WorldWideScience

Sample records for region sequences reveal

  1. Multi-region and single-cell sequencing reveal variable genomic heterogeneity in rectal cancer.

    Science.gov (United States)

    Liu, Mingshan; Liu, Yang; Di, Jiabo; Su, Zhe; Yang, Hong; Jiang, Beihai; Wang, Zaozao; Zhuang, Meng; Bai, Fan; Su, Xiangqian

    2017-11-23

    Colorectal cancer is a heterogeneous group of malignancies with complex molecular subtypes. While colon cancer has been widely investigated, studies on rectal cancer are very limited. Here, we performed multi-region whole-exome sequencing and single-cell whole-genome sequencing to examine the genomic intratumor heterogeneity (ITH) of rectal tumors. We sequenced nine tumor regions and 88 single cells from two rectal cancer patients with tumors of the same molecular classification and characterized their mutation profiles and somatic copy number alterations (SCNAs) at the multi-region and the single-cell levels. A variable extent of genomic heterogeneity was observed between the two patients, and the degree of ITH increased when analyzed on the single-cell level. We found that major SCNAs were early events in cancer development and inherited steadily. Single-cell sequencing revealed mutations and SCNAs which were hidden in bulk sequencing. In summary, we studied the ITH of rectal cancer at regional and single-cell resolution and demonstrated that variable heterogeneity existed in two patients. The mutational scenarios and SCNA profiles of two patients with treatment naïve from the same molecular subtype are quite different. Our results suggest each tumor possesses its own architecture, which may result in different diagnosis, prognosis, and drug responses. Remarkable ITH exists in the two patients we have studied, providing a preliminary impression of ITH in rectal cancer.

  2. Characterization of race 65 of Colletotrichum lindemuthianum by sequencing ITS regions

    Directory of Open Access Journals (Sweden)

    Marcela Coelho

    2016-09-01

    Full Text Available The present work aimed characterize isolates of C. lindemuthianum race 65 from different regions in Brazil by ITS sequencing. A total of 17 isolates of race 65, collected in the states of Mato Grosso, Minas Gerais, Paraná, Santa Catarina and São Paulo, were studied. Analysis of the sequences of isolates 8, 9, 12, 14 and 15 revealed the presence of two single nucleotide polymorphisms (SNPs in the ITS1 region at the same positions. These isolates, when analyzed together with the sequence of isolate 17, revealed a SNP in the ITS2 region. The highest genetic dissimilarity, observed between isolates 11 and  3 and between isolates 11 and 10, was 0.772. In turn, isolates 7 and 2 were the most similar, with a value of 0.002 for genetic distance. The phylogenetic tree obtained based on the sequences of the ITS1 and ITS2 regions revealed the formation of two groups, one with a subgroup. The results reveal high molecular variability among isolates of race 65 of C. lindemuthianum.

  3. Sequencing analysis reveals a unique gene organization in the gyrB region of Mycoplasma hominis

    DEFF Research Database (Denmark)

    Ladefoged, Søren; Christiansen, Gunna

    1994-01-01

    of which showed similarity to that which encodes the LicA protein of Haemophilus influenzae. The organization of the genes in the region showed no resemblance to that in the corresponding regions of other bacteria sequenced so far. The gyrA gene was mapped 35 kb downstream from the gyrB gene.......The homolog of the gyrB gene, which has been reported to be present in the vicinity of the initiation site of replication in bacteria, was mapped on the Mycoplasma hominis genome, and the region was subsequently sequenced. Five open reading frames were identified flanking the gyrB gene, one...

  4. Region segmentation along image sequence

    International Nuclear Information System (INIS)

    Monchal, L.; Aubry, P.

    1995-01-01

    A method to extract regions in sequence of images is proposed. Regions are not matched from one image to the following one. The result of a region segmentation is used as an initialization to segment the following and image to track the region along the sequence. The image sequence is exploited as a spatio-temporal event. (authors). 12 refs., 8 figs

  5. Sequencing the CHO DXB11 genome reveals regional variations in genomic stability and haploidy

    DEFF Research Database (Denmark)

    Kaas, Christian Schrøder; Kristensen, Claus; Betenbaugh, Michael J.

    2015-01-01

    Background: The DHFR negative CHO DXB11 cell line (also known as DUX-B11 and DUKX) was historically the first CHO cell line to be used for large scale production of heterologous proteins and is still used for production of a number of complex proteins.  Results: Here we present the genomic sequence...... of the CHO DXB11 genome sequenced to a depth of 33x. Overall a significant genomic drift was seen favoring GC -> AT point mutations in line with the chemical mutagenesis strategy used for generation of the cell line. The sequencing depth for each gene in the genome revealed distinct peaks at sequencing...... in eight additional analyzed CHO genomes (15-20% haploidy) but not in the genome of the Chinese hamster. The dhfr gene is confirmed to be haploid in CHO DXB11; transcriptionally active and the remaining allele contains a G410C point mutation causing a Thr137Arg missense mutation. We find similar to 2...

  6. Three genetic stocks of frigate tuna Auxis thazard thazard (Lacepede, 1800) along the Indian coast revealed from sequence analyses of mitochondrial DNA D-loop region

    Digital Repository Service at National Institute of Oceanography (India)

    GirishKumar; Kunal, S.P.; Menezes, M.R.; Meena, R.M.

    revealed from sequence analyses of mitochondrial DNA D-loop region Name of authors: 1. Girish Kumar* Biological Oceanography Division (BOD) National Institute of Oceanography (NIO) Dona Paula, Goa 403004, India. Email: girishkumar....nio@gmail.com Tel: +919766548060 2. Swaraj Priyaranjan Kunal Biological Oceanography Division (BOD) National Institute of Oceanography (NIO) Dona Paula, Goa 403004, India. Email: swar.mbt@gmail.com 3. Maria Rosalia Menezes Biological Oceanography...

  7. Whole-exome sequencing reveals genetic variants associated with chronic kidney disease characterized by tubulointerstitial damages in North Central Region, Sri Lanka.

    Science.gov (United States)

    Nanayakkara, Shanika; Senevirathna, S T M L D; Parahitiyawa, Nipuna B; Abeysekera, Tilak; Chandrajith, Rohana; Ratnatunga, Neelakanthi; Hitomi, Toshiaki; Kobayashi, Hatasu; Harada, Kouji H; Koizumi, Akio

    2015-09-01

    The familial clustering observed in chronic kidney disease of uncertain etiology (CKDu) characterized by tubulointerstitial damages in the North Central Region of Sri Lanka strongly suggests the involvement of genetic factors in its pathogenesis. The objective of the present study is to use whole-exome sequencing to identify the genetic variants associated with CKDu. Whole-exome sequencing of eight CKDu cases and eight controls was performed, followed by direct sequencing of candidate loci in 301 CKDu cases and 276 controls. Association study revealed rs34970857 (c.658G > A/p.V220M) located in the KCNA10 gene encoding a voltage-gated K channel as the most promising SNP with the highest odds ratio of 1.74. Four rare variants were identified in gene encoding Laminin beta2 (LAMB2) which is known to cause congenital nephrotic syndrome. Three out of four variants in LAMB2 were novel variants found exclusively in cases. Genetic investigations provide strong evidence on the presence of genetic susceptibility for CKDu. Possibility of presence of several rare variants associated with CKDu in this population is also suggested.

  8. Multilocus Sequence Analysis of Nectar Pseudomonads Reveals High Genetic Diversity and Contrasting Recombination Patterns

    Science.gov (United States)

    Álvarez-Pérez, Sergio; de Vega, Clara; Herrera, Carlos M.

    2013-01-01

    The genetic and evolutionary relationships among floral nectar-dwelling Pseudomonas ‘sensu stricto’ isolates associated to South African and Mediterranean plants were investigated by multilocus sequence analysis (MLSA) of four core housekeeping genes (rrs, gyrB, rpoB and rpoD). A total of 35 different sequence types were found for the 38 nectar bacterial isolates characterised. Phylogenetic analyses resulted in the identification of three main clades [nectar groups (NGs) 1, 2 and 3] of nectar pseudomonads, which were closely related to five intrageneric groups: Pseudomonas oryzihabitans (NG 1); P. fluorescens, P. lutea and P. syringae (NG 2); and P. rhizosphaerae (NG 3). Linkage disequilibrium analysis pointed to a mostly clonal population structure, even when the analysis was restricted to isolates from the same floristic region or belonging to the same NG. Nevertheless, signatures of recombination were observed for NG 3, which exclusively included isolates retrieved from the floral nectar of insect-pollinated Mediterranean plants. In contrast, the other two NGs comprised both South African and Mediterranean isolates. Analyses relating diversification to floristic region and pollinator type revealed that there has been more unique evolution of the nectar pseudomonads within the Mediterranean region than would be expected by chance. This is the first work analysing the sequence of multiple loci to reveal geno- and ecotypes of nectar bacteria. PMID:24116076

  9. Multilocus sequence analysis of nectar pseudomonads reveals high genetic diversity and contrasting recombination patterns.

    Science.gov (United States)

    Alvarez-Pérez, Sergio; de Vega, Clara; Herrera, Carlos M

    2013-01-01

    The genetic and evolutionary relationships among floral nectar-dwelling Pseudomonas 'sensu stricto' isolates associated to South African and Mediterranean plants were investigated by multilocus sequence analysis (MLSA) of four core housekeeping genes (rrs, gyrB, rpoB and rpoD). A total of 35 different sequence types were found for the 38 nectar bacterial isolates characterised. Phylogenetic analyses resulted in the identification of three main clades [nectar groups (NGs) 1, 2 and 3] of nectar pseudomonads, which were closely related to five intrageneric groups: Pseudomonas oryzihabitans (NG 1); P. fluorescens, P. lutea and P. syringae (NG 2); and P. rhizosphaerae (NG 3). Linkage disequilibrium analysis pointed to a mostly clonal population structure, even when the analysis was restricted to isolates from the same floristic region or belonging to the same NG. Nevertheless, signatures of recombination were observed for NG 3, which exclusively included isolates retrieved from the floral nectar of insect-pollinated Mediterranean plants. In contrast, the other two NGs comprised both South African and Mediterranean isolates. Analyses relating diversification to floristic region and pollinator type revealed that there has been more unique evolution of the nectar pseudomonads within the Mediterranean region than would be expected by chance. This is the first work analysing the sequence of multiple loci to reveal geno- and ecotypes of nectar bacteria.

  10. Intra-Genomic Internal Transcribed Spacer Region Sequence Heterogeneity and Molecular Diagnosis in Clinical Microbiology.

    Science.gov (United States)

    Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Cheng, Jingwei; Xu, Yingchun; Lau, Susanna K P; Woo, Patrick C Y

    2015-10-22

    Internal transcribed spacer region (ITS) sequencing is the most extensively used technology for accurate molecular identification of fungal pathogens in clinical microbiology laboratories. Intra-genomic ITS sequence heterogeneity, which makes fungal identification based on direct sequencing of PCR products difficult, has rarely been reported in pathogenic fungi. During the process of performing ITS sequencing on 71 yeast strains isolated from various clinical specimens, direct sequencing of the PCR products showed ambiguous sequences in six of them. After cloning the PCR products into plasmids for sequencing, interpretable sequencing electropherograms could be obtained. For each of the six isolates, 10-49 clones were selected for sequencing and two to seven intra-genomic ITS copies were detected. The identities of these six isolates were confirmed to be Candida glabrata (n=2), Pichia (Candida) norvegensis (n=2), Candida tropicalis (n=1) and Saccharomyces cerevisiae (n=1). Multiple sequence alignment revealed that one to four intra-genomic ITS polymorphic sites were present in the six isolates, and all these polymorphic sites were located in the ITS1 and/or ITS2 regions. We report and describe the first evidence of intra-genomic ITS sequence heterogeneity in four different pathogenic yeasts, which occurred exclusively in the ITS1 and ITS2 spacer regions for the six isolates in this study.

  11. DNA Barcoding: Amplification and sequence analysis of rbcl and matK genome regions in three divergent plant species

    Directory of Open Access Journals (Sweden)

    Javed Iqbal Wattoo

    2016-11-01

    Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.

  12. MicroRNA sequence motifs reveal asymmetry between the stem arms

    DEFF Research Database (Denmark)

    Gorodkin, Jan; Havgaard, Jakob Hull; Ensterö, M.

    2006-01-01

    The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature miRNAs in their gen......The processing of micro RNAs (miRNAs) from their stemloop precursor have revealed asymmetry in the processing of the mature and its star sequence. Furthermore, the miRNA processing system between organism differ. To assess this at the sequence level we have investigated mature mi...

  13. Taxonomy of anaerobic digestion microbiome reveals biases associated with the applied high throughput sequencing strategies

    DEFF Research Database (Denmark)

    Campanaro, Stefano; Treu, Laura; Kougias, Panagiotis

    2018-01-01

    In the past few years, many studies investigated the anaerobic digestion microbiome by means of 16S rRNA amplicon sequencing. Results obtained from these studies were compared to each other without taking into consideration the followed procedure for amplicons preparation and data analysis...... specifically, the microbial compositions of three laboratory scale biogas reactors were analyzed before and after addition of sodium oleate by sequencing the microbiome with three different approaches: 16S rRNA amplicon sequencing, shotgun DNA and shotgun RNA. This comparative analysis revealed that......, in amplicon sequencing, abundance of some taxa (Euryarchaeota and Spirochaetes) was biased by the inefficiency of universal primers to hybridize all the templates. Reliability of the results obtained was also influenced by the number of hypervariable regions under investigation. Finally, amplicon sequencing...

  14. DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1T

    OpenAIRE

    Choudhary, M.; Kaplan, Samuel

    2000-01-01

    This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1T. The photosynthesis gene cluster is located within a ~73 kb AseI genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The da...

  15. Comparative sequence analyses of the major quantitative trait locus phosphorus uptake 1 (Pup1) reveal a complex genetic structure.

    Science.gov (United States)

    Heuer, Sigrid; Lu, Xiaochun; Chin, Joong Hyoun; Tanaka, Juan Pariasca; Kanamori, Hiroyuki; Matsumoto, Takashi; De Leon, Teresa; Ulat, Victor Jun; Ismail, Abdelbagi M; Yano, Masahiro; Wissuwa, Matthias

    2009-06-01

    The phosphorus uptake 1 (Pup1) locus was identified as a major quantitative trait locus (QTL) for tolerance of phosphorus deficiency in rice. Near-isogenic lines with the Pup1 region from tolerant donor parent Kasalath typically show threefold higher phosphorus uptake and grain yield in phosphorus-deficient field trials than the intolerant parent Nipponbare. In this study, we report the fine mapping of the Pup1 locus to the long arm of chromosome 12 (15.31-15.47 Mb). Genes in the region were initially identified on the basis of the Nipponbare reference genome, but did not reveal any obvious candidate genes related to phosphorus uptake. Kasalath BAC clones were therefore sequenced and revealed a 278-kbp sequence significantly different from the syntenic regions in Nipponbare (145 kb) and in the indica reference genome of 93-11 (742 kbp). Size differences are caused by large insertions or deletions (INDELs), and an exceptionally large number of retrotransposon and transposon-related elements (TEs) present in all three sequences (45%-54%). About 46 kb of the Kasalath sequence did not align with the entire Nipponbare genome, and only three Nipponbare genes (fatty acid alpha-dioxygenase, dirigent protein and aspartic proteinase) are highly conserved in Kasalath. Two Nipponbare genes (expressed proteins) might have evolved by at least three TE integrations in an ancestor gene that is still present in Kasalath. Several predicted Kasalath genes are novel or unknown genes that are mainly located within INDEL regions. Our results highlight the importance of sequencing QTL regions in the respective donor parent, as important genes might not be present in the current reference genomes.

  16. Chromosomal structures and repetitive sequences divergence in Cucumis species revealed by comparative cytogenetic mapping.

    Science.gov (United States)

    Zhang, Yunxia; Cheng, Chunyan; Li, Ji; Yang, Shuqiong; Wang, Yunzhu; Li, Ziang; Chen, Jinfeng; Lou, Qunfeng

    2015-09-25

    Differentiation and copy number of repetitive sequences affect directly chromosome structure which contributes to reproductive isolation and speciation. Comparative cytogenetic mapping has been verified an efficient tool to elucidate the differentiation and distribution of repetitive sequences in genome. In present study, the distinct chromosomal structures of five Cucumis species were revealed through genomic in situ hybridization (GISH) technique and comparative cytogenetic mapping of major satellite repeats. Chromosome structures of five Cucumis species were investigated using GISH and comparative mapping of specific satellites. Southern hybridization was employed to study the proliferation of satellites, whose structural characteristics were helpful for analyzing chromosome evolution. Preferential distribution of repetitive DNAs at the subtelomeric regions was found in C. sativus, C hystrix and C. metuliferus, while majority was positioned at the pericentromeric heterochromatin regions in C. melo and C. anguria. Further, comparative GISH (cGISH) through using genomic DNA of other species as probes revealed high homology of repeats between C. sativus and C. hystrix. Specific satellites including 45S rDNA, Type I/II, Type III, Type IV, CentM and telomeric repeat were then comparatively mapped in these species. Type I/II and Type IV produced bright signals at the subtelomeric regions of C. sativus and C. hystrix simultaneously, which might explain the significance of their amplification in the divergence of Cucumis subgenus from the ancient ancestor. Unique positioning of Type III and CentM only at the centromeric domains of C. sativus and C. melo, respectively, combining with unique southern bands, revealed rapid evolutionary patterns of centromeric DNA in Cucumis. Obvious interstitial telomeric repeats were observed in chromosomes 1 and 2 of C. sativus, which might provide evidence of the fusion hypothesis of chromosome evolution from x = 12 to x = 7 in

  17. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    Science.gov (United States)

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was

  18. Exome sequencing generates high quality data in non-target regions

    Directory of Open Access Journals (Sweden)

    Guo Yan

    2012-05-01

    Full Text Available Abstract Background Exome sequencing using next-generation sequencing technologies is a cost efficient approach to selectively sequencing coding regions of human genome for detection of disease variants. A significant amount of DNA fragments from the capture process fall outside target regions, and sequence data for positions outside target regions have been mostly ignored after alignment. Result We performed whole exome sequencing on 22 subjects using Agilent SureSelect capture reagent and 6 subjects using Illumina TrueSeq capture reagent. We also downloaded sequencing data for 6 subjects from the 1000 Genomes Project Pilot 3 study. Using these data, we examined the quality of SNPs detected outside target regions by computing consistency rate with genotypes obtained from SNP chips or the Hapmap database, transition-transversion (Ti/Tv ratio, and percentage of SNPs inside dbSNP. For all three platforms, we obtained high-quality SNPs outside target regions, and some far from target regions. In our Agilent SureSelect data, we obtained 84,049 high-quality SNPs outside target regions compared to 65,231 SNPs inside target regions (a 129% increase. For our Illumina TrueSeq data, we obtained 222,171 high-quality SNPs outside target regions compared to 95,818 SNPs inside target regions (a 232% increase. For the data from the 1000 Genomes Project, we obtained 7,139 high-quality SNPs outside target regions compared to 1,548 SNPs inside target regions (a 461% increase. Conclusions These results demonstrate that a significant amount of high quality genotypes outside target regions can be obtained from exome sequencing data. These data should not be ignored in genetic epidemiology studies.

  19. Sequencing the GRHL3 Coding Region Reveals Rare Truncating Mutations and a Common Susceptibility Variant for Nonsyndromic Cleft Palate

    Science.gov (United States)

    Mangold, Elisabeth; Böhmer, Anne C.; Ishorst, Nina; Hoebel, Ann-Kathrin; Gültepe, Pinar; Schuenke, Hannah; Klamt, Johanna; Hofmann, Andrea; Gölz, Lina; Raff, Ruth; Tessmann, Peter; Nowak, Stefanie; Reutter, Heiko; Hemprich, Alexander; Kreusch, Thomas; Kramer, Franz-Josef; Braumann, Bert; Reich, Rudolf; Schmidt, Gül; Jäger, Andreas; Reiter, Rudolf; Brosch, Sibylle; Stavusis, Janis; Ishida, Miho; Seselgyte, Rimante; Moore, Gudrun E.; Nöthen, Markus M.; Borck, Guntram; Aldhorae, Khalid A.; Lace, Baiba; Stanier, Philip; Knapp, Michael; Ludwig, Kerstin U.

    2016-01-01

    Nonsyndromic cleft lip with/without cleft palate (nsCL/P) and nonsyndromic cleft palate only (nsCPO) are the most frequent subphenotypes of orofacial clefts. A common syndromic form of orofacial clefting is Van der Woude syndrome (VWS) where individuals have CL/P or CPO, often but not always associated with lower lip pits. Recently, ∼5% of VWS-affected individuals were identified with mutations in the grainy head-like 3 gene (GRHL3). To investigate GRHL3 in nonsyndromic clefting, we sequenced its coding region in 576 Europeans with nsCL/P and 96 with nsCPO. Most strikingly, nsCPO-affected individuals had a higher minor allele frequency for rs41268753 (0.099) than control subjects (0.049; p = 1.24 × 10−2). This association was replicated in nsCPO/control cohorts from Latvia, Yemen, and the UK (pcombined = 2.63 × 10−5; ORallelic = 2.46 [95% CI 1.6–3.7]) and reached genome-wide significance in combination with imputed data from a GWAS in nsCPO triads (p = 2.73 × 10−9). Notably, rs41268753 is not associated with nsCL/P (p = 0.45). rs41268753 encodes the highly conserved p.Thr454Met (c.1361C>T) (GERP = 5.3), which prediction programs denote as deleterious, has a CADD score of 29.6, and increases protein binding capacity in silico. Sequencing also revealed four novel truncating GRHL3 mutations including two that were de novo in four families, where all nine individuals harboring mutations had nsCPO. This is important for genetic counseling: given that VWS is rare compared to nsCPO, our data suggest that dominant GRHL3 mutations are more likely to cause nonsyndromic than syndromic CPO. Thus, with rare dominant mutations and a common risk variant in the coding region, we have identified an important contribution for GRHL3 in nsCPO. PMID:27018475

  20. Homozygosity mapping and targeted sanger sequencing reveal genetic defects underlying inherited retinal disease in families from pakistan.

    Directory of Open Access Journals (Sweden)

    Maleeha Maria

    Full Text Available Homozygosity mapping has facilitated the identification of the genetic causes underlying inherited diseases, particularly in consanguineous families with multiple affected individuals. This knowledge has also resulted in a mutation dataset that can be used in a cost and time effective manner to screen frequent population-specific genetic variations associated with diseases such as inherited retinal disease (IRD.We genetically screened 13 families from a cohort of 81 Pakistani IRD families diagnosed with Leber congenital amaurosis (LCA, retinitis pigmentosa (RP, congenital stationary night blindness (CSNB, or cone dystrophy (CD. We employed genome-wide single nucleotide polymorphism (SNP array analysis to identify homozygous regions shared by affected individuals and performed Sanger sequencing of IRD-associated genes located in the sizeable homozygous regions. In addition, based on population specific mutation data we performed targeted Sanger sequencing (TSS of frequent variants in AIPL1, CEP290, CRB1, GUCY2D, LCA5, RPGRIP1 and TULP1, in probands from 28 LCA families.Homozygosity mapping and Sanger sequencing of IRD-associated genes revealed the underlying mutations in 10 families. TSS revealed causative variants in three families. In these 13 families four novel mutations were identified in CNGA1, CNGB1, GUCY2D, and RPGRIP1.Homozygosity mapping and TSS revealed the underlying genetic cause in 13 IRD families, which is useful for genetic counseling as well as therapeutic interventions that are likely to become available in the near future.

  1. Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout.

    Science.gov (United States)

    Rasmussen, C; Purcell, M K; Gregg, J L; LaPatra, S E; Winton, J R; Hershberger, P K

    2010-03-09

    The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of approximately 740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

  2. Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences

    OpenAIRE

    Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

    2017-01-01

    Background The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Results Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consi...

  3. Complete genome sequence analysis of novel human bocavirus reveals genetic recombination between human bocavirus 2 and human bocavirus 4.

    Science.gov (United States)

    Khamrin, Pattara; Okitsu, Shoko; Ushijima, Hiroshi; Maneekarn, Niwat

    2013-07-01

    Epidemiological surveillance of human bocavirus (HBoV) was conducted on fecal specimens collected from hospitalized children with diarrhea in Chiang Mai, Thailand in 2011. By partial sequence analysis of VP1 gene, an unusual strain of HBoV (CMH-S011-11), was initially identified as HBoV4. The complete genome sequence of CMH-S011-11 was performed and analyzed further to clarify whether it was a recombinant strain or a new HBoV variant. Analysis of complete genome sequence revealed that the coding sequence starting from NS1, NP1 to VP1/VP2 was 4795 nucleotides long. Interestingly, the nucleotide sequence of NS1 gene of CMH-S011-11 was most closely related to the HBoV2 reference strains detected in Pakistan, which contradicted to the initial genotyping result of the partial VP1 region in the previous study. In addition, comparison of NP1 nucleotide sequence of CMH-S011-11 with those of other HBoV1-4 reference strains also revealed a high level of sequence identity with HBoV2. On the other hand, nucleotide sequence of VP1/VP2 gene of CMH-S011-11 was most closely related to those of HBoV4 reference strains detected in Nigeria. The overall full-length sequence analysis revealed that this CMH-S011-11 was grouped within HBoV4 species, but located in a separate branch from other HBoV4 prototype strains. Recombination analysis revealed that CMH-S011-11 was the result of recombination between HBoV2 and HBoV4 strains with the break point located near the start codon of VP2. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Molecular evolution and diversification of snake toxin genes, revealed by analysis of intron sequences.

    Science.gov (United States)

    Fujimi, T J; Nakajyo, T; Nishimura, E; Ogura, E; Tsuchiya, T; Tamiya, T

    2003-08-14

    The genes encoding erabutoxin (short chain neurotoxin) isoforms (Ea, Eb, and Ec), LsIII (long chain neurotoxin) and a novel long chain neurotoxin pseudogene were cloned from a Laticauda semifasciata genomic library. Short and long chain neurotoxin genes were also cloned from the genome of Laticauda laticaudata, a closely related species of L. semifasciata, by PCR. A putative matrix attached region (MAR) sequence was found in the intron I of the LsIII gene. Comparative analysis of 11 structurally relevant snake toxin genes (three-finger-structure toxins) revealed the molecular evolution of these toxins. Three-finger-structure toxin genes diverged from a common ancestor through two types of evolutionary pathways (long and short types), early in the course of evolution. At a later stage of evolution in each gene, the accumulation of mutations in the exons, especially exon II, by accelerated evolution may have caused the increased diversification in their functions. It was also revealed that the putative MAR sequence found in the LsIII gene was integrated into the gene after the species-level divergence.

  5. High quality maize centromere 10 sequence reveals evidence of frequent recombination events

    Directory of Open Access Journals (Sweden)

    Thomas Kai Wolfgruber

    2016-03-01

    Full Text Available The ancestral centromeres of maize contain long stretches of the tandemly arranged CentC repeat. The abundance of tandem DNA repeats and centromeric retrotransposons (CR have presented a significant challenge to completely assembling centromeres using traditional sequencing methods. Here we report a nearly complete assembly of the 1.85 Mb maize centromere 10 from inbred B73 using PacBio technology and BACs from the reference genome project. The error rates estimated from overlapping BAC sequences are 7 x 10-6 and 5 x 10-5 for mismatches and indels, respectively. The number of gaps in the region covered by the reassembly was reduced from 140 in the reference genome to three. Three expressed genes are located between 92 and 477 kb of the inferred ancestral CentC cluster, which lies within the region of highest centromeric repeat density. The improved assembly increased the count of full-length centromeric retrotransposons from 5 to 55 and revealed a 22.7 kb segmental duplication that occurred approximately 121,000 years ago. Our analysis provides evidence of frequent recombination events in the form of partial retrotransposons, deletions within retrotransposons, chimeric retrotransposons, segmental duplications including higher order CentC repeats, a deleted CentC monomer, centromere-proximal inversions, and insertion of mitochondrial sequences. Double-strand DNA break (DSB repair is the most plausible mechanism for these events and may be the major driver of centromere repeat evolution and diversity. This repair appears to be mediated by microhomology, suggesting that tandem repeats may have evolved to facilitate the repair of frequent DSBs in centromeres.

  6. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    Science.gov (United States)

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  7. Genome re-sequencing of semi-wild soybean reveals a complex Soja population structure and deep introgression.

    Directory of Open Access Journals (Sweden)

    Jie Qiu

    Full Text Available Semi-wild soybean is a unique type of soybean that retains both wild and domesticated characteristics, which provides an important intermediate type for understanding the evolution of the subgenus Soja population in the Glycine genus. In this study, a semi-wild soybean line (Maliaodou and a wild line (Lanxi 1 collected from the lower Yangtze regions were deeply sequenced while nine other semi-wild lines were sequenced to a 3-fold genome coverage. Sequence analysis revealed that (1 no independent phylogenetic branch covering all 10 semi-wild lines was observed in the Soja phylogenetic tree; (2 besides two distinct subpopulations of wild and cultivated soybean in the Soja population structure, all semi-wild lines were mixed with some wild lines into a subpopulation rather than an independent one or an intermediate transition type of soybean domestication; (3 high heterozygous rates (0.19-0.49 were observed in several semi-wild lines; and (4 over 100 putative selective regions were identified by selective sweep analysis, including those related to the development of seed size. Our results suggested a hybridization origin for the semi-wild soybean, which makes a complex Soja population structure.

  8. Highly conserved intragenic HSV-2 sequences: Results from next-generation sequencing of HSV-2 UL and US regions from genital swabs collected from 3 continents.

    Science.gov (United States)

    Johnston, Christine; Magaret, Amalia; Roychoudhury, Pavitra; Greninger, Alexander L; Cheng, Anqi; Diem, Kurt; Fitzgibbon, Matthew P; Huang, Meei-Li; Selke, Stacy; Lingappa, Jairam R; Celum, Connie; Jerome, Keith R; Wald, Anna; Koelle, David M

    2017-10-01

    Understanding the variability in circulating herpes simplex virus type 2 (HSV-2) genomic sequences is critical to the development of HSV-2 vaccines. Genital lesion swabs containing ≥ 10 7 log 10 copies HSV DNA collected from Africa, the USA, and South America underwent next-generation sequencing, followed by K-mer based filtering and de novo genomic assembly. Sites of heterogeneity within coding regions in unique long and unique short (U L _U S ) regions were identified. Phylogenetic trees were created using maximum likelihood reconstruction. Among 46 samples from 38 persons, 1468 intragenic base-pair substitutions were identified. The maximum nucleotide distance between strains for concatenated U L_ U S segments was 0.4%. Phylogeny did not reveal geographic clustering. The most variable proteins had non-synonymous mutations in < 3% of amino acids. Unenriched HSV-2 DNA can undergo next-generation sequencing to identify intragenic variability. The use of clinical swabs for sequencing expands the information that can be gathered directly from these specimens. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Next generation sequencing reveals the hidden diversity of zooplankton assemblages.

    Directory of Open Access Journals (Sweden)

    Penelope K Lindeque

    Full Text Available BACKGROUND: Zooplankton play an important role in our oceans, in biogeochemical cycling and providing a food source for commercially important fish larvae. However, difficulties in correctly identifying zooplankton hinder our understanding of their roles in marine ecosystem functioning, and can prevent detection of long term changes in their community structure. The advent of massively parallel next generation sequencing technology allows DNA sequence data to be recovered directly from whole community samples. Here we assess the ability of such sequencing to quantify richness and diversity of a mixed zooplankton assemblage from a productive time series site in the Western English Channel. METHODOLOGY/PRINCIPLE FINDINGS: Plankton net hauls (200 µm were taken at the Western Channel Observatory station L4 in September 2010 and January 2011. These samples were analysed by microscopy and metagenetic analysis of the 18S nuclear small subunit ribosomal RNA gene using the 454 pyrosequencing platform. Following quality control a total of 419,041 sequences were obtained for all samples. The sequences clustered into 205 operational taxonomic units using a 97% similarity cut-off. Allocation of taxonomy by comparison with the National Centre for Biotechnology Information database identified 135 OTUs to species level, 11 to genus level and 1 to order, <2.5% of sequences were classified as unknowns. By comparison a skilled microscopic analyst was able to routinely enumerate only 58 taxonomic groups. CONCLUSIONS: Metagenetics reveals a previously hidden taxonomic richness, especially for Copepoda and hard-to-identify meroplankton such as Bivalvia, Gastropoda and Polychaeta. It also reveals rare species and parasites. We conclude that Next Generation Sequencing of 18S amplicons is a powerful tool for elucidating the true diversity and species richness of zooplankton communities. While this approach allows for broad diversity assessments of plankton it may

  10. Functional region prediction with a set of appropriate homologous sequences-an index for sequence selection by integrating structure and sequence information with spatial statistics

    Science.gov (United States)

    2012-01-01

    Background The detection of conserved residue clusters on a protein structure is one of the effective strategies for the prediction of functional protein regions. Various methods, such as Evolutionary Trace, have been developed based on this strategy. In such approaches, the conserved residues are identified through comparisons of homologous amino acid sequences. Therefore, the selection of homologous sequences is a critical step. It is empirically known that a certain degree of sequence divergence in the set of homologous sequences is required for the identification of conserved residues. However, the development of a method to select homologous sequences appropriate for the identification of conserved residues has not been sufficiently addressed. An objective and general method to select appropriate homologous sequences is desired for the efficient prediction of functional regions. Results We have developed a novel index to select the sequences appropriate for the identification of conserved residues, and implemented the index within our method to predict the functional regions of a protein. The implementation of the index improved the performance of the functional region prediction. The index represents the degree of conserved residue clustering on the tertiary structure of the protein. For this purpose, the structure and sequence information were integrated within the index by the application of spatial statistics. Spatial statistics is a field of statistics in which not only the attributes but also the geometrical coordinates of the data are considered simultaneously. Higher degrees of clustering generate larger index scores. We adopted the set of homologous sequences with the highest index score, under the assumption that the best prediction accuracy is obtained when the degree of clustering is the maximum. The set of sequences selected by the index led to higher functional region prediction performance than the sets of sequences selected by other sequence

  11. Optimization of sequence alignment for simple sequence repeat regions

    Directory of Open Access Journals (Sweden)

    Ogbonnaya Francis C

    2011-07-01

    Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic

  12. Protein sequences from mastodon and Tyrannosaurus rex revealed by mass spectrometry.

    Science.gov (United States)

    Asara, John M; Schweitzer, Mary H; Freimark, Lisa M; Phillips, Matthew; Cantley, Lewis C

    2007-04-13

    Fossilized bones from extinct taxa harbor the potential for obtaining protein or DNA sequences that could reveal evolutionary links to extant species. We used mass spectrometry to obtain protein sequences from bones of a 160,000- to 600,000-year-old extinct mastodon (Mammut americanum) and a 68-million-year-old dinosaur (Tyrannosaurus rex). The presence of T. rex sequences indicates that their peptide bonds were remarkably stable. Mass spectrometry can thus be used to determine unique sequences from ancient organisms from peptide fragmentation patterns, a valuable tool to study the evolution and adaptation of ancient taxa from which genomic sequences are unlikely to be obtained.

  13. Deep sequencing of the oral microbiome reveals signatures of periodontal disease.

    Directory of Open Access Journals (Sweden)

    Bo Liu

    Full Text Available The oral microbiome, the complex ecosystem of microbes inhabiting the human mouth, harbors several thousands of bacterial types. The proliferation of pathogenic bacteria within the mouth gives rise to periodontitis, an inflammatory disease known to also constitute a risk factor for cardiovascular disease. While much is known about individual species associated with pathogenesis, the system-level mechanisms underlying the transition from health to disease are still poorly understood. Through the sequencing of the 16S rRNA gene and of whole community DNA we provide a glimpse at the global genetic, metabolic, and ecological changes associated with periodontitis in 15 subgingival plaque samples, four from each of two periodontitis patients, and the remaining samples from three healthy individuals. We also demonstrate the power of whole-metagenome sequencing approaches in characterizing the genomes of key players in the oral microbiome, including an unculturable TM7 organism. We reveal the disease microbiome to be enriched in virulence factors, and adapted to a parasitic lifestyle that takes advantage of the disrupted host homeostasis. Furthermore, diseased samples share a common structure that was not found in completely healthy samples, suggesting that the disease state may occupy a narrow region within the space of possible configurations of the oral microbiome. Our pilot study demonstrates the power of high-throughput sequencing as a tool for understanding the role of the oral microbiome in periodontal disease. Despite a modest level of sequencing (~2 lanes Illumina 76 bp PE and high human DNA contamination (up to ~90% we were able to partially reconstruct several oral microbes and to preliminarily characterize some systems-level differences between the healthy and diseased oral microbiomes.

  14. Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.

    Science.gov (United States)

    Nagar, Anurag; Hahsler, Michael

    2013-01-01

    Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to

  15. Full Genome Sequencing Reveals New Southern African Territories Genotypes Bringing Us Closer to Understanding True Variability of Foot-and-Mouth Disease Virus in Africa

    Science.gov (United States)

    Lasecka-Dykes, Lidia; Wright, Caroline F.; Di Nardo, Antonello; Logan, Grace; Mioulet, Valerie; Jackson, Terry; Tuthill, Tobias J.; Knowles, Nick J.; King, Donald P.

    2018-01-01

    Foot-and-mouth disease virus (FMDV) causes a highly contagious disease of cloven-hooved animals that poses a constant burden on farmers in endemic regions and threatens the livestock industries in disease-free countries. Despite the increased number of publicly available whole genome sequences, FMDV data are biased by the opportunistic nature of sampling. Since whole genomic sequences of Southern African Territories (SAT) are particularly underrepresented, this study sequenced 34 isolates from eastern and southern Africa. Phylogenetic analyses revealed two novel genotypes (that comprised 8/34 of these SAT isolates) which contained unusual 5′ untranslated and non-structural encoding regions. While recombination has occurred between these sequences, phylogeny violation analyses indicated that the high degree of sequence diversity for the novel SAT genotypes has not solely arisen from recombination events. Based on estimates of the timing of ancestral divergence, these data are interpreted as being representative of un-sampled FMDV isolates that have been subjected to geographical isolation within Africa by the effects of the Great African Rinderpest Pandemic (1887–1897), which caused a mass die-out of FMDV-susceptible hosts. These findings demonstrate that further sequencing of African FMDV isolates is likely to reveal more unusual genotypes and will allow for better understanding of natural variability and evolution of FMDV. PMID:29652800

  16. Sequence Ready Characterization of the Pericentromeric Region of 19p12

    Energy Technology Data Exchange (ETDEWEB)

    Evan E. Eichler

    2006-08-31

    Current mapping and sequencing strategies have been inadequate within the proximal portion of 19p12 due, in part, to the presence of a recently expanded ZNF (zinc-finger) gene family and the presence of large (25-50 kb) inverted beta-satellite repeat structures which bracket this tandemly duplicated gene family. The virtual of absence of classically defined “unique” sequence within the region has hampered efforts to identify and characterize a suitable minimal tiling path of clones which can be used as templates required for finished sequencing of the region. The goal of this proposal is to develop and implement a novel sequence-anchor strategy to generate a contiguous BAC map of the most proximal portion of chromosome 19p12 for the purpose of complete sequence characterization. The target region will be an estimated 4.5 Mb of DNA extending from STS marker D19S450 (the beginning of the ZNF gene cluster) to the centromeric (alpha-satellite) junction of 19p11. The approach will entail 1) pre-selection of 19p12 BAC and cosmid clones (NIH approved library) utilizing both 19p12 -unique and 19p12-SPECIFIC repeat probes (Eichler et al., 1998); 2) the generation of a BAC/cosmid end-sequence map across the region with a density of one marker every 8kb; 3) the development of a second-generation of STS (sequence tagged sites) which will be used to identify and verify clonal overlap at the level of the sequence; 4) incorporation of these sequence-anchored overlapping clones into existing cosmid/BAC restriction maps developed at Livermore National Laboratory; and 5) validation of the organization of this region utilizing high-resolution FISH techniques (extended chromatin analysis) on monochromosomal 19 somatic cell hybrids and parental cell lines of source material. The data generated will be used in the selection of the most parsimonious tiling path of BAC clones to be sequenced as part of the JGI effort on chromosome 19 and should serve as a model for the sequence

  17. Deep amplicon sequencing reveals mixed phytoplasma infection within single grapevine plants

    DEFF Research Database (Denmark)

    Nicolaisen, Mogens; Contaldo, Nicoletta; Makarova, Olga

    2011-01-01

    The diversity of phytoplasmas within single plants has not yet been fully investigated. In this project, deep amplicon sequencing was used to generate 50,926 phytoplasma sequences from 11 phytoplasma-infected grapevine samples from a PCR amplicon in the 5' end of the 16S region. After clustering ...

  18. Deep sequencing of foot-and-mouth disease virus reveals RNA sequences involved in genome packaging.

    Science.gov (United States)

    Logan, Grace; Newman, Joseph; Wright, Caroline F; Lasecka-Dykes, Lidia; Haydon, Daniel T; Cottam, Eleanor M; Tuthill, Tobias J

    2017-10-18

    Non-enveloped viruses protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. Packaging and capsid assembly in RNA viruses can involve interactions between capsid proteins and secondary structures in the viral genome as exemplified by the RNA bacteriophage MS2 and as proposed for other RNA viruses of plants, animals and human. In the picornavirus family of non-enveloped RNA viruses, the requirements for genome packaging remain poorly understood. Here we show a novel and simple approach to identify predicted RNA secondary structures involved in genome packaging in the picornavirus foot-and-mouth disease virus (FMDV). By interrogating deep sequencing data generated from both packaged and unpackaged populations of RNA we have determined multiple regions of the genome with constrained variation in the packaged population. Predicted secondary structures of these regions revealed stem loops with conservation of structure and a common motif at the loop. Disruption of these features resulted in attenuation of virus growth in cell culture due to a reduction in assembly of mature virions. This study provides evidence for the involvement of predicted RNA structures in picornavirus packaging and offers a readily transferable methodology for identifying packaging requirements in many other viruses. Importance In order to transmit their genetic material to a new host, non-enveloped viruses must protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. For many non-enveloped RNA viruses the requirements for this critical part of the viral life cycle remain poorly understood. We have identified RNA sequences involved in genome packaging of the picornavirus foot-and-mouth disease virus. This virus causes an economically devastating disease of livestock affecting both the developed and developing world. The experimental methods developed to carry out this work are novel, simple and transferable to the

  19. Comparative sequence analysis of Solanum and Arabidopsis in a hot spot for pathogen resistance on potato chromosome V reveals a patchwork of conserved and rapidly evolving genome segments

    Directory of Open Access Journals (Sweden)

    Bruggmann Rémy

    2007-05-01

    Full Text Available Abstract Background Quantitative phenotypic variation of agronomic characters in crop plants is controlled by environmental and genetic factors (quantitative trait loci = QTL. To understand the molecular basis of such QTL, the identification of the underlying genes is of primary interest and DNA sequence analysis of the genomic regions harboring QTL is a prerequisite for that. QTL mapping in potato (Solanum tuberosum has identified a region on chromosome V tagged by DNA markers GP21 and GP179, which contains a number of important QTL, among others QTL for resistance to late blight caused by the oomycete Phytophthora infestans and to root cyst nematodes. Results To obtain genomic sequence for the targeted region on chromosome V, two local BAC (bacterial artificial chromosome contigs were constructed and sequenced, which corresponded to parts of the homologous chromosomes of the diploid, heterozygous genotype P6/210. Two contiguous sequences of 417,445 and 202,781 base pairs were assembled and annotated. Gene-by-gene co-linearity was disrupted by non-allelic insertions of retrotransposon elements, stretches of diverged intergenic sequences, differences in gene content and gene order. The latter was caused by inversion of a 70 kbp genomic fragment. These features were also found in comparison to orthologous sequence contigs from three homeologous chromosomes of Solanum demissum, a wild tuber bearing species. Functional annotation of the sequence identified 48 putative open reading frames (ORF in one contig and 22 in the other, with an average of one ORF every 9 kbp. Ten ORFs were classified as resistance-gene-like, 11 as F-box-containing genes, 13 as transposable elements and three as transcription factors. Comparing potato to Arabidopsis thaliana annotated proteins revealed five micro-syntenic blocks of three to seven ORFs with A. thaliana chromosomes 1, 3 and 5. Conclusion Comparative sequence analysis revealed highly conserved collinear regions

  20. The 2012 Ferrara seismic sequence: Regional crustal structure, earthquake sources, and seismic hazard

    Science.gov (United States)

    Malagnini, Luca; Herrmann, Robert B.; Munafò, Irene; Buttinelli, Mauro; Anselmi, Mario; Akinci, Aybige; Boschi, E.

    2012-10-01

    Inadequate seismic design codes can be dangerous, particularly when they underestimate the true hazard. In this study we use data from a sequence of moderate-sized earthquakes in northeast Italy to validate and test a regional wave propagation model which, in turn, is used to understand some weaknesses of the current design spectra. Our velocity model, while regionalized and somewhat ad hoc, is consistent with geophysical observations and the local geology. In the 0.02-0.1 Hz band, this model is validated by using it to calculate moment tensor solutions of 20 earthquakes (5.6 ≥ MW ≥ 3.2) in the 2012 Ferrara, Italy, seismic sequence. The seismic spectra observed for the relatively small main shock significantly exceeded the design spectra to be used in the area for critical structures. Observations and synthetics reveal that the ground motions are dominated by long-duration surface waves, which, apparently, the design codes do not adequately anticipate. In light of our results, the present seismic hazard assessment in the entire Pianura Padana, including the city of Milan, needs to be re-evaluated.

  1. Sequence analysis of serum albumins reveals the molecular evolution of ligand recognition properties.

    Science.gov (United States)

    Fanali, Gabriella; Ascenzi, Paolo; Bernardi, Giorgio; Fasano, Mauro

    2012-01-01

    Serum albumin (SA) is a circulating protein providing a depot and carrier for many endogenous and exogenous compounds. At least seven major binding sites have been identified by structural and functional investigations mainly in human SA. SA is conserved in vertebrates, with at least 49 entries in protein sequence databases. The multiple sequence analysis of this set of entries leads to the definition of a cladistic tree for the molecular evolution of SA orthologs in vertebrates, thus showing the clustering of the considered species, with lamprey SAs (Lethenteron japonicum and Petromyzon marinus) in a separate outgroup. Sequence analysis aimed at searching conserved domains revealed that most SA sequences are made up by three repeated domains (about 600 residues), as extensively characterized for human SA. On the contrary, lamprey SAs are giant proteins (about 1400 residues) comprising seven repeated domains. The phylogenetic analysis of the SA family reveals a stringent correlation with the taxonomic classification of the species available in sequence databases. A focused inspection of the sequences of ligand binding sites in SA revealed that in all sites most residues involved in ligand binding are conserved, although the versatility towards different ligands could be peculiar of higher organisms. Moreover, the analysis of molecular links between the different sites suggests that allosteric modulation mechanisms could be restricted to higher vertebrates.

  2. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Science.gov (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  3. Natural selection in a population of Drosophila melanogaster explained by changes in gene expression caused by sequence variation in core promoter regions.

    Science.gov (United States)

    Sato, Mitsuhiko P; Makino, Takashi; Kawata, Masakado

    2016-02-09

    , behavioral plasticity, and memory. Diversity of neural and behavioral traits may have been maintained by balancing selection. Our results revealed the evolutionary process occurring by natural selection for differences in gene expression levels caused by sequence variation in core promoter regions in a natural population. The sequences of core promoter regions were diverse even within the population, possibly providing a source for natural selection.

  4. Targeted sequencing of large genomic regions with CATCH-Seq.

    Directory of Open Access Journals (Sweden)

    Kenneth Day

    Full Text Available Current target enrichment systems for large-scale next-generation sequencing typically require synthetic oligonucleotides used as capture reagents to isolate sequences of interest. The majority of target enrichment reagents are focused on gene coding regions or promoters en masse. Here we introduce development of a customizable targeted capture system using biotinylated RNA probe baits transcribed from sheared bacterial artificial chromosome clone templates that enables capture of large, contiguous blocks of the genome for sequencing applications. This clone adapted template capture hybridization sequencing (CATCH-Seq procedure can be used to capture both coding and non-coding regions of a gene, and resolve the boundaries of copy number variations within a genomic target site. Furthermore, libraries constructed with methylated adapters prior to solution hybridization also enable targeted bisulfite sequencing. We applied CATCH-Seq to diverse targets ranging in size from 125 kb to 3.5 Mb. Our approach provides a simple and cost effective alternative to other capture platforms because of template-based, enzymatic probe synthesis and the lack of oligonucleotide design costs. Given its similarity in procedure, CATCH-Seq can also be performed in parallel with commercial systems.

  5. Sequence based polymorphic (SBP marker technology for targeted genomic regions: its application in generating a molecular map of the Arabidopsis thaliana genome

    Directory of Open Access Journals (Sweden)

    Sahu Binod B

    2012-01-01

    Full Text Available Abstract Background Molecular markers facilitate both genotype identification, essential for modern animal and plant breeding, and the isolation of genes based on their map positions. Advancements in sequencing technology have made possible the identification of single nucleotide polymorphisms (SNPs for any genomic regions. Here a sequence based polymorphic (SBP marker technology for generating molecular markers for targeted genomic regions in Arabidopsis is described. Results A ~3X genome coverage sequence of the Arabidopsis thaliana ecotype, Niederzenz (Nd-0 was obtained by applying Illumina's sequencing by synthesis (Solexa technology. Comparison of the Nd-0 genome sequence with the assembled Columbia-0 (Col-0 genome sequence identified putative single nucleotide polymorphisms (SNPs throughout the entire genome. Multiple 75 base pair Nd-0 sequence reads containing SNPs and originating from individual genomic DNA molecules were the basis for developing co-dominant SBP markers. SNPs containing Col-0 sequences, supported by transcript sequences or sequences from multiple BAC clones, were compared to the respective Nd-0 sequences to identify possible restriction endonuclease enzyme site variations. Small amplicons, PCR amplified from both ecotypes, were digested with suitable restriction enzymes and resolved on a gel to reveal the sequence based polymorphisms. By applying this technology, 21 SBP markers for the marker poor regions of the Arabidopsis map representing polymorphisms between Col-0 and Nd-0 ecotypes were generated. Conclusions The SBP marker technology described here allowed the development of molecular markers for targeted genomic regions of Arabidopsis. It should facilitate isolation of co-dominant molecular markers for targeted genomic regions of any animal or plant species, whose genomic sequences have been assembled. This technology will particularly facilitate the development of high density molecular marker maps, essential for

  6. Ballooning mode second stability region for sequences of tokamak equilibria

    International Nuclear Information System (INIS)

    Sugiyama, L.; Mark, J.W.K.

    A numerical study of several sequences of tokamak equilibria derived from two flux conserving sequences confirms the tendency of high n ideal MHD ballooning modes to stabilize for values of the plasma beta greater than a second critical beta, for sufficiently favorable equilibria. The major stabilizing effect of increasing the inverse rotational transform profile q(Psi) for equilibria with the same flux surface geometry is shown. The unstable region shifts toward larger shear d ln q/d ln γ and the width of the region measured in terms of the poloidal beta or a pressure gradient parameter, for fixed shear, decreases. The smaller aspect ratio sequences are more sensitive to changes in q and have less stringent limits on the attainable value of the plasma beta in the high beta stable region. Finally, the disconnected mode approximation is shown to provide a reasonable description of the second high beta stability boundary

  7. The complementarity-determining region sequences in IgY antivenom hypervariable regions

    Directory of Open Access Journals (Sweden)

    David Gitirana da Rocha

    2017-08-01

    Full Text Available The data presented in this article are related to the research article entitled "Development of IgY antibodies against anti-snake toxins endowed with highly lethal neutralizing activity" (da Rocha et al., 2017 [1]. Complementarity-determining region (CDR sequences are variable antibody (Ab sequences that respond with specificity, duration and strength to identify and bind to antigen (Ag epitopes. B lymphocytes isolated from hens immunized with Bitis arietans (Ba and anti-Crotalus durissus terrificus (Cdt venoms and expressing high specificity, affinity and toxicity neutralizing antibody titers were used as DNA sources. The VLF1, CDR1, CDR2, VLR1 and CDR3 sequences were validated by BLASTp, and values corresponding to IgY VL and VH anti-Ba or anti-Cdt venoms were identified, registered [Gallus gallus IgY Fv Light chain (GU815099/Gallus gallus IgY Fv Heavy chain (GU815098] and used for molecular modeling of IgY scFv anti-Ba. The resulting CDR1, CDR2 and CDR3 sequences were combined to construct the three - dimensional structure of the Ab paratope.

  8. Rapid allopolyploid radiation of moonwort ferns (Botrychium; Ophioglossaceae) revealed by PacBio sequencing of homologous and homeologous nuclear regions.

    Science.gov (United States)

    Dauphin, Benjamin; Grant, Jason R; Farrar, Donald R; Rothfels, Carl J

    2018-03-01

    Polyploidy is a major speciation process in vascular plants, and is postulated to be particularly important in shaping the diversity of extant ferns. However, limitations in the availability of bi-parental markers for ferns have greatly limited phylogenetic investigation of polyploidy in this group. With a large number of allopolyploid species, the genus Botrychium is a classic example in ferns where recurrent polyploidy is postulated to have driven frequent speciation events. Here, we use PacBio sequencing and the PURC bioinformatics pipeline to capture all homeologous or allelic copies of four long (∼1 kb) low-copy nuclear regions from a sample of 45 specimens (25 diploids and 20 polyploids) representing 37 Botrychium taxa, and three outgroups. This sample includes most currently recognized Botrychium species in Europe and North America, and the majority of our specimens were genotyped with co-dominant nuclear allozymes to ensure species identification. We analyzed the sequence data using maximum likelihood (ML) and Bayesian inference (BI) concatenated-data ("gene tree") approaches to explore the relationships among Botrychium species. Finally, we estimated divergence times among Botrychium lineages and inferred the multi-labeled polyploid species tree showing the origins of the polyploid taxa, and their relationships to each other and to their diploid progenitors. We found strong support for the monophyly of the major lineages within Botrychium and identified most of the parental donors of the polyploids; these results largely corroborate earlier morphological and allozyme-based investigations. Each polyploid had at least two distinct homeologs, indicating that all sampled polyploids are likely allopolyploids (rather than autopolyploids). Our divergence-time analyses revealed that these allopolyploid lineages originated recently-within the last two million years-and thus that the genus has undergone a recent radiation, correlated with multiple independent

  9. Circuit-wide Transcriptional Profiling Reveals Brain Region-Specific Gene Networks Regulating Depression Susceptibility.

    Science.gov (United States)

    Bagot, Rosemary C; Cates, Hannah M; Purushothaman, Immanuel; Lorsch, Zachary S; Walker, Deena M; Wang, Junshi; Huang, Xiaojie; Schlüter, Oliver M; Maze, Ian; Peña, Catherine J; Heller, Elizabeth A; Issler, Orna; Wang, Minghui; Song, Won-Min; Stein, Jason L; Liu, Xiaochuan; Doyle, Marie A; Scobie, Kimberly N; Sun, Hao Sheng; Neve, Rachael L; Geschwind, Daniel; Dong, Yan; Shen, Li; Zhang, Bin; Nestler, Eric J

    2016-06-01

    Depression is a complex, heterogeneous disorder and a leading contributor to the global burden of disease. Most previous research has focused on individual brain regions and genes contributing to depression. However, emerging evidence in humans and animal models suggests that dysregulated circuit function and gene expression across multiple brain regions drive depressive phenotypes. Here, we performed RNA sequencing on four brain regions from control animals and those susceptible or resilient to chronic social defeat stress at multiple time points. We employed an integrative network biology approach to identify transcriptional networks and key driver genes that regulate susceptibility to depressive-like symptoms. Further, we validated in vivo several key drivers and their associated transcriptional networks that regulate depression susceptibility and confirmed their functional significance at the levels of gene transcription, synaptic regulation, and behavior. Our study reveals novel transcriptional networks that control stress susceptibility and offers fundamentally new leads for antidepressant drug discovery. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Torque measurements reveal sequence-specific cooperative transitions in supercoiled DNA

    Science.gov (United States)

    Oberstrass, Florian C.; Fernandes, Louis E.; Bryant, Zev

    2012-01-01

    B-DNA becomes unstable under superhelical stress and is able to adopt a wide range of alternative conformations including strand-separated DNA and Z-DNA. Localized sequence-dependent structural transitions are important for the regulation of biological processes such as DNA replication and transcription. To directly probe the effect of sequence on structural transitions driven by torque, we have measured the torsional response of a panel of DNA sequences using single molecule assays that employ nanosphere rotational probes to achieve high torque resolution. The responses of Z-forming d(pGpC)n sequences match our predictions based on a theoretical treatment of cooperative transitions in helical polymers. “Bubble” templates containing 50–100 bp mismatch regions show cooperative structural transitions similar to B-DNA, although less torque is required to disrupt strand–strand interactions. Our mechanical measurements, including direct characterization of the torsional rigidity of strand-separated DNA, establish a framework for quantitative predictions of the complex torsional response of arbitrary sequences in their biological context. PMID:22474350

  11. Sequencing of a QTL-rich region of the Theobroma cacao genome using pooled BACs and the identification of trait specific candidate genes

    Directory of Open Access Journals (Sweden)

    Blackmon Barbara P

    2011-07-01

    Full Text Available Abstract Background BAC-based physical maps provide for sequencing across an entire genome or a selected sub-genomic region of biological interest. Such a region can be approached with next-generation whole-genome sequencing and assembly as if it were an independent small genome. Using the minimum tiling path as a guide, specific BAC clones representing the prioritized genomic interval are selected, pooled, and used to prepare a sequencing library. Results This pooled BAC approach was taken to sequence and assemble a QTL-rich region, of ~3 Mbp and represented by twenty-seven BACs, on linkage group 5 of the Theobroma cacao cv. Matina 1-6 genome. Using various mixtures of read coverages from paired-end and linear 454 libraries, multiple assemblies of varied quality were generated. Quality was assessed by comparing the assembly of 454 reads with a subset of ten BACs individually sequenced and assembled using Sanger reads. A mixture of reads optimal for assembly was identified. We found, furthermore, that a quality assembly suitable for serving as a reference genome template could be obtained even with a reduced depth of sequencing coverage. Annotation of the resulting assembly revealed several genes potentially responsible for three T. cacao traits: black pod disease resistance, bean shape index, and pod weight. Conclusions Our results, as with other pooled BAC sequencing reports, suggest that pooling portions of a minimum tiling path derived from a BAC-based physical map is an effective method to target sub-genomic regions for sequencing. While we focused on a single QTL region, other QTL regions of importance could be similarly sequenced allowing for biological discovery to take place before a high quality whole-genome assembly is completed.

  12. Sequence tagging reveals unexpected modifications in toxicoproteomics

    Science.gov (United States)

    Dasari, Surendra; Chambers, Matthew C.; Codreanu, Simona G.; Liebler, Daniel C.; Collins, Ben C.; Pennington, Stephen R.; Gallagher, William M.; Tabb, David L.

    2010-01-01

    Toxicoproteomic samples are rich in posttranslational modifications (PTMs) of proteins. Identifying these modifications via standard database searching can incur significant performance penalties. Here we describe the latest developments in TagRecon, an algorithm that leverages inferred sequence tags to identify modified peptides in toxicoproteomic data sets. TagRecon identifies known modifications more effectively than the MyriMatch database search engine. TagRecon outperformed state of the art software in recognizing unanticipated modifications from LTQ, Orbitrap, and QTOF data sets. We developed user-friendly software for detecting persistent mass shifts from samples. We follow a three-step strategy for detecting unanticipated PTMs in samples. First, we identify the proteins present in the sample with a standard database search. Next, identified proteins are interrogated for unexpected PTMs with a sequence tag-based search. Finally, additional evidence is gathered for the detected mass shifts with a refinement search. Application of this technology on toxicoproteomic data sets revealed unintended cross-reactions between proteins and sample processing reagents. Twenty five proteins in rat liver showed signs of oxidative stress when exposed to potentially toxic drugs. These results demonstrate the value of mining toxicoproteomic data sets for modifications. PMID:21214251

  13. Sequence analysis of the breakpoint regions of an X;5 translocation in a female with Duchenne muscular dystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Bakel, I. van; Holt, S.; Craig, I. [Univ. of Oxford (United Kingdom)] [and others

    1995-08-01

    X;autosome translocations in females with Duchenne muscular dystrophy (DMD) provide an opportunity to study the mechanisms responsible for chromosomal rearrangements that occur in the germ line. We describe here a detailed molecular analysis of the translocation breakpoints of an X;autosome reciprocal translocation, t(X;5) (p21;q31.1), in a female with DMD. Cosmid clones that contained the X-chromosome breakpoint region were identified, and subclones that hybridized to the translocation junction fragment in restriction digests of the patient`s DNA were isolated and sequenced. Primers designed from the X-chromosomal sequence were used to obtain the junction fragments on the der(X) and the der(5) by inverse PCR. The resultant clones were also cloned and sequenced, and this information used to isolate the chromosome 5 breakpoint region. Comparison of the DNA sequences of the junction fragments with those of the breakpoint regions on chromosomes X and 5 revealed that the translocation arose by nonhomologous recombination with an imprecise reciprocal exchange. Four and six base pairs of unknown origin are inserted at the exchange points of the der(X) and der(5), respectively, and three nucleotides are deleted from the X-chromosome sequence. Two features were found that may have played a role in the generation of the translocation. These were (1) a repeat motif with an internal homopyrimidine stretch 10 bp upstream from the X-chromosome breakpoint and (2) a 9-bp sequence of 78% homology located near the breakpoints on chromosomes 5 and X. 32 refs., 4 figs., 2 tabs.

  14. Unexpected allelic heterogeneity and spectrum of mutations in Fowler syndrome revealed by next-generation exome sequencing.

    Science.gov (United States)

    Lalonde, Emilie; Albrecht, Steffen; Ha, Kevin C H; Jacob, Karine; Bolduc, Nathalie; Polychronakos, Constantin; Dechelotte, Pierre; Majewski, Jacek; Jabado, Nada

    2010-08-01

    Protein coding genes constitute approximately 1% of the human genome but harbor 85% of the mutations with large effects on disease-related traits. Therefore, efficient strategies for selectively sequencing complete coding regions (i.e., "whole exome") have the potential to contribute our understanding of human diseases. We used a method for whole-exome sequencing coupling Agilent whole-exome capture to the Illumina DNA-sequencing platform, and investigated two unrelated fetuses from nonconsanguineous families with Fowler Syndrome (FS), a stereotyped phenotype lethal disease. We report novel germline mutations in feline leukemia virus subgroup C cellular-receptor-family member 2, FLVCR2, which has recently been shown to cause FS. Using this technology, we identified three types of genetic abnormalities: point-mutations, insertions-deletions, and intronic splice-site changes (first pathogenic report using this technology), in the fetuses who both were compound heterozygotes for the disease. Although revealing a high level of allelic heterogeneity and mutational spectrum in FS, this study further illustrates the successful application of whole-exome sequencing to uncover genetic defects in rare Mendelian disorders. Of importance, we show that we can identify genes underlying rare, monogenic and recessive diseases using a limited number of patients (n=2), in the absence of shared genetic heritage and in the presence of allelic heterogeneity.

  15. Multi-species sequence comparison reveals dynamic evolution of the elastin gene that has involved purifying selection and lineage-specific insertions/deletions

    Directory of Open Access Journals (Sweden)

    Green Eric D

    2004-05-01

    Full Text Available Abstract Background The elastin gene (ELN is implicated as a factor in both supravalvular aortic stenosis (SVAS and Williams Beuren Syndrome (WBS, two diseases involving pronounced complications in mental or physical development. Although the complete spectrum of functional roles of the processed gene product remains to be established, these roles are inferred to be analogous in human and mouse. This view is supported by genomic sequence comparison, in which there are no large-scale differences in the ~1.8 Mb sequence block encompassing the common region deleted in WBS, with the exception of an overall reversed physical orientation between human and mouse. Results Conserved synteny around ELN does not translate to a high level of conservation in the gene itself. In fact, ELN orthologs in mammals show more sequence divergence than expected for a gene with a critical role in development. The pattern of divergence is non-conventional due to an unusually high ratio of gaps to substitutions. Specifically, multi-sequence alignments of eight mammalian sequences reveal numerous non-aligning regions caused by species-specific insertions and deletions, in spite of the fact that the vast majority of aligning sites appear to be conserved and undergoing purifying selection. Conclusions The pattern of lineage-specific, in-frame insertions/deletions in the coding exons of ELN orthologous genes is unusual and has led to unique features of the gene in each lineage. These differences may indicate that the gene has a slightly different functional mechanism in mammalian lineages, or that the corresponding regions are functionally inert. Identified regions that undergo purifying selection reflect a functional importance associated with evolutionary pressure to retain those features.

  16. THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

    Energy Technology Data Exchange (ETDEWEB)

    Falconer, David A; Moore, Ronald L; Adams, Mitzi [Space Science Office, VP62, Marshall Space Flight Center, Huntsville, AL 35812 (United States); Gary, G. Allen [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 35899 (United States)], E-mail: David.falconer@msfc.nasa.gov

    2009-08-01

    We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R {sub Sun}. The two quantities are {sup L}WL{sub SG}, a gauge of the total free energy in an active region's magnetic field, and {sup L}{phi}, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log {sup L}WL{sub SG}, log {sup L}{phi}) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

  17. THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION

    International Nuclear Information System (INIS)

    Falconer, David A.; Moore, Ronald L.; Adams, Mitzi; Gary, G. Allen

    2009-01-01

    We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R Sun . The two quantities are L WL SG , a gauge of the total free energy in an active region's magnetic field, and L Φ, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log L WL SG , log L Φ) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.

  18. Characterization of promoter sequence of toll-like receptor genes in Vechur cattle

    Directory of Open Access Journals (Sweden)

    R. Lakshmi

    2016-06-01

    Full Text Available Aim: To analyze the promoter sequence of toll-like receptor (TLR genes in Vechur cattle, an indigenous breed of Kerala with the sequence of Bos taurus and access the differences that could be attributed to innate immune responses against bovine mastitis. Materials and Methods: Blood samples were collected from Jugular vein of Vechur cattle, maintained at Vechur cattle conservation center of Kerala Veterinary and Animal Sciences University, using an acid-citrate-dextrose anticoagulant. The genomic DNA was extracted, and polymerase chain reaction was carried out to amplify the promoter region of TLRs. The amplified product of TLR2, 4, and 9 promoter regions was sequenced by Sanger enzymatic DNA sequencing technique. Results: The sequence of promoter region of TLR2 of Vechur cattle with the B. taurus sequence present in GenBank showed 98% similarity and revealed variants for four sequence motifs. The sequence of the promoter region of TLR4 of Vechur cattle revealed 99% similarity with that of B. taurus sequence but not reveals significant variant in motifregions. However, two heterozygous loci were observed from the chromatogram. Promoter sequence of TLR9 gene also showed 99% similarity to B. taurus sequence and revealed variants for four sequence motifs. Conclusion: The results of this study indicate that significant variation in the promoter of TLR2 and 9 genes in Vechur cattle breed and may potentially link the influence the innate immunity response against mastitis diseases.

  19. Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences.

    Science.gov (United States)

    Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

    2017-01-26

    The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consisting of N. ampullaria, N. mirabilis, N. gracilis and N. rafflesiana, and another containing both intermediately distributed species (N. albomarginata and N. benstonei) and four highland species (N. sanguinea, N. macfarlanei, N. ramispina and N. alba). The trnL intron and ITS sequences proved to provide phylogenetic informative characters for deriving a phylogeny of Nepenthes species in Peninsular Malaysia. To our knowledge, this is the first molecular phylogenetic study of Nepenthes species occurring along an altitudinal gradient in Peninsular Malaysia.

  20. Genetic variation in the Staphylococcus aureus 8325 strain lineage revealed by whole-genome sequencing.

    Directory of Open Access Journals (Sweden)

    Kristoffer T Bæk

    Full Text Available Staphylococcus aureus strains of the 8325 lineage, especially 8325-4 and derivatives lacking prophage, have been used extensively for decades of research. We report herein the results of our deep sequence analysis of strain 8325-4. Assignment of sequence variants compared with the reference strain 8325 (NRS77/PS47 required correction of errors in the 8325 reference genome, and reassessment of variation previously attributed to chemical mutagenesis of the restriction-defective RN4220. Using an extensive strain pedigree analysis, we discovered that 8325-4 contains 16 single nucleotide polymorphisms (SNP arising prior to the construction of RN4220. We identified 5 indels in 8325-4 compared with 8325. Three indels correspond to expected Φ11, 12, 13 excisions, one indel is explained by a sequence assembly artifact, and the final indel (Δ63bp in the spa-sarS intergenic region is common to only a sub-lineage of 8325-4 strains including SH1000. This deletion was found to significantly decrease (75% steady state sarS but not spa transcript levels in post-exponential phase. The sub-lineage 8325-4 was also found to harbor 4 additional SNPs. We also found large sequence variation between 8325, 8325-4 and RN4220 in a cluster of repetitive hypothetical proteins (SA0282 homologs near the Ess secretion cluster. The overall 8325-4 SNP set results in 17 alterations within coding sequences. Remarkably, we discovered that all tested strains of the 8325-4 lineage lack phenol soluble modulin α3 (PSMα3, a virulence determinant implicated in neutrophil chemotaxis, biofilm architecture and surface spreading. Collectively, our results clarify and define the 8325-4 pedigree and reveal clear evidence that mutations existing throughout all branches of this lineage, including the widely used RN6390 and SH1000 strains, could conceivably impact virulence regulation.

  1. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

    Science.gov (United States)

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

    2011-10-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

  2. Mitochondrial genome sequences reveal deep divergences among Anopheles punctulatus sibling species in Papua New Guinea

    Directory of Open Access Journals (Sweden)

    Logue Kyle

    2013-02-01

    Full Text Available Abstract Background Members of the Anopheles punctulatus group (AP group are the primary vectors of human malaria in Papua New Guinea. The AP group includes 13 sibling species, most of them morphologically indistinguishable. Understanding why only certain species are able to transmit malaria requires a better comprehension of their evolutionary history. In particular, understanding relationships and divergence times among Anopheles species may enable assessing how malaria-related traits (e.g. blood feeding behaviours, vector competence have evolved. Methods DNA sequences of 14 mitochondrial (mt genomes from five AP sibling species and two species of the Anopheles dirus complex of Southeast Asia were sequenced. DNA sequences from all concatenated protein coding genes (10,770 bp were then analysed using a Bayesian approach to reconstruct phylogenetic relationships and date the divergence of the AP sibling species. Results Phylogenetic reconstruction using the concatenated DNA sequence of all mitochondrial protein coding genes indicates that the ancestors of the AP group arrived in Papua New Guinea 25 to 54 million years ago and rapidly diverged to form the current sibling species. Conclusion Through evaluation of newly described mt genome sequences, this study has revealed a divergence among members of the AP group in Papua New Guinea that would significantly predate the arrival of humans in this region, 50 thousand years ago. The divergence observed among the mtDNA sequences studied here may have resulted from reproductive isolation during historical changes in sea-level through glacial minima and maxima. This leads to a hypothesis that the AP sibling species have evolved independently for potentially thousands of generations. This suggests that the evolution of many phenotypes, such as insecticide resistance will arise independently in each of the AP sibling species studied here.

  3. Face processing regions are sensitive to distinct aspects of temporal sequence in facial dynamics.

    Science.gov (United States)

    Reinl, Maren; Bartels, Andreas

    2014-11-15

    Facial movement conveys important information for social interactions, yet its neural processing is poorly understood. Computational models propose that shape- and temporal sequence sensitive mechanisms interact in processing dynamic faces. While face processing regions are known to respond to facial movement, their sensitivity to particular temporal sequences has barely been studied. Here we used fMRI to examine the sensitivity of human face-processing regions to two aspects of directionality in facial movement trajectories. We presented genuine movie recordings of increasing and decreasing fear expressions, each of which were played in natural or reversed frame order. This two-by-two factorial design matched low-level visual properties, static content and motion energy within each factor, emotion-direction (increasing or decreasing emotion) and timeline (natural versus artificial). The results showed sensitivity for emotion-direction in FFA, which was timeline-dependent as it only occurred within the natural frame order, and sensitivity to timeline in the STS, which was emotion-direction-dependent as it only occurred for decreased fear. The occipital face area (OFA) was sensitive to the factor timeline. These findings reveal interacting temporal sequence sensitive mechanisms that are responsive to both ecological meaning and to prototypical unfolding of facial dynamics. These mechanisms are temporally directional, provide socially relevant information regarding emotional state or naturalness of behavior, and agree with predictions from modeling and predictive coding theory. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  4. Re-Analysis of Metagenomic Sequences from Acute Flaccidmyelitis Patients Reveals Alternatives to Enterovirus D68 Infection

    Science.gov (United States)

    2015-07-13

    caused in some cases by infection with enterovirus D68. We found that among the patients whose symptoms were previously attributed to enterovirus D68...distribution is unlimited. Re-analysis of metagenomic sequences from acute flaccidmyelitis patients reveals alternatives to enterovirus D68...Street Baltimore, MD 21218 -2685 ABSTRACT Re-analysis of metagenomic sequences from acute flaccidmyelitis patients reveals alternatives to enterovirus

  5. Targeted Genome Sequencing Reveals Varicella-Zoster Virus Open Reading Frame 12 Deletion.

    Science.gov (United States)

    Cohrs, Randall J; Lee, Katherine S; Beach, Addilynn; Sanford, Bridget; Baird, Nicholas L; Como, Christina; Graybill, Chiharu; Jones, Dallas; Tekeste, Eden; Ballard, Mitchell; Chen, Xiaomi; Yalacki, David; Frietze, Seth; Jones, Kenneth; Lenac Rovis, Tihana; Jonjić, Stipan; Haas, Jürgen; Gilden, Don

    2017-10-15

    The neurotropic herpesvirus varicella-zoster virus (VZV) establishes a lifelong latent infection in humans following primary infection. The low abundance of VZV nucleic acids in human neurons has hindered an understanding of the mechanisms that regulate viral gene transcription during latency. To overcome this critical barrier, we optimized a targeted capture protocol to enrich VZV DNA and cDNA prior to whole-genome/transcriptome sequence analysis. Since the VZV genome is remarkably stable, it was surprising to detect that VZV32, a VZV laboratory strain with no discernible growth defect in tissue culture, contained a 2,158-bp deletion in open reading frame (ORF) 12. Consequently, ORF 12 and 13 protein expression was abolished and Akt phosphorylation was inhibited. The discovery of the ORF 12 deletion, revealed through targeted genome sequencing analysis, points to the need to authenticate the VZV genome when the virus is propagated in tissue culture. IMPORTANCE Viruses isolated from clinical samples often undergo genetic modifications when cultured in the laboratory. Historically, VZV is among the most genetically stable herpesviruses, a notion supported by more than 60 complete genome sequences from multiple isolates and following multiple in vitro passages. However, application of enrichment protocols to targeted genome sequencing revealed the unexpected deletion of a significant portion of VZV ORF 12 following propagation in cultured human fibroblast cells. While the enrichment protocol did not introduce bias in either the virus genome or transcriptome, the findings indicate the need for authentication of VZV by sequencing when the virus is propagated in tissue culture. Copyright © 2017 American Society for Microbiology.

  6. AlignMiner: a Web-based tool for detection of divergent regions in multiple sequence alignments of conserved sequences

    Directory of Open Access Journals (Sweden)

    Claros M Gonzalo

    2010-06-01

    Full Text Available Abstract Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used

  7. Population structure and genetic diversity of Indian Major Carp, Labeo rohita (Hamilton, 1822) from three phylo-geographically isolated riverine ecosystems of India as revealed by mtDNA cytochrome b region sequences.

    Science.gov (United States)

    Behera, Bijay Kumar; Baisvar, Vishwamitra Singh; Kunal, Swaraj Priyaranjan; Meena, Dharmendra Kumar; Panda, Debarata; Pakrashi, Sudip; Paria, Prasenjit; Das, Pronob; Bhakta, Dibakar; Debnath, Dipesh; Roy, Suvra; Suresh, V R; Jena, J K

    2018-03-01

    The population structure and genetic diversity of Rohu (Labeo rohita Hamilton, 1822) was studied by analysis of the partial sequences of mitochondrial DNA cytochrome b region. We examined 133 samples collected from six locations in three geographically isolated rivers of India. Analysis of 11 haplotypes showed low haplotype diversity (0.00150), nucleotide diversity (π) (0.02884) and low heterogeneity value (0.00374). Analysis of molecular variance (AMOVA) revealed the genetic diversity of L. rohita within population is very high than between the populations. The Fst scores (-0.07479 to 0.07022) were the indication of low genetic structure of L. rohita populations of three rivers of India. Conspicuously, Farakka-Bharuch population pair Fst score of 0.0000, although the sampling sites are from different rivers. The phylogenetic reconstruction of unique haplotypes revealed sharing of a single central haplotype (Hap_1) by all the six populations with a point mutations ranging from 1-25 nucleotides.

  8. An ongoing earthquake sequence near Dhaka, Bangladesh, from regional recordings

    Science.gov (United States)

    Howe, M.; Mondal, D. R.; Akhter, S. H.; Kim, W.; Seeber, L.; Steckler, M. S.

