stations are assessed and compared.

  5. Asian Network for Education in Nuclear Technology (ANENT). Report of the IAEA regional workshop on the development of a web-portal for ANENT

    International Nuclear Information System (INIS)

    2007-01-01

    The report contains the status of the development of anent web-portal, the country evaluation of the web-portal, the summary evaluation and suggested preparation of an operation system for anent web-portal, suggestions on upgrading of anent web-portal (including the systematic connection to other web portals, the improvement on the content, E/Cyber learning, display of the periodic review, user groups and mailing list). The workshop participants have concluded that, in general, the ANENT web-portal developed by GA (Group Activity) 1 coordinator is considered as appropriate and user friendly as the infrastructure for promoting, managing and preserving nuclear knowledge and facilitating the ANENT Group Activities. ANENT is one of the mechanisms to enhance Technical Cooperation amongst Developing Countries and an initiative for Knowledge Management Practice in the region. The developed ANENT Web portal is an important platform to facilitate the fellowship-training placement of fellows not only under the IAEA Technical Cooperation Fellowship and Training Program but also for other regional and national programs in nuclear science and technology. For revising the web-portal in the short term, a number of comments were provided by the participants. Some of them were already implemented in the current version of web-portal during the workshop. The operation management system was prepared, which will be exercised until it is submitted to the 2nd Coordination Committee Meeting for approval and further possible changes. The prepared system covers mode of operation, operation management activities, responsibilities and operation management process: KAERI will designate a web-portal system administrator and each member country will nominate a data provider. For security, a back up system will be established. An alternative access control system was suggested for consideration in the 2nd Coordination Committee meeting in order to attract the general users providing them more

  6. Nuclear power and nuclear safety 2006

    International Nuclear Information System (INIS)

    Lauritzen, B.; Oelgaard, P.L.; Kampmann, D.; Majborn, B.; Nonboel, E.; Nystrup, P.E.

    2007-04-01

    The report is the fourth report in a series of annual reports on the international development of nuclear power production, with special emphasis on safety issues and nuclear emergency preparedness. The report is written in collaboration between Risoe National Laboratory and the Danish Emergency Management Agency. The report for 2006 covers the following topics: status of nuclear power production, regional trends, reactor development and development of emergency management systems, safety related events of nuclear power, and international relations and conflicts. (LN)

  7. Nuclear power and nuclear safety 2004

    International Nuclear Information System (INIS)

    2005-03-01

    The report is the second report in a new series of annual reports on the international development of nuclear power production, with special emphasis on safety issues and nuclear emergency preparedness. The report is written in collaboration between Risoe National Laboratory and the Danish Emergency Management Agency. The report for 2004 covers the following topics: status of nuclear power production, regional trends, reactor development and development of emergency management systems, safety related events of nuclear power and international relations and conflicts. (ln)

  8. Nuclear power and nuclear safety 2005

    International Nuclear Information System (INIS)

    Lauritzen, B.; Oelgaard, P.L.; Kampman, D.; Majborn, B.; Nonboel, E.; Nystrup, P.E.

    2006-03-01

    The report is the third report in a series of annual reports on the international development of nuclear power production, with special emphasis on safety issues and nuclear emergency preparedness. The report is written in collaboration between Risoe National Laboratory and the Danish Emergency Management Agency. The report for 2005 covers the following topics: status of nuclear power production, regional trends, reactor development and development of emergency management systems, safety related events of nuclear power and international relations and conflicts. (ln)

  9. Nuclear power and nuclear safety 2008

    International Nuclear Information System (INIS)

    Lauritzen, B.; Oelgaard, P.L.; Kampmann, D.

    2009-06-01

    The report is the fifth report in a series of annual reports on the international development of nuclear power production, with special emphasis on safety issues and nuclear emergency preparedness. The report is written in collaboration between Risoe DTU and the Danish Emergency Management Agency. The report for 2008 covers the following topics: status of nuclear power production, regional trends, reactor development, safety related events of nuclear power, and international relations and conflicts. (LN)

  10. The Text of the Agreement to Extend the Regional Co-operative Agreement for Research, Development and Training related to Nuclear Science and Technology, 1987. Status of Acceptances as of 28 February 1993

    International Nuclear Information System (INIS)

