The Southern HII Region Discovery Survey
Wenger, Trey; Miller Dickey, John; Jordan, Christopher; Bania, Thomas M.; Balser, Dana S.; Dawson, Joanne; Anderson, Loren D.; Armentrout, William P.; McClure-Griffiths, Naomi
2016-01-01
HII regions are zones of ionized gas surrounding recently formed high-mass (OB-type) stars. They are among the brightest objects in the sky at radio wavelengths. HII regions provide a useful tool in constraining the Galactic morphological structure, chemical structure, and star formation rate. We describe the Southern HII Region Discovery Survey (SHRDS), an Australia Telescope Compact Array (ATCA) survey that discovered ~80 new HII regions (so far) in the Galactic longitude range 230 degrees to 360 degrees. This project is an extension of the Green Bank Telescope HII Region Discovery Survey (GBT HRDS), Arecibo HRDS, and GBT Widefield Infrared Survey Explorer (WISE) HRDS, which together discovered ~800 new HII regions in the Galactic longitude range -20 degrees to 270 degrees. Similar to those surveys, candidate HII regions were chosen from 20 micron emission (from WISE) coincident with 10 micron (WISE) and 20 cm (SGPS) emission. By using the ATCA to detect radio continuum and radio recombination line emission from a subset of these candidates, we have added to the population of known Galactic HII regions.
The Southern HII Region Discovery Survey: The Bright Catalog
Wenger, Trey V.; Dickey, John M.; Jordan, Christopher H.; Balser, Dana; Armentrout, William Paul; Anderson, Loren; Bania, Thomas; Dawson, Joanne; McClure-Griffiths, Naomi M.; Shea, Jeanine
2018-01-01
HII regions, the zones of ionized gas surrounding recently formed high-mass stars, are the archetypical tracers of Galactic structure. The census of Galactic HII regions in the Southern sky is vastly incomplete due to a lack of sensitive radio recombination line (RRL) surveys. The Southern HII Region Discovery Survey (SHRDS) is a 900-hour Australia Telescope Compact Array cm-wavelength RRL and continuum emission survey of hundreds of third and fourth quadrant Galactic HII region candidates. These candidates are identified in the Widefield Infrared Survey Explorer (WISE) Catalog of Galactic HII Regions based on coincident 10 micron (WISE) and 20 cm (Southern Galactic Plane Survey) emission. The SHRDS is an extension of HII Region Discovery Surveys in the Northern sky with the Green Bank Telescope and Arecibo Telescope which discovered ~800 new HII regions. In the first 500 hours of the SHRDS, we targeted the 249 brightest HII region candidates and 33 previously known HII regions. We discuss the data reduction, analysis, and preliminary results from this first stage of the survey.
Discovery of accessible locations using region-based geo-social data
Wang, Yan
2018-03-17
Geo-social data plays a significant role in location discovery and recommendation. In this light, we propose and study a novel problem of discovering accessible locations in spatial networks using region-based geo-social data. Given a set Q of query regions, the top-k accessible location discovery query (k ALDQ) finds k locations that have the highest spatial-density correlations to Q. Both the spatial distances between locations and regions and the POI (point of interest) density within the regions are taken into account. We believe that this type of k ALDQ query can bring significant benefit to many applications such as travel planning, facility allocation, and urban planning. Three challenges exist in k ALDQ: (1) how to model the spatial-density correlation practically, (2) how to prune the search space effectively, and (3) how to schedule the searches from multiple query regions. To tackle the challenges and process k ALDQ effectively and efficiently, we first define a series of spatial and density metrics to model the spatial-density correlation. Then we propose a novel three-phase solution with a pair of upper and lower bounds of the spatial-density correlation and a heuristic scheduling strategy to schedule multiple query regions. Finally, we conduct extensive experiments on real and synthetic spatial data to demonstrate the performance of the developed solutions.
Educational Testing Service, Los Angeles, CA.
At the seventh Western Regional Conference on Testing Problems, the following speeches were given: (1) "A Guidance Person's Approach to Testing for the Discovery and Development of Human Talent" by Frances D. McGill; (2) "The Instructional Uses of Measurement in the Discovery and Development of Human Talent" by Roy P. Wahle; (3) "New Frontiers of…
2010-10-01
... 49 Transportation 8 2010-10-01 2010-10-01 false Discovery. 1121.2 Section 1121.2 Transportation... TRANSPORTATION RULES OF PRACTICE RAIL EXEMPTION PROCEDURES § 1121.2 Discovery. Discovery shall follow the procedures set forth at 49 CFR part 1114, subpart B. Discovery may begin upon the filing of the petition for...
2010-07-01
... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Discovery. 2.120 Section 2... COMMERCE RULES OF PRACTICE IN TRADEMARK CASES Procedure in Inter Partes Proceedings § 2.120 Discovery. (a... to disclosure and discovery shall apply in opposition, cancellation, interference and concurrent use...
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Discovery. 2.1018 Section 2.1018 Energy NUCLEAR REGULATORY... Geologic Repository § 2.1018 Discovery. (a)(1) Parties, potential parties, and interested governmental participants in the high-level waste licensing proceeding may obtain discovery by one or more of the following...
The Southern HII Region Discovery Survey: Preliminary Results
Shea, Jeanine; Wenger, Trey; Balser, Dana S.; Anderson, Loren D.; Armentrout, William P.; Bania, Thomas M.; Dawson, Joanne; Miller Dickey, John; Jordan, Christopher; McClure-Griffiths, Naomi M.
2017-01-01
HII regions are some of the brightest sources at radio frequencies in the Milky Way and are the sites of massive O and B-type star formation. They have relatively short (Bank Telescope. Candidate HII regions were selected from mid-infrared emission coincident with radio continuum emission, and confirmed as HII regions by the detection of radio recombination lines. Here we discuss the Southern HII Region Discovery Survey (SHRDS), a continuation of the HRDS using the Australia Telescope Compact Array over the Galactic longitude range 230 to 360 degrees. We have reduced and analyzed a small sub-set of the SHRDS sources and discuss preliminary results, including kinematic distances and metallicities.
The Southern H ii Region Discovery Survey (SHRDS): Pilot Survey
Energy Technology Data Exchange (ETDEWEB)
Brown, C.; Dickey, John M. [School of Physical Sciences, Private Bag 37, University of Tasmania, Hobart, TAS, 7001 (Australia); Jordan, C. [International Centre for Radio Astronomy Research, Curtin University, Perth, WA, 6845 (Australia); Anderson, L. D.; Armentrout, W. P. [Department of Physics and Astronomy, West Virginia University, P.O. Box 6315, Morgantown, WV 26506 (United States); Balser, Dana S.; Wenger, Trey V. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22904 (United States); Bania, T. M. [Institute for Astrophysical Research, Department of Astronomy, Boston University, 725 Commonwealth Avenue, Boston, MA 02215 (United States); Dawson, J. R. [Department of Physics and Astronomy and MQ Research Centre in Astronomy, Astrophysics and Astrophotonics, Macquarie University, NSW, 2109 (Australia); Mc Clure-Griffiths, N. M. [Research School of Astronomy and Astrophysics, The Australian National University, Canberra ACT 2611 (Australia)
2017-07-01
The Southern H ii Region Discovery Survey is a survey of the third and fourth quadrants of the Galactic plane that will detect radio recombination line (RRL) and continuum emission at cm-wavelengths from several hundred H ii region candidates using the Australia Telescope Compact Array. The targets for this survey come from the WISE Catalog of Galactic H ii Regions and were identified based on mid-infrared and radio continuum emission. In this pilot project, two different configurations of the Compact Array Broad Band receiver and spectrometer system were used for short test observations. The pilot surveys detected RRL emission from 36 of 53 H ii region candidates, as well as seven known H ii regions that were included for calibration. These 36 recombination line detections confirm that the candidates are true H ii regions and allow us to estimate their distances.
The Southern H ii Region Discovery Survey (SHRDS): Pilot Survey
International Nuclear Information System (INIS)
Brown, C.; Dickey, John M.; Jordan, C.; Anderson, L. D.; Armentrout, W. P.; Balser, Dana S.; Wenger, Trey V.; Bania, T. M.; Dawson, J. R.; Mc Clure-Griffiths, N. M.
2017-01-01
The Southern H ii Region Discovery Survey is a survey of the third and fourth quadrants of the Galactic plane that will detect radio recombination line (RRL) and continuum emission at cm-wavelengths from several hundred H ii region candidates using the Australia Telescope Compact Array. The targets for this survey come from the WISE Catalog of Galactic H ii Regions and were identified based on mid-infrared and radio continuum emission. In this pilot project, two different configurations of the Compact Array Broad Band receiver and spectrometer system were used for short test observations. The pilot surveys detected RRL emission from 36 of 53 H ii region candidates, as well as seven known H ii regions that were included for calibration. These 36 recombination line detections confirm that the candidates are true H ii regions and allow us to estimate their distances.
Zhang, Wenming
2017-09-19
One of the greatest global challenges is to feed the ever-increasing world population. The agrochemical tools growers currently utilize are also under continuous pressure, due to a number of factors that contribute to the loss of existing products. Mesoionic pyrido[1,2-a]pyrimidinones are an unusual yet very intriguing class of compounds. Known for several decades, this class of compounds had not been systemically studied until we started our insecticide discovery program. This Account provides an overview of the efforts on mesoionic pyrido[1,2-a]pyridinone insecticide discovery, beginning from the initial high throughput screen (HTS) discovery to ultimate identification of triflumezopyrim (4, DuPont Pyraxalt) and dicloromezotiaz (5) for commercialization as novel insecticides. Mesoionic pyrido[1,2-a]pyrimidinones with a n-propyl group at the 1-position, such as compound 1, were initially isolated as undesired byproducts from reactions for a fungicide discovery program at DuPont Crop Protection. Such compounds showed interesting insecticidal activity in a follow-up screen and against an expanded insect species list. The area became an insecticide hit for exploration and then a lead area for optimization. At the lead optimization stage, variations at three regions of compound 1, i.e., side-chain (n-propyl group), substituents on the 3-phenyl group, and substitutions on the pyrido- moiety, were explored with many analogues prepared and evaluated. Breakthrough discoveries included replacing the n-propyl group with a 2,2,2-trifluoroethyl group to generate compound 2, and then with a 2-chlorothiazol-5-ylmethyl group to form compound 3. 3 possesses potent insecticidal activity not only against a group of hopper species, including corn planthopper (Peregrinus maidis (Ashmead), CPH) and potato leafhopper (Empoasca fabae (Harris), PLH), as well as two key rice hopper species, namely, brown planthopper (Nilaparvata lugens (Stål), BPH) and rice green leafhopper (Nephotettix
Discovery of accessible locations using region-based geo-social data
Wang, Yan; Li, Jianmin; Zhong, Ying; Zhu, Shunzhi; Guo, Danhuai; Shang, Shuo
2018-01-01
Geo-social data plays a significant role in location discovery and recommendation. In this light, we propose and study a novel problem of discovering accessible locations in spatial networks using region-based geo-social data. Given a set Q of query
A P2P Service Discovery Strategy Based on Content Catalogues
Directory of Open Access Journals (Sweden)
Lican Huang
2007-08-01
Full Text Available This paper presents a framework for distributed service discovery based on VIRGO P2P technologies. The services are classified as multi-layer, hierarchical catalogue domains according to their contents. The service providers, which have their own service registries such as UDDIs, register the services they provide and establish a virtual tree in a VIRGO network according to the domain of their service. The service location done by the proposed strategy is effective and guaranteed. This paper also discusses the primary implementation of service discovery based on Tomcat/Axis and jUDDI.
Discovery of new dipper stars with K2: a window into the inner disc region of T Tauri stars
Hedges, Christina; Hodgkin, Simon; Kennedy, Grant
2018-05-01
In recent years, a new class of young stellar object (YSO) has been defined, referred to as dippers, where large transient drops in flux are observed. These dips are too large to be attributed to stellar variability, last from hours to days and can reduce the flux of a star by 10-50 per cent. This variability has been attributed to occultations by warps or accretion columns near the inner edge of circumstellar discs. Here, we present 95 dippers in the Upper Scorpius association and ρ Ophiuchus cloud complex found in K2 Campaign 2 data using supervised machine learning with a random forest classifier. We also present 30 YSOs that exhibit brightening events on the order of days, known as bursters. Not all dippers and bursters are known members, but all exhibit infrared excesses and are consistent with belonging to either of the two young star-forming regions. We find 21.0 ± 5.5 per cent of stars with discs are dippers for both regions combined. Our entire dipper sample consists only of late-type (KM) stars, but we show that biases limit dipper discovery for earlier spectral types. Using the dipper properties as a proxy, we find that the temperature at the inner disc edge is consistent with interferometric results for similar and earlier type stars.
Impact of Recent Discoveries on Petroleum and Natural Gas Exploration: Emphasis on India
Herndon, J. Marvin
2010-01-01
Two discoveries have greatly impacted understanding relevant to the origination and emplacement of petroleum and natural gas deposits. One discovery, pertaining to hydrocarbon formation from methane broadens significantly potential regions where abiotic petroleum and natural gas deposits might be found. The other, discovery of the physical impossibility of Earth-mantle convection, restricts the range and domain of geodynamic behavior, and leads to new insights on the formation of petroleum an...
Pharmacogenetics in type 2 diabetes: precision medicine or discovery tool?
Florez, Jose C
2017-05-01
In recent years, technological and analytical advances have led to an explosion in the discovery of genetic loci associated with type 2 diabetes. However, their ability to improve prediction of disease outcomes beyond standard clinical risk factors has been limited. On the other hand, genetic effects on drug response may be stronger than those commonly seen for disease incidence. Pharmacogenetic findings may aid in identifying new drug targets, elucidate pathophysiology, unravel disease heterogeneity, help prioritise specific genes in regions of genetic association, and contribute to personalised or precision treatment. In diabetes, precedent for the successful application of pharmacogenetic concepts exists in its monogenic subtypes, such as MODY or neonatal diabetes. Whether similar insights will emerge for the much more common entity of type 2 diabetes remains to be seen. As genetic approaches advance, the progressive deployment of candidate gene, large-scale genotyping and genome-wide association studies has begun to produce suggestive results that may transform clinical practice. However, many barriers to the translation of diabetes pharmacogenetic discoveries to the clinic still remain. This perspective offers a contemporary overview of the field with a focus on sulfonylureas and metformin, identifies the major uses of pharmacogenetics, and highlights potential limitations and future directions.
10 CFR 2.709 - Discovery against NRC staff.
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Discovery against NRC staff. 2.709 Section 2.709 Energy... Rules for Formal Adjudications § 2.709 Discovery against NRC staff. (a)(1) In a proceeding in which the NRC staff is a party, the NRC staff will make available one or more witnesses, designated by the...
Cross-Layer Service Discovery Mechanism for OLSRv2 Mobile Ad Hoc Networks
Directory of Open Access Journals (Sweden)
M. Isabel Vara
2015-07-01
Full Text Available Service discovery plays an important role in mobile ad hoc networks (MANETs. The lack of central infrastructure, limited resources and high mobility make service discovery a challenging issue for this kind of network. This article proposes a new service discovery mechanism for discovering and advertising services integrated into the Optimized Link State Routing Protocol Version 2 (OLSRv2. In previous studies, we demonstrated the validity of a similar service discovery mechanism integrated into the previous version of OLSR (OLSRv1. In order to advertise services, we have added a new type-length-value structure (TLV to the OLSRv2 protocol, called service discovery message (SDM, according to the Generalized MANET Packet/Message Format defined in Request For Comments (RFC 5444. Each node in the ad hoc network only advertises its own services. The advertisement frequency is a user-configurable parameter, so that it can be modified depending on the user requirements. Each node maintains two service tables, one to store information about its own services and another one to store information about the services it discovers in the network. We present simulation results, that compare our service discovery integrated into OLSRv2 with the one defined for OLSRv1 and with the integration of service discovery in Ad hoc On-demand Distance Vector (AODV protocol, in terms of service discovery ratio, service latency and network overhead.
Cross-Layer Service Discovery Mechanism for OLSRv2 Mobile Ad Hoc Networks.
Vara, M Isabel; Campo, Celeste
2015-07-20
Service discovery plays an important role in mobile ad hoc networks (MANETs). The lack of central infrastructure, limited resources and high mobility make service discovery a challenging issue for this kind of network. This article proposes a new service discovery mechanism for discovering and advertising services integrated into the Optimized Link State Routing Protocol Version 2 (OLSRv2). In previous studies, we demonstrated the validity of a similar service discovery mechanism integrated into the previous version of OLSR (OLSRv1). In order to advertise services, we have added a new type-length-value structure (TLV) to the OLSRv2 protocol, called service discovery message (SDM), according to the Generalized MANET Packet/Message Format defined in Request For Comments (RFC) 5444. Each node in the ad hoc network only advertises its own services. The advertisement frequency is a user-configurable parameter, so that it can be modified depending on the user requirements. Each node maintains two service tables, one to store information about its own services and another one to store information about the services it discovers in the network. We present simulation results, that compare our service discovery integrated into OLSRv2 with the one defined for OLSRv1 and with the integration of service discovery in Ad hoc On-demand Distance Vector (AODV) protocol, in terms of service discovery ratio, service latency and network overhead.
THE DISCOVERY OF RAMAN SCATTERING IN H II REGIONS
Energy Technology Data Exchange (ETDEWEB)
Dopita, Michael A.; Nicholls, David C.; Sutherland, Ralph S.; Kewley, Lisa J.; Groves, Brent A., E-mail: Michael.Dopita@anu.edu.au [Research School of Astronomy and Astrophysics, Australian National University, Canberra, ACT 2611 (Australia)
2016-06-10
We report here on the discovery of faint extended wings of H α observed out to an apparent velocity of ∼7600 km s{sup −1} in the Orion Nebula (M42) and in five H ii regions in the Large and the Small Magellanic Clouds. We show that these wings are caused by Raman scattering of both the O i and Si ii resonance lines and stellar continuum UV photons with H i followed by radiative decay to the H i n = 2 level. The broad wings also seen in H β and in H γ result from Raman scattering of the UV continuum in the H i n = 4 and n = 5 levels, respectively. The Raman scattering fluorescence is correlated with the intensity of the narrow permitted lines of O i and Si ii. In the case of Si ii, this is explained by radiative pumping of the same 1023.7 Å resonance line involved in the Raman scattering by the Ly β radiation field. The subsequent radiative cascade produces enhanced Si ii λλ 5978.9, 6347.1, and 6371.4 Å permitted transitions. Finally, we show that in O i, radiative pumping of the 1025.76 Å resonance line by the Lyman series radiation field is also the cause of the enhancement in the permitted lines of this species lying near H α in wavelength, but here the process is a little more complex. We argue that all these processes are active in the zone of the H ii region near the ionization front.
Accounting for discovery bias in genomic prediction
Our objective was to evaluate an approach to mitigating discovery bias in genomic prediction. Accuracy may be improved by placing greater emphasis on regions of the genome expected to be more influential on a trait. Methods emphasizing regions result in a phenomenon known as “discovery bias” if info...
Can Full Duplex reduce the discovery time in D2D Communication?
DEFF Research Database (Denmark)
Gatnau, Marta; Berardinelli, Gilberto; Mahmood, Nurul Huda
2016-01-01
Device-to-device (D2D) communication is considered as one of the key technologies to support new types of services, such as public safety and proximity-based applications. D2D communication requires a discovery phase, i.e., the node awareness procedure prior to the communication phase. Conventional...... half duplex transmission may not be sufficient to provide fast discovery and cope with the strict latency targets of future 5G services. On the other hand, in-band full duplex, by allowing simultaneous transmission and reception, may complete the discovery phase faster. In this paper, the potential...... of full duplex in providing fast discovery for the next 5th generation (5G) system supporting D2D communication is investigated. A design for such system is presented and evaluated via simulations, showing that full duplex can accelerate the discovery phase by supporting a higher transmission probability...
Directory of Open Access Journals (Sweden)
Mona ROMAN
2017-12-01
Full Text Available Entrepreneurial discovery process (EDP is a bottom-up process engaging regional actors from academic, business, government and civil society together to identify new market opportunities and overcome the potential barriers to innovation. While EDP forms the key principle behind the smart specialization policy of European Commission, its operationalization has remained a challenge. We adopted a grounded theory approach to explore the dynamics of EDP through a case study in Finnish regions. Our aim is to identify the key underlying factors of EDP. Based on the semi-structured interviews with 10 Finnish regions during September 2016, we identified openness, engaging, focused networking and continuous collaboration as the key factors underlying EDP. Our findings contribute to the theoretical debate on what constitutes EDP in the context of smart specialization. We also provide examples for policymakers how to implement these factors based on our case study.
The next generation of targeted mutation discovery
Harakalova, M.
2013-01-01
Sequencing technologies (NGS) now allows efficient analysis of the complete protein-coding regions of genomes (exomes) for multiple samples in a single sequencing run. In Chapter 2, we present our results with a genomic DNA pooling strategy for rare variant discovery on a NGS platform. The high
Choi, Chang-Ik
2016-08-27
Diabetes mellitus is a chronic condition associated with the metabolic impairment of insulin actions, leading to the development of life-threatening complications. Although many kinds of oral antihyperglycemic agents with different therapeutic mechanisms have been marketed, their undesirable adverse effects, such as hypoglycemia, weight gain, and hepato-renal toxicity, have increased demand for the discovery of novel, safer antidiabetic drugs. Since the important roles of the sodium-glucose cotransporter 2 (SGLT2) for glucose homeostasis in the kidney were recently elucidated, pharmacological inhibition of SGLT2 has been considered a promising therapeutic target for the treatment of type 2 diabetes. Since the discovery of the first natural SGLT2 inhibitor, phlorizin, several synthetic glucoside analogs have been developed and introduced into the market. Furthermore, many efforts to find new active constituents with SGLT2 inhibition from natural products are still ongoing. This review introduces the history of research on the development of early-generation SGLT2 inhibitors, and recent progress on the discovery of novel candidates for SGLT2 inhibitor from several natural products that are widely used in traditional herbal medicine.
Providing Fast Discovery in D2D Communication with Full Duplex Technology
DEFF Research Database (Denmark)
Gatnau, Marta; Berardinelli, Gilberto; Mahmood, Nurul Huda
2016-01-01
technology to provide D2D fast discovery. Such framework provides an algorithm to estimate the number of neighbor devices and to dynamically decide the transmission probability, for adapting to network changes and meeting the 10 milliseconds target. Finally, a signaling scheme is proposed to reduce......In Direct Device-to-Device (D2D), the device awareness procedure known as the discovery phase is required prior to the exchange of data. This work considers autonomous devices where the infrastructure is not involved in the discovery procedure. Commonly, the transmission of the discovery message...... the network interference. Results show that our framework performs better than a static approach, reducing the time it takes to complete the discovery phase. In addition, supporting full duplex allows to further reduce the discovery time compared to half duplex transmission mode....
Directory of Open Access Journals (Sweden)
Chang-Ik Choi
2016-08-01
Full Text Available Diabetes mellitus is a chronic condition associated with the metabolic impairment of insulin actions, leading to the development of life-threatening complications. Although many kinds of oral antihyperglycemic agents with different therapeutic mechanisms have been marketed, their undesirable adverse effects, such as hypoglycemia, weight gain, and hepato-renal toxicity, have increased demand for the discovery of novel, safer antidiabetic drugs. Since the important roles of the sodium-glucose cotransporter 2 (SGLT2 for glucose homeostasis in the kidney were recently elucidated, pharmacological inhibition of SGLT2 has been considered a promising therapeutic target for the treatment of type 2 diabetes. Since the discovery of the first natural SGLT2 inhibitor, phlorizin, several synthetic glucoside analogs have been developed and introduced into the market. Furthermore, many efforts to find new active constituents with SGLT2 inhibition from natural products are still ongoing. This review introduces the history of research on the development of early-generation SGLT2 inhibitors, and recent progress on the discovery of novel candidates for SGLT2 inhibitor from several natural products that are widely used in traditional herbal medicine.
PRE-DISCOVERY OBSERVATIONS OF DISRUPTING ASTEROID P/2010 A2
International Nuclear Information System (INIS)
Jewitt, David; Stuart, Joseph S.; Li Jing
2011-01-01
Solar system object P/2010 A2 is the first-noticed example of the aftermath of a recently disrupted asteroid, probably resulting from a collision. Nearly a year elapsed between its inferred initiation in early 2009 and its eventual detection in early 2010. Here, we use new observations to assess the factors underlying the visibility, especially to understand the delayed discovery. We present pre-discovery observations from the LINEAR telescope and set limits to the early-time brightness from SOHO and STEREO satellite coronagraphic images. Consideration of the circumstances of discovery of P/2010 A2 suggests that similar objects must be common, and that future all-sky surveys will reveal them in large numbers.
Evaluating Music Discovery Tools on Spotify: The Role of User Preference Characteristics
Directory of Open Access Journals (Sweden)
Muh-Chyun Tang
2017-06-01
Full Text Available An experimental study was conducted to assess the effectiveness of the four music discovery tools available on Spotify, a popular music streaming service, namely: radio recommendation, regional charts, genres and moods, as well as following Facebook friends. Both subjective judgment of user experience and objective measures of search effectiveness were used as the performance criteria. Other than comparison of these four tools, we also compared how consistent are these performance measures. The results show that user experience criteria were not necessarily corresponded to search effectiveness. Furthermore, three user preference characteristics: preference diversity, preference insight, and openness to novelty were introduced as mediating variables, with an aim to investigating how these attributes might interact with these four music discovery tools on performance. The results suggest that users’ preference characteristics did have an impact on the performance of these music discovery tools.
THE GREEN BANK TELESCOPE H II REGION DISCOVERY SURVEY. III. KINEMATIC DISTANCES
Energy Technology Data Exchange (ETDEWEB)
Anderson, L. D. [Department of Physics, West Virginia University, Morgantown, WV 26506 (United States); Bania, T. M. [Institute for Astrophysical Research, Department of Astronomy, Boston University, 725 Commonwealth Avenue, Boston, MA 02215 (United States); Balser, Dana S. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22903-2475 (United States); Rood, Robert T., E-mail: Loren.Anderson@mail.wvu.edu [Astronomy Department, University of Virginia, P.O. Box 3818, Charlottesville, VA 22903-0818 (United States)
2012-07-20
Using the H I emission/absorption method, we resolve the kinematic distance ambiguity and derive distances for 149 of 182 (82%) H II regions discovered by the Green Bank Telescope H II Region Discovery Survey (GBT HRDS). The HRDS is an X-band (9 GHz, 3 cm) GBT survey of 448 previously unknown H II regions in radio recombination line and radio continuum emission. Here, we focus on HRDS sources from 67 Degree-Sign {>=} l {>=} 18 Degree-Sign , where kinematic distances are more reliable. The 25 HRDS sources in this zone that have negative recombination line velocities are unambiguously beyond the orbit of the Sun, up to 20 kpc distant. They are the most distant H II regions yet discovered. We find that 61% of HRDS sources are located at the far distance, 31% at the tangent-point distance, and only 7% at the near distance. 'Bubble' H II regions are not preferentially located at the near distance (as was assumed previously) but average 10 kpc from the Sun. The HRDS nebulae, when combined with a large sample of H II regions with previously known distances, show evidence of spiral structure in two circular arc segments of mean Galactocentric radii of 4.25 and 6.0 kpc. We perform a thorough uncertainty analysis to analyze the effect of using different rotation curves, streaming motions, and a change to the solar circular rotation speed. The median distance uncertainty for our sample of H II regions is only 0.5 kpc, or 5%. This is significantly less than the median difference between the near and far kinematic distances, 6 kpc. The basic Galactic structure results are unchanged after considering these sources of uncertainty.
2017-12-01
What started 50 years ago as a `smudge' on paper has flourished into a fundamental field of astrophysics replete with unexpected applications and exciting discoveries. To celebrate the discovery of pulsars, we look at the past, present and future of pulsar astrophysics.
A replacement LH2 recirculation line before installation in Discovery
1999-01-01
A spare four-inch diameter LH2 recirculation line (shown in photo) will be used to replace a damaged LH2 line in the orbiter Discovery. The line recirculates hydrogen from the Shuttle main engines back to the external tank during prelaunch engine conditioning. Workers noted a dent in the line during routine aft compartment inspections Tuesday, Dec. 7. The dent measures 12 inches long and about =-inch deep. Managers expect the replacement work to take about 3 days, followed by system retests and final aft compartment close-outs. Preliminary assessments reflect a launch date of Space Shuttle Discovery on mission STS-103 no earlier than Dec. 16. STS-103 is the third servicing mission for the Hubble Space Telescope.