    2013-12-01

    Earthquakes in and around the syntaxial region between the continent-continent collision of the Himalayan arc and oceanic subduction of the Sunda arc result primarily from the convergence of India and Eurasia-Sunda plates along two fronts. The northern front, the convergence of the Indian and Eurasian plates, has produced the Himalayas. The eastern front, the convergence of the Indian and Sunda plates, ranges from ocean-continent subduction at the Andaman Arc and Burma Arc, and transitions to continent-continent collision to the north at the Assam Syntaxis in northeast India. The India-Sunda convergence at the Burma Arc is extremely oblique. The boundary-normal convergence rate is ~17 mm/yr while the boundary-parallel rate is ~45 mm/yr including the well-known Sagaing strike-slip fault, which accommodates about half the shear component. This heterogeneous tectonic setting produces multiple earthquake sources that need to be considered when assessing seismic hazard and risk in this region. The largest earthquakes, just as in other subduction systems, are expected to be interplate events that occur on the low-angle megathrusts, such as the Mw 9.2 2004 Sumatra-Andaman earthquake and the 1762 earthquake along the Arakan margin. These earthquakes are known to produce large damage over vast areas, but since they account for large fault motions they are relatively rare. The majority of current seismicity in the study area is intraplate. Most of the seismicity associated with the Burma Arc subduction system is in the down-going slab, including the shallow-dipping part below the megathrust flooring the accretionary wedge. The strike of the wedge is ~N-S and Dhaka lies at its outer limit. One particular source relevant to seismic risk in Dhaka is illuminated by a multi-year sequence of earthquakes in Bangladesh less than 100 km southeast of Dhaka. The population in Dhaka (now at least 15 million) has been increasing dramatically due to rapid urbanization. The vulnerability

  9. Whole Exome Sequencing Reveals Genetic Predisposition in a Large Family with Retinitis Pigmentosa

    Directory of Open Access Journals (Sweden)

    Juan Wu

    2014-01-01

    Full Text Available Next-generation sequencing has become more widely used to reveal genetic defect in monogenic disorders. Retinitis pigmentosa (RP, the leading cause of hereditary blindness worldwide, has been attributed to more than 67 disease-causing genes. Due to the extreme genetic heterogeneity, using general molecular screening alone is inadequate for identifying genetic predispositions in susceptible individuals. In order to identify underlying mutation rapidly, we utilized next-generation sequencing in a four-generation Chinese family with RP. Two affected patients and an unaffected sibling were subjected to whole exome sequencing. Through bioinformatics analysis and direct sequencing confirmation, we identified p.R135W transition in the rhodopsin gene. The mutation was subsequently confirmed to cosegregate with the disease in the family. In this study, our results suggest that whole exome sequencing is a robust method in diagnosing familial hereditary disease.

  10. Assembly of the Lactuca sativa, L. cv. Tizian draft genome sequence reveals differences within major resistance complex 1 as compared to the cv. Salinas reference genome.

    Science.gov (United States)

    Verwaaijen, Bart; Wibberg, Daniel; Nelkner, Johanna; Gordin, Miriam; Rupp, Oliver; Winkler, Anika; Bremges, Andreas; Blom, Jochen; Grosch, Rita; Pühler, Alfred; Schlüter, Andreas

    2018-02-10

    Lettuce (Lactuca sativa, L.) is an important annual plant of the family Asteraceae (Compositae). The commercial lettuce cultivar Tizian has been used in various scientific studies investigating the interaction of the plant with phytopathogens or biological control agents. Here, we present the de novo draft genome sequencing and gene prediction for this specific cultivar derived from transcriptome sequence data. The assembled scaffolds amount to a size of 2.22 Gb. Based on RNAseq data, 31,112 transcript isoforms were identified. Functional predictions for these transcripts were determined within the GenDBE annotation platform. Comparison with the cv. Salinas reference genome revealed a high degree of sequence similarity on genome and transcriptome levels, with an average amino acid identity of 99%. Furthermore, it was observed that two large regions are either missing or are highly divergent within the cv. Tizian genome compared to cv. Salinas. One of these regions covers the major resistance complex 1 region of cv. Salinas. The cv. Tizian draft genome sequence provides a valuable resource for future functional and transcriptome analyses focused on this lettuce cultivar. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Reconstruction of phylogenetic relationships in dermatomycete genus Trichophyton Malmsten 1848 based on ribosomal internal transcribed spacer region, partial 28S rRNA and beta-tubulin genes sequences.

    Science.gov (United States)

    Pchelin, Ivan M; Zlatogursky, Vasily V; Rudneva, Mariya V; Chilina, Galina A; Rezaei-Matehkolaei, Ali; Lavnikevich, Dmitry M; Vasilyeva, Natalya V; Taraskina, Anastasia E

    2016-09-01

    Trichophyton spp. are important causative agents of superficial mycoses. The phylogeny of the genus and accurate strain identification, based on the ribosomal ITS region sequencing, are still under development. The present work is aimed at (i) inferring the genus phylogeny from partial ITS, LSU and BT2 sequences (ii) description of ribosomal ITS region polymorphism in 15 strains of Trichophyton interdigitale. We performed DNA sequence-based species identification and phylogenetic analysis on 48 strains belonging to the genus Trichophyton. Phylogenetic relationships were inferred by maximum likelihood and Bayesian methods on concatenated ITS, LSU and BT2 sequences. Ribosomal ITS region polymorphisms were assessed directly on the alignment. By phylogenetic reconstruction, we reveal major anthropophilic and zoophilic species clusters in the genus Trichophyton. We describe several sequences of the ITS region of T. interdigitale, which do not fit in the traditional polymorphism scheme and propose emendations in this scheme for discrimination between ITS sequence types in T. interdigitale. The new polymorphism scheme will allow inclusion of a wider spectrum of isolates while retaining its explanatory power. This scheme was also found to be partially congruent with NTS typing technique. © 2016 Blackwell Verlag GmbH.

  12. Genome-Based Identification of Active Prophage Regions by Next Generation Sequencing in Bacillus licheniformis DSM13

    Science.gov (United States)

    Hertel, Robert; Rodríguez, David Pintor; Hollensteiner, Jacqueline; Dietrich, Sascha; Leimbach, Andreas; Hoppert, Michael; Liesegang, Heiko; Volland, Sonja

    2015-01-01

    Prophages are viruses, which have integrated their genomes into the genome of a bacterial host. The status of the prophage genome can vary from fully intact with the potential to form infective particles to a remnant state where only a few phage genes persist. Prophages have impact on the properties of their host and are therefore of great interest for genomic research and strain design. Here we present a genome- and next generation sequencing (NGS)-based approach for identification and activity evaluation of prophage regions. Seven prophage or prophage-like regions were identified in the genome of Bacillus licheniformis DSM13. Six of these regions show similarity to members of the Siphoviridae phage family. The remaining region encodes the B. licheniformis orthologue of the PBSX prophage from Bacillus subtilis. Analysis of isolated phage particles (induced by mitomycin C) from the wild-type strain and prophage deletion mutant strains revealed activity of the prophage regions BLi_Pp2 (PBSX-like), BLi_Pp3 and BLi_Pp6. In contrast to BLi_Pp2 and BLi_Pp3, neither phage DNA nor phage particles of BLi_Pp6 could be visualized. However, the ability of prophage BLi_Pp6 to generate particles could be confirmed by sequencing of particle-protected DNA mapping to prophage locus BLi_Pp6. The introduced NGS-based approach allows the investigation of prophage regions and their ability to form particles. Our results show that this approach increases the sensitivity of prophage activity analysis and can complement more conventional approaches such as transmission electron microscopy (TEM). PMID:25811873

  13. High sequence variations in the region containing genes encoding a cellular morphogenesis protein and the repressor of sexual development help to reveal origins of Aspergillus oryzae.

    Science.gov (United States)

    Chang, Perng-Kuang; Scharfenstein, Leslie L; Solorzano, Cesar D; Abbas, Hamed K; Hua, Sui-Sheng T; Jones, Walker A; Zablotowicz, Robert M

    2015-05-04

    Aspergillus oryzae and Aspergillus flavus are closely related fungal species. The A. flavus morphotype that produces numerous small sclerotia (S strain) and aflatoxin has a unique 1.5 kb deletion in the norB-cypA region of the aflatoxin gene cluster (i.e. the S genotype). Phylogenetic studies have indicated that an isolate of the nonaflatoxigenic A. flavus with the S genotype is the ancestor of A. oryzae. Genome sequence comparison between A. flavus NRRL3357, which produces large sclerotia (L strain), and S-strain A. flavus 70S identified a region (samA-rosA) that was highly variable in the two morphotypes. A third type of samA-rosA region was found in A. oryzae RIB40. The three samA-rosA types were later revealed to be commonly present in A. flavus L-strain populations. Of the 182 L-strain A. flavus field isolates examined, 46%, 15% and 39% had the samA-rosA type of NRRL3357, 70S and RIB40, respectively. The three types also were found in 18 S-strain A. flavus isolates with different proportions. For A. oryzae, however, the majority (80%) of the 16 strains examined had the RIB40 type and none had the NRRL3357 type. The results suggested that A. oryzae strains in the current culture collections were mostly derived from the samA-rosA/RIB40 lineage of the nonaflatoxigenic A. flavus with the S genotype. Published by Elsevier B.V.

  14. Isolation of Hox cluster genes from insects reveals an accelerated sequence evolution rate.

    Directory of Open Access Journals (Sweden)

    Heike Hadrys

    Full Text Available Among gene families it is the Hox genes and among metazoan animals it is the insects (Hexapoda that have attracted particular attention for studying the evolution of development. Surprisingly though, no Hox genes have been isolated from 26 out of 35 insect orders yet, and the existing sequences derive mainly from only two orders (61% from Hymenoptera and 22% from Diptera. We have designed insect specific primers and isolated 37 new partial homeobox sequences of Hox cluster genes (lab, pb, Hox3, ftz, Antp, Scr, abd-a, Abd-B, Dfd, and Ubx from six insect orders, which are crucial to insect phylogenetics. These new gene sequences provide a first step towards comparative Hox gene studies in insects. Furthermore, comparative distance analyses of homeobox sequences reveal a correlation between gene divergence rate and species radiation success with insects showing the highest rate of homeobox sequence evolution.

  15. Whole-exome sequencing reveals GPIHBP1 mutations in infantile colitis with severe hypertriglyceridemia.

    Science.gov (United States)

    Gonzaga-Jauregui, Claudia; Mir, Sabina; Penney, Samantha; Jhangiani, Shalini; Midgen, Craig; Finegold, Milton; Muzny, Donna M; Wang, Min; Bacino, Carlos A; Gibbs, Richard A; Lupski, James R; Kellermayer, Richard; Hanchard, Neil A

    2014-07-01

    Severe congenital hypertriglyceridemia (HTG) is a rare disorder caused by mutations in genes affecting lipoprotein lipase (LPL) activity. Here we report a 5-week-old Hispanic girl with severe HTG (12,031 mg/dL, normal limit 150 mg/dL) who presented with the unusual combination of lower gastrointestinal bleeding and milky plasma. Initial colonoscopy was consistent with colitis, which resolved with reduction of triglycerides. After negative sequencing of the LPL gene, whole-exome sequencing revealed novel compound heterozygous mutations in GPIHBP1. Our study broadens the phenotype of GPIHBP1-associated HTG, reinforces the effectiveness of whole-exome sequencing in Mendelian diagnoses, and implicates triglycerides in gastrointestinal mucosal injury.

  16. Massively parallel amplicon sequencing reveals isotype-specific variability of antimicrobial peptide transcripts in Mytilus galloprovincialis.

    Directory of Open Access Journals (Sweden)

    Umberto Rosani

    Full Text Available BACKGROUND: Effective innate responses against potential pathogens are essential in the living world and possibly contributed to the evolutionary success of invertebrates. Taken together, antimicrobial peptide (AMP precursors of defensin, mytilin, myticin and mytimycin can represent about 40% of the hemocyte transcriptome in mussels injected with viral-like and bacterial preparations, and unique profiles of myticin C variants are expressed in single mussels. Based on amplicon pyrosequencing, we have ascertained and compared the natural and Vibrio-induced diversity of AMP transcripts in mussel hemocytes from three European regions. METHODOLOGY/PRINCIPAL FINDINGS: Hemolymph was collected from mussels farmed in the coastal regions of Palavas (France, Vigo (Spain and Venice (Italy. To represent the AMP families known in M. galloprovincialis, nine transcript sequences have been selected, amplified from hemocyte RNA and subjected to pyrosequencing. Hemolymph from farmed (offshore and wild (lagoon Venice mussels, both injected with 10(7 Vibrio cells, were similarly processed. Amplicon pyrosequencing emphasized the AMP transcript diversity, with Single Nucleotide Changes (SNC minimal for mytilin B/C and maximal for arthropod-like defensin and myticin C. Ratio of non-synonymous vs. synonymous changes also greatly differed between AMP isotypes. Overall, each amplicon revealed similar levels of nucleotidic variation across geographical regions, with two main sequence patterns confirmed for mytimycin and no substantial changes after immunostimulation. CONCLUSIONS/SIGNIFICANCE: Barcoding and bidirectional pyrosequencing allowed us to map and compare the transcript diversity of known mussel AMPs. Though most of the genuine cds variation was common to the analyzed samples we could estimate from 9 to 106 peptide variants in hemolymph pools representing 100 mussels, depending on the AMP isoform and sampling site. In this study, no prevailing SNC patterns related

  17. Next-generation sequencing can reveal in vitro-generated PCR crossover products: some artifactual sequences correspond to HLA alleles in the IMGT/HLA database.

    Science.gov (United States)

    Holcomb, C L; Rastrou, M; Williams, T C; Goodridge, D; Lazaro, A M; Tilanus, M; Erlich, H A

    2014-01-01

    The high-resolution human leukocyte antigen (HLA) genotyping assay that we developed using 454 sequencing and Conexio software uses generic polymerase chain reaction (PCR) primers for DRB exon 2. Occasionally, we observed low abundance DRB amplicon sequences that resulted from in vitro PCR 'crossing over' between DRB1 and DRB3/4/5. These hybrid sequences, revealed by the clonal sequencing property of the 454 system, were generally observed at a read depth of 5%-10% of the true alleles. They usually contained at least one mismatch with the IMGT/HLA database, and consequently, were easily recognizable and did not cause a problem for HLA genotyping. Sometimes, however, these artifactual sequences matched a rare allele and the automatic genotype assignment was incorrect. These observations raised two issues: (1) could PCR conditions be modified to reduce such artifacts? and (2) could some of the rare alleles listed in the IMGT/HLA database be artifacts rather than true alleles? Because PCR crossing over occurs during late cycles of PCR, we compared DRB genotypes resulting from 28 and (our standard) 35 cycles of PCR. For all 21 cell line DNAs amplified for 35 cycles, crossover products were detected. In 33% of the cases, these hybrid sequences corresponded to named alleles. With amplification for only 28 cycles, these artifactual sequences were not detectable. To investigate whether some rare alleles in the IMGT/HLA database might be due to PCR artifacts, we analyzed four samples obtained from the investigators who submitted the sequences. In three cases, the sequences were generated from true alleles. In one case, our 454 sequencing revealed an error in the previously submitted sequence. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. The effects of alignment quality, distance calculation method, sequence filtering, and region on the analysis of 16S rRNA gene-based studies.

    Directory of Open Access Journals (Sweden)

    Patrick D Schloss

    Full Text Available Pyrosequencing of PCR-amplified fragments that target variable regions within the 16S rRNA gene has quickly become a powerful method for analyzing the membership and structure of microbial communities. This approach has revealed and introduced questions that were not fully appreciated by those carrying out traditional Sanger sequencing-based methods. These include the effects of alignment quality, the best method of calculating pairwise genetic distances for 16S rRNA genes, whether it is appropriate to filter variable regions, and how the choice of variable region relates to the genetic diversity observed in full-length sequences. I used a diverse collection of 13,501 high-quality full-length sequences to assess each of these questions. First, alignment quality had a significant impact on distance values and downstream analyses. Specifically, the greengenes alignment, which does a poor job of aligning variable regions, predicted higher genetic diversity, richness, and phylogenetic diversity than the SILVA and RDP-based alignments. Second, the effect of different gap treatments in determining pairwise genetic distances was strongly affected by the variation in sequence length for a region; however, the effect of different calculation methods was subtle when determining the sample's richness or phylogenetic diversity for a region. Third, applying a sequence mask to remove variable positions had a profound impact on genetic distances by muting the observed richness and phylogenetic diversity. Finally, the genetic distances calculated for each of the variable regions did a poor job of correlating with the full-length gene. Thus, while it is tempting to apply traditional cutoff levels derived for full-length sequences to these shorter sequences, it is not advisable. Analysis of beta-diversity metrics showed that each of these factors can have a significant impact on the comparison of community membership and structure. Taken together, these results

  19. Genetic diversity and relatedness of Fasciola spp. isolates from different hosts and geographic regions revealed by analysis of mitochondrial DNA sequences.

    Science.gov (United States)

    Ai, L; Weng, Y B; Elsheikha, H M; Zhao, G H; Alasaad, S; Chen, J X; Li, J; Li, H L; Wang, C R; Chen, M X; Lin, R Q; Zhu, X Q

    2011-09-27

    The present study examined sequence variability in a portion of the mitochondrial cytochrome c oxidase subunit 1 (pcox1) and NADH dehydrogenase subunits 4 and 5 (pnad4 and pnad5) among 39 isolates of Fasciola spp., from different hosts from China, Niger, France, the United States of America, and Spain; and their phylogenetic relationships were re-constructed. Intra-species sequence variations were 0.0-1.1% for pcox1, 0.0-2.7% for pnad4, and 0.0-3.3% for pnad5 for Fasciola hepatica; 0.0-1.8% for pcox1, 0.0-2.5% for pnad4, and 0.0-4.2% for pnad5 for Fasciola gigantica, and 0.0-0.9% for pcox1, 0.0-0.2% for pnad4, and 0.0-1.1% for pnad5 for the intermediate Fasciola form. Whereas, nucleotide differences were 2.1-2.7% for pcox1, 3.1-3.3% for pnad4, and 4.2-4.8% for pnad5 between F. hepatica and F. gigantica; were 1.3-1.5% for pcox1, 2.1-2.9% for pnad4, 3.1-3.4% for pnad5 between F. hepatica and the intermediate form; and were 0.9-1.1% for pcox1, 1.4-1.8% for pnad4, 2.2-2.4% for pnad5 between F. gigantica and the intermediate form. Phylogenetic analysis based on the combined sequences of pcox1, pnad4 and pnad5 revealed distinct groupings of isolates of F. hepatica, F. gigantica, or the intermediate Fasciola form irrespective of their origin, demonstrating the usefulness of the mtDNA sequences for the delineation of Fasciola species, and reinforcing the genetic evidence for the existence of the intermediate Fasciola form. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Sequencing of BAC pools by different next generation sequencing platforms and strategies

    Directory of Open Access Journals (Sweden)

    Scholz Uwe

    2011-10-01

    Full Text Available Abstract Background Next generation sequencing of BACs is a viable option for deciphering the sequence of even large and highly repetitive genomes. In order to optimize this strategy, we examined the influence of read length on the quality of Roche/454 sequence assemblies, to what extent Illumina/Solexa mate pairs (MPs improve the assemblies by scaffolding and whether barcoding of BACs is dispensable. Results Sequencing four BACs with both FLX and Titanium technologies revealed similar sequencing accuracy, but showed that the longer Titanium reads produce considerably less misassemblies and gaps. The 454 assemblies of 96 barcoded BACs were improved by scaffolding 79% of the total contig length with MPs from a non-barcoded library. Assembly of the unmasked 454 sequences without separation by barcodes revealed chimeric contig formation to be a major problem, encompassing 47% of the total contig length. Masking the sequences reduced this fraction to 24%. Conclusion Optimal BAC pool sequencing should be based on the longest available reads, with barcoding essential for a comprehensive assessment of both repetitive and non-repetitive sequence information. When interest is restricted to non-repetitive regions and repeats are masked prior to assembly, barcoding is non-essential. In any case, the assemblies can be improved considerably by scaffolding with non-barcoded BAC pool MPs.

  1. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    Science.gov (United States)

    Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

    2012-01-01

    RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  2. Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

    Directory of Open Access Journals (Sweden)

    Sara Kangaspeska

    Full Text Available RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60% of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

  3. Comprehensive assessment of sequence variation within the copy number variable defensin cluster on 8p23 by target enriched in-depth 454 sequencing

    Directory of Open Access Journals (Sweden)

    Zhang Xinmin

    2011-05-01

    Full Text Available Abstract Background In highly copy number variable (CNV regions such as the human defensin gene locus, comprehensive assessment of sequence variations is challenging. PCR approaches are practically restricted to tiny fractions, and next-generation sequencing (NGS approaches of whole individual genomes e.g. by the 1000 Genomes Project is confined by an affordable sequence depth. Combining target enrichment with NGS may represent a feasible approach. Results As a proof of principle, we enriched a ~850 kb section comprising the CNV defensin gene cluster DEFB, the invariable DEFA part and 11 control regions from two genomes by sequence capture and sequenced it by 454 technology. 6,651 differences to the human reference genome were found. Comparison to HapMap genotypes revealed sensitivities and specificities in the range of 94% to 99% for the identification of variations. Using error probabilities for rigorous filtering revealed 2,886 unique single nucleotide variations (SNVs including 358 putative novel ones. DEFB CN determinations by haplotype ratios were in agreement with alternative methods. Conclusion Although currently labor extensive and having high costs, target enriched NGS provides a powerful tool for the comprehensive assessment of SNVs in highly polymorphic CNV regions of individual genomes. Furthermore, it reveals considerable amounts of putative novel variations and simultaneously allows CN estimation.

  4. Ultra-deep sequencing reveals high prevalence and broad structural diversity of hepatitis B surface antigen mutations in a global population.

    Science.gov (United States)

    Gencay, Mikael; Hübner, Kirsten; Gohl, Peter; Seffner, Anja; Weizenegger, Michael; Neofytos, Dionysios; Batrla, Richard; Woeste, Andreas; Kim, Hyon-Suk; Westergaard, Gaston; Reinsch, Christine; Brill, Eva; Thu Thuy, Pham Thi; Hoang, Bui Huu; Sonderup, Mark; Spearman, C Wendy; Pabinger, Stephan; Gautier, Jérémie; Brancaccio, Giuseppina; Fasano, Massimo; Santantonio, Teresa; Gaeta, Giovanni B; Nauck, Markus; Kaminski, Wolfgang E

    2017-01-01

    The diversity of the hepatitis B surface antigen (HBsAg) has a significant impact on the performance of diagnostic screening tests and the clinical outcome of hepatitis B infection. Neutralizing or diagnostic antibodies against the HBsAg are directed towards its highly conserved major hydrophilic region (MHR), in particular towards its "a" determinant subdomain. Here, we explored, on a global scale, the genetic diversity of the HBsAg MHR in a large, multi-ethnic cohort of randomly selected subjects with HBV infection from four continents. A total of 1553 HBsAg positive blood samples of subjects originating from 20 different countries across Africa, America, Asia and central Europe were characterized for amino acid variation in the MHR. Using highly sensitive ultra-deep sequencing, we found 72.8% of the successfully sequenced subjects (n = 1391) demonstrated amino acid sequence variation in the HBsAg MHR. This indicates that the global variation frequency in the HBsAg MHR is threefold higher than previously reported. The majority of the amino acid mutations were found in the HBV genotypes B (28.9%) and C (25.4%). Collectively, we identified 345 distinct amino acid mutations in the MHR. Among these, we report 62 previously unknown mutations, which extends the worldwide pool of currently known HBsAg MHR mutations by 22%. Importantly, topological analysis identified the "a" determinant upstream flanking region as the structurally most diverse subdomain of the HBsAg MHR. The highest prevalence of "a" determinant region mutations was observed in subjects from Asia, followed by the African, American and European cohorts, respectively. Finally, we found that more than half (59.3%) of all HBV subjects investigated carried multiple MHR mutations. Together, this worldwide ultra-deep sequencing based genotyping study reveals that the global prevalence and structural complexity of variation in the hepatitis B surface antigen have, to date, been significantly underappreciated.

  5. Intratumor Heterogeneity and Branched Evolution Revealed by Multiregion Sequencing

    DEFF Research Database (Denmark)

    Gerlinger, Marco; Rowan, Andrew J.; Horswell, Stuart

    2012-01-01

    .RESULTS: Phylogenetic reconstruction revealed branched evolutionary tumor growth, with 63 to 69% of all somatic mutations not detectable across every tumor region. Intratumor heterogeneity was observed for a mutation within an autoinhibitory domain of the mammalian target of rapamycin (mTOR) kinase, correlating with S6...

  6. Colorectal Cancer Genetic Heterogeneity Delineated by Multi-Region Sequencing.

    Directory of Open Access Journals (Sweden)

    You-Wang Lu

    Full Text Available Intratumor heterogeneity (ITH leads to an underestimation of the mutational landscape portrayed by a single needle biopsy and consequently affects treatment precision. The extent of colorectal cancer (CRC genetic ITH is not well understood in Chinese patients. Thus, we conducted deep sequencing by using the OncoGxOne™ Plus panel, targeting 333 cancer-specific genes in multi-region biopsies of primary and liver metastatic tumors from three Chinese CRC patients. We determined that the extent of ITH varied among the three cases. On average, 65% of all the mutations detected were common within individual tumors. KMT2C aberrations and the NCOR1 mutation were the only ubiquitous events. Subsequent phylogenetic analysis showed that the tumors evolved in a branched manner. Comparison of the primary and metastatic tumors revealed that PPP2R1A (E370X, SETD2 (I1608V, SMAD4 (G382T, and AR splicing site mutations may be specific to liver metastatic cancer. These mutations might contribute to the initiation and progression of distant metastasis. Collectively, our analysis identified a substantial level of genetic ITH in CRC, which should be considered for personalized therapeutic strategies.

  7. Chromosome-wide mapping of DNA methylation patterns in normal and malignant prostate cells reveals pervasive methylation of gene-associated and conserved intergenic sequences

    Directory of Open Access Journals (Sweden)

    De Marzo Angelo M

    2011-06-01

    Full Text Available Abstract Background DNA methylation has been linked to genome regulation and dysregulation in health and disease respectively, and methods for characterizing genomic DNA methylation patterns are rapidly emerging. We have developed/refined methods for enrichment of methylated genomic fragments using the methyl-binding domain of the human MBD2 protein (MBD2-MBD followed by analysis with high-density tiling microarrays. This MBD-chip approach was used to characterize DNA methylation patterns across all non-repetitive sequences of human chromosomes 21 and 22 at high-resolution in normal and malignant prostate cells. Results Examining this data using computational methods that were designed specifically for DNA methylation tiling array data revealed widespread methylation of both gene promoter and non-promoter regions in cancer and normal cells. In addition to identifying several novel cancer hypermethylated 5' gene upstream regions that mediated epigenetic gene silencing, we also found several hypermethylated 3' gene downstream, intragenic and intergenic regions. The hypermethylated intragenic regions were highly enriched for overlap with intron-exon boundaries, suggesting a possible role in regulation of alternative transcriptional start sites, exon usage and/or splicing. The hypermethylated intergenic regions showed significant enrichment for conservation across vertebrate species. A sampling of these newly identified promoter (ADAMTS1 and SCARF2 genes and non-promoter (downstream or within DSCR9, C21orf57 and HLCS genes hypermethylated regions were effective in distinguishing malignant from normal prostate tissues and/or cell lines. Conclusions Comparison of chromosome-wide DNA methylation patterns in normal and malignant prostate cells revealed significant methylation of gene-proximal and conserved intergenic sequences. Such analyses can be easily extended for genome-wide methylation analysis in health and disease.

  8. Tracking TCRβ sequence clonotype expansions during antiviral therapy using high-throughput sequencing of the hypervariable region

    Directory of Open Access Journals (Sweden)

    Mark W Robinson

    2016-04-01

    Full Text Available To maintain a persistent infection viruses such as hepatitis C virus (HCV employ a range of mechanisms that subvert protective T cell responses. The suppression of antigen-specific T cell responses by HCV hinders efforts to profile T cell responses during chronic infection and antiviral therapy. Conventional methods of detecting antigen-specific T cells utilise either antigen stimulation (e.g. ELISpot, proliferation assays, cytokine production or antigen-loaded tetramer staining. This limits the ability to profile T cell responses during chronic infection due to suppressed effector function and the requirement for prior knowledge of antigenic viral peptide sequences. Recently high-throughput sequencing (HTS technologies have been developed for the analysis of T cell repertoires. In the present study we have assessed the feasibility of HTS of the TCRβ complementarity determining region (CDR3 to track T cell expansions in an antigen-independent manner. Using sequential blood samples from HCV-infected individuals undergoing anti-viral therapy we were able to measure the population frequencies of >35,000 TCRβ sequence clonotypes in each individual over the course of 12 weeks. TRBV/TRBJ gene segment usage varied markedly between individuals but remained relatively constant within individuals across the course of therapy. Despite this stable TRBV/TRBJ gene segment usage, a number of TCRβ sequence clonotypes showed dramatic changes in read frequency. These changes could not be linked to therapy outcomes in the present study however the TCRβ CDR3 sequences with the largest fold changes did include sequences with identical TRBV/TRBJ gene segment usage and high joining region homology to previously published CDR3 sequences from HCV-specific T cells targeting the HLA-B*0801-restricted 1395HSKKKCDEL1403 and HLA-A*0101–restricted 1435ATDALMTGY1443 epitopes. The pipeline developed in this proof of concept study provides a platform for the design of

  9. Evaluation of a target region capture sequencing platform using monogenic diabetes as a study-model

    DEFF Research Database (Denmark)

    Gao, Rui; Liu, Yanxia; Gjesing, Anette Marianne Prior

    2014-01-01

    Monogenic diabetes is a genetic disease often caused by mutations in genes involved in beta-cell function. Correct sub-categorization of the disease is a prerequisite for appropriate treatment and genetic counseling. Target-region capture sequencing is a combination of genomic region enrichment...... and next generation sequencing which might be used as an efficient way to diagnose various genetic disorders. We aimed to develop a target-region capture sequencing platform to screen 117 selected candidate genes involved in metabolism for mutations and to evaluate its performance using monogenic diabetes...

  10. Tandemly repeated sequence in 5'end of mtDNA control region of ...

    African Journals Online (AJOL)

    Extensive length variability was observed in 5' end sequence of the mitochondrial DNA control region of the Japanese Spanish mackerel (Scomberomorus niphonius). This length variability was due to the presence of varying numbers of a 56-bp tandemly repeated sequence and a 46-bp insertion/deletion (indel).

  11. Using a sequence characterized amplified region (SCAR) marker for ...

    African Journals Online (AJOL)

    GREGORY

    2010-09-13

    Sep 13, 2010 ... This work used sequence characterized amplified region (SCAR) marker to detect the Bacillus cereus strain in strawberry fields. The purpose was to develop an effective molecular method for detecting the functional target microorganisms applied in agricultural fields. A 3×109. CFU/ml vegetative cell.

  12. Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.

    Science.gov (United States)

    Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M

    2011-07-01

    Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.

  13. Whole-genome sequencing reveals a potential causal mutation for dwarfism in the Miniature Shetland pony.

    Science.gov (United States)

    Metzger, Julia; Gast, Alana Christina; Schrimpf, Rahel; Rau, Janina; Eikelberg, Deborah; Beineke, Andreas; Hellige, Maren; Distl, Ottmar

    2017-04-01

    The Miniature Shetland pony represents a horse breed with an extremely small body size. Clinical examination of a dwarf Miniature Shetland pony revealed a lowered size at the withers, malformed skull and brachygnathia superior. Computed tomography (CT) showed a shortened maxilla and a cleft of the hard and soft palate which protruded into the nasal passage leading to breathing difficulties. Pathological examination confirmed these findings but did not reveal histopathological signs of premature ossification in limbs or cranial sutures. Whole-genome sequencing of this dwarf Miniature Shetland pony and comparative sequence analysis using 26 reference equids from NCBI Sequence Read Archive revealed three probably damaging missense variants which could be exclusively found in the affected foal. Validation of these three missense mutations in 159 control horses from different horse breeds and five donkeys revealed only the aggrecan (ACAN)-associated g.94370258G>C variant as homozygous wild-type in all control samples. The dwarf Miniature Shetland pony had the homozygous mutant genotype C/C of the ACAN:g.94370258G>C variant and the normal parents were heterozygous G/C. An unaffected full sib and 3/5 unaffected half-sibs were heterozygous G/C for the ACAN:g.94370258G>C variant. In summary, we could demonstrate a dwarf phenotype in a miniature pony breed perfectly associated with a missense mutation within the ACAN gene.

  14. Prediction of flexible/rigid regions from protein sequences using k-spaced amino acid pairs

    Directory of Open Access Journals (Sweden)

    Ruan Jishou

    2007-04-01

    Full Text Available Abstract Background Traditionally, it is believed that the native structure of a protein corresponds to a global minimum of its free energy. However, with the growing number of known tertiary (3D protein structures, researchers have discovered that some proteins can alter their structures in response to a change in their surroundings or with the help of other proteins or ligands. Such structural shifts play a crucial role with respect to the protein function. To this end, we propose a machine learning method for the prediction of the flexible/rigid regions of proteins (referred to as FlexRP; the method is based on a novel sequence representation and feature selection. Knowledge of the flexible/rigid regions may provide insights into the protein folding process and the 3D structure prediction. Results The flexible/rigid regions were defined based on a dataset, which includes protein sequences that have multiple experimental structures, and which was previously used to study the structural conservation of proteins. Sequences drawn from this dataset were represented based on feature sets that were proposed in prior research, such as PSI-BLAST profiles, composition vector and binary sequence encoding, and a newly proposed representation based on frequencies of k-spaced amino acid pairs. These representations were processed by feature selection to reduce the dimensionality. Several machine learning methods for the prediction of flexible/rigid regions and two recently proposed methods for the prediction of conformational changes and unstructured regions were compared with the proposed method. The FlexRP method, which applies Logistic Regression and collocation-based representation with 95 features, obtained 79.5% accuracy. The two runner-up methods, which apply the same sequence representation and Support Vector Machines (SVM and Naïve Bayes classifiers, obtained 79.2% and 78.4% accuracy, respectively. The remaining considered methods are

  15. Detection of genomic variation by selection of a 9 mb DNA region and high throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Sergey I Nikolaev

    Full Text Available Detection of the rare polymorphisms and causative mutations of genetic diseases in a targeted genomic area has become a major goal in order to understand genomic and phenotypic variability. We have interrogated repeat-masked regions of 8.9 Mb on human chromosomes 21 (7.8 Mb and 7 (1.1 Mb from an individual from the International HapMap Project (NA12872. We have optimized a method of genomic selection for high throughput sequencing. Microarray-based selection and sequencing resulted in 260-fold enrichment, with 41% of reads mapping to the target region. 83% of SNPs in the targeted region had at least 4-fold sequence coverage and 54% at least 15-fold. When assaying HapMap SNPs in NA12872, our sequence genotypes are 91.3% concordant in regions with coverage > or = 4-fold, and 97.9% concordant in regions with coverage > or = 15-fold. About 81% of the SNPs recovered with both thresholds are listed in dbSNP. We observed that regions with low sequence coverage occur in close proximity to low-complexity DNA. Validation experiments using Sanger sequencing were performed for 46 SNPs with 15-20 fold coverage, with a confirmation rate of 96%, suggesting that DNA selection provides an accurate and cost-effective method for identifying rare genomic variants.

  16. Analysis of the 9p21.3 sequence associated with coronary artery disease reveals a tendency for duplication in a CAD patient

    Science.gov (United States)

    Kouprina, Natalay; Noskov, Vladimir N.; Waterfall, Joshua J.; Walker, Robert L.; Meltzer, Paul S.; Topol, Eric J.; Larionov, Vladimir

    2018-01-01

    Tandem segmental duplications (SDs) greater than 10 kb are widespread in complex genomes. They provide material for gene divergence and evolutionary adaptation, while formation of specific de novo SDs is a hallmark of cancer and some human diseases. Most SDs map to distinct genomic regions termed ‘duplication blocks’. SDs organization within these blocks is often poorly characterized as they are mosaics of ancestral duplicons juxtaposed with younger duplicons arising from more recent duplication events. Structural and functional analysis of SDs is further hampered as long repetitive DNA structures are underrepresented in existing BAC and YAC libraries. We applied Transformation-Associated Recombination (TAR) cloning, a versatile technique for large DNA manipulation, to selectively isolate the coronary artery disease (CAD) interval sequence within the 9p21.3 chromosome locus from a patient with coronary artery disease and normal individuals. Four tandem head-to-tail duplicons, each ∼50 kb long, were recovered in the patient but not in normal individuals. Sequence analysis revealed that the repeats varied by 10-15 SNPs between each other and by 82 SNPs between the human genome sequence (version hg19). SNPs polymorphism within the junctions between repeats allowed two junction types to be distinguished, Type 1 and Type 2, which were found at a 2:1 ratio. The junction sequences contained an Alu element, a sequence previously shown to play a role in duplication. Knowledge of structural variation in the CAD interval from more patients could help link this locus to cardiovascular diseases susceptibility, and maybe relevant to other cases of regional amplification, including cancer. PMID:29632643

  17. ASAP: Amplification, sequencing & annotation of plastomes

    Directory of Open Access Journals (Sweden)

    Folta Kevin M

    2005-12-01

    Full Text Available Abstract Background Availability of DNA sequence information is vital for pursuing structural, functional and comparative genomics studies in plastids. Traditionally, the first step in mining the valuable information within a chloroplast genome requires sequencing a chloroplast plasmid library or BAC clones. These activities involve complicated preparatory procedures like chloroplast DNA isolation or identification of the appropriate BAC clones to be sequenced. Rolling circle amplification (RCA is being used currently to amplify the chloroplast genome from purified chloroplast DNA and the resulting products are sheared and cloned prior to sequencing. Herein we present a universal high-throughput, rapid PCR-based technique to amplify, sequence and assemble plastid genome sequence from diverse species in a short time and at reasonable cost from total plant DNA, using the large inverted repeat region from strawberry and peach as proof of concept. The method exploits the highly conserved coding regions or intergenic regions of plastid genes. Using an informatics approach, chloroplast DNA sequence information from 5 available eudicot plastomes was aligned to identify the most conserved regions. Cognate primer pairs were then designed to generate ~1 – 1.2 kb overlapping amplicons from the inverted repeat region in 14 diverse genera. Results 100% coverage of the inverted repeat region was obtained from Arabidopsis, tobacco, orange, strawberry, peach, lettuce, tomato and Amaranthus. Over 80% coverage was obtained from distant species, including Ginkgo, loblolly pine and Equisetum. Sequence from the inverted repeat region of strawberry and peach plastome was obtained, annotated and analyzed. Additionally, a polymorphic region identified from gel electrophoresis was sequenced from tomato and Amaranthus. Sequence analysis revealed large deletions in these species relative to tobacco plastome thus exhibiting the utility of this method for structural and

  18. Transcriptome Sequencing Revealed Significant Alteration of Cortical Promoter Usage and Splicing in Schizophrenia

    Science.gov (United States)

    Wu, Jing Qin; Wang, Xi; Beveridge, Natalie J.; Tooney, Paul A.; Scott, Rodney J.; Carr, Vaughan J.; Cairns, Murray J.

    2012-01-01

    Background While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression. Methodology/Principal Findings The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22) from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDRschizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia. PMID:22558445

  19. BAC and RNA sequencing reveal the brown planthopper resistance gene BPH15 in a recombination cold spot that mediates a unique defense mechanism.

    Science.gov (United States)

    Lv, Wentang; Du, Ba; Shangguan, Xinxin; Zhao, Yan; Pan, Yufang; Zhu, Lili; He, Yuqing; He, Guangcun

    2014-08-11

    Brown planthopper (BPH, Nilaparvata lugens Stål), is the most destructive phloem-feeding insect pest of rice (Oryza sativa). The BPH-resistance gene BPH15 has been proved to be effective in controlling the pest and widely applied in rice breeding programs. Nevertheless, molecular mechanism of the resistance remain unclear. In this study, we narrowed down the position of BPH15 on chromosome 4 and investigated the transcriptome of BPH15 rice after BPH attacked. We analyzed 13,000 BC2F2 plants of cross between susceptible rice TN1 and the recombinant inbred line RI93 that carrying the BPH15 gene from original resistant donor B5. BPH15 was mapped to a 0.0269 cM region on chromosome 4, which is 210-kb in the reference genome of Nipponbare. Sequencing bacterial artificial chromosome (BAC) clones that span the BPH15 region revealed that the physical size of BPH15 region in resistant rice B5 is 580-kb, much bigger than the corresponding region in the reference genome of Nipponbare. There were 87 predicted genes in the BPH15 region in resistant rice. The expression profiles of predicted genes were analyzed. Four jacalin-related lectin proteins genes and one LRR protein gene were found constitutively expressed in resistant parent and considered the candidate genes of BPH15. The transcriptomes of resistant BPH15 introgression line and the susceptible recipient line were analyzed using high-throughput RNA sequencing. In total, 2,914 differentially expressed genes (DEGs) were identified. BPH-responsive transcript profiles were distinct between resistant and susceptible plants and between the early stage (6 h after infestation, HAI) and late stage (48 HAI). The key defense mechanism was related to jasmonate signaling, ethylene signaling, receptor kinase, MAPK cascades, Ca(2+) signaling, PR genes, transcription factors, and protein posttranslational modifications. Our work combined BAC and RNA sequencing to identify candidate genes of BPH15 and revealed the resistance mechanism

  20. Diversity analysis of Bemisia tabaci biotypes: RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region

    OpenAIRE

    Rabello, Aline R.; Queiroz, Paulo R.; Simões, Kenya C.C.; Hiragi, Cássia O.; Lima, Luzia H.C.; Oliveira, Maria Regina V.; Mehta, Angela

    2008-01-01

    The Bemisia tabaci complex is formed by approximately 41 biotypes, two of which (B and BR) occur in Brazil. In this work we aimed at obtaining genetic markers to assess the genetic diversity of the different biotypes. In order to do that we analyzed Bemisia tabaci biotypes B, BR, Q and Cassava using molecular techniques including RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region. The analyses revealed a high similarity between the individuals of the B and Q biotypes, which could be distin...

  1. Loss of genetic variability in a hatchery strain of Senegalese sole (Solea senegalensis revealed by sequence data of the mitochondrial DNA control region and microsatellite markers

    Directory of Open Access Journals (Sweden)

    Pablo Sánchez

    2012-06-01

    Full Text Available Comparisons of the levels of genetic variation within and between a hatchery F1 (FAR, n=116 of Senegalese sole, Solea senegalensis, and its wild donor population (ATL, n = 26, both native to the SW Atlantic coast of the Iberian peninsula, as well as between the wild donor population and a wild western Mediterranean sample (MED, n=18, were carried out by characterizing 412 base pairs of the nucleotide sequence of the mitochondrial DNA control region I, and six polymorphic microsatellite loci. FAR showed a substantial loss of genetic variability (haplotypic diversity, h=0.49±0.066; nucleotide diversity, π=0.006±0.004; private allelic richness, pAg=0.28 to its donor population ATL (h=0.69±0.114; π=0.009±0.006; pAg=1.21. Pairwise FST values of microsatellite data were highly significant (P < 0.0001 between FAR and ATL (0.053 and FAR and MED (0.055. The comparison of wild samples revealed higher values of genetic variability in MED than in ATL, but only with mtDNA CR-I sequence data (h=0.948±0.033; π=0.030±0.016. However, pairwise ΦST and FST values between ATL and MED were highly significant (P < 0.0001 with mtDNA CR-I (0.228 and with microsatellite data (0.095, respectively. While loss of genetic variability in FAR could be associated with the sampling error when the broodstock was established, the results of parental and sibship inference suggest that most of these losses can be attributed to a high variance in reproductive success among members of the broodstock, particularly among females.

  2. Phylogenetic relationships of Malaysia's pig-tailed macaque Macaca nemestrina based on D-loop region sequences

    Science.gov (United States)

    Abdul-Latiff M. A., B.; Ampeng, A.; Yaakop, S.; Md-Zain B., M.

    2014-09-01

    Phylogenetic relationships among Malaysian pig-tailed macaques have never been established even though the data are crucial in aiding conservation plan for the species. The aims of this study is to establish the phylogenetic relationships of Macaca nemestrina in Malaysia. A total of 21 genetic samples of M. nemestrina yielding 458 bp of D-loop sequences were used in phylogenetic analyses, in addition to one sample of M. fascicularis which was used as an outgroup. Sequence character analysis revealed that D-loop locus contains 23% parsimony informative character detected among the ingroups. Further analysis indicated a clear separation between populations originating from different regions; the Malay Peninsula populations are separated from Borneo Insular population; and Perak population formed a distinctive clade within Peninsular Malaysia populations. Phylogenetic trees (NJ, MP and Bayesian) portray a consistent clustering paradigm as Borneo population was distinguished from Peninsula population (100% bootstrap value in the NJ, MP, 1.00 posterior probability in Bayesian trees). Perak's population was separated from other Peninsula populations (100% in NJ, 99% in MP and 1.00 in Bayesian). D-loop region of mtDNA is proven to be a suitable locus in studying the separation of M. nemestrina at population level. These findings are crucial in aiding the conservation management and translocation process of M. fascicularis populations in Malaysia.

  3. The Douglas-Fir Genome Sequence Reveals Specialization of the Photosynthetic Apparatus in Pinaceae

    Directory of Open Access Journals (Sweden)

    David B. Neale

    2017-09-01

    Full Text Available A reference genome sequence for Pseudotsuga menziesii var. menziesii (Mirb. Franco (Coastal Douglas-fir is reported, thus providing a reference sequence for a third genus of the family Pinaceae. The contiguity and quality of the genome assembly far exceeds that of other conifer reference genome sequences (contig N50 = 44,136 bp and scaffold N50 = 340,704 bp. Incremental improvements in sequencing and assembly technologies are in part responsible for the higher quality reference genome, but it may also be due to a slightly lower exact repeat content in Douglas-fir vs. pine and spruce. Comparative genome annotation with angiosperm species reveals gene-family expansion and contraction in Douglas-fir and other conifers which may account for some of the major morphological and physiological differences between the two major plant groups. Notable differences in the size of the NDH-complex gene family and genes underlying the functional basis of shade tolerance/intolerance were observed. This reference genome sequence not only provides an important resource for Douglas-fir breeders and geneticists but also sheds additional light on the evolutionary processes that have led to the divergence of modern angiosperms from the more ancient gymnosperms.

  4. Time Separation Between Events in a Sequence: a Regional Property?

    Science.gov (United States)

    Muirwood, R.; Fitzenz, D. D.

    2013-12-01

    Earthquake sequences are loosely defined as events occurring too closely in time and space to appear unrelated. Depending on the declustering method, several, all, or no event(s) after the first large event might be recognized as independent mainshocks. It can therefore be argued that a probabilistic seismic hazard assessment (PSHA, traditionally dealing with mainshocks only) might already include the ground shaking effects of such sequences. Alternatively all but the largest event could be classified as an ';aftershock' and removed from the earthquake catalog. While in PSHA the question is only whether to keep or remove the events from the catalog, for Risk Management purposes, the community response to the earthquakes, as well as insurance risk transfer mechanisms, can be profoundly affected by the actual timing of events in such a sequence. In particular the repetition of damaging earthquakes over a period of weeks to months can lead to businesses closing and families evacuating from the region (as happened in Christchurch, New Zealand in 2011). Buildings that are damaged in the first earthquake may go on to be damaged again, even while they are being repaired. Insurance also functions around a set of critical timeframes - including the definition of a single 'event loss' for reinsurance recoveries within the 192 hour ';hours clause', the 6-18 month pace at which insurance claims are settled, and the annual renewal of insurance and reinsurance contracts. We show how temporal aspects of earthquake sequences need to be taken into account within models for Risk Management, and what time separation between events are most sensitive, both in terms of the modeled disruptions to lifelines and business activity as well as in the losses to different parties (such as insureds, insurers and reinsurers). We also explore the time separation between all events and between loss causing events for a collection of sequences from across the world and we point to the need to

  5. Draft whole genome sequence of groundnut stem rot fungus Athelia rolfsii revealing genetic architect of its pathogenicity and virulence.

    Science.gov (United States)

    Iquebal, M A; Tomar, Rukam S; Parakhia, M V; Singla, Deepak; Jaiswal, Sarika; Rathod, V M; Padhiyar, S M; Kumar, Neeraj; Rai, Anil; Kumar, Dinesh

    2017-07-13

    Groundnut (Arachis hypogaea L.) is an important oil seed crop having major biotic constraint in production due to stem rot disease caused by fungus, Athelia rolfsii causing 25-80% loss in productivity. As chemical and biological combating strategies of this fungus are not very effective, thus genome sequencing can reveal virulence and pathogenicity related genes for better understanding of the host-parasite interaction. We report draft assembly of Athelia rolfsii genome of ~73 Mb having 8919 contigs. Annotation analysis revealed 16830 genes which are involved in fungicide resistance, virulence and pathogenicity along with putative effector and lethal genes. Secretome analysis revealed CAZY genes representing 1085 enzymatic genes, glycoside hydrolases, carbohydrate esterases, carbohydrate-binding modules, auxillary activities, glycosyl transferases and polysaccharide lyases. Repeat analysis revealed 11171 SSRs, LTR, GYPSY and COPIA elements. Comparative analysis with other existing ascomycotina genome predicted conserved domain family of WD40, CYP450, Pkinase and ABC transporter revealing insight of evolution of pathogenicity and virulence. This study would help in understanding pathogenicity and virulence at molecular level and development of new combating strategies. Such approach is imperative in endeavour of genome based solution in stem rot disease management leading to better productivity of groundnut crop in tropical region of world.

  6. [Exome sequencing revealed Allan-Herndon-Dudley syndrome underlying multiple disabilities].

    Science.gov (United States)

    Arvio, Maria; Philips, Anju K; Ahvenainen, Minna; Somer, Mirja; Kalscheuer, Vera; Järvelä, Irma

    2014-01-01

    Normal function of the thyroid gland is the cornerstone of a child's mental development and physical growth. We describe a Finnish family, in which the diagnosis of three brothers became clear after investigations that lasted for more than 30 years. Two of the sons have already died. DNA analysis of the third one, a 16-year-old boy, revealed in exome sequencing of the complete X chromosome a mutation in the SLC16A2 gene, i.e. MCT8, coding for a thyroid hormone transport protein. Allan-Herndon-Dudley syndrome was thus shown to be the cause of multiple disabilities.

  7. Whole-exome sequencing revealed two novel mutations in Usher syndrome.

    Science.gov (United States)

    Koparir, Asuman; Karatas, Omer Faruk; Atayoglu, Ali Timucin; Yuksel, Bayram; Sagiroglu, Mahmut Samil; Seven, Mehmet; Ulucan, Hakan; Yuksel, Adnan; Ozen, Mustafa

    2015-06-01

    Usher syndrome is a clinically and genetically heterogeneous autosomal recessive inherited disorder accompanied by hearing loss and retinitis pigmentosa (RP). Since the associated genes are various and quite large, we utilized whole-exome sequencing (WES) as a diagnostic tool to identify the molecular basis of Usher syndrome. DNA from a 12-year-old male diagnosed with Usher syndrome was analyzed by WES. Mutations detected were confirmed by Sanger sequencing. The pathogenicity of these mutations was determined by in silico analysis. A maternally inherited deleterious frameshift mutation, c.14439_14454del in exon 66 and a paternally inherited non-sense c.10830G>A stop-gain SNV in exon 55 of USH2A were found as two novel compound heterozygous mutations. Both of these mutations disrupt the C terminal of USH2A protein. As a result, WES revealed two novel compound heterozygous mutations in a Turkish USH2A patient. This approach gave us an opportunity to have an appropriate diagnosis and provide genetic counseling to the family within a reasonable time. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Widespread alternative and aberrant splicing revealed by lariat sequencing

    Science.gov (United States)

    Stepankiw, Nicholas; Raghavan, Madhura; Fogarty, Elizabeth A.; Grimson, Andrew; Pleiss, Jeffrey A.

    2015-01-01

    Alternative splicing is an important and ancient feature of eukaryotic gene structure, the existence of which has likely facilitated eukaryotic proteome expansions. Here, we have used intron lariat sequencing to generate a comprehensive profile of splicing events in Schizosaccharomyces pombe, amongst the simplest organisms that possess mammalian-like splice site degeneracy. We reveal an unprecedented level of alternative splicing, including alternative splice site selection for over half of all annotated introns, hundreds of novel exon-skipping events, and thousands of novel introns. Moreover, the frequency of these events is far higher than previous estimates, with alternative splice sites on average activated at ∼3% the rate of canonical sites. Although a subset of alternative sites are conserved in related species, implying functional potential, the majority are not detectably conserved. Interestingly, the rate of aberrant splicing is inversely related to expression level, with lowly expressed genes more prone to erroneous splicing. Although we validate many events with RNAseq, the proportion of alternative splicing discovered with lariat sequencing is far greater, a difference we attribute to preferential decay of aberrantly spliced transcripts. Together, these data suggest the spliceosome possesses far lower fidelity than previously appreciated, highlighting the potential contributions of alternative splicing in generating novel gene structures. PMID:26261211

  9. Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

    Science.gov (United States)

    Seo, Heewon; Park, Yoomi; Min, Byung Joo; Seo, Myung Eui; Kim, Ju Han

    2017-01-01

    The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7%) of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit) exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

  10. Evaluation of exome variants using the Ion Proton Platform to sequence error-prone regions.

    Directory of Open Access Journals (Sweden)

    Heewon Seo

    Full Text Available The Ion Proton sequencer from Thermo Fisher accurately determines sequence variants from target regions with a rapid turnaround time at a low cost. However, misleading variant-calling errors can occur. We performed a systematic evaluation and manual curation of read-level alignments for the 675 ultrarare variants reported by the Ion Proton sequencer from 27 whole-exome sequencing data but that are not present in either the 1000 Genomes Project and the Exome Aggregation Consortium. We classified positive variant calls into 393 highly likely false positives, 126 likely false positives, and 156 likely true positives, which comprised 58.2%, 18.7%, and 23.1% of the variants, respectively. We identified four distinct error patterns of variant calling that may be bioinformatically corrected when using different strategies: simplicity region, SNV cluster, peripheral sequence read, and base inversion. Local de novo assembly successfully corrected 201 (38.7% of the 519 highly likely or likely false positives. We also demonstrate that the two sequencing kits from Thermo Fisher (the Ion PI Sequencing 200 kit V3 and the Ion PI Hi-Q kit exhibit different error profiles across different error types. A refined calling algorithm with better polymerase may improve the performance of the Ion Proton sequencing platform.

  11. Genetic Diversity of Pinus nigra Arn. Populations in Southern Spain and Northern Morocco Revealed By Inter-Simple Sequence Repeat Profiles

    Directory of Open Access Journals (Sweden)

    Oussama Ahrazem

    2012-05-01

    Full Text Available Eight Pinus nigra Arn. populations from Southern Spain and Northern Morocco were examined using inter-simple sequence repeat markers to characterize the genetic variability amongst populations. Pair-wise population genetic distance ranged from 0.031 to 0.283, with a mean of 0.150 between populations. The highest inter-population average distance was between PaCU from Cuenca and YeCA from Cazorla, while the lowest distance was between TaMO from Morocco and MA Sierra Mágina populations. Analysis of molecular variance (AMOVA and Nei’s genetic diversity analyses revealed higher genetic variation within the same population than among different populations. Genetic differentiation (Gst was 0.233. Cuenca showed the highest Nei’s genetic diversity followed by the Moroccan region, Sierra Mágina, and Cazorla region. However, clustering of populations was not in accordance with their geographical locations. Principal component analysis showed the presence of two major groups—Group 1 contained all populations from Cuenca while Group 2 contained populations from Cazorla, Sierra Mágina and Morocco—while Bayesian analysis revealed the presence of three clusters. The low genetic diversity observed in PaCU and YeCA is probably a consequence of inappropriate management since no estimation of genetic variability was performed before the silvicultural treatments. Data indicates that the inter-simple sequence repeat (ISSR method is sufficiently informative and powerful to assess genetic variability among populations of P. nigra.

  12. Sequencing of bovine herpesvirus 4 v.test strain reveals important genome features

    Directory of Open Access Journals (Sweden)

    Gillet Laurent

    2011-08-01

    Full Text Available Abstract Background Bovine herpesvirus 4 (BoHV-4 is a useful model for the human pathogenic gammaherpesviruses Epstein-Barr virus and Kaposi's Sarcoma-associated Herpesvirus. Although genome manipulations of this virus have been greatly facilitated by the cloning of the BoHV-4 V.test strain as a Bacterial Artificial Chromosome (BAC, the lack of a complete genome sequence for this strain limits its experimental use. Methods In this study, we have determined the complete sequence of BoHV-4 V.test strain by a pyrosequencing approach. Results The long unique coding region (LUR consists of 108,241 bp encoding at least 79 open reading frames and is flanked by several polyrepetitive DNA units (prDNA. As previously suggested, we showed that the prDNA unit located at the left prDNA-LUR junction (prDNA-G differs from the other prDNA units (prDNA-inner. Namely, the prDNA-G unit lacks the conserved pac-2 cleavage and packaging signal in its right terminal region. Based on the mechanisms of cleavage and packaging of herpesvirus genomes, this feature implies that only genomes bearing left and right end prDNA units are encapsulated into virions. Conclusions In this study, we have determined the complete genome sequence of the BAC-cloned BoHV-4 V.test strain and identified genome organization features that could be important in other herpesviruses.

  13. Conserved properties of dentate gyrus neurogenesis across postnatal development revealed by single-cell RNA sequencing.

    Science.gov (United States)

    Hochgerner, Hannah; Zeisel, Amit; Lönnerberg, Peter; Linnarsson, Sten

    2018-02-01

    The dentate gyrus of the hippocampus is a brain region in which neurogenesis persists into adulthood; however, the relationship between developmental and adult dentate gyrus neurogenesis has not been examined in detail. Here we used single-cell RNA sequencing to reveal the molecular dynamics and diversity of dentate gyrus cell types in perinatal, juvenile, and adult mice. We found distinct quiescent and proliferating progenitor cell types, linked by transient intermediate states to neuroblast stages and fully mature granule cells. We observed shifts in the molecular identity of quiescent and proliferating radial glia and granule cells during the postnatal period that were then maintained through adult stages. In contrast, intermediate progenitor cells, neuroblasts, and immature granule cells were nearly indistinguishable at all ages. These findings demonstrate the fundamental similarity of postnatal and adult neurogenesis in the hippocampus and pinpoint the early postnatal transformation of radial glia from embryonic progenitors to adult quiescent stem cells.

  14. Scalable whole-exome sequencing of cell-free DNA reveals high concordance with metastatic tumors.

    Science.gov (United States)

    Adalsteinsson, Viktor A; Ha, Gavin; Freeman, Samuel S; Choudhury, Atish D; Stover, Daniel G; Parsons, Heather A; Gydush, Gregory; Reed, Sarah C; Rotem, Denisse; Rhoades, Justin; Loginov, Denis; Livitz, Dimitri; Rosebrock, Daniel; Leshchiner, Ignaty; Kim, Jaegil; Stewart, Chip; Rosenberg, Mara; Francis, Joshua M; Zhang, Cheng-Zhong; Cohen, Ofir; Oh, Coyin; Ding, Huiming; Polak, Paz; Lloyd, Max; Mahmud, Sairah; Helvie, Karla; Merrill, Margaret S; Santiago, Rebecca A; O'Connor, Edward P; Jeong, Seong H; Leeson, Rachel; Barry, Rachel M; Kramkowski, Joseph F; Zhang, Zhenwei; Polacek, Laura; Lohr, Jens G; Schleicher, Molly; Lipscomb, Emily; Saltzman, Andrea; Oliver, Nelly M; Marini, Lori; Waks, Adrienne G; Harshman, Lauren C; Tolaney, Sara M; Van Allen, Eliezer M; Winer, Eric P; Lin, Nancy U; Nakabayashi, Mari; Taplin, Mary-Ellen; Johannessen, Cory M; Garraway, Levi A; Golub, Todd R; Boehm, Jesse S; Wagle, Nikhil; Getz, Gad; Love, J Christopher; Meyerson, Matthew

    2017-11-06

    Whole-exome sequencing of cell-free DNA (cfDNA) could enable comprehensive profiling of tumors from blood but the genome-wide concordance between cfDNA and tumor biopsies is uncertain. Here we report ichorCNA, software that quantifies tumor content in cfDNA from 0.1× coverage whole-genome sequencing data without prior knowledge of tumor mutations. We apply ichorCNA to 1439 blood samples from 520 patients with metastatic prostate or breast cancers. In the earliest tested sample for each patient, 34% of patients have ≥10% tumor-derived cfDNA, sufficient for standard coverage whole-exome sequencing. Using whole-exome sequencing, we validate the concordance of clonal somatic mutations (88%), copy number alterations (80%), mutational signatures, and neoantigens between cfDNA and matched tumor biopsies from 41 patients with ≥10% cfDNA tumor content. In summary, we provide methods to identify patients eligible for comprehensive cfDNA profiling, revealing its applicability to many patients, and demonstrate high concordance of cfDNA and metastatic tumor whole-exome sequencing.

  15. [Cloning and sequence analysis of the DHBV genome of the brown ducks in Guilin region and establishment of the quantitative method for detecting DHBV].

    Science.gov (United States)

    Su, He-Ling; Huang, Ri-Dong; He, Song-Qing; Xu, Qing; Zhu, Hua; Mo, Zhi-Jing; Liu, Qing-Bo; Liu, Yong-Ming

    2013-03-01

    Brown ducks carrying DHBV were widely used as hepatitis B animal model in the research of the activity and toxicity of anti-HBV dugs. Studies showed that the ratio of DHBV carriers in the brown ducks in Guilin region was relatively high. Nevertheless, the characters of the DHBV genome of Guilin brown duck remain unknown. Here we report the cloning of the genome of Guilin brown duck DHBV and the sequence analysis of the genome. The full length of the DHBV genome of Guilin brown duck was 3 027bp. Analysis using ORF finder found that there was an ORF for an unknown peptide other than S-ORF, PORF and C-ORF in the genome of the DHBV. Vector NTI 8. 0 analysis revealed that the unknown peptide contained a motif which binded to HLA * 0201. Aligning with the DHBV sequences from different countries and regions indicated that there were no obvious differences of regional distribution among the sequences. A fluorescence quantitative PCR for detecting DHBV was establishment based on the recombinant plasmid pGEM-DHBV-S constructed. This study laid the groundwork for using Guilin brown duck as a hepatitis B animal model.

  16. Sequence periodicity in nucleosomal DNA and intrinsic curvature.

    Science.gov (United States)

    Nair, T Murlidharan

    2010-05-17

    Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.

  17. Low diversity in the mitogenome of sperm whales revealed by next-generation sequencing

    Science.gov (United States)

    Alana Alexander; Debbie Steel; Beth Slikas; Kendra Hoekzema; Colm Carraher; Matthew Parks; Richard Cronn; C. Scott Baker

    2012-01-01

    Large population sizes and global distributions generally associate with high mitochondrial DNA control region (CR) diversity. The sperm whale (Physeter macrocephalus) is an exception, showing low CR diversity relative to other cetaceans; however, diversity levels throughout the remainder of the sperm whale mitogenome are unknown. We sequenced 20...

  18. Transcriptome sequencing revealed significant alteration of cortical promoter usage and splicing in schizophrenia.

    Directory of Open Access Journals (Sweden)

    Jing Qin Wu

    Full Text Available While hybridization based analysis of the cortical transcriptome has provided important insight into the neuropathology of schizophrenia, it represents a restricted view of disease-associated gene activity based on predetermined probes. By contrast, sequencing technology can provide un-biased analysis of transcription at nucleotide resolution. Here we use this approach to investigate schizophrenia-associated cortical gene expression.The data was generated from 76 bp reads of RNA-Seq, aligned to the reference genome and assembled into transcripts for quantification of exons, splice variants and alternative promoters in postmortem superior temporal gyrus (STG/BA22 from 9 male subjects with schizophrenia and 9 matched non-psychiatric controls. Differentially expressed genes were then subjected to further sequence and functional group analysis. The output, amounting to more than 38 Gb of sequence, revealed significant alteration of gene expression including many previously shown to be associated with schizophrenia. Gene ontology enrichment analysis followed by functional map construction identified three functional clusters highly relevant to schizophrenia including neurotransmission related functions, synaptic vesicle trafficking, and neural development. Significantly, more than 2000 genes displayed schizophrenia-associated alternative promoter usage and more than 1000 genes showed differential splicing (FDR<0.05. Both types of transcriptional isoforms were exemplified by reads aligned to the neurodevelopmentally significant doublecortin-like kinase 1 (DCLK1 gene.This study provided the first deep and un-biased analysis of schizophrenia-associated transcriptional diversity within the STG, and revealed variants with important implications for the complex pathophysiology of schizophrenia.

  19. OPAL: prediction of MoRF regions in intrinsically disordered protein sequences.

    Science.gov (United States)

    Sharma, Ronesh; Raicar, Gaurav; Tsunoda, Tatsuhiko; Patil, Ashwini; Sharma, Alok

    2018-06-01

    Intrinsically disordered proteins lack stable 3-dimensional structure and play a crucial role in performing various biological functions. Key to their biological function are the molecular recognition features (MoRFs) located within long disordered regions. Computationally identifying these MoRFs from disordered protein sequences is a challenging task. In this study, we present a new MoRF predictor, OPAL, to identify MoRFs in disordered protein sequences. OPAL utilizes two independent sources of information computed using different component predictors. The scores are processed and combined using common averaging method. The first score is computed using a component MoRF predictor which utilizes composition and sequence similarity of MoRF and non-MoRF regions to detect MoRFs. The second score is calculated using half-sphere exposure (HSE), solvent accessible surface area (ASA) and backbone angle information of the disordered protein sequence, using information from the amino acid properties of flanks surrounding the MoRFs to distinguish MoRF and non-MoRF residues. OPAL is evaluated using test sets that were previously used to evaluate MoRF predictors, MoRFpred, MoRFchibi and MoRFchibi-web. The results demonstrate that OPAL outperforms all the available MoRF predictors and is the most accurate predictor available for MoRF prediction. It is available at http://www.alok-ai-lab.com/tools/opal/. ashwini@hgc.jp or alok.sharma@griffith.edu.au. Supplementary data are available at Bioinformatics online.

  20. Taxonomy and phylogeny of the genus citrus based on the nuclear ribosomal dna its region sequence

    International Nuclear Information System (INIS)

    Sun, Y.L.

    2015-01-01

    The genus Citrus (Aurantioideae, Rutaceae) is the sole source of the citrus fruits of commerce showing high economic values. In this study, the taxonomy and phylogeny of Citrus species is evaluated using sequence analysis of the ITS region of nrDNA. This study is based on 26 plants materials belonging to 22 Citrus species having wild, domesticated, and cultivated species. Through DNA alignment of the ITS sequence, ITS1 and ITS2 regions showed relatively high variations of sequence length and nucleotide among these Citrus species. According to previous six-tribe discrimination theory by Swingle and Reece, the grouping in our ITS phylogenetic tree reconstructed by ITS sequences was not related to tribe discrimination but species discrimination. However, the molecular analysis could provide more information on citrus taxonomy. Combined with ITS sequences of other subgenera in then true citrus fruit tree group, the ITS phylogenetic tree indicated subgenera Citrus was monophyletic and nearer to Fortunella, Poncirus, and Clymenia compared to Microcitrus and Eremocitrus. Abundant sequence variations of the ITS region shown in this study would help species identification and tribe differentiation of the genus Citrus. (author)

  1. Comparative genomic sequence analysis of strawberry and other rosids reveals significant microsynteny

    Directory of Open Access Journals (Sweden)

    Abbott Albert

    2010-06-01

    Full Text Available Abstract Background Fragaria belongs to the Rosaceae, an economically important family that includes a number of important fruit producing genera such as Malus and Prunus. Using genomic sequences from 50 Fragaria fosmids, we have examined the microsynteny between Fragaria and other plant models. Results In more than half of the strawberry fosmids, we found syntenic regions that are conserved in Populus, Vitis, Medicago and/or Arabidopsis with Populus containing the greatest number of syntenic regions with Fragaria. The longest syntenic region was between LG VIII of the poplar genome and the strawberry fosmid 72E18, where seven out of twelve predicted genes were collinear. We also observed an unexpectedly high level of conserved synteny between Fragaria (rosid I and Vitis (basal rosid. One of the strawberry fosmids, 34E24, contained a cluster of R gene analogs (RGAs with NBS and LRR domains. We detected clusters of RGAs with high sequence similarity to those in 34E24 in all the genomes compared. In the phylogenetic tree we have generated, all the NBS-LRR genes grouped together with Arabidopsis CNL-A type NBS-LRR genes. The Fragaria RGA grouped together with those of Vitis and Populus in the phylogenetic tree. Conclusions Our analysis shows considerable microsynteny between Fragaria and other plant genomes such as Populus, Medicago, Vitis, and Arabidopsis to a lesser degree. We also detected a cluster of NBS-LRR type genes that are conserved in all the genomes compared.

  2. Genetic diversity in breonadia salicina based on intra-species sequence variation of chloroplast dna spacer sequence

    International Nuclear Information System (INIS)

    Qurainy, F.A.; Gaafar, A.R.Z.

    2014-01-01

    Assessment and knowledge of the genetic diversity and variation within and between populations of rare and endangered plants is very important for effective conservation. Intergenic spacer sequences variation of psbA-trnH locus of chloroplast genome was assessed within Breonadia salicina (Rubiaceae), a critically endangered and endemic plant species to South western part of Kingdom of Saudi Arabia. The obtained sequence data from 19 individuals in three populations revealed nine haplotypes. The aligned sequences obtained from the overall Saudi accessions extended to 355 bp, revealing nine haplotypes. A high level of haplotype diversity (Hd = 0.842) and low level of nucleotide diversity (Pi = 0.0058) were detected. Consistently, both hierarchical analysis of molecular variance (AMOVA) and constructed neighbor-joining tree indicated null genetic differentiation among populations. This level of differentiation between populations or between regions in psbA-trnH sequences may be due to effects of the abundance of ancestral haplotype sharing and the presence of private haplotypes fixed for each population. Furthermore, the results revealed almost the same level of genetic diversity in comparison with Yemeni accessions, in which Saudi accessions were sharing three haplotypes from the four haplotypes found in Yemeni accessions. (author)

  3. Designing a Bioengine for Detection and Analysis of Base String on an Affected Sequence in High-Concentration Regions

    Directory of Open Access Journals (Sweden)

    Debnath Bhattacharyya

    2013-01-01

    Full Text Available We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant as well as query sequence (virus. Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size. This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length.

  4. Designing a Bioengine for Detection and Analysis of Base String on an Affected Sequence in High-Concentration Regions

    Science.gov (United States)

    Mandal, Bijoy Kumar; Kim, Tai-hoon

    2013-01-01

    We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant) as well as query sequence (virus). Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size). This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length. PMID:24000321

  5. Sequencing of emerging canine distemper virus strain reveals new distinct genetic lineage in the United States associated with disease in wildlife and domestic canine populations.

    Science.gov (United States)

    Riley, Matthew C; Wilkes, Rebecca P

    2015-12-18

    Recent outbreaks of canine distemper have prompted examination of strains from clinical samples submitted to the University of Tennessee College of Veterinary Medicine (UTCVM) Clinical Virology Lab. We previously described a new strain of CDV that significantly diverged from all genotypes reported to date including America 2, the genotype proposed to be the main lineage currently circulating in the US. The aim of this study was to determine when this new strain appeared and how widespread it is in animal populations, given that it has also been detected in fully vaccinated adult dogs. Additionally, we sequenced complete viral genomes to characterize the strain and determine if variation is confined to known variable regions of the genome or if the changes are also present in more conserved regions. Archived clinical samples were genotyped using real-time RT-PCR amplification and sequencing. The genomes of two unrelated viruses from a dog and fox each from a different state were sequenced and aligned with previously published genomes. Phylogenetic analysis was performed using coding, non-coding and genome-length sequences. Virus neutralization assays were used to evaluate potential antigenic differences between this strain and a vaccine strain and mixed ANOVA test was used to compare the titers. Genotyping revealed this strain first appeared in 2011 and was detected in dogs from multiple states in the Southeast region of the United States. It was the main strain detected among the clinical samples that were typed from 2011-2013, including wildlife submissions. Genome sequencing demonstrated that it is highly conserved within a new lineage and preliminary serologic testing showed significant differences in neutralizing antibody titers between this strain and the strain commonly used in vaccines. This new strain represents an emerging CDV in domestic dogs in the US, may be associated with a stable reservoir in the wildlife population, and could facilitate vaccine

  6. An integrated tool to study MHC region: accurate SNV detection and HLA genes typing in human MHC region using targeted high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Hongzhi Cao

    Full Text Available The major histocompatibility complex (MHC is one of the most variable and gene-dense regions of the human genome. Most studies of the MHC, and associated regions, focus on minor variants and HLA typing, many of which have been demonstrated to be associated with human disease susceptibility and metabolic pathways. However, the detection of variants in the MHC region, and diagnostic HLA typing, still lacks a coherent, standardized, cost effective and high coverage protocol of clinical quality and reliability. In this paper, we presented such a method for the accurate detection of minor variants and HLA types in the human MHC region, using high-throughput, high-coverage sequencing of target regions. A probe set was designed to template upon the 8 annotated human MHC haplotypes, and to encompass the 5 megabases (Mb of the extended MHC region. We deployed our probes upon three, genetically diverse human samples for probe set evaluation, and sequencing data show that ∼97% of the MHC region, and over 99% of the genes in MHC region, are covered with sufficient depth and good evenness. 98% of genotypes called by this capture sequencing prove consistent with established HapMap genotypes. We have concurrently developed a one-step pipeline for calling any HLA type referenced in the IMGT/HLA database from this target capture sequencing data, which shows over 96% typing accuracy when deployed at 4 digital resolution. This cost-effective and highly accurate approach for variant detection and HLA typing in the MHC region may lend further insight into immune-mediated diseases studies, and may find clinical utility in transplantation medicine research. This one-step pipeline is released for general evaluation and use by the scientific community.

  7. Sequences within both the 5' untranslated region and the Gag gene are important for efficient encapsidation of Mason-Pfizer monkey virus RNA

    International Nuclear Information System (INIS)

    Schmidt, Russell D.; Mustafa, Farah; Lew, Kathy A.; Browning, Mathew T.; Rizvi, Tahir A.

    2003-01-01

    It has previously been shown that the 5' untranslated leader region (UTR), including about 495 bp of the gag gene, is sufficient for the efficient encapsidation and propagation of Mason-Pfizer monkey virus (MPMV) based retroviral vectors. In addition, a deletion upstream of the major splice donor, SD, has been shown to adversely affect MPMV RNA packaging. However, the precise sequence requirement for the encapsidation of MPMV genomic RNA within the 5' UTR and gag remains largely unknown. In this study, we have used a systematic deletion analysis of the 5' UTR and gag gene to define the cis-acting sequences responsible for efficient MPMV RNA packaging. Using an in vivo packaging and transduction assay, our results reveal that the MPMV packaging signal is primarily found within the first 30 bp immediately downstream of the primer binding site. However, its function is dependent upon the presence of the last 23 bp of the 5' UTR and approximately the first 100 bp of the gag gene. Thus, sequences that affect MPMV RNA packaging seem to reside both upstream and downstream of the major splice donor with the downstream region responsible for the efficient functioning of the upstream primary packaging determinant

  8. Characterization of Campylobacter jejuni applying flaA short variable region sequencing, multilocus sequencing and Fourier transform infrared spectroscopy

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hartmann; Bonnichsen, Lise; Larsson, Jonas

    flaA short variable region sequencing and phenetic Fourier transform infrared (FTIR) spectroscopy was applied on a collection of 102 Campylobacter jejuni isolated from continuous sampling of organic, free range geese and chickens. FTIR has been shown to serve as a valuable tool in typing...

  9. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Energy Technology Data Exchange (ETDEWEB)

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

    1988-07-25

    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  10. NMR studies of the fifth transmembrane segment of Na+,K+-ATPase reveals a non-helical ion-binding region

    DEFF Research Database (Denmark)

    Underhaug, Jarl; Jakobsen, Louise Odgaard; Esmann, Mikael

    2006-01-01

    The structure of a synthetic peptide corresponding to the fifth membrane-spanning segment (M5) in Na(+),K(+)-ATPase in sodium dodecyl sulfate (SDS) micelles was determined using liquid-state nuclear magnetic resonance (NMR) spectroscopy. The spectra reveal that this peptide is substantially less...... transmembrane element of the Ca(2+)-ATPase. Furthermore, this region spans the residues implicated in Na(+) and K(+) transport, where they are likely to offer the flexibility needed to coordinate Na(+) as well as K(+) during active transport....... alpha-helical than the corresponding M5 peptide of Ca(2+)-ATPase. A well-defined alpha-helix is shown in the C-terminal half of the peptide. Apart from a short helical stretch at the N-terminus, the N-terminal half contains a non-helical region with two proline residues and sequence similarity to a non-structured...