    1993-04-01

    As of 28 February 1993, notifications of acceptance of the Agreement to Extend the Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology, 1987 (See INFCIRC/ 167/Add.15), in accordance with Article 2 thereof, had been received by the Director General from the Governments [ru

  11. The Text of the Agreement to Extend the Regional Co-operative Agreement for Research, Development and Training related to Nuclear Science and Technology, 1987. Status of Acceptances as of 28 February 1993

    International Nuclear Information System (INIS)

    1993-04-01

    As of 28 February 1993, notifications of acceptance of the Agreement to Extend the Regional Co-operative Agreement for Research, Development and Training Related to Nuclear Science and Technology, 1987 (See INFCIRC/ 167/Add.15), in accordance with Article 2 thereof, had been received by the Director General from the Governments [es

  12. A central region in the minor capsid protein of papillomaviruses facilitates viral genome tethering and membrane penetration for mitotic nuclear entry.

    Directory of Open Access Journals (Sweden)

    Inci Aydin

    2017-05-01

    Full Text Available Incoming papillomaviruses (PVs depend on mitotic nuclear envelope breakdown to gain initial access to the nucleus for viral transcription and replication. In our previous work, we hypothesized that the minor capsid protein L2 of PVs tethers the incoming vDNA to mitotic chromosomes to direct them into the nascent nuclei. To re-evaluate how dynamic L2 recruitment to cellular chromosomes occurs specifically during prometaphase, we developed a quantitative, microscopy-based assay for measuring the degree of chromosome recruitment of L2-EGFP. Analyzing various HPV16 L2 truncation-mutants revealed a central chromosome-binding region (CBR of 147 amino acids that confers binding to mitotic chromosomes. Specific mutations of conserved motifs (IVAL286AAAA, RR302/5AA, and RTR313EEE within the CBR interfered with chromosomal binding. Moreover, assembly-competent HPV16 containing the chromosome-binding deficient L2(RTR313EEE or L2(IVAL286AAAA were inhibited for infection despite their ability to be transported to intracellular compartments. Since vDNA and L2 were not associated with mitotic chromosomes either, the infectivity was likely impaired by a defect in tethering of the vDNA to mitotic chromosomes. However, L2 mutations that abrogated chromatin association also compromised translocation of L2 across membranes of intracellular organelles. Thus, chromatin recruitment of L2 may in itself be a requirement for successful penetration of the limiting membrane thereby linking both processes mechanistically. Furthermore, we demonstrate that the association of L2 with mitotic chromosomes is conserved among the alpha, beta, gamma, and iota genera of Papillomaviridae. However, different binding patterns point to a certain variance amongst the different genera. Overall, our data suggest a common strategy among various PVs, in which a central region of L2 mediates tethering of vDNA to mitotic chromosomes during cell division thereby coordinating membrane

  13. Perception of the nuclear industry by general practitioner in Champagne-Ardennes (France); Perception du nucleaire par le medecin generaliste en region Champagne-Ardenne

    Energy Technology Data Exchange (ETDEWEB)

    Bouet, P; Goasguen, P; Lewicki, M; Petit, J F; Villette, M

    1990-06-01

    In the case of a nuclear accident, the general practitioners should be the relay in the population information. In order to confront their knowledge and sensitivity with the nuclear industry problems, the authors have conducted an inquiry near to 144 general practitioners in Champagne-Ardennes area, in the immediate neighbourhood of nuclear facilities (CHOOZ, Nogent-sur-Seine, Gravelines) or not. Four subjects are studied: -their perception of the nuclear industry in the environment problems - their knowledge in nuclear physics - their knowledge about the nuclear power plant - their attitude in front of a radiation accident. The authors show that their education and knowledges about the nuclear industry is insufficient and propose several solutions in order to cope with these difficulties.

  14. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Maíra C. M. Freire

    2008-01-01

    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  15. Molecular analysis of aspermic Fasciola flukes from Korea on the basis of the nuclear ITS1 region and mitochondrial DNA markers and comparison with Japanese aspermic Fasciola flukes.