Radio Resource Management for V2V Discovery
DEFF Research Database (Denmark)
Alvarez, Beatriz Soret; Gatnau, Marta; Kovács, Istvan
2016-01-01
Big expectations are put into vehicular communications (V2X) for a safer and more intelligent driving. With human lives at risk, the system cannot afford to fail, which translates into very stringent reliability and latency requirements to the radio network. One of the challenges is to find...... efficient radio resource management (RRM) strategies for direct vehicle-to-vehicle (V2V) communication that can fulfil the requirements even with high traffic density. In cellular networks, a device-to-device (D2D) communication is usually split into two phases: the discovery process, for node awareness...... of each other; and the communication phase itself, where data exchange takes place. In the case of V2V, the discovery phase can utilize the status information that cars broadcast periodically as the beacons to detect the presence of neighbouring cars. For the delivery of specific messages (e...
International Nuclear Information System (INIS)
Piccioni, O.
1989-01-01
The author of this article describes his own role in the discovery of the antiproton. Although Segre and Chamberlain received the Nobel Prize in 1959 for its discovery, the author claims that their experimental method was his idea which he communicated to them informally in December 1954. He describes how his application for citizenship (he was Italian), and other scientists' manipulation, prevented him from being at Berkeley to work on the experiment himself. (UK)
McBride, Christopher; Cheruvallath, Zacharia; Komandla, Mallareddy; Tang, Mingnam; Farrell, Pamela; Lawson, J David; Vanderpool, Darin; Wu, Yiqin; Dougan, Douglas R; Plonowski, Artur; Holub, Corine; Larson, Chris
2016-06-15
Methionine aminopeptidase-2 (MetAP2) is an enzyme that cleaves an N-terminal methionine residue from a number of newly synthesized proteins. This step is required before they will fold or function correctly. Pre-clinical and clinical studies with a MetAP2 inhibitor suggest that they could be used as a novel treatment for obesity. Herein we describe the discovery of a series of pyrazolo[4,3-b]indoles as reversible MetAP2 inhibitors. A fragment-based drug discovery (FBDD) approach was used, beginning with the screening of fragment libraries to generate hits with high ligand-efficiency (LE). An indazole core was selected for further elaboration, guided by structural information. SAR from the indazole series led to the design of a pyrazolo[4,3-b]indole core and accelerated knowledge-based fragment growth resulted in potent and efficient MetAP2 inhibitors, which have shown robust and sustainable body weight loss in DIO mice when dosed orally. Copyright © 2016 Elsevier Ltd. All rights reserved.
Rational discovery of dengue type 2 non-competitive inhibitors.
Heh, Choon H; Othman, Rozana; Buckle, Michael J C; Sharifuddin, Yusrizam; Yusof, Rohana; Rahman, Noorsaadah A
2013-07-01
Various works have been carried out in developing therapeutics against dengue. However, to date, no effective vaccine or anti-dengue agent has yet been discovered. The development of protease inhibitors is considered as a promising option, but most previous works have involved competitive inhibition. In this study, we focused on rational discovery of potential anti-dengue agents based on non-competitive inhibition of DEN-2 NS2B/NS3 protease. A homology model of the DEN-2 NS2B/NS3 protease (using West Nile Virus NS2B/NS3 protease complex, 2FP7, as the template) was used as the target, and pinostrobin, a flavanone, was used as the standard ligand. Virtual screening was performed involving a total of 13 341 small compounds, with the backbone structures of chalcone, flavanone, and flavone, available in the ZINC database. Ranking of the resulting compounds yielded compounds with higher binding affinities compared with the standard ligand. Inhibition assay of the selected top-ranking compounds against DEN-2 NS2B/NS3 proteolytic activity resulted in significantly better inhibition compared with the standard and correlated well with in silico results. In conclusion, via this rational discovery technique, better inhibitors were identified. This method can be used in further work to discover lead compounds for anti-dengue agents. © 2013 John Wiley & Sons A/S.
Directory of Open Access Journals (Sweden)
Eduardo Amaral Haddad
2014-03-01
Full Text Available The Brazilian government has recently confirmed the discovery of a huge oil and natural gas field in the pre-salt layer of the country’s southeastern coast. It has been said that the oil fields can boost Brazil’s oil production and turn the country into one of the largest oil producers in the world. The fields are spatially concentrated in the coastal areas of a few Brazilian states that may directly benefit from oil production. This paper uses an interregional computable general equilibrium model to assess the impacts of pre-salt on the economy of the State of Espírito Santo, a region already characterized by an economic base that is heavily reliant on natural resources. We focus our analysis on the structural economic impacts on the local economy
Translational Research 2.0: a framework for accelerating collaborative discovery.
Asakiewicz, Chris
2014-05-01
The world wide web has revolutionized the conduct of global, cross-disciplinary research. In the life sciences, interdisciplinary approaches to problem solving and collaboration are becoming increasingly important in facilitating knowledge discovery and integration. Web 2.0 technologies promise to have a profound impact - enabling reproducibility, aiding in discovery, and accelerating and transforming medical and healthcare research across the healthcare ecosystem. However, knowledge integration and discovery require a consistent foundation upon which to operate. A foundation should be capable of addressing some of the critical issues associated with how research is conducted within the ecosystem today and how it should be conducted for the future. This article will discuss a framework for enhancing collaborative knowledge discovery across the medical and healthcare research ecosystem. A framework that could serve as a foundation upon which ecosystem stakeholders can enhance the way data, information and knowledge is created, shared and used to accelerate the translation of knowledge from one area of the ecosystem to another.
Trellis Tone Modulation Multiple-Access for Peer Discovery in D2D Networks
Directory of Open Access Journals (Sweden)
Chiwoo Lim
2018-04-01
Full Text Available In this paper, a new non-orthogonal multiple-access scheme, trellis tone modulation multiple-access (TTMMA, is proposed for peer discovery of distributed device-to-device (D2D communication. The range and capacity of discovery are important performance metrics in peer discovery. The proposed trellis tone modulation uses single-tone transmission and achieves a long discovery range due to its low Peak-to-Average Power Ratio (PAPR. The TTMMA also exploits non-orthogonal resource assignment to increase the discovery capacity. For the multi-user detection of superposed multiple-access signals, a message-passing algorithm with supplementary schemes are proposed. With TTMMA and its message-passing demodulation, approximately 1.5 times the number of devices are discovered compared to the conventional frequency division multiple-access (FDMA-based discovery.
Flexible End2End Workflow Automation of Hit-Discovery Research.
Holzmüller-Laue, Silke; Göde, Bernd; Thurow, Kerstin
2014-08-01
The article considers a new approach of more complex laboratory automation at the workflow layer. The authors purpose the automation of end2end workflows. The combination of all relevant subprocesses-whether automated or manually performed, independently, and in which organizational unit-results in end2end processes that include all result dependencies. The end2end approach focuses on not only the classical experiments in synthesis or screening, but also on auxiliary processes such as the production and storage of chemicals, cell culturing, and maintenance as well as preparatory activities and analyses of experiments. Furthermore, the connection of control flow and data flow in the same process model leads to reducing of effort of the data transfer between the involved systems, including the necessary data transformations. This end2end laboratory automation can be realized effectively with the modern methods of business process management (BPM). This approach is based on a new standardization of the process-modeling notation Business Process Model and Notation 2.0. In drug discovery, several scientific disciplines act together with manifold modern methods, technologies, and a wide range of automated instruments for the discovery and design of target-based drugs. The article discusses the novel BPM-based automation concept with an implemented example of a high-throughput screening of previously synthesized compound libraries. © 2014 Society for Laboratory Automation and Screening.
STS-39 Discovery in the VAB and Columbia Tow From HB-2
1991-01-01
The orbiter Discovery sits inside the Vehicle Assembly Building (VAB) after its rollover from the Orbiter Processing Facility (OPF). In the VAB, Discovery will be mated with an external tank and solid rocket boosters for its launch. Shown also is Columbia orbiter being towed from the High Bay 2.
A historical reflection on the discovery of human retroviruses.
Vahlne, Anders
2009-05-01
The discovery of HIV-1 as the cause of AIDS was one of the major scientific achievements during the last century. Here the events leading to this discovery are reviewed with particular attention to priority and actual contributions by those involved. Since I would argue that discovering HIV was dependent on the previous discovery of the first human retrovirus HTLV-I, the history of this discovery is also re-examined. The first human retroviruses (HTLV-I) was first reported by Robert C. Gallo and coworkers in 1980 and reconfirmed by Yorio Hinuma and coworkers in 1981. These discoveries were in turn dependent on the previous discovery by Gallo and coworkers in 1976 of interleukin 2 or T-cell growth factor as it was called then. HTLV-II was described by Gallo's group in 1982. A human retrovirus distinct from HTLV-I and HTLV-II in that it was shown to have the morphology of a lentivirus was in my mind described for the first time by Luc Montagnier in an oral presentation at Cold Spring Harbor in September of 1983. This virus was isolated from a patient with lymphadenopathy using the protocol previously described for HTLV by Gallo. The first peer reviewed paper by Montagnier's group of such a retrovirus, isolated from two siblings of whom one with AIDS, appeared in Lancet in April of 1984. However, the proof that a new human retrovirus (HIV-1) was the cause of AIDS was first established in four publications by Gallo's group in the May 4th issue of Science in 1984.
Object-graphs for context-aware visual category discovery.
Lee, Yong Jae; Grauman, Kristen
2012-02-01
How can knowing about some categories help us to discover new ones in unlabeled images? Unsupervised visual category discovery is useful to mine for recurring objects without human supervision, but existing methods assume no prior information and thus tend to perform poorly for cluttered scenes with multiple objects. We propose to leverage knowledge about previously learned categories to enable more accurate discovery, and address challenges in estimating their familiarity in unsegmented, unlabeled images. We introduce two variants of a novel object-graph descriptor to encode the 2D and 3D spatial layout of object-level co-occurrence patterns relative to an unfamiliar region and show that by using them to model the interaction between an image’s known and unknown objects, we can better detect new visual categories. Rather than mine for all categories from scratch, our method identifies new objects while drawing on useful cues from familiar ones. We evaluate our approach on several benchmark data sets and demonstrate clear improvements in discovery over conventional purely appearance-based baselines.
Paul, J T; Singh, A K; Dong, Z; Zhuang, H; Revard, B C; Rijal, B; Ashton, M; Linscheid, A; Blonsky, M; Gluhovic, D; Guo, J; Hennig, R G
2017-11-29
The discovery of two-dimensional (2D) materials comes at a time when computational methods are mature and can predict novel 2D materials, characterize their properties, and guide the design of 2D materials for applications. This article reviews the recent progress in computational approaches for 2D materials research. We discuss the computational techniques and provide an overview of the ongoing research in the field. We begin with an overview of known 2D materials, common computational methods, and available cyber infrastructures. We then move onto the discovery of novel 2D materials, discussing the stability criteria for 2D materials, computational methods for structure prediction, and interactions of monolayers with electrochemical and gaseous environments. Next, we describe the computational characterization of the 2D materials' electronic, optical, magnetic, and superconducting properties and the response of the properties under applied mechanical strain and electrical fields. From there, we move on to discuss the structure and properties of defects in 2D materials, and describe methods for 2D materials device simulations. We conclude by providing an outlook on the needs and challenges for future developments in the field of computational research for 2D materials.
Discovery of the transfermium elements: Pts. 2 and 3
International Nuclear Information System (INIS)
Wilkinson, D.H.; Wapstra, A.H.; Ulehla, I.; Barber, R.C.; Greenwood, N.N.; Hrynkiewicz, A.; Jeannin, Y.P.; Lefort, M.; Sakai, M.
1993-01-01
In 1985 the International Union of Pure and Applied Physics (IUPAP) and the International Union of Pure and Applied Chemistry (IUPAC) decided to establish a Transfermium Working Group to consider questions of priority in the discovery of elements with nuclear charge number Z>100. The work of the Group was carried out in two phases. Phase (i) established the criteria that must be satisfied for the discovery of an element to be recognized. The report on Phase (i), Part I of the present paper, was accepted by IUPAP and by IUPAC in 1990 and published separately. The report on Phase (ii), the judgemental phase of the work of the Group, was accepted by the IUPAP Council in Madrid, Sept. 1991, and approved for publication by the IUPAC Bureau in Hamburg, Aug. 1991 and forms Parts II and III of the present paper. It completes the work of the Group by applying the criteria of Part I on an element-by-element basis; it considers and analyzes all the pertinent literature and discusses in chronological and critical detail those papers considered important for the building up of confidence that each element had been put in evidence. This delineation of discovery profiles results, in some cases, in a sharing of the credit for discovery. (Author)
Directory of Open Access Journals (Sweden)
Kristofer Davie
2015-02-01
Full Text Available Genomic enhancers regulate spatio-temporal gene expression by recruiting specific combinations of transcription factors (TFs. When TFs are bound to active regulatory regions, they displace canonical nucleosomes, making these regions biochemically detectable as nucleosome-depleted regions or accessible/open chromatin. Here we ask whether open chromatin profiling can be used to identify the entire repertoire of active promoters and enhancers underlying tissue-specific gene expression during normal development and oncogenesis in vivo. To this end, we first compare two different approaches to detect open chromatin in vivo using the Drosophila eye primordium as a model system: FAIRE-seq, based on physical separation of open versus closed chromatin; and ATAC-seq, based on preferential integration of a transposon into open chromatin. We find that both methods reproducibly capture the tissue-specific chromatin activity of regulatory regions, including promoters, enhancers, and insulators. Using both techniques, we screened for regulatory regions that become ectopically active during Ras-dependent oncogenesis, and identified 3778 regions that become (over-activated during tumor development. Next, we applied motif discovery to search for candidate transcription factors that could bind these regions and identified AP-1 and Stat92E as key regulators. We validated the importance of Stat92E in the development of the tumors by introducing a loss of function Stat92E mutant, which was sufficient to rescue the tumor phenotype. Additionally we tested if the predicted Stat92E responsive regulatory regions are genuine, using ectopic induction of JAK/STAT signaling in developing eye discs, and observed that similar chromatin changes indeed occurred. Finally, we determine that these are functionally significant regulatory changes, as nearby target genes are up- or down-regulated. In conclusion, we show that FAIRE-seq and ATAC-seq based open chromatin profiling
4th International conference on Knowledge Discovery and Data Mining
Knowledge Discovery and Data Mining
2012-01-01
The volume includes a set of selected papers extended and revised from the 4th International conference on Knowledge Discovery and Data Mining, March 1-2, 2011, Macau, Chin. This Volume is to provide a forum for researchers, educators, engineers, and government officials involved in the general areas of knowledge discovery and data mining and learning to disseminate their latest research results and exchange views on the future research directions of these fields. 108 high-quality papers are included in the volume.
Constrained Combinatorial Libraries of Gp2 Proteins Enhance Discovery of PD-L1 Binders.
Kruziki, Max A; Sarma, Vidur; Hackel, Benjamin J
2018-06-05
Engineered protein ligands are used for molecular therapy, diagnostics, and industrial biotechnology. The Gp2 domain is a 45-amino acid scaffold that has been evolved for specific, high-affinity binding to multiple targets by diversification of two solvent-exposed loops. Inspired by sitewise enrichment of select amino acids, including cysteine pairs, in earlier Gp2 discovery campaigns, we hypothesized that the breadth and efficiency of de novo Gp2 discovery will be aided by sitewise amino acid constraint within combinatorial library design. We systematically constructed eight libraries and comparatively evaluated their efficacy for binder discovery via yeast display against a panel of targets. Conservation of a cysteine pair at the termini of the first diversified paratope loop increased binder discovery 16-fold ( p libraries with conserved cysteine pairs, within the second loop or an interloop pair, did not aid discovery thereby indicating site-specific impact. Via a yeast display protease resistance assay, Gp2 variants from the loop one cysteine pair library were 3.3 ± 2.1-fold ( p = 0.005) more stable than nonconstrained variants. Sitewise constraint of noncysteine residues-guided by previously evolved binders, natural Gp2 homology, computed stability, and structural analysis-did not aid discovery. A panel of binders to programmed death ligand 1 (PD-L1), a key target in cancer immunotherapy, were discovered from the loop 1 cysteine constraint library. Affinity maturation via loop walking resulted in strong, specific cellular PD-L1 affinity ( K d = 6-9 nM).
Resource-estimation models and predicted discovery
International Nuclear Information System (INIS)
Hill, G.W.
1982-01-01
Resources have been estimated by predictive extrapolation from past discovery experience, by analogy with better explored regions, or by inference from evidence of depletion of targets for exploration. Changes in technology and new insights into geological mechanisms have occurred sufficiently often in the long run to form part of the pattern of mature discovery experience. The criterion, that a meaningful resource estimate needs an objective measure of its precision or degree of uncertainty, excludes 'estimates' based solely on expert opinion. This is illustrated by development of error measures for several persuasive models of discovery and production of oil and gas in USA, both annually and in terms of increasing exploration effort. Appropriate generalizations of the models resolve many points of controversy. This is illustrated using two USA data sets describing discovery of oil and of U 3 O 8 ; the latter set highlights an inadequacy of available official data. Review of the oil-discovery data set provides a warrant for adjusting the time-series prediction to a higher resource figure for USA petroleum. (author)
A historical reflection on the discovery of human retroviruses
Directory of Open Access Journals (Sweden)
Vahlne Anders
2009-05-01
Full Text Available Abstract The discovery of HIV-1 as the cause of AIDS was one of the major scientific achievements during the last century. Here the events leading to this discovery are reviewed with particular attention to priority and actual contributions by those involved. Since I would argue that discovering HIV was dependent on the previous discovery of the first human retrovirus HTLV-I, the history of this discovery is also re-examined. The first human retroviruses (HTLV-I was first reported by Robert C. Gallo and coworkers in 1980 and reconfirmed by Yorio Hinuma and coworkers in 1981. These discoveries were in turn dependent on the previous discovery by Gallo and coworkers in 1976 of interleukin 2 or T-cell growth factor as it was called then. HTLV-II was described by Gallo's group in 1982. A human retrovirus distinct from HTLV-I and HTLV-II in that it was shown to have the morphology of a lentivirus was in my mind described for the first time by Luc Montagnier in an oral presentation at Cold Spring Harbor in September of 1983. This virus was isolated from a patient with lymphadenopathy using the protocol previously described for HTLV by Gallo. The first peer reviewed paper by Montagnier's group of such a retrovirus, isolated from two siblings of whom one with AIDS, appeared in Lancet in April of 1984. However, the proof that a new human retrovirus (HIV-1 was the cause of AIDS was first established in four publications by Gallo's group in the May 4th issue of Science in 1984.
GWATCH: a web platform for automated gene association discovery analysis
2014-01-01
Background As genome-wide sequence analyses for complex human disease determinants are expanding, it is increasingly necessary to develop strategies to promote discovery and validation of potential disease-gene associations. Findings Here we present a dynamic web-based platform – GWATCH – that automates and facilitates four steps in genetic epidemiological discovery: 1) Rapid gene association search and discovery analysis of large genome-wide datasets; 2) Expanded visual display of gene associations for genome-wide variants (SNPs, indels, CNVs), including Manhattan plots, 2D and 3D snapshots of any gene region, and a dynamic genome browser illustrating gene association chromosomal regions; 3) Real-time validation/replication of candidate or putative genes suggested from other sources, limiting Bonferroni genome-wide association study (GWAS) penalties; 4) Open data release and sharing by eliminating privacy constraints (The National Human Genome Research Institute (NHGRI) Institutional Review Board (IRB), informed consent, The Health Insurance Portability and Accountability Act (HIPAA) of 1996 etc.) on unabridged results, which allows for open access comparative and meta-analysis. Conclusions GWATCH is suitable for both GWAS and whole genome sequence association datasets. We illustrate the utility of GWATCH with three large genome-wide association studies for HIV-AIDS resistance genes screened in large multicenter cohorts; however, association datasets from any study can be uploaded and analyzed by GWATCH. PMID:25374661
Adventitious discovery of elastofibroma dorsi on skin biopsy
Directory of Open Access Journals (Sweden)
Salsabil Attafi Sehli
2015-04-01
Full Text Available Elastofibroma dorsi is a rare soft tissue pseudotumor, slow-growing, sitting in 99% of cases at the subscapular region and occurring in the elderly active people. Its pathogenesis is unclear. It is often asymptomatic. However, the diagnosis can be made on the typical topography of the mass and its characteristic appearance on CT and MRI. Thus, in the literature, most of the reported cases were radiologically discovered. An incidental histological discovery, like in our case is rare. We report the case of a 63 year-old man who had multiple nodular lesions, well circumscribed, firm, sometimes inflammatory, measuring between 3 and 5 cm, and located on the thighs and the paravertebral and scapular regions. The chest x-ray showed a right basal opacity suggesting a malignant processus. These nodules were biopsied in search of cutaneous metastasis of a probable pulmonary neoplasia. At histological examination, the diagnosis of elastofibroma was retained. Despite its rarity, the dorsal elastofibroma deserves to be known, thus avoiding excessive surgery. We propose to study its clinical, radiological and pathological features and its therapeutic modalities.
Fragment-Based Discovery of Pyrimido[1,2-b]indazole PDE10A Inhibitors.
Chino, Ayaka; Seo, Ryushi; Amano, Yasushi; Namatame, Ichiji; Hamaguchi, Wataru; Honbou, Kazuya; Mihara, Takuma; Yamazaki, Mayako; Tomishima, Masaki; Masuda, Naoyuki
2018-01-01
In this study, we report the identification of potent pyrimidoindazoles as phosphodiesterase10A (PDE10A) inhibitors by using the method of fragment-based drug discovery (FBDD). The pyrazolopyridine derivative 2 was found to be a fragment hit compound which could occupy a part of the binding site of PDE10A enzyme by using the method of the X-ray co-crystal structure analysis. On the basis of the crystal structure of compound 2 and PDE10A protein, a number of compounds were synthesized and evaluated, by means of structure-activity relationship (SAR) studies, which culminated in the discovery of a novel pyrimidoindazole derivative 13 having good physicochemical properties.
Discovery of multiple, ionization-created CS2 anions and a new mode of operation for drift chambers
International Nuclear Information System (INIS)
Snowden-Ifft, Daniel P.
2014-01-01
This paper focuses on the surprising discovery of multiple species of ionization-created CS 2 anions in gas mixtures containing electronegative CS 2 and O 2 , identified by their slightly different drift velocities. Data are presented to understand the formation mechanism and identity of these new anions. Regardless of the micro-physics, however, this discovery offers a new, trigger-less mode of operation for the drift chambers. A demonstration of trigger-less operation is presented
Panorama 2014 - New oil and gas discoveries
International Nuclear Information System (INIS)
Vially, Roland; Hureau, Geoffroy
2013-12-01
Spending on exploration increased significantly in 2012, and this growth should continue into 2013. Over a period of ten years, exploration budgets have increased five-fold, leading to major discoveries in regions as yet unexplored. In 2012, 25 billion barrels of oil equivalent (Gboe) were revealed. This is more than the average for the whole decade, but less than the amount for the previous year. Although knowledge of the volumes that have been discovered is still very fragmented, they should continue to fall into 2013. The main reason lies in the fact that spending on exploration is being shifted towards assessing discoveries made in previous years in the particularly prolific basins of Brazil and East Africa, while the exploration of border regions - such as the West African pre-salt formation - is still only in its early stages. (authors)
An online conserved SSR discovery through cross-species comparison
Directory of Open Access Journals (Sweden)
Tun-Wen Pai
2009-02-01
Full Text Available Tun-Wen Pai1, Chien-Ming Chen1, Meng-Chang Hsiao1, Ronshan Cheng2, Wen-Shyong Tzou3, Chin-Hua Hu31Department of Computer Science and Engineering; 2Department of Aquaculture, 3Institute of Bioscience and Biotechnology, National Taiwan Ocean University, Keelung, Taiwan, Republic of ChinaAbstract: Simple sequence repeats (SSRs play important roles in gene regulation and genome evolution. Although there exist several online resources for SSR mining, most of them only extract general SSR patterns without providing functional information. Here, an online search tool, CG-SSR (Comparative Genomics SSR discovery, has been developed for discovering potential functional SSRs from vertebrate genomes through cross-species comparison. In addition to revealing SSR candidates in conserved regions among various species, it also combines accurate coordinate and functional genomics information. CG-SSR is the first comprehensive and efficient online tool for conserved SSR discovery.Keywords: microsatellites, genome, comparative genomics, functional SSR, gene ontology, conserved region
Toward an Understanding of Foreground Emission in the BICEP2 Region
CERN. Geneva
2014-01-01
BICEP2 has reported the detection of a degree-scale B-mode polarization pattern in the Cosmic Microwave Background (CMB) and has interpreted the measurement as evidence for primordial gravitational waves. Motivated by the profound importance of the discovery of gravitational waves from the early Universe, I will discuss to what extent a combination of Galactic foregrounds and lensed E-modes could be responsible for the signal. I will present independent estimates of the dust polarization signal in the BICEP2 region using several different approaches. These estimates of the dust polarization signal in the BICEP2 region are consistent with each other, but the expected amplitude of the dust polarization power spectrum is uncertain by about a factor of three. The lower end of the prediction leaves room for a primordial contribution, but at the higher end the dust in combination with the standard CMB lensing signal could account for the BICEP2 observations, without requiring the existence of primordial gravitatio...
On reliable discovery of molecular signatures
Directory of Open Access Journals (Sweden)
Björkegren Johan
2009-01-01
Full Text Available Abstract Background Molecular signatures are sets of genes, proteins, genetic variants or other variables that can be used as markers for a particular phenotype. Reliable signature discovery methods could yield valuable insight into cell biology and mechanisms of human disease. However, it is currently not clear how to control error rates such as the false discovery rate (FDR in signature discovery. Moreover, signatures for cancer gene expression have been shown to be unstable, that is, difficult to replicate in independent studies, casting doubts on their reliability. Results We demonstrate that with modern prediction methods, signatures that yield accurate predictions may still have a high FDR. Further, we show that even signatures with low FDR may fail to replicate in independent studies due to limited statistical power. Thus, neither stability nor predictive accuracy are relevant when FDR control is the primary goal. We therefore develop a general statistical hypothesis testing framework that for the first time provides FDR control for signature discovery. Our method is demonstrated to be correct in simulation studies. When applied to five cancer data sets, the method was able to discover molecular signatures with 5% FDR in three cases, while two data sets yielded no significant findings. Conclusion Our approach enables reliable discovery of molecular signatures from genome-wide data with current sample sizes. The statistical framework developed herein is potentially applicable to a wide range of prediction problems in bioinformatics.
International Nuclear Information System (INIS)
1992-01-01
An introduction to the Alligator Rivers Region is presented. It contains general information regarding the physiography, climate, hydrology and mining of the region. The Alligator Rivers Region is within an ancient basin, the Pine Creek Geosyncline, which has an area of approximately 66000 km 2 . The Geosyncline has a history of mineral exploitation dating back to 1865, during which time 16 metals have been extracted (silver, arsenic, gold, bismuth, cadmium, cobalt, copper, iron, manganese, molybdenum, lead, tin, tantalum, uranium, tungsten, zinc). Uranium exploration in the Pine Creek Geosyncline was stimulated by the discovery in 1949 of secondary uranium mineralisation near Rum June, 70 km south-east of Darwin. This was followed by a decade of intense exploration activity resulting in the discoveries of economic uranium ore bodies at Rum Jungle and in the upper reaches of the South Alligator River Valley. All the known major uranium deposits of the East Alligator River uranium field have been discovered since 1969. The present known resources of the Geosyncline are approximately 360 000 tonnes of contained U 3 O 8 . 2 refs., 2 figs., 1 tab
Price discovery on the Johannesburg Stock Exchange: Examining ...
African Journals Online (AJOL)
Price discovery on the Johannesburg Stock Exchange: Examining the impact of the ... of price discovery aim to determine which market reflects new information first. ... This paper examines the FTSE/JSE Top 40 Index, the Top 40 Index Futures ...
Development of Scientific Approach Based on Discovery Learning Module
Ellizar, E.; Hardeli, H.; Beltris, S.; Suharni, R.