  11. High genetic diversity in the coat protein and 3' untranslated regions

    Indian Academy of Sciences (India)

    The 3′ terminal region consisting of the coat protein (CP) coding sequence and 3′ untranslated region (3′UTR) was cloned and sequenced from seven isolates. Sequence comparisons revealed considerable genetic diversity among the isolates in their CP and 3′UTR, making CdMV one of the highly variable members ...

  12. Sequence organization and control of transcription in the bacteriophage T4 tRNA region.

    Science.gov (United States)

    Broida, J; Abelson, J

    1985-10-05

    Bacteriophage T4 contains genes for eight transfer RNAs and two stable RNAs of unknown function. These are found in two clusters at 70 X 10(3) base-pairs on the T4 genetic map. To understand the control of transcription in this region we have completed the sequencing of 5000 base-pairs in this region. The sequence contains a part of gene 3, gene 1, gene 57, internal protein I, the tRNA genes and five open reading frames which most likely code for heretofore unidentified proteins. We have used subclones of the region to investigate the kinetics of transcription in vivo. The results show that transcription in this region consists of overlapping early, middle and late transcripts. Transcription is directed from two early promoters, one or two middle promoters and perhaps two late promoters. This region contains all of the features that are seen in T4 transcription and as such is a good place to study the phenomenon in more detail.

  13. Whole-genome sequencing reveals mutational landscape underlying phenotypic differences between two widespread Chinese cattle breeds.

    Directory of Open Access Journals (Sweden)

    Yao Xu

    Full Text Available Whole-genome sequencing provides a powerful tool to obtain more genetic variability that could produce a range of benefits for cattle breeding industry. Nanyang (Bos indicus and Qinchuan (Bos taurus are two important Chinese indigenous cattle breeds with distinct phenotypes. To identify the genetic characteristics responsible for variation in phenotypes between the two breeds, in the present study, we for the first time sequenced the genomes of four Nanyang and four Qinchuan cattle with 10 to 12 fold on average of 97.86% and 98.98% coverage of genomes, respectively. Comparison with the Bos_taurus_UMD_3.1 reference assembly yielded 9,010,096 SNPs for Nanyang, and 6,965,062 for Qinchuan cattle, 51% and 29% of which were novel SNPs, respectively. A total of 154,934 and 115,032 small indels (1 to 3 bp were found in the Nanyang and Qinchuan genomes, respectively. The SNP and indel distribution revealed that Nanyang showed a genetically high diversity as compared to Qinchuan cattle. Furthermore, a total of 2,907 putative cases of copy number variation (CNV were identified by aligning Nanyang to Qinchuan genome, 783 of which (27% encompassed the coding regions of 495 functional genes. The gene ontology (GO analysis revealed that many CNV genes were enriched in the immune system and environment adaptability. Among several CNV genes related to lipid transport and fat metabolism, Lepin receptor gene (LEPR overlapping with CNV_1815 showed remarkably higher copy number in Qinchuan than Nanyang (log2 (ratio = -2.34988; P value = 1.53E-102. Further qPCR and association analysis investigated that the copy number of the LEPR gene presented positive correlations with transcriptional expression and phenotypic traits, suggesting the LEPR CNV may contribute to the higher fat deposition in muscles of Qinchuan cattle. Our findings provide evidence that the distinct phenotypes of Nanyang and Qinchuan breeds may be due to the different genetic variations including SNPs

  14. Genome sequence of the acid-tolerant Desulfovibrio sp. DV isolated from the sediments of a Pb-Zn mine tailings dam in the Chita region, Russia

    Directory of Open Access Journals (Sweden)

    Anastasiia Kovaliova

    2017-03-01

    Full Text Available Here we report the draft genome sequence of the acid-tolerant Desulfovibrio sp. DV isolated from the sediments of a Pb-Zn mine tailings dam in the Chita region, Russia. The draft genome has a size of 4.9 Mb and encodes multiple K+-transporters and proton-consuming decarboxylases. The phylogenetic analysis based on concatenated ribosomal proteins revealed that strain DV clusters together with the acid-tolerant Desulfovibrio sp. TomC and Desulfovibrio magneticus. The draft genome sequence and annotation have been deposited at GenBank under the accession number MLBG00000000.

  15. Analysis of HIV-1 intersubtype recombination breakpoints suggests region with high pairing probability may be a more fundamental factor than sequence similarity affecting HIV-1 recombination.

    Science.gov (United States)

    Jia, Lei; Li, Lin; Gui, Tao; Liu, Siyang; Li, Hanping; Han, Jingwan; Guo, Wei; Liu, Yongjian; Li, Jingyun

    2016-09-21

    With increasing data on HIV-1, a more relevant molecular model describing mechanism details of HIV-1 genetic recombination usually requires upgrades. Currently an incomplete structural understanding of the copy choice mechanism along with several other issues in the field that lack elucidation led us to perform an analysis of the correlation between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarity to further explore structural mechanisms. Near full length sequences of URFs from Asia, Europe, and Africa (one sequence/patient), and representative sequences of worldwide CRFs were retrieved from the Los Alamos HIV database. Their recombination patterns were analyzed by jpHMM in detail. Then the relationships between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarities were investigated. Pearson correlation test showed that all URF groups and the CRF group exhibit the same breakpoint distribution pattern. Additionally, the Wilcoxon two-sample test indicated a significant and inexplicable limitation of recombination in regions with high pairing probability. These regions have been found to be strongly conserved across distinct biological states (i.e., strong intersubtype similarity), and genetic similarity has been determined to be a very important factor promoting recombination. Thus, the results revealed an unexpected disagreement between intersubtype similarity and breakpoint distribution, which were further confirmed by genetic similarity analysis. Our analysis reveals a critical conflict between results from natural HIV-1 isolates and those from HIV-1-based assay vectors in which genetic similarity has been shown to be a very critical factor promoting recombination. These results indicate the region with high-pairing probabilities may be a more fundamental factor affecting HIV-1 recombination than sequence similarity in natural HIV-1 infections. Our

  16. Geographic structure and demographic history of Iranian brown bear (Ursus arctos based on mtDNA control region sequences

    Directory of Open Access Journals (Sweden)

    Mohammad Reza Ashrafzadeh

    2015-12-01

    Full Text Available In recent years, the brown bear's range has declined and its populations in some areas have faced extinction. Therefore, to have a comprehensive picture of genetic diversity and geographic structure of populations is essential for effective conservation strategies. In this research, we sequenced a 271bp segment of mtDNA control region of seven Iranian brown bears, where a total dataset of 467 sequences (brown and polar bears were used in analyses. Overall, 113 different haplotypes and 77 polymorphic sites were identified within the segment. Based on phylogenetic analyses, Iranian brown bears were not nested in any other clades. The low values of Nm (range=0.014-0.187 and high values of Fst (range=0.728-0.972 among Iranian bears and others revealed a genetically significant differentiation. We aren't found any significant signal of demographic reduction in Iranian bears. The time to the most recent common ancestor of Iranian brown bears (Northern Iran was found to be around 19000 BP.

  17. Mouse tetranectin: cDNA sequence, tissue-specific expression, and chromosomal mapping

    DEFF Research Database (Denmark)

    Ibaraki, K; Kozak, C A; Wewer, U M

    1995-01-01

    regulation, mouse tetranectin cDNA was cloned from a 16-day-old mouse embryo library. Sequence analysis revealed a 992-bp cDNA with an open reading frame of 606 bp, which is identical in length to the human tetranectin cDNA. The deduced amino acid sequence showed high homology to the human cDNA with 76......(s) of tetranectin. The sequence analysis revealed a difference in both sequence and size of the noncoding regions between mouse and human cDNAs. Northern analysis of the various tissues from mouse, rat, and cow showed the major transcript(s) to be approximately 1 kb, which is similar in size to that observed...

  18. Some maternal lineages of domestic horses may have origins in East Asia revealed with further evidence of mitochondrial genomes and HVR-1 sequences

    Directory of Open Access Journals (Sweden)

    Hongying Ma

    2018-06-01

    Full Text Available Objectives There are large populations of indigenous horse (Equus caballus in China and some other parts of East Asia. However, their matrilineal genetic diversity and origin remained poorly understood. Using a combination of mitochondrial DNA (mtDNA and hypervariable region (HVR-1 sequences, we aim to investigate the origin of matrilineal inheritance in these domestic horses. Methods To investigate patterns of matrilineal inheritance in domestic horses, we conducted a phylogenetic study using 31 de novo mtDNA genomes together with 317 others from the GenBank. In terms of the updated phylogeny, a total of 5,180 horse mitochondrial HVR-1 sequences were analyzed. Results Eightteen haplogroups (Aw-Rw were uncovered from the analysis of the whole mitochondrial genomes. Most of which have a divergence time before the earliest domestication of wild horses (about 5,800 years ago and during the Upper Paleolithic (35–10 KYA. The distribution of some haplogroups shows geographic patterns. The Lw haplogroup contained a significantly higher proportion of European horses than the horses from other regions, while haplogroups Jw, Rw, and some maternal lineages of Cw, have a higher frequency in the horses from East Asia. The 5,180 sequences of horse mitochondrial HVR-1 form nine major haplogroups (A-I. We revealed a corresponding relationship between the haplotypes of HVR-1 and those of whole mitochondrial DNA sequences. The data of the HVR-1 sequences also suggests that Jw, Rw, and some haplotypes of Cw may have originated in East Asia while Lw probably formed in Europe. Conclusions Our study supports the hypothesis of the multiple origins of the maternal lineage of domestic horses and some maternal lineages of domestic horses may have originated from East Asia.

  19. WeederH: an algorithm for finding conserved regulatory motifs and regions in homologous sequences

    Directory of Open Access Journals (Sweden)

    Pesole Graziano

    2007-02-01

    Full Text Available Abstract Background This work addresses the problem of detecting conserved transcription factor binding sites and in general regulatory regions through the analysis of sequences from homologous genes, an approach that is becoming more and more widely used given the ever increasing amount of genomic data available. Results We present an algorithm that identifies conserved transcription factor binding sites in a given sequence by comparing it to one or more homologs, adapting a framework we previously introduced for the discovery of sites in sequences from co-regulated genes. Differently from the most commonly used methods, the approach we present does not need or compute an alignment of the sequences investigated, nor resorts to descriptors of the binding specificity of known transcription factors. The main novel idea we introduce is a relative measure of conservation, assuming that true functional elements should present a higher level of conservation with respect to the rest of the sequence surrounding them. We present tests where we applied the algorithm to the identification of conserved annotated sites in homologous promoters, as well as in distal regions like enhancers. Conclusion Results of the tests show how the algorithm can provide fast and reliable predictions of conserved transcription factor binding sites regulating the transcription of a gene, with better performances than other available methods for the same task. We also show examples on how the algorithm can be successfully employed when promoter annotations of the genes investigated are missing, or when regulatory sites and regions are located far away from the genes.

  20. Deep Sequencing Reveals the Complete Genome and Evidence for Transcriptional Activity of the First Virus-Like Sequences Identified in Aristotelia chilensis (Maqui Berry

    Directory of Open Access Journals (Sweden)

    Javier Villacreses

    2015-04-01

    Full Text Available Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1. High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs: ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV, Petuvirus genus. ORF1 encodes a movement protein (MP; ORF2 a Reverse Transcriptase (RT and a Ribonuclease H (RNase H domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs, AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq. Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant.

  1. A new method for detecting signal regions in ordered sequences of real numbers, and application to viral genomic data.

    Science.gov (United States)

    Gog, Julia R; Lever, Andrew M L; Skittrall, Jordan P

    2018-01-01

    We present a fast, robust and parsimonious approach to detecting signals in an ordered sequence of numbers. Our motivation is in seeking a suitable method to take a sequence of scores corresponding to properties of positions in virus genomes, and find outlying regions of low scores. Suitable statistical methods without using complex models or making many assumptions are surprisingly lacking. We resolve this by developing a method that detects regions of low score within sequences of real numbers. The method makes no assumptions a priori about the length of such a region; it gives the explicit location of the region and scores it statistically. It does not use detailed mechanistic models so the method is fast and will be useful in a wide range of applications. We present our approach in detail, and test it on simulated sequences. We show that it is robust to a wide range of signal morphologies, and that it is able to capture multiple signals in the same sequence. Finally we apply it to viral genomic data to identify regions of evolutionary conservation within influenza and rotavirus.

  2. Sequence analysis of the canine mitochondrial DNA control region from shed hair samples in criminal investigations.

    Science.gov (United States)

    Berger, C; Berger, B; Parson, W

    2012-01-01

    In recent years, evidence from domestic dogs has increasingly been analyzed by forensic DNA testing. Especially, canine hairs have proved most suitable and practical due to the high rate of hair transfer occurring between dogs and humans. Starting with the description of a contamination-free sample handling procedure, we give a detailed workflow for sequencing hypervariable segments (HVS) of the mtDNA control region from canine evidence. After the hair material is lysed and the DNA extracted by Phenol/Chloroform, the amplification and sequencing strategy comprises the HVS I and II of the canine control region and is optimized for DNA of medium-to-low quality and quantity. The sequencing procedure is based on the Sanger Big-dye deoxy-terminator method and the separation of the sequencing reaction products is performed on a conventional multicolor fluorescence detection capillary electrophoresis platform. Finally, software-aided base calling and sequence interpretation are addressed exemplarily.

  3. Classic selective sweeps revealed by massive sequencing in cattle.

    Directory of Open Access Journals (Sweden)

    Saber Qanbari

    2014-02-01

    Full Text Available Human driven selection during domestication and subsequent breed formation has likely left detectable signatures within the genome of modern cattle. The elucidation of these signatures of selection is of interest from the perspective of evolutionary biology, and for identifying domestication-related genes that ultimately may help to further genetically improve this economically important animal. To this end, we employed a panel of more than 15 million autosomal SNPs identified from re-sequencing of 43 Fleckvieh animals. We mainly applied two somewhat complementary statistics, the integrated Haplotype Homozygosity Score (iHS reflecting primarily ongoing selection, and the Composite of Likelihood Ratio (CLR having the most power to detect completed selection after fixation of the advantageous allele. We find 106 candidate selection regions, many of which are harboring genes related to phenotypes relevant in domestication, such as coat coloring pattern, neurobehavioral functioning and sensory perception including KIT, MITF, MC1R, NRG4, Erbb4, TMEM132D and TAS2R16, among others. To further investigate the relationship between genes with signatures of selection and genes identified in QTL mapping studies, we use a sample of 3062 animals to perform four genome-wide association analyses using appearance traits, body size and somatic cell count. We show that regions associated with coat coloring significantly (P<0.0001 overlap with the candidate selection regions, suggesting that the selection signals we identify are associated with traits known to be affected by selection during domestication. Results also provide further evidence regarding the complexity of the genetics underlying coat coloring in cattle. This study illustrates the potential of population genetic approaches for identifying genomic regions affecting domestication-related phenotypes and further helps to identify specific regions targeted by selection during speciation, domestication and

  4. Prevalence of Hepatitis C Virus Subgenotypes 1a and 1b in Japanese Patients: Ultra-Deep Sequencing Analysis of HCV NS5B Genotype-Specific Region

    Science.gov (United States)

    Wu, Shuang; Kanda, Tatsuo; Nakamoto, Shingo; Jiang, Xia; Miyamura, Tatsuo; Nakatani, Sueli M.; Ono, Suzane Kioko; Takahashi-Nakaguchi, Azusa; Gonoi, Tohru; Yokosuka, Osamu

    2013-01-01

    Background Hepatitis C virus (HCV) subgenotypes 1a and 1b have different impacts on the treatment response to peginterferon plus ribavirin with direct-acting antivirals (DAAs) against patients infected with HCV genotype 1, as the emergence rates of resistance mutations are different between these two subgenotypes. In Japan, almost all of HCV genotype 1 belongs to subgenotype 1b. Methods and Findings To determine HCV subgenotype 1a or 1b in Japanese patients infected with HCV genotype 1, real-time PCR-based method and Sanger method were used for the HCV NS5B region. HCV subgenotypes were determined in 90% by real-time PCR-based method. We also analyzed the specific probe regions for HCV subgenotypes 1a and 1b using ultra-deep sequencing, and uncovered mutations that could not be revealed using direct-sequencing by Sanger method. We estimated the prevalence of HCV subgenotype 1a as 1.2-2.5% of HCV genotype 1 patients in Japan. Conclusions Although real-time PCR-based HCV subgenotyping method seems fair for differentiating HCV subgenotypes 1a and 1b, it may not be sufficient for clinical practice. Ultra-deep sequencing is useful for revealing the resistant strain(s) of HCV before DAA treatment as well as mixed infection with different genotypes or subgenotypes of HCV. PMID:24069214

  5. Targeted sequencing reveals low-frequency variants in EPHA genes as markers of paclitaxel-induced peripheral neuropathy.

    OpenAIRE

    Apellániz-Ruiz, Maria; Tejero, Héctor; Inglada-Pérez, Lucía; Sánchez-Barroso, Lara; Gutiérrez-Gutiérrez, Gerardo; Calvo, Isabel; Castelo, Beatriz; Redondo, Andrés; García-Donás, Jesus; Romero-Laorden, Nuria; Sereno, Maria; Merino, María; Currás-Freixes, Maria; Montero-Conde, Cristina; Mancikova, Veronika

    2017-01-01

    PURPOSE: Neuropathy is the dose limiting toxicity of paclitaxel and a major cause for decreased quality of life. Genetic factors have been shown to contribute to paclitaxel neuropathy susceptibility; however, the major causes for inter-individual differences remain unexplained. In this study we identified genetic markers associated with paclitaxel-induced neuropathy through massive sequencing of candidate genes. EXPERIMENTAL DESIGN: We sequenced the coding region of 4 EPHA genes, 5 genes invo...

  6. Entropic fluctuations in DNA sequences

    Science.gov (United States)

    Thanos, Dimitrios; Li, Wentian; Provata, Astero

    2018-03-01

    The Local Shannon Entropy (LSE) in blocks is used as a complexity measure to study the information fluctuations along DNA sequences. The LSE of a DNA block maps the local base arrangement information to a single numerical value. It is shown that despite this reduction of information, LSE allows to extract meaningful information related to the detection of repetitive sequences in whole chromosomes and is useful in finding evolutionary differences between organisms. More specifically, large regions of tandem repeats, such as centromeres, can be detected based on their low LSE fluctuations along the chromosome. Furthermore, an empirical investigation of the appropriate block sizes is provided and the relationship of LSE properties with the structure of the underlying repetitive units is revealed by using both computational and mathematical methods. Sequence similarity between the genomic DNA of closely related species also leads to similar LSE values at the orthologous regions. As an application, the LSE covariance function is used to measure the evolutionary distance between several primate genomes.

  7. In Silico Characterization of Pectate Lyase Protein Sequences from Different Source Organisms

    Directory of Open Access Journals (Sweden)

    Amit Kumar Dubey

    2010-01-01

    Full Text Available A total of 121 protein sequences of pectate lyases were subjected to homology search, multiple sequence alignment, phylogenetic tree construction, and motif analysis. The phylogenetic tree constructed revealed different clusters based on different source organisms representing bacterial, fungal, plant, and nematode pectate lyases. The multiple accessions of bacterial, fungal, nematode, and plant pectate lyase protein sequences were placed closely revealing a sequence level similarity. The multiple sequence alignment of these pectate lyase protein sequences from different source organisms showed conserved regions at different stretches with maximum homology from amino acid residues 439–467, 715–816, and 829–910 which could be used for designing degenerate primers or probes specific for pectate lyases. The motif analysis revealed a conserved Pec_Lyase_C domain uniformly observed in all pectate lyases irrespective of variable sources suggesting its possible role in structural and enzymatic functions.

  8. The complete chloroplast genome sequence of Mahonia bealei (Berberidaceae) reveals a significant expansion of the inverted repeat and phylogenetic relationship with other angiosperms.

    Science.gov (United States)

    Ma, Ji; Yang, Bingxian; Zhu, Wei; Sun, Lianli; Tian, Jingkui; Wang, Xumin

    2013-10-10

    Mahonia bealei (Berberidaceae) is a frequently-used traditional Chinese medicinal plant with efficient anti-inflammatory ability. This plant is one of the sources of berberine, a new cholesterol-lowering drug with anti-diabetic activity. We have sequenced the complete nucleotide sequence of the chloroplast (cp) genome of M. bealei. The complete cp genome of M. bealei is 164,792 bp in length, and has a typical structure with large (LSC 73,052 bp) and small (SSC 18,591 bp) single-copy regions separated by a pair of inverted repeats (IRs 36,501 bp) of large size. The Mahonia cp genome contains 111 unique genes and 39 genes are duplicated in the IR regions. The gene order and content of M. bealei are almost unarranged which is consistent with the hypothesis that large IRs stabilize cp genome and reduce gene loss-and-gain probabilities during evolutionary process. A large IR expansion of over 12 kb has occurred in M. bealei, 15 genes (rps19, rpl22, rps3, rpl16, rpl14, rps8, infA, rpl36, rps11, petD, petB, psbH, psbN, psbT and psbB) have expanded to have an additional copy in the IRs. The IR expansion rearrangement occurred via a double-strand DNA break and subsequence repair, which is different from the ordinary gene conversion mechanism. Repeat analysis identified 39 direct/inverted repeats 30 bp or longer with a sequence identity ≥ 90%. Analysis also revealed 75 simple sequence repeat (SSR) loci and almost all are composed of A or T, contributing to a distinct bias in base composition. Comparison of protein-coding sequences with ESTs reveals 9 putative RNA edits and 5 of them resulted in non-synonymous modifications in rpoC1, rps2, rps19 and ycf1. Phylogenetic analysis using maximum parsimony (MP) and maximum likelihood (ML) was performed on a dataset composed of 65 protein-coding genes from 25 taxa, which yields an identical tree topology as previous plastid-based trees, and provides strong support for the sister relationship between Ranunculaceae and Berberidaceae

  9. First full-length genome sequence of the polerovirus luffa aphid-borne yellows virus (LABYV) reveals the presence of at least two consensus sequences in an isolate from Thailand.

    Science.gov (United States)

    Knierim, Dennis; Maiss, Edgar; Kenyon, Lawrence; Winter, Stephan; Menzel, Wulf

    2015-10-01

    Luffa aphid-borne yellows virus (LABYV) was proposed as the name for a previously undescribed polerovirus based on partial genome sequences obtained from samples of cucurbit plants collected in Thailand between 2008 and 2013. In this study, we determined the first full-length genome sequence of LABYV. Based on phylogenetic analysis and genome properties, it is clear that this virus represents a distinct species in the genus Polerovirus. Analysis of sequences from sample TH24, which was collected in 2010 from a luffa plant in Thailand, reveals the presence of two different full-length genome consensus sequences.

  10. Mitochondrial DNA reveals regional and interregional importance of the central Mediterranean African shelf for loggerhead sea turtles (Caretta caretta

    Directory of Open Access Journals (Sweden)

    Paolo Casale

    2008-09-01

    Full Text Available The wide north African continental shelf in the central Mediterranean is known to be one of the few important areas in the basin for loggerhead turtles in the neritic stage. In order to assess the origin of these turtles, sequences of the mtDNA control region were obtained from 70 turtles caught by bottom trawlers in the area, and compared with known sequences from turtles from Mediterranean and Atlantic nesting sites. Five haplotypes were identified (Haplotype diversity = 0.262; nucleotide diversity = 5.4×10-3. Specific haplotypes indicate contributions from distant rookeries such as Turkey and the Atlantic, which shows that Atlantic turtles entering the Mediterranean while in the oceanic phase use at least one Mediterranean continental shelf as a neritic foraging ground. A new haplotype and another one previously found only in foraging areas, highlight the genetic information gaps for nesting sites, which undermine powerful mixed stock analyses. Despite these limitations, the results reveal the regional importance of the study area as a neritic foraging ground for turtles that are probably from most of the Mediterranean nesting aggregates. Therefore, reducing turtle mortality resulting from the high fishing effort in the area should be regarded as key for Mediterranean turtle conservation and is also possibly important for Atlantic populations.

  11. Phylogenetic and genome-wide deep-sequencing analyses of canine parvovirus reveal co-infection with field variants and emergence of a recent recombinant strain.

    Directory of Open Access Journals (Sweden)

    Ruben Pérez

    Full Text Available Canine parvovirus (CPV, a fast-evolving single-stranded DNA virus, comprises three antigenic variants (2a, 2b, and 2c with different frequencies and genetic variability among countries. The contribution of co-infection and recombination to the genetic variability of CPV is far from being fully elucidated. Here we took advantage of a natural CPV population, recently formed by the convergence of divergent CPV-2c and CPV-2a strains, to study co-infection and recombination. Complete sequences of the viral coding region of CPV-2a and CPV-2c strains from 40 samples were generated and analyzed using phylogenetic tools. Two samples showed co-infection and were further analyzed by deep sequencing. The sequence profile of one of the samples revealed the presence of CPV-2c and CPV-2a strains that differed at 29 nucleotides. The other sample included a minor CPV-2a strain (13.3% of the viral population and a major recombinant strain (86.7%. The recombinant strain arose from inter-genotypic recombination between CPV-2c and CPV-2a strains within the VP1/VP2 gene boundary. Our findings highlight the importance of deep-sequencing analysis to provide a better understanding of CPV molecular diversity.

  12. Phylogenetic and Genome-Wide Deep-Sequencing Analyses of Canine Parvovirus Reveal Co-Infection with Field Variants and Emergence of a Recent Recombinant Strain

    Science.gov (United States)

    Pérez, Ruben; Calleros, Lucía; Marandino, Ana; Sarute, Nicolás; Iraola, Gregorio; Grecco, Sofia; Blanc, Hervé; Vignuzzi, Marco; Isakov, Ofer; Shomron, Noam; Carrau, Lucía; Hernández, Martín; Francia, Lourdes; Sosa, Katia; Tomás, Gonzalo; Panzera, Yanina

    2014-01-01

    Canine parvovirus (CPV), a fast-evolving single-stranded DNA virus, comprises three antigenic variants (2a, 2b, and 2c) with different frequencies and genetic variability among countries. The contribution of co-infection and recombination to the genetic variability of CPV is far from being fully elucidated. Here we took advantage of a natural CPV population, recently formed by the convergence of divergent CPV-2c and CPV-2a strains, to study co-infection and recombination. Complete sequences of the viral coding region of CPV-2a and CPV-2c strains from 40 samples were generated and analyzed using phylogenetic tools. Two samples showed co-infection and were further analyzed by deep sequencing. The sequence profile of one of the samples revealed the presence of CPV-2c and CPV-2a strains that differed at 29 nucleotides. The other sample included a minor CPV-2a strain (13.3% of the viral population) and a major recombinant strain (86.7%). The recombinant strain arose from inter-genotypic recombination between CPV-2c and CPV-2a strains within the VP1/VP2 gene boundary. Our findings highlight the importance of deep-sequencing analysis to provide a better understanding of CPV molecular diversity. PMID:25365348

  13. Phylogenetic relations of humans and African apes from DNA sequences in the Psi eta-globin region

    Energy Technology Data Exchange (ETDEWEB)

    Miyamoto, M.M.; Slightom, J.L.; Goodman, M.

    1987-10-16

    Sequences from the upstream and downstream flanking DNA regions of the Psi eta-globin locus in Pan troglodytes (common chimpanzee), Gorilla gorilla (gorilla), and Pongo pygmaeus (orangutan, the closest living relative to Homo, Pan, and Gorilla) provided further data for evaluating the phylogenetic relations of humans and African apes. These newly sequenced orthologs (an additional 4.9 kilobase pairs (kbp) for each species) were combined with published Psi eta-gene sequences and then compared to the same orthologous stretch (a continuous 7.1-kbp region) available for humans. Phylogenetic analysis of these nucleotide sequences by the parsimony method indicated (i) that human and chimpanzee are more closely related to each other than either is to gorilla and (ii) that the slowdown in the rate of sequence evolution evident in higher primates is especially pronounced in humans. These results indicate that features unique to African apes (but not to humans) are primitive and that even local molecular clocks should be applied with caution.

  14. Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

    Directory of Open Access Journals (Sweden)

    Michael H. Kohn

    2008-01-01

    Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

  15. RNA-Sequencing Reveals Unique Transcriptional Signatures of Running and Running-Independent Environmental Enrichment in the Adult Mouse Dentate Gyrus.

    Science.gov (United States)

    Grégoire, Catherine-Alexandra; Tobin, Stephanie; Goldenstein, Brianna L; Samarut, Éric; Leclerc, Andréanne; Aumont, Anne; Drapeau, Pierre; Fulton, Stephanie; Fernandes, Karl J L

    2018-01-01

    Environmental enrichment (EE) is a powerful stimulus of brain plasticity and is among the most accessible treatment options for brain disease. In rodents, EE is modeled using multi-factorial environments that include running, social interactions, and/or complex surroundings. Here, we show that running and running-independent EE differentially affect the hippocampal dentate gyrus (DG), a brain region critical for learning and memory. Outbred male CD1 mice housed individually with a voluntary running disk showed improved spatial memory in the radial arm maze compared to individually- or socially-housed mice with a locked disk. We therefore used RNA sequencing to perform an unbiased interrogation of DG gene expression in mice exposed to either a voluntary running disk (RUN), a locked disk (LD), or a locked disk plus social enrichment and tunnels [i.e., a running-independent complex environment (CE)]. RNA sequencing revealed that RUN and CE mice showed distinct, non-overlapping patterns of transcriptomic changes versus the LD control. Bio-informatics uncovered that the RUN and CE environments modulate separate transcriptional networks, biological processes, cellular compartments and molecular pathways, with RUN preferentially regulating synaptic and growth-related pathways and CE altering extracellular matrix-related functions. Within the RUN group, high-distance runners also showed selective stress pathway alterations that correlated with a drastic decline in overall transcriptional changes, suggesting that excess running causes a stress-induced suppression of running's genetic effects. Our findings reveal stimulus-dependent transcriptional signatures of EE on the DG, and provide a resource for generating unbiased, data-driven hypotheses for novel mediators of EE-induced cognitive changes.

  16. Molecular cloning and construction of the coding region for human acetylcholinesterase reveals a G + C-rich attenuating structure

    International Nuclear Information System (INIS)

    Soreq, H.; Ben-Aziz, R.; Prody, C.A.; Seidman, S.; Gnatt, A.; Neville, L.; Lieman-Hurwitz, J.; Lev-Lehman, E.; Ginzberg, D.; Lapidot-Lifson, Y.; Zakut, H.

    1990-01-01

    To study the primary structure of human acetylcholinesterase and its gene expression and amplification, cDNA libraries from human tissues expressing oocyte-translatable AcChoEase mRNA were constructed and screened with labeled oligodeoxynucleotide probes. Several cDNA clones were isolated that encoded a polypeptide with ≥50% identically aligned amino acids to Torpedo AcChoEase and human butyrylcholinesterase. However, these cDNA clones were all truncated within a 300-nucleotide-long G + C-rich region with a predicted pattern of secondary structure having a high Gibbs free energy downstream from the expected 5' end of the coding region. Screening of a genomic DNA library revealed the missing 5' domain. When ligated to the cDNA and constructed into a transcription vector, this sequence encoded a synthetic mRNA translated in microinjected oocytes into catalytically active AcChoEase with marked preference for acetylthiocholine over butyrylthiocholine as a substrate, susceptibility to inhibition by the AcChoEase inhibitor BW284C51, and resistance to the AcChoEase inhibitor tetraisopropylpyrophosphoramide. Blot hybridization of genomic DNA from different individuals carrying amplified AcChoEase genes revealed variable intensities and restriction patterns with probes from the regions upstream and downstream from the predicted G + C-rich structure. Thus, the human AcChoEase gene includes a putative G + C-rich attenuator domain and is subject to structural alterations in cases of AcChoEase gene amplification

  17. Two tandemly repeated telomere-associated sequences in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Chen, C M; Wang, C T; Wang, C J; Ho, C H; Kao, Y Y; Chen, C C

    1997-12-01

    Two tandemly repeated telomere-associated sequences, NP3R and NP4R, have been isolated from Nicotiana plumbaginifolia. The length of a repeating unit for NP3R and NP4R is 165 and 180 nucleotides respectively. The abundance of NP3R, NP4R and telomeric repeats is, respectively, 8.4 x 10(4), 6 x 10(3) and 1.5 x 10(6) copies per haploid genome of N. plumbaginifolia. Fluorescence in situ hybridization revealed that NP3R is located at the ends and/or in interstitial regions of all 10 chromosomes and NP4R on the terminal regions of three chromosomes in the haploid genome of N. plumbaginifolia. Sequence homology search revealed that not only are NP3R and NP4R homologous to HRS60 and GRS, respectively, two tandem repeats isolated from N. tabacum, but that NP3R and NP4R are also related to each other, suggesting that they originated from a common ancestral sequence. The role of these repeated sequences in chromosome healing is discussed based on the observation that two to three copies of a telomere-similar sequence were present in each repeating unit of NP3R and NP4R.

  18. Genetic relatedness among indigenous rice varieties in the Eastern Himalayan region based on nucleotide sequences of the Waxy gene.

    Science.gov (United States)

    Choudhury, Baharul I; Khan, Mohammed L; Dayanandan, Selvadurai

    2014-12-29

    Indigenous rice varieties in the Eastern Himalayan region of Northeast India are traditionally classified into sali, boro and jum ecotypes based on geographical locality and the season of cultivation. In this study, we used DNA sequence data from the Waxy (Wx) gene to infer the genetic relatedness among indigenous rice varieties in Northeast India and to assess the genetic distinctiveness of ecotypes. The results of all three analyses (Bayesian, Maximum Parsimony and Neighbor Joining) were congruent and revealed two genetically distinct clusters of rice varieties in the region. The large group comprised several varieties of sali and boro ecotypes, and all agronomically improved varieties. The small group consisted of only traditionally cultivated indigenous rice varieties, which included one boro, few sali and all jum varieties. The fixation index analysis revealed a very low level of differentiation between sali and boro (F(ST) = 0.005), moderate differentiation between sali and jum (F(ST) = 0.108) and high differentiation between jum and boro (F(ST) = 0.230) ecotypes. The genetic relatedness analyses revealed that sali, boro and jum ecotypes are genetically heterogeneous, and the current classification based on cultivation type is not congruent with the genetic background of rice varieties. Indigenous rice varieties chosen from genetically distinct clusters could be used in breeding programs to improve genetic gain through heterosis, while maintaining high genetic diversity.

  19. Draft genome sequence of Streptomyces coelicoflavus ZG0656 reveals the putative biosynthetic gene cluster of acarviostatin family α-amylase inhibitors.

    Science.gov (United States)

    Guo, X; Geng, P; Bai, F; Bai, G; Sun, T; Li, X; Shi, L; Zhong, Q

    2012-08-01

    The aims of this study are to obtain the draft genome sequence of Streptomyces coelicoflavus ZG0656, which produces novel acarviostatin family α-amylase inhibitors, and then to reveal the putative acarviostatin-related gene cluster and the biosynthetic pathway. The draft genome sequence of S. coelicoflavus ZG0656 was generated using a shotgun approach employing a combination of 454 and Solexa sequencing technologies. Genome analysis revealed a putative gene cluster for acarviostatin biosynthesis, termed sct-cluster. The cluster contains 13 acarviostatin synthetic genes, six transporter genes, four starch degrading or transglycosylation enzyme genes and two regulator genes. On the basis of bioinformatic analysis, we proposed a putative biosynthetic pathway of acarviostatins. The intracellular steps produce a structural core, acarviostatin I00-7-P, and the extracellular assemblies lead to diverse acarviostatin end products. The draft genome sequence of S. coelicoflavus ZG0656 revealed the putative biosynthetic gene cluster of acarviostatins and a putative pathway of acarviostatin production. To our knowledge, S. coelicoflavus ZG0656 is the first strain in this species for which a genome sequence has been reported. The analysis of sct-cluster provided important insights into the biosynthesis of acarviostatins. This work will be a platform for producing novel variants and yield improvement. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  20. Digital Sequences and a Time Reversal-Based Impact Region Imaging and Localization Method

    Science.gov (United States)

    Qiu, Lei; Yuan, Shenfang; Mei, Hanfei; Qian, Weifeng

    2013-01-01

    To reduce time and cost of damage inspection, on-line impact monitoring of aircraft composite structures is needed. A digital monitor based on an array of piezoelectric transducers (PZTs) is developed to record the impact region of impacts on-line. It is small in size, lightweight and has low power consumption, but there are two problems with the impact alarm region localization method of the digital monitor at the current stage. The first one is that the accuracy rate of the impact alarm region localization is low, especially on complex composite structures. The second problem is that the area of impact alarm region is large when a large scale structure is monitored and the number of PZTs is limited which increases the time and cost of damage inspections. To solve the two problems, an impact alarm region imaging and localization method based on digital sequences and time reversal is proposed. In this method, the frequency band of impact response signals is estimated based on the digital sequences first. Then, characteristic signals of impact response signals are constructed by sinusoidal modulation signals. Finally, the phase synthesis time reversal impact imaging method is adopted to obtain the impact region image. Depending on the image, an error ellipse is generated to give out the final impact alarm region. A validation experiment is implemented on a complex composite wing box of a real aircraft. The validation results show that the accuracy rate of impact alarm region localization is approximately 100%. The area of impact alarm region can be reduced and the number of PZTs needed to cover the same impact monitoring region is reduced by more than a half. PMID:24084123

  1. Low-pass shotgun sequencing of the barley genome facilitates rapid identification of genes, conserved non-coding sequences and novel repeats

    Directory of Open Access Journals (Sweden)

    Graner Andreas

    2008-10-01

    Full Text Available Abstract Background Barley has one of the largest and most complex genomes of all economically important food crops. The rise of new short read sequencing technologies such as Illumina/Solexa permits such large genomes to be effectively sampled at relatively low cost. Based on the corresponding sequence reads a Mathematically Defined Repeat (MDR index can be generated to map repetitive regions in genomic sequences. Results We have generated 574 Mbp of Illumina/Solexa sequences from barley total genomic DNA, representing about 10% of a genome equivalent. From these sequences we generated an MDR index which was then used to identify and mark repetitive regions in the barley genome. Comparison of the MDR plots with expert repeat annotation drawing on the information already available for known repetitive elements revealed a significant correspondence between the two methods. MDR-based annotation allowed for the identification of dozens of novel repeat sequences, though, which were not recognised by hand-annotation. The MDR data was also used to identify gene-containing regions by masking of repetitive sequences in eight de-novo sequenced bacterial artificial chromosome (BAC clones. For half of the identified candidate gene islands indeed gene sequences could be identified. MDR data were only of limited use, when mapped on genomic sequences from the closely related species Triticum monococcum as only a fraction of the repetitive sequences was recognised. Conclusion An MDR index for barley, which was obtained by whole-genome Illumina/Solexa sequencing, proved as efficient in repeat identification as manual expert annotation. Circumventing the labour-intensive step of producing a specific repeat library for expert annotation, an MDR index provides an elegant and efficient resource for the identification of repetitive and low-copy (i.e. potentially gene-containing sequences regions in uncharacterised genomic sequences. The restriction that a particular

  2. Analysis of complete nucleotide sequences of Angolan hepatitis B virus isolates reveals the existence of a separate lineage within genotype E.

    Directory of Open Access Journals (Sweden)

    Barbara V Lago

    Full Text Available Hepatitis B virus genotype E (HBV/E is highly prevalent in Western Africa. In this work, 30 HBV/E isolates from HBsAg positive Angolans (staff and visitors of a private hospital in Luanda were genetically characterized: 16 of them were completely sequenced and the pre-S/S sequences of the remaining 14 were determined. A high proportion (12/30, 40% of subjects tested positive for both HBsAg and anti-HBs markers. Deduced amino acid sequences revealed the existence of specific substitutions and deletions in the B- and T-cell epitopes of the surface antigen (pre-S1- and pre-S2 regions of the virus isolates derived from 8/12 individuals with concurrent HBsAg/anti-HBs. Phylogenetic analysis performed with 231 HBV/E full-length sequences, including 16 from this study, showed that all isolates from Angola, Namibia and the Democratic Republic of Congo (n = 28 clustered in a separate lineage, divergent from the HBV/E isolates from nine other African countries, namely Cameroon, Central African Republic, Côte d'Ivoire, Ghana, Guinea, Madagascar, Niger, Nigeria and Sudan, with a Bayesian posterior probability of 1. Five specific mutations, namely small S protein T57I, polymerase Q177H, G245W and M612L, and X protein V30L, were observed in 79-96% of the isolates of the separate lineage, compared to a frequency of 0-12% among the other HBV/E African isolates.

  3. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    International Nuclear Information System (INIS)

    Maat, J.

    1978-01-01

    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  4. A transcriptome atlas of rabbit revealed by PacBio single-molecule long-read sequencing.

    Science.gov (United States)

    Chen, Shi-Yi; Deng, Feilong; Jia, Xianbo; Li, Cao; Lai, Song-Jia

    2017-08-09

    It is widely acknowledged that transcriptional diversity largely contributes to biological regulation in eukaryotes. Since the advent of second-generation sequencing technologies, a large number of RNA sequencing studies have considerably improved our understanding of transcriptome complexity. However, it still remains a huge challenge for obtaining full-length transcripts because of difficulties in the short read-based assembly. In the present study we employ PacBio single-molecule long-read sequencing technology for whole-transcriptome profiling in rabbit (Oryctolagus cuniculus). We totally obtain 36,186 high-confidence transcripts from 14,474 genic loci, among which more than 23% of genic loci and 66% of isoforms have not been annotated yet within the current reference genome. Furthermore, about 17% of transcripts are computationally revealed to be non-coding RNAs. Up to 24,797 alternative splicing (AS) and 11,184 alternative polyadenylation (APA) events are detected within this de novo constructed transcriptome, respectively. The results provide a comprehensive set of reference transcripts and hence contribute to the improved annotation of rabbit genome.

  5. Genetic signatures of adaptation revealed from transcriptome sequencing of Arctic and red foxes.

    Science.gov (United States)

    Kumar, Vikas; Kutschera, Verena E; Nilsson, Maria A; Janke, Axel

    2015-08-07

    The genus Vulpes (true foxes) comprises numerous species that inhabit a wide range of habitats and climatic conditions, including one species, the Arctic fox (Vulpes lagopus) which is adapted to the arctic region. A close relative to the Arctic fox, the red fox (Vulpes vulpes), occurs in subarctic to subtropical habitats. To study the genetic basis of their adaptations to different environments, transcriptome sequences from two Arctic foxes and one red fox individual were generated and analyzed for signatures of positive selection. In addition, the data allowed for a phylogenetic analysis and divergence time estimate between the two fox species. The de novo assembly of reads resulted in more than 160,000 contigs/transcripts per individual. Approximately 17,000 homologous genes were identified using human and the non-redundant databases. Positive selection analyses revealed several genes involved in various metabolic and molecular processes such as energy metabolism, cardiac gene regulation, apoptosis and blood coagulation to be under positive selection in foxes. Branch site tests identified four genes to be under positive selection in the Arctic fox transcriptome, two of which are fat metabolism genes. In the red fox transcriptome eight genes are under positive selection, including molecular process genes, notably genes involved in ATP metabolism. Analysis of the three transcriptomes and five Sanger re-sequenced genes in additional individuals identified a lower genetic variability within Arctic foxes compared to red foxes, which is consistent with distribution range differences and demographic responses to past climatic fluctuations. A phylogenomic analysis estimated that the Arctic and red fox lineages diverged about three million years ago. Transcriptome data are an economic way to generate genomic resources for evolutionary studies. Despite not representing an entire genome, this transcriptome analysis identified numerous genes that are relevant to arctic

  6. High-throughput sequencing of the B-cell receptor in African Burkitt lymphoma reveals clues to pathogenesis.

    Science.gov (United States)

    Lombardo, Katharine A; Coffey, David G; Morales, Alicia J; Carlson, Christopher S; Towlerton, Andrea M H; Gerdts, Sarah E; Nkrumah, Francis K; Neequaye, Janet; Biggar, Robert J; Orem, Jackson; Casper, Corey; Mbulaiteye, Sam M; Bhatia, Kishor G; Warren, Edus H

    2017-03-28

    Burkitt lymphoma (BL), the most common pediatric cancer in sub-Saharan Africa, is a malignancy of antigen-experienced B lymphocytes. High-throughput sequencing (HTS) of the immunoglobulin heavy ( IGH ) and light chain ( IGK / IGL ) loci was performed on genomic DNA from 51 primary BL tumors: 19 from Uganda and 32 from Ghana. Reverse transcription polymerase chain reaction analysis and tumor RNA sequencing (RNAseq) was performed on the Ugandan tumors to confirm and extend the findings from the HTS of tumor DNA. Clonal IGH and IGK / IGL rearrangements were identified in 41 and 46 tumors, respectively. Evidence for rearrangement of the second IGH allele was observed in only 6 of 41 tumor samples with a clonal IGH rearrangement, suggesting that the normal process of biallelic IGHD to IGHJ diversity-joining (DJ) rearrangement is often disrupted in BL progenitor cells. Most tumors, including those with a sole dominant, nonexpressed DJ rearrangement, contained many IGH and IGK / IGL sequences that differed from the dominant rearrangement by < 10 nucleotides, suggesting that the target of ongoing mutagenesis of these loci in BL tumor cells is not limited to expressed alleles. IGHV usage in both BL tumor cohorts revealed enrichment for IGHV genes that are infrequently used in memory B cells from healthy subjects. Analysis of publicly available DNA sequencing and RNAseq data revealed that these same IGHV genes were overrepresented in dominant tumor-associated IGH rearrangements in several independent BL tumor cohorts. These data suggest that BL derives from an abnormal B-cell progenitor and that aberrant mutational processes are active on the immunoglobulin loci in BL cells.

  7. RNA-Sequencing Reveals Unique Transcriptional Signatures of Running and Running-Independent Environmental Enrichment in the Adult Mouse Dentate Gyrus

    Directory of Open Access Journals (Sweden)

    Catherine-Alexandra Grégoire

    2018-04-01

    Full Text Available Environmental enrichment (EE is a powerful stimulus of brain plasticity and is among the most accessible treatment options for brain disease. In rodents, EE is modeled using multi-factorial environments that include running, social interactions, and/or complex surroundings. Here, we show that running and running-independent EE differentially affect the hippocampal dentate gyrus (DG, a brain region critical for learning and memory. Outbred male CD1 mice housed individually with a voluntary running disk showed improved spatial memory in the radial arm maze compared to individually- or socially-housed mice with a locked disk. We therefore used RNA sequencing to perform an unbiased interrogation of DG gene expression in mice exposed to either a voluntary running disk (RUN, a locked disk (LD, or a locked disk plus social enrichment and tunnels [i.e., a running-independent complex environment (CE]. RNA sequencing revealed that RUN and CE mice showed distinct, non-overlapping patterns of transcriptomic changes versus the LD control. Bio-informatics uncovered that the RUN and CE environments modulate separate transcriptional networks, biological processes, cellular compartments and molecular pathways, with RUN preferentially regulating synaptic and growth-related pathways and CE altering extracellular matrix-related functions. Within the RUN group, high-distance runners also showed selective stress pathway alterations that correlated with a drastic decline in overall transcriptional changes, suggesting that excess running causes a stress-induced suppression of running’s genetic effects. Our findings reveal stimulus-dependent transcriptional signatures of EE on the DG, and provide a resource for generating unbiased, data-driven hypotheses for novel mediators of EE-induced cognitive changes.

  8. The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes

    NARCIS (Netherlands)

    Skaletsky, Helen; Kuroda-Kawaguchi, Tomoko; Minx, Patrick J.; Cordum, Holland S.; Hillier, LaDeana; Brown, Laura G.; Repping, Sjoerd; Pyntikova, Tatyana; Ali, Johar; Bieri, Tamberlyn; Chinwalla, Asif; Delehaunty, Andrew; Delehaunty, Kim; Du, Hui; Fewell, Ginger; Fulton, Lucinda; Fulton, Robert; Graves, Tina; Hou, Shun-Fang; Latrielle, Philip; Leonard, Shawn; Mardis, Elaine; Maupin, Rachel; McPherson, John; Miner, Tracie; Nash, William; Nguyen, Christine; Ozersky, Philip; Pepin, Kymberlie; Rock, Susan; Rohlfing, Tracy; Scott, Kelsi; Schultz, Brian; Strong, Cindy; Tin-Wollam, Aye; Yang, Shiaw-Pyng; Waterston, Robert H.; Wilson, Richard K.; Rozen, Steve; Page, David C.

    2003-01-01

    The male-specific region of the Y chromosome, the MSY, differentiates the sexes and comprises 95% of the chromosome's length. Here, we report that the MSY is a mosaic of heterochromatic sequences and three classes of euchromatic sequences: X-transposed, X-degenerate and ampliconic. These classes

  9. Genome sequence analysis of five Canadian isolates of strawberry mottle virus reveals extensive intra-species diversity and a longer RNA2 with increased coding capacity compared to a previously characterized European isolate.

    Science.gov (United States)

    Bhagwat, Basdeo; Dickison, Virginia; Ding, Xinlun; Walker, Melanie; Bernardy, Michael; Bouthillier, Michel; Creelman, Alexa; DeYoung, Robyn; Li, Yinzi; Nie, Xianzhou; Wang, Aiming; Xiang, Yu; Sanfaçon, Hélène

    2016-06-01

    In this study, we report the genome sequence of five isolates of strawberry mottle virus (family Secoviridae, order Picornavirales) from strawberry field samples with decline symptoms collected in Eastern Canada. The Canadian isolates differed from the previously characterized European isolate 1134 in that they had a longer RNA2, resulting in a 239-amino-acid extension of the C-terminal region of the polyprotein. Sequence analysis suggests that reassortment and recombination occurred among the isolates. Phylogenetic analysis revealed that the Canadian isolates are diverse, grouping in two separate branches along with isolates from Europe and the Americas.

  10. Identification of Dendrobium species by a candidate DNA barcode sequence: the chloroplast psbA-trnH intergenic region.

    Science.gov (United States)

    Yao, Hui; Song, Jing-Yuan; Ma, Xin-Ye; Liu, Chang; Li, Ying; Xu, Hong-Xi; Han, Jian-Ping; Duan, Li-Sheng; Chen, Shi-Lin

    2009-05-01

    DNA barcoding is a novel technology that uses a standard DNA sequence to facilitate species identification. Although a consensus has not been reached regarding which DNA sequences can be used as the best plant barcodes, the psbA-trnH spacer region has been tested extensively in recent years. In this study, we hypothesize that the psbA-trnH spacer regions are also effective barcodes for Dendrobium species. We have sequenced the chloroplast psbA-trnH intergenic spacers of 17 Dendrobium species to test this hypothesis. The sequences were found to be significantly different from those of other species, with percentages of variation ranging from 0.3 % to 2.3 % and an average of 1.2 %. In contrast, the intraspecific variation among the Dendrobium species studied ranged from 0 % to 0.1 %. The sequence difference between the psbA-trnH sequences of 17 Dendrobium species and one Bulbophyllum odoratissimum ranged from 2.0 % to 3.1 %, with an average of 2.5 %. Our results support the notion that the psbA-trnH intergenic spacer region could be used as a barcode to distinguish various Dendrobium species and to differentiate Dendrobium species from other adulterating species. Copyright Georg Thieme Verlag KG Stuttgart. New York.

  11. Deep Sequencing of Plant and Animal DNA Contained within Traditional Chinese Medicines Reveals Legality Issues and Health Safety Concerns

    Science.gov (United States)

    Coghlan, Megan L.; Haile, James; Houston, Jayne; Murray, Dáithí C.; White, Nicole E.; Moolhuijzen, Paula; Bellgard, Matthew I.; Bunce, Michael

    2012-01-01

    Traditional Chinese medicine (TCM) has been practiced for thousands of years, but only within the last few decades has its use become more widespread outside of Asia. Concerns continue to be raised about the efficacy, legality, and safety of many popular complementary alternative medicines, including TCMs. Ingredients of some TCMs are known to include derivatives of endangered, trade-restricted species of plants and animals, and therefore contravene the Convention on International Trade in Endangered Species (CITES) legislation. Chromatographic studies have detected the presence of heavy metals and plant toxins within some TCMs, and there are numerous cases of adverse reactions. It is in the interests of both biodiversity conservation and public safety that techniques are developed to screen medicinals like TCMs. Targeting both the p-loop region of the plastid trnL gene and the mitochondrial 16S ribosomal RNA gene, over 49,000 amplicon sequence reads were generated from 15 TCM samples presented in the form of powders, tablets, capsules, bile flakes, and herbal teas. Here we show that second-generation, high-throughput sequencing (HTS) of DNA represents an effective means to genetically audit organic ingredients within complex TCMs. Comparison of DNA sequence data to reference databases revealed the presence of 68 different plant families and included genera, such as Ephedra and Asarum, that are potentially toxic. Similarly, animal families were identified that include genera that are classified as vulnerable, endangered, or critically endangered, including Asiatic black bear (Ursus thibetanus) and Saiga antelope (Saiga tatarica). Bovidae, Cervidae, and Bufonidae DNA were also detected in many of the TCM samples and were rarely declared on the product packaging. This study demonstrates that deep sequencing via HTS is an efficient and cost-effective way to audit highly processed TCM products and will assist in monitoring their legality and safety especially when

  12. Single nucleus genome sequencing reveals high similarity among nuclei of an endomycorrhizal fungus.

    Directory of Open Access Journals (Sweden)

    Kui Lin

    2014-01-01

    Full Text Available Nuclei of arbuscular endomycorrhizal fungi have been described as highly diverse due to their asexual nature and absence of a single cell stage with only one nucleus. This has raised fundamental questions concerning speciation, selection and transmission of the genetic make-up to next generations. Although this concept has become textbook knowledge, it is only based on studying a few loci, including 45S rDNA. To provide a more comprehensive insight into the genetic makeup of arbuscular endomycorrhizal fungi, we applied de novo genome sequencing of individual nuclei of Rhizophagus irregularis. This revealed a surprisingly low level of polymorphism between nuclei. In contrast, within a nucleus, the 45S rDNA repeat unit turned out to be highly diverged. This finding demystifies a long-lasting hypothesis on the complex genetic makeup of arbuscular endomycorrhizal fungi. Subsequent genome assembly resulted in the first draft reference genome sequence of an arbuscular endomycorrhizal fungus. Its length is 141 Mbps, representing over 27,000 protein-coding gene models. We used the genomic sequence to reinvestigate the phylogenetic relationships of Rhizophagus irregularis with other fungal phyla. This unambiguously demonstrated that Glomeromycota are more closely related to Mucoromycotina than to its postulated sister Dikarya.

  13. IRAS 18153-1651: an H II region with a possible wind bubble blown by a young main-sequence B star

    Science.gov (United States)

    Gvaramadze, V. V.; Mackey, J.; Kniazev, A. Y.; Langer, N.; Chené, A.-N.; Castro, N.; Haworth, T. J.; Grebel, E. K.

    2017-04-01

    We report the results of spectroscopic observations and numerical modelling of the H II region IRAS 18153-1651. Our study was motivated by the discovery of an optical arc and two main-sequence stars of spectral type B1 and B3 near the centre of IRAS 18153-1651. We interpret the arc as the edge of the wind bubble (blown by the B1 star), whose brightness is enhanced by the interaction with a photoevaporation flow from a nearby molecular cloud. This interpretation implies that we deal with a unique case of a young massive star (the most massive member of a recently formed low-mass star cluster) caught just tens of thousands of years after its stellar wind has begun to blow a bubble into the surrounding dense medium. Our 2D, radiation-hydrodynamics simulations of the wind bubble and the H II region around the B1 star provide a reasonable match to observations, both in terms of morphology and absolute brightness of the optical and mid-infrared emission, and verify the young age of IRAS 18153-1651. Taken together our results strongly suggest that we have revealed the first example of a wind bubble blown by a main-sequence B star.

  14. Sequence exploration reveals information bias among molecular markers used in phylogenetic reconstruction for Colletotrichum species.

    Science.gov (United States)

    Rampersad, Sephra N; Hosein, Fazeeda N; Carrington, Christine Vf

    2014-01-01

    The Colletotrichum gloeosporioides species complex is among the most destructive fungal plant pathogens in the world, however, identification of isolates of quarantine importance to the intra-specific level is confounded by a number of factors that affect phylogenetic reconstruction. Information bias and quality parameters were investigated to determine whether nucleotide sequence alignments and phylogenetic trees accurately reflect the genetic diversity and phylogenetic relatedness of individuals. Sequence exploration of GAPDH, ACT, TUB2 and ITS markers indicated that the query sequences had different patterns of nucleotide substitution but were without evidence of base substitution saturation. Regions of high entropy were much more dispersed in the ACT and GAPDH marker alignments than for the ITS and TUB2 markers. A discernible bimodal gap in the genetic distance frequency histograms was produced for the ACT and GAPDH markers which indicated successful separation of intra- and inter-specific sequences in the data set. Overall, analyses indicated clear differences in the ability of these markers to phylogenetically separate individuals to the intra-specific level which coincided with information bias.

  15. Genetic characterization of UCS region of Pneumocystis jirovecii and construction of allelic profiles of Indian isolates based on sequence typing at three regions.

    Science.gov (United States)

    Gupta, Rashmi; Mirdha, Bijay Ranjan; Guleria, Randeep; Kumar, Lalit; Luthra, Kalpana; Agarwal, Sanjay Kumar; Sreenivas, Vishnubhatla

    2013-01-01

    Pneumocystis jirovecii is an opportunistic pathogen that causes severe pneumonia in immunocompromised patients. To study the genetic diversity of P. jirovecii in India the upstream conserved sequence (UCS) region of Pneumocystis genome was amplified, sequenced and genotyped from a set of respiratory specimens obtained from 50 patients with a positive result for nested mitochondrial large subunit ribosomal RNA (mtLSU rRNA) PCR during the years 2005-2008. Of these 50 cases, 45 showed a positive PCR for UCS region. Variations in the tandem repeats in UCS region were characterized by sequencing all the positive cases. Of the 45 cases, one case showed five repeats, 11 cases showed four repeats, 29 cases showed three repeats and four cases showed two repeats. By running amplified DNA from all these cases on a high-resolution gel, mixed infection was observed in 12 cases (26.7%, 12/45). Forty three of 45 cases included in this study had previously been typed at mtLSU rRNA and internal transcribed spacer (ITS) region by our group. In the present study, the genotypes at those two regions were combined with UCS repeat patterns to construct allelic profiles of 43 cases. A total of 36 allelic profiles were observed in 43 isolates indicating high genetic variability. A statistically significant association was observed between mtLSU rRNA genotype 1, ITS type Ea and UCS repeat pattern 4. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Re-annotation of the physical map of Glycine max for polyploid-like regions by BAC end sequence driven whole genome shotgun read assembly

    Directory of Open Access Journals (Sweden)

    Shultz Jeffry

    2008-07-01

    Full Text Available Abstract Background Many of the world's most important food crops have either polyploid genomes or homeologous regions derived from segmental shuffling following polyploid formation. The soybean (Glycine max genome has been shown to be composed of approximately four thousand short interspersed homeologous regions with 1, 2 or 4 copies per haploid genome by RFLP analysis, microsatellite anchors to BACs and by contigs formed from BAC fingerprints. Despite these similar regions,, the genome has been sequenced by whole genome shotgun sequence (WGS. Here the aim was to use BAC end sequences (BES derived from three minimum tile paths (MTP to examine the extent and homogeneity of polyploid-like regions within contigs and the extent of correlation between the polyploid-like regions inferred from fingerprinting and the polyploid-like sequences inferred from WGS matches. Results Results show that when sequence divergence was 1–10%, the copy number of homeologous regions could be identified from sequence variation in WGS reads overlapping BES. Homeolog sequence variants (HSVs were single nucleotide polymorphisms (SNPs; 89% and single nucleotide indels (SNIs 10%. Larger indels were rare but present (1%. Simulations that had predicted fingerprints of homeologous regions could be separated when divergence exceeded 2% were shown to be false. We show that a 5–10% sequence divergence is necessary to separate homeologs by fingerprinting. BES compared to WGS traces showed polyploid-like regions with less than 1% sequence divergence exist at 2.3% of the locations assayed. Conclusion The use of HSVs like SNPs and SNIs to characterize BACs wil improve contig building methods. The implications for bioinformatic and functional annotation of polyploid and paleopolyploid genomes show that a combined approach of BAC fingerprint based physical maps, WGS sequence and HSV-based partitioning of BAC clones from homeologous regions to separate contigs will allow reliable de

  17. Genetic signatures of adaptation revealed from transcriptome sequencing of Arctic and red foxes

    OpenAIRE

    Kumar, Vikas; Kutschera, Verena E.; Nilsson, Maria A.; Janke, Axel

    2015-01-01

    Background The genus Vulpes (true foxes) comprises numerous species that inhabit a wide range of habitats and climatic conditions, including one species, the Arctic fox (Vulpes lagopus) which is adapted to the arctic region. A close relative to the Arctic fox, the red fox (Vulpes vulpes), occurs in subarctic to subtropical habitats. To study the genetic basis of their adaptations to different environments, transcriptome sequences from two Arctic foxes and one red fox individual were generated...

  18. Whole-Exome Sequencing Reveals Clinically Relevant Variants in Family Affected with Autism Spectrum Disorder

    Directory of Open Access Journals (Sweden)

    Jiaxiu Zhou

    2016-10-01

    Full Text Available Chromosomal microarray (CMA has been suggested as a first tier clinical diagnostic test for ASD. High-throughput sequencing (HTS has associated hundreds of genes associated with ASD. Whole Exome Sequencing (WES was used in combination with CMA to identify clinically-relevant ASD variants. In prior work, a trio-based (father, mother, and proband WGS (Whole Genome Sequencing was used to reveal clinically-relevant de novo, or inherited, rare variants in half (16 / 32 of the ASD families in which all probands had normal, or VOUS (Variant of Uncertain Clinical Significance, CMA results. In this study, after CMA screening chromosome structural abnormalities of a proband affected with ASD, a WES was performed on the patient and parents. Some rare de novo, and inherited, variants were detected using trio-based bioinformatics analysis. ASD variants were ranked by SFARI Gene score, HPO (human phenotype ontology, protein function damage, and manual searching PubMed. Sanger sequencing was used to validated some candidate variants in family members. A de novo homozygous mutation in SPG11 (p.C209F, two inherited, compound-heterozygote mutations in SCN9A (p.Q10R and p.R1893H and BEST1 (p.A135V and p.A297V were confirmed. Heterozygous mutations in TSC1 (p.S487C and SHANK2 (p.Arg569His inherited from mother were also confirmed.

  19. Atypical case of Wolfram syndrome revealed through targeted exome sequencing in a patient with suspected mitochondrial disease.

    Science.gov (United States)

    Lieber, Daniel S; Vafai, Scott B; Horton, Laura C; Slate, Nancy G; Liu, Shangtao; Borowsky, Mark L; Calvo, Sarah E; Schmahmann, Jeremy D; Mootha, Vamsi K

    2012-01-06

    Mitochondrial diseases comprise a diverse set of clinical disorders that affect multiple organ systems with varying severity and age of onset. Due to their clinical and genetic heterogeneity, these diseases are difficult to diagnose. We have developed a targeted exome sequencing approach to improve our ability to properly diagnose mitochondrial diseases and apply it here to an individual patient. Our method targets mitochondrial DNA (mtDNA) and the exons of 1,600 nuclear genes involved in mitochondrial biology or Mendelian disorders with multi-system phenotypes, thereby allowing for simultaneous evaluation of multiple disease loci. Targeted exome sequencing was performed on a patient initially suspected to have a mitochondrial disorder. The patient presented with diabetes mellitus, diffuse brain atrophy, autonomic neuropathy, optic nerve atrophy, and a severe amnestic syndrome. Further work-up revealed multiple heteroplasmic mtDNA deletions as well as profound thiamine deficiency without a clear nutritional cause. Targeted exome sequencing revealed a homozygous c.1672C > T (p.R558C) missense mutation in exon 8 of WFS1 that has previously been reported in a patient with Wolfram syndrome. This case demonstrates how clinical application of next-generation sequencing technology can enhance the diagnosis of patients suspected to have rare genetic disorders. Furthermore, the finding of unexplained thiamine deficiency in a patient with Wolfram syndrome suggests a potential link between WFS1 biology and thiamine metabolism that has implications for the clinical management of Wolfram syndrome patients.

  20. Atypical case of Wolfram syndrome revealed through targeted exome sequencing in a patient with suspected mitochondrial disease

    Directory of Open Access Journals (Sweden)

    Lieber Daniel S

    2012-01-01

    Full Text Available Abstract Background Mitochondrial diseases comprise a diverse set of clinical disorders that affect multiple organ systems with varying severity and age of onset. Due to their clinical and genetic heterogeneity, these diseases are difficult to diagnose. We have developed a targeted exome sequencing approach to improve our ability to properly diagnose mitochondrial diseases and apply it here to an individual patient. Our method targets mitochondrial DNA (mtDNA and the exons of 1,600 nuclear genes involved in mitochondrial biology or Mendelian disorders with multi-system phenotypes, thereby allowing for simultaneous evaluation of multiple disease loci. Case Presentation Targeted exome sequencing was performed on a patient initially suspected to have a mitochondrial disorder. The patient presented with diabetes mellitus, diffuse brain atrophy, autonomic neuropathy, optic nerve atrophy, and a severe amnestic syndrome. Further work-up revealed multiple heteroplasmic mtDNA deletions as well as profound thiamine deficiency without a clear nutritional cause. Targeted exome sequencing revealed a homozygous c.1672C > T (p.R558C missense mutation in exon 8 of WFS1 that has previously been reported in a patient with Wolfram syndrome. Conclusion This case demonstrates how clinical application of next-generation sequencing technology can enhance the diagnosis of patients suspected to have rare genetic disorders. Furthermore, the finding of unexplained thiamine deficiency in a patient with Wolfram syndrome suggests a potential link between WFS1 biology and thiamine metabolism that has implications for the clinical management of Wolfram syndrome patients.

  1. A unique genomic sequence in the Wolf-Hirschhorn syndrome [WHS] region of humans is conserved in the great apes.

    Science.gov (United States)

    Tarzami, S T; Kringstein, A M; Conte, R A; Verma, R S

    1996-10-01

    The Wolf-Hirschhorn syndrome (WHS) is caused by a partial deletion in the short arm of chromosome 4 band 16.3 (4p 16.3). A unique-sequence human DNA probe (39 kb) localized within this region has been used to search for sequence homology in the apes' equivalent chromosome 3 by FISH-technique. The WHS loci are conserved in higher primates at the expected position. Nevertheless, a control probe, which detects alphoid sequences of the pericentromeric region of humans, is diverged in chimpanzee, gorilla, and orangutan. The conservation of WHS loci and divergence of DNA alphoid sequences have further added to the controversy concerning human descent.

  2. Levels of integration in cognitive control and sequence processing in the prefrontal cortex.

    Science.gov (United States)

    Bahlmann, Jörg; Korb, Franziska M; Gratton, Caterina; Friederici, Angela D

    2012-01-01

    Cognitive control is necessary to flexibly act in changing environments. Sequence processing is needed in language comprehension to build the syntactic structure in sentences. Functional imaging studies suggest that sequence processing engages the left ventrolateral prefrontal cortex (PFC). In contrast, cognitive control processes additionally recruit bilateral rostral lateral PFC regions. The present study aimed to investigate these two types of processes in one experimental paradigm. Sequence processing was manipulated using two different sequencing rules varying in complexity. Cognitive control was varied with different cue-sets that determined the choice of a sequencing rule. Univariate analyses revealed distinct PFC regions for the two types of processing (i.e. sequence processing: left ventrolateral PFC and cognitive control processing: bilateral dorsolateral and rostral PFC). Moreover, in a common brain network (including left lateral PFC and intraparietal sulcus) no interaction between sequence and cognitive control processing was observed. In contrast, a multivariate pattern analysis revealed an interaction of sequence and cognitive control processing, such that voxels in left lateral PFC and parietal cortex showed different tuning functions for tasks involving different sequencing and cognitive control demands. These results suggest that the difference between the process of rule selection (i.e. cognitive control) and the process of rule-based sequencing (i.e. sequence processing) find their neuronal underpinnings in distinct activation patterns in lateral PFC. Moreover, the combination of rule selection and rule sequencing can shape the response of neurons in lateral PFC and parietal cortex.

  3. [Sequence polymorphisms of the mitochondrial DNA HVR I and HVR II regions in the Deng populations from Tibet in China].

    Science.gov (United States)

    Kang, Longli; Zhang, Xiaofeng; Liu, Kai; Zhao, Jianmin

    2009-12-01

    To analyze the sequence polymorphisms of the mitochondrial DNA hypervariable regions I (HVR I) and HVR II in the Deng population in Linzhi area of Tibet. mtDNAs obtained from 119 unrelated individuals were amplified and directly sequenced. One hundred and ten variable sites were identified, including nucleotide transitions, transversions, and insertions. In the HVR I region (nt16024-nt16365), 68 polymorphic sites and 119 haplotypes were observed, the genetic diversity was 0.9916. In the HVR II (nt73-nt340) region, 42 polymorphic sites and 113 haplotypes were observed, and the genetic diversity was 0.9907. The random match probability of the HVR I and HVR II regions were 0.0084 and 0.0093, respectively. When combining the HVR I and HVR II regions, 119 different haplotypes were found. The combined match probability of two unrelated persons having the same sequence was 0.0084. There are some unique polymorphic loci in the Deng population. There are different genetic structures between Chinese and other Asian populations in the mitochondrial DNA D-loop region. Sequence polymorphism of mitochondrial DNA HVR I and HVR II can be used as a genetic marker for forensic individual identification and genetic analysis.

  4. Sequences within the 5' untranslated region regulate the levels of a kinetoplast DNA topoisomerase mRNA during the cell cycle.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Ou, X; Mahmood, R; Ray, D S

    1996-12-01

    Gene expression in trypanosomatids appears to be regulated largely at the posttranscriptional level and involves maturation of mRNA precursors by trans splicing of a 39-nucleotide miniexon sequence to the 5' end of the mRNA and cleavage and polyadenylation at the 3' end of the mRNA. To initiate the identification of sequences involved in the periodic expression of DNA replication genes in trypanosomatids, we have mapped splice acceptor sites in the 5' flanking region of the TOP2 gene, which encodes the kinetoplast DNA topoisomerase, and have carried out deletion analysis of this region on a plasmid-encoded TOP2 gene. Block deletions within the 5' untranslated region (UTR) identified two regions (-608 to -388 and -387 to -186) responsible for periodic accumulation of the mRNA. Deletion of one or the other of these sequences had no effect on periodic expression of the mRNA, while deletion of both regions resulted in constitutive expression of the mRNA throughout the cell cycle. Subcloning of these sequences into the 5' UTR of a construct lacking both regions of the TOP2 5' UTR has shown that an octamer consensus sequence present in the 5' UTR of the TOP2, RPA1, and DHFR-TS mRNAs is required for normal cycling of the TOP2 mRNA. Mutation of the consensus octamer sequence in the TOP2 5' UTR in a plasmid construct containing only a single consensus octamer and that shows normal cycling of the plasmid-encoded TOP2 mRNA resulted in substantial reduction of the cycling of the mRNA level. These results imply a negative regulation of TOP2 mRNA during the cell cycle by a mechanism involving redundant elements containing one or more copies of a conserved octamer sequence within the 5' UTR of TOP2 mRNA.

  5. Salmon louse (Lepeophtheirus salmonis transcriptomes during post molting maturation and egg production, revealed using EST-sequencing and microarray analysis

    Directory of Open Access Journals (Sweden)

    Jonassen Inge

    2008-03-01

    Full Text Available Abstract Background Lepeophtheirus salmonis is an ectoparasitic copepod feeding on skin, mucus and blood from salmonid hosts. Initial analysis of EST sequences from pre adult and adult stages of L. salmonis revealed a large proportion of novel transcripts. In order to link unknown transcripts to biological functions we have combined EST sequencing and microarray analysis to characterize female salmon louse transcriptomes during post molting maturation and egg production. Results EST sequence analysis shows that 43% of the ESTs have no significant hits in GenBank. Sequenced ESTs assembled into 556 contigs and 1614 singletons and whenever homologous genes were identified no clear correlation with homologous genes from any specific animal group was evident. Sequence comparison of 27 L. salmonis proteins with homologous proteins in humans, zebrafish, insects and crustaceans revealed an almost identical sequence identity with all species. Microarray analysis of maturing female adult salmon lice revealed two major transcription patterns; up-regulation during the final molting followed by down regulation and female specific up regulation during post molting growth and egg production. For a third minor group of ESTs transcription decreased during molting from pre-adult II to immature adults. Genes regulated during molting typically gave hits with cuticula proteins whilst transcripts up regulated during post molting growth were female specific, including two vitellogenins. Conclusion The copepod L.salmonis contains high a level of novel genes. Among analyzed L.salmonis proteins, sequence identities with homologous proteins in crustaceans are no higher than to homologous proteins in humans. Three distinct processes, molting, post molting growth and egg production correlate with transcriptional regulation of three groups of transcripts; two including genes related to growth, one including genes related to egg production. The function of the regulated

  6. Functional anthology of intrinsic disorder. 2. Cellular components, domains, technical terms, developmental processes, and coding sequence diversities correlated with long disordered regions.

    Science.gov (United States)

    Vucetic, Slobodan; Xie, Hongbo; Iakoucheva, Lilia M; Oldfield, Christopher J; Dunker, A Keith; Obradovic, Zoran; Uversky, Vladimir N

    2007-05-01

    Biologically active proteins without stable ordered structure (i.e., intrinsically disordered proteins) are attracting increased attention. Functional repertoires of ordered and disordered proteins are very different, and the ability to differentiate whether a given function is associated with intrinsic disorder or with a well-folded protein is crucial for modern protein science. However, there is a large gap between the number of proteins experimentally confirmed to be disordered and their actual number in nature. As a result, studies of functional properties of confirmed disordered proteins, while helpful in revealing the functional diversity of protein disorder, provide only a limited view. To overcome this problem, a bioinformatics approach for comprehensive study of functional roles of protein disorder was proposed in the first paper of this series (Xie, H.; Vucetic, S.; Iakoucheva, L. M.; Oldfield, C. J.; Dunker, A. K.; Obradovic, Z.; Uversky, V. N. Functional anthology of intrinsic disorder. 1. Biological processes and functions of proteins with long disordered regions. J. Proteome Res. 2007, 5, 1882-1898). Applying this novel approach to Swiss-Prot sequences and functional keywords, we found over 238 and 302 keywords to be strongly positively or negatively correlated, respectively, with long intrinsically disordered regions. This paper describes approximately 90 Swiss-Prot keywords attributed to the cellular components, domains, technical terms, developmental processes, and coding sequence diversities possessing strong positive and negative correlation with long disordered regions.

  7. Functional Anthology of Intrinsic Disorder. II. Cellular Components, Domains, Technical Terms, Developmental Processes and Coding Sequence Diversities Correlated with Long Disordered Regions

    Science.gov (United States)

    Vucetic, Slobodan; Xie, Hongbo; Iakoucheva, Lilia M.; Oldfield, Christopher J.; Dunker, A. Keith; Obradovic, Zoran; Uversky, Vladimir N.

    2008-01-01

    Biologically active proteins without stable ordered structure (i.e., intrinsically disordered proteins) are attracting increased attention. Functional repertoires of ordered and disordered proteins are very different, and the ability to differentiate whether a given function is associated with intrinsic disorder or with a well-folded protein is crucial for modern protein science. However, there is a large gap between the number of proteins experimentally confirmed to be disordered and their actual number in nature. As a result, studies of functional properties of confirmed disordered proteins, while helpful in revealing the functional diversity of protein disorder, provide only a limited view. To overcome this problem, a bioinformatics approach for comprehensive study of functional roles of protein disorder was proposed in the first paper of this series (Xie H., Vucetic S., Iakoucheva L.M., Oldfield C.J., Dunker A.K., Obradovic Z., Uversky V.N. (2006) Functional anthology of intrinsic disorder. I. Biological processes and functions of proteins with long disordered regions. J. Proteome Res.). Applying this novel approach to Swiss-Prot sequences and functional keywords, we found over 238 and 302 keywords to be strongly positively or negatively correlated, respectively, with long intrinsically disordered regions. This paper describes ~90 Swiss-Prot keywords attributed to the cellular components, domains, technical terms, developmental processes and coding sequence diversities possessing strong positive and negative correlation with long disordered regions. PMID:17391015

  8. Ultra Deep Sequencing of a Baculovirus Population Reveals Widespread Genomic Variations

    Directory of Open Access Journals (Sweden)

    Aurélien Chateigner

    2015-07-01

    Full Text Available Viruses rely on widespread genetic variation and large population size for adaptation. Large DNA virus populations are thought to harbor little variation though natural populations may be polymorphic. To measure the genetic variation present in a dsDNA virus population, we deep sequenced a natural strain of the baculovirus Autographa californica multiple nucleopolyhedrovirus. With 124,221X average genome coverage of our 133,926 bp long consensus, we could detect low frequency mutations (0.025%. K-means clustering was used to classify the mutations in four categories according to their frequency in the population. We found 60 high frequency non-synonymous mutations under balancing selection distributed in all functional classes. These mutants could alter viral adaptation dynamics, either through competitive or synergistic processes. Lastly, we developed a technique for the delimitation of large deletions in next generation sequencing data. We found that large deletions occur along the entire viral genome, with hotspots located in homologous repeat regions (hrs. Present in 25.4% of the genomes, these deletion mutants presumably require functional complementation to complete their infection cycle. They might thus have a large impact on the fitness of the baculovirus population. Altogether, we found a wide breadth of genomic variation in the baculovirus population, suggesting it has high adaptive potential.