    Science.gov (United States)

    Ichikawa, Madoka; Itagaki, Tadashi

    2012-07-01

    It has been speculated that populations of aspermic Fasciola flukes in Korea and Japan have a close phylogenetic relationship. To evaluate this, we analyzed 33 Korean aspermic Fasciola flukes on the basis of nuclear ribosomal internal transcribed spacer 1 (ITS1) and mitochondrial NADH dehydrogenase subunit 1 (nad1) and cytochrome c oxidase 1 (cox1) sequences. Fh, Fg, and Fh/Fg types were detected in the ITS1 region and displayed the fragment patterns of F. hepatica, F. gigantica, and both species, respectively by a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Additionally, three concatenated haplotypes of nad1 and cox1(nad1/cox1) were detected, and 2 of these, Kor1/Kor1 (Fsp1/Fsp1) haplotype and Kor2a/Kor2 (Fsp2/Fsp2) haplotype, were shared by Korean and Japanese aspermic flukes. The Fst value (0.019), calculated using the concatenated sequences, indicated that Korean and Japanese aspermic Fasciola populations were genetically undifferentiated. Interestingly, a combination of the Fh/Fg type and Kor1/Kor1 haplotype was found at the highest frequency in Korean aspermic flukes, whereas the Fg type and Fsp2/Fsp2 haplotype combination was found at a conspicuously high frequency in Japanese aspermic flukes. This indicates that a founder effect caused by the introduction of infected hosts may have played a key role in the introduction of aspermic Fasciola flukes from Korea into Japan.

  16. Geological disposal of radioactive waste: national commitment, local and regional involvement - A Collective Statement of the OECD Nuclear Energy Agency Radioactive Waste Management Committee Adopted March 2012

    International Nuclear Information System (INIS)

    2012-01-01

    Disposal in engineered facilities built in stable, deep geological formations is the reference solution for permanently isolating long-lived radioactive waste from the human biosphere. This management method is designed to be intrinsically safe and final, meaning that it is not dependent on human presence or intervention in order to fulfil its safety goal. Selecting the site of a waste repository brings up a range of issues involving scientific knowledge, technical capacity, ethical values, territorial planning, community well-being and more. Bringing to fruition the multi-decade task of siting and developing a repository demands a strong national commitment and significant regional and local involvement. This collective statement by the Radioactive Waste Management Committee of the OECD Nuclear Energy Agency recognises the advances made towards greater transparency and dialogue among the diverse stakeholders concerned and identifies the fundamental elements needed to support national commitment and to foster territorial involvement. It concludes that technical and societal partners can develop shared confidence in the safety of geological repositories and jointly carry these projects forward [fr

  17. Autoantibodies in infectious mononucleosis have specificity for the glycine-alanine repeating region of the Epstein-Barr virus nuclear antigen

    Science.gov (United States)

    1987-01-01

    Viruses have been postulated to be involved in the induction of autoantibodies by: autoimmunization with tissue proteins released by virally induced tissue damage; immunization with virally encoded antigens bearing molecular similarities to normal tissue proteins; or nonspecific (polyclonal) B cell stimulation by the infection. Infectious mononucleosis (IM) is an experiment of nature that provides the opportunity for examining these possibilities. We show here that IgM antibodies produced in this disease react with at least nine normal tissue proteins, in addition to the virally encoded Epstein-Barr nuclear antigen (EBNA-1). The antibodies are generated to configurations in the glycine-alanine repeat region of EBNA-1 and are crossreactive with the normal tissue proteins through similar configurations, as demonstrated by the effectiveness of a synthetic glycine-alanine peptide in inhibiting the reactions. The antibodies are absent in preillness sera and gradually disappear over a period of months after illness, being replaced by IgG anti-EBNA-1 antibodies that do not crossreact with the normal tissue proteins but that are still inhibited by the glycine-alanine peptide. These findings are most easily explained by either a molecular mimicry model of IgM autoantibody production or by the polyclonal activation of a germline gene for a crossreactive antibody. It also indicates a selection of highly specific, non-crossreactive anti-EBNA-1 antibodies during IgM to IgG isotype switching. PMID:2435830

  18. Cholangiocarcinomas associated with long-term inflammation express the activation-induced cytidine deaminase and germinal center-associated nuclear protein involved in immunoglobulin V-region diversification.