2018-04-01
Scientific Approach is a learning process, designed to make the students actively construct their own knowledge through stages of scientific method. The scientific approach in learning process can be done by using learning modules. One of the learning model is discovery based learning. Discovery learning is a learning model for the valuable things in learning through various activities, such as observation, experience, and reasoning. In fact, the students’ activity to construct their own knowledge were not optimal. It’s because the available learning modules were not in line with the scientific approach. The purpose of this study was to develop a scientific approach discovery based learning module on Acid Based, also on electrolyte and non-electrolyte solution. The developing process of this chemistry modules use the Plomp Model with three main stages. The stages are preliminary research, prototyping stage, and the assessment stage. The subject of this research was the 10th and 11th Grade of Senior High School students (SMAN 2 Padang). Validation were tested by the experts of Chemistry lecturers and teachers. Practicality of these modules had been tested through questionnaire. The effectiveness had been tested through experimental procedure by comparing student achievement between experiment and control groups. Based on the findings, it can be concluded that the developed scientific approach discovery based learning module significantly improve the students’ learning in Acid-based and Electrolyte solution. The result of the data analysis indicated that the chemistry module was valid in content, construct, and presentation. Chemistry module also has a good practicality level and also accordance with the available time. This chemistry module was also effective, because it can help the students to understand the content of the learning material. That’s proved by the result of learning student. Based on the result can conclude that chemistry module based on
SECURE SERVICE DISCOVERY BASED ON PROBE PACKET MECHANISM FOR MANETS
Directory of Open Access Journals (Sweden)
S. Pariselvam
2015-03-01
Full Text Available In MANETs, Service discovery process is always considered to be crucial since they do not possess a centralized infrastructure for communication. Moreover, different services available through the network necessitate varying categories. Hence, a need arises for devising a secure probe based service discovery mechanism to reduce the complexity in providing the services to the network users. In this paper, we propose a Secure Service Discovery Based on Probe Packet Mechanism (SSDPPM for identifying the DoS attack in MANETs, which depicts a new approach for estimating the level of trust present in each and every routing path of a mobile ad hoc network by using probe packets. Probing based service discovery mechanisms mainly identifies a mobile node’s genuineness using a test packet called probe that travels the entire network for the sake of computing the degree of trust maintained between the mobile nodes and it’s attributed impact towards the network performance. The performance of SSDPPM is investigated through a wide range of network related parameters like packet delivery, throughput, Control overhead and total overhead using the version ns-2.26 network simulator. This mechanism SSDPPM, improves the performance of the network in an average by 23% and 19% in terms of packet delivery ratio and throughput than the existing service discovery mechanisms available in the literature.
DEFF Research Database (Denmark)
Dias, Gustavo Fruet; Scherrer, Cristina; Papailias, Fotis
The price discovery literature investigates how homogenous securities traded on different markets incorporate information into prices. We take this literature one step further and investigate how these markets contribute to stochastic volatility (volatility discovery). We formally show...... that the realized measures from homogenous securities share a fractional stochastic trend, which is a combination of the price and volatility discovery measures. Furthermore, we show that volatility discovery is associated with the way that market participants process information arrival (market sensitivity......). Finally, we compute volatility discovery for 30 actively traded stocks in the U.S. and report that Nyse and Arca dominate Nasdaq....
Directory of Open Access Journals (Sweden)
Mariela Bollini
2018-03-01
Full Text Available Bovine viral diarrhea virus (BVDV is a member of the genus Pestivirus within the family Flaviviridae. BVDV causes both acute and persistent infections in cattle, leading to substantial financial losses to the livestock industry each year. The global prevalence of persistent BVDV infection and the lack of a highly effective antiviral therapy have spurred intensive efforts to discover and develop novel anti-BVDV therapies in the pharmaceutical industry. Antiviral targeting of virus envelope proteins is an effective strategy for therapeutic intervention of viral infections. We performed prospective small-molecule high-throughput docking to identify molecules that likely bind to the region delimited by domains I and II of the envelope protein E2 of BVDV. Several structurally different compounds were purchased or synthesized, and assayed for antiviral activity against BVDV. Five of the selected compounds were active displaying IC50 values in the low- to mid-micromolar range. For these compounds, their possible binding determinants were characterized by molecular dynamics simulations. A common pattern of interactions between active molecules and aminoacid residues in the binding site in E2 was observed. These findings could offer a better understanding of the interaction of BVDV E2 with these inhibitors, as well as benefit the discovery of novel and more potent BVDV antivirals.
Bollini, Mariela; Leal, Emilse S.; Adler, Natalia S.; Aucar, María G.; Fernández, Gabriela A.; Pascual, María J.; Merwaiss, Fernando; Alvarez, Diego E.; Cavasotto, Claudio N.
2018-03-01
Bovine viral diarrhea virus (BVDV) is a member of the genus Pestivirus within the family Flaviviridae. BVDV causes both acute and persistent infections in cattle, leading to substantial financial losses to the livestock industry each year. The global prevalence of persistent BVDV infection and the lack of a highly effective antiviral therapy have spurred intensive efforts to discover and develop novel anti-BVDV therapies in the pharmaceutical industry. Antiviral targeting of virus envelope proteins is an effective strategy for therapeutic intervention of viral infections. We performed prospective small-molecule high-throughput docking to identify molecules that likely bind to the region delimited by domains I and II of the envelope protein E2 of BVDV. Several structurally different compounds were purchased or synthesized, and assayed for antiviral activity against BVDV. Five of the selected compounds were active displaying IC50 values in the low- to mid-micromolar range. For these compounds, their possible binding determinants were characterized by molecular dynamics simulations. A common pattern of interactions between active molecules and aminoacid residues in the binding site in E2 was observed. These findings could offer a better understanding of the interaction of BVDV E2 with these inhibitors, as well as benefit the discovery of novel and more potent BVDV antivirals.
2010-07-01
... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Discovery. 76.21 Section 76.21 Judicial... POSSESSION OF CERTAIN CONTROLLED SUBSTANCES § 76.21 Discovery. (a) Scope. Discovery under this part covers... as a general guide for discovery practices in proceedings before the Judge. However, unless otherwise...
BCL-2: Long and winding path from discovery to therapeutic target
International Nuclear Information System (INIS)
Schenk, Robyn L.; Strasser, Andreas; Dewson, Grant
2017-01-01
In 1988, the BCL-2 protein was found to promote cancer by limiting cell death rather than enhancing proliferation. This discovery set the wheels in motion for an almost 30 year journey involving many international research teams that has recently culminated in the approval for a drug, ABT-199/venetoclax/Venclexta that targets this protein in the treatment of cancer. This review will describe the long and winding path from the discovery of this protein and understanding the fundamental process of apoptosis that BCL-2 and its numerous homologues control, through to its exploitation as a drug target that is set to have significant benefit for cancer patients. - Highlights: • BCL-2 proteins control the intrinsic or mitochondrial pathway of apoptosis. • Defective apoptosis is a hallmark of cancer. • BH3-mimetics inhibit pro-survival BCL-2 proteins to induce cancer cell death. • ABT-199/venetoclax is approved for treatment of chronic lymphocytic leukaemia.
Discovery of a protostar in the Large Magellanic Cloud
International Nuclear Information System (INIS)
Gatley, I.; Becklin, E.E.; Hyland, A.R.; Jones, T.J.
1981-01-01
A near infrared search of the H II region/molecular cloud complex N 159 in the Large Magellanic Cloud has revealed a very red (H-K = 2.1, K-L' = 2.7) compact object. The location, brightness, colour and 2.1 to 2.4 μm spectrum of this source suggest that it is very young, and similar to the galactic infrared 'protostars'. This is the first identification of an infrared protostar in an external galaxy. Its discovery provides direct evidence of current star formation in the Large Magellanic Cloud, and suggests that regions of star formation in external galaxies will appear similar to those in the Milky Way. (author)
Park, Woon Bae; Singh, Satendra Pal; Sohn, Kee-Sun
2014-02-12
Most of the novel phosphors that appear in the literature are either a variant of well-known materials or a hybrid material consisting of well-known materials. This situation has actually led to intellectual property (IP) complications in industry and several lawsuits have been the result. Therefore, the definition of a novel phosphor for use in light-emitting diodes should be clarified. A recent trend in phosphor-related IP applications has been to focus on the novel crystallographic structure, so that a slight composition variance and/or the hybrid of a well-known material would not qualify from either a scientific or an industrial point of view. In our previous studies, we employed a systematic materials discovery strategy combining heuristics optimization and a high-throughput process to secure the discovery of genuinely novel and brilliant phosphors that would be immediately ready for use in light emitting diodes. Despite such an achievement, this strategy requires further refinement to prove its versatility under any circumstance. To accomplish such demands, we improved our discovery strategy by incorporating an elitism-involved nondominated sorting genetic algorithm (NSGA-II) that would guarantee the discovery of truly novel phosphors in the present investigation. Using the improved discovery strategy, we discovered an Eu(2+)-doped AB5X8 (A = Sr or Ba, B = Si and Al, X = O and N) phosphor in an orthorhombic structure (A21am) with lattice parameters a = 9.48461(3) Å, b = 13.47194(6) Å, c = 5.77323(2) Å, α = β = γ = 90°, which cannot be found in any of the existing inorganic compound databases.
2010-01-01
... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Discovery. 719.10 Section 719.10... Discovery. (a) General. The parties are encouraged to engage in voluntary discovery regarding any matter... the Federal Rules of Civil Procedure relating to discovery apply to the extent consistent with this...
2010-07-01
... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Discovery. 42.21 Section... IMPLEMENTING THE PROGRAM FRAUD CIVIL REMEDIES ACT § 42.21 Discovery. (a) The following types of discovery are... creation of a document. (c) Unless mutually agreed to by the parties, discovery is available only as...
2010-04-01
... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Discovery. 521.21 Section 521.21 Foreign... Discovery. (a) The following types of discovery are authorized: (1) Requests for production of documents for... interpreted to require the creation of a document. (c) Unless mutually agreed to by the parties, discovery is...
2010-01-01
... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Discovery. 766.9 Section 766.9... PROCEEDINGS § 766.9 Discovery. (a) General. The parties are encouraged to engage in voluntary discovery... provisions of the Federal Rules of Civil Procedure relating to discovery apply to the extent consistent with...
THE GREEN BANK TELESCOPE H II REGION DISCOVERY SURVEY. IV. HELIUM AND CARBON RECOMBINATION LINES
Energy Technology Data Exchange (ETDEWEB)
Wenger, Trey V.; Bania, T. M. [Astronomy Department, 725 Commonwealth Avenue, Boston University, Boston, MA 02215 (United States); Balser, Dana S. [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA, 22903-2475 (United States); Anderson, L. D. [Department of Physics, West Virginia University, Morgantown, WV 26506 (United States)
2013-02-10
The Green Bank Telescope H II Region Discovery Survey (GBT HRDS) found hundreds of previously unknown Galactic regions of massive star formation by detecting hydrogen radio recombination line (RRL) emission from candidate H II region targets. Since the HRDS nebulae lie at large distances from the Sun, they are located in previously unprobed zones of the Galactic disk. Here, we derive the properties of helium and carbon RRL emission from HRDS nebulae. Our target sample is the subset of the HRDS that has visible helium or carbon RRLs. This criterion gives a total of 84 velocity components (14% of the HRDS) with helium emission and 52 (9%) with carbon emission. For our highest quality sources, the average {sup 4}He{sup +}/H{sup +} abundance ratio by number, (y {sup +}), is 0.068 {+-} 0.023(1{sigma}). This is the same ratio as that measured for the sample of previously known Galactic H II regions. Nebulae without detected helium emission give robust y {sup +} upper limits. There are 5 RRL emission components with y {sup +} less than 0.04 and another 12 with upper limits below this value. These H II regions must have either a very low {sup 4}He abundance or contain a significant amount of neutral helium. The HRDS has 20 nebulae with carbon RRL emission but no helium emission at its sensitivity level. There is no correlation between the carbon RRL parameters and the 8 {mu}m mid-infrared morphology of these nebulae.
Polar Domain Discovery with Sparkler
Duerr, R.; Khalsa, S. J. S.; Mattmann, C. A.; Ottilingam, N. K.; Singh, K.; Lopez, L. A.
2017-12-01
The scientific web is vast and ever growing. It encompasses millions of textual, scientific and multimedia documents describing research in a multitude of scientific streams. Most of these documents are hidden behind forms which require user action to retrieve and thus can't be directly accessed by content crawlers. These documents are hosted on web servers across the world, most often on outdated hardware and network infrastructure. Hence it is difficult and time-consuming to aggregate documents from the scientific web, especially those relevant to a specific domain. Thus generating meaningful domain-specific insights is currently difficult. We present an automated discovery system (Figure 1) using Sparkler, an open-source, extensible, horizontally scalable crawler which facilitates high throughput and focused crawling of documents pertinent to a particular domain such as information about polar regions. With this set of highly domain relevant documents, we show that it is possible to answer analytical questions about that domain. Our domain discovery algorithm leverages prior domain knowledge to reach out to commercial/scientific search engines to generate seed URLs. Subject matter experts then annotate these seed URLs manually on a scale from highly relevant to irrelevant. We leverage this annotated dataset to train a machine learning model which predicts the `domain relevance' of a given document. We extend Sparkler with this model to focus crawling on documents relevant to that domain. Sparkler avoids disruption of service by 1) partitioning URLs by hostname such that every node gets a different host to crawl and by 2) inserting delays between subsequent requests. With an NSF-funded supercomputer Wrangler, we scaled our domain discovery pipeline to crawl about 200k polar specific documents from the scientific web, within a day.
Research of using mobile agents for information discovery in P2P networks
International Nuclear Information System (INIS)
Lan Yan; Yao Qing
2003-01-01
The technology of P2P is a new network-computing model that has great value of commerce and technology. After analyzing the current information discovery technology in P2P network, a new solution that is based on mobile agent is proposed. The mobile agent solution can reduce the need of bandwidth, be adapt to the dynamic of P2P network, and be asynchronous and be very fault tolerant. (authors)
Effectiveness of discovery learning model on mathematical problem solving
Herdiana, Yunita; Wahyudin, Sispiyati, Ririn
2017-08-01
This research is aimed to describe the effectiveness of discovery learning model on mathematical problem solving. This research investigate the students' problem solving competency before and after learned by using discovery learning model. The population used in this research was student in grade VII in one of junior high school in West Bandung Regency. From nine classes, class VII B were randomly selected as the sample of experiment class, and class VII C as control class, which consist of 35 students every class. The method in this research was quasi experiment. The instrument in this research is pre-test, worksheet and post-test about problem solving of mathematics. Based on the research, it can be conclude that the qualification of problem solving competency of students who gets discovery learning model on level 80%, including in medium category and it show that discovery learning model effective to improve mathematical problem solving.
Price interactions and discovery among natural gas spot markets in North America
International Nuclear Information System (INIS)
Park, Haesun; Mjelde, James W.; Bessler, David A.
2008-01-01
Recent advances in modeling causal flows with time series analysis are used to study relationships among eight North American natural gas spot market prices. Results indicate that the Canadian and US natural gas market is a single highly integrated market. Further results indicate that price discovery tends to reflect both regions of excess demand and supply. Across North America, Malin Hub in Oregon, Chicago Hub, Illinois, Waha, Texas, and Henry Hub, Louisiana region, are the most important markets for price discovery. Opal Hub in Wyoming is an information sink in contemporaneous time, receiving price information but passing on no price information. AECO Hub in Alberta, Canada, receives price signals from several markets and passes on information to Opal and the Oklahoma region. (author)
DISCOVERY OF TeV GAMMA-RAY EMISSION TOWARD SUPERNOVA REMNANT SNR G78.2+2.1
Energy Technology Data Exchange (ETDEWEB)
Aliu, E. [Department of Physics and Astronomy, Barnard College, Columbia University, NY 10027 (United States); Archambault, S. [Physics Department, McGill University, Montreal, QC H3A 2T8 (Canada); Arlen, T.; Aune, T. [Department of Physics and Astronomy, University of California, Los Angeles, CA 90095 (United States); Beilicke, M.; Buckley, J. H.; Bugaev, V.; Dickherber, R. [Department of Physics, Washington University, St. Louis, MO 63130 (United States); Benbow, W. [Fred Lawrence Whipple Observatory, Harvard-Smithsonian Center for Astrophysics, Amado, AZ 85645 (United States); Bird, R.; Cannon, A.; Collins-Hughes, E. [School of Physics, University College Dublin, Belfield, Dublin 4 (Ireland); Bouvier, A. [Santa Cruz Institute for Particle Physics and Department of Physics, University of California, Santa Cruz, CA 95064 (United States); Bradbury, S. M. [School of Physics and Astronomy, University of Leeds, Leeds, LS2 9JT (United Kingdom); Byrum, K. [Argonne National Laboratory, 9700 S. Cass Avenue, Argonne, IL 60439 (United States); Cesarini, A.; Connolly, M. P. [School of Physics, National University of Ireland Galway, University Road, Galway (Ireland); Ciupik, L. [Astronomy Department, Adler Planetarium and Astronomy Museum, Chicago, IL 60605 (United States); Cui, W. [Department of Physics, Purdue University, West Lafayette, IN 47907 (United States); Duke, C., E-mail: amandajw@iastate.edu [Department of Physics, Grinnell College, Grinnell, IA 50112-1690 (United States); and others
2013-06-20
We report the discovery of an unidentified, extended source of very-high-energy gamma-ray emission, VER J2019+407, within the radio shell of the supernova remnant SNR G78.2+2.1, using 21.4 hr of data taken by the VERITAS gamma-ray observatory in 2009. These data confirm the preliminary indications of gamma-ray emission previously seen in a two-year (2007-2009) blind survey of the Cygnus region by VERITAS. VER J2019+407, which is detected at a post-trials significance of 7.5 standard deviations in the 2009 data, is localized to the northwestern rim of the remnant in a region of enhanced radio and X-ray emission. It has an intrinsic extent of 0.23 Degree-Sign .23 {+-} 0. Degree-Sign 03{sub stat-0 Degree-Sign .02sys}{sup +0 Degree-Sign .04} and its spectrum is well-characterized by a differential power law (dN/dE = N{sub 0} Multiplication-Sign (E/TeV){sup -{Gamma}}) with a photon index of {Gamma} = 2.37 {+-} 0.14{sub stat} {+-} 0.20{sub sys} and a flux normalization of N{sub 0} = 1.5 {+-} 0.2{sub stat} {+-} 0.4{sub sys} Multiplication-Sign 10{sup -12} photon TeV{sup -1} cm{sup -2} s{sup -1}. This yields an integral flux of 5.2 {+-} 0.8{sub stat} {+-} 1.4{sub sys} Multiplication-Sign 10{sup -12} photon cm{sup -2} s{sup -1} above 320 GeV, corresponding to 3.7% of the Crab Nebula flux. We consider the relationship of the TeV gamma-ray emission with the GeV gamma-ray emission seen from SNR G78.2+2.1 as well as that seen from a nearby cocoon of freshly accelerated cosmic rays. Multiple scenarios are considered as possible origins for the TeV gamma-ray emission, including hadronic particle acceleration at the SNR shock.
Choosing Discovery: A Literature Review on the Selection and Evaluation of Discovery Layers
Moore, Kate B.; Greene, Courtney
2012-01-01
Within the next few years, traditional online public access catalogs will be replaced by more robust and interconnected discovery layers that can serve as primary public interfaces to simultaneously search many separate collections of resources. Librarians have envisioned this type of discovery tool since the 1980s, and research shows that…
Relay discovery and selection for large-scale P2P streaming.
Directory of Open Access Journals (Sweden)
Chengwei Zhang
Full Text Available In peer-to-peer networks, application relays have been commonly used to provide various networking services. The service performance often improves significantly if a relay is selected appropriately based on its network location. In this paper, we studied the location-aware relay discovery and selection problem for large-scale P2P streaming networks. In these large-scale and dynamic overlays, it incurs significant communication and computation cost to discover a sufficiently large relay candidate set and further to select one relay with good performance. The network location can be measured directly or indirectly with the tradeoffs between timeliness, overhead and accuracy. Based on a measurement study and the associated error analysis, we demonstrate that indirect measurements, such as King and Internet Coordinate Systems (ICS, can only achieve a coarse estimation of peers' network location and those methods based on pure indirect measurements cannot lead to a good relay selection. We also demonstrate that there exists significant error amplification of the commonly used "best-out-of-K" selection methodology using three RTT data sets publicly available. We propose a two-phase approach to achieve efficient relay discovery and accurate relay selection. Indirect measurements are used to narrow down a small number of high-quality relay candidates and the final relay selection is refined based on direct probing. This two-phase approach enjoys an efficient implementation using the Distributed-Hash-Table (DHT. When the DHT is constructed, the node keys carry the location information and they are generated scalably using indirect measurements, such as the ICS coordinates. The relay discovery is achieved efficiently utilizing the DHT-based search. We evaluated various aspects of this DHT-based approach, including the DHT indexing procedure, key generation under peer churn and message costs.
International Nuclear Information System (INIS)
Cherenkov, P.A.
1986-01-01
The author, the discoverer of the Cherenkov radiation, recalls some interesting circumstances of his discoery 50 years ago and puts it into the context of the knowledge of the period. The discovery of Cherenkov radiation which today is in practice used especially for the detection of charged particles, was correctly understood and appreciated somewhat belatedly. At first the discovery was met with distrust and the original article announcing it was rejected by the magazine Nature. In effect, the discovery was not the result of any planned experiment but was the by-product of another research. It was, of course, allowed by previous achievements in various fields of physics, namely progress reached in the study of luminescence by S.I. Vavilov and his pupils. The discovery was made during an experimental study of luminescence induced in liquids by the β and γ radiations of uranyl salts. During his attempts to suppress the background radiation from vessel walls the autor found a ''background'' from pure solvent which differed from luminescence by being independent of the concentration, temperature and viscosity of the liquid. A closer examination of the phenomenon more or less by accident revealed its marked spatial asymmetry which had major importance for the development of the theory of the new phenomenon by I.V. Tamm and I.M. Frank. (A.K.)
Discovery of path nearby clusters in spatial networks
Shang, Shuo; Zheng, Kai; Jensen, Christian S.; Yang, Bin; Kalnis, Panos; Li, Guohe; Wen, Ji Rong
2015-01-01
The discovery of regions of interest in large cities is an important challenge. We propose and investigate a novel query called the path nearby cluster (PNC) query that finds regions of potential interest (e.g., sightseeing places and commercial
Revisiting lab-on-a-chip technology for drug discovery.
Neuži, Pavel; Giselbrecht, Stefan; Länge, Kerstin; Huang, Tony Jun; Manz, Andreas
2012-08-01
The field of microfluidics or lab-on-a-chip technology aims to improve and extend the possibilities of bioassays, cell biology and biomedical research based on the idea of miniaturization. Microfluidic systems allow more accurate modelling of physiological situations for both fundamental research and drug development, and enable systematic high-volume testing for various aspects of drug discovery. Microfluidic systems are in development that not only model biological environments but also physically mimic biological tissues and organs; such 'organs on a chip' could have an important role in expediting early stages of drug discovery and help reduce reliance on animal testing. This Review highlights the latest lab-on-a-chip technologies for drug discovery and discusses the potential for future developments in this field.
Directory of Open Access Journals (Sweden)
Recep Colak
2010-10-01
Full Text Available Computational prediction of functionally related groups of genes (functional modules from large-scale data is an important issue in computational biology. Gene expression experiments and interaction networks are well studied large-scale data sources, available for many not yet exhaustively annotated organisms. It has been well established, when analyzing these two data sources jointly, modules are often reflected by highly interconnected (dense regions in the interaction networks whose participating genes are co-expressed. However, the tractability of the problem had remained unclear and methods by which to exhaustively search for such constellations had not been presented.We provide an algorithmic framework, referred to as Densely Connected Biclustering (DECOB, by which the aforementioned search problem becomes tractable. To benchmark the predictive power inherent to the approach, we computed all co-expressed, dense regions in physical protein and genetic interaction networks from human and yeast. An automatized filtering procedure reduces our output which results in smaller collections of modules, comparable to state-of-the-art approaches. Our results performed favorably in a fair benchmarking competition which adheres to standard criteria. We demonstrate the usefulness of an exhaustive module search, by using the unreduced output to more quickly perform GO term related function prediction tasks. We point out the advantages of our exhaustive output by predicting functional relationships using two examples.We demonstrate that the computation of all densely connected and co-expressed regions in interaction networks is an approach to module discovery of considerable value. Beyond confirming the well settled hypothesis that such co-expressed, densely connected interaction network regions reflect functional modules, we open up novel computational ways to comprehensively analyze the modular organization of an organism based on prevalent and largely
Colak, Recep; Moser, Flavia; Chu, Jeffrey Shih-Chieh; Schönhuth, Alexander; Chen, Nansheng; Ester, Martin
2010-10-25
Computational prediction of functionally related groups of genes (functional modules) from large-scale data is an important issue in computational biology. Gene expression experiments and interaction networks are well studied large-scale data sources, available for many not yet exhaustively annotated organisms. It has been well established, when analyzing these two data sources jointly, modules are often reflected by highly interconnected (dense) regions in the interaction networks whose participating genes are co-expressed. However, the tractability of the problem had remained unclear and methods by which to exhaustively search for such constellations had not been presented. We provide an algorithmic framework, referred to as Densely Connected Biclustering (DECOB), by which the aforementioned search problem becomes tractable. To benchmark the predictive power inherent to the approach, we computed all co-expressed, dense regions in physical protein and genetic interaction networks from human and yeast. An automatized filtering procedure reduces our output which results in smaller collections of modules, comparable to state-of-the-art approaches. Our results performed favorably in a fair benchmarking competition which adheres to standard criteria. We demonstrate the usefulness of an exhaustive module search, by using the unreduced output to more quickly perform GO term related function prediction tasks. We point out the advantages of our exhaustive output by predicting functional relationships using two examples. We demonstrate that the computation of all densely connected and co-expressed regions in interaction networks is an approach to module discovery of considerable value. Beyond confirming the well settled hypothesis that such co-expressed, densely connected interaction network regions reflect functional modules, we open up novel computational ways to comprehensively analyze the modular organization of an organism based on prevalent and largely available large
2010-01-01
... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Discovery. 785.8 Section 785.8... INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE ADDITIONAL PROTOCOL REGULATIONS ENFORCEMENT § 785.8 Discovery. (a) General. The parties are encouraged to engage in voluntary discovery regarding any matter, not...
An explanation of resisted discoveries based on construal-level theory.
Fang, Hui
2015-02-01
New discoveries and theories are crucial for the development of science, but they are often initially resisted by the scientific community. This paper analyses resistance to scientific discoveries that supplement previous research results or conclusions with new phenomena, such as long chains in macromolecules, Alfvén waves, parity nonconservation in weak interactions and quasicrystals. Construal-level theory is used to explain that the probability of new discoveries may be underestimated because of psychological distance. Thus, the insufficiently examined scope of an accepted theory may lead to overstating the suitable scope and underestimating the probability of its undiscovered counter-examples. Therefore, psychological activity can result in people instinctively resisting new discoveries. Direct evidence can help people judge the validity of a hypothesis with rational thinking. The effects of authorities and textbooks on the resistance to discoveries are also discussed. From the results of our analysis, suggestions are provided to reduce resistance to real discoveries, which will benefit the development of science.
Performance measurements for the PET/CT Discovery-600 using NEMA NU 2-2007 standards
International Nuclear Information System (INIS)
De Ponti, E.; Morzenti, S.; Guerra, L.; Pasquali, C.; Arosio, M.; Bettinardi, V.; Crespi, A.; Gilardi, M. C.; Messa, C.
2011-01-01
Purpose: The aim of this study was to assess the performance measurements of the new PET/CT system Discovery-600 (D-600, GEMS, Milwaukee, WI). Methods: Performance measures were obtained with the National Electrical Manufacturers Association (NEMA) NU 2-2007 procedures. Results: The transverse (axial) spatial resolution FWHMs were 4.9 (5.6) mm and 5.6 (6.4) mm at 1 and 10 cm off axis, respectively. The sensitivity (average at 0 and 10 cm) was 9.6 cps/kBq. The scatter fraction was 36.6% (low energy threshold: 425 keV). The NEC peak rate (k=1) was 75.2 kcps at 12.9 kBq/cc. The hot contrasts for 10, 13, 17, and 22 mm spheres were 41%, 51%, 62%, and 73% and the cold contrasts for 28 and 37 mm spheres were 68% and 72%. Conclusions: The Discovery-600 has good performance for the NEMA NU 2-2007 parameters, particularly in improved sensitivity compared to the scanners of the same Discovery family, D-ST and D-STE.
Discovery Mondays: Zoom on materials
2003-01-01
Following the success of the first Discovery Monday, which had over 100 visitors, the series of evening events in Microcosm continues. On Monday 2nd June, discover the world of materials. Find out how CERN scientists examine, manufacture and study different materials, at different scales. Did you know for example that using electrons you can observe a hair at a scale equivalent to looking at a boat with the naked eye? Also, that using ultrasound, you can measure the thickness of an object that is completely inaccessible? Find out more about these techniques, and also the high-tech machining and soldering that is carried out in CERN's central workshop. Plus, see how engineers can detect tiny leaks through solder points - essential for maintaining the vacuum in the LHC. The evening is open to all, without reservation, suggested age 12 and above. Rendez-vous in Microcosm on Monday 2nd June From 19.30 - 21.00 Free entry For more information : http://www.cern.ch/microcosm Using a scanning microscope, the head o...
2010-04-01
... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Discovery. 355.21 Section 355.21 Employees... UNDER THE PROGRAM FRAUD CIVIL REMEDIES ACT OF 1986 § 355.21 Discovery. (a) The following types of discovery are authorized: (1) Requests for production of documents for inspection and copying; (2) Requests...