  9. Comparative analyses of six solanaceous transcriptomes reveal a high degree of sequence conservation and species-specific transcripts

    Directory of Open Access Journals (Sweden)

    Ouyang Shu

    2005-09-01

    Full Text Available Abstract Background The Solanaceae is a family of closely related species with diverse phenotypes that have been exploited for agronomic purposes. Previous studies involving a small number of genes suggested sequence conservation across the Solanaceae. The availability of large collections of Expressed Sequence Tags (ESTs for the Solanaceae now provides the opportunity to assess sequence conservation and divergence on a genomic scale. Results All available ESTs and Expressed Transcripts (ETs, 449,224 sequences for six Solanaceae species (potato, tomato, pepper, petunia, tobacco and Nicotiana benthamiana, were clustered and assembled into gene indices. Examination of gene ontologies revealed that the transcripts within the gene indices encode a similar suite of biological processes. Although the ESTs and ETs were derived from a variety of tissues, 55–81% of the sequences had significant similarity at the nucleotide level with sequences among the six species. Putative orthologs could be identified for 28–58% of the sequences. This high degree of sequence conservation was supported by expression profiling using heterologous hybridizations to potato cDNA arrays that showed similar expression patterns in mature leaves for all six solanaceous species. 16–19% of the transcripts within the six Solanaceae gene indices did not have matches among Solanaceae, Arabidopsis, rice or 21 other plant gene indices. Conclusion Results from this genome scale analysis confirmed a high level of sequence conservation at the nucleotide level of the coding sequence among Solanaceae. Additionally, the results indicated that part of the Solanaceae transcriptome is likely to be unique for each species.

  10. 16S-23S rDNA intergenic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis.

    Science.gov (United States)

    Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo

    2002-12-01

    The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.

  11. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  12. Nucleotide sequences of the cDNAs encoding the V-regions of H- and L-chains of a human monoclonal antibody with broad reactivity to malignant tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)

    1989-06-12

    The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.

  13. Evolution of naturally occurring 5'non-coding region variants of Hepatitis C virus in human populations of the South American region

    Directory of Open Access Journals (Sweden)

    García-Aguirre Laura

    2007-08-01

    Full Text Available Abstract Background Hepatitis C virus (HCV has been the subject of intense research and clinical investigation as its major role in human disease has emerged. Previous and recent studies have suggested a diversification of type 1 HCV in the South American region. The degree of genetic variation among HCV strains circulating in Bolivia and Colombia is currently unknown. In order to get insight into these matters, we performed a phylogenetic analysis of HCV 5' non-coding region (5'NCR sequences from strains isolated in Bolivia, Colombia and Uruguay, as well as available comparable sequences of HCV strains isolated in South America. Methods Phylogenetic tree analysis was performed using the neighbor-joining method under a matrix of genetic distances established under the Kimura-two parameter model. Signature pattern analysis, which identifies particular sites in nucleic acid alignments of variable sequences that are distinctly representative relative to a background set, was performed using the method of Korber & Myers, as implemented in the VESPA program. Prediction of RNA secondary structures was done by the method of Zuker & Turner, as implemented in the mfold program. Results Phylogenetic tree analysis of HCV strains isolated in the South American region revealed the presence of a distinct genetic lineage inside genotype 1. Signature pattern analysis revealed that the presence of this lineage is consistent with the presence of a sequence signature in the 5'NCR of HCV strains isolated in South America. Comparisons of these results with the ones found for Europe or North America revealed that this sequence signature is characteristic of the South American region. Conclusion Phylogentic analysis revealed the presence of a sequence signature in the 5'NCR of type 1 HCV strains isolated in South America. This signature is frequent enough in type 1 HCV populations circulating South America to be detected in a phylogenetic tree analysis as a distinct

  14. Mycobacterium malmesburyense sp. nov., a non-tuberculous species of the genus Mycobacterium revealed by multiple gene sequence characterization

    CSIR Research Space (South Africa)

    Gcebe, N

    2017-04-01

    Full Text Available Journal of Systematic and Evolutionary Microbiology: DOI 10.1099/ijsem.0.001678 Mycobacterium malmesburyense sp. nov., a non-tuberculous species of the genus Mycobacterium revealed by multiple gene sequence characterization Gcebe N Rutten V Gey...

  15. Secondary structure of the rRNA ITS2 region reveals key evolutionary patterns in acroporid corals.

    Science.gov (United States)

    Coleman, Annette W; van Oppen, Madeleine J H

    2008-10-01

    This study investigates the ribosomal RNA transcript secondary structure in corals as confirmed by compensatory base changes in Isopora/Acropora species. These species are unique versus all other corals in the absence of a eukaryote-wide conserved structural component, the helix III in internal transcriber spacer (ITS) 2, and their variability in the 5.8S-LSU helix basal to ITS2, a helix with pairings identical among all other scleractinian corals. Furthermore, Isopora/Acropora individuals display at least two, and as many as three, ITS sequence isotypes in their genome which appear to be capable of function. From consideration of the conserved elements in ITS2 and flanking regions, it appears that there are three major groups within the IsoporaAcropora lineage: the Isopora + Acropora "longi" group, the large group including Caribbean Acropora + the Acropora "carib" types plus the bulk of the Indo-Pacific Acropora species, and the remaining enigmatic "pseudo" group found in the Pacific. Interbreeding is possible among Caribbean A. palmata and A. cervicornis and among some species of Indo-Pacific Acropora. Recombinant ITS sequences are obvious among these latter, such that morphology (as represented by species name) does not correlate with common ITS sequence. The combination of characters revealed by RNA secondary structure analyses suggests a recent past/current history of interbreeding among the Indo-Pacific Acropora species and a shared ancestry of some of these with the Caribbean Acropora. The unusual absence of helix III of ITS2 of Isopora/Acropora species may have some causative role in the equally unusual instability in the 5.8S-LSU helix basal to ITS2 of this species complex.

  16. Genetic diversity of the captive Asian tapir population in Thailand, based on mitochondrial control region sequence data and the comparison of its nucleotide structure with Brazilian tapir.

    Science.gov (United States)

    Muangkram, Yuttamol; Amano, Akira; Wajjwalku, Worawidh; Pinyopummintr, Tanu; Thongtip, Nikorn; Kaolim, Nongnid; Sukmak, Manakorn; Kamolnorranath, Sumate; Siriaroonrat, Boripat; Tipkantha, Wanlaya; Maikaew, Umaporn; Thomas, Warisara; Polsrila, Kanda; Dongsaard, Kwanreaun; Sanannu, Saowaphang; Wattananorrasate, Anuwat

    2017-07-01

    The Asian tapir (Tapirus indicus) has been classified as Endangered on the IUCN Red List of Threatened Species (2008). Genetic diversity data provide important information for the management of captive breeding and conservation of this species. We analyzed mitochondrial control region (CR) sequences from 37 captive Asian tapirs in Thailand. Multiple alignments of the full-length CR sequences sized 1268 bp comprised three domains as described in other mammal species. Analysis of 16 parsimony-informative variable sites revealed 11 haplotypes. Furthermore, the phylogenetic analysis using median-joining network clearly showed three clades correlated with our earlier cytochrome b gene study in this endangered species. The repetitive motif is located between first and second conserved sequence blocks, similar to the Brazilian tapir. The highest polymorphic site was located in the extended termination associated sequences domain. The results could be applied for future genetic management based in captivity and wild that shows stable populations.

  17. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Maíra C. M. Freire

    2008-01-01

    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  18. Detection of Emerging Vaccine-Related Polioviruses by Deep Sequencing.

    Science.gov (United States)

    Sahoo, Malaya K; Holubar, Marisa; Huang, ChunHong; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Waggoner, Jesse J; Troy, Stephanie B; Garcia-Garcia, Lourdes; Ferreyra-Reyes, Leticia; Maldonado, Yvonne; Pinsky, Benjamin A

    2017-07-01

    Oral poliovirus vaccine can mutate to regain neurovirulence. To date, evaluation of these mutations has been performed primarily on culture-enriched isolates by using conventional Sanger sequencing. We therefore developed a culture-independent, deep-sequencing method targeting the 5' untranslated region (UTR) and P1 genomic region to characterize vaccine-related poliovirus variants. Error analysis of the deep-sequencing method demonstrated reliable detection of poliovirus mutations at levels of vaccinated, asymptomatic children and their close contacts collected during a prospective cohort study in Veracruz, Mexico, revealed no vaccine-derived polioviruses. This was expected given that the longest duration between sequenced sample collection and the end of the most recent national immunization week was 66 days. However, we identified many low-level variants (Sabin serotypes, as well as vaccine-related viruses with multiple canonical mutations associated with phenotypic reversion present at high levels (>90%). These results suggest that monitoring emerging vaccine-related poliovirus variants by deep sequencing may aid in the poliovirus endgame and efforts to ensure global polio eradication. Copyright © 2017 Sahoo et al.

  19. Genome analysis of Excretory/Secretory proteins in Taenia solium reveals their Abundance of Antigenic Regions (AAR).

    Science.gov (United States)

    Gomez, Sandra; Adalid-Peralta, Laura; Palafox-Fonseca, Hector; Cantu-Robles, Vito Adrian; Soberón, Xavier; Sciutto, Edda; Fragoso, Gladis; Bobes, Raúl J; Laclette, Juan P; Yauner, Luis del Pozo; Ochoa-Leyva, Adrián

    2015-05-19

    Excretory/Secretory (ES) proteins play an important role in the host-parasite interactions. Experimental identification of ES proteins is time-consuming and expensive. Alternative bioinformatics approaches are cost-effective and can be used to prioritize the experimental analysis of therapeutic targets for parasitic diseases. Here we predicted and functionally annotated the ES proteins in T. solium genome using an integration of bioinformatics tools. Additionally, we developed a novel measurement to evaluate the potential antigenicity of T. solium secretome using sequence length and number of antigenic regions of ES proteins. This measurement was formalized as the Abundance of Antigenic Regions (AAR) value. AAR value for secretome showed a similar value to that obtained for a set of experimentally determined antigenic proteins and was different to the calculated value for the non-ES proteins of T. solium genome. Furthermore, we calculated the AAR values for known helminth secretomes and they were similar to that obtained for T. solium. The results reveal the utility of AAR value as a novel genomic measurement to evaluate the potential antigenicity of secretomes. This comprehensive analysis of T. solium secretome provides functional information for future experimental studies, including the identification of novel ES proteins of therapeutic, diagnosis and immunological interest.

  20. Nucleotide sequence of soybean chloroplast DNA regions which contain the psb A and trn H genes and cover the ends of the large single copy region and one end of the inverted repeats.

    Science.gov (United States)

    Spielmann, A; Stutz, E

    1983-10-25

    The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.

  1. The complete chloroplast genome sequence of Euonymus japonicus (Celastraceae).

    Science.gov (United States)

    Choi, Kyoung Su; Park, SeonJoo

    2016-09-01

    The complete chloroplast (cp) genome sequence of the Euonymus japonicus, the first sequenced of the genus Euonymus, was reported in this study. The total length was 157 637 bp, containing a pair of 26 678 bp inverted repeat region (IR), which were separated by small single copy (SSC) region and large single copy (LSC) region of 18 340 bp and 85 941 bp, respectively. This genome contains 107 unique genes, including 74 coding genes, four rRNA genes, and 29 tRNA genes. Seventeen genes contain intron of E. japonicus, of which three genes (clpP, ycf3, and rps12) include two introns. The maximum likelihood (ML) phylogenetic analysis revealed that E. japonicus was closely related to Manihot and Populus.

  2. The genetic diversity of genus Bacillus and the related genera revealed by 16S rRNA gene sequences and ardra analyses isolated from geothermal regions of turkey

    Directory of Open Access Journals (Sweden)

    Arzu Coleri Cihan

    2012-03-01

    Full Text Available Previously isolated 115 endospore-forming bacilli were basically grouped according to their temperature requirements for growth: the thermophiles (74%, the facultative thermophiles (14% and the mesophiles (12%. These isolates were taken into 16S rRNA gene sequence analyses, and they were clustered among the 7 genera: Anoxybacillus, Aeribacillus, Bacillus, Brevibacillus, Geobacillus, Paenibacillus, and Thermoactinomycetes. Of these bacilli, only the thirty two isolates belonging to genera Bacillus (16, Brevibacillus (13, Paenibacillus (1 and Thermoactinomycetes (2 were selected and presented in this paper. The comparative sequence analyses revealed that the similarity values were ranged as 91.4-100 %, 91.8- 99.2 %, 92.6- 99.8 % and 90.7 - 99.8 % between the isolates and the related type strains from these four genera, respectively. Twenty nine of them were found to be related with the validly published type strains. The most abundant species was B. thermoruber with 9 isolates followed by B. pumilus (6, B. lichenformis (3, B. subtilis (3, B. agri (3, B. smithii (2, T. vulgaris (2 and finally P. barengoltzii (1. In addition, isolates of A391a, B51a and D295 were proposed as novel species as their 16S rRNA gene sequences displayed similarities ≤ 97% to their closely related type strains. The AluI-, HaeIII- and TaqI-ARDRA results were in congruence with the 16S rRNA gene sequence analyses. The ARDRA results allowed us to differentiate these isolates, and their discriminative restriction fragments were able to be determined. Some of their phenotypic characters and their amylase, chitinase and protease production were also studied and biotechnologically valuable enzyme producing isolates were introduced in order to use in further studies.

  3. RNA expression in a cartilaginous fish cell line reveals ancient 3′ noncoding regions highly conserved in vertebrates

    Science.gov (United States)

    Forest, David; Nishikawa, Ryuhei; Kobayashi, Hiroshi; Parton, Angela; Bayne, Christopher J.; Barnes, David W.

    2007-01-01

    We have established a cartilaginous fish cell line [Squalus acanthias embryo cell line (SAE)], a mesenchymal stem cell line derived from the embryo of an elasmobranch, the spiny dogfish shark S. acanthias. Elasmobranchs (sharks and rays) first appeared >400 million years ago, and existing species provide useful models for comparative vertebrate cell biology, physiology, and genomics. Comparative vertebrate genomics among evolutionarily distant organisms can provide sequence conservation information that facilitates identification of critical coding and noncoding regions. Although these genomic analyses are informative, experimental verification of functions of genomic sequences depends heavily on cell culture approaches. Using ESTs defining mRNAs derived from the SAE cell line, we identified lengthy and highly conserved gene-specific nucleotide sequences in the noncoding 3′ UTRs of eight genes involved in the regulation of cell growth and proliferation. Conserved noncoding 3′ mRNA regions detected by using the shark nucleotide sequences as a starting point were found in a range of other vertebrate orders, including bony fish, birds, amphibians, and mammals. Nucleotide identity of shark and human in these regions was remarkably well conserved. Our results indicate that highly conserved gene sequences dating from the appearance of jawed vertebrates and representing potential cis-regulatory elements can be identified through the use of cartilaginous fish as a baseline. Because the expression of genes in the SAE cell line was prerequisite for their identification, this cartilaginous fish culture system also provides a physiologically valid tool to test functional hypotheses on the role of these ancient conserved sequences in comparative cell biology. PMID:17227856

  4. DNA sequence analyses reveal abundant diversity, endemism and evidence for Asian origin of the porcini mushrooms.

    Directory of Open Access Journals (Sweden)

    Bang Feng

    Full Text Available The wild gourmet mushroom Boletus edulis and its close allies are of significant ecological and economic importance. They are found throughout the Northern Hemisphere, but despite their ubiquity there are still many unresolved issues with regard to the taxonomy, systematics and biogeography of this group of mushrooms. Most phylogenetic studies of Boletus so far have characterized samples from North America and Europe and little information is available on samples from other areas, including the ecologically and geographically diverse regions of China. Here we analyzed DNA sequence variation in three gene markers from samples of these mushrooms from across China and compared our findings with those from other representative regions. Our results revealed fifteen novel phylogenetic species (about one-third of the known species and a newly identified lineage represented by Boletus sp. HKAS71346 from tropical Asia. The phylogenetic analyses support eastern Asia as the center of diversity for the porcini sensu stricto clade. Within this clade, B. edulis is the only known holarctic species. The majority of the other phylogenetic species are geographically restricted in their distributions. Furthermore, molecular dating and geological evidence suggest that this group of mushrooms originated during the Eocene in eastern Asia, followed by dispersal to and subsequent speciation in other parts of Asia, Europe, and the Americas from the middle Miocene through the early Pliocene. In contrast to the ancient dispersal of porcini in the strict sense in the Northern Hemisphere, the occurrence of B. reticulatus and B. edulis sensu lato in the Southern Hemisphere was probably due to recent human-mediated introductions.

  5. DNA Sequence Analyses Reveal Abundant Diversity, Endemism and Evidence for Asian Origin of the Porcini Mushrooms

    Science.gov (United States)

    Feng, Bang; Xu, Jianping; Wu, Gang; Zeng, Nian-Kai; Li, Yan-Chun; Tolgor, Bau; Kost, Gerhard W.; Yang, Zhu L.

    2012-01-01

    The wild gourmet mushroom Boletus edulis and its close allies are of significant ecological and economic importance. They are found throughout the Northern Hemisphere, but despite their ubiquity there are still many unresolved issues with regard to the taxonomy, systematics and biogeography of this group of mushrooms. Most phylogenetic studies of Boletus so far have characterized samples from North America and Europe and little information is available on samples from other areas, including the ecologically and geographically diverse regions of China. Here we analyzed DNA sequence variation in three gene markers from samples of these mushrooms from across China and compared our findings with those from other representative regions. Our results revealed fifteen novel phylogenetic species (about one-third of the known species) and a newly identified lineage represented by Boletus sp. HKAS71346 from tropical Asia. The phylogenetic analyses support eastern Asia as the center of diversity for the porcini sensu stricto clade. Within this clade, B. edulis is the only known holarctic species. The majority of the other phylogenetic species are geographically restricted in their distributions. Furthermore, molecular dating and geological evidence suggest that this group of mushrooms originated during the Eocene in eastern Asia, followed by dispersal to and subsequent speciation in other parts of Asia, Europe, and the Americas from the middle Miocene through the early Pliocene. In contrast to the ancient dispersal of porcini in the strict sense in the Northern Hemisphere, the occurrence of B. reticulatus and B. edulis sensu lato in the Southern Hemisphere was probably due to recent human-mediated introductions. PMID:22629418

  6. Combining genomic sequencing methods to explore viral diversity and reveal potential virus-host interactions

    Directory of Open Access Journals (Sweden)

    Cheryl-Emiliane Tien Chow

    2015-04-01

    Full Text Available Viral diversity and virus-host interactions in oxygen-starved regions of the ocean, also known as oxygen minimum zones (OMZs, remain relatively unexplored. Microbial community metabolism in OMZs alters nutrient and energy flow through marine food webs, resulting in biological nitrogen loss and greenhouse gas production. Thus, viruses infecting OMZ microbes have the potential to modulate community metabolism with resulting feedback on ecosystem function. Here, we describe viral communities inhabiting oxic surface (10m and oxygen-starved basin (200m waters of Saanich Inlet, a seasonally anoxic fjord on the coast of Vancouver Island, British Columbia using viral metagenomics and complete viral fosmid sequencing on samples collected between April 2007 and April 2010. Of 6459 open reading frames (ORFs predicted across all 34 viral fosmids, 77.6% (n=5010 had no homology to reference viral genomes. These fosmids recruited a higher proportion of viral metagenomic sequences from Saanich Inlet than from nearby northeastern subarctic Pacific Ocean (Line P waters, indicating differences in the viral communities between coastal and open ocean locations. While functional annotations of fosmid ORFs were limited, recruitment to NCBI’s non-redundant ‘nr’ database and publicly available single-cell genomes identified putative viruses infecting marine thaumarchaeal and SUP05 proteobacteria to provide potential host linkages with relevance to coupled biogeochemical cycling processes in OMZ waters. Taken together, these results highlight the power of coupled analyses of multiple sequence data types, such as viral metagenomic and fosmid sequence data with prokaryotic single cell genomes, to chart viral diversity, elucidate genomic and ecological contexts for previously unclassifiable viral sequences, and identify novel host interactions in natural and engineered ecosystems.

  7. De novo Transcriptome Sequencing Reveals a Considerable Bias in the Incidence of Simple Sequence Repeats towards the Downstream of ‘Pre-miRNAs’ of Black Pepper

    Science.gov (United States)

    Joy, Nisha; Asha, Srinivasan; Mallika, Vijayan; Soniya, Eppurathu Vasudevan

    2013-01-01

    Next generation sequencing has an advantageon transformational development of species with limited available sequence data as it helps to decode the genome and transcriptome. We carried out the de novo sequencing using illuminaHiSeq™ 2000 to generate the first leaf transcriptome of black pepper (Piper nigrum L.), an important spice variety native to South India and also grown in other tropical regions. Despite the economic and biochemical importance of pepper, a scientifically rigorous study at the molecular level is far from complete due to lack of sufficient sequence information and cytological complexity of its genome. The 55 million raw reads obtained, when assembled using Trinity program generated 2,23,386 contigs and 1,28,157 unigenes. Reports suggest that the repeat-rich genomic regions give rise to small non-coding functional RNAs. MicroRNAs (miRNAs) are the most abundant type of non-coding regulatory RNAs. In spite of the widespread research on miRNAs, little is known about the hair-pin precursors of miRNAs bearing Simple Sequence Repeats (SSRs). We used the array of transcripts generated, for the in silico prediction and detection of ‘43 pre-miRNA candidates bearing different types of SSR motifs’. The analysis identified 3913 different types of SSR motifs with an average of one SSR per 3.04 MB of thetranscriptome. About 0.033% of the transcriptome constituted ‘pre-miRNA candidates bearing SSRs’. The abundance, type and distribution of SSR motifs studied across the hair-pin miRNA precursors, showed a significant bias in the position of SSRs towards the downstream of predicted ‘pre-miRNA candidates’. The catalogue of transcripts identified, together with the demonstration of reliable existence of SSRs in the miRNA precursors, permits future opportunities for understanding the genetic mechanism of black pepper and likely functions of ‘tandem repeats’ in miRNAs. PMID:23469176

  8. Capillary electrophoresis of Big-Dye terminator sequencing reactions for human mtDNA Control Region haplotyping in the identification of human remains.

    Science.gov (United States)

    Montesino, Marta; Prieto, Lourdes

    2012-01-01

    Cycle sequencing reaction with Big-Dye terminators provides the methodology to analyze mtDNA Control Region amplicons by means of capillary electrophoresis. DNA sequencing with ddNTPs or terminators was developed by (1). The progressive automation of the method by combining the use of fluorescent-dye terminators with cycle sequencing has made it possible to increase the sensibility and efficiency of the method and hence has allowed its introduction into the forensic field. PCR-generated mitochondrial DNA products are the templates for sequencing reactions. Different set of primers can be used to generate amplicons with different sizes according to the quality and quantity of the DNA extract providing sequence data for different ranges inside the Control Region.

  9. Genomic library screening for viruses from the human dental plaque revealed pathogen-specific lytic phage sequences.

    Science.gov (United States)

    Al-Jarbou, Ahmed Nasser

    2012-01-01

    Bacterial pathogenesis presents an astounding arsenal of virulence factors that allow them to conquer many different niches throughout the course of infection. Principally fascinating is the fact that some bacterial species are able to induce different diseases by expression of different combinations of virulence factors. Nevertheless, studies aiming at screening for the presence of bacteriophages in humans have been limited. Such screening procedures would eventually lead to identification of phage-encoded properties that impart increased bacterial fitness and/or virulence in a particular niche, and hence, would potentially be used to reverse the course of bacterial infections. As the human oral cavity represents a rich and dynamic ecosystem for several upper respiratory tract pathogens. However, little is known about virus diversity in human dental plaque which is an important reservoir. We applied the culture-independent approach to characterize virus diversity in human dental plaque making a library from a virus DNA fraction amplified using a multiple displacement method and sequenced 80 clones. The resulting sequence showed 44% significant identities to GenBank databases by TBLASTX analysis. TBLAST homology comparisons showed that 66% was viral; 18% eukarya; 10% bacterial; 6% mobile elements. These sequences were sorted into 6 contigs and 45 single sequences in which 4 contigs and a single sequence showed significant identity to a small region of a putative prophage in the Corynebacterium diphtheria genome. These findings interestingly highlight the uniqueness of over half of the sequences, whilst the dominance of a pathogen-specific prophage sequences imply their role in virulence.

  10. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    Science.gov (United States)

    Hoy, Marshal S.; Rodriguez, Rusty J.

    2013-01-01

    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  11. Phylogenetic relationships within the cyst-forming nematodes (Nematoda, Heteroderidae) based on analysis of sequences from the ITS regions of ribosomal DNA.

    Science.gov (United States)

    Subbotin, S A; Vierstraete, A; De Ley, P; Rowe, J; Waeyenberge, L; Moens, M; Vanfleteren, J R

    2001-10-01

    The ITS1, ITS2, and 5.8S gene sequences of nuclear ribosomal DNA from 40 taxa of the family Heteroderidae (including the genera Afenestrata, Cactodera, Heterodera, Globodera, Punctodera, Meloidodera, Cryphodera, and Thecavermiculatus) were sequenced and analyzed. The ITS regions displayed high levels of sequence divergence within Heteroderinae and compared to outgroup taxa. Unlike recent findings in root knot nematodes, ITS sequence polymorphism does not appear to complicate phylogenetic analysis of cyst nematodes. Phylogenetic analyses with maximum-parsimony, minimum-evolution, and maximum-likelihood methods were performed with a range of computer alignments, including elision and culled alignments. All multiple alignments and phylogenetic methods yielded similar basic structure for phylogenetic relationships of Heteroderidae. The cyst-forming nematodes are represented by six main clades corresponding to morphological characters and host specialization, with certain clades assuming different positions depending on alignment procedure and/or method of phylogenetic inference. Hypotheses of monophyly of Punctoderinae and Heteroderinae are, respectively, strongly and moderately supported by the ITS data across most alignments. Close relationships were revealed between the Avenae and the Sacchari groups and between the Humuli group and the species H. salixophila within Heteroderinae. The Goettingiana group occupies a basal position within this subfamily. The validity of the genera Afenestrata and Bidera was tested and is discussed based on molecular data. We conclude that ITS sequence data are appropriate for studies of relationships within the different species groups and less so for recovery of more ancient speciations within Heteroderidae. Copyright 2001 Academic Press.

  12. WildSpan: mining structured motifs from protein sequences

    Directory of Open Access Journals (Sweden)

    Chen Chien-Yu

    2011-03-01

    of WildSpan is developed for discovering functional regions of a single protein by referring to a set of related sequences (e.g. its homologues. The discovered W-patterns are used to characterize the protein sequence and the results are compared with the conserved positions identified by multiple sequence alignment (MSA. The family-based mining mode of WildSpan is developed for extracting sequence signatures for a group of related proteins (e.g. a protein family for protein function classification. In this situation, the discovered W-patterns are compared with PROSITE patterns as well as the patterns generated by three existing methods performing the similar task. Finally, analysis on execution time of running WildSpan reveals that the proposed pruning strategy is effective in improving the scalability of the proposed algorithm. Conclusions The mining results conducted in this study reveal that WildSpan is efficient and effective in discovering functional signatures of proteins directly from sequences. The proposed pruning strategy is effective in improving the scalability of WildSpan. It is demonstrated in this study that the W-patterns discovered by WildSpan provides useful information in characterizing protein sequences. The WildSpan executable and open source codes are available on the web (http://biominer.csie.cyu.edu.tw/wildspan.

  13. V(D)J recombination frequency is affected by the sequence interposed between a pair of recombination signals: sequence comparison reveals a putative recombinational enhancer element

    DEFF Research Database (Denmark)

    Roch, F A; Hobi, R; Berchtold, M W

    1997-01-01

    respectively, can markedly affect the frequency of V(D)J recombination. We report that the entire Emu, the Emu core as well as its flanking 5' and 3' matrix associated regions (5' and 3' MARs) upregulate V(D)J recombination while the downstream section of the 3' MAR of Emu does not. Also, prokaryotic sequences...

  14. Hydraulic fracturing and the Crooked Lake Sequences: Insights gleaned from regional seismic networks

    Science.gov (United States)

    Schultz, Ryan; Stern, Virginia; Novakovic, Mark; Atkinson, Gail; Gu, Yu Jeffrey

    2015-04-01

    Within central Alberta, Canada, a new sequence of earthquakes has been recognized as of 1 December 2013 in a region of previous seismic quiescence near Crooked Lake, ~30 km west of the town of Fox Creek. We utilize a cross-correlation detection algorithm to detect more than 160 events to the end of 2014, which is temporally distinguished into five subsequences. This observation is corroborated by the uniqueness of waveforms clustered by subsequence. The Crooked Lake Sequences have come under scrutiny due to its strong temporal correlation (>99.99%) to the timing of hydraulic fracturing operations in the Duvernay Formation. We assert that individual subsequences are related to fracturing stimulation and, despite adverse initial station geometry, double-difference techniques allow us to spatially relate each cluster back to a unique horizontal well. Overall, we find that seismicity in the Crooked Lake Sequences is consistent with first-order observations of hydraulic fracturing induced seismicity.

  15. Deep sequencing reveals exceptional diversity and modes of transmission for bacterial sponge symbionts.

    Science.gov (United States)

    Webster, Nicole S; Taylor, Michael W; Behnam, Faris; Lücker, Sebastian; Rattei, Thomas; Whalan, Stephen; Horn, Matthias; Wagner, Michael

    2010-08-01

    Marine sponges contain complex bacterial communities of considerable ecological and biotechnological importance, with many of these organisms postulated to be specific to sponge hosts. Testing this hypothesis in light of the recent discovery of the rare microbial biosphere, we investigated three Australian sponges by massively parallel 16S rRNA gene tag pyrosequencing. Here we show bacterial diversity that is unparalleled in an invertebrate host, with more than 250,000 sponge-derived sequence tags being assigned to 23 bacterial phyla and revealing up to 2996 operational taxonomic units (95% sequence similarity) per sponge species. Of the 33 previously described 'sponge-specific' clusters that were detected in this study, 48% were found exclusively in adults and larvae - implying vertical transmission of these groups. The remaining taxa, including 'Poribacteria', were also found at very low abundance among the 135,000 tags retrieved from surrounding seawater. Thus, members of the rare seawater biosphere may serve as seed organisms for widely occurring symbiont populations in sponges and their host association might have evolved much more recently than previously thought. © 2009 Society for Applied Microbiology and Blackwell Publishing Ltd.

  16. 454 sequencing reveals extreme complexity of the class II Major Histocompatibility Complex in the collared flycatcher

    Directory of Open Access Journals (Sweden)

    Gustafsson Lars

    2010-12-01

    Full Text Available Abstract Background Because of their functional significance, the Major Histocompatibility Complex (MHC class I and II genes have been the subject of continuous interest in the fields of ecology, evolution and conservation. In some vertebrate groups MHC consists of multiple loci with similar alleles; therefore, the multiple loci must be genotyped simultaneously. In such complex systems, understanding of the evolutionary patterns and their causes has been limited due to challenges posed by genotyping. Results Here we used 454 amplicon sequencing to characterize MHC class IIB exon 2 variation in the collared flycatcher, an important organism in evolutionary and immuno-ecological studies. On the basis of over 152,000 sequencing reads we identified 194 putative alleles in 237 individuals. We found an extreme complexity of the MHC class IIB in the collared flycatchers, with our estimates pointing to the presence of at least nine expressed loci and a large, though difficult to estimate precisely, number of pseudogene loci. Many similar alleles occurred in the pseudogenes indicating either a series of recent duplications or extensive concerted evolution. The expressed alleles showed unambiguous signals of historical selection and the occurrence of apparent interlocus exchange of alleles. Placing the collared flycatcher's MHC sequences in the context of passerine diversity revealed transspecific MHC class II evolution within the Muscicapidae family. Conclusions 454 amplicon sequencing is an effective tool for advancing our understanding of the MHC class II structure and evolutionary patterns in Passeriformes. We found a highly dynamic pattern of evolution of MHC class IIB genes with strong signals of selection and pronounced sequence divergence in expressed genes, in contrast to the apparent sequence homogenization in pseudogenes. We show that next generation sequencing offers a universal, affordable method for the characterization and, in perspective

  17. Targeted exome sequencing reveals novel USH2A mutations in Chinese patients with simplex Usher syndrome.

    Science.gov (United States)

    Shu, Hai-Rong; Bi, Huai; Pan, Yang-Chun; Xu, Hang-Yu; Song, Jian-Xin; Hu, Jie

    2015-09-16

    Usher syndrome (USH) is an autosomal recessive disorder characterized by hearing impairment and vision dysfunction due to retinitis pigmentosa. Phenotypic and genetic heterogeneities of this disease make it impractical to obtain a genetic diagnosis by conventional Sanger sequencing. In this study, we applied a next-generation sequencing approach to detect genetic abnormalities in patients with USH. Two unrelated Chinese families were recruited, consisting of two USH afflicted patients and four unaffected relatives. We selected 199 genes related to inherited retinal diseases as targets for deep exome sequencing. Through systematic data analysis using an established bioinformatics pipeline, all variants that passed filter criteria were validated by Sanger sequencing and co-segregation analysis. A homozygous frameshift mutation (c.4382delA, p.T1462Lfs*2) was revealed in exon20 of gene USH2A in the F1 family. Two compound heterozygous mutations, IVS47 + 1G > A and c.13156A > T (p.I4386F), located in intron 48 and exon 63 respectively, of USH2A, were identified as causative mutations for the F2 family. Of note, the missense mutation c.13156A > T has not been reported so far. In conclusion, targeted exome sequencing precisely and rapidly identified the genetic defects in two Chinese USH families and this technique can be applied as a routine examination for these disorders with significant clinical and genetic heterogeneity.

  18. Seasonal changes in the communities of photosynthetic picoeukaryotes in Ofunato Bay as revealed by shotgun metagenomic sequencing

    KAUST Repository

    Rashid, Jonaira; Kobiyama, Atsushi; Reza, Md. Shaheed; Yamada, Yuichiro; Ikeda, Yuri; Ikeda, Daisuke; Mizusawa, Nanami; Ikeo, Kazuho; Sato, Shigeru; Ogata, Takehiko; Kudo, Toshiaki; Kaga, Shinnosuke; Watanabe, Shiho; Naiki, Kimiaki; Kaga, Yoshimasa; Mineta, Katsuhiko; Bajic, Vladimir B.; Gojobori, Takashi; Watabe, Shugo

    2018-01-01

    Small photosynthetic eukaryotes play important roles in oceanic food webs in coastal regions. We investigated seasonal changes in the communities of photosynthetic picoeukaryotes (PPEs) of the class Mamiellophyceae, including the genera Bathycoccus, Micromonas and Ostreococcus, in Ofunato Bay, which is located in northeastern Japan and faces the Pacific Ocean. The abundances of PPEs were assessed over a period of one year in 2015 at three sampling stations, KSt. 1 (innermost bay area), KSt. 2 (middle bay area) and KSt. 3 (bay entrance area) at depths of 1 m (KSt. 1, KSt. 2 and KSt. 3), 8 m (KSt. 1) or 10 m (KSt. 2 and KSt. 3) by employing MiSeq shotgun metagenomic sequencing. The total abundances of Bathycoccus, Ostreococcus and Micromonas were in the ranges of 42–49%, 35–49% and 13–17%, respectively. Considering all assayed sampling stations and depths, seasonal changes revealed high abundances of PPEs during the winter and summer and low abundances during late winter to early spring and late summer to early autumn. Bathycoccus was most abundant in the winter, and Ostreococcus showed a high abundance during the summer. Another genus, Micromonas, was relatively low in abundance throughout the study period. Taken together with previously suggested blooming periods of phytoplankton, as revealed by chlorophyll a concentrations in Ofunato Bay during spring and late autumn, these results for PPEs suggest that greater phytoplankton blooming has a negative influence on the seasonal occurrences of PPEs in the bay.

  19. Seasonal changes in the communities of photosynthetic picoeukaryotes in Ofunato Bay as revealed by shotgun metagenomic sequencing

    KAUST Repository

    Rashid, Jonaira

    2018-04-30

    Small photosynthetic eukaryotes play important roles in oceanic food webs in coastal regions. We investigated seasonal changes in the communities of photosynthetic picoeukaryotes (PPEs) of the class Mamiellophyceae, including the genera Bathycoccus, Micromonas and Ostreococcus, in Ofunato Bay, which is located in northeastern Japan and faces the Pacific Ocean. The abundances of PPEs were assessed over a period of one year in 2015 at three sampling stations, KSt. 1 (innermost bay area), KSt. 2 (middle bay area) and KSt. 3 (bay entrance area) at depths of 1 m (KSt. 1, KSt. 2 and KSt. 3), 8 m (KSt. 1) or 10 m (KSt. 2 and KSt. 3) by employing MiSeq shotgun metagenomic sequencing. The total abundances of Bathycoccus, Ostreococcus and Micromonas were in the ranges of 42–49%, 35–49% and 13–17%, respectively. Considering all assayed sampling stations and depths, seasonal changes revealed high abundances of PPEs during the winter and summer and low abundances during late winter to early spring and late summer to early autumn. Bathycoccus was most abundant in the winter, and Ostreococcus showed a high abundance during the summer. Another genus, Micromonas, was relatively low in abundance throughout the study period. Taken together with previously suggested blooming periods of phytoplankton, as revealed by chlorophyll a concentrations in Ofunato Bay during spring and late autumn, these results for PPEs suggest that greater phytoplankton blooming has a negative influence on the seasonal occurrences of PPEs in the bay.

  20. MULTILOCUS SEQUENCE TYPING OF BRUCELLA ISOLATES FROM THAILAND.

    Science.gov (United States)

    Chawjiraphan, Wireeya; Sonthayanon, Piengchan; Chanket, Phanita; Benjathummarak, Surachet; Kerdsin, Anusak; Kalambhaheti, Thareerat

    2016-11-01

    Although brucellosis outbreaks in Thailand are rare, they cause abortions and infertility in animals, resulting in significant economic loss. Because Brucella spp display > 90% DNA homology, multilocus sequence typing (MLST) was employed to categorize local Brucella isolates into sequence types (STs) and to determine their genetic relatedness. Brucella samples were isolated from vaginal secretion of cows and goats, and from blood cultures of infected individuals. Brucella species were determined by multiplex PCR of eight loci, in addition to MLST based on partial DNA sequences of nine house-keeping genes. MLST analysis of 36 isolates revealed 78 distinct novel allele types and 34 novel STs, while two isolates possessed the known ST8. Sequence alignments identified polymorphic sites in each allele, ranging from 2-6%, while overall genetic diversity was 3.6%. MLST analysis of the 36 Brucella isolates classified them into three species, namely, B. melitensis, B. abortus and B. suis, in agreement with multiplex PCR results. Genetic relatedness among ST members of B. melitensis and B. abortus determined by eBURST program revealed ST2 as founder of B. abortus isolates and ST8 the founder of B. melitensis isolates. ST 36, 41 and 50 of Thai Brucella isolates were identified as single locus variants of clonal cluster (CC) 8, while the majority of STs were diverse. The genetic diversity and relatedness identified using MLST revealed hitherto unexpected diversity among Thai Brucella isolates. Genetic classification of isolates could reveal the route of brucellosis transmission among humans and farm animals and also reveal their relationship with other isolates in the region and other parts of the world.

  1. Genomic multiple sequence alignments: refinement using a genetic algorithm

    Directory of Open Access Journals (Sweden)

    Lefkowitz Elliot J

    2005-08-01

    Full Text Available Abstract Background Genomic sequence data cannot be fully appreciated in isolation. Comparative genomics – the practice of comparing genomic sequences from different species – plays an increasingly important role in understanding the genotypic differences between species that result in phenotypic differences as well as in revealing patterns of evolutionary relationships. One of the major challenges in comparative genomics is producing a high-quality alignment between two or more related genomic sequences. In recent years, a number of tools have been developed for aligning large genomic sequences. Most utilize heuristic strategies to identify a series of strong sequence similarities, which are then used as anchors to align the regions between the anchor points. The resulting alignment is globally correct, but in many cases is suboptimal locally. We describe a new program, GenAlignRefine, which improves the overall quality of global multiple alignments by using a genetic algorithm to improve local regions of alignment. Regions of low quality are identified, realigned using the program T-Coffee, and then refined using a genetic algorithm. Because a better COFFEE (Consistency based Objective Function For alignmEnt Evaluation score generally reflects greater alignment quality, the algorithm searches for an alignment that yields a better COFFEE score. To improve the intrinsic slowness of the genetic algorithm, GenAlignRefine was implemented as a parallel, cluster-based program. Results We tested the GenAlignRefine algorithm by running it on a Linux cluster to refine sequences from a simulation, as well as refine a multiple alignment of 15 Orthopoxvirus genomic sequences approximately 260,000 nucleotides in length that initially had been aligned by Multi-LAGAN. It took approximately 150 minutes for a 40-processor Linux cluster to optimize some 200 fuzzy (poorly aligned regions of the orthopoxvirus alignment. Overall sequence identity increased only

  2. Sequence evolution of the hypervariable region in the putative envelope region E2/NS1 of hepatitis C virus is correlated with specific humoral immune responses.

    OpenAIRE

    van Doorn, L J; Capriles, I; Maertens, G; DeLeys, R; Murray, K; Kos, T; Schellekens, H; Quint, W

    1995-01-01

    Sequence evolution of the hypervariable region 1 (HVR1) in the N terminus of E2/NS1 of hepatitis C virus (HCV) was studied retrospectively in six chimpanzees inoculated with the same genotype 1b strain, containing a unique predominant HVR1 sequence. Immediately after inoculation, all animals contained the same HVR predominant sequence. Two animals developed an acute self-limiting infection. Anti-HVR1 immunoglobulin G (IgG) was produced 40 to 60 days after inoculation and rapidly disappeared a...

  3. Implementing targeted region capture sequencing for the clinical detection of Alagille syndrome: An efficient and cost‑effective method.

    Science.gov (United States)

    Huang, Tianhong; Yang, Guilin; Dang, Xiao; Ao, Feijian; Li, Jiankang; He, Yizhou; Tang, Qiyuan; He, Qing

    2017-11-01

    Alagille syndrome (AGS) is a highly variable, autosomal dominant disease that affects multiple structures including the liver, heart, eyes, bones and face. Targeted region capture sequencing focuses on a panel of known pathogenic genes and provides a rapid, cost‑effective and accurate method for molecular diagnosis. In a Chinese family, this method was used on the proband and Sanger sequencing was applied to validate the candidate mutation. A de novo heterozygous mutation (c.3254_3255insT p.Leu1085PhefsX24) of the jagged 1 gene was identified as the potential disease‑causing gene mutation. In conclusion, the present study suggested that target region capture sequencing is an efficient, reliable and accurate approach for the clinical diagnosis of AGS. Furthermore, these results expand on the understanding of the pathogenesis of AGS.

  4. Ribosomal DNA sequence analysis of different geographically distributed Aloe Vera plants: Comparison with clonally regenerated plants

    International Nuclear Information System (INIS)

    Yagi, A.; Sato, Y.; Miwa, Y.; Kabbash, A.; Moustafa, S.; Shimomura, K.; El-Bassuony, A.

    2006-01-01

    A comparison of the sequences in an internally transcribed spacer (ITS) 1 region of rDNA between clonally regenerated A.vera and same species in Japan, USA and Egypt revealed the presence of two types of nucleotide sequences, 252 and 254 bps. Based on the findings in the ITS 1 region, A.vera having 252 and 254 bps clearly showed a stable sequence similarity, suggesting high conversation of the base peak sequence in the ITS 1 region. However, frequent base substitutions in the 252 bps samples leaves that came from callus tissue and micropropagated plants were observed around the regions of nucleotide positions 66, 99 and 199-201. The minor deviation in clonally regenerated A.vera may be due to the stage of regeneration and cell specification in cases of the callus tissue. In the present study, the base peak sequence of the Its 1 region of rDNA was adopted as a molecular marker for differentiating A.vera plants from geographically distributed and clonally regenerated A.vera plants and it was suggested that the base peak substitutions in the ITS 1 region may arise from the different nutritional and environmental factors in cultivation and plant growth stages. (author)

  5. Whole-exome sequencing reveals the spectrum of gene mutations and the clonal evolution patterns in paediatric acute myeloid leukaemia.

    Science.gov (United States)

    Shiba, Norio; Yoshida, Kenichi; Shiraishi, Yuichi; Okuno, Yusuke; Yamato, Genki; Hara, Yusuke; Nagata, Yasunobu; Chiba, Kenichi; Tanaka, Hiroko; Terui, Kiminori; Kato, Motohiro; Park, Myoung-Ja; Ohki, Kentaro; Shimada, Akira; Takita, Junko; Tomizawa, Daisuke; Kudo, Kazuko; Arakawa, Hirokazu; Adachi, Souichi; Taga, Takashi; Tawa, Akio; Ito, Etsuro; Horibe, Keizo; Sanada, Masashi; Miyano, Satoru; Ogawa, Seishi; Hayashi, Yasuhide

    2016-11-01

    Acute myeloid leukaemia (AML) is a molecularly and clinically heterogeneous disease. Targeted sequencing efforts have identified several mutations with diagnostic and prognostic values in KIT, NPM1, CEBPA and FLT3 in both adult and paediatric AML. In addition, massively parallel sequencing enabled the discovery of recurrent mutations (i.e. IDH1/2 and DNMT3A) in adult AML. In this study, whole-exome sequencing (WES) of 22 paediatric AML patients revealed mutations in components of the cohesin complex (RAD21 and SMC3), BCORL1 and ASXL2 in addition to previously known gene mutations. We also revealed intratumoural heterogeneities in many patients, implicating multiple clonal evolution events in the development of AML. Furthermore, targeted deep sequencing in 182 paediatric AML patients identified three major categories of recurrently mutated genes: cohesion complex genes [STAG2, RAD21 and SMC3 in 17 patients (8·3%)], epigenetic regulators [ASXL1/ASXL2 in 17 patients (8·3%), BCOR/BCORL1 in 7 patients (3·4%)] and signalling molecules. We also performed WES in four patients with relapsed AML. Relapsed AML evolved from one of the subclones at the initial phase and was accompanied by many additional mutations, including common driver mutations that were absent or existed only with lower allele frequency in the diagnostic samples, indicating a multistep process causing leukaemia recurrence. © 2016 John Wiley & Sons Ltd.

  6. Distinct genetic diversity of Oncomelania hupensis, intermediate host of Schistosoma japonicum in mainland China as revealed by ITS sequences.

    Directory of Open Access Journals (Sweden)

    Qin Ping Zhao

    Full Text Available BACKGROUND: Oncomelania hupensis is the unique intermediate host of Schistosoma japonicum, which causes schistosomiasis endemic in the Far East, and especially in mainland China. O. hupensis largely determines the parasite's geographical range. How O. hupensis's genetic diversity is distributed geographically in mainland China has never been well examined with DNA sequence data. METHODOLOGY/PRINCIPAL FINDINGS: In this study we investigate the genetic variation among O. hupensis from different geographical origins using the combined complete internal transcribed spacer 1 (ITS1 and ITS2 regions of nuclear ribosomal DNA. 165 O. hupensis isolates were obtained in 29 localities from 7 provinces across mainland China: lake/marshland and hill regions in Anhui, Hubei, Hunan, Jiangxi and Jiangsu provinces, located along the middle and lower reaches of Yangtze River, and mountainous regions in Sichuan and Yunnan provinces. Phylogenetic and haplotype network analyses showed distinct genetic diversity and no shared haplotypes between populations from lake/marshland regions of the middle and lower reaches of the Yangtze River and populations from mountainous regions of Sichuan and Yunnan provinces. The genetic distance between these two groups is up to 0.81 based on Fst, and branch time was estimated as 2-6 Ma. As revealed in the phylogenetic tree, snails from Sichuan and Yunnan provinces were also clustered separately. Geographical separation appears to be an important factor accounting for the diversification of the two groups of O. hupensis in mainland China, and probably for the separate clades between snails from Sichuan and Yunnan provinces. In lake/marshland and hill regions along the middle and lower reaches of the Yangtze River, three clades were identified in the phylogenetic tree, but without any obvious clustering of snails from different provinces. CONCLUSIONS: O. hupensis in mainland China may have considerable genetic diversity, and a more

  7. Comparative In silico Study of Sex-Determining Region Y (SRY) Protein Sequences Involved in Sex-Determining.

    Science.gov (United States)

    Vakili Azghandi, Masoume; Nasiri, Mohammadreza; Shamsa, Ali; Jalali, Mohsen; Shariati, Mohammad Mahdi

    2016-04-01

    The SRY gene (SRY) provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/) and MEGA6 softwares. The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale) and Tursiopsaduncus (dolphin) have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee) have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

  8. Whale phylogeny and rapid radiation events revealed using novel retroposed elements and their flanking sequences.

    Science.gov (United States)

    Chen, Zhuo; Xu, Shixia; Zhou, Kaiya; Yang, Guang

    2011-10-27

    A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales), and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae), and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae), whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving cetacean phylogenetic relationships in the future.

  9. Whale phylogeny and rapid radiation events revealed using novel retroposed elements and their flanking sequences

    Directory of Open Access Journals (Sweden)

    Zhou Kaiya

    2011-10-01

    Full Text Available Abstract Background A diversity of hypotheses have been proposed based on both morphological and molecular data to reveal phylogenetic relationships within the order Cetacea (dolphins, porpoises, and whales, and great progress has been made in the past two decades. However, there is still some controversy concerning relationships among certain cetacean taxa such as river dolphins and delphinoid species, which needs to be further addressed with more markers in an effort to address unresolved portions of the phylogeny. Results An analysis of additional SINE insertions and SINE-flanking sequences supported the monophyly of the order Cetacea as well as Odontocete, Delphinoidea (Delphinidae + Phocoenidae + Mondontidae, and Delphinidae. A sister relationship between Delphinidae and Phocoenidae + Mondontidae was supported, and members of classical river dolphins and the genera Tursiops and Stenella were found to be paraphyletic. Estimates of divergence times revealed rapid divergences of basal Odontocete lineages in the Oligocene and Early Miocene, and a recent rapid diversification of Delphinidae in the Middle-Late Miocene and Pliocene within a narrow time frame. Conclusions Several novel SINEs were found to differentiate Delphinidae from the other two families (Monodontidae and Phocoenidae, whereas the sister grouping of the latter two families with exclusion of Delphinidae was further revealed using the SINE-flanking sequences. Interestingly, some anomalous PCR amplification patterns of SINE insertions were detected, which can be explained as the result of potential ancestral SINE polymorphisms and incomplete lineage sorting. Although a few loci were potentially anomalous, this study demonstrated that the SINE-based approach is a powerful tool in phylogenetic studies. Identifying additional SINE elements that resolve the relationships in the superfamily Delphinoidea and family Delphinidae will be important steps forward in completely resolving

  10. Isolation of Microsporum gypseum in soil samples from different geographical regions of Brazil, evaluation of the extracellular proteolytic enzymes activities (keratinase and elastase and molecular sequencing of selected strains

    Directory of Open Access Journals (Sweden)

    Mauro Cintra Giudice

    2012-09-01

    Full Text Available A survey of Microsporum gypseum was conducted in soil samples in different geographical regions of Brazil. The isolation of dermatophyte from soil samples was performed by hair baiting technique and the species were identified by morphology studies. We analyzed 692 soil samples and the recuperating rate was 19.2%. The activities of keratinase and elastase were quantitatively performed in 138 samples. The sequencing of the ITS region of rDNA was performed in representatives samples. M. gypseum isolates showed significant quantitative differences in the expression of both keratinase and elastase, but no significant correlation was observed between these enzymes. The sequencing of the representative samples revealed the presence of two teleomorphic species of M. gypseum (Arthroderma gypseum and A. incurvatum. The enzymatic activities may play an important role in the pathogenicity and a probable adaptation of this fungus to the animal parasitism. Using the phenotypical and molecular analysis, the Microsporum identification and their teleomorphic states will provide a useful and reliable identification system.

  11. Validation of Skeletal Muscle cis-Regulatory Module Predictions Reveals Nucleotide Composition Bias in Functional Enhancers

    Science.gov (United States)

    Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.

    2011-01-01

    We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875

  12. Validation of skeletal muscle cis-regulatory module predictions reveals nucleotide composition bias in functional enhancers.

    Directory of Open Access Journals (Sweden)

    Andrew T Kwon

    2011-12-01

    Full Text Available We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions.

  13. Deep sequencing analysis of the developing mouse brain reveals a novel microRNA

    Directory of Open Access Journals (Sweden)

    Piltz Sandra

    2011-04-01

    Full Text Available Abstract Background MicroRNAs (miRNAs are small non-coding RNAs that can exert multilevel inhibition/repression at a post-transcriptional or protein synthesis level during disease or development. Characterisation of miRNAs in adult mammalian brains by deep sequencing has been reported previously. However, to date, no small RNA profiling of the developing brain has been undertaken using this method. We have performed deep sequencing and small RNA analysis of a developing (E15.5 mouse brain. Results We identified the expression of 294 known miRNAs in the E15.5 developing mouse brain, which were mostly represented by let-7 family and other brain-specific miRNAs such as miR-9 and miR-124. We also discovered 4 putative 22-23 nt miRNAs: mm_br_e15_1181, mm_br_e15_279920, mm_br_e15_96719 and mm_br_e15_294354 each with a 70-76 nt predicted pre-miRNA. We validated the 4 putative miRNAs and further characterised one of them, mm_br_e15_1181, throughout embryogenesis. Mm_br_e15_1181 biogenesis was Dicer1-dependent and was expressed in E3.5 blastocysts and E7 whole embryos. Embryo-wide expression patterns were observed at E9.5 and E11.5 followed by a near complete loss of expression by E13.5, with expression restricted to a specialised layer of cells within the developing and early postnatal brain. Mm_br_e15_1181 was upregulated during neurodifferentiation of P19 teratocarcinoma cells. This novel miRNA has been identified as miR-3099. Conclusions We have generated and analysed the first deep sequencing dataset of small RNA sequences of the developing mouse brain. The analysis revealed a novel miRNA, miR-3099, with potential regulatory effects on early embryogenesis, and involvement in neuronal cell differentiation/function in the brain during late embryonic and early neonatal development.

  14. Comparing whole-genome sequencing with Sanger sequencing for spa typing of methicillin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Bartels, Mette Damkjær; Petersen, Andreas; Worning, Peder; Nielsen, Jesper Boye; Larner-Svensson, Hanna; Johansen, Helle Krogh; Andersen, Leif Percival; Jarløv, Jens Otto; Boye, Kit; Larsen, Anders Rhod; Westh, Henrik

    2014-12-01

    spa typing of methicillin-resistant Staphylococcus aureus (MRSA) has traditionally been done by PCR amplification and Sanger sequencing of the spa repeat region. At Hvidovre Hospital, Denmark, whole-genome sequencing (WGS) of all MRSA isolates has been performed routinely since January 2013, and an in-house analysis pipeline determines the spa types. Due to national surveillance, all MRSA isolates are sent to Statens Serum Institut, where the spa type is determined by PCR and Sanger sequencing. The purpose of this study was to evaluate the reliability of the spa types obtained by 150-bp paired-end Illumina WGS. MRSA isolates from new MRSA patients in 2013 (n = 699) in the capital region of Denmark were included. We found a 97% agreement between spa types obtained by the two methods. All isolates achieved a spa type by both methods. Nineteen isolates differed in spa types by the two methods, in most cases due to the lack of 24-bp repeats in the whole-genome-sequenced isolates. These related but incorrect spa types should have no consequence in outbreak investigations, since all epidemiologically linked isolates, regardless of spa type, will be included in the single nucleotide polymorphism (SNP) analysis. This will reveal the close relatedness of the spa types. In conclusion, our data show that WGS is a reliable method to determine the spa type of MRSA. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  15. High-resolution whole-genome sequencing reveals that specific chromatin domains from most human chromosomes associate with nucleoli.

    Science.gov (United States)

    van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I

    2010-11-01

    The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.

  16. RAPD and Internal Transcribed Spacer Sequence Analyses Reveal Zea nicaraguensis as a Section Luxuriantes Species Close to Zea luxurians

    Science.gov (United States)

    Wang, Pei; Lu, Yanli; Zheng, Mingmin; Rong, Tingzhao; Tang, Qilin

    2011-01-01

    Genetic relationship of a newly discovered teosinte from Nicaragua, Zea nicaraguensis with waterlogging tolerance, was determined based on randomly amplified polymorphic DNA (RAPD) markers and the internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA using 14 accessions from Zea species. RAPD analysis showed that a total of 5,303 fragments were produced by 136 random decamer primers, of which 84.86% bands were polymorphic. RAPD-based UPGMA analysis demonstrated that the genus Zea can be divided into section Luxuriantes including Zea diploperennis, Zea luxurians, Zea perennis and Zea nicaraguensis, and section Zea including Zea mays ssp. mexicana, Zea mays ssp. parviglumis, Zea mays ssp. huehuetenangensis and Zea mays ssp. mays. ITS sequence analysis showed the lengths of the entire ITS region of the 14 taxa in Zea varied from 597 to 605 bp. The average GC content was 67.8%. In addition to the insertion/deletions, 78 variable sites were recorded in the total ITS region with 47 in ITS1, 5 in 5.8S, and 26 in ITS2. Sequences of these taxa were analyzed with neighbor-joining (NJ) and maximum parsimony (MP) methods to construct the phylogenetic trees, selecting Tripsacum dactyloides L. as the outgroup. The phylogenetic relationships of Zea species inferred from the ITS sequences are highly concordant with the RAPD evidence that resolved two major subgenus clades. Both RAPD and ITS sequence analyses indicate that Zea nicaraguensis is more closely related to Zea luxurians than the other teosintes and cultivated maize, which should be regarded as a section Luxuriantes species. PMID:21525982

  17. Development of dominant sequence characterized amplified region (SCAR marker linked with plume moth (Exelastis atomosa Walsingham 1886 resistance in pigeon-pea

    Directory of Open Access Journals (Sweden)

    Ramya R Mishra

    2015-12-01

    Full Text Available The mode of gene action governing resistance to plume moth (Exelastis atomosa Walsingham 1886 derived from pigeon-pea (Cajanus scarabaeoides (L. Thouars accession ICPW-94 has been determined and the resistance alleles have been designated as PPM1. The progenies of F2 population and F3 families derived from an interspecific cross C. cajan (L. Huth ('ICP-26' x C. scarabaeoides (accession ICPW-94 revealed monogenic gene action for resistance to plume moth, and the dominant control by single locus or cluster of tightly linked alleles. Bulked segregant analysis (BSA of 116 F2 progenies by using 143 parental polymorphic RAPD primers could identify a fragment OPA09(910 associated with plume moth resistance in coupling phase of linkage. Further single plant analysis of the 116 F2 mapping population revealed OPA09(910 was linked to PPMi locus conferring host resistance to plume moth with recombination fraction (rf value of 0.125 (12.7 cM of Kosambi function. The resistance specific fragment OPA09(910 was cloned, sequenced and converted into a sequence characterized amplified region (SCAR marker, SCOPA09(942, which was also closely associated (10.3 cM with the locus PPMl with rf value 0.102. BLAST analysis with pigeon-pea genome sequence also confirmed its occurrence in CcLG02 (Scafseq.LG_V5.0fa and contig 01597 (AFSP01.fsa1. This SCAR marker showed reasonable screening efficiency in the F2, F3, and BC1F1 lines, thus it can be used as genetic handle in marker-assisted introgression of the genomic fragment conferring plume moth resistance and screening of breeding lines in pigeon-pea.

  18. Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

    Science.gov (United States)

    Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

    2004-01-01

    The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

  19. Identification of new polymorphic regions and differentiation of cultivated olives (Olea europaea L.) through plastome sequence comparison

    Science.gov (United States)

    2010-01-01

    Background The cultivated olive (Olea europaea L.) is the most agriculturally important species of the Oleaceae family. Although many studies have been performed on plastid polymorphisms to evaluate taxonomy, phylogeny and phylogeography of Olea subspecies, only few polymorphic regions discriminating among the agronomically and economically important olive cultivars have been identified. The objective of this study was to sequence the entire plastome of olive and analyze many potential polymorphic regions to develop new inter-cultivar genetic markers. Results The complete plastid genome of the olive cultivar Frantoio was determined by direct sequence analysis using universal and novel PCR primers designed to amplify all overlapping regions. The chloroplast genome of the olive has an organisation and gene order that is conserved among numerous Angiosperm species and do not contain any of the inversions, gene duplications, insertions, inverted repeat expansions and gene/intron losses that have been found in the chloroplast genomes of the genera Jasminum and Menodora, from the same family as Olea. The annotated sequence was used to evaluate the content of coding genes, the extent, and distribution of repeated and long dispersed sequences and the nucleotide composition pattern. These analyses provided essential information for structural, functional and comparative genomic studies in olive plastids. Furthermore, the alignment of the olive plastome sequence to those of other varieties and species identified 30 new organellar polymorphisms within the cultivated olive. Conclusions In addition to identifying mutations that may play a functional role in modifying the metabolism and adaptation of olive cultivars, the new chloroplast markers represent a valuable tool to assess the level of olive intercultivar plastome variation for use in population genetic analysis, phylogenesis, cultivar characterisation and DNA food tracking. PMID:20868482

  20. Sparse genetic tracing reveals regionally specific functional organization of mammalian nociceptors.

    Science.gov (United States)

    Olson, William; Abdus-Saboor, Ishmail; Cui, Lian; Burdge, Justin; Raabe, Tobias; Ma, Minghong; Luo, Wenqin

    2017-10-12

    The human distal limbs have a high spatial acuity for noxious stimuli but a low density of pain-sensing neurites. To elucidate mechanisms underlying regional differences in processing nociception, we sparsely traced non-peptidergic nociceptors across the body using a newly generated Mrgprd CreERT2 mouse line. We found that mouse plantar paw skin is also innervated by a low density of Mrgprd + nociceptors, while individual arbors in different locations are comparable in size. Surprisingly, the central arbors of plantar paw and trunk innervating nociceptors have distinct morphologies in the spinal cord. This regional difference is well correlated with a heightened signal transmission for plantar paw circuits, as revealed by both spinal cord slice recordings and behavior assays. Taken together, our results elucidate a novel somatotopic functional organization of the mammalian pain system and suggest that regional central arbor structure could facilitate the "enlarged representation" of plantar paw regions in the CNS.

  1. Sequencing of 50 human exomes reveals adaptation to high altitude

    DEFF Research Database (Denmark)

    Yi, Xin; Liang, Yu; Huerta-Sanchez, Emilia

    2010-01-01

    Residents of the Tibetan Plateau show heritable adaptations to extreme altitude. We sequenced 50 exomes of ethnic Tibetans, encompassing coding sequences of 92% of human genes, with an average coverage of 18x per individual. Genes showing population-specific allele frequency changes, which repres...... in genetic adaptation to high altitude.......Residents of the Tibetan Plateau show heritable adaptations to extreme altitude. We sequenced 50 exomes of ethnic Tibetans, encompassing coding sequences of 92% of human genes, with an average coverage of 18x per individual. Genes showing population-specific allele frequency changes, which...... represent strong candidates for altitude adaptation, were identified. The strongest signal of natural selection came from endothelial Per-Arnt-Sim (PAS) domain protein 1 (EPAS1), a transcription factor involved in response to hypoxia. One single-nucleotide polymorphism (SNP) at EPAS1 shows a 78% frequency...

  2. Global MYCN transcription factor binding analysis in neuroblastoma reveals association with distinct E-box motifs and regions of DNA hypermethylation.

    LENUS (Irish Health Repository)

    Murphy, Derek M

    2009-01-01

    BACKGROUND: Neuroblastoma, a cancer derived from precursor cells of the sympathetic nervous system, is a major cause of childhood cancer related deaths. The single most important prognostic indicator of poor clinical outcome in this disease is genomic amplification of MYCN, a member of a family of oncogenic transcription factors. METHODOLOGY: We applied MYCN chromatin immunoprecipitation to microarrays (ChIP-chip) using MYCN amplified\\/non-amplified cell lines as well as a conditional knockdown cell line to determine the distribution of MYCN binding sites within all annotated promoter regions. CONCLUSION: Assessment of E-box usage within consistently positive MYCN binding sites revealed a predominance for the CATGTG motif (p<0.0016), with significant enrichment of additional motifs CATTTG, CATCTG, CAACTG in the MYCN amplified state. For cell lines over-expressing MYCN, gene ontology analysis revealed enrichment for the binding of MYCN at promoter regions of numerous molecular functional groups including DNA helicases and mRNA transcriptional regulation. In order to evaluate MYCN binding with respect to other genomic features, we determined the methylation status of all annotated CpG islands and promoter sequences using methylated DNA immunoprecipitation (MeDIP). The integration of MYCN ChIP-chip and MeDIP data revealed a highly significant positive correlation between MYCN binding and DNA hypermethylation. This association was also detected in regions of hemizygous loss, indicating that the observed association occurs on the same homologue. In summary, these findings suggest that MYCN binding occurs more commonly at CATGTG as opposed to the classic CACGTG E-box motif, and that disease associated over expression of MYCN leads to aberrant binding to additional weaker affinity E-box motifs in neuroblastoma. The co-localization of MYCN binding and DNA hypermethylation further supports the dual role of MYCN, namely that of a classical transcription factor affecting the

  3. Integrated analysis of whole genome and transcriptome sequencing reveals diverse transcriptomic aberrations driven by somatic genomic changes in liver cancers.

    Directory of Open Access Journals (Sweden)

    Yuichi Shiraishi

    Full Text Available Recent studies applying high-throughput sequencing technologies have identified several recurrently mutated genes and pathways in multiple cancer genomes. However, transcriptional consequences from these genomic alterations in cancer genome remain unclear. In this study, we performed integrated and comparative analyses of whole genomes and transcriptomes of 22 hepatitis B virus (HBV-related hepatocellular carcinomas (HCCs and their matched controls. Comparison of whole genome sequence (WGS and RNA-Seq revealed much evidence that various types of genomic mutations triggered diverse transcriptional changes. Not only splice-site mutations, but also silent mutations in coding regions, deep intronic mutations and structural changes caused splicing aberrations. HBV integrations generated diverse patterns of virus-human fusion transcripts depending on affected gene, such as TERT, CDK15, FN1 and MLL4. Structural variations could drive over-expression of genes such as WNT ligands, with/without creating gene fusions. Furthermore, by taking account of genomic mutations causing transcriptional aberrations, we could improve the sensitivity of deleterious mutation detection in known cancer driver genes (TP53, AXIN1, ARID2, RPS6KA3, and identified recurrent disruptions in putative cancer driver genes such as HNF4A, CPS1, TSC1 and THRAP3 in HCCs. These findings indicate genomic alterations in cancer genome have diverse transcriptomic effects, and integrated analysis of WGS and RNA-Seq can facilitate the interpretation of a large number of genomic alterations detected in cancer genome.

  4. DNA sequence analyses reveal co-occurrence of novel haplotypes of Fasciola gigantica with F. hepatica in South Africa and Zimbabwe.

    Science.gov (United States)

    Mucheka, Vimbai T; Lamb, Jennifer M; Pfukenyi, Davies M; Mukaratirwa, Samson

    2015-11-30

    The aim of this study was to identify and determine the genetic diversity of Fasciola species in cattle from Zimbabwe, the KwaZulu-Natal and Mpumalanga provinces of South Africa and selected wildlife hosts from Zimbabwe. This was based on analysis of DNA sequences of the nuclear ribosomal internal transcribed spacer (ITS1 and 2) and mitochondrial cytochrome oxidase 1 (CO1) regions. The sample of 120 flukes was collected from livers of 57 cattle at 4 abattoirs in Zimbabwe and 47 cattle at 6 abattoirs in South Africa; it also included three alcohol-preserved duiker, antelope and eland samples from Zimbabwe. Aligned sequences (ITS 506 base pairs and CO1 381 base pairs) were analyzed by neighbour-joining, maximum parsimony and Bayesian inference methods. Phylogenetic trees revealed the presence of Fasciola gigantica in cattle from Zimbabwe and F. gigantica and Fasciola hepatica in the samples from South Africa. F. hepatica was more prevalent (64%) in South Africa than F. gigantica. In Zimbabwe, F. gigantica was present in 99% of the samples; F. hepatica was found in only one cattle sample, an antelope (Hippotragus niger) and a duiker (Sylvicapra grimmia). This is the first molecular confirmation of the identity Fasciola species in Zimbabwe and South Africa. Knowledge on the identity and distribution of these liver flukes at molecular level will allow disease surveillance and control in the studied areas. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Complete chloroplast genome sequence of a major economic species, Ziziphus jujuba (Rhamnaceae).

    Science.gov (United States)

    Ma, Qiuyue; Li, Shuxian; Bi, Changwei; Hao, Zhaodong; Sun, Congrui; Ye, Ning

    2017-02-01

    Ziziphus jujuba is an important woody plant with high economic and medicinal value. Here, we analyzed and characterized the complete chloroplast (cp) genome of Z. jujuba, the first member of the Rhamnaceae family for which the chloroplast genome sequence has been reported. We also built a web browser for navigating the cp genome of Z. jujuba ( http://bio.njfu.edu.cn/gb2/gbrowse/Ziziphus_jujuba_cp/ ). Sequence analysis showed that this cp genome is 161,466 bp long and has a typical quadripartite structure of large (LSC, 89,120 bp) and small (SSC, 19,348 bp) single-copy regions separated by a pair of inverted repeats (IRs, 26,499 bp). The sequence contained 112 unique genes, including 78 protein-coding genes, 30 transfer RNAs, and four ribosomal RNAs. The genome structure, gene order, GC content, and codon usage are similar to other typical angiosperm cp genomes. A total of 38 tandem repeats, two forward repeats, and three palindromic repeats were detected in the Z. jujuba cp genome. Simple sequence repeat (SSR) analysis revealed that most SSRs were AT-rich. The homopolymer regions in the cp genome of Z. jujuba were verified and manually corrected by Sanger sequencing. One-third of mononucleotide repeats were found to be erroneously sequenced by the 454 pyrosequencing, which resulted in sequences of 1-4 bases shorter than that by the Sanger sequencing. Analyzing the cp genome of Z. jujuba revealed that the IR contraction and expansion events resulted in ycf1 and rps19 pseudogenes. A phylogenetic analysis based on 64 protein-coding genes showed that Z. jujuba was closely related to members of the Elaeagnaceae family, which will be helpful for phylogenetic studies of other Rosales species. The complete cp genome sequence of Z. jujuba will facilitate population, phylogenetic, and cp genetic engineering studies of this economic plant.

  6. [Study on sequence characterized amplified region (SCAR) markers of Cornus officinalis].

    Science.gov (United States)

    Chen, Suiqing; Lu, Xiaolei; Wang, Lili

    2011-05-01

    To establish sequence characterized amplified region markers of Cornus officinalis and provide a scientific basis for molecular identification of C. officinalis. The random primer was screened through RAPD to obtain specific RAPD marker bands. The RAPD marker bands were separated, extracted, cloned and sequenced. Both ends of the sequence of RAPD marker bands were determined. A pair of specific primers was designed for conventional PCR reaction, and SCAR marker was acquired. Four pairs of primers were designed based on the sequence of RAPD marker bands. The DNA of the seven varieties of C. officinalis was amplified by using YST38 and YST43 primer. The results showed that seven varieties of C. officinalis were able to produce a single PCR product. It was an effective way to identify C. officinalis. The varieties with cylindrical and long-pear shape fruits amplified by YST38 showed a specific band, which could be used as the evidence of variety identification. Seven varieties of C. oficinalis were amplified by using primer YST39. But the size of band of the variety with spindly shape fruit (35,0400 bp) was about 300 bp, which was shorter than those of the variety with the other shape fruits of C. officinalis (650-700 bp). The variety with the spindly shape fruit could be identified through this difference. The primer YST92 could produce a fragment from 600-700 bp in the varieties with cylindrical and long-pear shape fruits, a fragment from 200-300 bp in the varieties with oval and short-cylindrical shape fruits and had no fragment in the varieties with long cylindrical, elliptic and short-pear shape fruits, which could be used to select the different shapes of C. officinalis. SCAR mark is established and can be used as the basis for breeding and distinguishing the verieties of C. officinalis.

  7. Quick regional centroid moment tensor solutions for the Emilia 2012 (northern Italy seismic sequence

    Directory of Open Access Journals (Sweden)

    Silvia Pondrelli

    2012-10-01

    Full Text Available In May 2012, a seismic sequence struck the Emilia region (northern Italy. The mainshock, of Ml 5.9, occurred on May 20, 2012, at 02:03 UTC. This was preceded by a smaller Ml 4.1 foreshock some hours before (23:13 UTC on May 19, 2012 and followed by more than 2,500 earthquakes in the magnitude range from Ml 0.7 to 5.2. In addition, on May 29, 2012, three further strong earthquakes occurred, all with magnitude Ml ≥5.2: a Ml 5.8 earthquake in the morning (07:00 UTC, followed by two events within just 5 min of each other, one at 10:55 UTC (Ml 5.3 and the second at 11:00 UTC (Ml 5.2. For all of the Ml ≥4.0 earthquakes in Italy and for all of the Ml ≥4.5 in the Mediterranean area, an automatic procedure for the computation of a regional centroid moment tensor (RCMT is triggered by an email alert. Within 1 h of the event, a manually revised quick RCMT (QRCMT can be published on the website if the solution is considered stable. In particular, for the Emilia seismic sequence, 13 QRCMTs were determined and for three of them, those with M >5.5, the automatically computed QRCMTs fitted the criteria for publication without manual revision. Using this seismic sequence as a test, we can then identify the magnitude threshold for automatic publication of our QRCMTs.

  8. Discrepancy between Hepatitis C Virus Genotypes and NS4-Based Serotypes: Association with Their Subgenomic Sequences

    Directory of Open Access Journals (Sweden)

    Nan Nwe Win

    2017-01-01

    Full Text Available Determination of hepatitis C virus (HCV genotypes plays an important role in the direct-acting agent era. Discrepancies between HCV genotyping and serotyping assays are occasionally observed. Eighteen samples with discrepant results between genotyping and serotyping methods were analyzed. HCV serotyping and genotyping were based on the HCV nonstructural 4 (NS4 region and 5′-untranslated region (5′-UTR, respectively. HCV core and NS4 regions were chosen to be sequenced and were compared with the genotyping and serotyping results. Deep sequencing was also performed for the corresponding HCV NS4 regions. Seventeen out of 18 discrepant samples could be sequenced by the Sanger method. Both HCV core and NS4 sequences were concordant with that of genotyping in the 5′-UTR in all 17 samples. In cloning analysis of the HCV NS4 region, there were several amino acid variations, but each sequence was much closer to the peptide with the same genotype. Deep sequencing revealed that minor clones with different subgenotypes existed in two of the 17 samples. Genotyping by genome amplification showed high consistency, while several false reactions were detected by serotyping. The deep sequencing method also provides accurate genotyping results and may be useful for analyzing discrepant cases. HCV genotyping should be correctly determined before antiviral treatment.

  9. Comparative In silico Study of Sex-Determining Region Y (SRY Protein Sequences Involved in Sex-Determining

    Directory of Open Access Journals (Sweden)

    Masoume Vakili Azghandi

    2016-05-01

    Full Text Available Background: The SRY gene (SRY provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Methods: Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/ and MEGA6 softwares. Results: The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale and Tursiopsaduncus (dolphin have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. Conclusion: These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

  10. Sequence analysis of chromosome 1 revealed different selection patterns between Chinese wild mice and laboratory strains.

    Science.gov (United States)

    Xu, Fuyi; Hu, Shixian; Chao, Tianzhu; Wang, Maochun; Li, Kai; Zhou, Yuxun; Xu, Hongyan; Xiao, Junhua

    2017-10-01

    Both natural and artificial selection play a critical role in animals' adaptation to the environment. Detection of the signature of selection in genomic regions can provide insights for understanding the function of specific phenotypes. It is generally assumed that laboratory mice may experience intense artificial selection while wild mice more natural selection. However, the differences of selection signature in the mouse genome and underlying genes between wild and laboratory mice remain unclear. In this study, we used two mouse populations: chromosome 1 (Chr 1) substitution lines (C1SLs) derived from Chinese wild mice and mouse genome project (MGP) sequenced inbred strains and two selection detection statistics: Fst and Tajima's D to identify the signature of selection footprint on Chr 1. For the differentiation between the C1SLs and MGP, 110 candidate selection regions containing 47 protein coding genes were detected. A total of 149 selection regions which encompass 7.215 Mb were identified in the C1SLs by Tajima's D approach. While for the MGP, we identified nearly twice selection regions (243) compared with the C1SLs which accounted for 13.27 Mb Chr 1 sequence. Through functional annotation, we identified several biological processes with significant enrichment including seven genes in the olfactory transduction pathway. In addition, we searched the phenotypes associated with the 47 candidate selection genes identified by Fst. These genes were involved in behavior, growth or body weight, mortality or aging, and immune systems which align well with the phenotypic differences between wild and laboratory mice. Therefore, the findings would be helpful for our understanding of the phenotypic differences between wild and laboratory mice and applications for using this new mouse resource (C1SLs) for further genetics studies.