    Science.gov (United States)

    Chan-On, Waraporn; Kuwahara, Kazuhiko; Kobayashi, Naoya; Ohta, Kazutaka; Shimasaki, Tatsuya; Sripa, Banchob; Leelayuwat, Chanvit; Sakaguchi, Nobuo

    2009-08-01

    Cholangiocarcinoma (CCA) represents a model of tumor development after long-term inflammation which causes DNA damage or impairs DNA repair mechanism. AID and GANP, both appearing in antigen-driven B cells, are involved in affinity maturation of the immunoglobulin V-region with increased somatic mutation. A normal cholangiocyte line showed the induction of AID transcripts after stimulation with TNF-alpha, whereas ganp transcripts appeared constitutively in this cell line. Next, we examined the expression of AID and GANP in clinical CCA specimens to obtain information whether their expression levels are associated with the malignant grade of CCA. AID expression was similarly detected in the clinical cases of both well-differentiated and poorly-differentiated CCAs. On the contrary, GANP expression was detected in CCA cells at a higher level in the nucleus of poorly-differentiated CCAs with shorter survivals than in that of well-differentiated CCAs. The high and low cases of nuclear GANP expression showed no change in the frequency of the TP53 mutations, however, further investigation by in vitro experiment demonstrated that the high GANP expression caused the increased number of gammaH2AX foci after DNA damage by ionizing-irradiation. These results suggest that GANP is involved in regulation of DNA repair mechanism and the abnormal over-expression of GANP together with AID might be associated with rigorous DNA damage, potentially causing the malignant development of CCAs during long-term inflammation.

  19. Genotoxicity and cytotoxicity assay of water sampled from the underground nuclear explosion site in the north of the Perm region (Russia)

    Energy Technology Data Exchange (ETDEWEB)

    Evseeva, Tatiana I. [Institute of Biology, Komi Scientific Center, Ural Division RAS, 167982, Syktyvkar, Kommunisticheskaya 28 (Russian Federation); Geras' kin, Stanislav A. [Russian Institute of Agricultural Radiology and Agroecology RAAS, 249020 Obninsk, Kaluga region (Russian Federation)]. E-mail: stgeraskin@list.ru; Shuktomova, Ida I. [Institute of Biology, Komi Scientific Center, Ural Division RAS, 167982, Syktyvkar, Kommunisticheskaya 28 (Russian Federation); Taskaev, Anatoliy I. [Institute of Biology, Komi Scientific Center, Ural Division RAS, 167982, Syktyvkar, Kommunisticheskaya 28 (Russian Federation)

    2005-07-01

    The results of our study revealed a local biologically relevant surface water contamination in the radionuclide anomaly in the north of Russia (Perm region) by means of Allium schoenoprasum L. anaphase-telophase chromosome aberration assay. This radionuclide anomaly was formed in 1971 as a result of an underground nuclear explosion with soil excavation. Specific activities of main dose-forming radionuclides in all examined reservoirs are below intervention levels officially adopted in Russia for drinking water. We found that {sup 90}Sr significantly contributes to induction of cytogenetic disturbances. Our previous data and the data described here suggest that metal and radionuclide combined exposure (with the dose below permissible exposure limits for human) may cause substantial biological effects. These effects are in part due to synergic response. The findings described here indicated that development of a new concept of radiation protection for humans and biota should be based on the clear understanding of biological effects of low doses of radiation in chronic exposure to multi-pollutant mixtures.

  20. Geological disposal of radioactive wastes: national commitment, local and regional involvement. A Collective Statement of the OECD Nuclear Energy Agency 'Radioactive Waste Management Committee', adopted March 2011

    International Nuclear Information System (INIS)

    2012-01-01

    Disposal in engineered facilities built in stable, deep geological formations is the reference solution for permanently isolating long-lived radioactive waste from the human biosphere. This management method is designed to be intrinsically safe and final, i.e. not dependent on human presence and intervention in order to fulfil its safety goal. Siting waste repositories brings up a range of issues that touch on scientific knowledge, technical capacity, ethical values, territorial planning, community well-being, and more. Bringing to fruition the multi-decades task of siting and developing a repository demands a strong national commitment and a significant regional and local involvement. This Collective Statement by the Radioactive Waste Management Committee of the OECD Nuclear Energy Agency recognizes the advances made toward greater transparency and dialogue among the diverse relevant stakeholders and identifies the fundamental ingredients needed to support national commitment and foster territorial involvement. It concludes that technical and societal partners can develop shared confidence in the safety of geological repositories and jointly carry these projects forward