2010-07-01
... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Discovery. 71.21 Section 71.21 Judicial... REMEDIES ACT OF 1986 Implementation for Actions Initiated by the Department of Justice § 71.21 Discovery. (a) The following types of discovery are authorized: (1) Requests for production of documents for...
2010-01-01
... 7 Agriculture 1 2010-01-01 2010-01-01 false Discovery. 1.322 Section 1.322 Agriculture Office of... Under the Program Fraud Civil Remedies Act of 1986 § 1.322 Discovery. (a) The following types of discovery are authorized: (1) Requests for production, inspection and photocopying of documents; (2...
2010-01-01
... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Discovery. 308.520 Section 308.520 Banks and... PROCEDURE Program Fraud Civil Remedies and Procedures § 308.520 Discovery. (a) The following types of discovery are authorized: (1) Requests for production of documents for inspection and copying; (2) Requests...
STS-121: Discovery L-2 Countdown Status Briefing
2006-01-01
Bruce Buckingham from NASA Public Affairs introduces Pete Nicolenko, NASA Test Director, and Kathy Winters, Shuttle Weather Officer. During this STS-121 two days before launch countdown briefing, Pete Nicolenko says that there are no issues of concern and that they are on schedule for launch. He then presents and discusses an Orbiter Processing Facility (OPF) video. The OPF topics of discussion include: 1) Wheel and tire installation; 2) Gap filler installation; 3) Booster build-up; 4) Transport of External Tank (ET) 119; 5) ET to Shuttle Rocket Booster (SRB) Mate operation; 6) Roll-over of Discovery out of OPF to the Vehicle Assembly Building (VAB); and 7) Roll-out to the pad. Kathy Winters gives her weather forecast for the STS-121 launch. The video ends with a question and answer period from the media.
2010-10-01
... 42 Public Health 2 2010-10-01 2010-10-01 false Discovery. 405.1037 Section 405.1037 Public Health... Appeals Under Original Medicare (Part A and Part B) Alj Hearings § 405.1037 Discovery. (a) General rules. (1) Discovery is permissible only when CMS or its contractor elects to participate in an ALJ hearing...
2010-04-01
... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Discovery. 498.207 Section 498.207 Employees... § 498.207 Discovery. (a) For the purpose of inspection and copying, a party may make a request to...) Any form of discovery other than that permitted under paragraph (a) of this section, such as requests...
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Discovery. 22.21 Section 22.21 Labor Office of the Secretary of Labor PROGRAM FRAUD CIVIL REMEDIES ACT OF 1986 § 22.21 Discovery. (a) The following types of discovery are authorized: (1) Requests for production of documents for inspection and copying; (2) Requests...
Sosa, A.; Fernández, J. A.; Pais, P.
2012-12-01
We study the dynamical evolution of the near-Earth Jupiter family comets (NEJFCs) that came close to or crossed the Earth's orbit at the epoch of their discovery (perihelion distances qdisc time evolution of the mean perihelion distance bar{q} of the NEJFCs at the discovery time of each comet (taken as t = 0) and a past-future asymmetry of bar{q} in an interval -1000 yr, +1000 yr centred on t = 0, confirming previous results. The asymmetry indicates that there are more comets with greater q in the past than in the future. For comparison purposes, we also analysed the population of near-Earth asteroids in cometary orbits (defined as those with aphelion distances Q > 4.5 AU) and with absolute magnitudes H time a large sample of fictitious comets, cloned from the observed NEJFCs, over a 20 000 yr time interval and started the integration before the comet's discovery time, when it had a perihelion distance q > 2 AU. By assuming that NEJFCs are mostly discovered when they decrease their perihelion distances below a certain threshold qthre = 1.05 AU for the first time during their evolution, we were able to reproduce the main features of the observed bar{q} evolution in the interval [-1000, 1000] yr with respect to the discovery time. Our best fits indicate that 40% of the population of NEJFCs would be composed of young, fresh comets that entered the region q spending at least 3000 yr in the q family comets (JFCs).
Novel opportunities for computational biology and sociology in drug discovery
Yao, Lixia
2009-01-01
Drug discovery today is impossible without sophisticated modeling and computation. In this review we touch on previous advances in computational biology and by tracing the steps involved in pharmaceutical development, we explore a range of novel, high value opportunities for computational innovation in modeling the biological process of disease and the social process of drug discovery. These opportunities include text mining for new drug leads, modeling molecular pathways and predicting the efficacy of drug cocktails, analyzing genetic overlap between diseases and predicting alternative drug use. Computation can also be used to model research teams and innovative regions and to estimate the value of academy-industry ties for scientific and human benefit. Attention to these opportunities could promise punctuated advance, and will complement the well-established computational work on which drug discovery currently relies. PMID:19674801
Some historical glimpses on the discovery of x-rays and radioactivity
International Nuclear Information System (INIS)
Patil, S.K.
1996-01-01
In the last decade of the nineteenth century, a cascade of a number of scientific discoveries of great importance took place. The first of these was the discovery of x-rays which marked the beginning of a new era in physics and this was soon followed by the discovery of radioactivity. Both x-rays and radioactivity have wide applications in basic science, technology and medicine. Some glimpses on the historical aspects of the discovery of x-rays and radioactivity are presented. (author). 72 refs., 1 fig
Therapeutics discovery: From bench to first in-human trials.
Al-Hujaily, Ensaf M; Khatlani, Tanvir; Alehaideb, Zeyad; Ali, Rizwan; Almuzaini, Bader; Alrfaei, Bahauddeen M; Iqbal, Jahangir; Islam, Imadul; Malik, Shuja; Marwani, Bader A; Massadeh, Salam; Nehdi, Atef; Alsomaie, Barrak; Debasi, Bader; Bushnak, Ibraheem; Noibi, Saeed; Hussain, Syed; Wajid, Wahid Abdul; Armand, Jean-Pierre; Gul, Sheraz; Oyarzabal, Julen; Rais, Rana; Bountra, Chas; Alaskar, Ahmed; Knawy, Bander Al; Boudjelal, Mohamed
2018-03-01
The 'Therapeutics discovery: From bench to first in-human trials' conference, held at the King Abdullah International Medical Research Center (KAIMRC), Ministry of National Guard Health Affairs (MNGHA), Kingdom of Saudi Arabia (KSA) from October 10-12, 2017, provided a unique opportunity for experts worldwide to discuss advances in drug discovery and development, focusing on phase I clinical trials. It was the first event of its kind to be hosted at the new research center, which was constructed to boost drug discovery and development in the KSA in collaboration with institutions, such as the Academic Drug Discovery Consortium in the United States of America (USA), Structural Genomics Consortium of the University of Oxford in the United Kingdom (UK), and Institute of Materia Medica of the Chinese Academy of Medical Sciences in China. The program was divided into two parts. A pre-symposium day took place on October 10, during which courses were conducted on clinical trials, preclinical drug discovery, molecular biology and nanofiber research. The attendees had the opportunity for one-to-one meetings with international experts to exchange information and foster collaborations. In the second part of the conference, which took place on October 11 and 12, the clinical trials pipeline, design and recruitment of volunteers, and economic impact of clinical trials were discussed. The Saudi Food and Drug Administration presented the regulations governing clinical trials in the KSA. The process of preclinical drug discovery from small molecules, cellular and immunologic therapies, and approaches to identifying new targets were also presented. The recommendation of the conference was that researchers in the KSA must invest more fund, talents and infrastructure to lead the region in phase I clinical trials and preclinical drug discovery. Diseases affecting the local population, such as Middle East Respiratory Syndrome and resistant bacterial infections, represent the optimal
2010-04-01
... 19 Customs Duties 3 2010-04-01 2010-04-01 false Discovery. 356.20 Section 356.20 Customs Duties... § 356.20 Discovery. (a) Voluntary discovery. All parties are encouraged to engage in voluntary discovery... sanctions proceeding. (b) Limitations on discovery. The administrative law judge shall place such limits...
Quach, N.; Huang, T.; Boening, C.; Gill, K. M.
2016-12-01
Research related to sea level rise crosses multiple disciplines from sea ice to land hydrology. The NASA Sea Level Change Portal (SLCP) is a one-stop source for current sea level change information and data, including interactive tools for accessing and viewing regional data, a virtual dashboard of sea level indicators, and ongoing updates through a suite of editorial products that include content articles, graphics, videos, and animations. The architecture behind the SLCP makes it possible to integrate web content and data relevant to sea level change that are archived across various data centers as well as new data generated by sea level change principal investigators. The Extensible Data Gateway Environment (EDGE) is incorporated into the SLCP architecture to provide a unified platform for web content and science data discovery. EDGE is a data integration platform designed to facilitate high-performance geospatial data discovery and access with the ability to support multi-metadata standard specifications. EDGE has the capability to retrieve data from one or more sources and package the resulting sets into a single response to the requestor. With this unified endpoint, the Data Analysis Tool that is available on the SLCP can retrieve dataset and granule level metadata as well as perform geospatial search on the data. This talk focuses on the architecture that makes it possible to seamlessly integrate and enable discovery of disparate data relevant to sea level rise.
Open innovation for phenotypic drug discovery: The PD2 assay panel.
Lee, Jonathan A; Chu, Shaoyou; Willard, Francis S; Cox, Karen L; Sells Galvin, Rachelle J; Peery, Robert B; Oliver, Sarah E; Oler, Jennifer; Meredith, Tamika D; Heidler, Steven A; Gough, Wendy H; Husain, Saba; Palkowitz, Alan D; Moxham, Christopher M
2011-07-01
Phenotypic lead generation strategies seek to identify compounds that modulate complex, physiologically relevant systems, an approach that is complementary to traditional, target-directed strategies. Unlike gene-specific assays, phenotypic assays interrogate multiple molecular targets and signaling pathways in a target "agnostic" fashion, which may reveal novel functions for well-studied proteins and discover new pathways of therapeutic value. Significantly, existing compound libraries may not have sufficient chemical diversity to fully leverage a phenotypic strategy. To address this issue, Eli Lilly and Company launched the Phenotypic Drug Discovery Initiative (PD(2)), a model of open innovation whereby external research groups can submit compounds for testing in a panel of Lilly phenotypic assays. This communication describes the statistical validation, operations, and initial screening results from the first PD(2) assay panel. Analysis of PD(2) submissions indicates that chemical diversity from open source collaborations complements internal sources. Screening results for the first 4691 compounds submitted to PD(2) have confirmed hit rates from 1.6% to 10%, with the majority of active compounds exhibiting acceptable potency and selectivity. Phenotypic lead generation strategies, in conjunction with novel chemical diversity obtained via open-source initiatives such as PD(2), may provide a means to identify compounds that modulate biology by novel mechanisms and expand the innovation potential of drug discovery.
BLSSpeller: exhaustive comparative discovery of conserved cis-regulatory elements.
De Witte, Dieter; Van de Velde, Jan; Decap, Dries; Van Bel, Michiel; Audenaert, Pieter; Demeester, Piet; Dhoedt, Bart; Vandepoele, Klaas; Fostier, Jan
2015-12-01
The accurate discovery and annotation of regulatory elements remains a challenging problem. The growing number of sequenced genomes creates new opportunities for comparative approaches to motif discovery. Putative binding sites are then considered to be functional if they are conserved in orthologous promoter sequences of multiple related species. Existing methods for comparative motif discovery usually rely on pregenerated multiple sequence alignments, which are difficult to obtain for more diverged species such as plants. As a consequence, misaligned regulatory elements often remain undetected. We present a novel algorithm that supports both alignment-free and alignment-based motif discovery in the promoter sequences of related species. Putative motifs are exhaustively enumerated as words over the IUPAC alphabet and screened for conservation using the branch length score. Additionally, a confidence score is established in a genome-wide fashion. In order to take advantage of a cloud computing infrastructure, the MapReduce programming model is adopted. The method is applied to four monocotyledon plant species and it is shown that high-scoring motifs are significantly enriched for open chromatin regions in Oryza sativa and for transcription factor binding sites inferred through protein-binding microarrays in O.sativa and Zea mays. Furthermore, the method is shown to recover experimentally profiled ga2ox1-like KN1 binding sites in Z.mays. BLSSpeller was written in Java. Source code and manual are available at http://bioinformatics.intec.ugent.be/blsspeller Klaas.Vandepoele@psb.vib-ugent.be or jan.fostier@intec.ugent.be. Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.
Wide-Area Publish/Subscribe Mobile Resource Discovery Based on IPv6 GeoNetworking
Noguchi, Satoru; Matsuura, Satoshi; Inomata, Atsuo; Fujikawa, Kazutoshi; Sunahara, Hideki
2013-01-01
Resource discovery is an essential function for distributed mobile applications integrated in vehicular communication systems. Key requirements of the mobile resource discovery are wide-area geographic-based discovery and scalable resource discovery not only inside a vehicular ad-hoc network but also through the Internet. While a number of resource discovery solutions have been proposed, most of them have focused on specific scale of network. Furthermore, managing a large number of mobile res...
2010-07-01
... 39 Postal Service 1 2010-07-01 2010-07-01 false Discovery. 963.14 Section 963.14 Postal Service... PANDERING ADVERTISEMENTS STATUTE, 39 U.S.C. 3008 § 963.14 Discovery. Discovery is to be conducted on a... such discovery as he or she deems reasonable and necessary. Discovery may include one or more of the...
DEFF Research Database (Denmark)
Sannino, Francesco
2013-01-01
has been challenged by the discovery of a not-so-heavy Higgs-like state. I will therefore review the recent discovery \\cite{Foadi:2012bb} that the standard model top-induced radiative corrections naturally reduce the intrinsic non-perturbative mass of the composite Higgs state towards the desired...... via first principle lattice simulations with encouraging results. The new findings show that the recent naive claims made about new strong dynamics at the electroweak scale being disfavoured by the discovery of a not-so-heavy composite Higgs are unwarranted. I will then introduce the more speculative......I discuss the impact of the discovery of a Higgs-like state on composite dynamics starting by critically examining the reasons in favour of either an elementary or composite nature of this state. Accepting the standard model interpretation I re-address the standard model vacuum stability within...
Benthic boundary layer - IOS Observational Programme: Discovery Gap measurements, March 1984
International Nuclear Information System (INIS)
Saunders, P.M.
1984-01-01
A narrow gap in the East Azores Fracture Zone provides a channel for the exchange of the bottom water between the Madeira and Iberian abyssal basins. It is named Discovery Gap and a detailed survey defines its length, morphology and sills. Year-long measurements of flow are made from six moorings and ten current meters. This data is supplemented by numerous measurements of temperature made from ship-lowered instruments. A persistent S-N flow is found in Discovery Gap and an estimate of the flux of water colder than 2.05 deg C (potential temperature) is made. This discharge spreads over a region beyond the Gap exit where it is warmed both by the geothermal heating from the seabed and also by mixing with the overlying warm water. An estimate of approximately 2 cm 2 s -1 for the through density surface diffusion is derived, quite similar to two values determined from much larger channels in the Western Atlantic. It is not known whether most of the mixing takes place near the sea-bed or not. The values are in quite striking contrast to those derived for diffusion along a density surface: in Discovery Gap values are estimated to be about 5 x 10 6 cm 2 s -1 . (author)
History of the discovery of uranium fission by neutrons
International Nuclear Information System (INIS)
Simane, C.
1989-01-01
The history is briefly described of the discovery of uranium fission by neutrons, based on the texts of original scientific studies, memories or biographies of those who participated in the discovery and of their contemporaries. Obstacles that stood in the way of the discovery are discussed. It is stated that only a few scientists contributed to the discovery of uranium fission. The fission process itself still remains subject of physical research which studies its detailed laws. (Z.M.). 2 tabs., 16 refs
Roecker, Anthony J; Reger, Thomas S; Mattern, M Christa; Mercer, Swati P; Bergman, Jeffrey M; Schreier, John D; Cube, Rowena V; Cox, Christopher D; Li, Dansu; Lemaire, Wei; Bruno, Joseph G; Harrell, C Meacham; Garson, Susan L; Gotter, Anthony L; Fox, Steven V; Stevens, Joanne; Tannenbaum, Pamela L; Prueksaritanont, Thomayant; Cabalu, Tamara D; Cui, Donghui; Stellabott, Joyce; Hartman, George D; Young, Steven D; Winrow, Christopher J; Renger, John J; Coleman, Paul J
2014-10-15
Orexin receptor antagonists have demonstrated clinical utility for the treatment of insomnia. The majority of clinical efforts to date have focused on the development of dual orexin receptor antagonists (DORAs), small molecules that antagonize both the orexin 1 and orexin 2 receptors. Our group has recently disclosed medicinal chemistry efforts to identify highly potent, orally bioavailable selective orexin 2 receptor antagonists (2-SORAs) that possess acceptable profiles for clinical development. Herein we report additional SAR studies within the 'triaryl' amide 2-SORA series focused on improvements in compound stability in acidic media and time-dependent inhibition of CYP3A4. These studies resulted in the discovery of 2,5-disubstituted isonicotinamide 2-SORAs such as compound 24 that demonstrated improved stability and TDI profiles as well as excellent sleep efficacy across species. Copyright © 2014 Elsevier Ltd. All rights reserved.
2010-10-01
... 45 Public Welfare 2 2010-10-01 2010-10-01 false Discovery. 213.23a Section 213.23a Public Welfare... Discovery. The Department and any party named in the notice issued pursuant to § 213.11 shall have the right to conduct discovery (including depositions) against opposing parties. Rules 26-37 of the Federal...
DISCOVERY OF TWO SUPERNOVAE IN THE NUCLEAR REGIONS OF THE LUMINOUS INFRARED GALAXY IC 883
Energy Technology Data Exchange (ETDEWEB)
Kankare, E.; Mattila, S.; Takalo, A. [Tuorla Observatory, Department of Physics and Astronomy, University of Turku, Vaeisaelaentie 20, FI-21500 Piikkioe (Finland); Ryder, S. [Australian Astronomical Observatory, P.O. Box 296, Epping, NSW 1710 (Australia); Vaeisaenen, P. [South African Astronomical Observatory, P.O. Box 9, Observatory 7935 (South Africa); Alberdi, A.; Perez-Torres, M.-A.; Romero-Canizales, C. [Instituto de Astrofsica de Andalucia, IAA-CSIC, Apartado 3004, 18080 Granada (Spain); Alonso-Herrero, A.; Colina, L. [Departamento de Astrofisica, Centro de Astrobiologia, CSIC/INTA, Carretera de Torrejon a Ajalvir, km 4, 28850, Torrejon de Ardoz, Madrid (Spain); Efstathiou, A. [School of Sciences, European University Cyprus, Diogenes Street, Engomi, 1516 Nicosia (Cyprus); Kotilainen, J. [Finnish Centre for Astronomy with ESO (FINCA), University of Turku, Vaeisaelaentie 20, FI-21500 Piikkioe (Finland); Melinder, J., E-mail: erkki.kankare@utu.fi [Department of Astronomy, Oskar Klein Centre, Stockholm University, AlbaNova University Centre, 106 91 Stockholm (Sweden)
2012-01-10
We report the discovery of two consecutive supernovae (SNe), 2010cu and 2011hi, located at 0.''37 (180 pc) and 0.''79 (380 pc) projected distance, respectively, from the center of the K-band nucleus of the luminous infrared galaxy (LIRG) IC 883. The SNe were discovered in an ongoing near-infrared K-band search for core-collapse SNe in such galaxies using the ALTAIR/NIRI adaptive optics system with laser guide star at the Gemini-North Telescope. These are thus the closest SNe yet discovered to an LIRG nucleus in optical or near-infrared wavelengths. The near-infrared light curves and colors of both SNe are consistent with core-collapse events. Both SNe seem to suffer from relatively low host galaxy extinction suggesting that regardless of their low projected galactocentric distances, they are not deeply buried in the nuclear regions of the host galaxy.
The Greatest Mathematical Discovery?
Energy Technology Data Exchange (ETDEWEB)
Bailey, David H.; Borwein, Jonathan M.
2010-05-12
What mathematical discovery more than 1500 years ago: (1) Is one of the greatest, if not the greatest, single discovery in the field of mathematics? (2) Involved three subtle ideas that eluded the greatest minds of antiquity, even geniuses such as Archimedes? (3) Was fiercely resisted in Europe for hundreds of years after its discovery? (4) Even today, in historical treatments of mathematics, is often dismissed with scant mention, or else is ascribed to the wrong source? Answer: Our modern system of positional decimal notation with zero, together with the basic arithmetic computational schemes, which were discovered in India about 500 CE.
A dented LH2 recirculation line is removed from Discovery
1999-01-01
In the Payload Changeout Room, Launch Pad 39B, United Space Alliance and NASA workers look at the replacement main propulsion system liquid hydrogen recirculation line (left) to be installed in Shuttle Discovery's aft compartment. At right is the dented line that has been removed. The 12-inch-long dent was discovered during routine aft compartment inspections Tuesday, Dec. 7. The line recirculates hydrogen from the Shuttle main engines back to the external tank during prelaunch engine conditioning. The line is being replaced and managers expect the replacement work to take about 3 days, followed by system retests and final aft compartment close-outs. Preliminary assessments reflect a launch date of Space Shuttle Discovery on mission STS-103 no earlier than Dec. 16. STS-103 is the third servicing mission for the Hubble Space Telescope.
Impact of the discovery of crude oil on inter-group relations between ...
African Journals Online (AJOL)
Impact of the discovery of crude oil on inter-group relations between Isoko and her immediate neighbours in the western Niger Delta of Nigeria. ... The article shows that the discovery of crude oil petroleum in the western Niger Delta marked a watershed in the history of intergroup relations in the area. Keywords: Discovery ...
A cell-based fluorescent glucose transporter assay for SGLT2 inhibitor discovery
Directory of Open Access Journals (Sweden)
Yi Huan
2013-04-01
Full Text Available The sodium/glucose cotransporter 2 (SGLT2 is responsible for the majority of glucose reabsorption in the kidney, and currently, SGLT2 inhibitors are considered as promising hypoglycemic agents for the treatment of type 2 diabetes mellitus. By constructing CHO cell lines that stably express the human SGLT2 transmembrane protein, along with a fluorescent glucose transporter assay that uses 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-ylamino]2-deoxyglucose (2-NBDG as a glucose analog, we have developed a nonradioactive, cell-based assay for the discovery and characterization of SGLT2 inhibitors.
Energy Technology Data Exchange (ETDEWEB)
Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk
2014-04-25
Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.
Liu, Qiufeng; Huang, Fubao; Yuan, Xiaojing; Wang, Kai; Zou, Yi; Shen, Jianhua; Xu, Yechun
2017-12-28
Lipoprotein-associated phospholipase A2 (Lp-PLA2) is a promising therapeutic target for atherosclerosis, Alzheimer's disease, and diabetic macular edema. Here we report the identification of novel sulfonamide scaffold Lp-PLA2 inhibitors derived from a relatively weak fragment. Similarity searching on this fragment followed by molecular docking leads to the discovery of a micromolar inhibitor with a 300-fold potency improvement. Subsequently, by the application of a structure-guided design strategy, a successful hit-to-lead optimization was achieved and a number of Lp-PLA2 inhibitors with single-digit nanomolar potency were obtained. After preliminary evaluation of the properties of drug-likeness in vitro and in vivo, compound 37 stands out from this congeneric series of inhibitors for good inhibitory activity and favorable oral bioavailability in male Sprague-Dawley rats, providing a quality candidate for further development. The present study thus clearly demonstrates the power and advantage of integrally employing fragment screening, crystal structures determination, virtual screening, and medicinal chemistry in an efficient lead discovery project, providing a good example for structure-based drug design.
Gas reserves, discoveries and production
International Nuclear Information System (INIS)
Saniere, A.
2006-01-01
Between 2000 and 2004, new discoveries, located mostly in the Asia/Pacific region, permitted a 71% produced reserve replacement rate. The Middle East and the offshore sector represent a growing proportion of world gas production Non-conventional gas resources are substantial but are not exploited to any significant extent, except in the United States, where they account for 30% of U.S. gas production. (author)
28 CFR 2.30 - False information or new criminal conduct: Discovery after release.
2010-07-01
... 28 Judicial Administration 1 2010-07-01 2010-07-01 false False information or new criminal conduct... Prisoners and Parolees § 2.30 False information or new criminal conduct: Discovery after release. If... willfully provided false information or misrepresented information deemed significant to his application for...
Copmans, Daniëlle; Rateb, Mostafa; Tabudravu, Jioji N; Pérez-Bonilla, Mercedes; Dirkx, Nina; Vallorani, Riccardo; Diaz, Caridad; Pérez Del Palacio, José; Smith, Alan J; Ebel, Rainer; Reyes, Fernando; Jaspars, Marcel; de Witte, Peter A M
2018-04-19
In search for novel antiseizure drugs (ASDs), the European FP7-funded PharmaSea project used zebrafish embryos and larvae as a drug discovery platform to screen marine natural products to identify promising antiseizure hits in vivo for further development. Within the framework of this project, seven known heterospirocyclic γ-lactams, namely, pseurotin A, pseurotin A 2 , pseurotin F1, 11- O-methylpseurotin A, pseurotin D, azaspirofuran A, and azaspirofuran B, were isolated from the bioactive marine fungus Aspergillus fumigatus, and their antiseizure activity was evaluated in the larval zebrafish pentylenetetrazole (PTZ) seizure model. Pseurotin A 2 and azaspirofuran A were identified as antiseizure hits, while their close chemical analogues were inactive. Besides, electrophysiological analysis from the zebrafish midbrain demonstrated that pseurotin A 2 and azaspirofuran A also ameliorate PTZ-induced epileptiform discharges. Next, to determine whether these findings translate to mammalians, both compounds were analyzed in the mouse 6 Hz (44 mA) psychomotor seizure model. They lowered the seizure duration dose-dependently, thereby confirming their antiseizure properties and suggesting activity against drug-resistant seizures. Finally, in a thorough ADMET assessment, pseurotin A 2 and azaspirofuran A were found to be drug-like. Based on the prominent antiseizure activity in both species and the drug-likeness, we propose pseurotin A 2 and azaspirofuran A as lead compounds that are worth further investigation for the treatment of epileptic seizures. This study not only provides the first evidence of antiseizure activity of pseurotins and azaspirofurans, but also demonstrates the value of the zebrafish model in (marine) natural product drug discovery in general, and for ASD discovery in particular.
Statistics and Discoveries at the LHC (2/4)
CERN. Geneva
2010-01-01
The lectures will give an introduction to statistics as applied in particle physics and will provide all the necessary basics for data analysis at the LHC. Special emphasis will be placed on the the problems and questions that arise when searching for new phenomena, including p-values, discovery significance, limit setting procedures, treatment of small signals in the presence of large backgrounds. Specific issues that will be addressed include the advantages and drawbacks of different statistical test procedures (cut-based, likelihood-ratio, etc.), the look-elsewhere effect and treatment of systematic uncertainties.
2010-01-01
... 12 Banks and Banking 7 2010-01-01 2010-01-01 false Discovery. 908.46 Section 908.46 Banks and... PRACTICE AND PROCEDURE IN HEARINGS ON THE RECORD Pre-Hearing Proceedings § 908.46 Discovery. (a) Limits on discovery. Subject to the limitations set out in paragraphs (b), (d), and (e) of this section, any party to...
Sulistiani, E.; Waluya, S. B.; Masrukan
2018-03-01
This study aims to determine (1) the effectiveness of Discovery Learning model by using Hand on Activity toward critical thinking abilities, and (2) to describe students’ critical thinking abilities in Discovery Learning by Hand on Activity based on curiosity. This study is mixed method research with concurrent embedded design. Sample of this study are students of VII A and VII B of SMP Daarul Qur’an Ungaran. While the subject in this study is based on the curiosity of the students groups are classified Epistemic Curiosity (EC) and Perceptual Curiosity (PC). The results showed that the learning of Discovery Learning by using Hand on Activity is effective toward mathematics critical thinking abilities. Students of the EC type are able to complete six indicators of mathematics critical thinking abilities, although there are still two indicators that the result is less than the maximum. While students of PC type have not fully been able to complete the indicator of mathematics critical thinking abilities. They are only strong on indicators formulating questions, while on the other five indicators they are still weak. The critical thinking abilities of EC’s students is better than the critical thinking abilities of the PC’s students.