  11. Genomic region operation kit for flexible processing of deep sequencing data.

    Science.gov (United States)

    Ovaska, Kristian; Lyly, Lauri; Sahu, Biswajyoti; Jänne, Olli A; Hautaniemi, Sampsa

    2013-01-01

    Computational analysis of data produced in deep sequencing (DS) experiments is challenging due to large data volumes and requirements for flexible analysis approaches. Here, we present a mathematical formalism based on set algebra for frequently performed operations in DS data analysis to facilitate translation of biomedical research questions to language amenable for computational analysis. With the help of this formalism, we implemented the Genomic Region Operation Kit (GROK), which supports various DS-related operations such as preprocessing, filtering, file conversion, and sample comparison. GROK provides high-level interfaces for R, Python, Lua, and command line, as well as an extension C++ API. It supports major genomic file formats and allows storing custom genomic regions in efficient data structures such as red-black trees and SQL databases. To demonstrate the utility of GROK, we have characterized the roles of two major transcription factors (TFs) in prostate cancer using data from 10 DS experiments. GROK is freely available with a user guide from >http://csbi.ltdk.helsinki.fi/grok/.

  12. Sequence Variation in Toxoplasma gondii rop17 Gene among Strains from Different Hosts and Geographical Locations

    Directory of Open Access Journals (Sweden)

    Nian-Zhang Zhang

    2014-01-01

    Full Text Available Genetic diversity of T. gondii is a concern of many studies, due to the biological and epidemiological diversity of this parasite. The present study examined sequence variation in rhoptry protein 17 (ROP17 gene among T. gondii isolates from different hosts and geographical regions. The rop17 gene was amplified and sequenced from 10 T. gondii strains, and phylogenetic relationship among these T. gondii strains was reconstructed using maximum parsimony (MP, neighbor-joining (NJ, and maximum likelihood (ML analyses. The partial rop17 gene sequences were 1375 bp in length and A+T contents varied from 49.45% to 50.11% among all examined T. gondii strains. Sequence analysis identified 33 variable nucleotide positions (2.1%, 16 of which were identified as transitions. Phylogeny reconstruction based on rop17 gene data revealed two major clusters which could readily distinguish Type I and Type II strains. Analyses of sequence variations in nucleotides and amino acids among these strains revealed high ratio of nonsynonymous to synonymous polymorphisms (>1, indicating that rop17 shows signs of positive selection. This study demonstrated the existence of slightly high sequence variability in the rop17 gene sequences among T. gondii strains from different hosts and geographical regions, suggesting that rop17 gene may represent a new genetic marker for population genetic studies of T. gondii isolates.

  13. CSReport: A New Computational Tool Designed for Automatic Analysis of Class Switch Recombination Junctions Sequenced by High-Throughput Sequencing.

    Science.gov (United States)

    Boyer, François; Boutouil, Hend; Dalloul, Iman; Dalloul, Zeinab; Cook-Moreau, Jeanne; Aldigier, Jean-Claude; Carrion, Claire; Herve, Bastien; Scaon, Erwan; Cogné, Michel; Péron, Sophie

    2017-05-15

    B cells ensure humoral immune responses due to the production of Ag-specific memory B cells and Ab-secreting plasma cells. In secondary lymphoid organs, Ag-driven B cell activation induces terminal maturation and Ig isotype class switch (class switch recombination [CSR]). CSR creates a virtually unique IgH locus in every B cell clone by intrachromosomal recombination between two switch (S) regions upstream of each C region gene. Amount and structural features of CSR junctions reveal valuable information about the CSR mechanism, and analysis of CSR junctions is useful in basic and clinical research studies of B cell functions. To provide an automated tool able to analyze large data sets of CSR junction sequences produced by high-throughput sequencing (HTS), we designed CSReport, a software program dedicated to support analysis of CSR recombination junctions sequenced with a HTS-based protocol (Ion Torrent technology). CSReport was assessed using simulated data sets of CSR junctions and then used for analysis of Sμ-Sα and Sμ-Sγ1 junctions from CH12F3 cells and primary murine B cells, respectively. CSReport identifies junction segment breakpoints on reference sequences and junction structure (blunt-ended junctions or junctions with insertions or microhomology). Besides the ability to analyze unprecedentedly large libraries of junction sequences, CSReport will provide a unified framework for CSR junction studies. Our results show that CSReport is an accurate tool for analysis of sequences from our HTS-based protocol for CSR junctions, thereby facilitating and accelerating their study. Copyright © 2017 by The American Association of Immunologists, Inc.

  14. Advantages of genome sequencing by long-read sequencer using SMRT technology in medical area.

    Science.gov (United States)

    Nakano, Kazuma; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Ashimine, Noriko; Ohki, Shun; Shinzato, Misuzu; Minami, Maiko; Nakanishi, Tetsuhiro; Teruya, Kuniko; Satou, Kazuhito; Hirano, Takashi

    2017-07-01

    PacBio RS II is the first commercialized third-generation DNA sequencer able to sequence a single molecule DNA in real-time without amplification. PacBio RS II's sequencing technology is novel and unique, enabling the direct observation of DNA synthesis by DNA polymerase. PacBio RS II confers four major advantages compared to other sequencing technologies: long read lengths, high consensus accuracy, a low degree of bias, and simultaneous capability of epigenetic characterization. These advantages surmount the obstacle of sequencing genomic regions such as high/low G+C, tandem repeat, and interspersed repeat regions. Moreover, PacBio RS II is ideal for whole genome sequencing, targeted sequencing, complex population analysis, RNA sequencing, and epigenetics characterization. With PacBio RS II, we have sequenced and analyzed the genomes of many species, from viruses to humans. Herein, we summarize and review some of our key genome sequencing projects, including full-length viral sequencing, complete bacterial genome and almost-complete plant genome assemblies, and long amplicon sequencing of a disease-associated gene region. We believe that PacBio RS II is not only an effective tool for use in the basic biological sciences but also in the medical/clinical setting.

  15. Whole mitochondrial genome sequencing of domestic horses reveals incorporation of extensive wild horse diversity during domestication

    Directory of Open Access Journals (Sweden)

    Lippold Sebastian

    2011-11-01

    Full Text Available Abstract Background DNA target enrichment by micro-array capture combined with high throughput sequencing technologies provides the possibility to obtain large amounts of sequence data (e.g. whole mitochondrial DNA genomes from multiple individuals at relatively low costs. Previously, whole mitochondrial genome data for domestic horses (Equus caballus were limited to only a few specimens and only short parts of the mtDNA genome (especially the hypervariable region were investigated for larger sample sets. Results In this study we investigated whole mitochondrial genomes of 59 domestic horses from 44 breeds and a single Przewalski horse (Equus przewalski using a recently described multiplex micro-array capture approach. We found 473 variable positions within the domestic horses, 292 of which are parsimony-informative, providing a well resolved phylogenetic tree. Our divergence time estimate suggests that the mitochondrial genomes of modern horse breeds shared a common ancestor around 93,000 years ago and no later than 38,000 years ago. A Bayesian skyline plot (BSP reveals a significant population expansion beginning 6,000-8,000 years ago with an ongoing exponential growth until the present, similar to other domestic animal species. Our data further suggest that a large sample of wild horse diversity was incorporated into the domestic population; specifically, at least 46 of the mtDNA lineages observed in domestic horses (73% already existed before the beginning of domestication about 5,000 years ago. Conclusions Our study provides a window into the maternal origins of extant domestic horses and confirms that modern domestic breeds present a wide sample of the mtDNA diversity found in ancestral, now extinct, wild horse populations. The data obtained allow us to detect a population expansion event coinciding with the beginning of domestication and to estimate both the minimum number of female horses incorporated into the domestic gene pool and the

  16. Diversity and Structure of Diazotrophic Communities in Mangrove Rhizosphere, Revealed by High-Throughput Sequencing.

    Science.gov (United States)

    Zhang, Yanying; Yang, Qingsong; Ling, Juan; Van Nostrand, Joy D; Shi, Zhou; Zhou, Jizhong; Dong, Junde

    2017-01-01

    Diazotrophic communities make an essential contribution to the productivity through providing new nitrogen. However, knowledge of the roles that both mangrove tree species and geochemical parameters play in shaping mangove rhizosphere diazotrophic communities is still elusive. Here, a comprehensive examination of the diversity and structure of microbial communities in the rhizospheres of three mangrove species, Rhizophora apiculata , Avicennia marina , and Ceriops tagal , was undertaken using high - throughput sequencing of the 16S rRNA and nifH genes. Our results revealed a great diversity of both the total microbial composition and the diazotrophic composition specifically in the mangrove rhizosphere. Deltaproteobacteria and Gammaproteobacteria were both ubiquitous and dominant, comprising an average of 45.87 and 86.66% of total microbial and diazotrophic communities, respectively. Sulfate-reducing bacteria belonging to the Desulfobacteraceae and Desulfovibrionaceae were the dominant diazotrophs. Community statistical analyses suggested that both mangrove tree species and additional environmental variables played important roles in shaping total microbial and potential diazotroph communities in mangrove rhizospheres. In contrast to the total microbial community investigated by analysis of 16S rRNA gene sequences, most of the dominant diazotrophic groups identified by nifH gene sequences were significantly different among mangrove species. The dominant diazotrophs of the family Desulfobacteraceae were positively correlated with total phosphorus, but negatively correlated with the nitrogen to phosphorus ratio. The Pseudomonadaceae were positively correlated with the concentration of available potassium, suggesting that diazotrophs potentially play an important role in biogeochemical cycles, such as those of nitrogen, phosphorus, sulfur, and potassium, in the mangrove ecosystem.

  17. Diversity and Structure of Diazotrophic Communities in Mangrove Rhizosphere, Revealed by High-Throughput Sequencing

    Directory of Open Access Journals (Sweden)

    Yanying Zhang

    2017-10-01

    Full Text Available Diazotrophic communities make an essential contribution to the productivity through providing new nitrogen. However, knowledge of the roles that both mangrove tree species and geochemical parameters play in shaping mangove rhizosphere diazotrophic communities is still elusive. Here, a comprehensive examination of the diversity and structure of microbial communities in the rhizospheres of three mangrove species, Rhizophora apiculata, Avicennia marina, and Ceriops tagal, was undertaken using high-throughput sequencing of the 16S rRNA and nifH genes. Our results revealed a great diversity of both the total microbial composition and the diazotrophic composition specifically in the mangrove rhizosphere. Deltaproteobacteria and Gammaproteobacteria were both ubiquitous and dominant, comprising an average of 45.87 and 86.66% of total microbial and diazotrophic communities, respectively. Sulfate-reducing bacteria belonging to the Desulfobacteraceae and Desulfovibrionaceae were the dominant diazotrophs. Community statistical analyses suggested that both mangrove tree species and additional environmental variables played important roles in shaping total microbial and potential diazotroph communities in mangrove rhizospheres. In contrast to the total microbial community investigated by analysis of 16S rRNA gene sequences, most of the dominant diazotrophic groups identified by nifH gene sequences were significantly different among mangrove species. The dominant diazotrophs of the family Desulfobacteraceae were positively correlated with total phosphorus, but negatively correlated with the nitrogen to phosphorus ratio. The Pseudomonadaceae were positively correlated with the concentration of available potassium, suggesting that diazotrophs potentially play an important role in biogeochemical cycles, such as those of nitrogen, phosphorus, sulfur, and potassium, in the mangrove ecosystem.

  18. Analysis of 90 Mb of the potato genome reveals conservation of gene structures and order with tomato but divergence in repetitive sequence composition

    Directory of Open Access Journals (Sweden)

    O'Brien Kimberly

    2008-06-01

    Full Text Available Abstract Background The Solanaceae family contains a number of important crop species including potato (Solanum tuberosum which is grown for its underground storage organ known as a tuber. Albeit the 4th most important food crop in the world, other than a collection of ~220,000 Expressed Sequence Tags, limited genomic sequence information is currently available for potato and advances in potato yield and nutrition content would be greatly assisted through access to a complete genome sequence. While morphologically diverse, Solanaceae species such as potato, tomato, pepper, and eggplant share not only genes but also gene order thereby permitting highly informative comparative genomic analyses. Results In this study, we report on analysis 89.9 Mb of potato genomic sequence representing 10.2% of the genome generated through end sequencing of a potato bacterial artificial chromosome (BAC clone library (87 Mb and sequencing of 22 potato BAC clones (2.9 Mb. The GC content of potato is very similar to Solanum lycopersicon (tomato and other dicotyledonous species yet distinct from the monocotyledonous grass species, Oryza sativa. Parallel analyses of repetitive sequences in potato and tomato revealed substantial differences in their abundance, 34.2% in potato versus 46.3% in tomato, which is consistent with the increased genome size per haploid genome of these two Solanum species. Specific classes and types of repetitive sequences were also differentially represented between these two species including a telomeric-related repetitive sequence, ribosomal DNA, and a number of unclassified repetitive sequences. Comparative analyses between tomato and potato at the gene level revealed a high level of conservation of gene content, genic feature, and gene order although discordances in synteny were observed. Conclusion Genomic level analyses of potato and tomato confirm that gene sequence and gene order are conserved between these solanaceous species and that

  19. Draft genome sequences of three virulent Streptococcus thermophilus bacteriophages isolated from the dairy environment in the Veneto region of Italy

    DEFF Research Database (Denmark)

    Duarte, Viní­cius da Silva; Giaretta, Sabrina; Treu, Laura

    2018-01-01

    Streptococcus thermophilus, a very important dairy species, is constantly threatened by phage infection. We report the genome sequences of three S. thermophilus bacteriophages isolated from a dairy environment in the Veneto region of Italy. These sequences will be used for the development of new ...

  20. Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

    Science.gov (United States)

    Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent

    2016-03-22

    Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

  1. Analysis of sequences from field samples reveals the presence of the recently described pepper vein yellows virus (genus Polerovirus) in six additional countries.

    Science.gov (United States)

    Knierim, Dennis; Tsai, Wen-Shi; Kenyon, Lawrence

    2013-06-01

    Polerovirus infection was detected by reverse transcription polymerase chain reaction (RT-PCR) in 29 pepper plants (Capsicum spp.) and one black nightshade plant (Solanum nigrum) sample collected from fields in India, Indonesia, Mali, Philippines, Thailand and Taiwan. At least two representative samples for each country were selected to generate a general polerovirus RT-PCR product of 1.4 kb length for sequencing. Sequence analysis of the partial genome sequences revealed the presence of pepper vein yellows virus (PeVYV) in all 13 samples. A 1990 Australian herbarium sample of pepper described by serological means as infected with capsicum yellows virus (CYV) was identified by sequence analysis of a partial CP sequence as probably infected with a potato leaf roll virus (PLRV) isolate.

  2. Evolutionary growth process of highly conserved sequences in vertebrate genomes.

    Science.gov (United States)

    Ishibashi, Minaka; Noda, Akiko Ogura; Sakate, Ryuichi; Imanishi, Tadashi

    2012-08-01

    Genome sequence comparison between evolutionarily distant species revealed ultraconserved elements (UCEs) among mammals under strong purifying selection. Most of them were also conserved among vertebrates. Because they tend to be located in the flanking regions of developmental genes, they would have fundamental roles in creating vertebrate body plans. However, the evolutionary origin and selection mechanism of these UCEs remain unclear. Here we report that UCEs arose in primitive vertebrates, and gradually grew in vertebrate evolution. We searched for UCEs in two teleost fishes, Tetraodon nigroviridis and Oryzias latipes, and found 554 UCEs with 100% identity over 100 bps. Comparison of teleost and mammalian UCEs revealed 43 pairs of common, jawed-vertebrate UCEs (jUCE) with high sequence identities, ranging from 83.1% to 99.2%. Ten of them retain lower similarities to the Petromyzon marinus genome, and the substitution rates of four non-exonic jUCEs were reduced after the teleost-mammal divergence, suggesting that robust conservation had been acquired in the jawed vertebrate lineage. Our results indicate that prototypical UCEs originated before the divergence of jawed and jawless vertebrates and have been frozen as perfect conserved sequences in the jawed vertebrate lineage. In addition, our comparative sequence analyses of UCEs and neighboring regions resulted in a discovery of lineage-specific conserved sequences. They were added progressively to prototypical UCEs, suggesting step-wise acquisition of novel regulatory roles. Our results indicate that conserved non-coding elements (CNEs) consist of blocks with distinct evolutionary history, each having been frozen since different evolutionary era along the vertebrate lineage. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

    Science.gov (United States)

    Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

  4. The complete chloroplast DNA sequence of the green alga Oltmannsiellopsis viridis reveals a distinctive quadripartite architecture in the chloroplast genome of early diverging ulvophytes

    Directory of Open Access Journals (Sweden)

    Lemieux Claude

    2006-02-01

    Full Text Available Abstract Background The phylum Chlorophyta contains the majority of the green algae and is divided into four classes. The basal position of the Prasinophyceae has been well documented, but the divergence order of the Ulvophyceae, Trebouxiophyceae and Chlorophyceae is currently debated. The four complete chloroplast DNA (cpDNA sequences presently available for representatives of these classes have revealed extensive variability in overall structure, gene content, intron composition and gene order. The chloroplast genome of Pseudendoclonium (Ulvophyceae, in particular, is characterized by an atypical quadripartite architecture that deviates from the ancestral type by a large inverted repeat (IR featuring an inverted rRNA operon and a small single-copy (SSC region containing 14 genes normally found in the large single-copy (LSC region. To gain insights into the nature of the events that led to the reorganization of the chloroplast genome in the Ulvophyceae, we have determined the complete cpDNA sequence of Oltmannsiellopsis viridis, a representative of a distinct, early diverging lineage. Results The 151,933 bp IR-containing genome of Oltmannsiellopsis differs considerably from Pseudendoclonium and other chlorophyte cpDNAs in intron content and gene order, but shares close similarities with its ulvophyte homologue at the levels of quadripartite architecture, gene content and gene density. Oltmannsiellopsis cpDNA encodes 105 genes, contains five group I introns, and features many short dispersed repeats. As in Pseudendoclonium cpDNA, the rRNA genes in the IR are transcribed toward the single copy region featuring the genes typically found in the ancestral LSC region, and the opposite single copy region harbours genes characteristic of both the ancestral SSC and LSC regions. The 52 genes that were transferred from the ancestral LSC to SSC region include 12 of those observed in Pseudendoclonium cpDNA. Surprisingly, the overall gene organization of

  5. LookSeq: a browser-based viewer for deep sequencing data.

    Science.gov (United States)

    Manske, Heinrich Magnus; Kwiatkowski, Dominic P

    2009-11-01

    Sequencing a genome to great depth can be highly informative about heterogeneity within an individual or a population. Here we address the problem of how to visualize the multiple layers of information contained in deep sequencing data. We propose an interactive AJAX-based web viewer for browsing large data sets of aligned sequence reads. By enabling seamless browsing and fast zooming, the LookSeq program assists the user to assimilate information at different levels of resolution, from an overview of a genomic region to fine details such as heterogeneity within the sample. A specific problem, particularly if the sample is heterogeneous, is how to depict information about structural variation. LookSeq provides a simple graphical representation of paired sequence reads that is more revealing about potential insertions and deletions than are conventional methods.

  6. Analyses of Mitogenome Sequences Revealed that Asian Citrus Psyllids (Diaphorina citri) from California Were Related to Those from Florida.

    Science.gov (United States)

    Wu, Fengnian; Kumagai, Luci; Cen, Yijing; Chen, Jianchi; Wallis, Christopher M; Polek, MaryLou; Jiang, Hongyan; Zheng, Zheng; Liang, Guangwen; Deng, Xiaoling

    2017-08-31

    Asian citrus psyllid (ACP, Diaphorina citri Kuwayama) transmits "Candidatus Liberibacter asiaticus" (CLas), an unculturable alpha-proteobacterium associated with citrus Huanglongbing (HLB). CLas has recently been found in California. Understanding ACP population diversity is necessary for HLB regulatory practices aimed at reducing CLas spread. In this study, two circular ACP mitogenome sequences from California (mt-CApsy, ~15,027 bp) and Florida (mt-FLpsy, ~15,012 bp), USA, were acquired. Each mitogenome contained 13 protein coding genes, 2 ribosomal RNA and 22 transfer RNA genes, and a control region varying in sizes. The Californian mt-CApsy was identical to the Floridian mt-FLpsy, but different from the mitogenome (mt-GDpsy) of Guangdong, China, in 50 single nucleotide polymorphisms (SNPs). Further analyses were performed on sequences in cox1 and trnAsn regions with 100 ACPs, SNPs in nad1-nad4-nad5 locus through PCR with 252 ACP samples. All results showed the presence of a Chinese ACP cluster (CAC) and an American ACP cluster (AAC). We proposed that ACP in California was likely not introduced from China based on our current ACP collection but somewhere in America. However, more studies with ACP samples from around the world are needed. ACP mitogenome sequence analyses will facilitate ACP population research.

  7. Accurate and High-Coverage Immune Repertoire Sequencing Reveals Characteristics of Antibody Repertoire Diversification in Young Children with Malaria

    Science.gov (United States)

    Jiang, Ning

    Accurately measuring the immune repertoire sequence composition, diversity, and abundance is important in studying repertoire response in infections, vaccinations, and cancer immunology. Using molecular identifiers (MIDs) to tag mRNA molecules is an effective method in improving the accuracy of immune repertoire sequencing (IR-seq). However, it is still difficult to use IR-seq on small amount of clinical samples to achieve a high coverage of the repertoire diversities. This is especially challenging in studying infections and vaccinations where B cell subpopulations with fewer cells, such as memory B cells or plasmablasts, are often of great interest to study somatic mutation patterns and diversity changes. Here, we describe an approach of IR-seq based on the use of MIDs in combination with a clustering method that can reveal more than 80% of the antibody diversity in a sample and can be applied to as few as 1,000 B cells. We applied this to study the antibody repertoires of young children before and during an acute malaria infection. We discovered unexpectedly high levels of somatic hypermutation (SHM) in infants and revealed characteristics of antibody repertoire development in young children that would have a profound impact on immunization in children.

  8. Localization of Daucus carota NMCP1 to the nuclear periphery: the role of the N-terminal region and an NLS-linked sequence motif, RYNLRR, in the tail domain

    Directory of Open Access Journals (Sweden)

    Yuta eKimura

    2014-02-01

    Full Text Available Recent ultrastructural studies revealed that a structure similar to the vertebrate nuclear lamina exists in the nuclei of higher plants. However, plant genomes lack genes for lamins and intermediate-type filament proteins, and this suggests that plant-specific nuclear coiled-coil proteins make up the lamina-like structure in plants. NMCP1 is a protein, first identified in Daucus carota cells, that localizes exclusively to the nuclear periphery in interphase cells. It has a tripartite structure comprised of head, rod, and tail domains, and includes putative nuclear localization signal (NLS motifs. We identified the functional NLS of DcNMCP1 (carrot NMCP1 and determined the protein regions required for localizing to the nuclear periphery using EGFP-fused constructs transiently expressed in Apium graveolens epidermal cells. Transcription was driven under a CaMV35S promoter, and the genes were introduced into the epidermal cells by a DNA-coated microprojectile delivery system. Of the NLS motifs, KRRRK and RRHK in the tail domain were highly functional for nuclear localization. Addition of the N-terminal 141 amino acids from DcNMCP1 shifted the localization of a region including these NLSs from the entire nucleus to the nuclear periphery. Using this same construct, the replacement of amino acids in RRHK or its preceding sequence, YNL, with alanine residues abolished localization to the nuclear periphery, while replacement of KRRRK did not affect localization. The sequence R/Q/HYNLRR/H, including YNL and the first part of the sequence of RRHK, is evolutionarily conserved in a subclass of NMCP1 sequences from many plant species. These results show that NMCP1 localizes to the nuclear periphery by a combined action of a sequence composed of R/Q/HYNLRR/H, NLS, and the N-terminal region including the head and a portion of the rod domain, suggesting that more than one binding site is implicated in localization of NMCP1.

  9. Deep sequencing-based transcriptome profiling analysis of bacteria-challenged Lateolabrax japonicus reveals insight into the immune-relevant genes in marine fish

    Directory of Open Access Journals (Sweden)

    Xiang Li-xin

    2010-08-01

    Full Text Available Abstract Background Systematic research on fish immunogenetics is indispensable in understanding the origin and evolution of immune systems. This has long been a challenging task because of the limited number of deep sequencing technologies and genome backgrounds of non-model fish available. The newly developed Solexa/Illumina RNA-seq and Digital gene expression (DGE are high-throughput sequencing approaches and are powerful tools for genomic studies at the transcriptome level. This study reports the transcriptome profiling analysis of bacteria-challenged Lateolabrax japonicus using RNA-seq and DGE in an attempt to gain insights into the immunogenetics of marine fish. Results RNA-seq analysis generated 169,950 non-redundant consensus sequences, among which 48,987 functional transcripts with complete or various length encoding regions were identified. More than 52% of these transcripts are possibly involved in approximately 219 known metabolic or signalling pathways, while 2,673 transcripts were associated with immune-relevant genes. In addition, approximately 8% of the transcripts appeared to be fish-specific genes that have never been described before. DGE analysis revealed that the host transcriptome profile of Vibrio harveyi-challenged L. japonicus is considerably altered, as indicated by the significant up- or down-regulation of 1,224 strong infection-responsive transcripts. Results indicated an overall conservation of the components and transcriptome alterations underlying innate and adaptive immunity in fish and other vertebrate models. Analysis suggested the acquisition of numerous fish-specific immune system components during early vertebrate evolution. Conclusion This study provided a global survey of host defence gene activities against bacterial challenge in a non-model marine fish. Results can contribute to the in-depth study of candidate genes in marine fish immunity, and help improve current understanding of host

  10. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  11. Sequence differences in the diagnostic region of the cysteine protease 8 gene of Tritrichomonas foetus parasites of cats and cattle.

    Science.gov (United States)

    Sun, Zichen; Stack, Colin; Šlapeta, Jan

    2012-05-25

    In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Modeling of the Ebola Virus Delta Peptide Reveals a Potential Lytic Sequence Motif

    Directory of Open Access Journals (Sweden)

    William R. Gallaher

    2015-01-01

    Full Text Available Filoviruses, such as Ebola and Marburg viruses, cause severe outbreaks of human infection, including the extensive epidemic of Ebola virus disease (EVD in West Africa in 2014. In the course of examining mutations in the glycoprotein gene associated with 2014 Ebola virus (EBOV sequences, a differential level of conservation was noted between the soluble form of glycoprotein (sGP and the full length glycoprotein (GP, which are both encoded by the GP gene via RNA editing. In the region of the proteins encoded after the RNA editing site sGP was more conserved than the overlapping region of GP when compared to a distant outlier species, Tai Forest ebolavirus. Half of the amino acids comprising the “delta peptide”, a 40 amino acid carboxy-terminal fragment of sGP, were identical between otherwise widely divergent species. A lysine-rich amphipathic peptide motif was noted at the carboxyl terminus of delta peptide with high structural relatedness to the cytolytic peptide of the non-structural protein 4 (NSP4 of rotavirus. EBOV delta peptide is a candidate viroporin, a cationic pore-forming peptide, and may contribute to EBOV pathogenesis.

  13. SMRT Sequencing Revealed Mitogenome Characteristics and Mitogenome-Wide DNA Modification Pattern in Ophiocordyceps sinensis.

    Science.gov (United States)

    Kang, Xincong; Hu, Liqin; Shen, Pengyuan; Li, Rui; Liu, Dongbo

    2017-01-01

    Single molecule, real-time (SMRT) sequencing was used to characterize mitochondrial (mt) genome of Ophiocordyceps sinensis and to analyze the mt genome-wide pattern of epigenetic DNA modification. The complete mt genome of O. sinensis , with a size of 157,539 bp, is the fourth largest Ascomycota mt genome sequenced to date. It contained 14 conserved protein-coding genes (PCGs), 1 intronic protein rps3 , 27 tRNAs and 2 rRNA subunits, which are common characteristics of the known mt genomes in Hypocreales. A phylogenetic tree inferred from 14 PCGs in Pezizomycotina fungi supports O. sinensis as most closely related to Hirsutella rhossiliensis in Ophiocordycipitaceae. A total of 36 sequence sites in rps3 were under positive selection, with dN/dS >1 in the 20 compared fungi. Among them, 16 sites were statistically significant. In addition, the mt genome-wide base modification pattern of O. sinensis was determined in this study, especially DNA methylation. The methylations were located in coding and uncoding regions of mt PCGs in O. sinensis , and might be closely related to the expression of PCGs or the binding affinity of transcription factor A to mtDNA. Consequently, these methylations may affect the enzymatic activity of oxidative phosphorylation and then the mt respiratory rate; or they may influence mt biogenesis. Therefore, methylations in the mitogenome of O. sinensis might be a genetic feature to adapt to the cold and low PO 2 environment at high altitude, where O. sinensis is endemic. This is the first report on epigenetic modifications in a fungal mt genome.

  14. Comparative Genomics of Methanopyrus sp. SNP6 and KOL6 Revealing Genomic Regions of Plasticity Implicated in Extremely Thermophilic Profiles

    Directory of Open Access Journals (Sweden)

    Zhiliang Yu

    2017-07-01

    Full Text Available Methanopyrus spp. are usually isolated from harsh niches, such as high osmotic pressure and extreme temperature. However, the molecular mechanisms for their environmental adaption are poorly understood. Archaeal species is commonly considered as primitive organism. The evolutional placement of archaea is a fundamental and intriguing scientific question. We sequenced the genomes of Methanopyrus strains SNP6 and KOL6 isolated from the Atlantic and Iceland, respectively. Comparative genomic analysis revealed genetic diversity and instability implicated in niche adaption, including a number of transporter- and integrase/transposase-related genes. Pan-genome analysis also defined the gene pool of Methanopyrus spp., in addition of ~120-Kb genomic region of plasticity impacting cognate genomic architecture. We believe that Methanopyrus genomics could facilitate efficient investigation/recognition of archaeal phylogenetic diverse patterns, as well as improve understanding of biological roles and significance of these versatile microbes.

  15. Spatio-temporal alignment of pedobarographic image sequences.

    Science.gov (United States)

    Oliveira, Francisco P M; Sousa, Andreia; Santos, Rubim; Tavares, João Manuel R S

    2011-07-01

    This article presents a methodology to align plantar pressure image sequences simultaneously in time and space. The spatial position and orientation of a foot in a sequence are changed to match the foot represented in a second sequence. Simultaneously with the spatial alignment, the temporal scale of the first sequence is transformed with the aim of synchronizing the two input footsteps. Consequently, the spatial correspondence of the foot regions along the sequences as well as the temporal synchronizing is automatically attained, making the study easier and more straightforward. In terms of spatial alignment, the methodology can use one of four possible geometric transformation models: rigid, similarity, affine, or projective. In the temporal alignment, a polynomial transformation up to the 4th degree can be adopted in order to model linear and curved time behaviors. Suitable geometric and temporal transformations are found by minimizing the mean squared error (MSE) between the input sequences. The methodology was tested on a set of real image sequences acquired from a common pedobarographic device. When used in experimental cases generated by applying geometric and temporal control transformations, the methodology revealed high accuracy. In addition, the intra-subject alignment tests from real plantar pressure image sequences showed that the curved temporal models produced better MSE results (P alignment of pedobarographic image data, since previous methods can only be applied on static images.

  16. Methylome-wide Sequencing Detects DNA Hypermethylation Distinguishing Indolent from Aggressive Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Jeffrey M. Bhasin

    2015-12-01

    Full Text Available A critical need in understanding the biology of prostate cancer is characterizing the molecular differences between indolent and aggressive cases. Because DNA methylation can capture the regulatory state of tumors, we analyzed differential methylation patterns genome-wide among benign prostatic tissue and low-grade and high-grade prostate cancer and found extensive, focal hypermethylation regions unique to high-grade disease. These hypermethylation regions occurred not only in the promoters of genes but also in gene bodies and at intergenic regions that are enriched for DNA-protein binding sites. Integration with existing RNA-sequencing (RNA-seq and survival data revealed regions where DNA methylation correlates with reduced gene expression associated with poor outcome. Regions specific to aggressive disease are proximal to genes with distinct functions from regions shared by indolent and aggressive disease. Our compendium of methylation changes reveals crucial molecular distinctions between indolent and aggressive prostate cancer.

  17. The complete genome sequence of Fibrobacter succinogenes S85 reveals a cellulolytic and metabolic specialist.

    Directory of Open Access Journals (Sweden)

    Garret Suen

    Full Text Available Fibrobacter succinogenes is an important member of the rumen microbial community that converts plant biomass into nutrients usable by its host. This bacterium, which is also one of only two cultivated species in its phylum, is an efficient and prolific degrader of cellulose. Specifically, it has a particularly high activity against crystalline cellulose that requires close physical contact with this substrate. However, unlike other known cellulolytic microbes, it does not degrade cellulose using a cellulosome or by producing high extracellular titers of cellulase enzymes. To better understand the biology of F. succinogenes, we sequenced the genome of the type strain S85 to completion. A total of 3,085 open reading frames were predicted from its 3.84 Mbp genome. Analysis of sequences predicted to encode for carbohydrate-degrading enzymes revealed an unusually high number of genes that were classified into 49 different families of glycoside hydrolases, carbohydrate binding modules (CBMs, carbohydrate esterases, and polysaccharide lyases. Of the 31 identified cellulases, none contain CBMs in families 1, 2, and 3, typically associated with crystalline cellulose degradation. Polysaccharide hydrolysis and utilization assays showed that F. succinogenes was able to hydrolyze a number of polysaccharides, but could only utilize the hydrolytic products of cellulose. This suggests that F. succinogenes uses its array of hemicellulose-degrading enzymes to remove hemicelluloses to gain access to cellulose. This is reflected in its genome, as F. succinogenes lacks many of the genes necessary to transport and metabolize the hydrolytic products of non-cellulose polysaccharides. The F. succinogenes genome reveals a bacterium that specializes in cellulose as its sole energy source, and provides insight into a novel strategy for cellulose degradation.

  18. The complete chloroplast genome sequence of Abies nephrolepis (Pinaceae: Abietoideae

    Directory of Open Access Journals (Sweden)

    Dong-Keun Yi

    2016-06-01

    Full Text Available The plant chloroplast (cp genome has maintained a relatively conserved structure and gene content throughout evolution. Cp genome sequences have been used widely for resolving evolutionary and phylogenetic issues at various taxonomic levels of plants. Here, we report the complete cp genome of Abies nephrolepis. The A. nephrolepis cp genome is 121,336 base pairs (bp in length including a pair of short inverted repeat regions (IRa and IRb of 139 bp each separated by a small single copy (SSC region of 54,323 bp (SSC and a large single copy region of 66,735 bp (LSC. It contains 114 genes, 68 of which are protein coding genes, 35 tRNA and four rRNA genes, six open reading frames, and one pseudogene. Seventeen repeat units and 64 simple sequence repeats (SSR have been detected in A. nephrolepis cp genome. Large IR sequences locate in 42-kb inversion points (1186 bp. The A. nephrolepis cp genome is identical to Abies koreana’s which is closely related to taxa. Pairwise comparison between two cp genomes revealed 140 polymorphic sites in each. Complete cp genome sequence of A. nephrolepis has a significant potential to provide information on the evolutionary pattern of Abietoideae and valuable data for development of DNA markers for easy identification and classification.

  19. Mapping the transcription start points of the Staphylococcus aureus eap, emp, and vwb promoters reveals a conserved octanucleotide sequence that is essential for expression of these genes.

    Science.gov (United States)

    Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan

    2008-01-01

    Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.

  20. Introduction of the Python script STRinNGS for analysis of STR regions in FASTQ or BAM files and expansion of the Danish STR sequence database to 11 STRs

    DEFF Research Database (Denmark)

    Friis, Susanne L; Buchard, Anders; Rockenbauer, Eszter

    2016-01-01

    This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report with the......This work introduces the in-house developed Python application STRinNGS for analysis of STR sequence elements in BAM or FASTQ files. STRinNGS identifies sequence reads with STR loci by their flanking sequences, it analyses the STR sequence and the flanking regions, and generates a report...

  1. Kangaroo – A pattern-matching program for biological sequences

    Directory of Open Access Journals (Sweden)

    Betel Doron

    2002-07-01

    Full Text Available Abstract Background Biologists are often interested in performing a simple database search to identify proteins or genes that contain a well-defined sequence pattern. Many databases do not provide straightforward or readily available query tools to perform simple searches, such as identifying transcription binding sites, protein motifs, or repetitive DNA sequences. However, in many cases simple pattern-matching searches can reveal a wealth of information. We present in this paper a regular expression pattern-matching tool that was used to identify short repetitive DNA sequences in human coding regions for the purpose of identifying potential mutation sites in mismatch repair deficient cells. Results Kangaroo is a web-based regular expression pattern-matching program that can search for patterns in DNA, protein, or coding region sequences in ten different organisms. The program is implemented to facilitate a wide range of queries with no restriction on the length or complexity of the query expression. The program is accessible on the web at http://bioinfo.mshri.on.ca/kangaroo/ and the source code is freely distributed at http://sourceforge.net/projects/slritools/. Conclusion A low-level simple pattern-matching application can prove to be a useful tool in many research settings. For example, Kangaroo was used to identify potential genetic targets in a human colorectal cancer variant that is characterized by a high frequency of mutations in coding regions containing mononucleotide repeats.

  2. The ITS1-5.8S-ITS2 sequence region in the Musaceae: structure, diversity and use in molecular phylogeny.

    Directory of Open Access Journals (Sweden)

    Eva Hřibová

    2011-03-01

    Full Text Available Genes coding for 45S ribosomal RNA are organized in tandem arrays of up to several thousand copies and contain 18S, 5.8S and 26S rRNA units separated by internal transcribed spacers ITS1 and ITS2. While the rRNA units are evolutionary conserved, ITS show high level of interspecific divergence and have been used frequently in genetic diversity and phylogenetic studies. In this work we report on the structure and diversity of the ITS region in 87 representatives of the family Musaceae. We provide the first detailed information on ITS sequence diversity in the genus Musa and describe the presence of more than one type of ITS sequence within individual species. Both Sanger sequencing of amplified ITS regions and whole genome 454 sequencing lead to similar phylogenetic inferences. We show that it is necessary to identify putative pseudogenic ITS sequences, which may have negative effect on phylogenetic reconstruction at lower taxonomic levels. Phylogenetic reconstruction based on ITS sequence showed that the genus Musa is divided into two distinct clades--Callimusa and Australimusa and Eumusa and Rhodochlamys. Most of the intraspecific banana hybrids analyzed contain conserved parental ITS sequences, indicating incomplete concerted evolution of rDNA loci. Independent evolution of parental rDNA in hybrids enables determination of genomic constitution of hybrids using ITS. The observation of only one type of ITS sequence in some of the presumed interspecific hybrid clones warrants further study to confirm their hybrid origin and to unravel processes leading to evolution of their genomes.

  3. A modification to the SCAR (Sequence Characterized Amplified Region method provides phylogenetic insights within Ceratozamia (Zamiaceae Una modificación al método SCAR (Sequence Characterized Amplified Region aporta entendimiento filogenético en Ceratozamia (Zamiaceae

    Directory of Open Access Journals (Sweden)

    Dolores González

    2012-12-01

    Full Text Available Phylogenetic relationships among closely related plant species are still problematic. DNA intergenic regions often are insufficiently variable to provide desired resolution or support. In this study, a modification to the Sequence Characterized Amplified Region (SCAR method was used to find polymorphic loci for phylogenetic analyses within Ceratozamia. RAPD markers were first used to detect variation in 5 species. Then, equal length fragments found in 2 or more species were excised from the gel, purified and digested with frequent cutter restriction enzymes for isolating both ends, which have the same primer site. Digested fragments were sequenced with the RAPD primer. Variable sequences were used to design specific primers for amplifying and sequencing in all species for phylogenetic analyses. Our results confirmed the previously known high genome sequence resemblance within this genus that contrasts with its high morphological variation. Only 7 parsimony informative characters were found with this approach. Nonetheless, the Digested-SCAR (D-SCAR method provided some phylogenetic insights. Four main clades consistent with distribution ranges of the species were detected. The approach presented here was effective to solve some relationships within the genus and can potentially be implemented in other organisms to find polymorphic loci for phylogenetic studies at any taxonomic level.Las relaciones filogenéticas entre especies de plantas cercanamente relacionadas es aún problemático. Las regiones intergénicas del ADN son a menudo insuficientemente variables para proveer los niveles de resolución y soporte deseados. En este estudio, se usó una modificación al método Sequence Characterized Amplified Region (SCAR para encontrar loci polimórficos para análisis filogenéticos en Ceratozamia. Primero se usaron marcadores RAPD para detectar variación en 5 especies; luego, se cortaron del gel los fragmentos de la misma longitud en 2 o m

  4. Cytoplasmic protein binding to highly conserved sequences in the 3' untranslated region of mouse protamine 2 mRNA, a translationally regulated transcript of male germ cells

    International Nuclear Information System (INIS)

    Kwon, Y.K.; Hecht, N.B.

    1991-01-01

    The expression of the protamines, the predominant nuclear proteins of mammalian spermatozoa, is regulated translationally during male germ-cell development. The 3' untranslated region (UTR) of protamine 1 mRNA has been reported to control its time of translation. To understand the mechanisms controlling translation of the protamine mRNAs, we have sought to identify cis elements of the 3' UTR of protamine 2 mRNA that are recognized by cytoplasmic factors. From gel retardation assays, two sequence elements are shown to form specific RNA-protein complexes. Protein binding sites of the two complexes were determined by RNase T1 mapping, by blocking the putative binding sites with antisense oligonucleotides, and by competition assays. The sequences of these elements, located between nucleotides + 537 and + 572 in protamine 2 mRNA, are highly conserved among postmeiotic translationally regulated nuclear proteins of the mammalian testis. Two closely linked protein binding sites were detected. UV-crosslinking studies revealed that a protein of about 18 kDa binds to one of the conserved sequences. These data demonstrate specific protein binding to a highly conserved 3' UTR of translationally regulated testicular mRNA

  5. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

    1987-01-01

    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus

  6. Analysis of a new strain of Euphorbia mosaic virus with distinct replication specificity unveils a lineage of begomoviruses with short Rep sequences in the DNA-B intergenic region

    Directory of Open Access Journals (Sweden)

    Argüello-Astorga Gerardo R

    2010-10-01

    Full Text Available Abstract Background Euphorbia mosaic virus (EuMV is a member of the SLCV clade, a lineage of New World begomoviruses that display distinctive features in their replication-associated protein (Rep and virion-strand replication origin. The first entirely characterized EuMV isolate is native from Yucatan Peninsula, Mexico; subsequently, EuMV was detected in weeds and pepper plants from another region of Mexico, and partial DNA-A sequences revealed significant differences in their putative replication specificity determinants with respect to EuMV-YP. This study was aimed to investigate the replication compatibility between two EuMV isolates from the same country. Results A new isolate of EuMV was obtained from pepper plants collected at Jalisco, Mexico. Full-length clones of both genomic components of EuMV-Jal were biolistically inoculated into plants of three different species, which developed symptoms indistinguishable from those induced by EuMV-YP. Pseudorecombination experiments with EuMV-Jal and EuMV-YP genomic components demonstrated that these viruses do not form infectious reassortants in Nicotiana benthamiana, presumably because of Rep-iteron incompatibility. Sequence analysis of the EuMV-Jal DNA-B intergenic region (IR led to the unexpected discovery of a 35-nt-long sequence that is identical to a segment of the rep gene in the cognate viral DNA-A. Similar short rep sequences ranging from 35- to 51-nt in length were identified in all EuMV isolates and in three distinct viruses from South America related to EuMV. These short rep sequences in the DNA-B IR are positioned downstream to a ~160-nt non-coding domain highly similar to the CP promoter of begomoviruses belonging to the SLCV clade. Conclusions EuMV strains are not compatible in replication, indicating that this begomovirus species probably is not a replicating lineage in nature. The genomic analysis of EuMV-Jal led to the discovery of a subgroup of SLCV clade viruses that contain in

  7. The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification.

    Directory of Open Access Journals (Sweden)

    Nicolás Sarute

    Full Text Available Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.

  8. The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification.

    Science.gov (United States)

    Sarute, Nicolás; Calderón, Marina Gallo; Pérez, Ruben; La Torre, José; Hernández, Martín; Francia, Lourdes; Panzera, Yanina

    2013-01-01

    Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus) is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H) gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp) coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.

  9. Improvement of methods for large scale sequencing; application to human Xq28

    Energy Technology Data Exchange (ETDEWEB)

    Gibbs, R.A.; Andersson, B.; Wentland, M.A. [Baylor College of Medicine, Houston, TX (United States)] [and others

    1994-09-01

    Sequencing of a one-metabase region of Xq28, spanning the FRAXA and IDS loci has been undertaken in order to investigate the practicality of the shotgun approach for large scale sequencing and as a platform to develop improved methods. The efficiency of several steps in the shotgun sequencing strategy has been increased using PCR-based approaches. An improved method for preparation of M13 libraries has been developed. This protocol combines a previously described adaptor-based protocol with the uracil DNA glycosylase (UDG)-cloning procedure. The efficiency of this procedure has been found to be up to 100-fold higher than that of previously used protocols. In addition the novel protocol is more reliable and thus easy to establish in a laboratory. The method has also been adapted for the simultaneous shotgun sequencing of multiple short fragments by concentrating them before library construction is presented. This protocol is suitable for rapid characterization of cDNA clones. A library was constructed from 15 PCR-amplified and concentrated human cDNA inserts, and the insert sequences could easily be identified as separate contigs during the assembly process and the sequence coverage was even along each fragment. Using this strategy, the fine structures of the FraxA and IDS loci have been revealed and several EST homologies indicating novel expressed sequences have been identified. Use of PCR to close repetitive regions that are difficult to clone was tested by determination of the sequence of a cosmid mapping DXS455 in Xq28, containing a polymorphic VNTR. The region containing the VNTR was not represented in the shotgun library, but by designing PCR primers in the sequences flanking the gap and by cloning and sequencing the PCR product, the fine structure of the VNTR has been determined. It was found to be an AT-rich VNTR with a repeated 25-mer at the center.

  10. Sequence analysis of the PIP5K locus in Eimeria maxima provides further evidence for eimerian genome plasticity and segmental organization.

    Science.gov (United States)

    Song, B K; Pan, M Z; Lau, Y L; Wan, K L

    2014-07-29

    Commercial flocks infected by Eimeria species parasites, including Eimeria maxima, have an increased risk of developing clinical or subclinical coccidiosis; an intestinal enteritis associated with increased mortality rates in poultry. Currently, infection control is largely based on chemotherapy or live vaccines; however, drug resistance is common and vaccines are relatively expensive. The development of new cost-effective intervention measures will benefit from unraveling the complex genetic mechanisms that underlie host-parasite interactions, including the identification and characterization of genes encoding proteins such as phosphatidylinositol 4-phosphate 5-kinase (PIP5K). We previously identified a PIP5K coding sequence within the E. maxima genome. In this study, we analyzed two bacterial artificial chromosome clones presenting a ~145-kb E. maxima (Weybridge strain) genomic region spanning the PIP5K gene locus. Sequence analysis revealed that ~95% of the simple sequence repeats detected were located within regions comparable to the previously described feature-rich segments of the Eimeria tenella genome. Comparative sequence analysis with the orthologous E. maxima (Houghton strain) region revealed a moderate level of conserved synteny. Unique segmental organizations and telomere-like repeats were also observed in both genomes. A number of incomplete transposable elements were detected and further scrutiny of these elements in both orthologous segments revealed interesting nesting events, which may play a role in facilitating genome plasticity in E. maxima. The current analysis provides more detailed information about the genome organization of E. maxima and may help to reveal genotypic differences that are important for expression of traits related to pathogenicity and virulence.

  11. Multilocus sequence typing reveals a novel subspeciation of Lactobacillus delbrueckii.

    Science.gov (United States)

    Tanigawa, Kana; Watanabe, Koichi

    2011-03-01

    Currently, the species Lactobacillus delbrueckii is divided into four subspecies, L. delbrueckii subsp. delbrueckii, L. delbrueckii subsp. bulgaricus, L. delbrueckii subsp. indicus and L. delbrueckii subsp. lactis. These classifications were based mainly on phenotypic identification methods and few studies have used genotypic identification methods. As a result, these subspecies have not yet been reliably delineated. In this study, the four subspecies of L. delbrueckii were discriminated by phenotype and by genotypic identification [amplified-fragment length polymorphism (AFLP) and multilocus sequence typing (MLST)] methods. The MLST method developed here was based on the analysis of seven housekeeping genes (fusA, gyrB, hsp60, ileS, pyrG, recA and recG). The MLST method had good discriminatory ability: the 41 strains of L. delbrueckii examined were divided into 34 sequence types, with 29 sequence types represented by only a single strain. The sequence types were divided into eight groups. These groups could be discriminated as representing different subspecies. The results of the AFLP and MLST analyses were consistent. The type strain of L. delbrueckii subsp. delbrueckii, YIT 0080(T), was clearly discriminated from the other strains currently classified as members of this subspecies, which were located close to strains of L. delbrueckii subsp. lactis. The MLST scheme developed in this study should be a useful tool for the identification of strains of L. delbrueckii to the subspecies level.

  12. Genetic variability among Trichuris ovis isolates from different hosts in Guangdong Province, China revealed by sequences of three mitochondrial genes.

    Science.gov (United States)

    Wang, Yan; Liu, Guo-Hua; Li, Jia-Yuan; Xu, Min-Jun; Ye, Yong-Gang; Zhou, Dong-Hui; Song, Hui-Qun; Lin, Rui-Qing; Zhu, Xing-Quan

    2013-02-01

    This study examined sequence variation in three mitochondrial DNA (mtDNA) regions, namely cytochrome c oxidase subunit 1 (cox1), NADH dehydrogenase subunit 5 (nad5) and cytochrome b (cytb), among Trichuris ovis isolates from different hosts in Guangdong Province, China. A portion of the cox1 (pcox1), nad5 (pnad5) and cytb (pcytb) genes was amplified separately from individual whipworms by PCR, and was subjected to sequencing from both directions. The size of the sequences of pcox1, pnad5 and pcytb was 618, 240 and 464 bp, respectively. Although the intra-specific sequence variations within T. ovis were 0-0.8% for pcox1, 0-0.8% for pnad5 and 0-1.9% for pcytb, the inter-specific sequence differences among members of the genus Trichuris were significantly higher, being 24.3-26.5% for pcox1, 33.7-56.4% for pnad5 and 24.8-26.1% for pcytb, respectively. Phylogenetic analyses using combined sequences of pcox1, pnad5 and pcytb, with three different computational algorithms (maximum likelihood, maximum parsimony and Bayesian inference), indicated that all of the T. ovis isolates grouped together with high statistical support. These findings demonstrated the existence of intra-specific variation in mtDNA sequences among T. ovis isolates from different hosts, and have implications for studying molecular epidemiology and population genetics of T. ovis.

  13. Segmented seismicity of the Mw 6.2 Baladeh earthquake sequence (Alborz mountains, Iran) revealed from regional moment tensors

    DEFF Research Database (Denmark)

    Donner, Stefanie; Rössler, Dirk; Krüger, Frank

    2013-01-01

    The M w 6.2 Baladeh earthquake occurred on 28 May 2004 in the Alborz Mountains, northern Iran. This earthquake was the first strong shock in this intracontinental orogen for which digital regional broadband data are available. The Baladeh event provides a rare opportunity to study fault geometry...... model, regional waveform data of the mainshock and larger aftershocks (M w  ≥3.3) were inverted for moment tensors. For the Baladeh mainshock, this included inversion for kinematic parameters. All analysed earthquakes show dominant thrust mechanisms at depths between 14 and 26 km, with NW–SE striking...

  14. Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

    Directory of Open Access Journals (Sweden)

    Jacqueline Morris

    2017-12-01

    Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

  15. Genome sequencing and analysis reveals possible determinants of Staphylococcus aureus nasal carriage

    Directory of Open Access Journals (Sweden)

    Cole Alexander M

    2008-09-01

    Full Text Available Abstract Background Nasal carriage of Staphylococcus aureus is a major risk factor in clinical and community settings due to the range of etiologies caused by the organism. We have identified unique immunological and ultrastructural properties associated with nasal carriage isolates denoting a role for bacterial factors in nasal carriage. However, despite extensive molecular level characterizations by several groups suggesting factors necessary for colonization on nasal epithelium, genetic determinants of nasal carriage are unknown. Herein, we have set a genomic foundation for unraveling the bacterial determinants of nasal carriage in S. aureus. Results MLST analysis revealed no lineage specific differences between carrier and non-carrier strains suggesting a role for mobile genetic elements. We completely sequenced a model carrier isolate (D30 and a model non-carrier strain (930918-3 to identify differential gene content. Comparison revealed the presence of 84 genes unique to the carrier strain and strongly suggests a role for Type VII secretion systems in nasal carriage. These genes, along with a putative pathogenicity island (SaPIBov present uniquely in the carrier strains are likely important in affecting carriage. Further, PCR-based genotyping of other clinical isolates for a specific subset of these 84 genes raise the possibility of nasal carriage being caused by multiple gene sets. Conclusion Our data suggest that carriage is likely a heterogeneic phenotypic trait and implies a role for nucleotide level polymorphism in carriage. Complete genome level analyses of multiple carriage strains of S. aureus will be important in clarifying molecular determinants of S. aureus nasal carriage.

  16. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    Science.gov (United States)

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  17. kmer-SVM: a web server for identifying predictive regulatory sequence features in genomic data sets

    Science.gov (United States)

    Fletez-Brant, Christopher; Lee, Dongwon; McCallion, Andrew S.; Beer, Michael A.

    2013-01-01

    Massively parallel sequencing technologies have made the generation of genomic data sets a routine component of many biological investigations. For example, Chromatin immunoprecipitation followed by sequence assays detect genomic regions bound (directly or indirectly) by specific factors, and DNase-seq identifies regions of open chromatin. A major bottleneck in the interpretation of these data is the identification of the underlying DNA sequence code that defines, and ultimately facilitates prediction of, these transcription factor (TF) bound or open chromatin regions. We have recently developed a novel computational methodology, which uses a support vector machine (SVM) with kmer sequence features (kmer-SVM) to identify predictive combinations of short transcription factor-binding sites, which determine the tissue specificity of these genomic assays (Lee, Karchin and Beer, Discriminative prediction of mammalian enhancers from DNA sequence. Genome Res. 2011; 21:2167–80). This regulatory information can (i) give confidence in genomic experiments by recovering previously known binding sites, and (ii) reveal novel sequence features for subsequent experimental testing of cooperative mechanisms. Here, we describe the development and implementation of a web server to allow the broader research community to independently apply our kmer-SVM to analyze and interpret their genomic datasets. We analyze five recently published data sets and demonstrate how this tool identifies accessory factors and repressive sequence elements. kmer-SVM is available at http://kmersvm.beerlab.org. PMID:23771147

  18. Experimental evolution, genetic analysis and genome re-sequencing reveal the mutation conferring artemisinin resistance in an isogenic lineage of malaria parasites

    KAUST Repository

    Hunt, Paul; Martinelli, Axel; Modrzynska, Katarzyna; Borges, Sofia; Creasey, Alison; Rodrigues, Louise; Beraldi, Dario; Loewe, Laurence; Fawcett, Richard; Kumar, Sujai; Thomson, Marian; Trivedi, Urmi; Otto, Thomas D; Pain, Arnab; Blaxter, Mark; Cravo, Pedro

    2010-01-01

    was mapped to a region of chromosome 2 by Linkage Group Selection in two different genetic crosses. Whole-genome deep coverage short-read re-sequencing (IlluminaSolexa) defined the point mutations, insertions, deletions and copy-number variations arising

  19. Structure-Related Roles for the Conservation of the HIV-1 Fusion Peptide Sequence Revealed by Nuclear Magnetic Resonance.

    Science.gov (United States)

    Serrano, Soraya; Huarte, Nerea; Rujas, Edurne; Andreu, David; Nieva, José L; Jiménez, María Angeles

    2017-10-17

    Despite extensive characterization of the human immunodeficiency virus type 1 (HIV-1) hydrophobic fusion peptide (FP), the structure-function relationships underlying its extraordinary degree of conservation remain poorly understood. Specifically, the fact that the tandem repeat of the FLGFLG tripeptide is absolutely conserved suggests that high hydrophobicity may not suffice to unleash FP function. Here, we have compared the nuclear magnetic resonance (NMR) structures adopted in nonpolar media by two FP surrogates, wtFP-tag and scrFP-tag, which had equal hydrophobicity but contained wild-type and scrambled core sequences LFLGFLG and FGLLGFL, respectively. In addition, these peptides were tagged at their C-termini with an epitope sequence that folded independently, thereby allowing Western blot detection without interfering with FP structure. We observed similar α-helical FP conformations for both specimens dissolved in the low-polarity medium 25% (v/v) 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP), but important differences in contact with micelles of the membrane mimetic dodecylphosphocholine (DPC). Thus, whereas wtFP-tag preserved a helix displaying a Gly-rich ridge, the scrambled sequence lost in great part the helical structure upon being solubilized in DPC. Western blot analyses further revealed the capacity of wtFP-tag to assemble trimers in membranes, whereas membrane oligomers were not observed in the case of the scrFP-tag sequence. We conclude that, beyond hydrophobicity, preserving sequence order is an important feature for defining the secondary structures and oligomeric states adopted by the HIV FP in membranes.

  20. Sequences of the joining region genes for immunoglobulin heavy chains and their role in generation of antibody diversity.

    OpenAIRE

    Gough, N M; Bernard, O

    1981-01-01

    To assess the contribution to immunoglobulin heavy chain diversity made by recombination between variable region (VH) genes and joining region (JH) genes, we have determined the sequence of about 2000 nucleotides spanning the rearranged JH gene cluster associated with the VH gene expressed in plasmacytoma HPC76. The active VH76 gene has recombined with the second germ-line JH gene. The region we have studied contains two other JH genes, designated JH3 and JH4. No other JH gene was found withi...

  1. Mapping the transcription termination region of the mouse immunoglobulin kappa gene

    International Nuclear Information System (INIS)

    Xu, M.; Garrard, W.T.

    1986-01-01

    To define the transcription termination region of the mouse immunoglobulin kappa gene, they have subcloned single copy DNA sequences corresponding to both the template and the non-template strands of this locus. In vitro nuclear transcription with isolated MPC-11 nuclei was performed and the resulting 32 P-labeled RNA was hybridized to slot-blotted, single-stranded M13 probes covering regions within and flanking the kappa gene. The hybridization pattern for the template-strand reveals that transcription terminates within the region between 1.1 to 2.3 kb downstream from the poly(A) site. Ten different short sequences (8-13 bp) reside within 460 bp of this region that exhibit homology with sequences found in the termination regions of mouse β-globin and chicken ovalbumin genes. Transcription of the non-template strand occurs on either side of this termination region. They note that no transcription is detectable on the non-template strand downstream of the enhancer, indicating that if RNA polymerase II enters at this site, it does not initiate transcription during transit to the promoter region. They conclude that transcription of the kappa gene passes the poly(A) addition site and terminates within 2.3 Kb downstream

  2. Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

    Science.gov (United States)

    Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

    2008-01-01

    The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

  3. Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

    Science.gov (United States)

    Sánchez-Navarro, J A; Pallás, V

    1997-01-01

    The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

  4. Exploring evidence of positive selection reveals genetic basis of meat quality traits in Berkshire pigs through whole genome sequencing.

    Science.gov (United States)

    Jeong, Hyeonsoo; Song, Ki-Duk; Seo, Minseok; Caetano-Anollés, Kelsey; Kim, Jaemin; Kwak, Woori; Oh, Jae-Don; Kim, EuiSoo; Jeong, Dong Kee; Cho, Seoae; Kim, Heebal; Lee, Hak-Kyo

    2015-08-20

    Natural and artificial selection following domestication has led to the existence of more than a hundred pig breeds, as well as incredible variation in phenotypic traits. Berkshire pigs are regarded as having superior meat quality compared to other breeds. As the meat production industry seeks selective breeding approaches to improve profitable traits such as meat quality, information about genetic determinants of these traits is in high demand. However, most of the studies have been performed using trained sensory panel analysis without investigating the underlying genetic factors. Here we investigate the relationship between genomic composition and this phenotypic trait by scanning for signatures of positive selection in whole-genome sequencing data. We generated genomes of 10 Berkshire pigs at a total of 100.6 coverage depth, using the Illumina Hiseq2000 platform. Along with the genomes of 11 Landrace and 13 Yorkshire pigs, we identified genomic variants of 18.9 million SNVs and 3.4 million Indels in the mapped regions. We identified several associated genes related to lipid metabolism, intramuscular fatty acid deposition, and muscle fiber type which attribute to pork quality (TG, FABP1, AKIRIN2, GLP2R, TGFBR3, JPH3, ICAM2, and ERN1) by applying between population statistical tests (XP-EHH and XP-CLR). A statistical enrichment test was also conducted to detect breed specific genetic variation. In addition, de novo short sequence read assembly strategy identified several candidate genes (SLC25A14, IGF1, PI4KA, CACNA1A) as also contributing to lipid metabolism. Results revealed several candidate genes involved in Berkshire meat quality; most of these genes are involved in lipid metabolism and intramuscular fat deposition. These results can provide a basis for future research on the genomic characteristics of Berkshire pigs.

  5. Identification of Bacillus anthracis specific chromosomal sequences by suppressive subtractive hybridization

    Directory of Open Access Journals (Sweden)

    Redkar Rajendra

    2004-02-01

    Full Text Available Abstract Background Bacillus anthracis, Bacillus thuringiensis and Bacillus cereus are closely related members of the B. cereus-group of bacilli. Suppressive subtractive hybridization (SSH was used to identify specific chromosomal sequences unique to B. anthracis. Results Two SSH libraries were generated. Genomic DNA from plasmid-cured B. anthracis was used as the tester DNA in both libraries, while genomic DNA from either B. cereus or B. thuringiensis served as the driver DNA. Progressive screening of the libraries by colony filter and Southern blot analyses identified 29 different clones that were specific for the B. anthracis chromosome relative not only to the respective driver DNAs, but also to seven other different strains of B. cereus and B. thuringiensis included in the process. The nucleotide sequences of the clones were compared with those found in genomic databases, revealing that over half of the clones were located into 2 regions on the B. anthracis chromosome. Conclusions Genes encoding potential cell wall synthesis proteins dominated one region, while bacteriophage-related sequences dominated the other region. The latter supports the hypothesis that acquisition of these bacteriophage sequences occurred during or after speciation of B. anthracis relative to B. cereus and B. thuringiensis. This study provides insight into the chromosomal differences between B. anthracis and its closest phylogenetic relatives.

  6. Sequence analysis and typing of Saprolegnia strains isolated from freshwater fish from Southern Chinese regions

    Directory of Open Access Journals (Sweden)

    Siya Liu

    2017-09-01

    Full Text Available Saprolegniasis, caused by Saprolegnia infection, is one of the most common diseases in freshwater fish. Our study aimed to determine the epidemiological characteristics of saprolegniasis in Chinese regions of high incidence. Saprolegnia were isolated and identified by morphological and molecular methods targeting the internal transcribed spacer (ITS ribosomal DNA (rDNA and building neighbor-joining (NJ and maximum parsimony (MP phylogenetic trees. The ITS sequences of eight isolated strains were compared with GenBank sequences and all strains fell into three clades: CLADE1 (02, LP, 04 and 14, CLADE2 (S1, and CLADE3 (CP, S2, L5 and the reference ATCC200013. Isolates 02 and LP shared 80% sequence similarity with S. diclina, S. longicaulis, S. ferax, S. mixta, and S. anomalies. Further, isolates 04 and 14 shared 80% similarity with S. bulbosa and S. oliviae. Finally, extremely high ITS sequence similarities were identified between isolates S1 and S. australis (100%; CP and S. hypogyna (96%; and S2, L5, ATCC200013 and S. salmonis (98%. This research provides insights into the identification, prevention and control of saprolegniasis pathogens and the potential development of effective drugs.

  7. Cloning, nucleotide sequence and transcriptional analysis of the uvrA gene from Neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Black, C.G.; Fyfe, J.A.M.; Davies, J.K.

    1997-01-01

    A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)

  8. Genetic structure of Florida green turtle rookeries as indicated by mitochondrial DNA control region sequences

    Science.gov (United States)

    Shamblin, Brian M.; Bagley, Dean A.; Ehrhart, Llewellyn M.; Desjardin, Nicole A.; Martin, R. Erik; Hart, Kristen M.; Naro-Maciel, Eugenia; Rusenko, Kirt; Stiner, John C.; Sobel, Debra; Johnson, Chris; Wilmers, Thomas; Wright, Laura J.; Nairn, Campbell J.

    2014-01-01

    Green turtle (Chelonia mydas) nesting has increased dramatically in Florida over the past two decades, ranking the Florida nesting aggregation among the largest in the Greater Caribbean region. Individual beaches that comprise several hundred kilometers of Florida’s east coast and Keys support tens to thousands of nests annually. These beaches encompass natural to highly developed habitats, and the degree of demographic partitioning among rookeries was previously unresolved. We characterized the genetic structure of ten Florida rookeries from Cape Canaveral to the Dry Tortugas through analysis of 817 base pair mitochondrial DNA (mtDNA) control region sequences from 485 nesting turtles. Two common haplotypes, CM-A1.1 and CM-A3.1, accounted for 87 % of samples, and the haplotype frequencies were strongly partitioned by latitude along Florida’s Atlantic coast. Most genetic structure occurred between rookeries on either side of an apparent genetic break in the vicinity of the St. Lucie Inlet that separates Hutchinson Island and Jupiter Island, representing the finest scale at which mtDNA structure has been documented in marine turtle rookeries. Florida and Caribbean scale analyses of population structure support recognition of at least two management units: central eastern Florida and southern Florida. More thorough sampling and deeper sequencing are necessary to better characterize connectivity among Florida green turtle rookeries as well as between the Florida nesting aggregation and others in the Greater Caribbean region.

  9. Allelic variation of the inducible costimulator (ICOS) gene: detection of polymorphisms, analysis of the promoter region, and extended haplotype estimation

    DEFF Research Database (Denmark)

    Andersen, A.D.H.; Lange, Marianne; Lillevang, S.T.

    2003-01-01

    The human chromosome region 2q33 including the three costimulatory molecules CD28, CTLA-4 and ICOS, has been subject to much attention due to its linkage to a number of autoimmune diseases. The search for the causal relationship of this linkage has revealed several polymorphisms, but no variations...... in the amino acid sequences except for one polymorphism in, the leader sequence of CTLA-4. In the present study, we examined the ICOS gene of an unrelated group of healthy donors from the Danish population. We were able to report 16 intronic SNP, one intronic G-insert and two repeat regions in intron 4......, consistent with the [T](n) and the [GT](n) regions reported in a Japanese study. Putative haplotypes for the established SNP and repeat polymorphisms have been estimated by computational analysis. Sequencing of similar to3500 by of the upstream region of ICOS revealed an additional eight SNP of which two...

  10. Full genome sequence of a Danish isolate of Mycobacterium avium subspecies paratuberculosis, strain Ejlskov2007

    DEFF Research Database (Denmark)

    Afzal, Mamuna; Abidi, Soad; Mikkelsen, Heidi

    We have sequenced a Danish isolate of Mycobacterium avium subspecies paratuberculosis, strain Ejlskov2007. The strain was isolated from faecal material of a 48 month old second parity Danish Holstein cow, with clinical symptoms of chronic diarrhoea and emaciation. The cultures were grown on Löwen......We have sequenced a Danish isolate of Mycobacterium avium subspecies paratuberculosis, strain Ejlskov2007. The strain was isolated from faecal material of a 48 month old second parity Danish Holstein cow, with clinical symptoms of chronic diarrhoea and emaciation. The cultures were grown......, consisting of 4317 unique gene families. Comparison with M. avium paratuberculosis strain K10 revealed only 3436 genes in common (~70%). We have used GenomeAtlases to show conserved (and unique) regions along the Ejlskov2007 chromosome, compared to 2 other Mycobacterium avium sequenced genomes. Pan......-genome analyses of the sequenced Mycobacterium genomes reveal a surprisingly open and diverse set of genes for this bacterial genera....

  11. Sequence composition and gene content of the short arm of rye (Secale cereale chromosome 1.

    Directory of Open Access Journals (Sweden)

    Silvia Fluch

    Full Text Available BACKGROUND: The purpose of the study is to elucidate the sequence composition of the short arm of rye chromosome 1 (Secale cereale with special focus on its gene content, because this portion of the rye genome is an integrated part of several hundreds of bread wheat varieties worldwide. METHODOLOGY/PRINCIPAL FINDINGS: Multiple Displacement Amplification of 1RS DNA, obtained from flow sorted 1RS chromosomes, using 1RS ditelosomic wheat-rye addition line, and subsequent Roche 454FLX sequencing of this DNA yielded 195,313,589 bp sequence information. This quantity of sequence information resulted in 0.43× sequence coverage of the 1RS chromosome arm, permitting the identification of genes with estimated probability of 95%. A detailed analysis revealed that more than 5% of the 1RS sequence consisted of gene space, identifying at least 3,121 gene loci representing 1,882 different gene functions. Repetitive elements comprised about 72% of the 1RS sequence, Gypsy/Sabrina (13.3% being the most abundant. More than four thousand simple sequence repeat (SSR sites mostly located in gene related sequence reads were identified for possible marker development. The existence of chloroplast insertions in 1RS has been verified by identifying chimeric chloroplast-genomic sequence reads. Synteny analysis of 1RS to the full genomes of Oryza sativa and Brachypodium distachyon revealed that about half of the genes of 1RS correspond to the distal end of the short arm of rice chromosome 5 and the proximal region of the long arm of Brachypodium distachyon chromosome 2. Comparison of the gene content of 1RS to 1HS barley chromosome arm revealed high conservation of genes related to chromosome 5 of rice. CONCLUSIONS: The present study revealed the gene content and potential gene functions on this chromosome arm and demonstrated numerous sequence elements like SSRs and gene-related sequences, which can be utilised for future research as well as in breeding of wheat and rye.

  12. Bacterial Pathogens and Community Composition in Advanced Sewage Treatment Systems Revealed by Metagenomics Analysis Based on High-Throughput Sequencing

    Science.gov (United States)

    Lu, Xin; Zhang, Xu-Xiang; Wang, Zhu; Huang, Kailong; Wang, Yuan; Liang, Weigang; Tan, Yunfei; Liu, Bo; Tang, Junying

    2015-01-01

    This study used 454 pyrosequencing, Illumina high-throughput sequencing and metagenomic analysis to investigate bacterial pathogens and their potential virulence in a sewage treatment plant (STP) applying both conventional and advanced treatment processes. Pyrosequencing and Illumina sequencing consistently demonstrated that Arcobacter genus occupied over 43.42% of total abundance of potential pathogens in the STP. At species level, potential pathogens Arcobacter butzleri, Aeromonas hydrophila and Klebsiella pneumonia dominated in raw sewage, which was also confirmed by quantitative real time PCR. Illumina sequencing also revealed prevalence of various types of pathogenicity islands and virulence proteins in the STP. Most of the potential pathogens and virulence factors were eliminated in the STP, and the removal efficiency mainly depended on oxidation ditch. Compared with sand filtration, magnetic resin seemed to have higher removals in most of the potential pathogens and virulence factors. However, presence of the residual A. butzleri in the final effluent still deserves more concerns. The findings indicate that sewage acts as an important source of environmental pathogens, but STPs can effectively control their spread in the environment. Joint use of the high-throughput sequencing technologies is considered a reliable method for deep and comprehensive overview of environmental bacterial virulence. PMID:25938416

  13. How conserved are the conserved 16S-rRNA regions?

    Directory of Open Access Journals (Sweden)

    Marcel Martinez-Porchas

    2017-02-01

    Full Text Available The 16S rRNA gene has been used as master key for studying prokaryotic diversity in almost every environment. Despite the claim of several researchers to have the best universal primers, the reality is that no primer has been demonstrated to be truly universal. This suggests that conserved regions of the gene may not be as conserved as expected. The aim of this study was to evaluate the conservation degree of the so-called conserved regions flanking the hypervariable regions of the 16S rRNA gene. Data contained in SILVA database (release 123 were used for the study. Primers reported as matches of each conserved region were assembled to form contigs; sequences sizing 12 nucleotides (12-mers were extracted from these contigs and searched into the entire set of SILVA sequences. Frequency analysis shown that extreme regions, 1 and 10, registered the lowest frequencies. 12-mer frequencies revealed segments of contigs that were not as conserved as expected (≤90%. Fragments corresponding to the primer contigs 3, 4, 5b and 6a were recovered from all sequences in SILVA database. Nucleotide frequency analysis in each consensus demonstrated that only a small fraction of these so-called conserved regions is truly conserved in non-redundant sequences. It could be concluded that conserved regions of the 16S rRNA gene exhibit considerable variation that has to be considered when using this gene as biomarker.

  14. Improved annotation of 3' untranslated regions and complex loci by combination of strand-specific direct RNA sequencing, RNA-Seq and ESTs.

    Directory of Open Access Journals (Sweden)

    Nicholas J Schurch

    Full Text Available The reference annotations made for a genome sequence provide the framework for all subsequent analyses of the genome. Correct and complete annotation in addition to the underlying genomic sequence is particularly important when interpreting the results of RNA-seq experiments where short sequence reads are mapped against the genome and assigned to genes according to the annotation. Inconsistencies in annotations between the reference and the experimental system can lead to incorrect interpretation of the effect on RNA expression of an experimental treatment or mutation in the system under study. Until recently, the genome-wide annotation of 3' untranslated regions received less attention than coding regions and the delineation of intron/exon boundaries. In this paper, data produced for samples in Human, Chicken and A. thaliana by the novel single-molecule, strand-specific, Direct RNA Sequencing technology from Helicos Biosciences which locates 3' polyadenylation sites to within +/- 2 nt, were combined with archival EST and RNA-Seq data. Nine examples are illustrated where this combination of data allowed: (1 gene and 3' UTR re-annotation (including extension of one 3' UTR by 5.9 kb; (2 disentangling of gene expression in complex regions; (3 clearer interpretation of small RNA expression and (4 identification of novel genes. While the specific examples displayed here may become obsolete as genome sequences and their annotations are refined, the principles laid out in this paper will be of general use both to those annotating genomes and those seeking to interpret existing publically available annotations in the context of their own experimental data.

  15. Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags

    Science.gov (United States)

    de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.

    2000-01-01

    Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084

  16. Single-Cell RNA-Sequencing Reveals a Continuous Spectrum of Differentiation in Hematopoietic Cells

    Directory of Open Access Journals (Sweden)

    Iain C. Macaulay

    2016-02-01

    Full Text Available The transcriptional programs that govern hematopoiesis have been investigated primarily by population-level analysis of hematopoietic stem and progenitor cells, which cannot reveal the continuous nature of the differentiation process. Here we applied single-cell RNA-sequencing to a population of hematopoietic cells in zebrafish as they undergo thrombocyte lineage commitment. By reconstructing their developmental chronology computationally, we were able to place each cell along a continuum from stem cell to mature cell, refining the traditional lineage tree. The progression of cells along this continuum is characterized by a highly coordinated transcriptional program, displaying simultaneous suppression of genes involved in cell proliferation and ribosomal biogenesis as the expression of lineage specific genes increases. Within this program, there is substantial heterogeneity in the expression of the key lineage regulators. Overall, the total number of genes expressed, as well as the total mRNA content of the cell, decreases as the cells undergo lineage commitment.

  17. First Mitochondrial Genome from Nemouridae (Plecoptera) Reveals Novel Features of the Elongated Control Region and Phylogenetic Implications.

    Science.gov (United States)

    Chen, Zhi-Teng; Du, Yu-Zhou

    2017-05-05

    The complete mitochondrial genome (mitogenome) of Nemoura nankinensis (Plecoptera: Nemouridae) was sequenced as the first reported mitogenome from the family Nemouridae. The N. nankinensis mitogenome was the longest (16,602 bp) among reported plecopteran mitogenomes, and it contains 37 genes including 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes and two ribosomal RNA (rRNA) genes. Most PCGs used standard ATN as start codons, and TAN as termination codons. All tRNA genes of N. nankinensis could fold into the cloverleaf secondary structures except for trnSer ( AGN ), whose dihydrouridine (DHU) arm was reduced to a small loop. There was also a large non-coding region (control region, CR) in the N. nankinensis mitogenome. The 1751 bp CR was the longest and had the highest A+T content (81.8%) among stoneflies. A large tandem repeat region, five potential stem-loop (SL) structures, four tRNA-like structures and four conserved sequence blocks (CSBs) were detected in the elongated CR. The presence of these tRNA-like structures in the CR has never been reported in other plecopteran mitogenomes. These novel features of the elongated CR in N. nankinensis may have functions associated with the process of replication and transcription. Finally, phylogenetic reconstruction suggested that Nemouridae was the sister-group of Capniidae.

  18. Major soybean maturity gene haplotypes revealed by SNPViz analysis of 72 sequenced soybean genomes.

    Directory of Open Access Journals (Sweden)

    Tiffany Langewisch

    Full Text Available In this Genomics Era, vast amounts of next-generation sequencing data have become publicly available for multiple genomes across hundreds of species. Analyses of these large-scale datasets can become cumbersome, especially when comparing nucleotide polymorphisms across many samples within a dataset and among different datasets or organisms. To facilitate the exploration of allelic variation and diversity, we have developed and deployed an in-house computer software to categorize and visualize these haplotypes. The SNPViz software enables users to analyze region-specific haplotypes from single nucleotide polymorphism (SNP datasets for different sequenced genomes. The examination of allelic variation and diversity of important soybean [Glycine max (L. Merr.] flowering time and maturity genes may provide additional insight into flowering time regulation and enhance researchers' ability to target soybean breeding for particular environments. For this study, we utilized two available soybean genomic datasets for a total of 72 soybean genotypes encompassing cultivars, landraces, and the wild species Glycine soja. The major soybean maturity genes E1, E2, E3, and E4 along with the Dt1 gene for plant growth architecture were analyzed in an effort to determine the number of major haplotypes for each gene, to evaluate the consistency of the haplotypes with characterized variant alleles, and to identify evidence of artificial selection. The results indicated classification of a small number of predominant haplogroups for each gene and important insights into possible allelic diversity for each gene within the context of known causative mutations. The software has both a stand-alone and web-based version and can be used to analyze other genes, examine additional soybean datasets, and view similar genome sequence and SNP datasets from other species.

  19. Sequence elements correlating with circulating viral load in genotype 1b hepatitis C virus infection

    International Nuclear Information System (INIS)

    Watanabe, Hideki; Nagayama, Kazuyoshi; Enomoto, Nobuyuki; Itakura, Jun; Tanabe, Yoko; Hamano, Kosei; Izumi, Namiki; Sato, Chifumi; Watanabe, Mamoru

    2003-01-01

    The correlation between hepatitis C virus (HCV) genomic sequences and circulating HCV RNA levels was assessed to investigate the genetic elements affecting viral load. The interferon sensitivity-determining region (ISDR) sequence and the serum viral load were strongly correlated in 226 patients examined. Analysis of the entire HCV genome from six patients (three with a high and the others with a low viral load) with similar ISDR sequences identified several candidate residues associated with viral load. The amino acid (aa) sequences of these candidate residues and flanking regions in 67 additional patients revealed that only the residue at aa 962 varied significantly between the HCV patients with low and high serum loads (P 0.042). At this position, alanine was observed more frequently in the patients with a high viral load. In conclusion, our results strongly suggest that serum HCV RNA loads are inversely correlated with amino acid substitutions in the ISDR, and aa 962 was identified as a possible second determinant of serum HCV RNA load

  20. Sequence analysis-based characterization and identification of neurovirulence-associated variants of 36 EV71 strains from China.

    Science.gov (United States)

    Xu, Jun; Wang, Fang; Zhao, Desheng; Liu, Jiang; Su, Hong; Wang, Baolong

    2018-03-30

    Enterovirus 71 (EV71) is the main pathogen of hand-foot-mouth disease (HFMD) and causes several neurological complications. As new strains of EV71 are constantly discovered, it is important to understand the genomic characteristics of the viruses and the mechanism of virulence. Herein, we isolated five strains of EV71 from HFMD patients with or without neurovirulence and sequenced their whole genomes. We then performed whole genome sequence analysis of totally 36 EV71 strains. The phylogenetic analysis of the VP1 region revealed all five isolated strains are clustered into C4a of C4 subgenotype. In addition, by comparing the complete genome sequences of 36 strains, 253 variable amino acid positions were found, 14 of which were identified to be associated with neurovirulence (P < 0.05). Moreover, a similar pattern of amino acid variants combination was identified in four strains without neurovirulence, indicating this type of variant pattern might be associated with avirulence. The strains with neurovirulence appeared to be distinguished from those without neurovirulence by the variants in VP1 and P2 regions, implying VP1 and P2 are the important regions associated with neurovirulence. Indeed, 3-D modeling of VP1 and P2 regions of non-neurovirulent and neurovirulent strains revealed that the different variants resulted in different protein structures and amino acid composition of ligand binding site, which might account for their difference in neurovirulence. In summary, our study reveals 14 variable amino acid positions of VP1, P2 and P3 regions are related to the virulence and that mutations in the capsid proteins of EV71 might contribute to neurovirulence. © 2018 Wiley Periodicals, Inc.

  1. Characterization of the genomic organization of the region bordering the centromere of chromosome V of Podospora anserina by direct sequencing.

    Science.gov (United States)

    Silar, Philippe; Barreau, Christian; Debuchy, Robert; Kicka, Sébastien; Turcq, Béatrice; Sainsard-Chanet, Annie; Sellem, Carole H; Billault, Alain; Cattolico, Laurence; Duprat, Simone; Weissenbach, Jean

    2003-08-01

    A Podospora anserina BAC library of 4800 clones has been constructed in the vector pBHYG allowing direct selection in fungi. Screening of the BAC collection for centromeric sequences of chromosome V allowed the recovery of clones localized on either sides of the centromere, but no BAC clone was found to contain the centromere. Seven BAC clones containing 322,195 and 156,244bp from either sides of the centromeric region were sequenced and annotated. One 5S rRNA gene, 5 tRNA genes, and 163 putative coding sequences (CDS) were identified. Among these, only six CDS seem specific to P. anserina. The gene density in the centromeric region is approximately one gene every 2.8kb. Extrapolation of this gene density to the whole genome of P. anserina suggests that the genome contains about 11,000 genes. Synteny analyses between P. anserina and Neurospora crassa show that co-linearity extends at the most to a few genes, suggesting rapid genome rearrangements between these two species.

  2. Context based computational analysis and characterization of ARS consensus sequences (ACS of Saccharomyces cerevisiae genome

    Directory of Open Access Journals (Sweden)

    Vinod Kumar Singh

    2016-09-01

    Full Text Available Genome-wide experimental studies in Saccharomyces cerevisiae reveal that autonomous replicating sequence (ARS requires an essential consensus sequence (ACS for replication activity. Computational studies identified thousands of ACS like patterns in the genome. However, only a few hundreds of these sites act as replicating sites and the rest are considered as dormant or evolving sites. In a bid to understand the sequence makeup of replication sites, a content and context-based analysis was performed on a set of replicating ACS sequences that binds to origin-recognition complex (ORC denoted as ORC-ACS and non-replicating ACS sequences (nrACS, that are not bound by ORC. In this study, DNA properties such as base composition, correlation, sequence dependent thermodynamic and DNA structural profiles, and their positions have been considered for characterizing ORC-ACS and nrACS. Analysis reveals that ORC-ACS depict marked differences in nucleotide composition and context features in its vicinity compared to nrACS. Interestingly, an A-rich motif was also discovered in ORC-ACS sequences within its nucleosome-free region. Profound changes in the conformational features, such as DNA helical twist, inclination angle and stacking energy between ORC-ACS and nrACS were observed. Distribution of ACS motifs in the non-coding segments points to the locations of ORC-ACS which are found far away from the adjacent gene start position compared to nrACS thereby enabling an accessible environment for ORC-proteins. Our attempt is novel in considering the contextual view of ACS and its flanking region along with nucleosome positioning in the S. cerevisiae genome and may be useful for any computational prediction scheme.

  3. Non-virulence of a recombinant shrimp nidovirus is associated with its non structural gene sequence and not a large structural gene deletion

    International Nuclear Information System (INIS)

    Gangnonngiw, Warachin; Anantasomboon, Gun; Sang-oum, Wiwat; Sriurairatana, Siriporn; Sritunyalucksana, Kallaya; Flegel, Timothy W.

    2009-01-01

    RT-PCR using a commercial kit for yellow head virus (YHV) detection in growth-retarded shrimp yielded an unusual 777 bp amplicon instead of expected amplicons of 277 bp for YHV type-1 (YHV-1) or 406 bp for YHV type-2 (YHV-2). Cloning and sequencing (GenBank (EU170438)) revealed approximately 80% identity to non-structural (NS) ORF1b sequences of both YHV-1 (GenBank (AA083987)) and YHV-2 (GenBank (AF227196)), indicating an atypical YHV type (A-YHV) phylogenetically equidistant from both types. An RT-PCR test specifically designed for A-YHV revealed that it was uncommon and that its occurrence in shrimp culture ponds did not correlate with growth retardation or mortality. By immunohistochemistry with YHV-specific monoclonal antibodies, the A-YHV gave positive reactions for envelope protein gp64 and capsid protein p20, but not for envelope protein gp116, even though gp116 and gp64 originate from a polyprotein of ORF3. Lack of gp116 immunoreactivity correlated with a large ORF3 deletion (GenBank (EU123854)) in the region of the protein targeted by an MAb against gp116. Transmission electron microscopy of A-YHV-infected shrimp revealed only unenveloped pre-virions. During manuscript revision, information received revealed that typing of YHV isolates based on sequences of ORF1b and ORF3 had yielded several geographical types, including one virulent type (YHV-1b) with an ORF3 deletion sequence that matched the sequence of A-YHV. Using these sequences and an additional A-YHV sequence ( (EU853170)) from the ORF1b typing region, A-YHV potentially represents a recombinant between type 1b and type 5. SDS-PAGE and Western blot analysis revealed that type 1b produced a gp116 deletion protein that did not bind with the MAb or polyclonal Ab to normal gp116. Overall, the information suggested that lack of A-YHV virulence was associated with the NS gene sequence linked to ORF1b rather than the deletion in ORF3

  4. Molecular phylogenetic lineage of Plagiopogon and Askenasia (Protozoa, Ciliophora) revealed by their gene sequences

    Science.gov (United States)

    Liu, An; Yi, Zhenzhen; Lin, Xiaofeng; Hu, Xiaozhong; Al-Farraj, Saleh A.; Al-Rasheid, Khaled A. S.

    2015-08-01

    Prostomates and haptorians are two basal groups of ciliates with limited morphological characteristics available for taxonomy. Morphologically, the structures used to identify prostomates and haptorians are similar or even identical, which generate heavy taxonomic and phylogenetic confusion. In present work, phylogenetic positions lineage of two rare genera, Plagiopogon and Askenasia, were investigated. Three genes including small subunit ribosomal RNA gene (hereafter SSU rDNA), internal transcribed spacer region (ITS region), and large subunit ribosomal RNA gene (LSU rDNA) were analyzed, 10 new sequences five species each. Our findings included 1) class Prostomatea and order Haptorida are multiphyletic; 2) it may not be appropriate to place order Cyclotrichiida in subclass Haptoria, and the systematic lineage of order Cyclotrichiida needs to be verified further; 3) genus Plagiopogon branches consistently within a clade covering most prostomes and is basal of clade Colepidae, implying its close lineage to Prostomatea; and 4) Askenasia is phylogenetically distant from the subclass Haptoria but close to classes Prostomatea, Plagiopylea and Oligohymenophorea. We supposed that the toxicyst of Askenasia may be close to taxa of prostomes instead of haptorians, and the dorsal brush is a more typical morphological characteristics of haptorians than toxicysts.

  5. High Sequence Variations in Mitochondrial DNA Control Region among Worldwide Populations of Flathead Mullet Mugil cephalus

    Directory of Open Access Journals (Sweden)

    Brian Wade Jamandre

    2014-01-01

    Full Text Available The sequence and structure of the complete mtDNA control region (CR of M. cephalus from African, Pacific, and Atlantic populations are presented in this study to assess its usefulness in phylogeographic studies of this species. The mtDNA CR sequence variations among M. cephalus populations largely exceeded intraspecific polymorphisms that are generally observed in other vertebrates. The length of CR sequence varied among M. cephalus populations due to the presence of indels and variable number of tandem repeats at the 3′ hypervariable domain. The high evolutionary rate of the CR in this species probably originated from these mutations. However, no excessive homoplasic mutations were noticed. Finally, the star shaped tree inferred from the CR polymorphism stresses a rapid radiation worldwide, in this species. The CR still appears as a good marker for phylogeographic investigations and additional worldwide samples are warranted to further investigate the genetic structure and evolution in M. cephalus.

  6. Bm86 midgut protein sequence variation in South Texas cattle fever ticks

    Directory of Open Access Journals (Sweden)

    Kammlah Diane M

    2010-11-01

    Full Text Available Abstract Background Cattle fever ticks, Rhipicephalus (Boophilus microplus and R. (B. annulatus, vector bovine and equine babesiosis, and have significantly expanded beyond the permanent quarantine zone established in South Texas. Currently, there are no vaccines approved for use within the United States for controlling these vectors. Vaccines developed in Australia and Cuba based on the midgut antigen Bm86 have variable efficacy against cattle fever ticks. A possible explanation for this variation in vaccine efficacy is amino acid sequence divergence between the recombinant Bm86 vaccine component and native Bm86 expressed in ticks from different geographical regions of the world. Results There was 91.8% amino acid sequence identity in Bm86 among R. microplus and R. annulatus sequenced from South Texas infestations. When South Texas isolates were compared to the Australian Yeerongpilly and Cuban Camcord vaccine strains, there was 89.8% and 90.0% identity, respectively. Most of the sequence divergence was focused in one region of the protein, amino acids 206-298. Hydrophilicity profiles revealed that two short regions of Bm86 (amino acids 206-210 and 560-570 appear to be more hydrophilic in South Texas isolates compared to vaccine strains. Only one amino acid difference was found between South Texas and vaccine strains within two previously described B-cell epitopes. A total of 4 amino acid differences were observed within three peptides previously shown to induce protective immune responses in cattle. Conclusions Sequence differences between South Texas isolates and Yeerongpilly and Camcord strains are spread throughout the entire Bm86 sequence, suggesting that geographic variation does exist. Differences within previously described B-cell epitopes between South Texas isolates and vaccine strains are minimal; however, short regions of hydrophilic amino acids found unique to South Texas isolates suggest that additional unique surface exposed

  7. Complete genome sequence of an isolate of Potato virus X (PVX) infecting Cape gooseberry (Physalis peruviana) in Colombia.

    Science.gov (United States)

    Gutiérrez, Pablo A; Alzate, Juan F; Montoya, Mauricio Marín

    2015-06-01

    Transcriptome analysis of a Cape gooseberry (Physalis peruviana) plant with leaf symptoms of a mild yellow mosaic typical of a viral disease revealed an infection with Potato virus X (PVX). The genome sequence of the PVX-Physalis isolate comprises 6435 nt and exhibits higher sequence similarity to members of the Eurasian group of PVX (~95 %) than to the American group (~77 %). Genome organization is similar to other PVX isolates with five open reading frames coding for proteins RdRp, TGBp1, TGBp2, TGBp3, and CP. 5' and 3' untranslated regions revealed all regulatory motifs typically found in PVX isolates. The PVX-Physalis genome is the only complete sequence available for a Potexvirus in Colombia and is a new addition to the restricted number of available sequences of PVX isolates infecting plant species different to potato.

  8. DNA sequence responsible for the amplification of adjacent genes.

    Science.gov (United States)

    Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K

    1987-10-01

    A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.

  9. Genetic diagnosis of Mendelian disorders via RNA sequencing.

    Science.gov (United States)

    Kremer, Laura S; Bader, Daniel M; Mertes, Christian; Kopajtich, Robert; Pichler, Garwin; Iuso, Arcangela; Haack, Tobias B; Graf, Elisabeth; Schwarzmayr, Thomas; Terrile, Caterina; Koňaříková, Eliška; Repp, Birgit; Kastenmüller, Gabi; Adamski, Jerzy; Lichtner, Peter; Leonhardt, Christoph; Funalot, Benoit; Donati, Alice; Tiranti, Valeria; Lombes, Anne; Jardel, Claude; Gläser, Dieter; Taylor, Robert W; Ghezzi, Daniele; Mayr, Johannes A; Rötig, Agnes; Freisinger, Peter; Distelmaier, Felix; Strom, Tim M; Meitinger, Thomas; Gagneur, Julien; Prokisch, Holger

    2017-06-12

    Across a variety of Mendelian disorders, ∼50-75% of patients do not receive a genetic diagnosis by exome sequencing indicating disease-causing variants in non-coding regions. Although genome sequencing in principle reveals all genetic variants, their sizeable number and poorer annotation make prioritization challenging. Here, we demonstrate the power of transcriptome sequencing to molecularly diagnose 10% (5 of 48) of mitochondriopathy patients and identify candidate genes for the remainder. We find a median of one aberrantly expressed gene, five aberrant splicing events and six mono-allelically expressed rare variants in patient-derived fibroblasts and establish disease-causing roles for each kind. Private exons often arise from cryptic splice sites providing an important clue for variant prioritization. One such event is found in the complex I assembly factor TIMMDC1 establishing a novel disease-associated gene. In conclusion, our study expands the diagnostic tools for detecting non-exonic variants and provides examples of intronic loss-of-function variants with pathological relevance.

  10. Metagenome Sequence Analysis of Filamentous Microbial Communities Obtained from Geochemically Distinct Geothermal Channels Reveals Specialization of Three Aquificales Lineages

    Directory of Open Access Journals (Sweden)

    Cristina eTakacs-vesbach

    2013-05-01

    Full Text Available The Aquificales are thermophilic microorganisms that inhabit hydrothermal systems worldwide and are considered one of the earliest lineages of the domain Bacteria. We analyzed metagenome sequence obtained from six thermal ‘filamentous streamer’ communities (~40 Mbp per site, which targeted three different groups of Aquificales found in Yellowstone National Park (YNP. Unassembled metagenome sequence and PCR-amplified 16S rRNA gene libraries revealed that acidic, sulfidic sites were dominated by Hydrogenobaculum (Aquificaceae populations, whereas the circumneutral pH (6.5 - 7.8 sites containing dissolved sulfide were dominated by Sulfurihydrogenibium spp. (Hydrogenothermaceae. Thermocrinis (Aquificaceae populations were found primarily in the circumneutral sites with undetectable sulfide, and to a lesser extent in one sulfidic system at pH 8. Phylogenetic analysis of assembled sequence containing 16S rRNA genes as well as conserved protein-encoding genes revealed that the composition and function of these communities varied across geochemical conditions. Each Aquificales lineage contained genes for CO2 fixation by the reverse TCA cycle, but only the Sulfurihydrogenibium populations perform citrate cleavage using ATP citrate lyase (Acl. The Aquificaceae populations use an alternative pathway catalyzed by two separate enzymes, citryl CoA synthetase (Ccs and citryl CoA lyase (Ccl. All three Aquificales lineages contained evidence of aerobic respiration, albeit due to completely different types of heme Cu oxidases (subunit I involved in oxygen reduction. The distribution of Aquificales populations and differences among functional genes involved in energy generation and electron transport is consistent with the hypothesis that geochemical parameters (e.g., pH, sulfide, H2, O2 have resulted in niche specialization among members of the Aquificales.

  11. Mitochondrial genome sequences and comparative genomics ofPhytophthora ramorum and P. sojae

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Frank N.; Douda, Bensasson; Tyler, Brett M.; Boore,Jeffrey L.

    2007-01-01

    The complete sequences of the mitochondrial genomes of theoomycetes of Phytophthora ramorum and P. sojae were determined during thecourse of their complete nuclear genome sequencing (Tyler, et al. 2006).Both are circular, with sizes of 39,314 bp for P. ramorum and 42,975 bpfor P. sojae. Each contains a total of 37 identifiable protein-encodinggenes, 25 or 26 tRNAs (P. sojae and P. ramorum, respectively)specifying19 amino acids, and a variable number of ORFs (7 for P. ramorum and 12for P. sojae) which are potentially additional functional genes.Non-coding regions comprise approximately 11.5 percent and 18.4 percentof the genomes of P. ramorum and P. sojae, respectively. Relative to P.sojae, there is an inverted repeat of 1,150 bp in P. ramorum thatincludes an unassigned unique ORF, a tRNA gene, and adjacent non-codingsequences, but otherwise the gene order in both species is identical.Comparisons of these genomes with published sequences of the P. infestansmitochondrial genome reveals a number of similarities, but the gene orderin P. infestans differs in two adjacent locations due to inversions.Sequence alignments of the three genomes indicated sequence conservationranging from 75 to 85 percent and that specific regions were morevariable than others.

  12. Genetic Diversity of Toxoplasma gondii Strains from Different Hosts and Geographical Regions by Sequence Analysis of GRA20 Gene.

    Science.gov (United States)

    Ning, Hong-Rui; Huang, Si-Yang; Wang, Jin-Lei; Xu, Qian-Ming; Zhu, Xing-Quan

    2015-06-01

    Toxoplasma gondii is a eukaryotic parasite of the phylum Apicomplexa, which infects all warm-blood animals, including humans. In the present study, we examined sequence variation in dense granule 20 (GRA20) genes among T. gondii isolates collected from different hosts and geographical regions worldwide. The complete GRA20 genes were amplified from 16 T. gondii isolates using PCR, sequence were analyzed, and phylogenetic reconstruction was analyzed by maximum parsimony (MP) and maximum likelihood (ML) methods. The results showed that the complete GRA20 gene sequence was 1,586 bp in length among all the isolates used in this study, and the sequence variations in nucleotides were 0-7.9% among all strains. However, removing the type III strains (CTG, VEG), the sequence variations became very low, only 0-0.7%. These results indicated that the GRA20 sequence in type III was more divergence. Phylogenetic analysis of GRA20 sequences using MP and ML methods can differentiate 2 major clonal lineage types (type I and type III) into their respective clusters, indicating the GRA20 gene may represent a novel genetic marker for intraspecific phylogenetic analyses of T. gondii.

  13. Sequencing intractable DNA to close microbial genomes.

    Directory of Open Access Journals (Sweden)

    Richard A Hurt

    Full Text Available Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps and the Desulfovibrio africanus genome (1 intractable gap. The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  14. Sequencing Intractable DNA to Close Microbial Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Hurt, Jr., Richard Ashley [ORNL; Brown, Steven D [ORNL; Podar, Mircea [ORNL; Palumbo, Anthony Vito [ORNL; Elias, Dwayne A [ORNL

    2012-01-01

    Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled intractable resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such difficult regions in the non-contiguous finished Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. These developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  15. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

    Science.gov (United States)

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

  16. Sequence and secondary structure of the mitochondrial small-subunit rRNA V4, V6, and V9 domains reveal highly species-specific variations within the genus Agrocybe.

    Science.gov (United States)

    Gonzalez, P; Labarère, J

    1998-11-01

    A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The

  17. Genomic divergences among cattle, dog and human estimated from large-scale alignments of genomic sequences

    Directory of Open Access Journals (Sweden)

    Shade Larry L

    2006-06-01

    Full Text Available Abstract Background Approximately 11 Mb of finished high quality genomic sequences were sampled from cattle, dog and human to estimate genomic divergences and their regional variation among these lineages. Results Optimal three-way multi-species global sequence alignments for 84 cattle clones or loci (each >50 kb of genomic sequence were constructed using the human and dog genome assemblies as references. Genomic divergences and substitution rates were examined for each clone and for various sequence classes under different functional constraints. Analysis of these alignments revealed that the overall genomic divergences are relatively constant (0.32–0.37 change/site for pairwise comparisons among cattle, dog and human; however substitution rates vary across genomic regions and among different sequence classes. A neutral mutation rate (2.0–2.2 × 10(-9 change/site/year was derived from ancestral repetitive sequences, whereas the substitution rate in coding sequences (1.1 × 10(-9 change/site/year was approximately half of the overall rate (1.9–2.0 × 10(-9 change/site/year. Relative rate tests also indicated that cattle have a significantly faster rate of substitution as compared to dog and that this difference is about 6%. Conclusion This analysis provides a large-scale and unbiased assessment of genomic divergences and regional variation of substitution rates among cattle, dog and human. It is expected that these data will serve as a baseline for future mammalian molecular evolution studies.

  18. Genotyping by PCR and High-Throughput Sequencing of Commercial Probiotic Products Reveals Composition Biases.

    Directory of Open Access Journals (Sweden)

    Wesley Morovic

    2016-11-01

    Full Text Available Recent advances in microbiome research have brought renewed focus on beneficial bacteria, many of which are available in food and dietary supplements. Although probiotics have historically been defined as microorganisms that convey health benefits when ingested in sufficient viable amounts, this description now includes the stipulation well defined strains, encompassing definitive taxonomy for consumer consideration and regulatory oversight. Here, we evaluated 52 commercial dietary supplements covering a range of labeled species, and determined their content using plate counting, targeted genotyping. Additionally, strain identities were assessed using methods recently published by the United States Pharmacopeial Convention. We also determined the relative abundance of individual bacteria by high-throughput sequencing (HTS of the 16S rRNA sequence using paired-end 2x250bp Illumina MiSeq technology. Using multiple methods, we tested the hypothesis that products do contain the quantitative amount of labeled bacteria, and qualitative list of labeled microbial species. We found that 17 samples (33% were below label claim for CFU prior to their expiration dates. A multiplexed-PCR scheme showed that only 30/52 (58% of the products contained a correctly labeled classification, with issues encompassing incorrect taxonomy, missing species and un-labeled species. The HTS revealed that many blended products consisted predominantly of Lactobacillus acidophilus and Bifidobacterium animalis subsp. lactis. These results highlight the need for reliable methods to qualitatively determine the correct taxonomy and quantitatively ascertain the relative amounts of mixed microbial populations in commercial probiotic products.

  19. Genomic view of bipolar disorder revealed by whole genome sequencing in a genetic isolate.

    Directory of Open Access Journals (Sweden)

    Benjamin Georgi

    2014-03-01

    Full Text Available Bipolar disorder is a common, heritable mental illness characterized by recurrent episodes of mania and depression. Despite considerable effort to elucidate the genetic underpinnings of bipolar disorder, causative genetic risk factors remain elusive. We conducted a comprehensive genomic analysis of bipolar disorder in a large Old Order Amish pedigree. Microsatellite genotypes and high-density SNP-array genotypes of 388 family members were combined with whole genome sequence data for 50 of these subjects, comprising 18 parent-child trios. This study design permitted evaluation of candidate variants within the context of haplotype structure by resolving the phase in sequenced parent-child trios and by imputation of variants into multiple unsequenced siblings. Non-parametric and parametric linkage analysis of the entire pedigree as well as on smaller clusters of families identified several nominally significant linkage peaks, each of which included dozens of predicted deleterious variants. Close inspection of exonic and regulatory variants in genes under the linkage peaks using family-based association tests revealed additional credible candidate genes for functional studies and further replication in population-based cohorts. However, despite the in-depth genomic characterization of this unique, large and multigenerational pedigree from a genetic isolate, there was no convergence of evidence implicating a particular set of risk loci or common pathways. The striking haplotype and locus heterogeneity we observed has profound implications for the design of studies of bipolar and other related disorders.

  20. Genomic View of Bipolar Disorder Revealed by Whole Genome Sequencing in a Genetic Isolate

    Science.gov (United States)

    Georgi, Benjamin; Craig, David; Kember, Rachel L.; Liu, Wencheng; Lindquist, Ingrid; Nasser, Sara; Brown, Christopher; Egeland, Janice A.; Paul, Steven M.; Bućan, Maja

    2014-01-01

    Bipolar disorder is a common, heritable mental illness characterized by recurrent episodes of mania and depression. Despite considerable effort to elucidate the genetic underpinnings of bipolar disorder, causative genetic risk factors remain elusive. We conducted a comprehensive genomic analysis of bipolar disorder in a large Old Order Amish pedigree. Microsatellite genotypes and high-density SNP-array genotypes of 388 family members were combined with whole genome sequence data for 50 of these subjects, comprising 18 parent-child trios. This study design permitted evaluation of candidate variants within the context of haplotype structure by resolving the phase in sequenced parent-child trios and by imputation of variants into multiple unsequenced siblings. Non-parametric and parametric linkage analysis of the entire pedigree as well as on smaller clusters of families identified several nominally significant linkage peaks, each of which included dozens of predicted deleterious variants. Close inspection of exonic and regulatory variants in genes under the linkage peaks using family-based association tests revealed additional credible candidate genes for functional studies and further replication in population-based cohorts. However, despite the in-depth genomic characterization of this unique, large and multigenerational pedigree from a genetic isolate, there was no convergence of evidence implicating a particular set of risk loci or common pathways. The striking haplotype and locus heterogeneity we observed has profound implications for the design of studies of bipolar and other related disorders. PMID:24625924

  1. Constraining controls on carbonate sequences with high-resolution chronostratigraphy: Upper Miocene, Cabo de Gata region, SE Spain

    Science.gov (United States)

    Montgomery, P.; Farr, M.R.; Franseen, E.K.; Goldstein, R.H.

    2001-01-01

    A high-resolution chronostratigraphy has been developed for Miocene shallow-water carbonate strata in the Cabo de Gata region of SE Spain for evaluation of local, regional and global factors that controlled platform architecture prior to and during the Messinian salinity crisis. Paleomagnetic data were collected from strata at three localities. Mean natural remanent magnetization (NRM) ranges between 1.53 ?? 10-8 and 5.2 ?? 10-3 Am2/kg. Incremental thermal and alternating field demagnetization isolated the characteristic remanent magnetization (ChRM). Rock magnetic studies show that the dominant magnetic mineral is magnetite, but mixtures of magnetite and hematite occur. A composite chronostratigraphy was derived from five stratigraphic sections. Regional stratigraphic data, biostratigraphic data, and an 40Ar/39Ar date of 8.5 ?? 0.1 Ma, for an interbedded volcanic flow, place the strata in geomagnetic polarity Chrons C4r to C3r. Sequence-stratigraphic and diagenetic evidence indicate a major unconformity at the base of depositional sequence (DS)3 that contains a prograding reef complex, suggesting that approximately 250 000 yr of record (Subchrons C3Br.2r to 3Br.1r) are missing near the Messinian-Tortonian boundary. Correlation to the GPTS shows that the studied strata represent five third- to fourth-order DSs. Basal units are temperate to subtropical ramps (DS1A, DS1B, DS2); these are overlain by subtropical to tropical reefal platforms (DS3), which are capped by subtropical to tropical cyclic carbonates (Terminal Carbonate Complex, TCC). Correlation of the Cabo de Gata record to the Melilla area of Morocco, and the Sorbas basin of Spain indicate that early - Late Tortonian ramp strata from these areas are partially time-equivalent. Similar strata are extensively developed in the Western Mediterranean and likely were influenced by a cool climate or influx of nutrients during an overall rise in global sea-level. After ramp deposition, a sequence boundary (SB3) in

  2. Sequence and structural analysis of the chitinase insertion domain reveals two conserved motifs involved in chitin-binding.

    Directory of Open Access Journals (Sweden)

    Hai Li

    2010-01-01

    Full Text Available Chitinases are prevalent in life and are found in species including archaea, bacteria, fungi, plants, and animals. They break down chitin, which is the second most abundant carbohydrate in nature after cellulose. Hence, they are important for maintaining a balance between carbon and nitrogen trapped as insoluble chitin in biomass. Chitinases are classified into two families, 18 and 19 glycoside hydrolases. In addition to a catalytic domain, which is a triosephosphate isomerase barrel, many family 18 chitinases contain another module, i.e., chitinase insertion domain. While numerous studies focus on the biological role of the catalytic domain in chitinase activity, the function of the chitinase insertion domain is not completely understood. Bioinformatics offers an important avenue in which to facilitate understanding the role of residues within the chitinase insertion domain in chitinase function.Twenty-seven chitinase insertion domain sequences, which include four experimentally determined structures and span five kingdoms, were aligned and analyzed using a modified sequence entropy parameter. Thirty-two positions with conserved residues were identified. The role of these conserved residues was explored by conducting a structural analysis of a number of holo-enzymes. Hydrogen bonding and van der Waals calculations revealed a distinct subset of four conserved residues constituting two sequence motifs that interact with oligosaccharides. The other conserved residues may be key to the structure, folding, and stability of this domain.Sequence and structural studies of the chitinase insertion domains conducted within the framework of evolution identified four conserved residues which clearly interact with the substrates. Furthermore, evolutionary studies propose a link between the appearance of the chitinase insertion domain and the function of family 18 chitinases in the subfamily A.

  3. Plastome Sequence Determination and Comparative Analysis for Members of the Lolium-Festuca Grass Species Complex

    Science.gov (United States)

    Hand, Melanie L.; Spangenberg, German C.; Forster, John W.; Cogan, Noel O. I.

    2013-01-01

    Chloroplast genome sequences are of broad significance in plant biology, due to frequent use in molecular phylogenetics, comparative genomics, population genetics, and genetic modification studies. The present study used a second-generation sequencing approach to determine and assemble the plastid genomes (plastomes) of four representatives from the agriculturally important Lolium-Festuca species complex of pasture grasses (Lolium multiflorum, Festuca pratensis, Festuca altissima, and Festuca ovina). Total cellular DNA was extracted from either roots or leaves, was sequenced, and the output was filtered for plastome-related reads. A comparison between sources revealed fewer plastome-related reads from root-derived template but an increase in incidental bacterium-derived sequences. Plastome assembly and annotation indicated high levels of sequence identity and a conserved organization and gene content between species. However, frequent deletions within the F. ovina plastome appeared to contribute to a smaller plastid genome size. Comparative analysis with complete plastome sequences from other members of the Poaceae confirmed conservation of most grass-specific features. Detailed analysis of the rbcL–psaI intergenic region, however, revealed a “hot-spot” of variation characterized by independent deletion events. The evolutionary implications of this observation are discussed. The complete plastome sequences are anticipated to provide the basis for potential organelle-specific genetic modification of pasture grasses. PMID:23550121

  4. Peripheral blood transcriptome sequencing reveals rejection-relevant genes in long-term heart transplantation.

    Science.gov (United States)

    Chen, Yan; Zhang, Haibo; Xiao, Xue; Jia, Yixin; Wu, Weili; Liu, Licheng; Jiang, Jun; Zhu, Baoli; Meng, Xu; Chen, Weijun

    2013-10-03

    Peripheral blood-based gene expression patterns have been investigated as biomarkers to monitor the immune system and rule out rejection after heart transplantation. Recent advances in the high-throughput deep sequencing (HTS) technologies provide new leads in transcriptome analysis. By performing Solexa/Illumina's digital gene expression (DGE) profiling, we analyzed gene expression profiles of PBMCs from 6 quiescent (grade 0) and 6 rejection (grade 2R&3R) heart transplant recipients at more than 6 months after transplantation. Subsequently, quantitative real-time polymerase chain reaction (qRT-PCR) was carried out in an independent validation cohort of 47 individuals from three rejection groups (ISHLT, grade 0,1R, 2R&3R). Through DGE sequencing and qPCR validation, 10 genes were identified as informative genes for detection of cardiac transplant rejection. A further clustering analysis showed that the 10 genes were not only effective for distinguishing patients with acute cardiac allograft rejection, but also informative for discriminating patients with renal allograft rejection based on both blood and biopsy samples. Moreover, PPI network analysis revealed that the 10 genes were connected to each other within a short interaction distance. We proposed a 10-gene signature for heart transplant patients at high-risk of developing severe rejection, which was found to be effective as well in other organ transplant. Moreover, we supposed that these genes function systematically as biomarkers in long-time allograft rejection. Further validation in broad transplant population would be required before the non-invasive biomarkers can be generally utilized to predict the risk of transplant rejection. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  5. AllelicImbalance: An R/ bioconductor package for detecting, managing, and visualizing allele expression imbalance data from RNA sequencing

    DEFF Research Database (Denmark)

    Gådin, Jesper R.; van't Hooft, Ferdinand M.; Eriksson, Per

    2015-01-01

    the possible biases. Results: We present AllelicImblance, a software program that is designed to detect, manage, and visualize allelic imbalances comprehensively. The purpose of this software is to allow users to pose genetic questions in any RNA sequencing experiment quickly, enhancing the general utility...... of RNA sequencing. The visualization features can reveal notable, non-trivial allelic imbalance behavior over specific regions, such as exons. Conclusions: The software provides a complete framework to perform allelic imbalance analyses of aligned RNA sequencing data, from detection to visualization...

  6. Nuclear Species-Diagnostic SNP Markers Mined from 454 Amplicon Sequencing Reveal Admixture Genomic Structure of Modern Citrus Varieties

    Science.gov (United States)

    Curk, Franck; Ancillo, Gema; Ollitrault, Frédérique; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Garcia-Lor, Andres; Navarro, Luis; Ollitrault, Patrick

    2015-01-01

    Most cultivated Citrus species originated from interspecific hybridisation between four ancestral taxa (C. reticulata, C. maxima, C. medica, and C. micrantha) with limited further interspecific recombination due to vegetative propagation. This evolution resulted in admixture genomes with frequent interspecific heterozygosity. Moreover, a major part of the phenotypic diversity of edible citrus results from the initial differentiation between these taxa. Deciphering the phylogenomic structure of citrus germplasm is therefore essential for an efficient utilization of citrus biodiversity in breeding schemes. The objective of this work was to develop a set of species-diagnostic single nucleotide polymorphism (SNP) markers for the four Citrus ancestral taxa covering the nine chromosomes, and to use these markers to infer the phylogenomic structure of secondary species and modern cultivars. Species-diagnostic SNPs were mined from 454 amplicon sequencing of 57 gene fragments from 26 genotypes of the four basic taxa. Of the 1,053 SNPs mined from 28,507 kb sequence, 273 were found to be highly diagnostic for a single basic taxon. Species-diagnostic SNP markers (105) were used to analyse the admixture structure of varieties and rootstocks. This revealed C. maxima introgressions in most of the old and in all recent selections of mandarins, and suggested that C. reticulata × C. maxima reticulation and introgression processes were important in edible mandarin domestication. The large range of phylogenomic constitutions between C. reticulata and C. maxima revealed in mandarins, tangelos, tangors, sweet oranges, sour oranges, grapefruits, and orangelos is favourable for genetic association studies based on phylogenomic structures of the germplasm. Inferred admixture structures were in agreement with previous hypotheses regarding the origin of several secondary species and also revealed the probable origin of several acid citrus varieties. The developed species-diagnostic SNP

  7. Development of next generation sequencing panel for UMOD and association with kidney disease.

    Directory of Open Access Journals (Sweden)

    Caitlin Bailie

    Full Text Available Chronic kidney disease (CKD has a prevalence of approximately 10% in adult populations. CKD can progress to end-stage renal disease (ESRD and this is usually fatal unless some form of renal replacement therapy (chronic dialysis or renal transplantation is provided. There is an inherited predisposition to CKD with several genetic risk markers now identified. The UMOD gene has been associated with CKD of varying aetiologies. An AmpliSeq next generation sequencing panel was developed to facilitate comprehensive sequencing of the UMOD gene, covering exonic and regulatory regions. SNPs and CpG sites in the genomic region encompassing UMOD were evaluated for association with CKD in two studies; the UK Wellcome Trust Case-Control 3 Renal Transplant Dysfunction Study (n = 1088 and UK-ROI GENIE GWAS (n = 1726. A technological comparison of two Ion Torrent machines revealed 100% allele call concordance between S5 XL™ and PGM™ machines. One SNP (rs183962941, located in a non-coding region of UMOD, was nominally associated with ESRD (p = 0.008. No association was identified between UMOD variants and estimated glomerular filtration rate. Analysis of methylation data for over 480,000 CpG sites revealed differential methylation patterns within UMOD, the most significant of these was cg03140788 p = 3.7 x 10-10.

  8. Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

    Directory of Open Access Journals (Sweden)

    Andréia B. Poletto

    2008-01-01

    Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

  9. Sequencing chromosomal abnormalities reveals neurodevelopmental loci that confer risk across diagnostic boundaries

    Science.gov (United States)

    Talkowski, Michael E.; Rosenfeld, Jill A.; Blumenthal, Ian; Pillalamarri, Vamsee; Chiang, Colby; Heilbut, Adrian; Ernst, Carl; Hanscom, Carrie; Rossin, Elizabeth; Lindgren, Amelia; Pereira, Shahrin; Ruderfer, Douglas; Kirby, Andrew; Ripke, Stephan; Harris, David; Lee, Ji-Hyun; Ha, Kyungsoo; Kim, Hyung-Goo; Solomon, Benjamin D.; Gropman, Andrea L.; Lucente, Diane; Sims, Katherine; Ohsumi, Toshiro K.; Borowsky, Mark L.; Loranger, Stephanie; Quade, Bradley; Lage, Kasper; Miles, Judith; Wu, Bai-Lin; Shen, Yiping; Neale, Benjamin; Shaffer, Lisa G.; Daly, Mark J.; Morton, Cynthia C.; Gusella, James F.

    2012-01-01

    SUMMARY Balanced chromosomal abnormalities (BCAs) represent a reservoir of single gene disruptions in neurodevelopmental disorders (NDD). We sequenced BCAs in autism and related NDDs, revealing disruption of 33 loci in four general categories: 1) genes associated with abnormal neurodevelopment (e.g., AUTS2, FOXP1, CDKL5), 2) single gene contributors to microdeletion syndromes (MBD5, SATB2, EHMT1, SNURF-SNRPN), 3) novel risk loci (e.g., CHD8, KIRREL3, ZNF507), and 4) genes associated with later onset psychiatric disorders (e.g., TCF4, ZNF804A, PDE10A, GRIN2B, ANK3). We also discovered profoundly increased burden of copy number variants among 19,556 neurodevelopmental cases compared to 13,991 controls (p = 2.07×10−47) and enrichment of polygenic risk alleles from autism and schizophrenia genome-wide association studies (p = 0.0018 and 0.0009, respectively). Our findings suggest a polygenic risk model of autism incorporating loci of strong effect and indicate that some neurodevelopmental genes are sensitive to perturbation by multiple mutational mechanisms, leading to variable phenotypic outcomes that manifest at different life stages. PMID:22521361

  10. Chronology of Eocene-Miocene sequences on the New Jersey shallow shelf: implications for regional, interregional, and global correlations

    Science.gov (United States)

    Browning, James V.; Miller, Kenneth G.; Sugarman, Peter J.; Barron, John; McCarthy, Francine M.G.; Kulhanek, Denise K.; Katz, Miriam E.; Feigenson, Mark D.

    2013-01-01

    Integrated Ocean Drilling Program Expedition 313 continuously cored and logged latest Eocene to early-middle Miocene sequences at three sites (M27, M28, and M29) on the inner-middle continental shelf offshore New Jersey, providing an opportunity to evaluate the ages, global correlations, and significance of sequence boundaries. We provide a chronology for these sequences using integrated strontium isotopic stratigraphy and biostratigraphy (primarily calcareous nannoplankton, diatoms, and dinocysts [dinoflagellate cysts]). Despite challenges posed by shallow-water sediments, age resolution is typically ±0.5 m.y. and in many sequences is as good as ±0.25 m.y. Three Oligocene sequences were sampled at Site M27 on sequence bottomsets. Fifteen early to early-middle Miocene sequences were dated at Sites M27, M28, and M29 across clinothems in topsets, foresets (where the sequences are thickest), and bottomsets. A few sequences have coarse (∼1 m.y.) or little age constraint due to barren zones; we constrain the age estimates of these less well dated sequences by applying the principle of superposition, i.e., sediments above sequence boundaries in any site are younger than the sediments below the sequence boundaries at other sites. Our age control provides constraints on the timing of deposition in the clinothem; sequences on the topsets are generally the youngest in the clinothem, whereas the bottomsets generally are the oldest. The greatest amount of time is represented on foresets, although we have no evidence for a correlative conformity. Our chronology provides a baseline for regional and interregional correlations and sea-level reconstructions: (1) we correlate a major increase in sedimentation rate precisely with the timing of the middle Miocene climate changes associated with the development of a permanent East Antarctic Ice Sheet; and (2) the timing of sequence boundaries matches the deep-sea oxygen isotopic record, implicating glacioeustasy as a major driver

  11. Analysis of Pteridium ribosomal RNA sequences by rapid direct sequencing.

    Science.gov (United States)

    Tan, M K

    1991-08-01

    A total of 864 bases from 5 regions interspersed in the 18S and 26S rRNA molecules from various clones of Pteridium covering the general geographical distribution of the genus was analysed using a rapid rRNA sequencing technique. No base difference has been detected amongst the three major lineages, two of which apparently separated before the breakup of the ancient supercontinent, Pangaea. These regions of the rRNA sequences have thus been conserved for at least 160 million years and are here compared with other eukaryotic, especially plant rRNAs.

  12. Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

    Directory of Open Access Journals (Sweden)

    Ritland Carol

    2009-08-01

    Full Text Available Abstract Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs and full-length (FLcDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR and a cytochrome P450 (CYP720B4 from a non-arrayed genomic BAC library of white spruce (Picea glauca. Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR and 94 kbp (CYP720B4 long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs, high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene

  13. Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome.

    Science.gov (United States)

    Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg

    2009-08-06

    Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The

  14. Fold-recognition and comparative modeling of human α2,3-sialyltransferases reveal their sequence and structural similarities to CstII from Campylobacter jejuni

    Directory of Open Access Journals (Sweden)

    Balaji Petety V

    2006-04-01

    Full Text Available Abstract Background The 3-D structure of none of the eukaryotic sialyltransferases (SiaTs has been determined so far. Sequence alignment algorithms such as BLAST and PSI-BLAST could not detect a homolog of these enzymes from the protein databank. SiaTs, thus, belong to the hard/medium target category in the CASP experiments. The objective of the current work is to model the 3-D structures of human SiaTs which transfer the sialic acid in α2,3-linkage viz., ST3Gal I, II, III, IV, V, and VI, using fold-recognition and comparative modeling methods. The pair-wise sequence similarity among these six enzymes ranges from 41 to 63%. Results Unlike the sequence similarity servers, fold-recognition servers identified CstII, a α2,3/8 dual-activity SiaT from Campylobacter jejuni as the homolog of all the six ST3Gals; the level of sequence similarity between CstII and ST3Gals is only 15–20% and the similarity is restricted to well-characterized motif regions of ST3Gals. Deriving template-target sequence alignments for the entire ST3Gal sequence was not straightforward: the fold-recognition servers could not find a template for the region preceding the L-motif and that between the L- and S-motifs. Multiple structural templates were identified to model these regions and template identification-modeling-evaluation had to be performed iteratively to choose the most appropriate templates. The modeled structures have acceptable stereochemical properties and are also able to provide qualitative rationalizations for some of the site-directed mutagenesis results reported in literature. Apart from the predicted models, an unexpected but valuable finding from this study is the sequential and structural relatedness of family GT42 and family GT29 SiaTs. Conclusion The modeled 3-D structures can be used for docking and other modeling studies and for the rational identification of residues to be mutated to impart desired properties such as altered stability, substrate

  15. Sequence characterization of cotton leaf curl virus from Rajasthan: phylogenetic relationship with other members of geminiviruses and detection of recombination.

    Science.gov (United States)

    Kumar, A; Kumar, J; Khan, J A

    2010-04-01

    Diseased cotton plants showing typical leaf curl symptoms were collected from experimental plot of Agriculture Research Station-Sriganganagar, Rajasthan. Complete DNA-A component from samples taken from two areas were amplified through rolling circle amplification (RCA) using templiphi kit (GE Healthcare) and characterized. DNA-A of one isolate consists of 2751 nucleotides and second isolate of 2759 nucleotide. Both sequences comprised six ORF's. Genome organization of DNA-A of one isolate shows high sequence similarity with other characterized local begomovirus isolates of Rajasthan, while other isolate shows high sequence similarity with CLCuV reported from Pakistan. The maximum similarity of first isolate, CLCuV-SG01, shows highest sequence identity with Cotton leaf curl Abohar (Rajasthan) virus, and second isolate, CLCuV-SG02, shows highest sequence identity with cotton leaf curl virus from Pakistan. Both isolates showed 85% similarities with each other. The sequence data revealed probable infiltration of some strains of Cotton leaf curl virus from Pakistan to India, or co-existence of different isolates under similar geographical conditions. While CLCuV-SG01 shows highest nt sequence similarity with CLCuV Rajasthan (Abohar), nt identity of V1 ORF (encoding coat protein) of SG01 shows the highest nt identity (100%) with CLCuV Multan (Bhatinda) and Abohar virus while AC1 region also showed difference. Complete nucleotide sequence of SG01 shows only 86% similarity with CLCuV Multan virus. Similarity search revealed significant difference in AV1 and AC1 regions with respect to DNA-A suggesting an evolutionary history of recombination. Computer based analysis, recombination detection Program (RDP) supports the recombination hypothesis, indicated that recombination with other begomoviruses had taken place within V1 ORF and AC1 ORF of CLCuV-SG01 and AC1 ORF of CLCuV-SG02 and also in noncoding intergenic region (IR).

  16. Regions identity between the genome of vertebrates and non-retroviral families of insect viruses.

    Science.gov (United States)

    Fan, Gaowei; Li, Jinming

    2011-11-10

    The scope of our understanding of the evolutionary history between viruses and animals is limited. The fact that the recent availability of many complete insect virus genomes and vertebrate genomes as well as the ability to screen these sequences makes it possible to gain a new perspective insight into the evolutionary interaction between insect viruses and vertebrates. This study is to determine the possibility of existence of sequence identity between the genomes of insect viruses and vertebrates, attempt to explain this phenomenon in term of genetic mobile element, and try to investigate the evolutionary relationship between these short regions of identity among these species. Some of studied insect viruses contain variable numbers of short regions of sequence identity to the genomes of vertebrate with nucleotide sequence length from 28 bp to 124 bp. They are found to locate in multiple sites of the vertebrate genomes. The ontology of animal genes with identical regions involves in several processes including chromatin remodeling, regulation of apoptosis, signaling pathway, nerve system development and some enzyme-like catalysis. Phylogenetic analysis reveals that at least some short regions of sequence identity in the genomes of vertebrate are derived the ancestral of insect viruses. Short regions of sequence identity were found in the vertebrates and insect viruses. These sequences played an important role not only in the long-term evolution of vertebrates, but also in promotion of insect virus. This typical win-win strategy may come from natural selection.

  17. Two‐phase designs for joint quantitative‐trait‐dependent and genotype‐dependent sampling in post‐GWAS regional sequencing

    Science.gov (United States)

    Espin‐Garcia, Osvaldo; Craiu, Radu V.

    2017-01-01

    ABSTRACT We evaluate two‐phase designs to follow‐up findings from genome‐wide association study (GWAS) when the cost of regional sequencing in the entire cohort is prohibitive. We develop novel expectation‐maximization‐based inference under a semiparametric maximum likelihood formulation tailored for post‐GWAS inference. A GWAS‐SNP (where SNP is single nucleotide polymorphism) serves as a surrogate covariate in inferring association between a sequence variant and a normally distributed quantitative trait (QT). We assess test validity and quantify efficiency and power of joint QT‐SNP‐dependent sampling and analysis under alternative sample allocations by simulations. Joint allocation balanced on SNP genotype and extreme‐QT strata yields significant power improvements compared to marginal QT‐ or SNP‐based allocations. We illustrate the proposed method and evaluate the sensitivity of sample allocation to sampling variation using data from a sequencing study of systolic blood pressure. PMID:29239496

  18. Dynamic Evolution of Pathogenicity Revealed by Sequencing and Comparative Genomics of 19 Pseudomonas syringae Isolates

    Science.gov (United States)

    Romanchuk, Artur; Chang, Jeff H.; Mukhtar, M. Shahid; Cherkis, Karen; Roach, Jeff; Grant, Sarah R.; Jones, Corbin D.; Dangl, Jeffery L.

    2011-01-01

    Closely related pathogens may differ dramatically in host range, but the molecular, genetic, and evolutionary basis for these differences remains unclear. In many Gram- negative bacteria, including the phytopathogen Pseudomonas syringae, type III effectors (TTEs) are essential for pathogenicity, instrumental in structuring host range, and exhibit wide diversity between strains. To capture the dynamic nature of virulence gene repertoires across P. syringae, we screened 11 diverse strains for novel TTE families and coupled this nearly saturating screen with the sequencing and assembly of 14 phylogenetically diverse isolates from a broad collection of diseased host plants. TTE repertoires vary dramatically in size and content across all P. syringae clades; surprisingly few TTEs are conserved and present in all strains. Those that are likely provide basal requirements for pathogenicity. We demonstrate that functional divergence within one conserved locus, hopM1, leads to dramatic differences in pathogenicity, and we demonstrate that phylogenetics-informed mutagenesis can be used to identify functionally critical residues of TTEs. The dynamism of the TTE repertoire is mirrored by diversity in pathways affecting the synthesis of secreted phytotoxins, highlighting the likely role of both types of virulence factors in determination of host range. We used these 14 draft genome sequences, plus five additional genome sequences previously reported, to identify the core genome for P. syringae and we compared this core to that of two closely related non-pathogenic pseudomonad species. These data revealed the recent acquisition of a 1 Mb megaplasmid by a sub-clade of cucumber pathogens. This megaplasmid encodes a type IV secretion system and a diverse set of unknown proteins, which dramatically increases both the genomic content of these strains and the pan-genome of the species. PMID:21799664

  19. Structural organization of glycophorin A and B genes: Glycophorin B gene evolved by homologous recombination at Alu repeat sequences

    International Nuclear Information System (INIS)

    Kudo, Shinichi; Fukuda, Minoru

    1989-01-01

    Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication

  20. Complete sequence of two tick-borne flaviviruses isolated from Siberia and the UK: analysis and significance of the 5' and 3'-UTRs.

    Science.gov (United States)

    Gritsun, T S; Venugopal, K; Zanotto, P M; Mikhailov, M V; Sall, A A; Holmes, E C; Polkinghorne, I; Frolova, T V; Pogodina, V V; Lashkevich, V A; Gould, E A

    1997-05-01

    The complete nucleotide sequence of two tick-transmitted flaviviruses, Vasilchenko (Vs) from Siberia and louping ill (LI) from the UK, have been determined. The genomes were respectively, 10928 and 10871 nucleotides (nt) in length. The coding strategy and functional protein sequence motifs of tick-borne flaviviruses are presented in both Vs and LI viruses. The phylogenies based on maximum likelihood, maximum parsimony and distance analysis of the polyproteins, identified Vs virus as a member of the tick-borne encephalitis virus subgroup within the tick-borne serocomplex, genus Flavivirus, family Flaviviridae. Comparative alignment of the 3'-untranslated regions revealed deletions of different lengths essentially at the same position downstream of the stop codon for all tick-borne viruses. Two direct 27 nucleotide repeats at the 3'-end were found only for Vs and LI virus. Immediately following the deletions a region of 332-334 nt with relatively conserved primary structure (67-94% identity) was observed at the 3'-non-coding end of the virus genome. Pairwise comparisons of the nucleotide sequence data revealed similar levels of variation between the coding region, and the 5' and 3'-termini of the genome, implying an equivalent strong selective control for translated and untranslated regions. Indeed the predicted folding of the 5' and 3'-untranslated regions revealed patterns of stem and loop structures conserved for all tick-borne flaviviruses suggesting a purifying selection for preservation of essential RNA secondary structures which could be involved in translational control and replication. The possible implications of these findings are discussed.

  1. Characterization of Fasciola samples by ITS of rDNA sequences revealed the existence of Fasciola hepatica and Fasciola gigantica in Yunnan Province, China.

    Science.gov (United States)

    Shu, Fan-Fan; Lv, Rui-Qing; Zhang, Yi-Fang; Duan, Gang; Wu, Ding-Yu; Li, Bi-Feng; Yang, Jian-Fa; Zou, Feng-Cai

    2012-08-01

    On mainland China, liver flukes of Fasciola spp. (Digenea: Fasciolidae) can cause serious acute and chronic morbidity in numerous species of mammals such as sheep, goats, cattle, and humans. The objective of the present study was to examine the taxonomic identity of Fasciola species in Yunnan province by sequences of the first and second internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA). The ITS rDNA was amplified from 10 samples representing Fasciola species in cattle from 2 geographical locations in Yunnan Province, by polymerase chain reaction (PCR), and the products were sequenced directly. The lengths of the ITS-1 and ITS-2 sequences were 422 and 361-362 base pairs, respectively, for all samples sequenced. Using ITS sequences, 2 Fasciola species were revealed, namely Fasciola hepatica and Fasciola gigantica. This is the first demonstration of F. gigantica in cattle in Yunnan Province, China using a molecular approach; our findings have implications for studying the population genetic characterization of the Chinese Fasciola species and for the prevention and control of Fasciola spp. in this province.

  2. Microbial rRNA sequencing analysis of evaporative cooler indoor environments located in the Great Basin Desert region of the United States†

    Science.gov (United States)

    Lemons, Angela R.; Hogan, Mary Beth; Gault, Ruth A.; Holland, Kathleen; Sobek, Edward; Olsen-Wilson, Kimberly A.; Park, Yeonmi; Park, Ju-Hyeong; Gu, Ja Kook; Kashon, Michael L.; Green, Brett J.

    2017-01-01

    Recent studies conducted in the Great Basin Desert region of the United States have shown that skin test reactivity to fungal and dust mite allergens are increased in children with asthma or allergy living in homes with evaporative coolers (EC). The objective of this study was to determine if the increased humidity previously reported in EC homes leads to varying microbial populations compared to homes with air conditioners (AC). Children with physician-diagnosed allergic rhinitis living in EC or AC environments were recruited into the study. Air samples were collected from the child's bedroom for genomic DNA extraction and metagenomic analysis of bacteria and fungi using the Illumina MiSeq sequencing platform. The analysis of bacterial populations revealed no major differences between EC and AC sampling environments. The fungal populations observed in EC homes differed from AC homes. The most prevalent species discovered in AC environments belonged to the genera Cryptococcus (20%) and Aspergillus (20%). In contrast, the most common fungi identified in EC homes belonged to the order Pleosporales and included Alternaria alternata (32%) and Phoma spp. (22%). The variations in fungal populations provide preliminary evidence of the microbial burden children may be exposed to within EC environments in this region. PMID:28091681

  3. Genome sequencing of ovine isolates of Mycobacterium avium subspecies paratuberculosis offers insights into host association

    Directory of Open Access Journals (Sweden)

    Bannantine John P

    2012-03-01

    Full Text Available Abstract Background The genome of Mycobacterium avium subspecies paratuberculosis (MAP is remarkably homogeneous among the genomes of bovine, human and wildlife isolates. However, previous work in our laboratories with the bovine K-10 strain has revealed substantial differences compared to sheep isolates. To systematically characterize all genomic differences that may be associated with the specific hosts, we sequenced the genomes of three U.S. sheep isolates and also obtained an optical map. Results Our analysis of one of the isolates, MAP S397, revealed a genome 4.8 Mb in size with 4,700 open reading frames (ORFs. Comparative analysis of the MAP S397 isolate showed it acquired approximately 10 large sequence regions that are shared with the human M. avium subsp. hominissuis strain 104 and lost 2 large regions that are present in the bovine strain. In addition, optical mapping defined the presence of 7 large inversions between the bovine and ovine genomes (~ 2.36 Mb. Whole-genome sequencing of 2 additional sheep strains of MAP (JTC1074 and JTC7565 further confirmed genomic homogeneity of the sheep isolates despite the presence of polymorphisms on the nucleotide level. Conclusions Comparative sequence analysis employed here provided a better understanding of the host association, evolution of members of the M. avium complex and could help in deciphering the phenotypic differences observed among sheep and cattle strains of MAP. A similar approach based on whole-genome sequencing combined with optical mapping could be employed to examine closely related pathogens. We propose an evolutionary scenario for M. avium complex strains based on these genome sequences.

  4. The Douglas-fir genome sequence reveals specialization of the photosynthetic apparatus in Pinaceae

    Science.gov (United States)

    David B. Neale; Patrick E. McGuire; Nicholas C. Wheeler; Kristian A. Stevens; Marc W. Crepeau; Charis Cardeno; Aleksey V. Zimin; Daniela Puiu; Geo M. Pertea; U. Uzay Sezen; Claudio Casola; Tomasz E. Koralewski; Robin Paul; Daniel Gonzalez-Ibeas; Sumaira Zaman; Richard Cronn; Mark Yandell; Carson Holt; Charles H. Langley; James A. Yorke; Steven L. Salzberg; Jill L. Wegrzyn

    2017-01-01

    A reference genome sequence for Pseudotsuga menziesii var. menziesii (Mirb.) Franco (Coastal Douglas-fir) is reported, thus providing a reference sequence for a third genus of the family Pinaceae. The contiguity and quality of the genome assembly far exceeds that of other conifer reference genome sequences (contig N50 = 44,136 bp and scaffold N50...

  5. Sequencing of the Hepatitis C Virus: A Systematic Review.

    Directory of Open Access Journals (Sweden)

    Brendan Jacka

    Full Text Available Since the identification of hepatitis C virus (HCV, viral sequencing has been important in understanding HCV classification, epidemiology, evolution, transmission clustering, treatment response and natural history. The length and diversity of the HCV genome has resulted in analysis of certain regions of the virus, however there has been little standardisation of protocols. This systematic review was undertaken to map the location and frequency of sequencing on the HCV genome in peer reviewed publications, with the aim to produce a database of sequencing primers and amplicons to inform future research. Medline and Scopus databases were searched for English language publications based on keyword/MeSH terms related to sequence analysis (9 terms or HCV (3 terms, plus "primer" as a general search term. Exclusion criteria included non-HCV research, review articles, duplicate records, and incomplete description of HCV sequencing methods. The PCR primer locations of accepted publications were noted, and purpose of sequencing was determined. A total of 450 studies were accepted from the 2099 identified, with 629 HCV sequencing amplicons identified and mapped on the HCV genome. The most commonly sequenced region was the HVR-1 region, often utilised for studies of natural history, clustering/transmission, evolution and treatment response. Studies related to genotyping/classification or epidemiology of HCV genotype generally targeted the 5'UTR, Core and NS5B regions, while treatment response/resistance was assessed mainly in the NS3-NS5B region with emphasis on the Interferon sensitivity determining region (ISDR region of NS5A. While the sequencing of HCV is generally constricted to certain regions of the HCV genome there is little consistency in the positioning of sequencing primers, with the exception of a few highly referenced manuscripts. This study demonstrates the heterogeneity of HCV sequencing, providing a comprehensive database of previously

  6. ITS all right mama: investigating the formation of chimeric sequences in the ITS2 region by DNA metabarcoding analyses of fungal mock communities of different complexities.

    Science.gov (United States)

    Bjørnsgaard Aas, Anders; Davey, Marie Louise; Kauserud, Håvard

    2017-07-01

    The formation of chimeric sequences can create significant methodological bias in PCR-based DNA metabarcoding analyses. During mixed-template amplification of barcoding regions, chimera formation is frequent and well documented. However, profiling of fungal communities typically uses the more variable rDNA region ITS. Due to a larger research community, tools for chimera detection have been developed mainly for the 16S/18S markers. However, these tools are widely applied to the ITS region without verification of their performance. We examined the rate of chimera formation during amplification and 454 sequencing of the ITS2 region from fungal mock communities of different complexities. We evaluated the chimera detecting ability of two common chimera-checking algorithms: perseus and uchime. Large proportions of the chimeras reported were false positives. No false negatives were found in the data set. Verified chimeras accounted for only 0.2% of the total ITS2 reads, which is considerably less than what is typically reported in 16S and 18S metabarcoding analyses. Verified chimeric 'parent sequences' had significantly higher per cent identity to one another than to random members of the mock communities. Community complexity increased the rate of chimera formation. GC content was higher around the verified chimeric break points, potentially facilitating chimera formation through base pair mismatching in the neighbouring regions of high similarity in the chimeric region. We conclude that the hypervariable nature of the ITS region seems to buffer the rate of chimera formation in comparison with other, less variable barcoding regions, due to shorter regions of high sequence similarity. © 2016 John Wiley & Sons Ltd.

  7. Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes.

    Science.gov (United States)

    Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I

    2013-01-01

    Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

  8. Ontogeny of hepatic energy metabolism genes in mice as revealed by RNA-sequencing.

    Directory of Open Access Journals (Sweden)

    Helen J Renaud

    Full Text Available The liver plays a central role in metabolic homeostasis by coordinating synthesis, storage, breakdown, and redistribution of nutrients. Hepatic energy metabolism is dynamically regulated throughout different life stages due to different demands for energy during growth and development. However, changes in gene expression patterns throughout ontogeny for factors important in hepatic energy metabolism are not well understood. We performed detailed transcript analysis of energy metabolism genes during various stages of liver development in mice. Livers from male C57BL/6J mice were collected at twelve ages, including perinatal and postnatal time points (n = 3/age. The mRNA was quantified by RNA-Sequencing, with transcript abundance estimated by Cufflinks. One thousand sixty energy metabolism genes were examined; 794 were above detection, of which 627 were significantly changed during at least one developmental age compared to adult liver. Two-way hierarchical clustering revealed three major clusters dependent on age: GD17.5-Day 5 (perinatal-enriched, Day 10-Day 20 (pre-weaning-enriched, and Day 25-Day 60 (adolescence/adulthood-enriched. Clustering analysis of cumulative mRNA expression values for individual pathways of energy metabolism revealed three patterns of enrichment: glycolysis, ketogenesis, and glycogenesis were all perinatally-enriched; glycogenolysis was the only pathway enriched during pre-weaning ages; whereas lipid droplet metabolism, cholesterol and bile acid metabolism, gluconeogenesis, and lipid metabolism were all enriched in adolescence/adulthood. This study reveals novel findings such as the divergent expression of the fatty acid β-oxidation enzymes Acyl-CoA oxidase 1 and Carnitine palmitoyltransferase 1a, indicating a switch from mitochondrial to peroxisomal β-oxidation after weaning; as well as the dynamic ontogeny of genes implicated in obesity such as Stearoyl-CoA desaturase 1 and Elongation of very long chain fatty

  9. Sequence analysis of the 3’-untranslated region of HSP70 (type I genes in the genus Leishmania: its usefulness as a molecular marker for species identification

    Directory of Open Access Journals (Sweden)

    Requena Jose M

    2012-04-01

    Full Text Available Abstract Background The Leishmaniases are a group of clinically diverse diseases caused by parasites of the genus Leishmania. To distinguish between species is crucial for correct diagnosis and prognosis as well as for treatment decisions. Recently, sequencing of the HSP70 coding region has been applied in phylogenetic studies and for identifying of Leishmania species with excellent results. Methods In the present study, we analyzed the 3’-untranslated region (UTR of Leishmania HSP70-type I gene from 24 strains representing eleven Leishmania species in the belief that this non-coding region would have a better discriminatory capacity for species typing than coding regions. Results It was observed that there was a remarkable degree of sequence conservation in this region, even between species of the subgenus Leishmania and Viannia. In addition, the presence of many microsatellites was a common feature of the 3´-UTR of HSP70-I genes in the Leishmania genus. Finally, we constructed dendrograms based on global sequence alignments of the analyzed Leishmania species and strains, the results indicated that this particular region of HSP70 genes might be useful for species (or species complex typing, improving for particular species the discrimination capacity of phylogenetic trees based on HSP70 coding sequences. Given the large size variation of the analyzed region between the Leishmania and Viannia subgenera, direct visualization of the PCR amplification product would allow discrimination between subgenera, and a HaeIII-PCR-RFLP analysis might be used for differentiating some species within each subgenera. Conclusions Sequence and phylogenetic analyses indicated that this region, which is readily amplified using a single pair of primers from both Old and New World Leishmania species, might be useful as a molecular marker for species discrimination.

  10. Inverted repeats in the promoter as an autoregulatory sequence for TcrX in Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Bhattacharya, Monolekha; Das, Amit Kumar

    2011-01-01

    Highlights: ► The regulatory sequences recognized by TcrX have been identified. ► The regulatory region comprises of inverted repeats segregated by 30 bp region. ► The mode of binding of TcrX with regulatory sequence is unique. ► In silico TcrX–DNA docked model binds one of the inverted repeats. ► Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has not been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by ∼30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.

  11. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    DEFF Research Database (Denmark)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...

  12. Translational database selection and multiplexed sequence capture for up front filtering of reliable breast cancer biomarker candidates.

    Directory of Open Access Journals (Sweden)

    Patrik L Ståhl

    Full Text Available Biomarker identification is of utmost importance for the development of novel diagnostics and therapeutics. Here we make use of a translational database selection strategy, utilizing data from the Human Protein Atlas (HPA on differentially expressed protein patterns in healthy and breast cancer tissues as a means to filter out potential biomarkers for underlying genetic causatives of the disease. DNA was isolated from ten breast cancer biopsies, and the protein coding and flanking non-coding genomic regions corresponding to the selected proteins were extracted in a multiplexed format from the samples using a single DNA sequence capture array. Deep sequencing revealed an even enrichment of the multiplexed samples and a great variation of genetic alterations in the tumors of the sampled individuals. Benefiting from the upstream filtering method, the final set of biomarker candidates could be completely verified through bidirectional Sanger sequencing, revealing a 40 percent false positive rate despite high read coverage. Of the variants encountered in translated regions, nine novel non-synonymous variations were identified and verified, two of which were present in more than one of the ten tumor samples.

  13. Short Interspersed Nuclear Element (SINE) Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293.

    Science.gov (United States)

    Kanhayuwa, Lakkhana; Coutts, Robert H A

    2016-01-01

    Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.

  14. Automated identification of complementarity determining regions (CDRs) reveals peculiar characteristics of CDRs and B cell epitopes.

    Science.gov (United States)

    Ofran, Yanay; Schlessinger, Avner; Rost, Burkhard

    2008-11-01

    Exact identification of complementarity determining regions (CDRs) is crucial for understanding and manipulating antigenic interactions. One way to do this is by marking residues on the antibody that interact with B cell epitopes on the antigen. This, of course, requires identification of B cell epitopes, which could be done by marking residues on the antigen that bind to CDRs, thus requiring identification of CDRs. To circumvent this vicious circle, existing tools for identifying CDRs are based on sequence analysis or general biophysical principles. Often, these tools, which are based on partial data, fail to agree on the boundaries of the CDRs. Herein we present an automated procedure for identifying CDRs and B cell epitopes using consensus structural regions that interact with the antigens in all known antibody-protein complexes. Consequently, we provide the first comprehensive analysis of all CDR-epitope complexes of known three-dimensional structure. The CDRs we identify only partially overlap with the regions suggested by existing methods. We found that the general physicochemical properties of both CDRs and B cell epitopes are rather peculiar. In particular, only four amino acids account for most of the sequence of CDRs, and several types of amino acids almost never appear in them. The secondary structure content and the conservation of B cell epitopes are found to be different than previously thought. These characteristics of CDRs and epitopes may be instrumental in choosing which residues to mutate in experimental search for epitopes. They may also assist in computational design of antibodies and in predicting B cell epitopes.

  15. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  16. A composite method based on formal grammar and DNA structural features in detecting human polymerase II promoter region.

    Directory of Open Access Journals (Sweden)

    Sutapa Datta

    Full Text Available An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques.

  17. A Composite Method Based on Formal Grammar and DNA Structural Features in Detecting Human Polymerase II Promoter Region

    Science.gov (United States)

    Datta, Sutapa; Mukhopadhyay, Subhasis

    2013-01-01

    An important step in understanding gene regulation is to identify the promoter regions where the transcription factor binding takes place. Predicting a promoter region de novo has been a theoretical goal for many researchers for a long time. There exists a number of in silico methods to predict the promoter region de novo but most of these methods are still suffering from various shortcomings, a major one being the selection of appropriate features of promoter region distinguishing them from non-promoters. In this communication, we have proposed a new composite method that predicts promoter sequences based on the interrelationship between structural profiles of DNA and primary sequence elements of the promoter regions. We have shown that a Context Free Grammar (CFG) can formalize the relationships between different primary sequence features and by utilizing the CFG, we demonstrate that an efficient parser can be constructed for extracting these relationships from DNA sequences to distinguish the true promoter sequences from non-promoter sequences. Along with CFG, we have extracted the structural features of the promoter region to improve upon the efficiency of our prediction system. Extensive experiments performed on different datasets reveals that our method is effective in predicting promoter sequences on a genome-wide scale and performs satisfactorily as compared to other promoter prediction techniques. PMID:23437045

  18. Whole exome sequencing in 342 congenital cardiac left sided lesion cases reveals extensive genetic heterogeneity and complex inheritance patterns

    Directory of Open Access Journals (Sweden)

    Alexander H. Li

    2017-10-01

    Full Text Available Abstract Background Left-sided lesions (LSLs account for an important fraction of severe congenital cardiovascular malformations (CVMs. The genetic contributions to LSLs are complex, and the mutations that cause these malformations span several diverse biological signaling pathways: TGFB, NOTCH, SHH, and more. Here, we use whole exome sequence data generated in 342 LSL cases to identify likely damaging variants in putative candidate CVM genes. Methods Using a series of bioinformatics filters, we focused on genes harboring population-rare, putative loss-of-function (LOF, and predicted damaging variants in 1760 CVM candidate genes constructed a priori from the literature and model organism databases. Gene variants that were not observed in a comparably sequenced control dataset of 5492 samples without severe CVM were then subjected to targeted validation in cases and parents. Whole exome sequencing data from 4593 individuals referred for clinical sequencing were used to bolster evidence for the role of candidate genes in CVMs and LSLs. Results Our analyses revealed 28 candidate variants in 27 genes, including 17 genes not previously associated with a human CVM disorder, and revealed diverse patterns of inheritance among LOF carriers, including 9 confirmed de novo variants in both novel and newly described human CVM candidate genes (ACVR1, JARID2, NR2F2, PLRG1, SMURF1 as well as established syndromic CVM genes (KMT2D, NF1, TBX20, ZEB2. We also identified two genes (DNAH5, OFD1 with evidence of recessive and hemizygous inheritance patterns, respectively. Within our clinical cohort, we also observed heterozygous LOF variants in JARID2 and SMAD1 in individuals with cardiac phenotypes, and collectively, carriers of LOF variants in our candidate genes had a four times higher odds of having CVM (odds ratio = 4.0, 95% confidence interval 2.5–6.5. Conclusions Our analytical strategy highlights the utility of bioinformatic resources, including human

  19. Development of taxon-specific sequence characterized amplified region (SCAR) markers based on actin sequences and DNA amplification fingerprinting (DAF): a case study in the Phoma exigua species complex.

    Science.gov (United States)

    Aveskamp, Maikel M; Woudenberg, Joyce H C; de Gruyter, Johannes; Turco, Elena; Groenewald, Johannes Z; Crous, Pedro W

    2009-05-01

    Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to distinguish P. exigua from its close relatives and to correctly identify isolates up to the variety level, because of their low genetic variation and high morphological similarity. Because of quarantine issues and phytosanitary measures, a robust DNA-based tool is required for accurate and rapid identification of the separate taxa in this species complex. The present study therefore aims to develop such a tool based on unique nucleotide sequence identifiers. More than 60 strains of P. exigua and related species were compared in terms of partial actin gene sequences, or analysed using DNA amplification fingerprinting (DAF) with short, arbitrary, mini-hairpin primers. Fragments in the fingerprint unique to a single taxon were identified, purified and sequenced. Alignment of the sequence data and subsequent primer trials led to the identification of taxon-specific sequence characterized amplified regions (SCARs), and to a set of specific oligonucleotide combinations that can be used to identify these organisms in plant quarantine inspections.

  20. Association between VNTR polymorphism in promoter region of prodynorphin (PDYN) gene and heroin dependence.

    Science.gov (United States)

    Saify, Khyber; Saadat, Iraj; Saadat, Mostafa

    2014-11-30

    Within the core promoter region of prodynorphin (PDYN), a 68-bp sequence was found to occur as a polymorphism element, either singular or as tandemly repeated two, three or four times. We report the sequence of a novel allele (5-repeats). Our study revealed the existence of an ancestral nucleotide (A) at 29th position of the VNTR in human. In total, 442 heroin addicts and 799 controls were included in this study. The present findings revealed a male-limited association between VNTR polymorphism and heroin dependence risk. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  1. The Complete Chloroplast Genome Sequences of the Medicinal Plant Forsythia suspensa (Oleaceae

    Directory of Open Access Journals (Sweden)

    Wenbin Wang

    2017-10-01

    Full Text Available Forsythia suspensa is an important medicinal plant and traditionally applied for the treatment of inflammation, pyrexia, gonorrhea, diabetes, and so on. However, there is limited sequence and genomic information available for F. suspensa. Here, we produced the complete chloroplast genomes of F. suspensa using Illumina sequencing technology. F. suspensa is the first sequenced member within the genus Forsythia (Oleaceae. The gene order and organization of the chloroplast genome of F. suspensa are similar to other Oleaceae chloroplast genomes. The F. suspensa chloroplast genome is 156,404 bp in length, exhibits a conserved quadripartite structure with a large single-copy (LSC; 87,159 bp region, and a small single-copy (SSC; 17,811 bp region interspersed between inverted repeat (IRa/b; 25,717 bp regions. A total of 114 unique genes were annotated, including 80 protein-coding genes, 30 tRNA, and four rRNA. The low GC content (37.8% and codon usage bias for A- or T-ending codons may largely affect gene codon usage. Sequence analysis identified a total of 26 forward repeats, 23 palindrome repeats with lengths >30 bp (identity > 90%, and 54 simple sequence repeats (SSRs with an average rate of 0.35 SSRs/kb. We predicted 52 RNA editing sites in the chloroplast of F. suspensa, all for C-to-U transitions. IR expansion or contraction and the divergent regions were analyzed among several species including the reported F. suspensa in this study. Phylogenetic analysis based on whole-plastome revealed that F. suspensa, as a member of the Oleaceae family, diverged relatively early from Lamiales. This study will contribute to strengthening medicinal resource conservation, molecular phylogenetic, and genetic engineering research investigations of this species.