Get Involved in Planetary Discoveries through New Worlds, New Discoveries
Shupla, Christine; Shipp, S. S.; Halligan, E.; Dalton, H.; Boonstra, D.; Buxner, S.; SMD Planetary Forum, NASA
2013-01-01
"New Worlds, New Discoveries" is a synthesis of NASA’s 50-year exploration history which provides an integrated picture of our new understanding of our solar system. As NASA spacecraft head to and arrive at key locations in our solar system, "New Worlds, New Discoveries" provides an integrated picture of our new understanding of the solar system to educators and the general public! The site combines the amazing discoveries of past NASA planetary missions with the most recent findings of ongoing missions, and connects them to the related planetary science topics. "New Worlds, New Discoveries," which includes the "Year of the Solar System" and the ongoing celebration of the "50 Years of Exploration," includes 20 topics that share thematic solar system educational resources and activities, tied to the national science standards. This online site and ongoing event offers numerous opportunities for the science community - including researchers and education and public outreach professionals - to raise awareness, build excitement, and make connections with educators, students, and the public about planetary science. Visitors to the site will find valuable hands-on science activities, resources and educational materials, as well as the latest news, to engage audiences in planetary science topics and their related mission discoveries. The topics are tied to the big questions of planetary science: how did the Sun’s family of planets and bodies originate and how have they evolved? How did life begin and evolve on Earth, and has it evolved elsewhere in our solar system? Scientists and educators are encouraged to get involved either directly or by sharing "New Worlds, New Discoveries" and its resources with educators, by conducting presentations and events, sharing their resources and events to add to the site, and adding their own public events to the site’s event calendar! Visit to find quality resources and ideas. Connect with educators, students and the public to
Comparison of discovery limits for extra Z bosons at future colliders
International Nuclear Information System (INIS)
Godfrey, S.
1995-01-01
We study and compare the discovery potential for heavy neutral gauge bosons (Z') at various e + e - and pp (-) colliders that are planned or have been proposed. Typical discovery limits are for the Fermilab Tevatron ∼1 TeV, Di-Tevatron ∼2 TeV, CERN LHC ∼4 TeV, LSGNA (a 60 TeV pp collider) ∼13 TeV while the e + e - discovery limits are 2--10x √s with the large variation reflecting the model dependence of the limits. While both types of colliders have comparable discovery limits the hadron colliders are generally less dependent on the specific Z' model and provide more robust limits since the signal has little background. In contrast, discovery limits for e + e - limits are more model dependent and, because they are based on indirect inferences of deviations from standard model predictions, they are more sensitive to systematic errors
STS-95 Discovery rolls over to the VAB
1998-01-01
The orbiter Discovery is moved from the Orbiter Processing Facility Bay 2 to the Vehicle Assembly Building, drawing the attention of KSC employees. The orbiter displays the recently painted NASA logo, termed the 'meatball,' on its left wing and both sides of the fuselage. Discovery (OV-103) is scheduled for its 25th flight, from Launch Pad 39B, on Oct. 29, 1998, for the STS-95 mission.
THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION
Energy Technology Data Exchange (ETDEWEB)
Falconer, David A; Moore, Ronald L; Adams, Mitzi [Space Science Office, VP62, Marshall Space Flight Center, Huntsville, AL 35812 (United States); Gary, G. Allen [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 35899 (United States)], E-mail: David.falconer@msfc.nasa.gov
2009-08-01
We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R {sub Sun}. The two quantities are {sup L}WL{sub SG}, a gauge of the total free energy in an active region's magnetic field, and {sup L}{phi}, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log {sup L}WL{sub SG}, log {sup L}{phi}) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.
THE 'MAIN SEQUENCE' OF EXPLOSIVE SOLAR ACTIVE REGIONS: DISCOVERY AND INTERPRETATION
International Nuclear Information System (INIS)
Falconer, David A.; Moore, Ronald L.; Adams, Mitzi; Gary, G. Allen
2009-01-01
We examine the location and distribution of the production of coronal mass ejections (CMEs) and major flares by sunspot active regions in the phase space of two whole-active-region magnetic quantities measured from 1897 SOHO/MDI magnetograms. These magnetograms track the evolution of 44 active regions across the central disk of radius 0.5 R Sun . The two quantities are L WL SG , a gauge of the total free energy in an active region's magnetic field, and L Φ, a measure of the active region's total magnetic flux. From these data and each active region's history of production of CMEs, X flares, and M flares, we find (1) that CME/flare-productive active regions are concentrated in a straight-line 'main sequence' in (log L WL SG , log L Φ) space, (2) that main-sequence active regions have nearly their maximum attainable free magnetic energy, and (3) evidence that this arrangement plausibly results from equilibrium between input of free energy to an explosive active region's magnetic field in the chromosphere and corona by contortion of the field via convection in and below the photosphere and loss of free energy via CMEs, flares, and coronal heating, an equilibrium between energy gain and loss that is analogous to that of the main sequence of hydrogen-burning stars in (mass, luminosity) space.
Analysis of regional difference on impact factors of China’s energy – Related CO2 emissions
International Nuclear Information System (INIS)
Li, Huanan; Mu, Hailin; Zhang, Ming; Gui, Shusen
2012-01-01
With the intensification of global warming, the issue of carbon emissions causes more and more attention in recent years. In this paper, China’s 30 provincial-level administrative units are divided into five emission regions according to the annual average value of provincial CO 2 emissions per capita during 1990 and 2010. The regional differences in impact factors on CO 2 emissions are discussed using STIRPAT (stochastic impacts by regression on population, affluence, and technology) model. The results indicate that although GDP (Gross domestic product) per capita, industrial structure, population, urbanization and technology level have different impacts on CO 2 emissions in different emission regions, they are almost always the main factors in all emission regions. In most emission regions, urbanization and GDP per capita has a bigger impact on CO 2 emissions than other factors. Improving technology level produces a small reduction in CO 2 emissions in most emission regions, but it is still a primary way for CO 2 reduction in China. It’s noteworthy that industrial structure isn’t the main factor and improving technology level increases CO 2 emissions in high emission region. Different measures should be adopted for CO 2 reductions according to local conditions in different regions. -- Highlights: ► Regional differences of the impact factors on China’s CO 2 emissions are analyzed. ► Five macro factors like GDP per capita are almost always main influence factors in all regions. ► The impacts of different factors are different. ► Improving technology has no significant reduction on CO 2 emission in most regions. ► Policy on CO 2 reduction should be adapted to local conditions.
Ziedan, Noha I; Hamdy, Rania; Cavaliere, Alessandra; Kourti, Malamati; Prencipe, Filippo; Brancale, Andrea; Jones, Arwyn T; Westwell, Andrew D
2017-07-01
A new series of oxadiazoles were designed to act as inhibitors of the anti-apoptotic Bcl-2 protein. Virtual screening led to the discovery of new hits that interact with Bcl-2 at the BH3 binding pocket. Further study of the structure-activity relationship of the most active compound of the first series, compound 1, led to the discovery of a novel oxadiazole analogue, compound 16j, that was a more potent small-molecule inhibitor of Bcl-2. 16j had good in vitro inhibitory activity with submicromolar IC 50 values in a metastatic human breast cancer cell line (MDA-MB-231) and a human cervical cancer cell line (HeLa). The antitumour effect of 16j is concomitant with its ability to bind to Bcl-2 protein as shown by an enzyme-linked immunosorbent assay (IC 50 = 4.27 μm). Compound 16j has a great potential to develop into highly active anticancer agent. © 2017 John Wiley & Sons A/S.
On the cradle of CCM research: discovery, development, and challenges ahead.
Kaplan, Aaron
2017-06-01
Herein, 40 years after its discovery, I briefly and critically survey the development of ideas that propelled research on CO2-concentrating mechanisms (CCMs; a term proposed by Dean Price) of phytoplankton, mainly focusing on cyanobacteria. This is not a comprehensive review on CCM research, but a personal view on the past developments and challenges that lie ahead. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
International Nuclear Information System (INIS)
Ohtani, S.; Kokubun, S.; Nakamura, R.; Elphic, R.C.; Russell, C.T.; Baker, D.N.
1990-01-01
The development of the substorm-associated current system in the near-tail region is examined in the light of both experiment and theory. First, the March 28, 1979, event is examined intensively by using ground magnetometer data and satellite magnetic field and energetic particle data. The comparison of field-aligned current signatures at geosynchronous altitude and in the near-tail region indicates that the development of the region 1 system is not merely the enhancement in current intensity of the pre-existing system. This finding is consistent with the so-called current wedge model, in which the tail current is converted into a pair of field-aligned currents with the region 1 polarity at substorm onsets. Detailed inspection, however, suggests that the region 2 system is as important as the region 1 system. Statistical properties of the azimuthal magnetic component at synchronous orbit indicate that the deviation during disturbed periods is larger than expected from the enhancement of the region 1 current. These individual and statistical studies suggest that the region 2 system tends to develop in the synchronous region and that the coupling between the region 1 and the region 2 systems is important. The current closure in the magnetosphere is discussed from a viewpoint of the macroscopic behavior of plasma. It is suggested that the dawnside and the duskside region 2 currents are closed in the magnetosphere by the curvature current during the growth phase and by the magnetic gradient current during the expansion phase. The field-aligned currents of the region 1 and the region 2 systems are closed in the ionosphere by the Pedersen current. Consequently, the energy is dissipated as the Joule heating and this energy must be supplied from the magnetosphere. Therefore, the counter part of the Pedersen current, which closes the region 1 and the region 2 currents in magnetosphere, must be the dynamo current
Harvey, Alan L
2014-12-15
Components from venoms have stimulated many drug discovery projects, with some notable successes. These are briefly reviewed, from captopril to ziconotide. However, there have been many more disappointments on the road from toxin discovery to approval of a new medicine. Drug discovery and development is an inherently risky business, and the main causes of failure during development programmes are outlined in order to highlight steps that might be taken to increase the chances of success with toxin-based drug discovery. These include having a clear focus on unmet therapeutic needs, concentrating on targets that are well-validated in terms of their relevance to the disease in question, making use of phenotypic screening rather than molecular-based assays, and working with development partners with the resources required for the long and expensive development process. Copyright © 2014 The Author. Published by Elsevier Ltd.. All rights reserved.
What about Th1/Th2 in cutaneous leishmaniasis vaccine discovery?
Directory of Open Access Journals (Sweden)
Campos-Neto A.
2005-01-01
Full Text Available The T helper cell type 1 (Th1 response is essential to resist leishmaniasis, whereas the Th2 response favors the disease. However, many leishmanial antigens, which stimulate a Th1 immune response during the disease or even after the disease is cured, have been shown to have no protective action. Paradoxically, antigens associated with an early Th2 response have been found to be highly protective if the Th1 response to them is generated before infection. Therefore, finding disease-associated Th2 antigens and inducing a Th1 immune response to them using defined vaccination protocols is an interesting unorthodox alternative approach to the discovery of a leishmania vaccine.
Fragment-based drug discovery and protein–protein interactions
Directory of Open Access Journals (Sweden)
Turnbull AP
2014-09-01
Full Text Available Andrew P Turnbull,1 Susan M Boyd,2 Björn Walse31CRT Discovery Laboratories, Department of Biological Sciences, Birkbeck, University of London, London, UK; 2IOTA Pharmaceuticals Ltd, Cambridge, UK; 3SARomics Biostructures AB, Lund, SwedenAbstract: Protein–protein interactions (PPIs are involved in many biological processes, with an estimated 400,000 PPIs within the human proteome. There is significant interest in exploiting the relatively unexplored potential of these interactions in drug discovery, driven by the need to find new therapeutic targets. Compared with classical drug discovery against targets with well-defined binding sites, developing small-molecule inhibitors against PPIs where the contact surfaces are frequently more extensive and comparatively flat, with most of the binding energy localized in “hot spots”, has proven far more challenging. However, despite the difficulties associated with targeting PPIs, important progress has been made in recent years with fragment-based drug discovery playing a pivotal role in improving their tractability. Computational and empirical approaches can be used to identify hot-spot regions and assess the druggability and ligandability of new targets, whilst fragment screening campaigns can detect low-affinity fragments that either directly or indirectly perturb the PPI. Once fragment hits have been identified and confirmed using biochemical and biophysical approaches, three-dimensional structural data derived from nuclear magnetic resonance or X-ray crystallography can be used to drive medicinal chemistry efforts towards the development of more potent inhibitors. A small-scale comparison presented in this review of “standard” fragments with those targeting PPIs has revealed that the latter tend to be larger, be more lipophilic, and contain more polar (acid/base functionality, whereas three-dimensional descriptor data indicate that there is little difference in their three
2010-01-01
... 12 Banks and Banking 7 2010-01-01 2010-01-01 false Discovery. 1780.26 Section 1780.26 Banks and... OF PRACTICE AND PROCEDURE RULES OF PRACTICE AND PROCEDURE Prehearing Proceedings § 1780.26 Discovery. (a) Limits on discovery. Subject to the limitations set out in paragraphs (b), (d), and (e) of this...
Perspectives on the agrochemical industry and agrochemical discovery.
Sparks, Thomas C; Lorsbach, Beth A
2017-04-01
Agrochemicals have been critical to the production of food and fiber, as well as the control of vectors of disease. The need for the discovery and development of new agrochemicals continues unabated due to the loss of existing products through the development of resistance, the desire for products with more favorable environmental and toxicological profiles, shifting pest spectra, and changing agricultural needs and practices. As presented in the associated analysis of the agrochemical industry, the rising costs and complexities of agrochemical discovery have, in part, led to increasing consolidation, especially in the USA and Europe. However, as demonstrated by the present analysis, the discovery of new agrochemicals continues in spite of the challenges. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Discovery in a World of Mashups
King, T. A.; Ritschel, B.; Hourcle, J. A.; Moon, I. S.
2014-12-01
When the first digital information was stored electronically, discovery of what existed was through file names and the organization of the file system. With the advent of networks, digital information was shared on a wider scale, but discovery remained based on file and folder names. With a growing number of information sources, named based discovery quickly became ineffective. The keyword based search engine was one of the first types of a mashup in the world of Web 1.0. Embedded links from one document to another with prescribed relationships between files and the world of Web 2.0 was formed. Search engines like Google used the links to improve search results and a worldwide mashup was formed. While a vast improvement, the need for semantic (meaning rich) discovery was clear, especially for the discovery of scientific data. In response, every science discipline defined schemas to describe their type of data. Some core schemas where shared, but most schemas are custom tailored even though they share many common concepts. As with the networking of information sources, science increasingly relies on data from multiple disciplines. So there is a need to bring together multiple sources of semantically rich information. We explore how harvesting, conceptual mapping, facet based search engines, search term promotion, and style sheets can be combined to create the next generation of mashups in the emerging world of Web 3.0. We use NASA's Planetary Data System and NASA's Heliophysics Data Environment to illustrate how to create a multi-discipline mash-up.
Perspectives on bioanalytical mass spectrometry and automation in drug discovery.
Janiszewski, John S; Liston, Theodore E; Cole, Mark J
2008-11-01
The use of high speed synthesis technologies has resulted in a steady increase in the number of new chemical entities active in the drug discovery research stream. Large organizations can have thousands of chemical entities in various stages of testing and evaluation across numerous projects on a weekly basis. Qualitative and quantitative measurements made using LC/MS are integrated throughout this process from early stage lead generation through candidate nomination. Nearly all analytical processes and procedures in modern research organizations are automated to some degree. This includes both hardware and software automation. In this review we discuss bioanalytical mass spectrometry and automation as components of the analytical chemistry infrastructure in pharma. Analytical chemists are presented as members of distinct groups with similar skillsets that build automated systems, manage test compounds, assays and reagents, and deliver data to project teams. The ADME-screening process in drug discovery is used as a model to highlight the relationships between analytical tasks in drug discovery. Emerging software and process automation tools are described that can potentially address gaps and link analytical chemistry related tasks. The role of analytical chemists and groups in modern 'industrialized' drug discovery is also discussed.
Kemnitzer, William; Sirisoma, Nilantha; May, Chris; Tseng, Ben; Drewe, John; Cai, Sui Xiong
2009-07-01
We report the discovery of N-((benzo[d][1,3]dioxol-5-yl)methyl)-6-phenylthieno[3,2-d]pyrimidin-4-amine (2a) as an apoptosis inducer using our proprietary cell- and caspase-based ASAP HTS assay, and SAR study of HTS hit 2a which led to the discovery of 4-anilino-N-methylthieno[3,2-d]pyrimidines and 4-anilino-N-methylthieno[2,3-d]pyrimidines as potent apoptosis inducers. Compounds 5d and 5e were the most potent with EC(50) values of 0.008 and 0.004microM in T47D human breast cancer cells, respectively. Compound 5d was found to be highly active in the MX-1 breast cancer model. Functionally, compounds 5d and 5e both induced apoptosis through inhibition of tubulin polymerization.
Topology Discovery Using Cisco Discovery Protocol
Rodriguez, Sergio R.
2009-01-01
In this paper we address the problem of discovering network topology in proprietary networks. Namely, we investigate topology discovery in Cisco-based networks. Cisco devices run Cisco Discovery Protocol (CDP) which holds information about these devices. We first compare properties of topologies that can be obtained from networks deploying CDP versus Spanning Tree Protocol (STP) and Management Information Base (MIB) Forwarding Database (FDB). Then we describe a method of discovering topology ...
Abou-Gharbia, Magid; Childers, Wayne E
2014-07-10
The pharmaceutical industry is facing enormous challenges, including reduced efficiency, stagnant success rate, patent expirations for key drugs, fierce price competition from generics, high regulatory hurdles, and the industry's perceived tarnished image. Pharma has responded by embarking on a range of initiatives. Other sectors, including NIH, have also responded. Academic drug discovery groups have appeared to support the transition of innovative academic discoveries and ideas into attractive drug discovery opportunities. Part 1 of this two-part series discussed the criticisms that have been leveled at the pharmaceutical industry over the past 3 decades and summarized the supporting data for and against these criticisms. This second installment will focus on the current challenges facing the pharmaceutical industry and Pharma's responses, focusing on the industry's changing perspective and new business models for coping with the loss of talent and declining clinical pipelines as well as presenting some examples of recent drug discovery successes.
Regional alternative transportation evaluation report - region 2
2012-03-01
The U.S. Fish and Wildlife Service (FWS) and the U.S. Department of Transportation (DOT) Volpe : Center (Volpe Center) conducted a regional alternative transportation evaluation (RATE) in Region 2, : which is comprised of Arizona, Oklahoma, New Mexic...
A Framework for Automatic Web Service Discovery Based on Semantics and NLP Techniques
Directory of Open Access Journals (Sweden)
Asma Adala
2011-01-01
Full Text Available As a greater number of Web Services are made available today, automatic discovery is recognized as an important task. To promote the automation of service discovery, different semantic languages have been created that allow describing the functionality of services in a machine interpretable form using Semantic Web technologies. The problem is that users do not have intimate knowledge about semantic Web service languages and related toolkits. In this paper, we propose a discovery framework that enables semantic Web service discovery based on keywords written in natural language. We describe a novel approach for automatic discovery of semantic Web services which employs Natural Language Processing techniques to match a user request, expressed in natural language, with a semantic Web service description. Additionally, we present an efficient semantic matching technique to compute the semantic distance between ontological concepts.
OSSOS. IV. Discovery of a Dwarf Planet Candidate in the 9:2 Resonance with Neptune
Bannister, Michele T.; Alexandersen, Mike; Benecchi, Susan; Chen, Ying-Tung; Delsanti, Audrey; Fraser, Wesley C.; Gladman, Brett; Granvik, Mikael; Grundy, Will M.; Guilbert-Lepoutre, Aurelie;
2016-01-01
We report the discovery and orbit of a new dwarf planet candidate, 2015 RR245, by the Outer Solar System Origins Survey (OSSOS). The orbit of 2015 RR245 is eccentric (e 0.586), with a semimajor axis near 82 au, yielding a perihelion distance of 34 au. 2015 RR245 has g - r 0.59 +/- 0.11 and absolute magnitude Hr 3.6 +/- 0.1; for an assumed albedo of pV 12, the object has a diameter of approximately 670 km. Based on astrometric measurements from OSSOS and Pan-STARRS1, we find that 2015 RR245 is securely trapped on ten-megayear timescales in the 9:2 mean-motion resonance with Neptune. It is the first trans-Neptunian object (TNO) identied in this resonance. On hundred-megayear timescales, particles in 2015 RR245-like orbits depart and sometimes return to the resonance, indicating that 2015 RR245 likely forms part of the long-lived metastable population of distant TNOs that drift between resonance sticking and actively scattering via gravitational encounters with Neptune. The discovery of a 9:2 TNO stresses the role of resonances in the long-term evolution of objects in the scattering disk and reinforces the view that distant resonances are heavily populated in the current solar system. This object further motivates detailed modeling of the transient sticking population.
Discovery of x-rays and its impact on the development of physics
International Nuclear Information System (INIS)
Sirdeshmukh, D.B.
1996-01-01
Roentgen's discovery of x-rays is discussed. Roentgen's discovery was important not only for the property of transmission of x-rays, which immediately resulted in the new field of radiology, but also because it led to several experiments which had a great impact on the development of physics. Laue's discovery of x-ray diffraction in turn led to the development of x-ray crystallography and x-ray spectroscopy. The contributions of Barkla, Moseley and Siegbahn are discussed. The experiments of Duane and Hunt on continuous x-rays and Compton on scattering of x-rays lent support to the photon nature of radiation. In recent times, the line-widths of x-ray emission lines have given information about the band structure of solids. (author). 21 refs., 6 figs
New perspectives on innovative drug discovery: an overview.
Pan, Si Yuan; Pan, Shan; Yu, Zhi-Ling; Ma, Dik-Lung; Chen, Si-Bao; Fong, Wang-Fun; Han, Yi-Fan; Ko, Kam-Ming
2010-01-01
Despite advances in technology, drug discovery is still a lengthy, expensive, difficult, and inefficient process, with a low rate of success. Today, advances in biomedical science have brought about great strides in therapeutic interventions for a wide spectrum of diseases. The advent of biochemical techniques and cutting-edge bio/chemical technologies has made available a plethora of practical approaches to drug screening and design. In 2010, the total sales of the global pharmaceutical market will reach 600 billion US dollars and expand to over 975 billion dollars by 2013. The aim of this review is to summarize available information on contemporary approaches and strategies in the discovery of novel therapeutic agents, especially from the complementary and alternative medicines, including natural products and traditional remedies such as Chinese herbal medicine.
Directory of Open Access Journals (Sweden)
Allison DaSilva
2014-10-01
Full Text Available A comparative analysis of content enrichment services, Syndetic Solutions and Content Café 2, was undertaken to explore which service would provide public library users with a superior online search and discovery experience through the enriched data elements offered, specifically looking at the cover image data element and exploring what factors impact the display of said element. A data-set of 250 items in five different formats, including books, CDs, DVDs, e-books, and video games, was searched in four North American public libraries’ discovery layers to compare the integration, extent, and quality of the cover image data element supplied by Syndetic Solutions and Content Café 2. Based on an analysis of the URLs, ISBNs, and UPCs for each of the 250 items, it was determined that the integration, and therefore the display, of the cover image data element was impacted by: (1 whether or not an ISBN or UPC was listed in the MARC bibliographic record; (2 which ISBN or UPC was listed, as items could potentially have more than one; (3 the inclusion of both ISBNs and UPCs in the record and the settings of the discovery tool; (4 the order in which the ISBNs or UPCs were listed in the record; and (5 whether or not Syndetic Solutions or Content Café 2 had the image data in its database at the time of the search. The quality of the cover image displayed was found to be impacted by the size requested by the library and the size of the image provided by the publisher. These findings may also have implications for the integration of other enriched data elements.
Quantifying the Ease of Scientific Discovery.
Arbesman, Samuel
2011-02-01
It has long been known that scientific output proceeds on an exponential increase, or more properly, a logistic growth curve. The interplay between effort and discovery is clear, and the nature of the functional form has been thought to be due to many changes in the scientific process over time. Here I show a quantitative method for examining the ease of scientific progress, another necessary component in understanding scientific discovery. Using examples from three different scientific disciplines - mammalian species, chemical elements, and minor planets - I find the ease of discovery to conform to an exponential decay. In addition, I show how the pace of scientific discovery can be best understood as the outcome of both scientific output and ease of discovery. A quantitative study of the ease of scientific discovery in the aggregate, such as done here, has the potential to provide a great deal of insight into both the nature of future discoveries and the technical processes behind discoveries in science.
Bayesian centroid estimation for motif discovery.
Carvalho, Luis
2013-01-01
Biological sequences may contain patterns that signal important biomolecular functions; a classical example is regulation of gene expression by transcription factors that bind to specific patterns in genomic promoter regions. In motif discovery we are given a set of sequences that share a common motif and aim to identify not only the motif composition, but also the binding sites in each sequence of the set. We propose a new centroid estimator that arises from a refined and meaningful loss function for binding site inference. We discuss the main advantages of centroid estimation for motif discovery, including computational convenience, and how its principled derivation offers further insights about the posterior distribution of binding site configurations. We also illustrate, using simulated and real datasets, that the centroid estimator can differ from the traditional maximum a posteriori or maximum likelihood estimators.
Bayesian centroid estimation for motif discovery.
Directory of Open Access Journals (Sweden)
Luis Carvalho
Full Text Available Biological sequences may contain patterns that signal important biomolecular functions; a classical example is regulation of gene expression by transcription factors that bind to specific patterns in genomic promoter regions. In motif discovery we are given a set of sequences that share a common motif and aim to identify not only the motif composition, but also the binding sites in each sequence of the set. We propose a new centroid estimator that arises from a refined and meaningful loss function for binding site inference. We discuss the main advantages of centroid estimation for motif discovery, including computational convenience, and how its principled derivation offers further insights about the posterior distribution of binding site configurations. We also illustrate, using simulated and real datasets, that the centroid estimator can differ from the traditional maximum a posteriori or maximum likelihood estimators.
De Fusco, Claudia; Brear, Paul; Iegre, Jessica; Georgiou, Kathy Hadje; Sore, Hannah F; Hyvönen, Marko; Spring, David R
2017-07-01
Recently we reported the discovery of a potent and selective CK2α inhibitor CAM4066. This compound inhibits CK2 activity by exploiting a pocket located outside the ATP binding site (αD pocket). Here we describe in detail the journey that led to the discovery of CAM4066 using the challenging fragment linking strategy. Specifically, we aimed to develop inhibitors by linking a high-affinity fragment anchored in the αD site to a weakly binding warhead fragment occupying the ATP site. Moreover, we describe the remarkable impact that molecular modelling had on the development of this novel chemical tool. The work described herein shows potential for the development of a novel class of CK2 inhibitors. Copyright © 2017. Published by Elsevier Ltd.
Open Drug Discovery Toolkit (ODDT): a new open-source player in the drug discovery field.
Wójcikowski, Maciej; Zielenkiewicz, Piotr; Siedlecki, Pawel
2015-01-01
There has been huge progress in the open cheminformatics field in both methods and software development. Unfortunately, there has been little effort to unite those methods and software into one package. We here describe the Open Drug Discovery Toolkit (ODDT), which aims to fulfill the need for comprehensive and open source drug discovery software. The Open Drug Discovery Toolkit was developed as a free and open source tool for both computer aided drug discovery (CADD) developers and researchers. ODDT reimplements many state-of-the-art methods, such as machine learning scoring functions (RF-Score and NNScore) and wraps other external software to ease the process of developing CADD pipelines. ODDT is an out-of-the-box solution designed to be easily customizable and extensible. Therefore, users are strongly encouraged to extend it and develop new methods. We here present three use cases for ODDT in common tasks in computer-aided drug discovery. Open Drug Discovery Toolkit is released on a permissive 3-clause BSD license for both academic and industrial use. ODDT's source code, additional examples and documentation are available on GitHub (https://github.com/oddt/oddt).
2010-01-01
... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Discovery. 406.143 Section 406.143... Transportation Adjudications § 406.143 Discovery. (a) Initiation of discovery. Any party may initiate discovery... after a complaint has been filed. (b) Methods of discovery. The following methods of discovery are...
The discovery of radioactivity: the centenary
International Nuclear Information System (INIS)
Patil, S.K.
1995-01-01
In the last decade of the nineteenth century, a number of fundamental discoveries of outstanding importance were made unexpectedly which marked the beginning of a new era in physics. A cascade of spectacular discoveries began with the announcement of the discovery of x-rays by Roentgen followed by the discoveries, in quick succession, of radioactivity by Becquerel, of Zeeman effect, of electron by J.J. Thomson, and of polonium and radium by the Curies. Both x-rays and radioactivity have wide applications in scientific, medical and industrial fields and have made outstanding contribution to the advancement of human knowledge and welfare. Radioactivity is well known and no other discovery in the field of physics or chemistry has had a more profound effect on our fundamental knowledge of nature. Present article, on the occasion of the centenary of the discovery of radioactivity, makes an attempt to describe some glimpses of the history of radioactivity. (author). 59 refs
Twenty years on: the impact of fragments on drug discovery.
Erlanson, Daniel A; Fesik, Stephen W; Hubbard, Roderick E; Jahnke, Wolfgang; Jhoti, Harren
2016-09-01
After 20 years of sometimes quiet growth, fragment-based drug discovery (FBDD) has become mainstream. More than 30 drug candidates derived from fragments have entered the clinic, with two approved and several more in advanced trials. FBDD has been widely applied in both academia and industry, as evidenced by the large number of papers from universities, non-profit research institutions, biotechnology companies and pharmaceutical companies. Moreover, FBDD draws on a diverse range of disciplines, from biochemistry and biophysics to computational and medicinal chemistry. As the promise of FBDD strategies becomes increasingly realized, now is an opportune time to draw lessons and point the way to the future. This Review briefly discusses how to design fragment libraries, how to select screening techniques and how to make the most of information gleaned from them. It also shows how concepts from FBDD have permeated and enhanced drug discovery efforts.