  2. Genome-wide methylation analysis identified sexually dimorphic methylated regions in hybrid tilapia

    Science.gov (United States)

    Wan, Zi Yi; Xia, Jun Hong; Lin, Grace; Wang, Le; Lin, Valerie C. L.; Yue, Gen Hua

    2016-01-01

    Sexual dimorphism is an interesting biological phenomenon. Previous studies showed that DNA methylation might play a role in sexual dimorphism. However, the overall picture of the genome-wide methylation landscape in sexually dimorphic species remains unclear. We analyzed the DNA methylation landscape and transcriptome in hybrid tilapia (Oreochromis spp.) using whole genome bisulfite sequencing (WGBS) and RNA-sequencing (RNA-seq). We found 4,757 sexually dimorphic differentially methylated regions (DMRs), with significant clusters of DMRs located on chromosomal regions associated with sex determination. CpG methylation in promoter regions was negatively correlated with the gene expression level. MAPK/ERK pathway was upregulated in male tilapia. We also inferred active cis-regulatory regions (ACRs) in skeletal muscle tissues from WGBS datasets, revealing sexually dimorphic cis-regulatory regions. These results suggest that DNA methylation contribute to sex-specific phenotypes and serve as resources for further investigation to analyze the functions of these regions and their contributions towards sexual dimorphisms. PMID:27782217

  3. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  4. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry.

    Science.gov (United States)

    Babrak, Lmar; McGarvey, Jeffery A; Stanker, Larry H; Hnasko, Robert

    2017-10-01

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibodies (rAb). This determination can be achieved by sequence analysis of immunoglobulin (Ig) transcripts obtained from a monoclonal antibody (MAb) producing hybridoma and subsequent expression of a rAb. However the polyploidy nature of a hybridoma cell often results in the added expression of aberrant immunoglobulin-like transcripts or even production of anomalous antibodies which can confound production of rAb. An incorrect VR sequence will result in a non-functional rAb and de novo assembly of Ig primary structure without a sequence map is challenging. To address these problems, we have developed a methodology which combines: 1) selective PCR amplification of VR from both the heavy and light chain IgG from hybridoma, 2) molecular cloning and DNA sequence analysis and 3) tandem mass spectrometry (MS/MS) on enzyme digests obtained from the purified IgG. Peptide analysis proceeds by evaluating coverage of the predicted primary protein sequence provided by the initial DNA maps for the VR. This methodology serves to both identify and verify the primary structure of the MAb VR for production as rAb. Published by Elsevier Ltd.

  5. Phylogenetic relationships in Solanaceae and related species based on cpDNA sequence from plastid trnE-trnT region

    Directory of Open Access Journals (Sweden)

    Danila Montewka Melotto-Passarin

    2008-01-01

    Full Text Available Intergenic spacers of chloroplast DNA (cpDNA are very useful in phylogenetic and population genetic studiesof plant species, to study their potential integration in phylogenetic analysis. The non-coding trnE-trnT intergenic spacer ofcpDNA was analyzed to assess the nucleotide sequence polymorphism of 16 Solanaceae species and to estimate its ability tocontribute to the resolution of phylogenetic studies of this group. Multiple alignments of DNA sequences of trnE-trnT intergenicspacer made the identification of nucleotide variability in this region possible and the phylogeny was estimated by maximumparsimony and rooted with Convolvulaceae Ipomoea batatas, the most closely related family. Besides, this intergenic spacerwas tested for the phylogenetic ability to differentiate taxonomic levels. For this purpose, species from four other families wereanalyzed and compared with Solanaceae species. Results confirmed polymorphism in the trnE-trnT region at different taxonomiclevels.

  6. Population genomics of parallel adaptation in threespine stickleback using sequenced RAD tags.

    Directory of Open Access Journals (Sweden)

    Paul A Hohenlohe

    2010-02-01

    Full Text Available Next-generation sequencing technology provides novel opportunities for gathering genome-scale sequence data in natural populations, laying the empirical foundation for the evolving field of population genomics. Here we conducted a genome scan of nucleotide diversity and differentiation in natural populations of threespine stickleback (Gasterosteus aculeatus. We used Illumina-sequenced RAD tags to identify and type over 45,000 single nucleotide polymorphisms (SNPs in each of 100 individuals from two oceanic and three freshwater populations. Overall estimates of genetic diversity and differentiation among populations confirm the biogeographic hypothesis that large panmictic oceanic populations have repeatedly given rise to phenotypically divergent freshwater populations. Genomic regions exhibiting signatures of both balancing and divergent selection were remarkably consistent across multiple, independently derived populations, indicating that replicate parallel phenotypic evolution in stickleback may be occurring through extensive, parallel genetic evolution at a genome-wide scale. Some of these genomic regions co-localize with previously identified QTL for stickleback phenotypic variation identified using laboratory mapping crosses. In addition, we have identified several novel regions showing parallel differentiation across independent populations. Annotation of these regions revealed numerous genes that are candidates for stickleback phenotypic evolution and will form the basis of future genetic analyses in this and other organisms. This study represents the first high-density SNP-based genome scan of genetic diversity and differentiation for populations of threespine stickleback in the wild. These data illustrate the complementary nature of laboratory crosses and population genomic scans by confirming the adaptive significance of previously identified genomic regions, elucidating the particular evolutionary and demographic history of such

  7. Systematics of Cladophora spp. (Chlorophyta) from North Carolina, USA, based upon morphology and DNA sequence data with a description of Cladophora subtilissima sp. nov.

    Science.gov (United States)

    Taylor, Robin L; Bailey, Jeffrey Craig; Freshwater, David Wilson

    2017-06-01

    Identification of Cladophora species is challenging due to conservation of gross morphology, few discrete autapomorphies, and environmental influences on morphology. Twelve species of marine Cladophora were reported from North Carolina waters. Cladophora specimens were collected from inshore and offshore marine waters for DNA sequence and morphological analyses. The nuclear-encoded rRNA internal transcribed spacer regions (ITS) were sequenced for 105 specimens and used in molecular assisted identification. The ITS1 and ITS2 region was highly variable, and sequences were sorted into ITS Sets of Alignable Sequences (SASs). Sequencing of short hyper-variable ITS1 sections from Cladophora type specimens was used to positively identify species represented by SASs when the types were made available. Secondary structures for the ITS1 locus were also predicted for each specimen and compared to predicted structures from Cladophora sequences available in GenBank. Nine ITS SASs were identified and representative specimens chosen for phylogenetic analyses of 18S and 28S rRNA gene sequences to reveal relationships with other Cladophora species. Phylogenetic analyses indicated that marine Cladophorales were polyphyletic and separated into two clades, the Cladophora clade and the "Siphonocladales" clade. Morphological analyses were performed to assess the consistency of character states within species, and complement the DNA sequence analyses. These analyses revealed intra- and interspecific character state variation, and that combined molecular and morphological analyses were required for the identification of species. One new report, Cladophora dotyana, and one new species Cladophora subtilissima sp. nov., were revealed, and increased the biodiversity of North Carolina marine Cladophora to 14 species. © 2017 Phycological Society of America.

  8. Novel transcripts discovered by mining genomic DNA from defined regions of bovine chromosome 6

    Directory of Open Access Journals (Sweden)

    Eberlein Annett

    2009-04-01

    Full Text Available Abstract Background Linkage analyses strongly suggest a number of QTL for production, health and conformation traits in the middle part of bovine chromosome 6 (BTA6. The identification of the molecular background underlying the genetic variation at the QTL and subsequent functional studies require a well-annotated gene sequence map of the critical QTL intervals. To complete the sequence map of the defined subchromosomal regions on BTA6 poorly covered with comparative gene information, we focused on targeted isolation of transcribed sequences from bovine bacterial artificial chromosome (BAC clones mapped to the QTL intervals. Results Using the method of exon trapping, 92 unique exon trapping sequences (ETS were discovered in a chromosomal region of poor gene coverage. Sequence identity to the current NCBI sequence assembly for BTA6 was detected for 91% of unique ETS. Comparative sequence similarity search revealed that 11% of the isolated ETS displayed high similarity to genomic sequences located on the syntenic chromosomes of the human and mouse reference genome assemblies. Nearly a third of the ETS identified similar equivalent sequences in genomic sequence scaffolds from the alternative Celera-based sequence assembly of the human genome. Screening gene, EST, and protein databases detected 17% of ETS with identity to known transcribed sequences. Expression analysis of a subset of the ETS showed that most ETS (84% displayed a distinctive expression pattern in a multi-tissue panel of a lactating cow verifying their existence in the bovine transcriptome. Conclusion The results of our study demonstrate that the exon trapping method based on region-specific BAC clones is very useful for targeted screening for novel transcripts located within a defined chromosomal region being deficiently endowed with annotated gene information. The majority of identified ETS represents unknown noncoding sequences in intergenic regions on BTA6 displaying a

  9. BIALLELIC POLYMORPHISM IN THE INTRON REGION OF B-TUBULIN GENE OF CRYPTOSPORIDIUM PARASITES

    Science.gov (United States)

    Nucleotide sequencing of polymerase chain reaction-amplified intron region of the Cryptosporidium parvum B-tubulin gene in 26 human and 15 animal isolates revealed distinct genetic polymorphism between the human and bovine genotypes. The separation of 2 genotypes of C. parvum is...

  10. The complete genome sequence of a south Indian isolate of Rice tungro spherical virus reveals evidence of genetic recombination between distinct isolates.

    Science.gov (United States)

    Sailaja, B; Anjum, Najreen; Patil, Yogesh K; Agarwal, Surekha; Malathi, P; Krishnaveni, D; Balachandran, S M; Viraktamath, B C; Mangrauthia, Satendra K

    2013-12-01

    In this study, complete genome of a south Indian isolate of Rice tungro spherical virus (RTSV) from Andhra Pradesh (AP) was sequenced, and the predicted amino acid sequence was analysed. The RTSV RNA genome consists of 12,171 nt without the poly(A) tail, encoding a putative typical polyprotein of 3,470 amino acids. Furthermore, cleavage sites and sequence motifs of the polyprotein were predicted. Multiple alignment with other RTSV isolates showed a nucleotide sequence identity of 95% to east Indian isolates and 90% to Philippines isolates. A phylogenetic tree based on complete genome sequence showed that Indian isolates clustered together, while Vt6 and PhilA isolates of Philippines formed two separate clusters. Twelve recombination events were detected in RNA genome of RTSV using the Recombination Detection Program version 3. Recombination analysis suggested significant role of 5' end and central region of genome in virus evolution. Further, AP and Odisha isolates appeared as important RTSV isolates involved in diversification of this virus in India through recombination phenomenon. The new addition of complete genome of first south Indian isolate provided an opportunity to establish the molecular evolution of RTSV through recombination analysis and phylogenetic relationship.

  11. Regions identity between the genome of vertebrates and non-retroviral families of insect viruses

    Directory of Open Access Journals (Sweden)

    Fan Gaowei

    2011-11-01

    Full Text Available Abstract Background The scope of our understanding of the evolutionary history between viruses and animals is limited. The fact that the recent availability of many complete insect virus genomes and vertebrate genomes as well as the ability to screen these sequences makes it possible to gain a new perspective insight into the evolutionary interaction between insect viruses and vertebrates. This study is to determine the possibility of existence of sequence identity between the genomes of insect viruses and vertebrates, attempt to explain this phenomenon in term of genetic mobile element, and try to investigate the evolutionary relationship between these short regions of identity among these species. Results Some of studied insect viruses contain variable numbers of short regions of sequence identity to the genomes of vertebrate with nucleotide sequence length from 28 bp to 124 bp. They are found to locate in multiple sites of the vertebrate genomes. The ontology of animal genes with identical regions involves in several processes including chromatin remodeling, regulation of apoptosis, signaling pathway, nerve system development and some enzyme-like catalysis. Phylogenetic analysis reveals that at least some short regions of sequence identity in the genomes of vertebrate are derived the ancestral of insect viruses. Conclusion Short regions of sequence identity were found in the vertebrates and insect viruses. These sequences played an important role not only in the long-term evolution of vertebrates, but also in promotion of insect virus. This typical win-win strategy may come from natural selection.

  12. Comparative sequence analysis of the potato cyst nematode resistance locus H1 reveals a major lack of co-linearity between three haplotypes in potato (Solanum tuberosum ssp.).

    Science.gov (United States)

    Finkers-Tomczak, Anna; Bakker, Erin; de Boer, Jan; van der Vossen, Edwin; Achenbach, Ute; Golas, Tomasz; Suryaningrat, Suwardi; Smant, Geert; Bakker, Jaap; Goverse, Aska

    2011-02-01

    The H1 locus confers resistance to the potato cyst nematode Globodera rostochiensis pathotypes 1 and 4. It is positioned at the distal end of chromosome V of the diploid Solanum tuberosum genotype SH83-92-488 (SH) on an introgression segment derived from S. tuberosum ssp. andigena. Markers from a high-resolution genetic map of the H1 locus (Bakker et al. in Theor Appl Genet 109:146-152, 2004) were used to screen a BAC library to construct a physical map covering a 341-kb region of the resistant haplotype coming from SH. For comparison, physical maps were also generated of the two haplotypes from the diploid susceptible genotype RH89-039-16 (S. tuberosum ssp. tuberosum/S. phureja), spanning syntenic regions of 700 and 319 kb. Gene predictions on the genomic segments resulted in the identification of a large cluster consisting of variable numbers of the CC-NB-LRR type of R genes for each haplotype. Furthermore, the regions were interspersed with numerous transposable elements and genes coding for an extensin-like protein and an amino acid transporter. Comparative analysis revealed a major lack of gene order conservation in the sequences of the three closely related haplotypes. Our data provide insight in the evolutionary mechanisms shaping the H1 locus and will facilitate the map-based cloning of the H1 resistance gene.

  13. Targeted deep sequencing of mucinous ovarian tumors reveals multiple overlapping RAS-pathway activating mutations in borderline and cancerous neoplasms

    International Nuclear Information System (INIS)

    Mackenzie, Robertson; Kommoss, Stefan; Winterhoff, Boris J.; Kipp, Benjamin R.; Garcia, Joaquin J.; Voss, Jesse; Halling, Kevin; Karnezis, Anthony; Senz, Janine; Yang, Winnie; Prigge, Elena-Sophie; Reuschenbach, Miriam; Doeberitz, Magnus Von Knebel; Gilks, Blake C.; Huntsman, David G.; Bakkum-Gamez, Jamie; McAlpine, Jessica N.; Anglesio, Michael S.

    2015-01-01

    Mucinous ovarian tumors represent a distinct histotype of epithelial ovarian cancer. The rarest (2-4 % of ovarian carcinomas) of the five major histotypes, their genomic landscape remains poorly described. We undertook hotspot sequencing of 50 genes commonly mutated in human cancer across 69 mucinous ovarian tumors. Our goals were to establish the overall frequency of cancer-hotspot mutations across a large cohort, especially those tumors previously thought to be “RAS-pathway alteration negative”, using highly-sensitive next-generation sequencing as well as further explore a small number of cases with apparent heterogeneity in RAS-pathway activating alterations. Using the Ion Torrent PGM platform, we performed next generation sequencing analysis using the v2 Cancer Hotspot Panel. Regions of disparate ERBB2-amplification status were sequenced independently for two mucinous carcinoma (MC) cases, previously established as showing ERBB2 amplification/overexpression heterogeneity, to assess the hypothesis of subclonal populations containing either KRAS mutation or ERBB2 amplification independently or simultaneously. We detected mutations in KRAS, TP53, CDKN2A, PIK3CA, PTEN, BRAF, FGFR2, STK11, CTNNB1, SRC, SMAD4, GNA11 and ERBB2. KRAS mutations remain the most frequently observed alteration among MC (64.9 %) and mucinous borderline tumors (MBOT) (92.3 %). TP53 mutation occurred more frequently in carcinomas than borderline tumors (56.8 % and 11.5 %, respectively), and combined IHC and mutation data suggest alterations occur in approximately 68 % of MC and as many as 20 % of MBOT. Proven and potential RAS-pathway activating changes were observed in all but one MC. Concurrent ERBB2 amplification and KRAS mutation were observed in a substantial number of cases (7/63 total), as was co-occurrence of KRAS and BRAF mutations (one case). Microdissection of ERBB2-amplified regions of tumors harboring KRAS mutation suggests these alterations are occurring in the same cell

  14. High Diversity of Myocyanophage in Various Aquatic Environments Revealed by High-Throughput Sequencing of Major Capsid Protein Gene With a New Set of Primers

    Directory of Open Access Journals (Sweden)

    Weiguo Hou

    2018-05-01

    Full Text Available Myocyanophages, a group of viruses infecting cyanobacteria, are abundant and play important roles in elemental cycling. Here we investigated the particle-associated viral communities retained on 0.2 μm filters and in sediment samples (representing ancient cyanophage communities from four ocean and three lake locations, using high-throughput sequencing and a newly designed primer pair targeting a gene fragment (∼145-bp in length encoding the cyanophage gp23 major capsid protein (MCP. Diverse viral communities were detected in all samples. The fragments of 142-, 145-, and 148-bp in length were most abundant in the amplicons, and most sequences (>92% belonged to cyanophages. Additionally, different sequencing depths resulted in different diversity estimates of the viral community. Operational taxonomic units obtained from deep sequencing of the MCP gene covered the majority of those obtained from shallow sequencing, suggesting that deep sequencing exhibited a more complete picture of cyanophage community than shallow sequencing. Our results also revealed a wide geographic distribution of marine myocyanophages, i.e., higher dissimilarities of the myocyanophage communities corresponded with the larger distances between the sampling sites. Collectively, this study suggests that the newly designed primer pair can be effectively used to study the community and diversity of myocyanophage from different environments, and the high-throughput sequencing represents a good method to understand viral diversity.

  15. Genome sequence of a diabetes-prone rodent reveals a mutation hotspot around the ParaHox gene cluster

    DEFF Research Database (Denmark)

    Hargreaves, Adam D.; Zhou, Long; Christensen, Josef

    2017-01-01

    The sand rat Psammomys obesus is a gerbil species native to deserts of North Africa and the Middle East, and is constrained in its ecology because high carbohydrate diets induce obesity and type II diabetes that, in extreme cases, can lead to pancreatic failure and death. We report the sequencing...... Pdx1 has been grossly affected by GC-biased mutation, leading to the highest divergence observed for this gene across the Bilateria. In addition to genomic insights into restricted caloric intake in a desert species, the discovery of a localized chromosomal region subject to elevated mutation suggests...

  16. Whole genome sequencing reveals genomic heterogeneity and antibiotic purification in Mycobacterium tuberculosis isolates

    KAUST Repository

    Black, PA

    2015-10-24

    Background Whole genome sequencing has revolutionised the interrogation of mycobacterial genomes. Recent studies have reported conflicting findings on the genomic stability of Mycobacterium tuberculosis during the evolution of drug resistance. In an age where whole genome sequencing is increasingly relied upon for defining the structure of bacterial genomes, it is important to investigate the reliability of next generation sequencing to identify clonal variants present in a minor percentage of the population. This study aimed to define a reliable cut-off for identification of low frequency sequence variants and to subsequently investigate genetic heterogeneity and the evolution of drug resistance in M. tuberculosis. Methods Genomic DNA was isolated from single colonies from 14 rifampicin mono-resistant M. tuberculosis isolates, as well as the primary cultures and follow up MDR cultures from two of these patients. The whole genomes of the M. tuberculosis isolates were sequenced using either the Illumina MiSeq or Illumina HiSeq platforms. Sequences were analysed with an in-house pipeline. Results Using next-generation sequencing in combination with Sanger sequencing and statistical analysis we defined a read frequency cut-off of 30 % to identify low frequency M. tuberculosis variants with high confidence. Using this cut-off we demonstrated a high rate of genetic diversity between single colonies isolated from one population, showing that by using the current sequencing technology, single colonies are not a true reflection of the genetic diversity within a whole population and vice versa. We further showed that numerous heterogeneous variants emerge and then disappear during the evolution of isoniazid resistance within individual patients. Our findings allowed us to formulate a model for the selective bottleneck which occurs during the course of infection, acting as a genomic purification event. Conclusions Our study demonstrated true levels of genetic diversity

  17. Bulk segregant analysis by high-throughput sequencing reveals a novel xylose utilization gene from Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Jared W Wenger

    2010-05-01

    Full Text Available Fermentation of xylose is a fundamental requirement for the efficient production of ethanol from lignocellulosic biomass sources. Although they aggressively ferment hexoses, it has long been thought that native Saccharomyces cerevisiae strains cannot grow fermentatively or non-fermentatively on xylose. Population surveys have uncovered a few naturally occurring strains that are weakly xylose-positive, and some S. cerevisiae have been genetically engineered to ferment xylose, but no strain, either natural or engineered, has yet been reported to ferment xylose as efficiently as glucose. Here, we used a medium-throughput screen to identify Saccharomyces strains that can increase in optical density when xylose is presented as the sole carbon source. We identified 38 strains that have this xylose utilization phenotype, including strains of S. cerevisiae, other sensu stricto members, and hybrids between them. All the S. cerevisiae xylose-utilizing strains we identified are wine yeasts, and for those that could produce meiotic progeny, the xylose phenotype segregates as a single gene trait. We mapped this gene by Bulk Segregant Analysis (BSA using tiling microarrays and high-throughput sequencing. The gene is a putative xylitol dehydrogenase, which we name XDH1, and is located in the subtelomeric region of the right end of chromosome XV in a region not present in the S288c reference genome. We further characterized the xylose phenotype by performing gene expression microarrays and by genetically dissecting the endogenous Saccharomyces xylose pathway. We have demonstrated that natural S. cerevisiae yeasts are capable of utilizing xylose as the sole carbon source, characterized the genetic basis for this trait as well as the endogenous xylose utilization pathway, and demonstrated the feasibility of BSA using high-throughput sequencing.

  18. Molecular dissection of a contiguous gene syndrome: Frequent submicroscopic deletions, evolutionarily conserved sequences, and a hypomethylated island in the Miller-Dieker chromosome region

    International Nuclear Information System (INIS)

    Ledbetter, D.H.; Ledbetter, S.A.; vanTuinen, P.

    1989-01-01

    The Miller-Dieker syndrome (MDS), composed of characteristic facial abnormalities and a severe neuronal migration disorder affecting the cerebral cortex, is caused by visible or submicroscopic deletions of chromosome band 17p13. Twelve anonymous DNA markers were tested against a panel of somatic cell hybrids containing 17p deletions from seven MDS patients. All patients, including three with normal karyotypes, are deleted for a variable set of 5-12 markers. Two highly polymorphic VNTR (variable number of tandem repeats) probes, YNZ22 and YNH37, are codeleted in all patients tested and make molecular diagnosis for this disorder feasible. By pulsed-field gel electrophoresis, YNZ22 and YNH37 were shown to be within 30 kilobases (kb) of each other. Cosmid clones containing both VNTR sequences were identified, and restriction mapping showed them to be 100 kb were completely deleted in all patients, providing a minimum estimate of the size of the MDS critical region. A hypomethylated island and evolutionarily conserved sequences were identified within this 100-kb region, indications of the presence of one or more expressed sequences potentially involved in the pathophysiology of this disorder. The conserved sequences were mapped to mouse chromosome 11 by using mouse-rat somatic cell hybrids, extending the remarkable homology between human chromosome 17 and mouse chromosome 11 by 30 centimorgans, into the 17p telomere region

  19. Whole-exome sequencing of a patient with severe and complex hemostatic abnormalities reveals a possible contributing frameshift mutation in C3AR1

    DEFF Research Database (Denmark)

    Leinøe, Eva; Nielsen, Ove Juul; Jønson, Lars

    2016-01-01

    -threatening coagulation disorder causing recurrent venous thromboembolic events, severe thrombocytopenia, and subdural hematomas. Whole-exome sequencing revealed a frameshift mutation (C3AR1 c.355-356dup, p.Asp119Alafs*19) resulting in a premature stop codon in C3AR1 (Complement Component 3a Receptor 1). Based...

  20. Isolation of the Drosophila melanogaster dunce chromosomal region and recombinational mapping of dunce sequences with restriction site polymorphisms as genetic markers

    OpenAIRE

    Davis, Ronald L.; Davidson, Norman

    1984-01-01

    Using the method of chromosomal walking, we have isolated a contiguous region of the Drosophila melanogaster X chromosome which corresponds to salivary gland chromosome bands 3C12 to 3D4. This five-band region contains approximately 100 kilobases of DNA, including those sequences comprising dunce, a gene which functions in memory and cyclic nucleotide metabolism. Genome blots of DNA from flies carrying several different chromosomal aberrations with breakpoints in the region have been probed w...

  1. Comparison of variable region 3 sequences of human immunodeficiency virus type 1 from infected children with the RNA and DNA sequences of the virus populations of their mothers.

    Science.gov (United States)

    Scarlatti, G; Leitner, T; Halapi, E; Wahlberg, J; Marchisio, P; Clerici-Schoeller, M A; Wigzell, H; Fenyö, E M; Albert, J; Uhlén, M

    1993-01-01

    We have compared the variable region 3 sequences from 10 human immunodeficiency virus type 1 (HIV-1)-infected infants to virus sequences from the corresponding mothers. The sequences were derived from DNA of uncultured peripheral blood mononuclear cells (PBMC), DNA of cultured PBMC, and RNA from serum collected at or shortly after delivery. The infected infants, in contrast to the mothers, harbored homogeneous virus populations. Comparison of sequences from the children and clones derived from DNA of the corresponding mothers showed that the transmitted virus represented either a minor or a major virus population of the mother. In contrast to an earlier study, we found no evidence of selection of minor virus variants during transmission. Furthermore, the transmitted virus variant did not show any characteristic molecular features. In some cases the transmitted virus was more related to the virus RNA population of the mother and in other cases it was more related to the virus DNA population. This suggests that either cell-free or cell-associated virus may be transmitted. These data will help AIDS researchers to understand the mechanism of transmission and to plan strategies for prevention of transmission. PMID:8446584

  2. Data on the evolutionary history of the V(DJ recombination-activating protein 1 – RAG1 coupled with sequence and variant analyses

    Directory of Open Access Journals (Sweden)

    Abhishek Kumar

    2016-09-01

    Full Text Available RAG1 protein is one of the key component of RAG complex regulating the V(DJ recombination. There are only few studies for RAG1 concerning evolutionary history, detailed sequence and mutational hotspots. Herein, we present out datasets used for the recent comprehensive study of RAG1 based on sequence, phylogenetic and genetic variant analyses (Kumar et al., 2015 [1]. Protein sequence alignment helped in characterizing the conserved domains and regions of RAG1. It also aided in unraveling ancestral RAG1 in the sea urchin. Human genetic variant analyses revealed 751 mutational hotspots, located both in the coding and the non-coding regions. For further analysis and discussion, see (Kumar et al., 2015 [1].

  3. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset.

    Science.gov (United States)

    Ignatieva, Elena V; Levitsky, Victor G; Yudin, Nikolay S; Moshkin, Mikhail P; Kolchanov, Nikolay A

    2014-01-01

    The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors), which are activated by olfactory stimuli (ligands). Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter [a region of DNA about 100-1000 base pairs long located upstream of the transcription start site (TSS)]. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.). In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  4. Comparison and evaluation of two exome capture kits and sequencing platforms for variant calling.

    Science.gov (United States)

    Zhang, Guoqiang; Wang, Jianfeng; Yang, Jin; Li, Wenjie; Deng, Yutian; Li, Jing; Huang, Jun; Hu, Songnian; Zhang, Bing

    2015-08-05

    To promote the clinical application of next-generation sequencing, it is important to obtain accurate and consistent variants of target genomic regions at low cost. Ion Proton, the latest updated semiconductor-based sequencing instrument from Life Technologies, is designed to provide investigators with an inexpensive platform for human whole exome sequencing that achieves a rapid turnaround time. However, few studies have comprehensively compared and evaluated the accuracy of variant calling between Ion Proton and Illumina sequencing platforms such as HiSeq 2000, which is the most popular sequencing platform for the human genome. The Ion Proton sequencer combined with the Ion TargetSeq Exome Enrichment Kit together make up TargetSeq-Proton, whereas SureSelect-Hiseq is based on the Agilent SureSelect Human All Exon v4 Kit and the HiSeq 2000 sequencer. Here, we sequenced exonic DNA from four human blood samples using both TargetSeq-Proton and SureSelect-HiSeq. We then called variants in the exonic regions that overlapped between the two exome capture kits (33.6 Mb). The rates of shared variant loci called by two sequencing platforms were from 68.0 to 75.3% in four samples, whereas the concordance of co-detected variant loci reached 99%. Sanger sequencing validation revealed that the validated rate of concordant single nucleotide polymorphisms (SNPs) (91.5%) was higher than the SNPs specific to TargetSeq-Proton (60.0%) or specific to SureSelect-HiSeq (88.3%). With regard to 1-bp small insertions and deletions (InDels), the Sanger sequencing validated rates of concordant variants (100.0%) and SureSelect-HiSeq-specific (89.6%) were higher than those of TargetSeq-Proton-specific (15.8%). In the sequencing of exonic regions, a combination of using of two sequencing strategies (SureSelect-HiSeq and TargetSeq-Proton) increased the variant calling specificity for concordant variant loci and the sensitivity for variant loci called by any one platform. However, for the

  5. Phylogenetic relationships of Scomberomorus commerson using sequence analysis of the mtDNA D-loop region in the Persian Gulf, Oman Sea and Arabian Sea

    Directory of Open Access Journals (Sweden)

    Ana Mansourkiaei

    2016-04-01

    Full Text Available Abstract Narrow-barred Spanish mackerel, Scomberomorus commerson, is an epipelagic and migratory species of family Scombridae which have a significant role in terms of ecology and fishery. 100 samples were collected from the Persian Gulf, Oman Sea and Arabian Sea. Part of their dorsal fins was snipped and transferred to micro-tubes containing ethanol; then, DNAs were extracted and HRM-Real Time PCR was performed to designate representative specimens for sequencing. Phylogenetic relationships of S. commerson from Persian Gulf, Oman Sea and Arabian Sea were investigated using sequence data of mitochondrial DNA D-loop region. None clustered Neighbor Joining tree indicated the proximity amid S. commerson in four sites. As numbers demonstrated in sequence analyses of mitochondrial DNA D-Loop region a sublimely high degree of genetic similarity among S. commerson from the Persian Gulf and Oman Sea were perceived, thereafter, having one stock structure of S. commerson in four regions were proved, and this approximation can be merely justified by their migration process along the coasts of Oman Sea and Persian Gulf. Therefore, the assessment of distribution patterns of 20 haplotypes in the constructed phylogenetic tree using mtDNA D-Loop sequences ascertained that no significant clustering according to the sampling sites was concluded.

  6. Using Markov chains of nucleotide sequences as a possible precursor to predict functional roles of human genome: a case study on inactive chromatin regions.

    Science.gov (United States)

    Lee, K-E; Lee, E-J; Park, H-S

    2016-08-30

    Recent advances in computational epigenetics have provided new opportunities to evaluate n-gram probabilistic language models. In this paper, we describe a systematic genome-wide approach for predicting functional roles in inactive chromatin regions by using a sequence-based Markovian chromatin map of the human genome. We demonstrate that Markov chains of sequences can be used as a precursor to predict functional roles in heterochromatin regions and provide an example comparing two publicly available chromatin annotations of large-scale epigenomics projects: ENCODE project consortium and Roadmap Epigenomics consortium.

  7. High-resolution deep sequencing reveals biodiversity, population structure, and persistence of HIV-1 quasispecies within host ecosystems

    Directory of Open Access Journals (Sweden)

    Yin Li

    2012-12-01

    Full Text Available Abstract Background Deep sequencing provides the basis for analysis of biodiversity of taxonomically similar organisms in an environment. While extensively applied to microbiome studies, population genetics studies of viruses are limited. To define the scope of HIV-1 population biodiversity within infected individuals, a suite of phylogenetic and population genetic algorithms was applied to HIV-1 envelope hypervariable domain 3 (Env V3 within peripheral blood mononuclear cells from a group of perinatally HIV-1 subtype B infected, therapy-naïve children. Results Biodiversity of HIV-1 Env V3 quasispecies ranged from about 70 to 270 unique sequence clusters across individuals. Viral population structure was organized into a limited number of clusters that included the dominant variants combined with multiple clusters of low frequency variants. Next generation viral quasispecies evolved from low frequency variants at earlier time points through multiple non-synonymous changes in lineages within the evolutionary landscape. Minor V3 variants detected as long as four years after infection co-localized in phylogenetic reconstructions with early transmitting viruses or with subsequent plasma virus circulating two years later. Conclusions Deep sequencing defines HIV-1 population complexity and structure, reveals the ebb and flow of dominant and rare viral variants in the host ecosystem, and identifies an evolutionary record of low-frequency cell-associated viral V3 variants that persist for years. Bioinformatics pipeline developed for HIV-1 can be applied for biodiversity studies of virome populations in human, animal, or plant ecosystems.

  8. Subset of Kappa and Lambda Germline Sequences Result in Light Chains with a Higher Molecular Mass Phenotype.

    Science.gov (United States)

    Barnidge, David R; Lundström, Susanna L; Zhang, Bo; Dasari, Surendra; Murray, David L; Zubarev, Roman A

    2015-12-04

    In our previous work, we showed that electrospray ionization of intact polyclonal kappa and lambda light chains isolated from normal serum generates two distinct, Gaussian-shaped, molecular mass distributions representing the light-chain repertoire. During the analysis of a large (>100) patient sample set, we noticed a low-intensity molecular mass distribution with a mean of approximately 24 250 Da, roughly 800 Da higher than the mean of the typical kappa molecular-mass distribution mean of 23 450 Da. We also observed distinct clones in this region that did not appear to contain any typical post-translational modifications that would account for such a large mass shift. To determine the origin of the high molecular mass clones, we performed de novo bottom-up mass spectrometry on a purified IgM monoclonal light chain that had a calculated molecular mass of 24 275.03 Da. The entire sequence of the monoclonal light chain was determined using multienzyme digestion and de novo sequence-alignment software and was found to belong to the germline allele IGKV2-30. The alignment of kappa germline sequences revealed ten IGKV2 and one IGKV4 sequences that contained additional amino acids in their CDR1 region, creating the high-molecular-mass phenotype. We also performed an alignment of lambda germline sequences, which showed additional amino acids in the CDR2 region, and the FR3 region of functional germline sequences that result in a high-molecular-mass phenotype. The work presented here illustrates the ability of mass spectrometry to provide information on the diversity of light-chain molecular mass phenotypes in circulation, which reflects the germline sequences selected by the immunoglobulin-secreting B-cell population.

  9. Influence of manure age and sunlight on the community structure of cattle fecal bacteria as revealed by Illumina sequencing

    Science.gov (United States)

    Wong, K.; Shaw, T. I.; Oladeinde, A.; Molina, M.

    2013-12-01

    Fecal pollution of environmental waters is a major concern for the general public because exposure to fecal-associated pathogens can have severe impacts on human health. Stream and river impairment due to fecal pollution is largely the result of agricultural activities in the United States. In the last few years, numerous metagenomic studies utilized next generation sequencing to develop microbial community profiles by massively sequencing the 16sRNA hypervariable region. This technology supports the application of water quality assessment such as pathogen detection and fecal source tracking. The bacteria communities of samples in these studies were determined when they were freshly collected; therefore, little is known about how feces age or how environmental stress influences the microbial ecology of fecal materials. In this study we monitored bacteria community changes in cattle feces for 57 days after excretion (day 0, 2, 4 8, 15, 22, 29, 43, 57) by sequencing the 16s variable region 4, using Illumnia MiSeq. Twelve cattle feces were studied; half of the samples were directly exposed to sunlight (unshaded) and half were shaded. Results indicate that the relative abundance (RA) profile in both shaded and unshaded samples rapidly changed from day 0 to 15, but stabilized from day 22 to 57. Firmcutes were the most abundant phylum (~40%) at day 0, but were reduced to rarefaction curve analysis, richness of bacteria diversity in feces decreased as time progressed. Some pathogens such as Campylobacter were detected only at the beginning, meaning they substantially decayed during the course of our study. Overall, this study indicated: (1) sunlight can influence the community structure and (2) after excretion the fecal bacteria diversity can be significantly changed over time. Future studies should therefore use not only the microbial signature of fresh but also moderately aged fecal samples to develop more accurate community profiles for fecal source tracking.

  10. Two unusual hepatitis C virus subtypes, 2j and 2q, in Spain: Identification by nested-PCR and sequencing of a NS5B region.

    Science.gov (United States)

    Margall, N; March, F; Español, M; Torras, X; Gallego, A; Coll, P

    2015-10-01

    Many studies have reported the use of the NS5B gene to subtype hepatitis C virus (HCV). Other HCV genes, such as HCV-5' UTR, Core (C) and E1, have also been used. In some studies, NS5B have been used together with 5'-UTR or C genes to improve genotyping results obtained using commercial procedures. Only two studies in Spain have compared molecular techniques versus commercial procedures regarding the efficacy of HCV subtyping. The aim of this study was to determine whether nested PCR and sequencing of a NS5B region was more reliable than commercial procedures to subtype HCV. We analyzed the results of HCV genotyping in [726] serum specimens collected from 2001 to 2013. From 2001 to 2011, we used PCR and INNO-LiPA hybridization or its new version Versant HCV Genotype 2.0 assay (471 samples). From 2012 to 2013, we used nested PCR and sequencing of a NS5B region (255 cases). This method used two pairs of primers to amplify the RNA of the sample converted to DNA by retrotranscription. The amplification product of 270 base pairs was further sequenced. To identify the subtype, the sequences obtained were compared to those in the international database: http://hcv.lanl.gov./content/sequence/, HCV/ToolsOutline.html and Geno2pheno[hcv] http://hcv.bioinf.mpi-inf.mpg.de/index.php. Nested PCR of a NS5B region and sequencing identified all but one subtype (0.4%, 1/255), differentiated all 1a subtypes from 1b subtypes, and characterized all HCV 2-4 subtypes. This approach also distinguished two subtypes, 2j and 2q, that had rarely been detected previously in Spain. However, commercial procedures failed to subtype 12.7% (60/471) of samples and to genotype 0.6% of specimens (3/471). Nested PCR and sequencing of a NS5B region improved the subtyping of HCV in comparison with classical procedures and identified two rare subtypes in Spain: 2j and 2q. However, full length genome sequencing is recommended to confirm HCV 2j and 2q subtypes. Copyright © 2015. Published by Elsevier B.V.

  11. Exome Sequencing Fails to Identify the Genetic Cause of Aicardi Syndrome.

    Science.gov (United States)

    Lund, Caroline; Striano, Pasquale; Sorte, Hanne Sørmo; Parisi, Pasquale; Iacomino, Michele; Sheng, Ying; Vigeland, Magnus D; Øye, Anne-Marte; Møller, Rikke Steensbjerre; Selmer, Kaja K; Zara, Federico

    2016-09-01

    Aicardi syndrome (AS) is a well-characterized neurodevelopmental disorder with an unknown etiology. In this study, we performed whole-exome sequencing in 11 female patients with the diagnosis of AS, in order to identify the disease-causing gene. In particular, we focused on detecting variants in the X chromosome, including the analysis of variants with a low number of sequencing reads, in case of somatic mosaicism. For 2 of the patients, we also sequenced the exome of the parents to search for de novo mutations. We did not identify any genetic variants likely to be damaging. Only one single missense variant was identified by the de novo analyses of the 2 trios, and this was considered benign. The failure to identify a disease gene in this study may be due to technical limitations of our study design, including the possibility that the genetic aberration leading to AS is situated in a non-exonic region or that the mutation is somatic and not detectable by our approach. Alternatively, it is possible that AS is genetically heterogeneous and that 11 patients are not sufficient to reveal the causative genes. Future studies of AS should consider designs where also non-exonic regions are explored and apply a sequencing depth so that also low-grade somatic mosaicism can be detected.

  12. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

    Science.gov (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

    2013-01-01

    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  13. Fetal anatomy revealed with fast MR sequences.

    Science.gov (United States)

    Levine, D; Hatabu, H; Gaa, J; Atkinson, M W; Edelman, R R

    1996-10-01

    Although all the imaging studies in this pictorial essay were done for maternal rather than fetal indications, fetal anatomy was well visualized. However, when scans are undertaken for fetal indications, fetal motion in between scout views and imaging sequences may make specific image planes difficult to obtain. Of the different techniques described in this review, we preferred the HASTE technique and use it almost exclusively for scanning pregnant patients. The T2-weighting is ideal for delineating fetal organs. Also, the HASTE technique allows images to be obtained in 430 msec, limiting artifacts arising from maternal and fetal motion. MR imaging should play a more important role in evaluating equivocal sonographic cases as fast scanning techniques are more widely used. Obstetric MR imaging no longer will be limited by fetal motion artifacts. When complex anatomy requires definition in a complicated pregnant patient, MR imaging should be considered as a useful adjunct to sonography.

  14. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  15. Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

    International Nuclear Information System (INIS)

    Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.

    1987-01-01

    The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

  16. Sequence alignment reveals possible MAPK docking motifs on HIV proteins.

    Directory of Open Access Journals (Sweden)

    Perry Evans

    Full Text Available Over the course of HIV infection, virus replication is facilitated by the phosphorylation of HIV proteins by human ERK1 and ERK2 mitogen-activated protein kinases (MAPKs. MAPKs are known to phosphorylate their substrates by first binding with them at a docking site. Docking site interactions could be viable drug targets because the sequences guiding them are more specific than phosphorylation consensus sites. In this study we use multiple bioinformatics tools to discover candidate MAPK docking site motifs on HIV proteins known to be phosphorylated by MAPKs, and we discuss the possibility of targeting docking sites with drugs. Using sequence alignments of HIV proteins of different subtypes, we show that MAPK docking patterns previously described for human proteins appear on the HIV matrix, Tat, and Vif proteins in a strain dependent manner, but are absent from HIV Rev and appear on all HIV Nef strains. We revise the regular expressions of previously annotated MAPK docking patterns in order to provide a subtype independent motif that annotates all HIV proteins. One revision is based on a documented human variant of one of the substrate docking motifs, and the other reduces the number of required basic amino acids in the standard docking motifs from two to one. The proposed patterns are shown to be consistent with in silico docking between ERK1 and the HIV matrix protein. The motif usage on HIV proteins is sufficiently different from human proteins in amino acid sequence similarity to allow for HIV specific targeting using small-molecule drugs.

  17. Extracellular DNA amplicon sequencing reveals high levels of benthic eukaryotic diversity in the central Red Sea

    KAUST Repository

    Pearman, John K.

    2015-11-01

    The present study aims to characterize the benthic eukaryotic biodiversity patterns at a coarse taxonomic level in three areas of the central Red Sea (a lagoon, an offshore area in Thuwal and a shallow coastal area near Jeddah) based on extracellular DNA. High-throughput amplicon sequencing targeting the V9 region of the 18S rRNA gene was undertaken for 32 sediment samples. High levels of alpha-diversity were detected with 16,089 operational taxonomic units (OTUs) being identified. The majority of the OTUs were assigned to Metazoa (29.2%), Alveolata (22.4%) and Stramenopiles (17.8%). Stramenopiles (Diatomea) and Alveolata (Ciliophora) were frequent in a lagoon and in shallower coastal stations, whereas metazoans (Arthropoda: Maxillopoda) were dominant in deeper offshore stations. Only 24.6% of total OTUs were shared among all areas. Beta-diversity was generally lower between the lagoon and Jeddah (nearshore) than between either of those and the offshore area, suggesting a nearshore–offshore biodiversity gradient. The current approach allowed for a broad-range of benthic eukaryotic biodiversity to be analysed with significantly less labour than would be required by other traditional taxonomic approaches. Our findings suggest that next generation sequencing techniques have the potential to provide a fast and standardised screening of benthic biodiversity at large spatial and temporal scales.

  18. Genome Sequencing Reveals the Potential of Achromobacter sp. HZ01 for Bioremediation

    Directory of Open Access Journals (Sweden)

    Yue-Hui Hong

    2017-08-01

    Full Text Available Petroleum pollution is a severe environmental issue. Comprehensively revealing the genetic backgrounds of hydrocarbon-degrading microorganisms contributes to developing effective methods for bioremediation of crude oil-polluted environments. Marine bacterium Achromobacter sp. HZ01 is capable of degrading hydrocarbons and producing biosurfactants. In this study, the draft genome (5.5 Mbp of strain HZ01 has been obtained by Illumina sequencing, containing 5,162 predicted genes. Genome annotation shows that “amino acid metabolism” is the most abundant metabolic pathway. Strain HZ01 is not capable of using some common carbohydrates as the sole carbon sources, which is due to that it contains few genes associated with carbohydrate transport and lacks some important enzymes related to glycometabolism. It contains abundant proteins directly related to petroleum hydrocarbon degradation. AlkB hydroxylase and its homologs were not identified. It harbors a complete enzyme system of terminal oxidation pathway for n-alkane degradation, which may be initiated by cytochrome P450. The enzymes involved in the catechol pathway are relatively complete for the degradation of aromatic compounds. This bacterium lacks several essential enzymes for methane oxidation, and Baeyer-Villiger monooxygenase involved in the subterminal oxidation pathway and cycloalkane degradation was not identified. These results suggest that strain HZ01 degrades n-alkanes via the terminal oxidation pathway, degrades aromatic compounds primarily via the catechol pathway and cannot perform methane oxidation or cycloalkane degradation. Additionally, strain HZ01 possesses abundant genes related to the metabolism of secondary metabolites, including some genes involved in biosurfactant (such as glycolipids and lipopeptides synthesis. The genome analysis also reveals its genetic basis for nitrogen metabolism, antibiotic resistance, regulatory responses to environmental changes, cell motility

  19. Immunoglobulin variable region sequences of two human monoclonal antibodies directed to an onco-developmental carbohydrate antigen, lactotetraosylceramide (LcOse4Cer).

    Science.gov (United States)

    Yago, K; Zenita, K; Ohwaki, I; Harada, R; Nozawa, S; Tsukazaki, K; Iwamori, M; Endo, N; Yasuda, N; Okuma, M

    1993-11-01

    A human monoclonal antibody, 11-50, was generated and was shown to recognize an onco-developmental carbohydrate antigen, LcOse4Cer. The isotype of this antibody was IgM, lambda, similar to the previously known human anti-LcOse4 antibodies, such as IgMWOO and HMST-1. We raised a murine anti-idiotypic antibody G3 (IgG1, kappa) against 11-50, and tested its reactivity towards the affinity purified human polyclonal anti-LcOse4 antibodies prepared from pooled human sera using a Gal beta 1-->3GlcNAc beta-immobilized column. The results indicated that at least a part of the human polyclonal anti-LcOse4 antibodies shared the G3 idiotype with 11-50. We further analyzed the sequence of variable regions of the two anti-LcOse4 antibodies, 11-50 and HMST-1. Sequence analysis of the heavy chain variable regions indicated that the VH regions of these two antibodies were highly homologous to each other (93.5% at the nucleic acid level), and these antibodies utilized the germline genes VH1.9III and hv3005f3 as the VH segments, which are closely related germline genes of the VHIII family. It was noted that these germline VH genes are frequently utilized in fetal B cells. The JH region of both antibodies was encoded by the JH4 gene. For the light chain, the V lambda segments of the two antibodies were 96.3% homologous to each other at the nucleic acid level. The V lambda segments of both antibodies showed the highest homology to the rearranged V lambda gene called V lambda II.DS among reported V lambda genes, while the exact germline V lambda genes encoding the two antibodies were not yet registered in available sequence databanks. The amino acid sequences of the J lambda segments of both antibodies were identical. These results indicate that the two human antibodies recognizing the onco-developmental carbohydrate antigen Lc4 are encoded by the same or very homologous germline genes.

  20. The hydrophobic core of twin-arginine signal sequences orchestrates specific binding to Tat-pathway related chaperones.

    Directory of Open Access Journals (Sweden)

    Anitha Shanmugham

    Full Text Available Redox enzyme maturation proteins (REMPs bind pre-proteins destined for translocation across the bacterial cytoplasmic membrane via the twin-arginine translocation system and enable the enzymatic incorporation of complex cofactors. Most REMPs recognize one specific pre-protein. The recognition site usually resides in the N-terminal signal sequence. REMP binding protects signal peptides against degradation by proteases. REMPs are also believed to prevent binding of immature pre-proteins to the translocon. The main aim of this work was to better understand the interaction between REMPs and substrate signal sequences. Two REMPs were investigated: DmsD (specific for dimethylsulfoxide reductase, DmsA and TorD (specific for trimethylamine N-oxide reductase, TorA. Green fluorescent protein (GFP was genetically fused behind the signal sequences of TorA and DmsA. This ensures native behavior of the respective signal sequence and excludes any effects mediated by the mature domain of the pre-protein. Surface plasmon resonance analysis revealed that these chimeric pre-proteins specifically bind to the cognate REMP. Furthermore, the region of the signal sequence that is responsible for specific binding to the corresponding REMP was identified by creating region-swapped chimeric signal sequences, containing parts of both the TorA and DmsA signal sequences. Surprisingly, specificity is not encoded in the highly variable positively charged N-terminal region of the signal sequence, but in the more similar hydrophobic C-terminal parts. Interestingly, binding of DmsD to its model substrate reduced membrane binding of the pre-protein. This property could link REMP-signal peptide binding to its reported proofreading function.

  1. Whole genome sequencing reveals a novel deletion variant in the KIT gene in horses with white spotted coat colour phenotypes.

    Science.gov (United States)

    Dürig, N; Jude, R; Holl, H; Brooks, S A; Lafayette, C; Jagannathan, V; Leeb, T

    2017-08-01

    White spotting phenotypes in horses can range in severity from the common white markings up to completely white horses. EDNRB, KIT, MITF, PAX3 and TRPM1 represent known candidate genes for such phenotypes in horses. For the present study, we re-investigated a large horse family segregating a variable white spotting phenotype, for which conventional Sanger sequencing of the candidate genes' individual exons had failed to reveal the causative variant. We obtained whole genome sequence data from an affected horse and specifically searched for structural variants in the known candidate genes. This analysis revealed a heterozygous ~1.9-kb deletion spanning exons 10-13 of the KIT gene (chr3:77,740,239_77,742,136del1898insTATAT). In continuity with previously named equine KIT variants we propose to designate the newly identified deletion variant W22. We had access to 21 horses carrying the W22 allele. Four of them were compound heterozygous W20/W22 and had a completely white phenotype. Our data suggest that W22 represents a true null allele of the KIT gene, whereas the previously identified W20 leads to a partial loss of function. These findings will enable more precise genetic testing for depigmentation phenotypes in horses. © 2017 Stichting International Foundation for Animal Genetics.

  2. Identification of human microRNA-like sequences embedded within the protein-encoding genes of the human immunodeficiency virus.

    Directory of Open Access Journals (Sweden)

    Bryan Holland

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the

  3. Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus.

    Science.gov (United States)

    Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H

    2008-01-01

    During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

  4. Genetic variation among the Mapuche Indians from the Patagonian region of Argentina: mitochondrial DNA sequence variation and allele frequencies of several nuclear genes.

    Science.gov (United States)

    Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C

    1993-01-01

    DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Sequencing of the Chlamydophila psittaci ompA Gene Reveals a New Genotype, E/B, and the Need for a Rapid Discriminatory Genotyping Method

    Science.gov (United States)

    Geens, Tom; Desplanques, Ann; Van Loock, Marnix; Bönner, Brigitte M.; Kaleta, Erhard F.; Magnino, Simone; Andersen, Arthur A.; Everett, Karin D. E.; Vanrompay, Daisy

    2005-01-01

    Twenty-one avian Chlamydophila psittaci isolates from different European countries were characterized using ompA restriction fragment length polymorphism, ompA sequencing, and major outer membrane protein serotyping. Results reveal the presence of a new genotype, E/B, in several European countries and stress the need for a discriminatory rapid genotyping method. PMID:15872282

  6. Molecular diagnostics of a single drug-resistant multiple myeloma case using targeted next-generation sequencing

    Directory of Open Access Journals (Sweden)

    Ikeda H

    2015-10-01

    Full Text Available Hiroshi Ikeda,1 Kazuya Ishiguro,1 Tetsuyuki Igarashi,1 Yuka Aoki,1 Toshiaki Hayashi,1 Tadao Ishida,1 Yasushi Sasaki,1,2 Takashi Tokino,2 Yasuhisa Shinomura1 1Department of Gastroenterology, Rheumatology and Clinical Immunology, 2Medical Genome Sciences, Research Institute for Frontier Medicine, Sapporo Medical University, Sapporo, Japan Abstract: A 69-year-old man was diagnosed with IgG λ-type multiple myeloma (MM, Stage II in October 2010. He was treated with one cycle of high-dose dexamethasone. After three cycles of bortezomib, the patient exhibited slow elevations in the free light-chain levels and developed a significant new increase of serum M protein. Bone marrow cytogenetic analysis revealed a complex karyotype characteristic of malignant plasma cells. To better understand the molecular pathogenesis of this patient, we sequenced for mutations in the entire coding regions of 409 cancer-related genes using a semiconductor-based sequencing platform. Sequencing analysis revealed eight nonsynonymous somatic mutations in addition to several copy number variants, including CCND1 and RB1. These alterations may play roles in the pathobiology of this disease. This targeted next-generation sequencing can allow for the prediction of drug resistance and facilitate improvements in the treatment of MM patients. Keywords: multiple myeloma, drug resistance, genome-wide sequencing, semiconductor sequencer, target therapy

  7. Genome sequencing and comparative genomics reveal a repertoire of putative pathogenicity genes in chilli anthracnose fungus Colletotrichum truncatum.

    Science.gov (United States)

    Rao, Soumya; Nandineni, Madhusudan R

    2017-01-01

    Colletotrichum truncatum, a major fungal phytopathogen, causes the anthracnose disease on an economically important spice crop chilli (Capsicum annuum), resulting in huge economic losses in tropical and sub-tropical countries. It follows a subcuticular intramural infection strategy on chilli with a short, asymptomatic, endophytic phase, which contrasts with the intracellular hemibiotrophic lifestyle adopted by most of the Colletotrichum species. However, little is known about the molecular determinants and the mechanism of pathogenicity in this fungus. A high quality whole genome sequence and gene annotation based on transcriptome data of an Indian isolate of C. truncatum from chilli has been obtained. Analysis of the genome sequence revealed a rich repertoire of pathogenicity genes in C. truncatum encoding secreted proteins, effectors, plant cell wall degrading enzymes, secondary metabolism associated proteins, with potential roles in the host-specific infection strategy, placing it next only to the Fusarium species. The size of genome assembly, number of predicted genes and some of the functional categories were similar to other sequenced Colletotrichum species. The comparative genomic analyses with other species and related fungi identified some unique genes and certain highly expanded gene families of CAZymes, proteases and secondary metabolism associated genes in the genome of C. truncatum. The draft genome assembly and functional annotation of potential pathogenicity genes of C. truncatum provide an important genomic resource for understanding the biology and lifestyle of this important phytopathogen and will pave the way for designing efficient disease control regimens.

  8. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

    Science.gov (United States)

    Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

    2016-02-01

    Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.

  9. Experimental single-strain mobilomics reveals events that shape pathogen emergence.

    Science.gov (United States)

    Schoeniger, Joseph S; Hudson, Corey M; Bent, Zachary W; Sinha, Anupama; Williams, Kelly P

    2016-08-19

    Virulence genes on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. Excision is an early step in GI mobilization, producing a circular GI and a deletion site in the chromosome; circular forms are also known for some bacterial insertion sequences (ISs). The recombinant sequence at the junctions of such circles and deletions can be detected sensitively in high-throughput sequencing data, using new computational methods that enable empirical discovery of mobile DNAs. For the rich mobilome of a hospital Klebsiella pneumoniae strain, circularization junctions (CJs) were detected for six GIs and seven IS types. Our methods revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21 Using the resistance of circular dsDNA molecules to exonuclease, internally calibrated with the native plasmids, showed that not all molecules bearing GI CJs were circular. Transpositions were also detected, revealing replicon preference (ISKpn18 prefers a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis) and IS polarity inversion. Efficient discovery and global characterization of numerous mobile elements per experiment improves accounting for the new gene combinations that arise in emerging pathogens. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. The diploid genome sequence of an individual human.

    Directory of Open Access Journals (Sweden)

    Samuel Levy

    2007-09-01

    Full Text Available Presented here is a genome sequence of an individual human. It was produced from approximately 32 million random DNA fragments, sequenced by Sanger dideoxy technology and assembled into 4,528 scaffolds, comprising 2,810 million bases (Mb of contiguous sequence with approximately 7.5-fold coverage for any given region. We developed a modified version of the Celera assembler to facilitate the identification and comparison of alternate alleles within this individual diploid genome. Comparison of this genome and the National Center for Biotechnology Information human reference assembly revealed more than 4.1 million DNA variants, encompassing 12.3 Mb. These variants (of which 1,288,319 were novel included 3,213,401 single nucleotide polymorphisms (SNPs, 53,823 block substitutions (2-206 bp, 292,102 heterozygous insertion/deletion events (indels(1-571 bp, 559,473 homozygous indels (1-82,711 bp, 90 inversions, as well as numerous segmental duplications and copy number variation regions. Non-SNP DNA variation accounts for 22% of all events identified in the donor, however they involve 74% of all variant bases. This suggests an important role for non-SNP genetic alterations in defining the diploid genome structure. Moreover, 44% of genes were heterozygous for one or more variants. Using a novel haplotype assembly strategy, we were able to span 1.5 Gb of genome sequence in segments >200 kb, providing further precision to the diploid nature of the genome. These data depict a definitive molecular portrait of a diploid human genome that provides a starting point for future genome comparisons and enables an era of individualized genomic information.

  11. Structure and Sequence Analyses of Clustered Protocadherins Reveal Antiparallel Interactions that Mediate Homophilic Specificity.

    Science.gov (United States)

    Nicoludis, John M; Lau, Sze-Yi; Schärfe, Charlotta P I; Marks, Debora S; Weihofen, Wilhelm A; Gaudet, Rachelle

    2015-11-03

    Clustered protocadherin (Pcdh) proteins mediate dendritic self-avoidance in neurons via specific homophilic interactions in their extracellular cadherin (EC) domains. We determined crystal structures of EC1-EC3, containing the homophilic specificity-determining region, of two mouse clustered Pcdh isoforms (PcdhγA1 and PcdhγC3) to investigate the nature of the homophilic interaction. Within the crystal lattices, we observe antiparallel interfaces consistent with a role in trans cell-cell contact. Antiparallel dimerization is supported by evolutionary correlations. Two interfaces, located primarily on EC2-EC3, involve distinctive clustered Pcdh structure and sequence motifs, lack predicted glycosylation sites, and contain residues highly conserved in orthologs but not paralogs, pointing toward their biological significance as homophilic interaction interfaces. These two interfaces are similar yet distinct, reflecting a possible difference in interaction architecture between clustered Pcdh subfamilies. These structures initiate a molecular understanding of clustered Pcdh assemblies that are required to produce functional neuronal networks. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Opsin cDNA sequences of a UV and green rhodopsin of the satyrine butterfly Bicyclus anynana.

    Science.gov (United States)

    Vanhoutte, K J A; Eggen, B J L; Janssen, J J M; Stavenga, D G

    2002-11-01

    The cDNAs of an ultraviolet (UV) and long-wavelength (LW) (green) absorbing rhodopsin of the bush brown Bicyclus anynana were partially identified. The UV sequence, encoding 377 amino acids, is 76-79% identical to the UV sequences of the papilionids Papilio glaucus and Papilio xuthus and the moth Manduca sexta. A dendrogram derived from aligning the amino acid sequences reveals an equidistant position of Bicyclus between Papilio and Manduca. The sequence of the green opsin cDNA fragment, which encodes 242 amino acids, represents six of the seven transmembrane regions. At the amino acid level, this fragment is more than 80% identical to the corresponding LW opsin sequences of Dryas, Heliconius, Papilio (rhodopsin 2) and Manduca. Whereas three LW absorbing rhodopsins were identified in the papilionid butterflies, only one green opsin was found in B. anynana.

  13. Genomic sequencing of Pleistocene cave bears

    Energy Technology Data Exchange (ETDEWEB)

    Noonan, James P.; Hofreiter, Michael; Smith, Doug; Priest, JamesR.; Rohland, Nadin; Rabeder, Gernot; Krause, Johannes; Detter, J. Chris; Paabo, Svante; Rubin, Edward M.

    2005-04-01

    Despite the information content of genomic DNA, ancient DNA studies to date have largely been limited to amplification of mitochondrial DNA due to technical hurdles such as contamination and degradation of ancient DNAs. In this study, we describe two metagenomic libraries constructed using unamplified DNA extracted from the bones of two 40,000-year-old extinct cave bears. Analysis of {approx}1 Mb of sequence from each library showed that, despite significant microbial contamination, 5.8 percent and 1.1 percent of clones in the libraries contain cave bear inserts, yielding 26,861 bp of cave bear genome sequence. Alignment of this sequence to the dog genome, the closest sequenced genome to cave bear in terms of evolutionary distance, revealed roughly the expected ratio of cave bear exons, repeats and conserved noncoding sequences. Only 0.04 percent of all clones sequenced were derived from contamination with modern human DNA. Comparison of cave bear with orthologous sequences from several modern bear species revealed the evolutionary relationship of these lineages. Using the metagenomic approach described here, we have recovered substantial quantities of mammalian genomic sequence more than twice as old as any previously reported, establishing the feasibility of ancient DNA genomic sequencing programs.

  14. Working memory for sequences of temporal durations reveals a volatile single-item store

    Directory of Open Access Journals (Sweden)

    Sanjay G Manohar

    2016-10-01

    Full Text Available When a sequence is held in working memory, different items are retained with differing fidelity. Here we ask whether a sequence of brief time intervals that must be remembered show recency effects, similar to those observed in verbal and visuospatial working memory. It has been suggested that prioritising some items over others can be accounted for by a focus of attention, maintaining some items in a privileged state. We therefore also investigated whether such benefits are vulnerable to disruption by attention or expectation. Participants listened to sequences of one to five tones, of varying durations (200ms to 2s. Subsequently, the length of one of the tones in the sequence had to be reproduced by holding a key. The discrepancy between the reproduced and actual durations quantified the fidelity of memory for auditory durations. Recall precision decreased with the number of items that had to be remembered, and was better for the first and last items of sequences, in line with set-size and serial position effects seen in other modalities. To test whether attentional filtering demands might impair performance, an irrelevant variation in pitch was introduced in some blocks of trials. In those blocks, memory precision was worse for sequences that consisted of only one item, i.e. the smallest memory set size. Thus, when irrelevant information was present, the benefit of having only one item in memory is attenuated. Finally we examined whether expectation could interfere with memory. On half the trials, the number of items in the upcoming sequence was cued. When the number of items was known in advance, performance was paradoxically worse when the sequence consisted of only one item. Thus the benefit of having only one item to remember is stronger when it is unexpectedly the only item. Our results suggest that similar mechanisms are used to hold auditory time durations in working memory, as for visual or verbal stimuli. Further, solitary items were

  15. Symbolic joint entropy reveals the coupling of various brain regions

    Science.gov (United States)

    Ma, Xiaofei; Huang, Xiaolin; Du, Sidan; Liu, Hongxing; Ning, Xinbao

    2018-01-01

    The convergence and divergence of oscillatory behavior of different brain regions are very important for the procedure of information processing. Measurements of coupling or correlation are very useful to study the difference of brain activities. In this study, EEG signals were collected from ten subjects under two conditions, i.e. eyes closed state and idle with eyes open. We propose a nonlinear algorithm, symbolic joint entropy, to compare the coupling strength among the frontal, temporal, parietal and occipital lobes and between two different states. Instead of decomposing the EEG into different frequency bands (theta, alpha, beta, gamma etc.), the novel algorithm is to investigate the coupling from the entire spectrum of brain wave activities above 4Hz. The coupling coefficients in two states with different time delay steps are compared and the group statistics are presented as well. We find that the coupling coefficient of eyes open state with delay consistently lower than that of eyes close state across the group except for one subject, whereas the results without delay are not consistent. The differences between two brain states with non-zero delay can reveal the intrinsic inter-region coupling better. We also use the well-known Hénon map data to validate the algorithm proposed in this paper. The result shows that the method is robust and has a great potential for other physiologic time series.

  16. Comparative analysis of pepper and tomato reveals euchromatin expansion of pepper genome caused by differential accumulation of Ty3/Gypsy-like elements

    Directory of Open Access Journals (Sweden)

    Ahn Jong Hwa

    2011-01-01

    Full Text Available Abstract Background Among the Solanaceae plants, the pepper genome is three times larger than that of tomato. Although the gene repertoire and gene order of both species are well conserved, the cause of the genome-size difference is not known. To determine the causes for the expansion of pepper euchromatic regions, we compared the pepper genome to that of tomato. Results For sequence-level analysis, we generated 35.6 Mb of pepper genomic sequences from euchromatin enriched 1,245 pepper BAC clones. The comparative analysis of orthologous gene-rich regions between both species revealed insertion of transposons exclusively in the pepper sequences, maintaining the gene order and content. The most common type of the transposon found was the LTR retrotransposon. Phylogenetic comparison of the LTR retrotransposons revealed that two groups of Ty3/Gypsy-like elements (Tat and Athila were overly accumulated in the pepper genome. The FISH analysis of the pepper Tat elements showed a random distribution in heterochromatic and euchromatic regions, whereas the tomato Tat elements showed heterochromatin-preferential accumulation. Conclusions Compared to tomato pepper euchromatin doubled its size by differential accumulation of a specific group of Ty3/Gypsy-like elements. Our results could provide an insight on the mechanism of genome evolution in the Solanaceae family.

  17. A complex array of Hpr consensus DNA recognition sequences proximal to the enterotoxin gene in Clostridium perfringens type A.

    Science.gov (United States)

    Brynestad, S; Iwanejko, L A; Stewart, G S; Granum, P E

    1994-01-01

    Enterotoxin production in Clostridium perfringens is both strain dependent and sporulation associated. Underlying these phenotypic observations must lie a genetic and molecular explanation and the principal keys will be held within the DNA sequence both upstream and downstream of the structural gene cpe. In accordance with the above we have sequenced 4.1 kbp of DNA upstream of cpe in the type strain NCTC 8239. A region of DNA extending up to 1.5 kb 5' to cpe is conserved in all enterotoxin-positive strains. This region contains a putative ORF with substantial homology to an ORF in the Salmonella typhimurium IS200 insertion element and, in addition, contains multiple perfect consensus DNA-binding sequences for the Bacillus subtilis transition state regulator Hpr. The detailed structural elements revealed by the sequence analysis are presented and used to develop a new perspective on the molecular basis of enterotoxin production in this important food-poisoning bacterium.

  18. 18S rDNA Sequences from Microeukaryotes Reveal Oil Indicators in Mangrove Sediment

    Science.gov (United States)

    Santos, Henrique F.; Cury, Juliano C.; Carmo, Flavia L.; Rosado, Alexandre S.; Peixoto, Raquel S.

    2010-01-01

    Background Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. Methodology/Principal Findings We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. Conclusions/Significance We believe that

  19. Inconsistencies of genome annotations in apicomplexan parasites revealed by 5'-end-one-pass and full-length sequences of oligo-capped cDNAs

    Directory of Open Access Journals (Sweden)

    Sugano Sumio

    2009-07-01

    Full Text Available Abstract Background Apicomplexan parasites are causative agents of various diseases including malaria and have been targets of extensive genomic sequencing. We generated 5'-EST collections for six apicomplexa parasites using our full-length oligo-capping cDNA library method. To improve upon the current genome annotations, as well as to validate the importance for physical cDNA clone resources, we generated a large-scale collection of full-length cDNAs for several apicomplexa parasites. Results In this study, we used a total of 61,056 5'-end-single-pass cDNA sequences from Plasmodium falciparum, P. vivax, P. yoelii, P. berghei, Cryptosporidium parvum, and Toxoplasma gondii. We compared these partially sequenced cDNA sequences with the currently annotated gene models and observed significant inconsistencies between the two datasets. In particular, we found that on average 14% of the exons in the current gene models were not supported by any cDNA evidence, and that 16% of the current gene models may contain at least one mis-annotation and should be re-evaluated. We also identified a large number of transcripts that had been previously unidentified. For 732 cDNAs in T. gondii, the entire sequences were determined in order to evaluate the annotated gene models at the complete full-length transcript level. We found that 41% of the T. gondii gene models contained at least one inconsistency. We also identified and confirmed by RT-PCR 140 previously unidentified transcripts found in the intergenic regions of the current gene annotations. We show that the majority of these discrepancies are due to questionable predictions of one or two extra exons in the upstream or downstream regions of the genes. Conclusion Our data indicates that the current gene models are likely to still be incomplete and have much room for improvement. Our unique full-length cDNA information is especially useful for further refinement of the annotations for the genomes of

  20. Complete Chloroplast Genome Sequences and Comparative Analysis of Chenopodium quinoa and C. album.

    Science.gov (United States)

    Hong, Su-Young; Cheon, Kyeong-Sik; Yoo, Ki-Oug; Lee, Hyun-Oh; Cho, Kwang-Soo; Suh, Jong-Taek; Kim, Su-Jeong; Nam, Jeong-Hwan; Sohn, Hwang-Bae; Kim, Yul-Ho

    2017-01-01

    The Chenopodium genus comprises ~150 species, including Chenopodium quinoa and Chenopodium album , two important crops with high nutritional value. To elucidate the phylogenetic relationship between the two species, the complete chloroplast (cp) genomes of these species were obtained by next generation sequencing. We performed comparative analysis of the sequences and, using InDel markers, inferred phylogeny and genetic diversity of the Chenopodium genus. The cp genome is 152,099 bp ( C. quinoa ) and 152,167 bp ( C. album ) long. In total, 119 genes (78 protein-coding, 37 tRNA, and 4 rRNA) were identified. We found 14 ( C. quinoa ) and 15 ( C. album ) tandem repeats (TRs); 14 TRs were present in both species and C. album and C. quinoa each had one species-specific TR. The trnI-GAU intron sequences contained one ( C. quinoa ) or two ( C. album ) copies of TRs (66 bp); the InDel marker was designed based on the copy number variation in TRs. Using the InDel markers, we detected this variation in the TR copy number in four species, Chenopodium hybridum, Chenopodium pumilio, Chenopodium ficifolium , and Chenopodium koraiense , but not in Chenopodium glaucum . A comparison of coding and non-coding regions between C. quinoa and C. album revealed divergent sites. Nucleotide diversity >0.025 was found in 17 regions-14 were located in the large single copy region (LSC), one in the inverted repeats, and two in the small single copy region (SSC). A phylogenetic analysis based on 59 protein-coding genes from 25 taxa resolved Chenopodioideae monophyletic and sister to Betoideae. The complete plastid genome sequences and molecular markers based on divergence hotspot regions in the two Chenopodium taxa will help to resolve the phylogenetic relationships of Chenopodium .

  1. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  2. Deep Sequencing of Myxilla (Ectyomyxilla) methanophila, an Epibiotic Sponge on Cold-Seep Tubeworms, Reveals Methylotrophic, Thiotrophic, and Putative Hydrocarbon-Degrading Microbial Associations

    KAUST Repository

    Arellano, Shawn M.

    2012-10-11

    The encrusting sponge Myxilla (Ectyomyxilla) methanophila (Poecilosclerida: Myxillidae) is an epibiont on vestimentiferan tubeworms at hydrocarbon seeps on the upper Louisiana slope of the Gulf of Mexico. It has long been suggested that this sponge harbors methylotrophic bacteria due to its low δ13C value and high methanol dehydrogenase activity, yet the full community of microbial associations in M. methanophila remained uncharacterized. In this study, we sequenced 16S rRNA genes representing the microbial community in M. methanophila collected from two hydrocarbon-seep sites (GC234 and Bush Hill) using both Sanger sequencing and next-generation 454 pyrosequencing technologies. Additionally, we compared the microbial community in M. methanophila to that of the biofilm collected from the associated tubeworm. Our results revealed that the microbial diversity in the sponges from both sites was low but the community structure was largely similar, showing a high proportion of methylotrophic bacteria of the genus Methylohalomonas and polycyclic aromatic hydrocarbon (PAH)-degrading bacteria of the genera Cycloclasticus and Neptunomonas. Furthermore, the sponge microbial clone library revealed the dominance of thioautotrophic gammaproteobacterial symbionts in M. methanophila. In contrast, the biofilm communities on the tubeworms were more diverse and dominated by the chemoorganotrophic Moritella at GC234 and methylotrophic Methylomonas and Methylohalomonas at Bush Hill. Overall, our study provides evidence to support previous suggestion that M. methanophila harbors methylotrophic symbionts and also reveals the association of PAH-degrading and thioautotrophic microbes in the sponge. © 2012 Springer Science+Business Media New York.

  3. Deep sequencing of Myxilla (Ectyomyxilla) methanophila, an epibiotic sponge on cold-seep tubeworms, reveals methylotrophic, thiotrophic, and putative hydrocarbon-degrading microbial associations.

    Science.gov (United States)

    Arellano, Shawn M; Lee, On On; Lafi, Feras F; Yang, Jiangke; Wang, Yong; Young, Craig M; Qian, Pei-Yuan

    2013-02-01

    The encrusting sponge Myxilla (Ectyomyxilla) methanophila (Poecilosclerida: Myxillidae) is an epibiont on vestimentiferan tubeworms at hydrocarbon seeps on the upper Louisiana slope of the Gulf of Mexico. It has long been suggested that this sponge harbors methylotrophic bacteria due to its low δ(13)C value and high methanol dehydrogenase activity, yet the full community of microbial associations in M. methanophila remained uncharacterized. In this study, we sequenced 16S rRNA genes representing the microbial community in M. methanophila collected from two hydrocarbon-seep sites (GC234 and Bush Hill) using both Sanger sequencing and next-generation 454 pyrosequencing technologies. Additionally, we compared the microbial community in M. methanophila to that of the biofilm collected from the associated tubeworm. Our results revealed that the microbial diversity in the sponges from both sites was low but the community structure was largely similar, showing a high proportion of methylotrophic bacteria of the genus Methylohalomonas and polycyclic aromatic hydrocarbon (PAH)-degrading bacteria of the genera Cycloclasticus and Neptunomonas. Furthermore, the sponge microbial clone library revealed the dominance of thioautotrophic gammaproteobacterial symbionts in M. methanophila. In contrast, the biofilm communities on the tubeworms were more diverse and dominated by the chemoorganotrophic Moritella at GC234 and methylotrophic Methylomonas and Methylohalomonas at Bush Hill. Overall, our study provides evidence to support previous suggestion that M. methanophila harbors methylotrophic symbionts and also reveals the association of PAH-degrading and thioautotrophic microbes in the sponge.

  4. Genetic basis of olfactory cognition: extremely high level of DNA sequence polymorphism in promoter regions of the human olfactory receptor genes revealed using the 1000 Genomes Project dataset

    Directory of Open Access Journals (Sweden)

    Elena V. Ignatieva

    2014-03-01

    Full Text Available The molecular mechanism of olfactory cognition is very complicated. Olfactory cognition is initiated by olfactory receptor proteins (odorant receptors, which are activated by olfactory stimuli (ligands. Olfactory receptors are the initial player in the signal transduction cascade producing a nerve impulse, which is transmitted to the brain. The sensitivity to a particular ligand depends on the expression level of multiple proteins involved in the process of olfactory cognition: olfactory receptor proteins, proteins that participate in signal transduction cascade, etc. The expression level of each gene is controlled by its regulatory regions, and especially, by the promoter (a region of DNA about 100–1000 base pairs long located upstream of the transcription start site. We analyzed single nucleotide polymorphisms using human whole-genome data from the 1000 Genomes Project and revealed an extremely high level of single nucleotide polymorphisms in promoter regions of olfactory receptor genes and HLA genes. We hypothesized that the high level of polymorphisms in olfactory receptor promoters was responsible for the diversity in regulatory mechanisms controlling the expression levels of olfactory receptor proteins. Such diversity of regulatory mechanisms may cause the great variability of olfactory cognition of numerous environmental olfactory stimuli perceived by human beings (air pollutants, human body odors, odors in culinary etc.. In turn, this variability may provide a wide range of emotional and behavioral reactions related to the vast variety of olfactory stimuli.

  5. Intercellular signalling in Vibrio harveyi: sequence and function of genes regulating expression of luminescence.

    Science.gov (United States)

    Bassler, B L; Wright, M; Showalter, R E; Silverman, M R

    1993-08-01

    Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of an extracellular signal molecule (autoinducer) in the culture medium. A recombinant clone that restored function to one class of spontaneous dim mutants was found to encode functions necessary for the synthesis of, and response to, a signal molecule. Sequence analysis of the region encoding these functions revealed three open reading frames, two (luxL and luxM) that are required for production of an autoinducer substance and a third (luxN) that is required for response to this signal substance. The LuxL and LuxM proteins are not similar in amino acid sequence to other proteins in the database, but the LuxN protein contains regions of sequence resembling both the histidine protein kinase and the response regulator domains of the family of two-component, signal transduction proteins. The phenotypes of mutants with luxL, luxM and luxN defects indicated that an additional signal-response system controlling density-dependent expression of luminescence remains to be identified.

  6. Minding the gap: Frequency of indels in mtDNA control region sequence data and influence on population genetic analyses

    Science.gov (United States)

    Pearce, J.M.

    2006-01-01

    Insertions and deletions (indels) result in sequences of various lengths when homologous gene regions are compared among individuals or species. Although indels are typically phylogenetically informative, occurrence and incorporation of these characters as gaps in intraspecific population genetic data sets are rarely discussed. Moreover, the impact of gaps on estimates of fixation indices, such as FST, has not been reviewed. Here, I summarize the occurrence and population genetic signal of indels among 60 published studies that involved alignments of multiple sequences from the mitochondrial DNA (mtDNA) control region of vertebrate taxa. Among 30 studies observing indels, an average of 12% of both variable and parsimony-informative sites were composed of these sites. There was no consistent trend between levels of population differentiation and the number of gap characters in a data block. Across all studies, the average influence on estimates of ??ST was small, explaining only an additional 1.8% of among population variance (range 0.0-8.0%). Studies most likely to observe an increase in ??ST with the inclusion of gap characters were those with control region DNA appears small, dependent upon total number of variable sites in the data block, and related to species-specific characteristics and the spatial distribution of mtDNA lineages that contain indels. ?? 2006 Blackwell Publishing Ltd.

  7. Detection and molecular characterization of Babesia, Theileria, and Hepatozoon species in hard ticks collected from Kagoshima, the southern region in Japan.

    Science.gov (United States)

    Masatani, Tatsunori; Hayashi, Kei; Andoh, Masako; Tateno, Morihiro; Endo, Yasuyuki; Asada, Masahito; Kusakisako, Kodai; Tanaka, Tetsuya; Gokuden, Mutsuyo; Hozumi, Nodoka; Nakadohzono, Fumiko; Matsuo, Tomohide

    2017-06-01

    To reveal the distribution of tick-borne parasites, we established a novel nested polymerase chain reaction (PCR) system to detect the most common agents of tick-borne parasitic diseases, namely Babesia, Theileria, and Hepatozoon parasites. We collected host-seeking or animal-feeding ticks in Kagoshima Prefecture, the southernmost region of Kyusyu Island in southwestern Japan. Twenty of the total of 776 tick samples displayed a specific band of the appropriate size (approximately 1.4-1.6kbp) for the 18S rRNA genes in the novel nested PCR (20/776: 2.58%). These PCR products have individual sequences of Babesia spp. (from 8 ticks), Theileria spp. (from 9 ticks: one tick sample including at least two Theileria spp. sequences), and Hepatozoon spp. (from 3 ticks). Phylogenetic analyses revealed that these sequences were close to those of undescribed Babesia spp. detected in feral raccoons in Japan (5 sequences; 3 sequences being identical), Babesia gibsoni-like parasites detected in pigs in China (3 sequences; all sequences being identical), Theileria spp. detected in sika deer in Japan and China (10 sequences; 2 sequences being identical), Hepatozoon canis (one sequence), and Hepatozoon spp. detected in Japanese martens in Japan (two sequences). In summary, we showed that various tick-borne parasites exist in Kagoshima, the southern region in Japan by using the novel nested PCR system. These including undescribed species such as Babesia gibsoni-like parasites previously detected in pigs in China. Importantly, our results revealed new combinations of ticks and protozoan parasites in southern Japan. The results of this study will aid in the recognition of potential parasitic animal diseases caused by tick-borne parasites. Copyright © 2017 Elsevier GmbH. All rights reserved.

  8. Short Interspersed Nuclear Element (SINE Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293.

    Directory of Open Access Journals (Sweden)

    Lakkhana Kanhayuwa

    Full Text Available Novel families of short interspersed nuclear element (SINE sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.

  9. [Using exon combined target region capture sequencing chip to detect the disease-causing genes of retinitis pigmentosa].

    Science.gov (United States)

    Rong, Weining; Chen, Xuejuan; Li, Huiping; Liu, Yani; Sheng, Xunlun

    2014-06-01

    To detect the disease-causing genes of 10 retinitis pigmentosa pedigrees by using exon combined target region capture sequencing chip. Pedigree investigation study. From October 2010 to December 2013, 10 RP pedigrees were recruited for this study in Ningxia Eye Hospital. All the patients and family members received complete ophthalmic examinations. DNA was abstracted from patients, family members and controls. Using exon combined target region capture sequencing chip to screen the candidate disease-causing mutations. Polymerase chain reaction (PCR) and direct sequencing were used to confirm the disease-causing mutations. Seventy patients and 23 normal family members were recruited from 10 pedigrees. Among 10 RP pedigrees, 1 was autosomal dominant pedigrees and 9 were autosomal recessive pedigrees. 7 mutations related to 5 genes of 5 pedigrees were detected. A frameshift mutation on BBS7 gene was detected in No.2 pedigree, the patients of this pedigree combined with central obesity, polydactyly and mental handicap. No.2 pedigree was diagnosed as Bardet-Biedl syndrome finally. A missense mutation was detected in No.7 and No.10 pedigrees respectively. Because the patients suffered deafness meanwhile, the final diagnosis was Usher syndrome. A missense mutation on C3 gene related to age-related macular degeneration was also detected in No. 7 pedigrees. A nonsense mutation and a missense mutation on CRB1 gene were detected in No. 1 pedigree and a splicesite mutation on PROM1 gene was detected in No. 5 pedigree. Retinitis pigmentosa is a kind of genetic eye disease with diversity clinical phenotypes. Rapid and effective genetic diagnosis technology combined with clinical characteristics analysis is helpful to improve the level of clinical diagnosis of RP.

  10. Genome Microscale Heterogeneity among Wild Potatoes Revealed by Diversity Arrays Technology Marker Sequences

    Directory of Open Access Journals (Sweden)

    Alessandra Traini

    2013-01-01

    Full Text Available Tuber-bearing potato species possess several genes that can be exploited to improve the genetic background of the cultivated potato Solanum tuberosum. Among them, S. bulbocastanum and S. commersonii are well known for their strong resistance to environmental stresses. However, scant information is available for these species in terms of genome organization, gene function, and regulatory networks. Consequently, genomic tools to assist breeding are meager, and efficient exploitation of these species has been limited so far. In this paper, we employed the reference genome sequences from cultivated potato and tomato and a collection of sequences of 1,423 potato Diversity Arrays Technology (DArT markers that show polymorphic representation across the genomes of S. bulbocastanum and/or S. commersonii genotypes. Our results highlighted microscale genome sequence heterogeneity that may play a significant role in functional and structural divergence between related species. Our analytical approach provides knowledge of genome structural and sequence variability that could not be detected by transcriptome and proteome approaches.

  11. Genome Microscale Heterogeneity among Wild Potatoes Revealed by Diversity Arrays Technology Marker Sequences.

    Science.gov (United States)

    Traini, Alessandra; Iorizzo, Massimo; Mann, Harpartap; Bradeen, James M; Carputo, Domenico; Frusciante, Luigi; Chiusano, Maria Luisa

    2013-01-01

    Tuber-bearing potato species possess several genes that can be exploited to improve the genetic background of the cultivated potato Solanum tuberosum. Among them, S. bulbocastanum and S. commersonii are well known for their strong resistance to environmental stresses. However, scant information is available for these species in terms of genome organization, gene function, and regulatory networks. Consequently, genomic tools to assist breeding are meager, and efficient exploitation of these species has been limited so far. In this paper, we employed the reference genome sequences from cultivated potato and tomato and a collection of sequences of 1,423 potato Diversity Arrays Technology (DArT) markers that show polymorphic representation across the genomes of S. bulbocastanum and/or S. commersonii genotypes. Our results highlighted microscale genome sequence heterogeneity that may play a significant role in functional and structural divergence between related species. Our analytical approach provides knowledge of genome structural and sequence variability that could not be detected by transcriptome and proteome approaches.

  12. Genome sequencing of the lizard parasite Leishmania tarentolae reveals loss of genes associated to the intracellular stage of human pathogenic species

    Science.gov (United States)

    Raymond, Frédéric; Boisvert, Sébastien; Roy, Gaétan; Ritt, Jean-François; Légaré, Danielle; Isnard, Amandine; Stanke, Mario; Olivier, Martin; Tremblay, Michel J.; Papadopoulou, Barbara; Ouellette, Marc; Corbeil, Jacques

    2012-01-01

    The Leishmania tarentolae Parrot-TarII strain genome sequence was resolved to an average 16-fold mean coverage by next-generation DNA sequencing technologies. This is the first non-pathogenic to humans kinetoplastid protozoan genome to be described thus providing an opportunity for comparison with the completed genomes of pathogenic Leishmania species. A high synteny was observed between all sequenced Leishmania species. A limited number of chromosomal regions diverged between L. tarentolae and L. infantum, while remaining syntenic to L. major. Globally, >90% of the L. tarentolae gene content was shared with the other Leishmania species. We identified 95 predicted coding sequences unique to L. tarentolae and 250 genes that were absent from L. tarentolae. Interestingly, many of the latter genes were expressed in the intracellular amastigote stage of pathogenic species. In addition, genes coding for products involved in antioxidant defence or participating in vesicular-mediated protein transport were underrepresented in L. tarentolae. In contrast to other Leishmania genomes, two gene families were expanded in L. tarentolae, namely the zinc metallo-peptidase surface glycoprotein GP63 and the promastigote surface antigen PSA31C. Overall, L. tarentolae's gene content appears better adapted to the promastigote insect stage rather than the amastigote mammalian stage. PMID:21998295

  13. An AU-rich element in the 3{prime} untranslated region of the spinach chloroplast petD gene participates in sequence-specific RNA-protein complex formation

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Qiuyun; Adams, C.C.; Usack, L. [Cornell Univ., Ithaca, NY (United States)] [and others

    1995-04-01

    In chloroplasts, the 3{prime} untranslated regions of most mRNAs contain a stem-loop-forming inverted repeat (IR) sequence that is required for mRNA stability and correct 3{prime}-end formation. The IR regions of several mRNAs are also known to bind chloroplast proteins, as judged from in vitro gel mobility shift and UV cross-linking assays, and these RNA-protein interactions may be involved in the regulation of chloroplast mRNA processing and/or stability. Here we describe in detail the RNA and protein components that are involved in 3{prime} IR-containing RNA (3{prime} IR-RNA)-protein complex formation for the spinach chloroplast petD gene, which encodes subunit IV of the cytochrome b{sub 6}/f complex. We show that the complex contains 55-, 41-, and 29-kDa RNA-binding proteins (ribonucleoproteins [RNPs]). These proteins together protect a 90-nucleotide segment of RNA from RNase T{sub 1} digestion; this RNA contains the IR and downstream flanking sequences. Competition experiments using 3{prime} IR-RNAs from the psbA or rbcL gene demonstrate that the RNPs have a strong specificity for the petD sequence. Site-directed mutagenesis was carried out to define the RNA sequence elements required for complex formation. These studies identified an 8-nucleotide AU-rich sequence downstream of the IR; mutations within this sequence had moderate to severe effects on RNA-protein complex formation. Although other similar sequences are present in the petD 3{prime} untranslated region, only a single copy, which we have termed box II, appears to be essential for in vivo protein binding. In addition, the IR itself is necessary for optimal complex formation. These two sequence elements together with an RNP complex may direct correct 3{prime}-end processing and/or influence the stability of petD mRNA in chloroplasts. 48 refs., 9 figs., 2 tabs.

  14. The human Ago2 MC region does not contain an eIF4E-like mRNA cap binding motif

    Directory of Open Access Journals (Sweden)

    Grishin Nick V

    2009-01-01

    Full Text Available Abstract Background Argonaute (Ago proteins interact with small regulatory RNAs to mediate gene regulatory pathways. A recent report by Kiriakidou et al. 1 describes an MC sequence region identified in Ago2 that displays similarity to the cap-binding motif in translation initiation factor 4E (eIF4E. In a cap-bound eIF4E structure, two important aromatic residues of the motif stack on either side of a 7-methylguanosine 5'-triphosphate (m7Gppp base. The corresponding Ago2 aromatic residues (F450 and F505 were hypothesized to perform the same cap-binding function. However, the detected similarity between the MC sequence and the eIF4E cap-binding motif was questionable. Results A number of sequence-based and structure-based bioinformatics methods reveal the reported similarity between the Ago2 MC sequence region and the eIF4E cap-binding motif to be spurious. Alternatively, the MC sequence region is confidently assigned to the N-terminus of the Ago piwi module, within the mid domain of experimentally determined prokaryotic Ago structures. Confident mapping of the Ago2 MC sequence region to the piwi mid domain results in a homology-based structure model that positions the identified aromatic residues over 20 Å apart, with one of the aromatic side chains (F450 contributing instead to the hydrophobic core of the domain. Conclusion Correct functional prediction based on weak sequence similarity requires substantial evolutionary and structural support. The evolutionary context of the Ago mid domain suggested by multiple sequence alignment is limited to a conserved hydrophobicity profile required for the fold and a motif following the MC region that binds guide RNA. Mapping of the MC sequence to the mid domain structure reveals Ago2 aromatics that are incompatible with eIF4E-like mRNA cap-binding, yet display some limited local structure similarities that cause the chance sequence match to eIF4E. Reviewers This article was reviewed by Arcady Mushegian

  15. Multilocus Sequence Analysis of Cercospora spp. from Different Host Plant Families

    Directory of Open Access Journals (Sweden)

    Floreta Fiska Yuliarni

    2014-06-01

    Full Text Available Identification of the genus Cercospora is still complicated due to the host preferences often being used as the main criteria to propose a new name. We determined the relationship between host plants and multilocus sequence variations (ITS rDNA including 5.8S rDNA, elongation factor 1-α, and calmodulin in Cercospora spp. to investigate the host specificity. We used 53 strains of Cercospora spp. infecting 12 plant families for phylogenetic analysis. The sequences of 23 strains of Cercospora spp. infecting the plant families of Asteraceae, Cucurbitaceae, and Solanaceae were determined in this study. The sequences of 30 strains of Cercospora spp. infecting the plant families of Fabaceae, Amaranthaceae, Apiaceae, Plumbaginaceae, Malvaceae, Cistaceae, Plantaginaceae, Lamiaceae, and Poaceae were obtained from GenBank. The molecular phylogenetic analysis revealed that the majority of Cercospora species lack host specificity, and only C. zinniicola, C. zeina, C. zeae-maydis, C. cocciniae, and C. mikaniicola were found to be host-specific. Closely related species of Cercospora could not be distinguished using molecular analyses of ITS, EF, and CAL gene regions. The topology of the phylogenetic tree based on the CAL gene showed a better topology and Cercospora species separation than the trees developed based on the ITS rDNA region or the EF gene.

  16. SBH and the integration of complementary approaches in the mapping, sequencing, and understanding of complex genomes

    Energy Technology Data Exchange (ETDEWEB)

    Drmanac, R.; Drmanac, S.; Labat, I.; Vicentic, A.; Gemmell, A.; Stavropoulos, N.; Jarvis, J.

    1992-01-01

    A variant of sequencing by hybridization (SBH) is being developed with a potential to inexpensively determine up to 100 million base pairs per year. The method comprises (1) arraying short clones in 864-well plates; (2) growth of the M13 clones or PCR of the inserts; (3) automated spotting of DNAs by corresponding pin-arrays; (4) hybridization of dotted samples with 200-3000 [sup 32]P- or [sup 33]P-labeled 6- to 8-mer probes; and (5) scoring hybridization signals using storage phosphor plates. Some 200 7- to 8-mers can provide an inventory of the genes if CDNA clones are hybridized, or can define the order of 2-kb genomic clones, creating physical and structural maps with 100-bp resolution; the distribution of G+C, LINEs, SINEs, and gene families would be revealed. cDNAs that represent new genes and genomic clones in regions of interest selected by SBH can be sequenced by a gel method. Uniformly distributed clones from the previous step will be hybridized with 2000--3000 6- to 8-mers. As a result, approximately 50--60% of the genomic regions containing members of large repetitive and gene families and those families represented in GenBank would be completely sequenced. In the less redundant regions, every base pair is expected to be read with 3-4 probes, but the complete sequence can not be reconstructed. Such partial sequences allow the inference of similarity and the recognition of coding, regulatory, and repetitive sequences, as well as study of the evolutionary processes all the way up to the species delineation.

  17. SBH and the integration of complementary approaches in the mapping, sequencing, and understanding of complex genomes

    Energy Technology Data Exchange (ETDEWEB)

    Drmanac, R.; Drmanac, S.; Labat, I.; Vicentic, A.; Gemmell, A.; Stavropoulos, N.; Jarvis, J.

    1992-12-01

    A variant of sequencing by hybridization (SBH) is being developed with a potential to inexpensively determine up to 100 million base pairs per year. The method comprises (1) arraying short clones in 864-well plates; (2) growth of the M13 clones or PCR of the inserts; (3) automated spotting of DNAs by corresponding pin-arrays; (4) hybridization of dotted samples with 200-3000 {sup 32}P- or {sup 33}P-labeled 6- to 8-mer probes; and (5) scoring hybridization signals using storage phosphor plates. Some 200 7- to 8-mers can provide an inventory of the genes if CDNA clones are hybridized, or can define the order of 2-kb genomic clones, creating physical and structural maps with 100-bp resolution; the distribution of G+C, LINEs, SINEs, and gene families would be revealed. cDNAs that represent new genes and genomic clones in regions of interest selected by SBH can be sequenced by a gel method. Uniformly distributed clones from the previous step will be hybridized with 2000--3000 6- to 8-mers. As a result, approximately 50--60% of the genomic regions containing members of large repetitive and gene families and those families represented in GenBank would be completely sequenced. In the less redundant regions, every base pair is expected to be read with 3-4 probes, but the complete sequence can not be reconstructed. Such partial sequences allow the inference of similarity and the recognition of coding, regulatory, and repetitive sequences, as well as study of the evolutionary processes all the way up to the species delineation.

  18. SBH and the integration of complementary approaches in the mapping, sequencing, and understanding of complex genomes

    International Nuclear Information System (INIS)

    Drmanac, R.; Drmanac, S.; Labat, I.; Vicentic, A.; Gemmell, A.; Stavropoulos, N.; Jarvis, J.

    1992-01-01

    A variant of sequencing by hybridization (SBH) is being developed with a potential to inexpensively determine up to 100 million base pairs per year. The method comprises (1) arraying short clones in 864-well plates; (2) growth of the M13 clones or PCR of the inserts; (3) automated spotting of DNAs by corresponding pin-arrays; (4) hybridization of dotted samples with 200-3000 32 P- or 33 P-labeled 6- to 8-mer probes; and (5) scoring hybridization signals using storage phosphor plates. Some 200 7- to 8-mers can provide an inventory of the genes if CDNA clones are hybridized, or can define the order of 2-kb genomic clones, creating physical and structural maps with 100-bp resolution; the distribution of G+C, LINEs, SINEs, and gene families would be revealed. cDNAs that represent new genes and genomic clones in regions of interest selected by SBH can be sequenced by a gel method. Uniformly distributed clones from the previous step will be hybridized with 2000--3000 6- to 8-mers. As a result, approximately 50--60% of the genomic regions containing members of large repetitive and gene families and those families represented in GenBank would be completely sequenced. In the less redundant regions, every base pair is expected to be read with 3-4 probes, but the complete sequence can not be reconstructed. Such partial sequences allow the inference of similarity and the recognition of coding, regulatory, and repetitive sequences, as well as study of the evolutionary processes all the way up to the species delineation

  19. Reference voltage calculation method based on zero-sequence component optimisation for a regional compensation DVR

    Science.gov (United States)

    Jian, Le; Cao, Wang; Jintao, Yang; Yinge, Wang

    2018-04-01

    This paper describes the design of a dynamic voltage restorer (DVR) that can simultaneously protect several sensitive loads from voltage sags in a region of an MV distribution network. A novel reference voltage calculation method based on zero-sequence voltage optimisation is proposed for this DVR to optimise cost-effectiveness in compensation of voltage sags with different characteristics in an ungrounded neutral system. Based on a detailed analysis of the characteristics of voltage sags caused by different types of faults and the effect of the wiring mode of the transformer on these characteristics, the optimisation target of the reference voltage calculation is presented with several constraints. The reference voltages under all types of voltage sags are calculated by optimising the zero-sequence component, which can reduce the degree of swell in the phase-to-ground voltage after compensation to the maximum extent and can improve the symmetry degree of the output voltages of the DVR, thereby effectively increasing the compensation ability. The validity and effectiveness of the proposed method are verified by simulation and experimental results.

  20. Selection of mRNA 5'-untranslated region sequence with high translation efficiency through ribosome display

    International Nuclear Information System (INIS)

    Mie, Masayasu; Shimizu, Shun; Takahashi, Fumio; Kobatake, Eiry

    2008-01-01

    The 5'-untranslated region (5'-UTR) of mRNAs functions as a translation enhancer, promoting translation efficiency. Many in vitro translation systems exhibit a reduced efficiency in protein translation due to decreased translation initiation. The use of a 5'-UTR sequence with high translation efficiency greatly enhances protein production in these systems. In this study, we have developed an in vitro selection system that favors 5'-UTRs with high translation efficiency using a ribosome display technique. A 5'-UTR random library, comprised of 5'-UTRs tagged with a His-tag and Renilla luciferase (R-luc) fusion, were in vitro translated in rabbit reticulocytes. By limiting the translation period, only mRNAs with high translation efficiency were translated. During translation, mRNA, ribosome and translated R-luc with His-tag formed ternary complexes. They were collected with translated His-tag using Ni-particles. Extracted mRNA from ternary complex was amplified using RT-PCR and sequenced. Finally, 5'-UTR with high translation efficiency was obtained from random 5'-UTR library

  1. The strength of combined cytogenetic and mate-pair sequencing techniques illustrated by a germline chromothripsis rearrangement involving FOXP2

    DEFF Research Database (Denmark)

    Nazaryan, Lusine; Stefanou, Eunice G; Hansen, Claus

    2014-01-01

    Next-generation mate-pair sequencing (MPS) has revealed that many constitutional complex chromosomal rearrangements (CCRs) are associated with local shattering of chromosomal regions (chromothripsis). Although MPS promises to identify the molecular basis of the abnormal phenotypes associated with...... publication, 17 July 2013; doi:10.1038/ejhg.2013.147....

  2. Multilocus sequence data reveal dozens of putative cryptic species in a radiation of endemic Californian mygalomorph spiders (Araneae, Mygalomorphae, Nemesiidae).

    Science.gov (United States)

    Leavitt, Dean H; Starrett, James; Westphal, Michael F; Hedin, Marshal

    2015-10-01

    We use mitochondrial and multi-locus nuclear DNA sequence data to infer both species boundaries and species relationships within California nemesiid spiders. Higher-level phylogenetic data show that the California radiation is monophyletic and distantly related to European members of the genus Brachythele. As such, we consider all California nemesiid taxa to belong to the genus Calisoga Chamberlin, 1937. Rather than find support for one or two taxa as previously hypothesized, genetic data reveal Calisoga to be a species-rich radiation of spiders, including perhaps dozens of species. This conclusion is supported by multiple mitochondrial barcoding analyses, and also independent analyses of nuclear data that reveal general genealogical congruence. We discovered three instances of sympatry, and genetic data indicate reproductive isolation when in sympatry. An examination of female reproductive morphology does not reveal species-specific characters, and observed male morphological differences for a subset of putative species are subtle. Our coalescent species tree analysis of putative species lays the groundwork for future research on the taxonomy and biogeographic history of this remarkable endemic radiation. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

    Science.gov (United States)

    Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

    1992-12-01

    The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

  4. Full-length cDNA sequences from Rhesus monkey placenta tissue: analysis and utility for comparative mapping

    Directory of Open Access Journals (Sweden)

    Lee Sang-Rae

    2010-07-01

    Full Text Available Abstract Background Rhesus monkeys (Macaca mulatta are widely-used as experimental animals in biomedical research and are closely related to other laboratory macaques, such as cynomolgus monkeys (Macaca fascicularis, and to humans, sharing a last common ancestor from about 25 million years ago. Although rhesus monkeys have been studied extensively under field and laboratory conditions, research has been limited by the lack of genetic resources. The present study generated placenta full-length cDNA libraries, characterized the resulting expressed sequence tags, and described their utility for comparative mapping with human RefSeq mRNA transcripts. Results From rhesus monkey placenta full-length cDNA libraries, 2000 full-length cDNA sequences were determined and 1835 rhesus placenta cDNA sequences longer than 100 bp were collected. These sequences were annotated based on homology to human genes. Homology search against human RefSeq mRNAs revealed that our collection included the sequences of 1462 putative rhesus monkey genes. Moreover, we identified 207 genes containing exon alterations in the coding region and the untranslated region of rhesus monkey transcripts, despite the highly conserved structure of the coding regions. Approximately 10% (187 of all full-length cDNA sequences did not represent any public human RefSeq mRNAs. Intriguingly, two rhesus monkey specific exons derived from the transposable elements of AluYRa2 (SINE family and MER11B (LTR family were also identified. Conclusion The 1835 rhesus monkey placenta full-length cDNA sequences described here could expand genomic resources and information of rhesus monkeys. This increased genomic information will greatly contribute to the development of evolutionary biology and biomedical research.

  5. New tool to assemble repetitive regions using next-generation sequencing data

    Science.gov (United States)

    Kuśmirek, Wiktor; Nowak, Robert M.; Neumann, Łukasz

    2017-08-01

    The next generation sequencing techniques produce a large amount of sequencing data. Some part of the genome are composed of repetitive DNA sequences, which are very problematic for the existing genome assemblers. We propose a modification of the algorithm for a DNA assembly, which uses the relative frequency of reads to properly reconstruct repetitive sequences. The new approach was implemented and tested, as a demonstration of the capability of our software we present some results for model organisms. The new implementation, using a three-layer software architecture was selected, where the presentation layer, data processing layer, and data storage layer were kept separate. Source code as well as demo application with web interface and the additional data are available at project web-page: http://dnaasm.sourceforge.net.

  6. SubClonal Hierarchy Inference from Somatic Mutations: Automatic Reconstruction of Cancer Evolutionary Trees from Multi-region Next Generation Sequencing.

    Science.gov (United States)

    Niknafs, Noushin; Beleva-Guthrie, Violeta; Naiman, Daniel Q; Karchin, Rachel

    2015-10-01

    Recent improvements in next-generation sequencing of tumor samples and the ability to identify somatic mutations at low allelic fractions have opened the way for new approaches to model the evolution of individual cancers. The power and utility of these models is increased when tumor samples from multiple sites are sequenced. Temporal ordering of the samples may provide insight into the etiology of both primary and metastatic lesions and rationalizations for tumor recurrence and therapeutic failures. Additional insights may be provided by temporal ordering of evolving subclones--cellular subpopulations with unique mutational profiles. Current methods for subclone hierarchy inference tightly couple the problem of temporal ordering with that of estimating the fraction of cancer cells harboring each mutation. We present a new framework that includes a rigorous statistical hypothesis test and a collection of tools that make it possible to decouple these problems, which we believe will enable substantial progress in the field of subclone hierarchy inference. The methods presented here can be flexibly combined with methods developed by others addressing either of these problems. We provide tools to interpret hypothesis test results, which inform phylogenetic tree construction, and we introduce the first genetic algorithm designed for this purpose. The utility of our framework is systematically demonstrated in simulations. For most tested combinations of tumor purity, sequencing coverage, and tree complexity, good power (≥ 0.8) can be achieved and Type 1 error is well controlled when at least three tumor samples are available from a patient. Using data from three published multi-region tumor sequencing studies of (murine) small cell lung cancer, acute myeloid leukemia, and chronic lymphocytic leukemia, in which the authors reconstructed subclonal phylogenetic trees by manual expert curation, we show how different configurations of our tools can identify either a single

  7. SubClonal Hierarchy Inference from Somatic Mutations: Automatic Reconstruction of Cancer Evolutionary Trees from Multi-region Next Generation Sequencing.

    Directory of Open Access Journals (Sweden)

    Noushin Niknafs

    2015-10-01

    Full Text Available Recent improvements in next-generation sequencing of tumor samples and the ability to identify somatic mutations at low allelic fractions have opened the way for new approaches to model the evolution of individual cancers. The power and utility of these models is increased when tumor samples from multiple sites are sequenced. Temporal ordering of the samples may provide insight into the etiology of both primary and metastatic lesions and rationalizations for tumor recurrence and therapeutic failures. Additional insights may be provided by temporal ordering of evolving subclones--cellular subpopulations with unique mutational profiles. Current methods for subclone hierarchy inference tightly couple the problem of temporal ordering with that of estimating the fraction of cancer cells harboring each mutation. We present a new framework that includes a rigorous statistical hypothesis test and a collection of tools that make it possible to decouple these problems, which we believe will enable substantial progress in the field of subclone hierarchy inference. The methods presented here can be flexibly combined with methods developed by others addressing either of these problems. We provide tools to interpret hypothesis test results, which inform phylogenetic tree construction, and we introduce the first genetic algorithm designed for this purpose. The utility of our framework is systematically demonstrated in simulations. For most tested combinations of tumor purity, sequencing coverage, and tree complexity, good power (≥ 0.8 can be achieved and Type 1 error is well controlled when at least three tumor samples are available from a patient. Using data from three published multi-region tumor sequencing studies of (murine small cell lung cancer, acute myeloid leukemia, and chronic lymphocytic leukemia, in which the authors reconstructed subclonal phylogenetic trees by manual expert curation, we show how different configurations of our tools can

  8. Sequence polymorphism in an insect RNA virus field population: A snapshot from a single point in space and time reveals stochastic differences among and within individual hosts

    Energy Technology Data Exchange (ETDEWEB)

    Stenger, Drake C., E-mail: drake.stenger@ars.usda.gov [USDA, Agricultural Research Service, San Joaquin Valley Agricultural Sciences Center, 9611 South Riverbend Ave., Parlier, CA 93648-9757 (United States); Krugner, Rodrigo [USDA, Agricultural Research Service, San Joaquin Valley Agricultural Sciences Center, 9611 South Riverbend Ave., Parlier, CA 93648-9757 (United States); Nouri, Shahideh; Ferriol, Inmaculada; Falk, Bryce W. [Department of Plant Pathology, University of California, Davis, CA 95616 (United States); Sisterson, Mark S. [USDA, Agricultural Research Service, San Joaquin Valley Agricultural Sciences Center, 9611 South Riverbend Ave., Parlier, CA 93648-9757 (United States)

    2016-11-15

    Population structure of Homalodisca coagulata Virus-1 (HoCV-1) among and within field-collected insects sampled from a single point in space and time was examined. Polymorphism in complete consensus sequences among single-insect isolates was dominated by synonymous substitutions. The mutant spectrum of the C2 helicase region within each single-insect isolate was unique and dominated by nonsynonymous singletons. Bootstrapping was used to correct the within-isolate nonsynonymous:synonymous arithmetic ratio (N:S) for RT-PCR error, yielding an N:S value ~one log-unit greater than that of consensus sequences. Probability of all possible single-base substitutions for the C2 region predicted N:S values within 95% confidence limits of the corrected within-isolate N:S when the only constraint imposed was viral polymerase error bias for transitions over transversions. These results indicate that bottlenecks coupled with strong negative/purifying selection drive consensus sequences toward neutral sequence space, and that most polymorphism within single-insect isolates is composed of newly-minted mutations sampled prior to selection. -- Highlights: •Sampling protocol minimized differential selection/history among isolates. •Polymorphism among consensus sequences dominated by negative/purifying selection. •Within-isolate N:S ratio corrected for RT-PCR error by bootstrapping. •Within-isolate mutant spectrum dominated by new mutations yet to undergo selection.

  9. Identification of genome-wide non-canonical spliced regions and analysis of biological functions for spliced sequences using Read-Split-Fly.

    Science.gov (United States)

    Bai, Yongsheng; Kinne, Jeff; Ding, Lizhong; Rath, Ethan C; Cox, Aaron; Naidu, Siva Dharman

    2017-10-03

    It is generally thought that most canonical or non-canonical splicing events involving U2- and U12 spliceosomes occur within nuclear pre-mRNAs. However, the question of whether at least some U12-type splicing occurs in the cytoplasm is still unclear. In recent years next-generation sequencing technologies have revolutionized the field. The "Read-Split-Walk" (RSW) and "Read-Split-Run" (RSR) methods were developed to identify genome-wide non-canonical spliced regions including special events occurring in cytoplasm. As the significant amount of genome/transcriptome data such as, Encyclopedia of DNA Elements (ENCODE) project, have been generated, we have advanced a newer more memory-efficient version of the algorithm, "Read-Split-Fly" (RSF), which can detect non-canonical spliced regions with higher sensitivity and improved speed. The RSF algorithm also outputs the spliced sequences for further downstream biological function analysis. We used open access ENCODE project RNA-Seq data to search spliced intron sequences against the U12-type spliced intron sequence database to examine whether some events could occur as potential signatures of U12-type splicing. The check was performed by searching spliced sequences against 5'ss and 3'ss sequences from the well-known orthologous U12-type spliceosomal intron database U12DB. Preliminary results of searching 70 ENCODE samples indicated that the presence of 5'ss with U12-type signature is more frequent than U2-type and prevalent in non-canonical junctions reported by RSF. The selected spliced sequences have also been further studied using miRBase to elucidate their functionality. Preliminary results from 70 samples of ENCODE datasets show that several miRNAs are prevalent in studied ENCODE samples. Two of these are associated with many diseases as suggested in the literature. Specifically, hsa-miR-1273 and hsa-miR-548 are associated with many diseases and cancers. Our RSF pipeline is able to detect many possible junctions

  10. A molecular roadmap of the AGM region reveals BMPER as a novel regulator of HSC maturation

    Science.gov (United States)

    McGarvey, Alison C.; Souilhol, Céline; Rice, Ritva; Hills, David; Rice, David; Tomlinson, Simon R.

    2017-01-01

    In the developing embryo, hematopoietic stem cells (HSCs) emerge from the aorta-gonad-mesonephros (AGM) region, but the molecular regulation of this process is poorly understood. Recently, the progression from E9.5 to E10.5 and polarity along the dorso-ventral axis have been identified as clear demarcations of the supportive HSC niche. To identify novel secreted regulators of HSC maturation, we performed RNA sequencing over these spatiotemporal transitions in the AGM region and supportive OP9 cell line. Screening several proteins through an ex vivo reaggregate culture system, we identify BMPER as a novel positive regulator of HSC development. We demonstrate that BMPER is associated with BMP signaling inhibition, but is transcriptionally induced by BMP4, suggesting that BMPER contributes to the precise control of BMP activity within the AGM region, enabling the maturation of HSCs within a BMP-negative environment. These findings and the availability of our transcriptional data through an accessible interface should provide insight into the maintenance and potential derivation of HSCs in culture. PMID:29093060

  11. Deep sequencing of the Camellia sinensis transcriptome revealed candidate genes for major metabolic pathways of tea-specific compounds

    Energy Technology Data Exchange (ETDEWEB)

    Shi, CY; Yang, H; Wei, CL; Yu, O; Zhang, ZZ; Sun, J; Wan, XC

    2011-01-01

    Tea is one of the most popular non-alcoholic beverages worldwide. However, the tea plant, Camellia sinensis, is difficult to culture in vitro, to transform, and has a large genome, rendering little genomic information available. Recent advances in large-scale RNA sequencing (RNA-seq) provide a fast, cost-effective, and reliable approach to generate large expression datasets for functional genomic analysis, which is especially suitable for non-model species with un-sequenced genomes. Using high-throughput Illumina RNA-seq, the transcriptome from poly (A){sup +} RNA of C. sinensis was analyzed at an unprecedented depth (2.59 gigabase pairs). Approximate 34.5 million reads were obtained, trimmed, and assembled into 127,094 unigenes, with an average length of 355 bp and an N50 of 506 bp, which consisted of 788 contig clusters and 126,306 singletons. This number of unigenes was 10-fold higher than existing C. sinensis sequences deposited in GenBank (as of August 2010). Sequence similarity analyses against six public databases (Uniprot, NR and COGs at NCBI, Pfam, InterPro and KEGG) found 55,088 unigenes that could be annotated with gene descriptions, conserved protein domains, or gene ontology terms. Some of the unigenes were assigned to putative metabolic pathways. Targeted searches using these annotations identified the majority of genes associated with several primary metabolic pathways and natural product pathways that are important to tea quality, such as flavonoid, theanine and caffeine biosynthesis pathways. Novel candidate genes of these secondary pathways were discovered. Comparisons with four previously prepared cDNA libraries revealed that this transcriptome dataset has both a high degree of consistency with previous EST data and an approximate 20 times increase in coverage. Thirteen unigenes related to theanine and flavonoid synthesis were validated. Their expression patterns in different organs of the tea plant were analyzed by RT-PCR and quantitative real

  12. Deep sequencing of the Camellia sinensis transcriptome revealed candidate genes for major metabolic pathways of tea-specific compounds

    Directory of Open Access Journals (Sweden)

    Chen Qi

    2011-02-01

    Full Text Available Abstract Background Tea is one of the most popular non-alcoholic beverages worldwide. However, the tea plant, Camellia sinensis, is difficult to culture in vitro, to transform, and has a large genome, rendering little genomic information available. Recent advances in large-scale RNA sequencing (RNA-seq provide a fast, cost-effective, and reliable approach to generate large expression datasets for functional genomic analysis, which is especially suitable for non-model species with un-sequenced genomes. Results Using high-throughput Illumina RNA-seq, the transcriptome from poly (A+ RNA of C. sinensis was analyzed at an unprecedented depth (2.59 gigabase pairs. Approximate 34.5 million reads were obtained, trimmed, and assembled into 127,094 unigenes, with an average length of 355 bp and an N50 of 506 bp, which consisted of 788 contig clusters and 126,306 singletons. This number of unigenes was 10-fold higher than existing C. sinensis sequences deposited in GenBank (as of August 2010. Sequence similarity analyses against six public databases (Uniprot, NR and COGs at NCBI, Pfam, InterPro and KEGG found 55,088 unigenes that could be annotated with gene descriptions, conserved protein domains, or gene ontology terms. Some of the unigenes were assigned to putative metabolic pathways. Targeted searches using these annotations identified the majority of genes associated with several primary metabolic pathways and natural product pathways that are important to tea quality, such as flavonoid, theanine and caffeine biosynthesis pathways. Novel candidate genes of these secondary pathways were discovered. Comparisons with four previously prepared cDNA libraries revealed that this transcriptome dataset has both a high degree of consistency with previous EST data and an approximate 20 times increase in coverage. Thirteen unigenes related to theanine and flavonoid synthesis were validated. Their expression patterns in different organs of the tea plant were

  13. Regional geological assessment of the Devonian-Mississippian shale sequence of the Appalachian, Illinois, and Michigan basins relative to potential storage/disposal of radioactive wastes

    Energy Technology Data Exchange (ETDEWEB)

    Lomenick, T.F.; Gonzales, S.; Johnson, K.S.; Byerly, D.

    1983-01-01

    The thick and regionally extensive sequence of shales and associated clastic sedimentary rocks of Late Devonian and Early Mississippian age has been considered among the nonsalt geologies for deep subsurface containment of high-level radioactive wastes. This report examines some of the regional and basin-specific characteristics of the black and associated nonblack shales of this sequence within the Appalachian, Illinois, and Michigan basins of the north-central and eastern United States. Principal areas where the thickness and depth of this shale sequence are sufficient to warrant further evaluation are identified, but no attempt is made to identify specific storage/disposal sites. Also identified are other areas with less promise for further study because of known potential conflicts such as geologic-hydrologic factors, competing subsurface priorities involving mineral resources and groundwater, or other parameters. Data have been compiled for each basin in an effort to indicate thickness, distribution, and depth relationships for the entire shale sequence as well as individual shale units in the sequence. Included as parts of this geologic assessment are isopach, depth information, structure contour, tectonic elements, and energy-resource maps covering the three basins. Summary evaluations are given for each basin as well as an overall general evaluation of the waste storage/disposal potential of the Devonian-Mississippian shale sequence,including recommendations for future studies to more fully characterize the shale sequence for that purpose. Based on data compiled in this cursory investigation, certain rock units have reasonable promise for radioactive waste storage/disposal and do warrant additional study.

  14. Regional geological assessment of the Devonian-Mississippian shale sequence of the Appalachian, Illinois, and Michigan basins relative to potential storage/disposal of radioactive wastes

    International Nuclear Information System (INIS)

    Lomenick, T.F.; Gonzales, S.; Johnson, K.S.; Byerly, D.

    1983-01-01

    The thick and regionally extensive sequence of shales and associated clastic sedimentary rocks of Late Devonian and Early Mississippian age has been considered among the nonsalt geologies for deep subsurface containment of high-level radioactive wastes. This report examines some of the regional and basin-specific characteristics of the black and associated nonblack shales of this sequence within the Appalachian, Illinois, and Michigan basins of the north-central and eastern United States. Principal areas where the thickness and depth of this shale sequence are sufficient to warrant further evaluation are identified, but no attempt is made to identify specific storage/disposal sites. Also identified are other areas with less promise for further study because of known potential conflicts such as geologic-hydrologic factors, competing subsurface priorities involving mineral resources and groundwater, or other parameters. Data have been compiled for each basin in an effort to indicate thickness, distribution, and depth relationships for the entire shale sequence as well as individual shale units in the sequence. Included as parts of this geologic assessment are isopach, depth information, structure contour, tectonic elements, and energy-resource maps covering the three basins. Summary evaluations are given for each basin as well as an overall general evaluation of the waste storage/disposal potential of the Devonian-Mississippian shale sequence,including recommendations for future studies to more fully characterize the shale sequence for that purpose. Based on data compiled in this cursory investigation, certain rock units have reasonable promise for radioactive waste storage/disposal and do warrant additional study

  15. Complete mitochondrial genome of endangered Yellow-shouldered Amazon (Amazona barbadensis): two control region copies in parrot species of the Amazona genus.

    Science.gov (United States)

    Urantowka, Adam Dawid; Hajduk, Kacper; Kosowska, Barbara

    2013-08-01

    Amazona barbadensis is an endangered species of parrot living in northern coastal Venezuela and in several Caribbean islands. In this study, we sequenced full mitochondrial genome of the considered species. The total length of the mitogenome was 18,983 bp and contained 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes, duplicated control region, and degenerate copies of ND6 and tRNA (Glu) genes. High degree of identity between two copies of control region suggests their coincident evolution and functionality. Comparative analysis of both the control region sequences from four Amazona species revealed their 89.1% identity over a region of 1300 bp and indicates the presence of distinctive parts of two control region copies.

  16. Which MRI sequence of the spine best reveals bone-marrow metastases of neuroblastoma?

    International Nuclear Information System (INIS)

    Meyer, James S.; Jaramillo, Diego; Siegel, Marilyn J.; Farooqui, Saleem O.; Fletcher, Barry D.; Hoffer, Fredric A.

    2005-01-01

    MRI is an effective tool in evaluating bone marrow metastases. However, no study has defined which MRI sequences or image characteristics best correlate with bone-marrow metastases in neuroblastoma. To identify and refine MRI criteria and sequence selection for the diagnosis of bone-marrow metastases in children with neuroblastoma. Ninety-one children (mean age: 3.2 years; standard deviation: 2.8 years) enrolled in the RDOG IV study participated in our study. Forty-five children had bone metastases determined by bone-marrow aspiration or biopsy (n=4), radionuclide imaging (n=2), or both (n=39). Spine lesions were characterized using coronal T1-weighted (T1W) sagittal short tau inversion recovery (STIR) and coronal gadolinium-enhanced T1-weighted (GAD) MR sequences. Contingency table analysis was performed to determine which MRI sequences and characteristics were associated with metastases. The MRI criteria for metastatic disease were then developed for each imaging sequence. The sensitivity, specificity, predictive values, and accuracy of these criteria were determined for the whole group, children younger than 12 months old, and children 12 months and older. The MR characteristics that had significant (P ≤ 0.05) associations with metastases were homogeneous low T1-signal intensity, homogeneous high STIR-signal intensity, and heterogeneous pattern on T1, STIR, or GAD. Homogeneous low T1-signal had the highest sensitivity (88%), but a specificity of 62% for detecting metastases. A heterogeneous pattern on GAD was highly specific (97%), but relatively insensitive (65%) for detecting metastases. These MR characteristics were most accurate in children 12 months and older. The combination of non-contrast-enhanced T1W and GAD sequences can be used to determine the presence of spinal metastases in children with neuroblastoma, particularly those children who are 1 year and older. (orig.)

  17. Genome sequence of Thermofilum pendens reveals an exceptional loss of biosynthetic pathways without genome reduction

    Energy Technology Data Exchange (ETDEWEB)

    Kyrpides, Nikos; Anderson, Iain; Rodriguez, Jason; Susanti, Dwi; Porat, Iris; Reich, Claudia; Ulrich, Luke E.; Elkins, James G.; Mavromatis, Kostas; Lykidis, Athanasios; Kim, Edwin; Thompson, Linda S.; Nolan, Matt; Land, Miriam; Copeland, Alex; Lapidus, Alla; Lucas, Susan; Detter, Chris; Zhulin, Igor B.; Olsen, Gary J.; Whitman, William; Mukhopadhyay, Biswarup; Bristow, James; Kyrpides, Nikos

    2008-01-01

    We report the complete genome of Thermofilum pendens, a deep-branching, hyperthermophilic member of the order Thermoproteales within the archaeal kingdom Crenarchaeota. T. pendens is a sulfur-dependent, anaerobic heterotroph isolated from a solfatara in Iceland. It is an extracellular commensal, requiring an extract of Thermoproteus tenax for growth, and the genome sequence reveals that biosynthetic pathways for purines, most amino acids, and most cofactors are absent. In fact T. pendens has fewer biosynthetic enzymes than obligate intracellular parasites, although it does not display other features common among obligate parasites and thus does not appear to be in the process of becoming a parasite. It appears that T. pendens has adapted to life in an environment rich in nutrients. T. pendens was known to utilize peptides as an energy source, but the genome reveals substantial ability to grow on carbohydrates. T. pendens is the first crenarchaeote and only the second archaeon found to have a transporter of the phosphotransferase system. In addition to fermentation, T. pendens may gain energy from sulfur reduction with hydrogen and formate as electron donors. It may also be capable of sulfur-independent growth on formate with formate hydrogenlyase. Additional novel features are the presence of a monomethylamine:corrinoid methyltransferase, the first time this enzyme has been found outside of Methanosarcinales, and a presenilin-related protein. Predicted highly expressed proteins do not include housekeeping genes, and instead include ABC transporters for carbohydrates and peptides, and CRISPR-associated proteins.

  18. Draft genome sequence of bitter gourd (Momordica charantia), a vegetable and medicinal plant in tropical and subtropical regions.

    Science.gov (United States)

    Urasaki, Naoya; Takagi, Hiroki; Natsume, Satoshi; Uemura, Aiko; Taniai, Naoki; Miyagi, Norimichi; Fukushima, Mai; Suzuki, Shouta; Tarora, Kazuhiko; Tamaki, Moritoshi; Sakamoto, Moriaki; Terauchi, Ryohei; Matsumura, Hideo

    2017-02-01

    Bitter gourd (Momordica charantia) is an important vegetable and medicinal plant in tropical and subtropical regions globally. In this study, the draft genome sequence of a monoecious bitter gourd inbred line, OHB3-1, was analyzed. Through Illumina sequencing and de novo assembly, scaffolds of 285.5 Mb in length were generated, corresponding to ∼84% of the estimated genome size of bitter gourd (339 Mb). In this draft genome sequence, 45,859 protein-coding gene loci were identified, and transposable elements accounted for 15.3% of the whole genome. According to synteny mapping and phylogenetic analysis of conserved genes, bitter gourd was more related to watermelon (Citrullus lanatus) than to cucumber (Cucumis sativus) or melon (C. melo). Using RAD-seq analysis, 1507 marker loci were genotyped in an F2 progeny of two bitter gourd lines, resulting in an improved linkage map, comprising 11 linkage groups. By anchoring RAD tag markers, 255 scaffolds were assigned to the linkage map. Comparative analysis of genome sequences and predicted genes determined that putative trypsin-inhibitor and ribosome-inactivating genes were distinctive in the bitter gourd genome. These genes could characterize the bitter gourd as a medicinal plant. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  19. Origin of the CMS gene locus in rapeseed cybrid mitochondria: active and inactive recombination produces the complex CMS gene region in the mitochondrial genomes of Brassicaceae.

    Science.gov (United States)

    Oshima, Masao; Kikuchi, Rie; Imamura, Jun; Handa, Hirokazu

    2010-01-01

    CMS (cytoplasmic male sterile) rapeseed is produced by asymmetrical somatic cell fusion between the Brassica napus cv. Westar and the Raphanus sativus Kosena CMS line (Kosena radish). The CMS rapeseed contains a CMS gene, orf125, which is derived from Kosena radish. Our sequence analyses revealed that the orf125 region in CMS rapeseed originated from recombination between the orf125/orfB region and the nad1C/ccmFN1 region by way of a 63 bp repeat. A precise sequence comparison among the related sequences in CMS rapeseed, Kosena radish and normal rapeseed showed that the orf125 region in CMS rapeseed consisted of the Kosena orf125/orfB region and the rapeseed nad1C/ccmFN1 region, even though Kosena radish had both the orf125/orfB region and the nad1C/ccmFN1 region in its mitochondrial genome. We also identified three tandem repeat sequences in the regions surrounding orf125, including a 63 bp repeat, which were involved in several recombination events. Interestingly, differences in the recombination activity for each repeat sequence were observed, even though these sequences were located adjacent to each other in the mitochondrial genome. We report results indicating that recombination events within the mitochondrial genomes are regulated at the level of specific repeat sequences depending on the cellular environment.

  20. Selection, Recombination and History in a Parasitic Flatworm (Echinococcus Inferred from Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Haag KL

    1998-01-01

    Full Text Available Three species of flatworms from the genus Echinococcus (E. granulosus, E. multilocularis and E. vogeli and four strains of E. granulosus (cattle, horse, pig and sheep strains were analysed by the PCR-SSCP method followed by sequencing, using as targets two non-coding and two coding (one nuclear and one mitochondrial genomic regions. The sequencing data was used to evaluate hypothesis about the parasite breeding system and the causes of genetic diversification. The calculated recombination parameters suggested that cross-fertilisation was rare in the history of the group. However, the relative rates of substitution in the coding sequences showed that positive selection (instead of purifying selection drove the evolution of an elastase and neutrophil chemotaxis inhibitor gene (AgB/1. The phylogenetic analyses revealed several ambiguities, indicating that the taxonomic status of the E. granulosus horse strain should be revised

  1. In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

    Science.gov (United States)

    Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

    2011-01-01

    To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

  2. Mammalian prions: tolerance to sequence changes-how far?

    Science.gov (United States)

    Salamat, Muhammad Khalid; Munoz-Montesino, Carola; Moudjou, Mohammed; Rezaei, Human; Laude, Hubert; Béringue, Vincent; Dron, Michel

    2013-01-01

    Upon prion infection, abnormal prion protein (PrP (Sc) ) self-perpetuate by conformational conversion of α-helix-rich PrP (C) into β sheet enriched form, leading to formation and deposition of PrP (Sc) aggregates in affected brains. However the process remains poorly understood at the molecular level and the regions of PrP critical for conversion are still debated. Minimal amino acid substitutions can impair prion replication at many places in PrP. Conversely, we recently showed that bona fide prions could be generated after introduction of eight and up to 16 additional amino acids in the H2-H3 inter-helix loop of PrP. Prion replication also accommodated the insertions of an octapeptide at different places in the last turns of H2. This reverse genetic approach reveals an unexpected tolerance of prions to substantial sequence changes in the protease-resistant part which is associated with infectivity. It also demonstrates that conversion does not require the presence of a specific sequence in the middle of the H2-H3 area. We discuss the implications of our findings according to different structural models proposed for PrP (Sc) and questioned the postulated existence of an N- or C-terminal prion domain in the protease-resistant region.

  3. Cloning and characterization of stress responsive Glp genes and their promotor regions from rice (abstract)

    International Nuclear Information System (INIS)

    Naqvi, S.M.S.; Mahmood, T.

    2005-01-01

    Plants respond to a number of environmental stimuli by modulating expression of genes. One such family of genes is now known as germin/germin-like protein genes (Glps). In order to detect any Glp gene response in rice, a pair of degenerate primers was designed based on consensus region from Glp sequences in Genbank. Using these primers a DNA fragment of about 550 bp was obtained by PCR amplification from genomic template. This 550 bp DNA was used as probe in Northern analysis. These studies provided evidence pointing to differential response of Glp expression to salt stress. RNA obtained from the roots was used for synthesis of cDNA. This cDNA was amplifiable with sense primer (RGLP1) from above mentioned pair and oligo-(dt) yielding a fragment of approx. 800 bp. Restriction analysis revealed that the PCR product was heterogeneous. After establishing that 800 bp fragment was the desired product, it was cloned in pCRII-TOPO. Five clones were picked up and analyzed by restriction analysis and sequencing. Two different Glp cDNAs were represented by these partial clones. Remaining sequence of the 5' end for clone 4 and 16 was obtained by Rapid Amplification of cDNA ends (RACE). The resultant sequences have been submitted to Genbank as Oryza sativa Rice Germin-like Protein 1 and 2 (osRGLP1 and 2). When full length genes corresponding to these sequences were amplified from genomic templates, resulting fragments were nearly 150 by larger than cDNAs. Cloning of structural genes for osRGLP1 revealed presence of a 162 bp intron in the coding region near 3' end. Preliminary evidence shows that expression of both osRGLP1 and 2 is severely reduced during salt stress. Another approach to establish both osRGLP1 and 2 genes involvement in stress tolerance is to study the ability of their promotor regions to drive expression of some reporter gene during stress. Promotor regions of about 1100 bp has been amplified and cloned and has been confirmed by restriction analysis and nested

  4. Temporal correlation of fluvial and alluvial sequences in the Makran Range, SE-Iran

    Science.gov (United States)

    Kober, F.; Zeilinger, G.; Ivy-Ochs, S.; Dolati, A.; Smit, J.; Burg, J.-P.; Bahroudi, A.; Kubik, P. W.; Baur, H.; Wieler, R.; Haghipour, N.

    2009-04-01

    The Makran region of southeastern Iran is an active accretionary wedge with a partially subaerial component. New investigations have revealed a rather complex geodynamic evolution of the Makran active accretionary wedge that is not yet fully understood in its entity. Ongoing convergence between the Arabian and Eurasian plates and tectonic activity since the late Mesozoic has extended all trough the Quaternary. We focus here on fluvial and alluvial sequences in tectonically separated basins that have been deposited probably in the Pliocene/Quaternary, based on stratigraphic classification in official geological maps, in order to understand the climatic and tectonic forces occurring during the ongoing accretionary wegde formation. Specifically, we investigate the influence of Quaternary climate variations (Pleistocene cold period, monsoonal variations) on erosional and depositional processes in the (semi)arid Makran as well as local and regional tectonic forces in the Coastal and Central Makran Range region. Necessary for such an analysis is a temporal calibration of alluvial and fluvial terrace sequences that will allow an inter-basin correlation. We utilize the exposure age dating method using terrestrial cosmogenic nuclides (TCN) due to the lack of otherwise datatable material in the arid Makran region. Limited radiocarbon data are only available for marine terraces (wave-cut platforms). Our preliminary 21Ne and 10Be TCN-ages of amalgamated clast samples from (un)deformed terrace and alluvial sequences range from ~250 ky to present day (modern wash). These ages agree in relative terms with sequences previously assigned by other investigations through correlation of Quaternary sequences from Central and Western Iran regions. However, our minimum ages suggest that all age sequences are of middle to late Pleistocene age, compared to Pliocene age estimates previously assigned for the oldest units. Although often suggested, a genetical relation and connection of those

  5. A comparison of chloroplast genome sequences in Aconitum (Ranunculaceae: a traditional herbal medicinal genus

    Directory of Open Access Journals (Sweden)

    Hanghui Kong

    2017-11-01

    Full Text Available The herbal medicinal genus Aconitum L., belonging to the Ranunculaceae family, represents the earliest diverging lineage within the eudicots. It currently comprises of two subgenera, A. subgenus Lycoctonum and A. subg. Aconitum. The complete chloroplast (cp genome sequences were characterized in three species: A. angustius, A. finetianum, and A. sinomontanum in subg. Lycoctonum and compared to other Aconitum species to clarify their phylogenetic relationship and provide molecular information for utilization of Aconitum species particularly in Eastern Asia. The length of the chloroplast genome sequences were 156,109 bp in A. angustius, 155,625 bp in A. finetianum and 157,215 bp in A. sinomontanum, with each species possessing 126 genes with 84 protein coding genes (PCGs. While genomic rearrangements were absent, structural variation was detected in the LSC/IR/SSC boundaries. Five pseudogenes were identified, among which Ψrps19 and Ψycf1 were in the LSC/IR/SSC boundaries, Ψrps16 and ΨinfA in the LSC region, and Ψycf15 in the IRb region. The nucleotide variability (Pi of Aconitum was estimated to be 0.00549, with comparably higher variations in the LSC and SSC than the IR regions. Eight intergenic regions were revealed to be highly variable and a total of 58–62 simple sequence repeats (SSRs were detected in all three species. More than 80% of SSRs were present in the LSC region. Altogether, 64.41% and 46.81% of SSRs are mononucleotides in subg. Lycoctonum and subg. Aconitum, respectively, while a higher percentage of di-, tri-, tetra-, and penta- SSRs were present in subg. Aconitum. Most species of subg. Aconitum in Eastern Asia were first used for phylogenetic analyses. The availability of the complete cp genome sequences of these species in subg. Lycoctonum will benefit future phylogenetic analyses and aid in germplasm utilization in Aconitum species.

  6. A comparison of chloroplast genome sequences in Aconitum (Ranunculaceae): a traditional herbal medicinal genus.

    Science.gov (United States)

    Kong, Hanghui; Liu, Wanzhen; Yao, Gang; Gong, Wei

    2017-01-01

    The herbal medicinal genus Aconitum L., belonging to the Ranunculaceae family, represents the earliest diverging lineage within the eudicots. It currently comprises of two subgenera, A . subgenus Lycoctonum and A . subg. Aconitum . The complete chloroplast (cp) genome sequences were characterized in three species: A. angustius , A. finetianum , and A. sinomontanum in subg. Lycoctonum and compared to other Aconitum species to clarify their phylogenetic relationship and provide molecular information for utilization of Aconitum species particularly in Eastern Asia. The length of the chloroplast genome sequences were 156,109 bp in A. angustius , 155,625 bp in A. finetianum and 157,215 bp in A. sinomontanum , with each species possessing 126 genes with 84 protein coding genes (PCGs). While genomic rearrangements were absent, structural variation was detected in the LSC/IR/SSC boundaries. Five pseudogenes were identified, among which Ψ rps 19 and Ψ ycf 1 were in the LSC/IR/SSC boundaries, Ψ rps 16 and Ψ inf A in the LSC region, and Ψ ycf 15 in the IRb region. The nucleotide variability ( Pi ) of Aconitum was estimated to be 0.00549, with comparably higher variations in the LSC and SSC than the IR regions. Eight intergenic regions were revealed to be highly variable and a total of 58-62 simple sequence repeats (SSRs) were detected in all three species. More than 80% of SSRs were present in the LSC region. Altogether, 64.41% and 46.81% of SSRs are mononucleotides in subg. Lycoctonum and subg. Aconitum , respectively, while a higher percentage of di-, tri-, tetra-, and penta- SSRs were present in subg. Aconitum . Most species of subg. Aconitum in Eastern Asia were first used for phylogenetic analyses. The availability of the complete cp genome sequences of these species in subg. Lycoctonum will benefit future phylogenetic analyses and aid in germplasm utilization in Aconitum species.

  7. The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11

    International Nuclear Information System (INIS)

    Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre

    2003-01-01

    The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome

  8. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.

    Science.gov (United States)

    Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves

    2017-08-21

    Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. UBV(RI)sub(c) photometry of some standard sequences in the Harvard F regions and in the Magellanic Clouds

    International Nuclear Information System (INIS)

    Menzies, J.W.; Laing, J.D.

    1988-01-01

    This paper presents the results of a photometric programme aimed at improving the UBV(RI)sub(c) standard sequences in the Harvard F regions and in the Small and Large Magellanic Clouds. Magnitudes and colours are given for 99 stars, and they are compared with the current values which were obtained or compiled by a previous author. (author)

  10. GEITLERINEMA SPECIES (OSCILLATORIALES, CYANOBACTERIA) REVEALED BY CELLULAR MORPHOLOGY, ULTRASTRUCTURE, AND DNA SEQUENCING(1).

    Science.gov (United States)

    Do Carmo Bittencourt-Oliveira, Maria; Do Nascimento Moura, Ariadne; De Oliveira, Mariana Cabral; Sidnei Massola, Nelson

    2009-06-01

    Geitlerinema amphibium (C. Agardh ex Gomont) Anagn. and G. unigranulatum (Rama N. Singh) Komárek et M. T. P. Azevedo are morphologically close species with characteristics frequently overlapping. Ten strains of Geitlerinema (six of G. amphibium and four of G. unigranulatum) were analyzed by DNA sequencing and transmission electronic and optical microscopy. Among the investigated strains, the two species were not separated with respect to cellular dimensions, and cellular width was the most varying characteristic. The number and localization of granules, as well as other ultrastructural characteristics, did not provide a means to discriminate between the two species. The two species were not separated either by geography or environment. These results were further corroborated by the analysis of the cpcB-cpcA intergenic spacer (PC-IGS) sequences. Given the fact that morphology is very uniform, plus the coexistence of these populations in the same habitat, it would be nearly impossible to distinguish between them in nature. On the other hand, two of the analyzed strains were distinct from all others based on the PC-IGS sequences, in spite of their morphological similarity. PC-IGS sequences indicate that these two strains could be a different species of Geitlerinema. Using morphology, cell ultrastructure, and PC-IGS sequences, it is not possible to distinguish G. amphibium and G. unigranulatum. Therefore, they should be treated as one species, G. unigranulatum as a synonym of G. amphibium. © 2009 Phycological Society of America.

  11. Overlapping hotspots in CDRs are critical sites for V region diversification.

    Science.gov (United States)

    Wei, Lirong; Chahwan, Richard; Wang, Shanzhi; Wang, Xiaohua; Pham, Phuong T; Goodman, Myron F; Bergman, Aviv; Scharff, Matthew D; MacCarthy, Thomas

    2015-02-17

    Activation-induced deaminase (AID) mediates the somatic hypermutation (SHM) of Ig variable (V) regions that is required for the affinity maturation of the antibody response. An intensive analysis of a published database of somatic hypermutations that arose in the IGHV3-23*01 human V region expressed in vivo by human memory B cells revealed that the focus of mutations in complementary determining region (CDR)1 and CDR2 coincided with a combination of overlapping AGCT hotspots, the absence of AID cold spots, and an abundance of polymerase eta hotspots. If the overlapping hotspots in the CDR1 or CDR2 did not undergo mutation, the frequency of mutations throughout the V region was reduced. To model this result, we examined the mutation of the human IGHV3-23*01 biochemically and in the endogenous heavy chain locus of Ramos B cells. Deep sequencing revealed that IGHV3-23*01 in Ramos cells accumulates AID-induced mutations primarily in the AGCT in CDR2, which was also the most frequent site of mutation in vivo. Replacing the overlapping hotspots in CDR1 and CDR2 with neutral or cold motifs resulted in a reduction in mutations within the modified motifs and, to some degree, throughout the V region. In addition, some of the overlapping hotspots in the CDRs were at sites in which replacement mutations could change the structure of the CDR loops. Our analysis suggests that the local sequence environment of the V region, and especially of the CDR1 and CDR2, is highly evolved to recruit mutations to key residues in the CDRs of the IgV region.

  12. Comparative analysis of full genomic sequences among different genotypes of dengue virus type 3

    Directory of Open Access Journals (Sweden)

    Lin Ting-Hsiang

    2008-05-01

    Full Text Available Abstract Background Although the previous study demonstrated the envelope protein of dengue viruses is under purifying selection pressure, little is known about the genetic differences of full-length viral genomes of DENV-3. In our study, complete genomic sequencing of DENV-3 strains collected from different geographical locations and isolation years were determined and the sequence diversity as well as selection pressure sites in the DENV genome other than within the E gene were also analyzed. Results Using maximum likelihood and Bayesian approaches, our phylogenetic analysis revealed that the Taiwan's indigenous DENV-3 isolated from 1994 and 1998 dengue/DHF epidemics and one 1999 sporadic case were of the three different genotypes – I, II, and III, each associated with DENV-3 circulating in Indonesia, Thailand and Sri Lanka, respectively. Sequence diversity and selection pressure of different genomic regions among DENV-3 different genotypes was further examined to understand the global DENV-3 evolution. The highest nucleotide sequence diversity among the fully sequenced DENV-3 strains was found in the nonstructural protein 2A (mean ± SD: 5.84 ± 0.54 and envelope protein gene regions (mean ± SD: 5.04 ± 0.32. Further analysis found that positive selection pressure of DENV-3 may occur in the non-structural protein 1 gene region and the positive selection site was detected at position 178 of the NS1 gene. Conclusion Our study confirmed that the envelope protein is under purifying selection pressure although it presented higher sequence diversity. The detection of positive selection pressure in the non-structural protein along genotype II indicated that DENV-3 originated from Southeast Asia needs to monitor the emergence of DENV strains with epidemic potential for better epidemic prevention and vaccine development.

  13. Regional two-dimensional magnetotelluric profile in West Bohemia/Vogtland reveals deep conductive channel into the earthquake swarm region

    Science.gov (United States)

    Muñoz, Gerard; Weckmann, Ute; Pek, Josef; Kováčiková, Světlana; Klanica, Radek

    2018-03-01

    The West Bohemia/Vogtland region, characterized by the intersection of the Eger (Ohře) Rift and the Mariánské Lázně fault, is a geodynamically active area exhibiting repeated occurrence of earthquake swarms, massive CO2 emanations and mid Pleistocene volcanism. The Eger Rift is the only known intra-continental region in Europe where such deep seated, active lithospheric processes currently take place. We present an image of electrical resistivity obtained from two-dimensional inversion of magnetotelluric (MT) data acquired along a regional profile crossing the Eger Rift. At the near surface, the Cheb basin and the aquifer feeding the mofette fields of Bublák and Hartoušov have been imaged as part of a region of very low resistivity. The most striking resistivity feature, however, is a deep reaching conductive channel which extends from the surface into the lower crust spatially correlated with the hypocentres of the seismic events of the Nový Kostel Focal Zone. This channel has been interpreted as imaging a pathway from a possible mid-crustal fluid reservoir to the surface. The resistivity model reinforces the relation between the fluid circulation along deep-reaching faults and the generation of the earthquakes. Additionally, a further conductive channel has been revealed to the south of the profile. This other feature could be associated to fossil hydrothermal alteration related to Mýtina and/or Neualbenreuth Maar structures or alternatively could be the signature of a structure associated to the suture between the Saxo-Thuringian and Teplá-Barrandian zones, whose surface expression is located only a few kilometres away.

  14. [Analysis of COX1 sequences of Taenia isolates from four areas of Guangxi].

    Science.gov (United States)

    Yang, Yi-Chao; Ou-Yang, Yi; Su, Ai-Rong; Wan, Xiao-Ling; Li, Shu-Lin

    2012-06-01

    To analyze the COX1 sequences of Taenia isolates from four areas of Guangxi Zhuang Autonomous Region, and to understand the distribution of Taenia asiatica in Guangxi. Patients with taeniasis in Luzhai, Rongshui, Tiandong and Sanjiang in Guangxi were treated by deworming, and the Taenia isolates were collected. Cyclooxygenase-1 (COX1) sequences of these isolates were amplified by PCR, and the PCR products were sequenced by T-A clone sequencing. The homogeneities and genetic distances were calculated and analyzed, and the phylogenic trees were constructed by some softwares. Meanwhile, the COX1 sequences of the isolates from the 4 areas were compared separately with the sequences of Taenia species in GenBank. The COX1 sequence of the 5 Taenia isolates collected had the same length of 444 bp. There were 5 variable positions between the Luzhai isolate and Taenia asiatica, the homogeneity was 98.87% and their genetic distance was 0.011. The phylogenetic tree analysis revealed that the Luzhai isolate and Taenia asiatica locating at the same node had a close relationship. The homogeneity between Rongshui isolate A and Taenia solium was 100%, while the homogeneity of Rongshui isolate B with Taeniasis saginata and Taenia asiatica were 98.20% and 96.17%, respectively. The homogeneities of the Tiandong and Sanjiang isolates with Taenia solium were 99.55% and 96.40%, respectively, and the genetic distances were 0.005 and 0.037, respectively. The homogeneity between the Luzhai isolate and Taeniasis saginate was 96.40%. Taenia asiatica exists in Luzhai and Taenia solium and Taenia saginata coexist in Rongshui, Guangxi Zhuang Autonomous Region.

  15. A complete mitochondrial genome sequence of Ogura-type male-sterile cytoplasm and its comparative analysis with that of normal cytoplasm in radish (Raphanus sativus L.

    Directory of Open Access Journals (Sweden)

    Tanaka Yoshiyuki

    2012-07-01

    Full Text Available Abstract Background Plant mitochondrial genome has unique features such as large size, frequent recombination and incorporation of foreign DNA. Cytoplasmic male sterility (CMS is caused by rearrangement of the mitochondrial genome, and a novel chimeric open reading frame (ORF created by shuffling of endogenous sequences is often responsible for CMS. The Ogura-type male-sterile cytoplasm is one of the most extensively studied cytoplasms in Brassicaceae. Although the gene orf138 has been isolated as a determinant of Ogura-type CMS, no homologous sequence to orf138 has been found in public databases. Therefore, how orf138 sequence was created is a mystery. In this study, we determined the complete nucleotide sequence of two radish mitochondrial genomes, namely, Ogura- and normal-type genomes, and analyzed them to reveal the origin of the gene orf138. Results Ogura- and normal-type mitochondrial genomes were assembled to 258,426-bp and 244,036-bp circular sequences, respectively. Normal-type mitochondrial genome contained 33 protein-coding and three rRNA genes, which are well conserved with the reported mitochondrial genome of rapeseed. Ogura-type genomes contained same genes and additional atp9. As for tRNA, normal-type contained 17 tRNAs, while Ogura-type contained 17 tRNAs and one additional trnfM. The gene orf138 was specific to Ogura-type mitochondrial genome, and no sequence homologous to it was found in normal-type genome. Comparative analysis of the two genomes revealed that radish mitochondrial genome consists of 11 syntenic regions (length >3 kb, similarity >99.9%. It was shown that short repeats and overlapped repeats present in the edge of syntenic regions were involved in recombination events during evolution to interconvert two types of mitochondrial genome. Ogura-type mitochondrial genome has four unique regions (2,803 bp, 1,601 bp, 451 bp and 15,255 bp in size that are non-syntenic to normal-type genome, and the gene orf138

  16. Direct, rapid RNA sequence analysis

    International Nuclear Information System (INIS)

    Peattie, D.A.

    1987-01-01

    The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

  17. Sequence Analysis of How Disability Influenced Life Trajectories in a Past Population from the Nineteenth-Century Sundsvall Region, Sweden

    Directory of Open Access Journals (Sweden)

    Lotta Vikström

    2017-05-01

    Full Text Available Historically, little is known about whether and to what extent disabled people found work and formed families. To fill this gap, this study analyses the life course trajectories of both disabled and non-disabled individuals, between the ages of 15 and 33, from the Sundsvall region in Sweden during the nineteenth century. Having access to micro-data that report disabilities in a population of 8,874 individuals from the parish registers digitised by the Demographic Data Base, Umeå University, we employ sequence analysis on a series of events that are expected to occur in life of young adults: getting a job, marrying and becoming a parent, while also taking into account out-migration and death. Through this method we obtain a holistic picture of the life course of disabled people. Main findings show that their trajectories did not include work or family to the same extent as those of non-disabled people. Secondary findings concerning migration and mortality indicate that the disabled rarely out-migrated from the region, and they suffered from premature deaths. To our knowledge this is the first study to employ sequence analysis on a substantially large number of cases to provide demographic evidence of how disability shaped human trajectories in the past during an extended period of life. Accordingly, we detail our motivation for this method, describe our analytical approach, and discuss the advantages and disadvantages associated with sequence analysis for our case study.

  18. Appearances can be deceptive: revealing a hidden viral infection with deep sequencing in a plant quarantine context.

    Science.gov (United States)

    Candresse, Thierry; Filloux, Denis; Muhire, Brejnev; Julian, Charlotte; Galzi, Serge; Fort, Guillaume; Bernardo, Pauline; Daugrois, Jean-Heindrich; Fernandez, Emmanuel; Martin, Darren P; Varsani, Arvind; Roumagnac, Philippe

    2014-01-01

    Comprehensive inventories of plant viral diversity are essential for effective quarantine and sanitation efforts. The safety of regulated plant material exchanges presently relies heavily on techniques such as PCR or nucleic acid hybridisation, which are only suited to the detection and characterisation of specific, well characterised pathogens. Here, we demonstrate the utility of sequence-independent next generation sequencing (NGS) of both virus-derived small interfering RNAs (siRNAs) and virion-associated nucleic acids (VANA) for the detailed identification and characterisation of viruses infecting two quarantined sugarcane plants. Both plants originated from Egypt and were known to be infected with Sugarcane streak Egypt Virus (SSEV; Genus Mastrevirus, Family Geminiviridae), but were revealed by the NGS approaches to also be infected by a second highly divergent mastrevirus, here named Sugarcane white streak Virus (SWSV). This novel virus had escaped detection by all routine quarantine detection assays and was found to also be present in sugarcane plants originating from Sudan. Complete SWSV genomes were cloned and sequenced from six plants and all were found to share >91% genome-wide identity. With the exception of two SWSV variants, which potentially express unusually large RepA proteins, the SWSV isolates display genome characteristics very typical to those of all other previously described mastreviruses. An analysis of virus-derived siRNAs for SWSV and SSEV showed them to be strongly influenced by secondary structures within both genomic single stranded DNA and mRNA transcripts. In addition, the distribution of siRNA size frequencies indicates that these mastreviruses are likely subject to both transcriptional and post-transcriptional gene silencing. Our study stresses the potential advantages of NGS-based virus metagenomic screening in a plant quarantine setting and indicates that such techniques could dramatically reduce the numbers of non

  19. Appearances can be deceptive: revealing a hidden viral infection with deep sequencing in a plant quarantine context.

    Directory of Open Access Journals (Sweden)

    Thierry Candresse

    Full Text Available Comprehensive inventories of plant viral diversity are essential for effective quarantine and sanitation efforts. The safety of regulated plant material exchanges presently relies heavily on techniques such as PCR or nucleic acid hybridisation, which are only suited to the detection and characterisation of specific, well characterised pathogens. Here, we demonstrate the utility of sequence-independent next generation sequencing (NGS of both virus-derived small interfering RNAs (siRNAs and virion-associated nucleic acids (VANA for the detailed identification and characterisation of viruses infecting two quarantined sugarcane plants. Both plants originated from Egypt and were known to be infected with Sugarcane streak Egypt Virus (SSEV; Genus Mastrevirus, Family Geminiviridae, but were revealed by the NGS approaches to also be infected by a second highly divergent mastrevirus, here named Sugarcane white streak Virus (SWSV. This novel virus had escaped detection by all routine quarantine detection assays and was found to also be present in sugarcane plants originating from Sudan. Complete SWSV genomes were cloned and sequenced from six plants and all were found to share >91% genome-wide identity. With the exception of two SWSV variants, which potentially express unusually large RepA proteins, the SWSV isolates display genome characteristics very typical to those of all other previously described mastreviruses. An analysis of virus-derived siRNAs for SWSV and SSEV showed them to be strongly influenced by secondary structures within both genomic single stranded DNA and mRNA transcripts. In addition, the distribution of siRNA size frequencies indicates that these mastreviruses are likely subject to both transcriptional and post-transcriptional gene silencing. Our study stresses the potential advantages of NGS-based virus metagenomic screening in a plant quarantine setting and indicates that such techniques could dramatically reduce the numbers of non

  20. Sequencing of FKS Hot Spot 1 from Saprochaete capitata To Search for a Relationship to Reduced Echinocandin Susceptibility.

    Science.gov (United States)

    Arrieta-Aguirre, Inés; Menéndez-Manjón, Pilar; Cuétara, María Soledad; Fernández de Larrinoa, Iñigo; García-Ruiz, Juan Carlos; Moragues, María Dolores

    2018-02-01

    Saprochaete capitata , formerly known as Geotrichum capitatum , is an emerging fungal pathogen with low susceptibility to echinocandins. Here, we report the nucleotide sequence of the S. capitata hot spot 1 region of the FKS gene ( FKS HS1), which codifies for the catalytic subunit of β-1,3-d-glucan synthase, the target of echinocandins. For that purpose, we first designed degenerated oligonucleotide primers derived from conserved flanking regions of the FKS1 HS1 segment of 12 different fungal species. Interestingly, analysis of the translated FKS HS1 sequences of 12 isolates of S. capitata revealed that all of them exhibited the same F-to-L substitution in a position that is highly related to reduced echinocandin susceptibility. Copyright © 2018 American Society for Microbiology.