Analytical strategies for discovery and replication of genetic effects in pharmacogenomic studies
Directory of Open Access Journals (Sweden)
Kohler JR
2014-08-01
Full Text Available Jared R Kohler, Tobias Guennel, Scott L MarshallBioStat Solutions, Inc., Frederick, MD, USAAbstract: In the past decade, the pharmaceutical industry and biomedical research sector have devoted considerable resources to pharmacogenomics (PGx with the hope that understanding genetic variation in patients would deliver on the promise of personalized medicine. With the advent of new technologies and the improved collection of DNA samples, the roadblock to advancements in PGx discovery is no longer the lack of high-density genetic information captured on patient populations, but rather the development, adaptation, and tailoring of analytical strategies to effectively harness this wealth of information. The current analytical paradigm in PGx considers the single-nucleotide polymorphism (SNP as the genomic feature of interest and performs single SNP association tests to discover PGx effects – ie, genetic effects impacting drug response. While it can be straightforward to process single SNP results and to consider how this information may be extended for use in downstream patient stratification, the rate of replication for single SNP associations has been low and the desired success of producing clinically and commercially viable biomarkers has not been realized. This may be due to the fact that single SNP association testing is suboptimal given the complexities of PGx discovery in the clinical trial setting, including: 1 relatively small sample sizes; 2 diverse clinical cohorts within and across trials due to genetic ancestry (potentially impacting the ability to replicate findings; and 3 the potential polygenic nature of a drug response. Subsequently, a shift in the current paradigm is proposed: to consider the gene as the genomic feature of interest in PGx discovery. The proof-of-concept study presented in this manuscript demonstrates that genomic region-based association testing has the potential to improve the power of detecting single SNP or
On teams, teamwork, and team performance: discoveries and developments.
Salas, Eduardo; Cooke, Nancy J; Rosen, Michael A
2008-06-01
We highlight some of the key discoveries and developments in the area of team performance over the past 50 years, especially as reflected in the pages of Human Factors. Teams increasingly have become a way of life in many organizations, and research has kept up with the pace. We have characterized progress in the field in terms of eight discoveries and five challenges. Discoveries pertain to the importance of shared cognition, the measurement of shared cognition, advances in team training, the use of synthetic task environments for research, factors influencing team effectiveness, models of team effectiveness, a multidisciplinary perspective, and training and technological interventions designed to improve team effectiveness. Challenges that are faced in the coming decades include an increased emphasis on team cognition; reconfigurable, adaptive teams; multicultural influences; and the need for naturalistic study and better measurement. Work in human factors has contributed significantly to the science and practice of teams, teamwork, and team performance. Future work must keep pace with the increasing use of teams in organizations. The science of teams contributes to team effectiveness in the same way that the science of individual performance contributes to individual effectiveness.
Cell and small animal models for phenotypic drug discovery
Directory of Open Access Journals (Sweden)
Szabo M
2017-06-01
Full Text Available Mihaly Szabo,1 Sara Svensson Akusjärvi,1 Ankur Saxena,1 Jianping Liu,2 Gayathri Chandrasekar,1 Satish S Kitambi1 1Department of Microbiology Tumor, and Cell Biology, 2Department of Biochemistry and Biophysics, Karolinska Institutet, Solna, Sweden Abstract: The phenotype-based drug discovery (PDD approach is re-emerging as an alternative platform for drug discovery. This review provides an overview of the various model systems and technical advances in imaging and image analyses that strengthen the PDD platform. In PDD screens, compounds of therapeutic value are identified based on the phenotypic perturbations produced irrespective of target(s or mechanism of action. In this article, examples of phenotypic changes that can be detected and quantified with relative ease in a cell-based setup are discussed. In addition, a higher order of PDD screening setup using small animal models is also explored. As PDD screens integrate physiology and multiple signaling mechanisms during the screening process, the identified hits have higher biomedical applicability. Taken together, this review highlights the advantages gained by adopting a PDD approach in drug discovery. Such a PDD platform can complement target-based systems that are currently in practice to accelerate drug discovery. Keywords: phenotype, screening, PDD, discovery, zebrafish, drug
International Nuclear Information System (INIS)
Bentley, Roger; Bentley, Yongmei
2015-01-01
This paper explains, in broad terms, the price of oil from 1971 to 2014 and focuses on the large price increases after 1973 and 2004. The explanation for these increases includes the quantity of conventional oil (i.e. oil in fields) discovered, combined with the decline in production of this oil that occurs typically once ‘mid-point’ is passed. Many past explanations of oil price have overlooked these two constraints, and hence provided insufficient explanations of oil price. Reliable data on conventional oil discovery cannot come from public-domain proved (‘1P’) oil reserves, as such data are very misleading. Instead oil industry backdated proved-plus-probable (‘2P’) data must be used. It is recognised that accessing 2P data can be expensive, or difficult. The ‘mid-point’ peak of conventional oil production results from a region's field-size distribution, its fall-off in oil discovery, and the physics of field decline. In terms of the future price of oil, estimates of the global recoverable resource of conventional oil show that the oil price will remain high on average, unless dramatic changes occur in the volume of production and cost of non-conventional oils, or if the overall demand for oil were to decline. The paper concludes with policy recommendations. - Highlights: • We show that understanding the oil price is assisted by reliable data on oil discovery. • These data need to be combined with the ‘peak at mid-point’ concept. • Results show that the world has probably entered an era of constrained oil supply. • Oil price stays high unless non-conventional supply, or demand, change significantly.
The discovery of the periodic table as a case of simultaneous discovery.
Scerri, Eric
2015-03-13
The article examines the question of priority and simultaneous discovery in the context of the discovery of the periodic system. It is argued that rather than being anomalous, simultaneous discovery is the rule. Moreover, I argue that the discovery of the periodic system by at least six authors in over a period of 7 years represents one of the best examples of a multiple discovery. This notion is supported by a new view of the evolutionary development of science through a mechanism that is dubbed Sci-Gaia by analogy with Lovelock's Gaia hypothesis. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
The Cygnus region of the galaxy: A VERITAS perspective
Directory of Open Access Journals (Sweden)
Weinstein A.
2015-01-01
Full Text Available The Cygnus-X star-forming region (“Cygnus” is the richest star-forming region within 2 kpc of Earth and is home to a wealth of potential cosmic ray accelerators, including supernova remnants, massive star clusters, and pulsar wind nebulae. Over the past five years, discoveries by several gamma-ray observatories sensitive in different energy bands, including the identification by Fermi-LAT of a potential cocoon of freshly accelerated cosmic rays, have pinpointed this region as a unique laboratory for studying the early phases of the cosmic ray life cycle. From 2007 to 2009 VERITAS, a very high energy (VHE; E > 100 GeV observatory in southern Arizona, undertook an extensive survey of the Cygnus region from 67 to 82 degrees Galactic longitude and from −1 to 4 degrees in Galactic latitude. In the years since, VERITAS has continued to accumulate data at specific locations within the survey region. We will review the discoveries and insights that this rich dataset has already provided. We will also consider the key role that we expect these data to play in interpreting the complex multiwavelength picture we have of the Cygnus region, particularly in the vicinity of the Cygnus cocoon. As part of this discussion we will summarize ongoing studies of VERITAS data in the Cygnus region, including the development of new data analysis techniques that dramatically increase VERITAS' sensitivity to sources on scales larger than a square degree.
DEFF Research Database (Denmark)
Korsgaard, Steffen; Sassmannshausen, Sean Patrick
2017-01-01
In this chapter we explore four alternatives to the dominant discovery view of entrepreneurship; the development view, the construction view, the evolutionary view, and the Neo-Austrian view. We outline the main critique points of the discovery presented in these four alternatives, as well...
Midwest Lake uranium discovery, Saskatchewan, Canada
International Nuclear Information System (INIS)
Scott, F.
1981-01-01
The discovery of the Midwest Lake uranium deposit in Saskatchewan came some ten years after the start of exploration. The original mining rights were acquired on the basis of regional published, geology and proximity to the earlier discovery. Aerial radiometric surveys led to the location of a train of radioactive, glacially transported sandstone boulders and cobbles. The source of these mineralized erratics did not outcrop, and an extensive series of magnetic, electromagnetic, seismic and gravity surveys was carried out in an unsuccessful attempt to identify the source location. These surveys were followed by several programmes of diamond drilling, geochemical surveys and Pleistocene geological studies. None of these programmes or surveys encountered bedrock mineralization. When information about ore controls in the Athabasca Basin became available, a limited programme of three 300-m wildcat diamond-drill holes was proposed. The second of these holes cut weak radioactivity in a poorly cored intersection. This intersection was at an unconformity at a depth of 200 m. The programme terminated prematurely with early melting of lake ice. The first hole in the subsequent winter's follow-up drilling intersected uranium values in excess of 8%. (author)
International Nuclear Information System (INIS)
Fowler, P.H.
1988-01-01
The paper traces the discovery of the Π meson. The discovery was made by exposure of nuclear emulsions to cosmic radiation at high altitudes, with subsequent scanning of the emulsions for meson tracks. Disintegration of nuclei by a negative meson, and the decay of a Π meson were both observed. Further measurements revealed the mass of the meson. The studies carried out on the origin of the Π-mesons, and their mode of decay, are both described. (U.K.)
45 CFR 2554.26 - Are there limits on disclosure of documents or discovery?
2010-10-01
... discovery? 2554.26 Section 2554.26 Public Welfare Regulations Relating to Public Welfare (Continued) CORPORATION FOR NATIONAL AND COMMUNITY SERVICE PROGRAM FRAUD CIVIL REMEDIES ACT REGULATIONS Hearing Provisions § 2554.26 Are there limits on disclosure of documents or discovery? (a) Upon written request to the...
"Eureka, Eureka!" Discoveries in Science
Agarwal, Pankaj
2011-01-01
Accidental discoveries have been of significant value in the progress of science. Although accidental discoveries are more common in pharmacology and chemistry, other branches of science have also benefited from such discoveries. While most discoveries are the result of persistent research, famous accidental discoveries provide a fascinating…
Potential Environmental Justice (EJ) areas in Region 2 based on 2000 Census [EPA.EJAREAS_2000
U.S. Environmental Protection Agency — Potential Environmental Justice (EJ) areas in Region 2 . This dataset was derived from 2000 census data and based on the criteria setforth in the Region 2 Interim...
'The Lusiads', poem of discovery
Directory of Open Access Journals (Sweden)
Natasha Furlan Felizi
2016-07-01
Full Text Available The article proposes reading Os Lusíadas as a discovery journey. Discovery here read as aletheia or “revelation”, as proposed by Sophia de Mello Breyner Andresen in 1980. Using Martin Heidegger’s notion of aletheia in the book Parmenides along with Jorge de Sena and Sophia de Mello Breyner Andresen reflections on Camões, I’ll seek to point out alternative readings for Os Lusíadas as a “discovery journey”.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Discovery. 44.24 Section 44.24 Mineral... Discovery. Parties shall be governed in their conduct of discovery by appropriate provisions of the Federal... discovery. Alternative periods of time for discovery may be prescribed by the presiding administrative law...
Brown, Herbert C.
1974-01-01
The role of discovery in the advance of the science of chemistry and the factors that are currently operating to handicap that function are considered. Examples are drawn from the author's work with boranes. The thesis that exploratory research and discovery should be encouraged is stressed. (DT)
Synthetic biology of antimicrobial discovery.
Zakeri, Bijan; Lu, Timothy K
2013-07-19
Antibiotic discovery has a storied history. From the discovery of penicillin by Sir Alexander Fleming to the relentless quest for antibiotics by Selman Waksman, the stories have become like folklore used to inspire future generations of scientists. However, recent discovery pipelines have run dry at a time when multidrug-resistant pathogens are on the rise. Nature has proven to be a valuable reservoir of antimicrobial agents, which are primarily produced by modularized biochemical pathways. Such modularization is well suited to remodeling by an interdisciplinary approach that spans science and engineering. Herein, we discuss the biological engineering of small molecules, peptides, and non-traditional antimicrobials and provide an overview of the growing applicability of synthetic biology to antimicrobials discovery.
Miatun, A.; Muntazhimah
2018-01-01
The aim of this research was to determine the effect of learning models on mathematics achievement viewed from student’s self-regulated learning. The learning model compared were discovery learning and problem-based learning. The population was all students at the grade VIII of Junior High School in Boyolali regency. The samples were students of SMPN 4 Boyolali, SMPN 6 Boyolali, and SMPN 4 Mojosongo. The instruments used were mathematics achievement tests and self-regulated learning questionnaire. The data were analyzed using unbalanced two-ways Anova. The conclusion was as follows: (1) discovery learning gives better achievement than problem-based learning. (2) Achievement of students who have high self-regulated learning was better than students who have medium and low self-regulated learning. (3) For discovery learning, achievement of students who have high self-regulated learning was better than students who have medium and low self-regulated learning. For problem-based learning, students who have high and medium self-regulated learning have the same achievement. (4) For students who have high self-regulated learning, discovery learning gives better achievement than problem-based learning. Students who have medium and low self-regulated learning, both learning models give the same achievement.
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Discovery. 180.500 Section 180.500... OPPORTUNITY CONSOLIDATED HUD HEARING PROCEDURES FOR CIVIL RIGHTS MATTERS Discovery § 180.500 Discovery. (a) In general. This subpart governs discovery in aid of administrative proceedings under this part. Discovery in...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discovery. 224.21 Section 224.21 Foreign....21 Discovery. (a) The following types of discovery are authorized: (1) Requests for production of... parties, discovery is available only as ordered by the ALJ. The ALJ shall regulate the timing of discovery...
13 CFR 142.23 - Are there limits on disclosure of documents or discovery?
2010-01-01
... documents or discovery? 142.23 Section 142.23 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION PROGRAM FRAUD CIVIL REMEDIES ACT REGULATIONS Hearing Provisions § 142.23 Are there limits on disclosure of documents or discovery? (a) Upon written request to the reviewing official, the defendant may review all non...
2010-04-01
... 19 Customs Duties 3 2010-04-01 2010-04-01 false Discovery. 207.109 Section 207.109 Customs Duties... and Committee Proceedings § 207.109 Discovery. (a) Discovery methods. All parties may obtain discovery under such terms and limitations as the administrative law judge may order. Discovery may be by one or...
2010-01-01
... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Discovery. 25.21 Section 25.21... Discovery. (a) The following types of discovery are authorized: (1) Requests for production of documents for..., discovery is available only as ordered by the ALJ. The ALJ shall regulate the timing of discovery. (d...
Discovery of an Apparent Nova in M81
Hornoch, K.; Alfaro, M. Diaz; Ordonez-Etxeberria, I.; Vaduvescu, O.
2015-01-01
We report the discovery of an apparent nova in M81 on a co-added 1600-s narrow-band H-alpha CCD image taken with the 2.5-m Isaac Newton Telescope (INT) + WFC at La Palma under ~2.4" seeing on 2015 Jan. 15.126 UT.
The future workforce in cancer prevention: advancing discovery, research, and technology.
Newhauser, Wayne D; Scheurer, Michael E; Faupel-Badger, Jessica M; Clague, Jessica; Weitzel, Jeffrey; Woods, Kendra V
2012-05-01
As part of a 2-day conference on October 15 and 16, 2009, a nine-member task force composed of scientists, clinicians, educators, administrators, and students from across the USA was formed to discuss research, discovery, and technology obstacles to progress in cancer prevention and control, specifically those related to the cancer prevention workforce. This article summarizes the task force's findings on the current state of the cancer prevention workforce in this area and its needs for the future. The task force identified two types of barriers impeding the current cancer prevention workforce in research, discovery, and technology from reaching its fullest potential: (1) limited cross-disciplinary research opportunities with underutilization of some disciplines is hampering discovery and research in cancer prevention, and (2) new research avenues are not being investigated because technology development and implementation are lagging. Examples of impediments and desired outcomes are provided in each of these areas. Recommended solutions to these problems are based on the goals of enhancing the current cancer prevention workforce and accelerating the pace of discovery and clinical translation.
Experimental analysis of the influence of context awareness on service discovery in PNs
DEFF Research Database (Denmark)
Olsen, Rasmus Løvenstein; Nickelsen, Anders; Nielsen, Jimmy Jessen
2006-01-01
In this paper we present an experimental prototype for context aware service discovery specifically aimed for Personal Networks. In the paper the concept of context aware service discovery, an architecture and the necessary components for performing context aware service discovery in Personal...... Networks is presented. The paper also presents a set of preliminary performance results of context aware service discovery. This is compared to normal service discovery, and as expected context awareness costs in performance....
Directory of Open Access Journals (Sweden)
Carrie L. Iwema
2016-07-01
Full Text Available The time it takes for a completed manuscript to be published traditionally can be extremely lengthy. Article publication delay, which occurs in part due to constraints associated with peer review, can prevent the timely dissemination of critical and actionable data associated with new information on rare diseases or developing health concerns such as Zika virus. Preprint servers are open access online repositories housing preprint research articles that enable authors (1 to make their research immediately and freely available and (2 to receive commentary and peer review prior to journal submission. There is a growing movement of preprint advocates aiming to change the current journal publication and peer review system, proposing that preprints catalyze biomedical discovery, support career advancement, and improve scientific communication. While the number of articles submitted to and hosted by preprint servers are gradually increasing, there has been no simple way to identify biomedical research published in a preprint format, as they are not typically indexed and are only discoverable by directly searching the specific preprint server websites. To address this issue, we created a search engine that quickly compiles preprints from disparate host repositories and provides a one-stop search solution. Additionally, we developed a web application that bolsters the discovery of preprints by enabling each and every word or phrase appearing on any web site to be integrated with articles from preprint servers. This tool, search.bioPreprint, is publicly available at http://www.hsls.pitt.edu/resources/preprint.
The in silico drug discovery toolbox: applications in lead discovery and optimization.
Bruno, Agostino; Costantino, Gabriele; Sartori, Luca; Radi, Marco
2017-11-06
Discovery and development of a new drug is a long lasting and expensive journey that takes around 15 years from starting idea to approval and marketing of new medication. Despite the R&D expenditures have been constantly increasing in the last few years, number of new drugs introduced into market has been steadily declining. This is mainly due to preclinical and clinical safety issues, which still represent about 40% of drug discontinuation. From this point of view, it is clear that if we want to increase drug-discovery success rate and reduce costs associated with development of a new drug, a comprehensive evaluation/prediction of potential safety issues should be conducted as soon as possible during early drug discovery phase. In the present review, we will analyse the early steps of drug-discovery pipeline, describing the sequence of steps from disease selection to lead optimization and focusing on the most common in silico tools used to assess attrition risks and build a mitigation plan. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Synthetic biology of antimicrobial discovery
Zakeri, Bijan; Lu, Timothy K.
2012-01-01
Antibiotic discovery has a storied history. From the discovery of penicillin by Sir Alexander Fleming to the relentless quest for antibiotics by Selman Waksman, the stories have become like folklore, used to inspire future generations of scientists. However, recent discovery pipelines have run dry at a time when multidrug resistant pathogens are on the rise. Nature has proven to be a valuable reservoir of antimicrobial agents, which are primarily produced by modularized biochemical pathways. Such modularization is well suited to remodeling by an interdisciplinary approach that spans science and engineering. Herein, we discuss the biological engineering of small molecules, peptides, and non-traditional antimicrobials and provide an overview of the growing applicability of synthetic biology to antimicrobials discovery. PMID:23654251
Discovery of inhibitors of bacterial histidine kinases
Velikova, N.R.
2014-01-01
Discovery of Inhibitors of Bacterial Histidine Kinases Summary
The thesis is on novel antibacterial drug discovery (http://youtu.be/NRMWOGgeysM). Using structure-based and fragment-based drug discovery approach, we have identified small-molecule histidine-kinase
Sigmund Freud (1856-1939) and Karl Köller (1857-1944) and the discovery of local anesthesia.
dos Reis, Almiro
2009-01-01
The understanding, occasionally recognized, that Sigmund Freud had the intuition to use cocaine as local anesthetic for surgical procedures, or even that he played any role in the discovery of local anesthesia is not true. The objective of Freud's studies were different, and based in irrefutable evidence, Karl Köller was the real inventor of local anesthesia. In face of those facts, proper knowledge of this historically important subject is due. This report refers to the long-known properties of cocaine. It also remembers personal data, and the professional and scientific activities of Sigmund Freud and Karl Köller. It presents Freud's researches on the pathophysiological effects of cocaine. It exposes the reasons for the harsh criticism of Freud's concepts. It describes the sudden, but conscious and justified, idea of Karl Köller to study scientifically the use of cocaine as a local anesthetic in animals and humans. It indicates how those pioneering studies, that culminated with the discovery of local anesthesia by Köller and two presentations in Vienna on the subject, were done. It also reports the first ophthalmologic surgery under local anesthesia. It shows the immediate dissemination throughout the world of the discovery that marked the beginning of regional blocks. It comments several documents corroborating the role of Köller in this discovery. And, finally, it mentions the numerous homages received by Köller in different areas of the world. COCLUSIONS: Regional block was introduced by Karl Köller in 1884, when he demonstrated the feasibility of performing painless ophthalmologic surgeries by using cocaine as a local anesthetic. Sigmund Freud studied cocaine extensively, but he did not have direct participation in this important discovery.
Usability of Discovery Portals
Bulens, J.D.; Vullings, L.A.E.; Houtkamp, J.M.; Vanmeulebrouk, B.
2013-01-01
As INSPIRE progresses to be implemented in the EU, many new discovery portals are built to facilitate finding spatial data. Currently the structure of the discovery portals is determined by the way spatial data experts like to work. However, we argue that the main target group for discovery portals are not spatial data experts but professionals with limited spatial knowledge, and a focus outside the spatial domain. An exploratory usability experiment was carried out in which three discovery p...
Conformity Adequacy Review: Region 2
Resources are for air quality and transportation government and community leaders. Information on the adequacy/inadequacy of state implementation plans (SIPs) in EPA Region 2 (NJ, NY, PR, VI) is provided here.
Discovery of Intrinsic Primitives on Triangle Meshes
Solomon, Justin; Ben-Chen, Mirela; Butscher, Adrian; Guibas, Leonidas
2011-01-01
The discovery of meaningful parts of a shape is required for many geometry processing applications, such as parameterization, shape correspondence, and animation. It is natural to consider primitives such as spheres, cylinders and cones
Antibody informatics for drug discovery
DEFF Research Database (Denmark)
Shirai, Hiroki; Prades, Catherine; Vita, Randi
2014-01-01
to the antibody science in every project in antibody drug discovery. Recent experimental technologies allow for the rapid generation of large-scale data on antibody sequences, affinity, potency, structures, and biological functions; this should accelerate drug discovery research. Therefore, a robust bioinformatic...... infrastructure for these large data sets has become necessary. In this article, we first identify and discuss the typical obstacles faced during the antibody drug discovery process. We then summarize the current status of three sub-fields of antibody informatics as follows: (i) recent progress in technologies...... for antibody rational design using computational approaches to affinity and stability improvement, as well as ab-initio and homology-based antibody modeling; (ii) resources for antibody sequences, structures, and immune epitopes and open drug discovery resources for development of antibody drugs; and (iii...
Silicon Detectors-Tools for Discovery in Particle Physics
International Nuclear Information System (INIS)
Krammer, Manfred
2009-01-01
Since the first application of Silicon strip detectors in high energy physics in the early 1980ies these detectors have enabled the experiments to perform new challenging measurements. With these devices it became possible to determine the decay lengths of heavy quarks, for example in the fixed target experiment NA11 at CERN. In this experiment Silicon tracking detectors were used for the identification of particles containing a c-quark. Later on, the experiments at the Large Electron Positron collider at CERN used already larger and sophisticated assemblies of Silicon detectors to identify and study particles containing the b-quark. A very important contribution to the discovery of the last of the six quarks, the top quark, has been made by even larger Silicon vertex detectors inside the experiments CDF and D0 at Fermilab. Nowadays a mature detector technology, the use of Silicon detectors is no longer restricted to the vertex regions of collider experiments. The two multipurpose experiments ATLAS and CMS at the Large Hadron Collider at CERN contain large tracking detectors made of Silicon. The largest is the CMS Inner Tracker consisting of 200 m 2 of Silicon sensor area. These detectors will be very important for a possible discovery of the Higgs boson or of Super Symmetric particles. This paper explains the first applications of Silicon sensors in particle physics and describes the continuous development of this technology up to the construction of the state of the art Silicon detector of CMS.
12 CFR 747.24 - Scope of document discovery.
2010-01-01
... act of Congress, or the principles of common law provide. (d) Time limits. All discovery, including... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Scope of document discovery. 747.24 Section 747... of Practice and Procedure § 747.24 Scope of document discovery. (a) Limits on discovery. (1) Subject...
New discoveries on the ecology and echolocation of the heart ...
African Journals Online (AJOL)
New discoveries on the ecology and echolocation of the heart-nosed bat Cardioderma cor with a ... Open Access DOWNLOAD FULL TEXT ... However, additional genetic data are necessary to resolve the phylogeny of Megadermatidae, ...
2010-04-01
... 19 Customs Duties 3 2010-04-01 2010-04-01 false Discovery. 354.10 Section 354.10 Customs Duties... ANTIDUMPING OR COUNTERVAILING DUTY ADMINISTRATIVE PROTECTIVE ORDER § 354.10 Discovery. (a) Voluntary discovery. All parties are encouraged to engage in voluntary discovery procedures regarding any matter, not...
2010-07-01
... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Discovery. 1150.63 Section... PRACTICE AND PROCEDURES FOR COMPLIANCE HEARINGS Prehearing Conferences and Discovery § 1150.63 Discovery. (a) Parties are encouraged to engage in voluntary discovery procedures. For good cause shown under...
2010-07-01
... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Discovery. 11.52 Section 11... Disciplinary Proceedings; Jurisdiction, Sanctions, Investigations, and Proceedings § 11.52 Discovery. Discovery... establishes that discovery is reasonable and relevant, the hearing officer, under such conditions as he or she...
"Drug" Discovery with the Help of Organic Chemistry.
Itoh, Yukihiro; Suzuki, Takayoshi
2017-01-01
The first step in "drug" discovery is to find compounds binding to a potential drug target. In modern medicinal chemistry, the screening of a chemical library, structure-based drug design, and ligand-based drug design, or a combination of these methods, are generally used for identifying the desired compounds. However, they do not necessarily lead to success and there is no infallible method for drug discovery. Therefore, it is important to explore medicinal chemistry based on not only the conventional methods but also new ideas. So far, we have found various compounds as drug candidates. In these studies, some strategies based on organic chemistry have allowed us to find drug candidates, through 1) construction of a focused library using organic reactions and 2) rational design of enzyme inhibitors based on chemical reactions catalyzed by the target enzyme. Medicinal chemistry based on organic chemical reactions could be expected to supplement the conventional methods. In this review, we present drug discovery with the help of organic chemistry showing examples of our explorative studies on histone deacetylase inhibitors and lysine-specific demethylase 1 inhibitors.
The Europa Ocean Discovery mission
Energy Technology Data Exchange (ETDEWEB)
Edwards, B.C. [Los Alamos National Lab., NM (United States); Chyba, C.F. [Univ. of Arizona, Tucson, AZ (United States); Abshire, J.B. [National Aeronautics and Space Administration, Greenbelt, MD (United States). Goddard Space Flight Center] [and others
1997-06-01
Since it was first proposed that tidal heating of Europa by Jupiter might lead to liquid water oceans below Europa`s ice cover, there has been speculation over the possible exobiological implications of such an ocean. Liquid water is the essential ingredient for life as it is known, and the existence of a second water ocean in the Solar System would be of paramount importance for seeking the origin and existence of life beyond Earth. The authors present here a Discovery-class mission concept (Europa Ocean Discovery) to determine the existence of a liquid water ocean on Europa and to characterize Europa`s surface structure. The technical goal of the Europa Ocean Discovery mission is to study Europa with an orbiting spacecraft. This goal is challenging but entirely feasible within the Discovery envelope. There are four key challenges: entering Europan orbit, generating power, surviving long enough in the radiation environment to return valuable science, and complete the mission within the Discovery program`s launch vehicle and budget constraints. The authors will present here a viable mission that meets these challenges.
Shafiee, Mohammad Javad; Chung, Audrey G; Khalvati, Farzad; Haider, Masoom A; Wong, Alexander
2017-10-01
While lung cancer is the second most diagnosed form of cancer in men and women, a sufficiently early diagnosis can be pivotal in patient survival rates. Imaging-based, or radiomics-driven, detection methods have been developed to aid diagnosticians, but largely rely on hand-crafted features that may not fully encapsulate the differences between cancerous and healthy tissue. Recently, the concept of discovery radiomics was introduced, where custom abstract features are discovered from readily available imaging data. We propose an evolutionary deep radiomic sequencer discovery approach based on evolutionary deep intelligence. Motivated by patient privacy concerns and the idea of operational artificial intelligence, the evolutionary deep radiomic sequencer discovery approach organically evolves increasingly more efficient deep radiomic sequencers that produce significantly more compact yet similarly descriptive radiomic sequences over multiple generations. As a result, this framework improves operational efficiency and enables diagnosis to be run locally at the radiologist's computer while maintaining detection accuracy. We evaluated the evolved deep radiomic sequencer (EDRS) discovered via the proposed evolutionary deep radiomic sequencer discovery framework against state-of-the-art radiomics-driven and discovery radiomics methods using clinical lung CT data with pathologically proven diagnostic data from the LIDC-IDRI dataset. The EDRS shows improved sensitivity (93.42%), specificity (82.39%), and diagnostic accuracy (88.78%) relative to previous radiomics approaches.
Usability of Discovery Portals
Bulens, J.D.; Vullings, L.A.E.; Houtkamp, J.M.; Vanmeulebrouk, B.
2013-01-01
As INSPIRE progresses to be implemented in the EU, many new discovery portals are built to facilitate finding spatial data. Currently the structure of the discovery portals is determined by the way spatial data experts like to work. However, we argue that the main target group for discovery portals
2010-01-01
... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Discovery. 16.213 Section 16.213... PRACTICE FOR FEDERALLY-ASSISTED AIRPORT ENFORCEMENT PROCEEDINGS Hearings § 16.213 Discovery. (a) Discovery... discovery permitted by this section if a party shows that— (1) The information requested is cumulative or...
2010-07-01
... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Discovery. 27.21 Section 27.21... Discovery. (a) The following types of discovery are authorized: (1) Requests for production of documents for..., discovery is available only as ordered by the presiding officer. The presiding officer shall regulate the...
2010-07-01
... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Discovery. 41.150 Section 41... COMMERCE PRACTICE BEFORE THE BOARD OF PATENT APPEALS AND INTERFERENCES Contested Cases § 41.150 Discovery. (a) Limited discovery. A party is not entitled to discovery except as authorized in this subpart. The...
2010-01-01
... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Discovery. 13.220 Section 13.220... INVESTIGATIVE AND ENFORCEMENT PROCEDURES Rules of Practice in FAA Civil Penalty Actions § 13.220 Discovery. (a) Initiation of discovery. Any party may initiate discovery described in this section, without the consent or...
2010-10-01
... 49 Transportation 7 2010-10-01 2010-10-01 false Discovery. 604.38 Section 604.38 Transportation... TRANSPORTATION CHARTER SERVICE Hearings. § 604.38 Discovery. (a) Permissible forms of discovery shall be within the discretion of the PO. (b) The PO shall limit the frequency and extent of discovery permitted by...
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Discovery. 26.18 Section 26.18... PROCEDURES Hearings Before Hearing Officers Discovery § 26.18 Discovery. (a) General. The parties are encouraged to engage in voluntary discovery procedures, which may commence at any time after an answer has...
2010-10-01
... 42 Public Health 3 2010-10-01 2010-10-01 false Discovery. 426.532 Section 426.532 Public Health... § 426.532 Discovery. (a) General rule. If the Board orders discovery, the Board must establish a reasonable timeframe for discovery. (b) Protective order—(1) Request for a protective order. Any party...
2010-10-01
... 49 Transportation 9 2010-10-01 2010-10-01 false Discovery. 1503.633 Section 1503.633... Rules of Practice in TSA Civil Penalty Actions § 1503.633 Discovery. (a) Initiation of discovery. Any party may initiate discovery described in this section, without the consent or approval of the ALJ, at...
2010-01-01
... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Discovery. 1264.120 Section 1264.120... PENALTIES ACT OF 1986 § 1264.120 Discovery. (a) The following types of discovery are authorized: (1..., discovery is available only as ordered by the presiding officer. The presiding officer shall regulate the...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discovery. 128.6 Section 128.6 Foreign... Discovery. (a) Discovery by the respondent. The respondent, through the Administrative Law Judge, may... discovery if the interests of national security or foreign policy so require, or if necessary to comply with...
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Discovery. 26.42 Section 26.42... PROCEDURES Hearings Pursuant to the Administrative Procedure Act Discovery § 26.42 Discovery. (a) General. The parties are encouraged to engage in voluntary discovery procedures, which may commence at any time...
2010-10-01
... 49 Transportation 5 2010-10-01 2010-10-01 false Discovery. 386.37 Section 386.37 Transportation... and Hearings § 386.37 Discovery. (a) Parties may obtain discovery by one or more of the following...; and requests for admission. (b) Discovery may not commence until the matter is pending before the...
2010-07-01
... 29 Labor 9 2010-07-01 2010-07-01 false Discovery. 1955.32 Section 1955.32 Labor Regulations...) PROCEDURES FOR WITHDRAWAL OF APPROVAL OF STATE PLANS Preliminary Conference and Discovery § 1955.32 Discovery... allow discovery by any other appropriate procedure, such as by interrogatories upon a party or request...
Proceedings of the 2. Regional meetings on energy 2009
International Nuclear Information System (INIS)
Falque-Masset, Marie-Laure; Labrousse, Muriel; Gorges, Pascale; Boulet, Sophie; Petit-Tesson, Christophe
2010-01-01
This conference addressed local initiatives and actors concerning or involved in climate and energy issues in the Ile de France region, initiatives for energy in European cities and regions. It discusses the impact of the Grenelle de l'Environnement on regional energy and climate policies. It comments the development of professions and activities related to energy efficiency and renewable energies in the Ile de France region. Some remarkable actions are presented: intelligent control of energetic installations, solar heat pump for an education centre, heat network and geothermal energy in Melun
Drug discovery for alopecia: gone today, hair tomorrow.
Santos, Zenildo; Avci, Pinar; Hamblin, Michael R
2015-03-01
Hair loss or alopecia affects the majority of the population at some time in their life, and increasingly, sufferers are demanding treatment. Three main types of alopecia (androgenic [AGA], areata [AA] and chemotherapy-induced [CIA]) are very different, and have their own laboratory models and separate drug-discovery efforts. In this article, the authors review the biology of hair, hair follicle (HF) cycling, stem cells and signaling pathways. AGA, due to dihydrotesterone, is treated by 5-α reductase inhibitors, androgen receptor blockers and ATP-sensitive potassium channel-openers. AA, which involves attack by CD8(+)NK group 2D-positive (NKG2D(+)) T cells, is treated with immunosuppressives, biologics and JAK inhibitors. Meanwhile, CIA is treated by apoptosis inhibitors, cytokines and topical immunotherapy. The desire to treat alopecia with an easy topical preparation is expected to grow with time, particularly with an increasing aging population. The discovery of epidermal stem cells in the HF has given new life to the search for a cure for baldness. Drug discovery efforts are being increasingly centered on these stem cells, boosting the hair cycle and reversing miniaturization of HF. Better understanding of the molecular mechanisms underlying the immune attack in AA will yield new drugs. New discoveries in HF neogenesis and low-level light therapy will undoubtedly have a role to play.
International Nuclear Information System (INIS)
Xu, Bin; Lin, Boqiang
2016-01-01
Identifying the key influencing factors of CO_2 emissions in China's iron and steel industry is vital for mitigating its emissions and formulating effective environmental protection measures. Most of the existing researches utilized time series data to investigate the driving factors of the industry's CO_2 emission at the national level, but regional differences have not been given appropriate attention. This paper adopts provincial panel data from 2000 to 2013 and panel data models to examine the key driving forces of CO_2 emissions at the regional levels in China. The results show that industrialization dominates the industry's CO_2 emissions, but its effect varies across regions. The impact of energy efficiency on CO_2 emissions in the eastern region is greater than in the central and western regions because of a huge difference in R&D investment. The influence of urbanization has significant regional differences due to the heterogeneity in human capital accumulation and real estate development. Energy structure has large potential to mitigate CO_2 emissions on account of increased R&D investment in energy-saving technology and expanded clean energy use. Hence, in order to effectively achieve emission reduction, local governments should consider all these factors as well as regional heterogeneity in formulating appropriate mitigation policies. - Highlights: • We explore the driving forces of CO_2 emissions in China's steel industry. • Industrialization dominates CO_2 emissions in the iron and steel industry. • Energy structure has large potential to mitigate CO_2 emissions in the steel industry. • The influence of urbanization has significant regional differences.
Huang, Chen; Leung, Ross Ka-Kit; Guo, Min; Tuo, Li; Guo, Lin; Yew, Wing Wai; Lou, Inchio; Lee, Simon Ming Yuen; Sun, Chenghang
2016-01-01
Microbial secondary metabolites are valuable resources for novel drug discovery. In particular, actinomycetes expressed a range of antibiotics against a spectrum of bacteria. In genus level, strain Allosalinactinospora lopnorensis CA15-2T is the first new actinomycete isolated from the Lop Nor region, China. Antimicrobial assays revealed that the strain could inhibit the growth of certain types of bacteria, including Acinetobacter baumannii and Staphylococcus aureus, highlighting its clinical significance. Here we report the 5,894,259 base pairs genome of the strain, containing 5,662 predicted genes, and 832 of them cannot be detected by sequence similarity-based methods, suggesting the new species may carry a novel gene pool. Furthermore, our genome-mining investigation reveals that A. lopnorensis CA15-2T contains 17 gene clusters coding for known or novel secondary metabolites. Meanwhile, at least six secondary metabolites were disclosed from ethyl acetate (EA) extract of the fermentation broth of the strain by high-resolution UPLC-MS. Compared with reported clusters of other species, many new genes were found in clusters, and the physical chromosomal location and order of genes in the clusters are distinct. This study presents evidence in support of A. lopnorensis CA15-2T as a potent natural products source for drug discovery. PMID:26864220
2010-10-01
... 42 Public Health 3 2010-10-01 2010-10-01 false Discovery. 426.432 Section 426.432 Public Health... § 426.432 Discovery. (a) General rule. If the ALJ orders discovery, the ALJ must establish a reasonable timeframe for discovery. (b) Protective order—(1) Request for a protective order. Any party receiving a...
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Discovery. 13.21 Section 13.21 Energy NUCLEAR REGULATORY COMMISSION PROGRAM FRAUD CIVIL REMEDIES § 13.21 Discovery. (a) The following types of discovery are...) Unless mutually agreed to by the parties, discovery is available only as ordered by the ALJ. The ALJ...
2010-07-01
... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Discovery. 10.71 Section 10.71 Money... SERVICE Rules Applicable to Disciplinary Proceedings § 10.71 Discovery. (a) In general. Discovery may be... relevance, materiality and reasonableness of the requested discovery and subject to the requirements of § 10...
2010-07-01
... 39 Postal Service 1 2010-07-01 2010-07-01 false Discovery. 955.15 Section 955.15 Postal Service... APPEALS § 955.15 Discovery. (a) The parties are encouraged to engage in voluntary discovery procedures. In connection with any deposition or other discovery procedure, the Board may issue any order which justice...
2010-10-01
... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Discovery. 35.21 Section 35.21 Public... AND STATEMENTS § 35.21 Discovery. (a) The following types of discovery are authorized: (1) Requests...) Unless mutually agreed to by the parties, discovery is available only as ordered by the ALJ. The ALJ...
Shmatkovska, Tetiana О.; Шматковська, Тетяна Олександрівна; Stashchuk, Olena V.; Стащук, Олена Володимирівна
2017-01-01
The main objectives of the study are generalization of the economic essence of the process of profitability formation, discovery of its tendencies and conditions of the agricultural producers in Lviv region. The research was conducted basing on the results of the activity of agricultural enterprises, issued by Main Statistic Administration in Lviv region in 2009 – 2013. The paper determines that profit of agricultural enterprises is the source of its development through reinvestment and is al...
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Discovery. 134.213 Section 134.213... OFFICE OF HEARINGS AND APPEALS Rules of Practice for Most Cases § 134.213 Discovery. (a) Motion. A party may obtain discovery only upon motion, and for good cause shown. (b) Forms. The forms of discovery...
2010-07-01
... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Discovery. 16.21 Section 16.21 Money... FRAUD CIVIL REMEDIES ACT OF 1986 § 16.21 Discovery. (a) The following types of discovery are authorized... to require the creation of a document. (c) Unless mutually agreed to by the parties, discovery is...
Defining Creativity with Discovery
Wilson, Nicholas Charles; Martin, Lee
2017-01-01
The standard definition of creativity has enabled significant empirical and theoretical advances, yet contains philosophical conundrums concerning the nature of novelty and the role of recognition and values. In this work we offer an act of conceptual valeting that addresses these issues and in doing so, argue that creativity definitions can be extended through the use of discovery. Drawing on dispositional realist philosophy we outline why adding the discovery and bringing into being of new ...
Inseparability of science history and discovery
Directory of Open Access Journals (Sweden)
J. M. Herndon
2010-04-01
Full Text Available Science is very much a logical progression through time. Progressing along a logical path of discovery is rather like following a path through the wilderness. Occasionally the path splits, presenting a choice; the correct logical interpretation leads to further progress, the wrong choice leads to confusion. By considering deeply the relevant science history, one might begin to recognize past faltering in the logical progression of observations and ideas and, perhaps then, to discover new, more precise understanding. The following specific examples of science faltering are described from a historical perspective: (1 Composition of the Earth's inner core; (2 Giant planet internal energy production; (3 Physical impossibility of Earth-core convection and Earth-mantle convection, and; (4 Thermonuclear ignition of stars. For each example, a revised logical progression is described, leading, respectively, to: (1 Understanding the endo-Earth's composition; (2 The concept of nuclear georeactor origin of geo- and planetary magnetic fields; (3 The invalidation and replacement of plate tectonics; and, (4 Understanding the basis for the observed distribution of luminous stars in galaxies. These revised logical progressions clearly show the inseparability of science history and discovery. A different and more fundamental approach to making scientific discoveries than the frequently discussed variants of the scientific method is this: An individual ponders and through tedious efforts arranges seemingly unrelated observations into a logical sequence in the mind so that causal relationships become evident and new understanding emerges, showing the path for new observations, for new experiments, for new theoretical considerations, and for new discoveries. Science history is rich in "seemingly unrelated observations" just waiting to be logically and causally related to reveal new discoveries.
Gene set-based module discovery in the breast cancer transcriptome
Directory of Open Access Journals (Sweden)
Zhang Michael Q
2009-02-01
Full Text Available Abstract Background Although microarray-based studies have revealed global view of gene expression in cancer cells, we still have little knowledge about regulatory mechanisms underlying the transcriptome. Several computational methods applied to yeast data have recently succeeded in identifying expression modules, which is defined as co-expressed gene sets under common regulatory mechanisms. However, such module discovery methods are not applied cancer transcriptome data. Results In order to decode oncogenic regulatory programs in cancer cells, we developed a novel module discovery method termed EEM by extending a previously reported module discovery method, and applied it to breast cancer expression data. Starting from seed gene sets prepared based on cis-regulatory elements, ChIP-chip data, and gene locus information, EEM identified 10 principal expression modules in breast cancer based on their expression coherence. Moreover, EEM depicted their activity profiles, which predict regulatory programs in each subtypes of breast tumors. For example, our analysis revealed that the expression module regulated by the Polycomb repressive complex 2 (PRC2 is downregulated in triple negative breast cancers, suggesting similarity of transcriptional programs between stem cells and aggressive breast cancer cells. We also found that the activity of the PRC2 expression module is negatively correlated to the expression of EZH2, a component of PRC2 which belongs to the E2F expression module. E2F-driven EZH2 overexpression may be responsible for the repression of the PRC2 expression modules in triple negative tumors. Furthermore, our network analysis predicts regulatory circuits in breast cancer cells. Conclusion These results demonstrate that the gene set-based module discovery approach is a powerful tool to decode regulatory programs in cancer cells.
Predicting future discoveries from current scientific literature.
Petrič, Ingrid; Cestnik, Bojan
2014-01-01
Knowledge discovery in biomedicine is a time-consuming process starting from the basic research, through preclinical testing, towards possible clinical applications. Crossing of conceptual boundaries is often needed for groundbreaking biomedical research that generates highly inventive discoveries. We demonstrate the ability of a creative literature mining method to advance valuable new discoveries based on rare ideas from existing literature. When emerging ideas from scientific literature are put together as fragments of knowledge in a systematic way, they may lead to original, sometimes surprising, research findings. If enough scientific evidence is already published for the association of such findings, they can be considered as scientific hypotheses. In this chapter, we describe a method for the computer-aided generation of such hypotheses based on the existing scientific literature. Our literature-based discovery of NF-kappaB with its possible connections to autism was recently approved by scientific community, which confirms the ability of our literature mining methodology to accelerate future discoveries based on rare ideas from existing literature.
Directional Bias and Pheromone for Discovery and Coverage on Networks
Energy Technology Data Exchange (ETDEWEB)
Fink, Glenn A.; Berenhaut, Kenneth S.; Oehmen, Christopher S.
2012-09-11
Natural multi-agent systems often rely on “correlated random walks” (random walks that are biased toward a current heading) to distribute their agents over a space (e.g., for foraging, search, etc.). Our contribution involves creation of a new movement and pheromone model that applies the concept of heading bias in random walks to a multi-agent, digital-ants system designed for cyber-security monitoring. We examine the relative performance effects of both pheromone and heading bias on speed of discovery of a target and search-area coverage in a two-dimensional network layout. We found that heading bias was unexpectedly helpful in reducing search time and that it was more influential than pheromone for improving coverage. We conclude that while pheromone is very important for rapid discovery, heading bias can also greatly improve both performance metrics.
Applied metabolomics in drug discovery.
Cuperlovic-Culf, M; Culf, A S
2016-08-01
The metabolic profile is a direct signature of phenotype and biochemical activity following any perturbation. Metabolites are small molecules present in a biological system including natural products as well as drugs and their metabolism by-products depending on the biological system studied. Metabolomics can provide activity information about possible novel drugs and drug scaffolds, indicate interesting targets for drug development and suggest binding partners of compounds. Furthermore, metabolomics can be used for the discovery of novel natural products and in drug development. Metabolomics can enhance the discovery and testing of new drugs and provide insight into the on- and off-target effects of drugs. This review focuses primarily on the application of metabolomics in the discovery of active drugs from natural products and the analysis of chemical libraries and the computational analysis of metabolic networks. Metabolomics methodology, both experimental and analytical is fast developing. At the same time, databases of compounds are ever growing with the inclusion of more molecular and spectral information. An increasing number of systems are being represented by very detailed metabolic network models. Combining these experimental and computational tools with high throughput drug testing and drug discovery techniques can provide new promising compounds and leads.
The Discovery Dome: A Tool for Increasing Student Engagement
Brevik, Corinne
2015-04-01
The Discovery Dome is a portable full-dome theater that plays professionally-created science films. Developed by the Houston Museum of Natural Science and Rice University, this inflatable planetarium offers a state-of-the-art visual learning experience that can address many different fields of science for any grade level. It surrounds students with roaring dinosaurs, fascinating planets, and explosive storms - all immersive, engaging, and realistic. Dickinson State University has chosen to utilize its Discovery Dome to address Earth Science education at two levels. University courses across the science disciplines can use the Discovery Dome as part of their curriculum. The digital shows immerse the students in various topics ranging from astronomy to geology to weather and climate. The dome has proven to be a valuable tool for introducing new material to students as well as for reinforcing concepts previously covered in lectures or laboratory settings. The Discovery Dome also serves as an amazing science public-outreach tool. University students are trained to run the dome, and they travel with it to schools and libraries around the region. During the 2013-14 school year, our Discovery Dome visited over 30 locations. Many of the schools visited are in rural settings which offer students few opportunities to experience state-of-the-art science technology. The school kids are extremely excited when the Discovery Dome visits their community, and they will talk about the experience for many weeks. Traveling with the dome is also very valuable for the university students who get involved in the program. They become very familiar with the science content, and they gain experience working with teachers as well as the general public. They get to share their love of science, and they get to help inspire a new generation of scientists.
Accessibility of second regions of stability in tokamaks
Energy Technology Data Exchange (ETDEWEB)
Manickam, J.
1985-12-01
Second regions of stability to the ideal ballooning modes have been shown to exist in large-aspect-ratio circular and small-aspect-ratio bean-shaped tokamaks. We report on the existence of these second stability regions in finite-aspect-ratio dee-shaped tokamaks. We also report on the discovery of a second-stable region with respect to the n = 1 external kink mode in a bean-shaped plasma. The role of the shear and current profile in determining these regions of parameter space are discussed. 13 refs., 6 figs.
Accessibility of second regions of stability in tokamaks
International Nuclear Information System (INIS)
Manickam, J.
1985-12-01
Second regions of stability to the ideal ballooning modes have been shown to exist in large-aspect-ratio circular and small-aspect-ratio bean-shaped tokamaks. We report on the existence of these second stability regions in finite-aspect-ratio dee-shaped tokamaks. We also report on the discovery of a second-stable region with respect to the n = 1 external kink mode in a bean-shaped plasma. The role of the shear and current profile in determining these regions of parameter space are discussed. 13 refs., 6 figs
2011-06-01
For the past two-and-a-half decades, the Office of Science at the U.S. Department of Energy has been at the forefront of scientific discovery. Over 100 important discoveries supported by the Office of Science are represented in this document.
Reflections on the discovery of fission
International Nuclear Information System (INIS)
Peieris, Rudolf
1989-01-01
In this article an eminent scientist looks back on the fifty years since the discovery of nuclear fission. Starting with Enrico Fermi's work with neutrons in the 1930s, the author then introduces Neils Bohr's ideas about atomic structure. The puzzle of what happens when uranium was bombarded by neutrons was gradually unravelled. Finally by 1939 it was becoming realised that the uranium nucleus had split in two. Gradually physicists began to speculate on the possibility of harnessing some of the energy stored in the nucleus and on the idea of a chain reaction. As the end of the decade approached, workers in the field combined with military forces to develop a weapon based on this reaction, the Manhatton Project. The author notes how fast an obscure, esoteric piece of physics research, can be taken up into the military and political area. (UK)
Comment on "drug discovery: turning the titanic".
Lesterhuis, W Joost; Bosco, Anthony; Lake, Richard A
2014-03-26
The pathobiology-based approach to research and development has been the dominant paradigm for successful drug discovery over the last decades. We propose that the molecular and cellular events that govern a resolving, rather than an evolving, disease may reveal new druggable pathways.
International Nuclear Information System (INIS)
1989-01-01
''Discovery and the Atom'' tells the story of the founding of nuclear physics. This programme looks at nuclear physics up to the discovery of the neutron in 1932. Animation explains the science of the classic experiments, such as the scattering of alpha particles by Rutherford and the discovery of the nucleus. Archive film shows the people: Lord Rutherford, James Chadwick, Marie Curie. (author)
On the LHC observation of gluinos from the Egret-preferred region
International Nuclear Information System (INIS)
Bednyakov, V. A.; Budagov, Ju. A.; Gladyshev, A. V.; Kazakov, D. I.; Khramov, E. V.; Khubua, D. I.
2009-01-01
Prospects for observation of a SUSY-like signal from two gluinos g-bar g-bar are investigated within a certain region of the mSUGRA parameter space, where the cross section of the two-gluino production in pp-collisions at the LHC (√s = 14 TeV) is estimated at a rather high level of 17.3 pb. In this so-called EGRET-preferred region, the lightest stable neutralinos χ 1 0 can serve as cold-dark-matter particles and can naturally explain the excess of diffuse Galactic gamma rays observed by the EGRET space apparatus. The g-bar g-bar-event selection relies on a clear signature when decay products of each gluino contain one bb-bar pair, one or two ll-bar pair(s) or one or two light qq-bar pair(s), and a neutralino. Rather high transverse missing energy carried away by the two neutralinos is the essential signature of the events using of which allows the relevant Standard Model background to be reduced significantly. Furthermore, distributions of the reconstructed invariant masses of two opposite-charged-lepton or light-jet pairs produced by the χ 2 0 → χ 1 0 l + l - and χ 2 0 → χ 1 0 qq-bar three-body decays have kinematic end points which measure the difference between masses of χ 2 0 and χ 1 0 . In particular, it was found that these signatures of selected processes demonstrate good prospects for discovery of gluinos at the LHC. These signatures allow one to distinguish different mSUGRA parameters m 1/2 within the EGRET-preferred region (at a higher than 6σ confidence level with 300 fb -1 data).
Intraday Price Discovery in Fragmented Markets
S.R. Ozturk (Sait); M. van der Wel (Michel); D.J.C. van Dijk (Dick)
2014-01-01
textabstractFor many assets, trading is fragmented across multiple exchanges. Price discovery measures summarize the informativeness of trading on each venue for discovering the asset’s true underlying value. We explore intraday variation in price discovery using a structural model with
Directory of Open Access Journals (Sweden)
Adekunle Oladipupo Bamiro
2015-01-01
Full Text Available This study investigated the effects of three strategies (i.e., guided discovery, think-pair-share, and lecture on senior secondary school students’ achievement in chemistry. A pretest, posttest, control group quasi-experimental design with a 3 × 3 × 2 factorial matrix was adopted for the study. Treatment was at three levels (guided discovery, think-pair-share, and lecture strategies. Intervening variables were cognitive entry behavior at three levels (high, middle, and low and gender at two levels (male and female. Two hundred forty-two Senior Secondary 1 students in intact classes from six secondary schools in Ijebu Ode and Odogbolu Local Government Areas of Ogun State were randomly assigned to the treatment and control groups. Three instruments were developed and used to collect data from students during the 8-week treatment program. The data collected were subjected to analysis of covariance and multiple classification analysis. Scheffé test was further used as post hoc measures. Where significant interactions were observed, they were represented with graphical illustrations. It was found that students taught with guided discovery and think-pair-share strategies obtained significantly higher posttest mean scores than those in the lecture strategy, F(4, 223 = 51.66, p < .05. The use of guided discovery and think-pair-share strategies had great potential for improving achievement in chemistry and science learning generally.
Energy Technology Data Exchange (ETDEWEB)
Ali, Ahmed [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany); Ahmed, Ishtiaq; Rehman, Abdur [Quaid-i-Azam University Campus, Islamabad (Pakistan). National Centre for Physics; Aslam, M. Jamil [Quaid-i-Azam University, Islamabad (Pakistan). Physics Dept.
2017-04-15
The LHCb discovery of the two baryonic states P{sub c}{sup +}(4380) and P{sub c}{sup +}(4450), having J{sup P}=3/2{sup -} and J{sup P}=5/2{sup +}, respectively, in the process pp → b anti b → Λ{sub b}X, followed by the decay Λ{sub b}→J/ψpK{sup -}, has motivated a number of theoretical models. Interpreting them as compact { anti c[cu][ud]; L_P=0,1} objects, the mass spectroscopy of the J{sup P}=3/2{sup -} and J{sup P}=5/2{sup +} pentaquarks was worked out by us for the pentaquarks in the SU(3){sub F} multiplets, using an effective Hamiltonian based on constituent diquarks and quarks. Their possible discovery modes in b-baryon decays were also given using the heavy quark spin symmetry. In this paper, we calculate the mass spectrum of the hidden c anti c pentaquarks having J{sup P}=(1)/(2){sup ±} for the SU(3){sub F} multiplets and their anticipated discovery modes in b-baryon decays. Some of the P{sub c}{sup +}(J{sup P}=1/2{sup ±}) pentaquarks, produced in the Λ{sub b} decays may have their masses just below the J/ψ p threshold, in which case they should be searched for in the modes P{sub c}{sup +}(J{sup P}=1/2{sup ±})→η{sub c}p,μ{sup +}μ{sup -}p,e{sup +}e{sup -}p.
Soheili, Arash; Tambar, Uttam K
2013-10-04
A formal total synthesis of (±)-amathaspiramide F through a tandem palladium-catalyzed allylic amination/[2,3]-Stevens rearrangement is reported. The unexpected diastereoselectivity of the [2,3]-Stevens rearrangement was controlled by the substitution patterns of an aromatic ring. This discovery represents a new stereocontrolling element for [2,3]-sigmatropic rearrangements in complex molecular settings.
29 CFR 2700.56 - Discovery; general.
2010-07-01
...(c) or 111 of the Act has been filed. 30 U.S.C. 815(c) and 821. (e) Completion of discovery... 29 Labor 9 2010-07-01 2010-07-01 false Discovery; general. 2700.56 Section 2700.56 Labor... Hearings § 2700.56 Discovery; general. (a) Discovery methods. Parties may obtain discovery by one or more...
Historical aspects of the discovery of plutonium
International Nuclear Information System (INIS)
Clark, David L.
2016-01-01
The historical events that led up to the discovery of plutonium and subsequently, how that discovery helped shape the modern period table of the elements, and ushered in a new era of nuclear science and technology are discussed. When the first of the transuranium elements, neptunium was discovered, it was realized that the radioactive βdecay of "2"3"9Np should lead to the formation of element 94. The scale of the experiments at that time, however, precluded its identification. Plutonium was first produced late in 1940 by Seaborg, McMillan, Kennedy, and Wahl1,2 by bombarding uranium with deuterons to produce the isotope "2"3"8Pu
Toward an understanding of foreground emission in the BICEP2 region
International Nuclear Information System (INIS)
Flauger, Raphael; Hill, J. Colin; Spergel, David N.
2014-01-01
BICEP2 has reported the detection of a degree-scale B-mode polarization pattern in the Cosmic Microwave Background (CMB) and has interpreted the measurement as evidence for primordial gravitational waves. Motivated by the profound importance of the discovery of gravitational waves from the early Universe, we examine to what extent a combination of Galactic foregrounds and lensed E-modes could be responsible for the signal. We reanalyze the BICEP2 results and show that the 100 ×150 GHz and 150 ×150 GHz data are consistent with a cosmology with r=0.2 and negligible foregrounds, but also with a cosmology with r=0 and a significant dust polarization signal. We give independent estimates of the dust polarization signal in the BICEP2 region using a number of different approaches: (1) data-driven models based on Planck 353 GHz intensity, polarization fractions inferred from the same Planck data used by the BICEP2 team but corrected for CMB and CIB contributions, and polarization angles from starlight polarization data or the Planck sky model; (2) the same set of pre-Planck models used by the BICEP2 team but taking into account the higher polarization fractions observed in the CMB- and CIB-corrected map; (3) a measurement of neutral hydrogen gas column density N HI in the BICEP2 region combined with an extrapolation of a relation between HI column density and dust polarization derived by Planck; and (4) a dust polarization map based on digitized Planck data, which we only use as a final cross-check. While these approaches are consistent with each other, the expected amplitude of the dust polarization power spectrum remains uncertain by about a factor of three. The lower end of the prediction leaves room for a primordial contribution, but at the higher end the dust in combination with the standard CMB lensing signal could account for the BICEP2 observations, without requiring the existence of primordial gravitational waves. By measuring the cross-correlations between the
International Nuclear Information System (INIS)
Goldhaber, G.
1984-11-01
In my talk I will cover the period 1973 to 1976 which saw the discoveries of the J/psi and psi' resonances and most of the Psion spectroscopy, the tau lepton and the D 0 ,D + charmed meson doublet. Occasionally I will refer briefly to more recent results. Since this conference is on the history of the weak-interactions I will deal primarily with the properties of naked charm and in particular the weakly decaying doublet of charmed mesons. Most of the discoveries I will mention were made with the SLAC-LBL Magnetic Detector or MARK I which we operated at SPEAR from 1973 to 1976. 27 references
Directory of Open Access Journals (Sweden)
Cunyou Zhao
Full Text Available BACKGROUND: Non-coding single nucleotide polymorphisms (SNPs in GABRB2, the gene for beta(2-subunit of gamma-aminobutyric acid type A (GABA(A receptor, have been associated with schizophrenia (SCZ and quantitatively correlated to mRNA expression and alternative splicing. METHODS AND FINDINGS: Expression of the Exon 10 region of GABRB2 from minigene constructs revealed this region to be an "alternative splicing hotspot" that readily gave rise to differently spliced isoforms depending on intron sequences. This led to a search in human brain cDNA libraries, and the discovery of two novel isoforms, beta(2S1 and beta(2S2, bearing variations in the neighborhood of Exon-10. Quantitative real-time PCR analysis of postmortem brain samples showed increased beta(2S1 expression and decreased beta(2S2 expression in both SCZ and bipolar disorder (BPD compared to controls. Disease-control differences were significantly correlated with SNP rs187269 in BPD males for both beta(2S1 and beta(2S2 expressions, and significantly correlated with SNPs rs2546620 and rs187269 in SCZ males for beta(2S2 expression. Moreover, site-directed mutagenesis indicated that Thr(365, a potential phosphorylation site in Exon-10, played a key role in determining the time profile of the ATP-dependent electrophysiological current run-down. CONCLUSION: This study therefore provided experimental evidence for the importance of non-coding sequences in the Exon-10 region in GABRB2 with respect to beta(2-subunit splicing diversity and the etiologies of SCZ and BPD.
Gobec, Martina; Tomašič, Tihomir; Štimac, Adela; Frkanec, Ruža; Trontelj, Jurij; Anderluh, Marko; Mlinarič-Raščan, Irena; Jakopin, Žiga
2018-04-12
Muramyl dipeptide (MDP), a fragment of bacterial peptidoglycan, has long been known as the smallest fragment possessing adjuvant activity, on the basis of its agonistic action on the nucleotide-binding oligomerization domain-containing protein 2 (NOD2). There is a pressing need for novel adjuvants, and NOD2 agonists provide an untapped source of potential candidates. Here, we report the design, synthesis, and characterization of a series of novel acyl tripeptides. A pivotal structural element for molecular recognition by NOD2 has been identified, culminating in the discovery of compound 9, the most potent desmuramylpeptide NOD2 agonist to date. Compound 9 augmented pro-inflammatory cytokine release from human peripheral blood mononuclear cells in synergy with lipopolysaccharide. Furthermore, it was able to induce ovalbumin-specific IgG titers in a mouse model of adjuvancy. These findings provide deeper insights into the structural requirements of desmuramylpeptides for NOD2-activation and highlight the potential use of NOD2 agonists as adjuvants for vaccines.
Imbalanced target prediction with pattern discovery on clinical data repositories.
Chan, Tak-Ming; Li, Yuxi; Chiau, Choo-Chiap; Zhu, Jane; Jiang, Jie; Huo, Yong
2017-04-20
Clinical data repositories (CDR) have great potential to improve outcome prediction and risk modeling. However, most clinical studies require careful study design, dedicated data collection efforts, and sophisticated modeling techniques before a hypothesis can be tested. We aim to bridge this gap, so that clinical domain users can perform first-hand prediction on existing repository data without complicated handling, and obtain insightful patterns of imbalanced targets for a formal study before it is conducted. We specifically target for interpretability for domain users where the model can be conveniently explained and applied in clinical practice. We propose an interpretable pattern model which is noise (missing) tolerant for practice data. To address the challenge of imbalanced targets of interest in clinical research, e.g., deaths less than a few percent, the geometric mean of sensitivity and specificity (G-mean) optimization criterion is employed, with which a simple but effective heuristic algorithm is developed. We compared pattern discovery to clinically interpretable methods on two retrospective clinical datasets. They contain 14.9% deaths in 1 year in the thoracic dataset and 9.1% deaths in the cardiac dataset, respectively. In spite of the imbalance challenge shown on other methods, pattern discovery consistently shows competitive cross-validated prediction performance. Compared to logistic regression, Naïve Bayes, and decision tree, pattern discovery achieves statistically significant (p-values repositories with imbalance and noise. The prediction results and interpretable patterns can provide insights in an agile and inexpensive way for the potential formal studies.
DISCOVERY OF RR LYRAE STARS IN THE NUCLEAR BULGE OF THE MILKY WAY
Energy Technology Data Exchange (ETDEWEB)
Minniti, Dante; Ramos, Rodrigo Contreras; Zoccali, Manuela; Gran, Felipe [Instituto Milenio de Astrofisica, Santiago (Chile); Rejkuba, Marina; Valenti, Elena [European Southern Observatory, Karl-Schwarszchild-Str. 2, D-85748 Garching bei Muenchen (Germany); Gonzalez, Oscar A., E-mail: dante@astrofisica.cl, E-mail: rcontrer@astro.puc.cl [UK Astronomy Technology Centre, Royal Observatory, Blackford Hill, Edinburgh, EH9 3HJ (United Kingdom)
2016-10-10
Galactic nuclei, such as that of the Milky Way, are extreme regions with high stellar densities, and in most cases, the hosts of a supermassive black hole. One of the scenarios proposed for the formation of the Galactic nucleus is merging of primordial globular clusters. An implication of this model is that this region should host stars that are characteristically found in old Milky Way globular clusters. RR Lyrae stars are primary distance indicators, well known representatives of old and metal-poor stellar populations, and therefore are regularly found in globular clusters. Here we report the discovery of a dozen RR Lyrae type ab stars in the vicinity of the Galactic center, i.e., in the so-called nuclear stellar bulge of the Milky Way. This discovery provides the first direct observational evidence that the Galactic nuclear stellar bulge contains ancient stars (>10 Gyr old). Based on this we conclude that merging globular clusters likely contributed to the build-up of the high stellar density in the nuclear stellar bulge of the Milky Way.
50 CFR 2.2 - Locations of regional offices.
2010-10-01
... Federal Complex, 911 N.E. 11th Avenue, Portland, Oregon 97232. (b) Albuquerque Regional Office (Region 2... Carolina, South Carolina and Tennessee; the Commonwealth of Puerto Rico; and the Virgin Islands and...
Predictors of timing of pregnancy discovery.
McCarthy, Molly; Upadhyay, Ushma; Biggs, M Antonia; Anthony, Renaisa; Holl, Jennifer; Roberts, Sarah Cm
2018-04-01
Earlier pregnancy discovery is important in the context of prenatal and abortion care. We evaluated characteristics associated with later pregnancy discovery among women seeking abortion care. Data come from a survey of women seeking abortion care at four family planning facilities in Utah. The participants completed a survey during the state-mandated abortion information visit they are required to complete prior to having an abortion. The outcome in this study was pregnancy discovery before versus after 6 weeks since respondents' last menstrual period (LMP). We used logistic regression to estimate the relationship between sociodemographic and health-related independent variables of interest and pregnancy discovery before versus after 6 weeks. Among the 458 women in the sample, 28% discovered their pregnancy later than 6 weeks since LMP. Most (n=366, 80%) knew the exact date of their LMP and a significant minority estimated it (n=92, 20%). Those who estimated the date of their LMP had higher odds of later pregnancy discovery than those who knew the exact date (adjusted odds ratio (aOR)=1.81[1.07-3.07]). Those who used illicit drugs weekly, daily, or almost daily had higher odds of later pregnancy discovery (aOR=6.33[2.44, 16.40]). Women who did not track their menstrual periods and those who frequently used drugs had higher odds of discovering their pregnancies later. Women who estimated the date of their LMP and who frequently used drugs may benefit from strategies to help them recognize their pregnancies earlier and link them to care when they discover their pregnancies later. Copyright © 2017 Elsevier Inc. All rights reserved.
The Discovery and Mass Measurement of a New Ultra-short-period Planet: K2-131b
Dai, Fei; Winn, Joshua N.; Gandolfi, Davide; Wang, Sharon X.; Teske, Johanna K.; Burt, Jennifer; Albrecht, Simon; Barragán, Oscar; Cochran, William D.; Endl, Michael; Fridlund, Malcolm; Hatzes, Artie P.; Hirano, Teruyuki; Hirsch, Lea A.; Johnson, Marshall C.; Justesen, Anders Bo; Livingston, John; Persson, Carina M.; Prieto-Arranz, Jorge; Vanderburg, Andrew; Alonso, Roi; Antoniciello, Giuliano; Arriagada, Pamela; Butler, R. P.; Cabrera, Juan; Crane, Jeffrey D.; Cusano, Felice; Csizmadia, Szilárd; Deeg, Hans; Dieterich, Sergio B.; Eigmüller, Philipp; Erikson, Anders; Everett, Mark E.; Fukui, Akihiko; Grziwa, Sascha; Guenther, Eike W.; Henry, Gregory W.; Howell, Steve B.; Johnson, John Asher; Korth, Judith; Kuzuhara, Masayuki; Narita, Norio; Nespral, David; Nowak, Grzegorz; Palle, Enric; Pätzold, Martin; Rauer, Heike; Montañés Rodríguez, Pilar; Shectman, Stephen A.; Smith, Alexis M. S.; Thompson, Ian B.; Van Eylen, Vincent; Williamson, Michael W.; Wittenmyer, Robert A.
2017-12-01
We report the discovery of a new ultra-short-period planet and summarize the properties of all such planets for which the mass and radius have been measured. The new planet, K2-131b, was discovered in K2 Campaign 10. It has a radius of {1.81}-0.12+0.16 {R}\\oplus and orbits a G dwarf with a period of 8.9 hr. Radial velocities obtained with Magellan/PFS and TNG/HARPS-N show evidence for stellar activity along with orbital motion. We determined the planetary mass using two different methods: (1) the “floating chunk offset” method, based only on changes in velocity observed on the same night; and (2) a Gaussian process regression based on both the radial velocity and photometric time series. The results are consistent and lead to a mass measurement of 6.5+/- 1.6 {M}\\oplus and a mean density of {6.0}-2.7+3.0 g cm-3.
Discovery of Intrinsic Primitives on Triangle Meshes
Solomon, Justin
2011-04-01
The discovery of meaningful parts of a shape is required for many geometry processing applications, such as parameterization, shape correspondence, and animation. It is natural to consider primitives such as spheres, cylinders and cones as the building blocks of shapes, and thus to discover parts by fitting such primitives to a given surface. This approach, however, will break down if primitive parts have undergone almost-isometric deformations, as is the case, for example, for articulated human models. We suggest that parts can be discovered instead by finding intrinsic primitives, which we define as parts that posses an approximate intrinsic symmetry. We employ the recently-developed method of computing discrete approximate Killing vector fields (AKVFs) to discover intrinsic primitives by investigating the relationship between the AKVFs of a composite object and the AKVFs of its parts. We show how to leverage this relationship with a standard clustering method to extract k intrinsic primitives and remaining asymmetric parts of a shape for a given k. We demonstrate the value of this approach for identifying the prominent symmetry generators of the parts of a given shape. Additionally, we show how our method can be modified slightly to segment an entire surface without marking asymmetric connecting regions and compare this approach to state-of-the-art methods using the Princeton Segmentation Benchmark. © 2011 The Author(s).
Arrayed antibody library technology for therapeutic biologic discovery.
Bentley, Cornelia A; Bazirgan, Omar A; Graziano, James J; Holmes, Evan M; Smider, Vaughn V
2013-03-15
Traditional immunization and display antibody discovery methods rely on competitive selection amongst a pool of antibodies to identify a lead. While this approach has led to many successful therapeutic antibodies, targets have been limited to proteins which are easily purified. In addition, selection driven discovery has produced a narrow range of antibody functionalities focused on high affinity antagonism. We review the current progress in developing arrayed protein libraries for screening-based, rather than selection-based, discovery. These single molecule per microtiter well libraries have been screened in multiplex formats against both purified antigens and directly against targets expressed on the cell surface. This facilitates the discovery of antibodies against therapeutically interesting targets (GPCRs, ion channels, and other multispanning membrane proteins) and epitopes that have been considered poorly accessible to conventional discovery methods. Copyright © 2013. Published by Elsevier Inc.
Automated discovery systems and the inductivist controversy
Giza, Piotr
2017-09-01
The paper explores possible influences that some developments in the field of branches of AI, called automated discovery and machine learning systems, might have upon some aspects of the old debate between Francis Bacon's inductivism and Karl Popper's falsificationism. Donald Gillies facetiously calls this controversy 'the duel of two English knights', and claims, after some analysis of historical cases of discovery, that Baconian induction had been used in science very rarely, or not at all, although he argues that the situation has changed with the advent of machine learning systems. (Some clarification of terms machine learning and automated discovery is required here. The key idea of machine learning is that, given data with associated outcomes, software can be trained to make those associations in future cases which typically amounts to inducing some rules from individual cases classified by the experts. Automated discovery (also called machine discovery) deals with uncovering new knowledge that is valuable for human beings, and its key idea is that discovery is like other intellectual tasks and that the general idea of heuristic search in problem spaces applies also to discovery tasks. However, since machine learning systems discover (very low-level) regularities in data, throughout this paper I use the generic term automated discovery for both kinds of systems. I will elaborate on this later on). Gillies's line of argument can be generalised: thanks to automated discovery systems, philosophers of science have at their disposal a new tool for empirically testing their philosophical hypotheses. Accordingly, in the paper, I will address the question, which of the two philosophical conceptions of scientific method is better vindicated in view of the successes and failures of systems developed within three major research programmes in the field: machine learning systems in the Turing tradition, normative theory of scientific discovery formulated by Herbert Simon
Research on Hotspot Discovery in Internet Public Opinions Based on Improved -Means
Directory of Open Access Journals (Sweden)
Gensheng Wang
2013-01-01
Full Text Available How to discover hotspot in the Internet public opinions effectively is a hot research field for the researchers related which plays a key role for governments and corporations to find useful information from mass data in the Internet. An improved -means algorithm for hotspot discovery in internet public opinions is presented based on the analysis of existing defects and calculation principle of original -means algorithm. First, some new methods are designed to preprocess website texts, select and express the characteristics of website texts, and define the similarity between two website texts, respectively. Second, clustering principle and the method of initial classification centers selection are analyzed and improved in order to overcome the limitations of original -means algorithm. Finally, the experimental results verify that the improved algorithm can improve the clustering stability and classification accuracy of hotspot discovery in internet public opinions when used in practice.
DEFF Research Database (Denmark)
Christiansen, Elisabeth; Hansen, Steffen V F; Urban, Christian
2013-01-01
Free fatty acid receptor 1 (FFA1 or GPR40) enhances glucose-stimulated insulin secretion from pancreatic β-cells and currently attracts high interest as a new target for the treatment of type 2 diabetes. We here report the discovery of a highly potent FFA1 agonist with favorable physicochemical...
Mamykina, Lena; Heitkemper, Elizabeth M; Smaldone, Arlene M; Kukafka, Rita; Cole-Lewis, Heather J; Davidson, Patricia G; Mynatt, Elizabeth D; Cassells, Andrea; Tobin, Jonathan N; Hripcsak, George
2017-12-01
To outline new design directions for informatics solutions that facilitate personal discovery with self-monitoring data. We investigate this question in the context of chronic disease self-management with the focus on type 2 diabetes. We conducted an observational qualitative study of discovery with personal data among adults attending a diabetes self-management education (DSME) program that utilized a discovery-based curriculum. The study included observations of class sessions, and interviews and focus groups with the educator and attendees of the program (n = 14). The main discovery in diabetes self-management evolved around discovering patterns of association between characteristics of individuals' activities and changes in their blood glucose levels that the participants referred to as "cause and effect". This discovery empowered individuals to actively engage in self-management and provided a desired flexibility in selection of personalized self-management strategies. We show that discovery of cause and effect involves four essential phases: (1) feature selection, (2) hypothesis generation, (3) feature evaluation, and (4) goal specification. Further, we identify opportunities to support discovery at each stage with informatics and data visualization solutions by providing assistance with: (1) active manipulation of collected data (e.g., grouping, filtering and side-by-side inspection), (2) hypotheses formulation (e.g., using natural language statements or constructing visual queries), (3) inference evaluation (e.g., through aggregation and visual comparison, and statistical analysis of associations), and (4) translation of discoveries into actionable goals (e.g., tailored selection from computable knowledge sources of effective diabetes self-management behaviors). The study suggests that discovery of cause and effect in diabetes can be a powerful approach to helping individuals to improve their self-management strategies, and that self-monitoring data can
A Tale of Two Discoveries: Comparing the Usability of Summon and EBSCO Discovery Service
Foster, Anita K.; MacDonald, Jean B.
2013-01-01
Web-scale discovery systems are gaining momentum among academic libraries as libraries seek a means to provide their users with a one-stop searching experience. Illinois State University's Milner Library found itself in the unique position of having access to two distinct discovery products, EBSCO Discovery Service and Serials Solutions' Summon.…
International Nuclear Information System (INIS)
Hauler, Carolin; Martin, René; Knölker, Hans-Joachim; Gaus, Caroline; Mueller, Jochen F.; Vetter, Walter
2013-01-01
Polyhalogenated 1,1′-dimethyl-2,2′-bipyrroles (PDBPs) are halogenated natural products (HNPs) previously shown to bioaccumulate in marine mammals and birds. Since their discovery in 1999, six hexahalogenated and a few lesser halogenated congeners have been identified in diverse marine mammal samples. Here we report the identification of 17 additional hexahalogenated PDBPs in the blubber extract of a humpback dolphin (Sousa chinensis) from Queensland, Australia. Thirteen of these new PDBPs were also detected in an Australian sea cucumber (Holothuria sp.). Additional samples were also tested positive on several new PDBPs, including an Australian venus tuskfish (Choerodon venustus) as well as a white whale (Delphinapterus leucas) and a sperm whale (Physeter macrocephalus) from the Northern Hemisphere. GC/ECNI-MS-SIM quantification of the molecular ions was carried out with the help of synthesized standards. The sum concentration of PDBPs was 1.1 mg/kg lipid in the humpback dolphin and 0.48 mg/kg lipid in the sea cucumber. -- Highlights: •Polyhalogenated 1,1′-dimethyl-2,2′-bipyrroles (PDBPs) are natural products. •17 New hexahalogenated PDBPs were identified in marine biota from Australia. •A humpback dolphin (Sousa chinensis) contained 1.1 mg/kg lipid PDBPs. •New PDBPs were also detected in marine mammals from the Northern Hemisphere. -- Detection of new polyhalogenated 1,1′-dimethyl-2,2′-bipyrroles indicates a higher toxic risk of these halogenated natural products in the marine environment than previously known
Natural Products for Drug Discovery in the 21st Century: Innovations for Novel Drug Discovery
Directory of Open Access Journals (Sweden)
Nicholas Ekow Thomford
2018-05-01
Full Text Available The therapeutic properties of plants have been recognised since time immemorial. Many pathological conditions have been treated using plant-derived medicines. These medicines are used as concoctions or concentrated plant extracts without isolation of active compounds. Modern medicine however, requires the isolation and purification of one or two active compounds. There are however a lot of global health challenges with diseases such as cancer, degenerative diseases, HIV/AIDS and diabetes, of which modern medicine is struggling to provide cures. Many times the isolation of “active compound” has made the compound ineffective. Drug discovery is a multidimensional problem requiring several parameters of both natural and synthetic compounds such as safety, pharmacokinetics and efficacy to be evaluated during drug candidate selection. The advent of latest technologies that enhance drug design hypotheses such as Artificial Intelligence, the use of ‘organ-on chip’ and microfluidics technologies, means that automation has become part of drug discovery. This has resulted in increased speed in drug discovery and evaluation of the safety, pharmacokinetics and efficacy of candidate compounds whilst allowing novel ways of drug design and synthesis based on natural compounds. Recent advances in analytical and computational techniques have opened new avenues to process complex natural products and to use their structures to derive new and innovative drugs. Indeed, we are in the era of computational molecular design, as applied to natural products. Predictive computational softwares have contributed to the discovery of molecular targets of natural products and their derivatives. In future the use of quantum computing, computational softwares and databases in modelling molecular interactions and predicting features and parameters needed for drug development, such as pharmacokinetic and pharmacodynamics, will result in few false positive leads in drug
Natural Products for Drug Discovery in the 21st Century: Innovations for Novel Drug Discovery.
Thomford, Nicholas Ekow; Senthebane, Dimakatso Alice; Rowe, Arielle; Munro, Daniella; Seele, Palesa; Maroyi, Alfred; Dzobo, Kevin
2018-05-25
The therapeutic properties of plants have been recognised since time immemorial. Many pathological conditions have been treated using plant-derived medicines. These medicines are used as concoctions or concentrated plant extracts without isolation of active compounds. Modern medicine however, requires the isolation and purification of one or two active compounds. There are however a lot of global health challenges with diseases such as cancer, degenerative diseases, HIV/AIDS and diabetes, of which modern medicine is struggling to provide cures. Many times the isolation of "active compound" has made the compound ineffective. Drug discovery is a multidimensional problem requiring several parameters of both natural and synthetic compounds such as safety, pharmacokinetics and efficacy to be evaluated during drug candidate selection. The advent of latest technologies that enhance drug design hypotheses such as Artificial Intelligence, the use of 'organ-on chip' and microfluidics technologies, means that automation has become part of drug discovery. This has resulted in increased speed in drug discovery and evaluation of the safety, pharmacokinetics and efficacy of candidate compounds whilst allowing novel ways of drug design and synthesis based on natural compounds. Recent advances in analytical and computational techniques have opened new avenues to process complex natural products and to use their structures to derive new and innovative drugs. Indeed, we are in the era of computational molecular design, as applied to natural products. Predictive computational softwares have contributed to the discovery of molecular targets of natural products and their derivatives. In future the use of quantum computing, computational softwares and databases in modelling molecular interactions and predicting features and parameters needed for drug development, such as pharmacokinetic and pharmacodynamics, will result in few false positive leads in drug development. This review
Bibliography on Cold Regions Science and Technology. Volume 35, Part 2
1981-12-01
miMures [1480. p.»7-91, rus) 35-1088 Arbazov, \\.A. I sing liquid chlorides in wmtet on slippery loads (1480. p 1 I. 21, ■ us...3,-2*J I sing liquid chlondes in winter on slippery roads [ 1480. p, 11. Ryan, U L Safonova, T.A. ii...volumes, ins, 35-858 Problems of the Vulb. a cmieiit bibllographs , IISII. I»«p.rtls) 35-859 Open pit nulling in aistie regions Elm . S.S
Evaluating the inverse reasoning account of object discovery.
Carroll, Christopher D; Kemp, Charles
2015-06-01
People routinely make inferences about unobserved objects. A hotel guest with welts on his arms, for example, will often worry about bed bugs. The discovery of unobserved objects almost always involves a backward inference from some observed effects (e.g., welts) to unobserved causes (e.g., bed bugs). The inverse reasoning account, which is typically formalized as Bayesian inference, posits that the strength of a backward inference is closely connected to the strength of the corresponding forward inference from the unobserved causes to the observed effects. We evaluated the inverse reasoning account of object discovery in three experiments where participants were asked to discover the unobserved "attractors" and "repellers" that controlled a "particle" moving within an arena. Experiments 1 and 2 showed that participants often failed to provide the best explanations for various particle motions, even when the best explanations were simple and when participants enthusiastically endorsed these explanations when presented with them. This failure demonstrates that object discovery is critically dependent on the processes that support hypothesis generation-processes that the inverse reasoning account does not explain. Experiment 3 demonstrated that people sometimes generate explanations that are invalid even according to their own forward inferences, suggesting that the psychological processes that support forward and backward inference are less intertwined than the inverse reasoning account suggests. The experimental findings support an alternative account of object discovery in which people rely on heuristics to generate possible explanations. Copyright © 2015 Elsevier B.V. All rights reserved.
STS-91 Launch of Discovery from Launch Pad 39-A
1998-01-01
Searing the early evening sky with its near sun-like rocket exhaust, the Space Shuttle Discovery lifts off from Launch Pad 39A at 6:06:24 p.m. EDT June 2 on its way to the Mir space station. On board Discovery are Mission Commander Charles J. Precourt; Pilot Dominic L. Gorie; and Mission Specialists Wendy B. Lawrence, Franklin R. Chang-Diaz, Janet Lynn Kavandi and Valery Victorovitch Ryumin. The nearly 10-day mission will feature the ninth and final Shuttle docking with the Russian space station Mir, the first Mir docking for the Space Shuttle orbiter Discovery, the first on-orbit test of the Alpha Magnetic Spectrometer (AMS), and the first flight of the new Space Shuttle super lightweight external tank. Astronaut Andrew S. W. Thomas will be returning to Earth as a STS-91 crew member after living more than four months aboard Mir.
2010-07-01
... 29 Labor 9 2010-07-01 2010-07-01 false Discovery. 2200.208 Section 2200.208 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH REVIEW COMMISSION RULES OF PROCEDURE Simplified Proceedings § 2200.208 Discovery. Discovery, including requests for admissions, will only be...
2010-10-01
... 47 Telecommunication 3 2010-10-01 2010-10-01 false Discovery. 65.105 Section 65.105... OF RETURN PRESCRIPTION PROCEDURES AND METHODOLOGIES Procedures § 65.105 Discovery. (a) Participants... evidence. (c) Discovery requests pursuant to § 65.105(b), including written interrogatories, shall be filed...
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Discovery. 209.313 Section 209.313 Transportation... TRANSPORTATION RAILROAD SAFETY ENFORCEMENT PROCEDURES Disqualification Procedures § 209.313 Discovery. (a... parties. Discovery is designed to enable a party to obtain relevant information needed for preparation of...
Modeling and validation of on-road CO2 emissions inventories at the urban regional scale
International Nuclear Information System (INIS)
Brondfield, Max N.; Hutyra, Lucy R.; Gately, Conor K.; Raciti, Steve M.; Peterson, Scott A.
2012-01-01
On-road emissions are a major contributor to rising concentrations of atmospheric greenhouse gases. In this study, we applied a downscaling methodology based on commonly available spatial parameters to model on-road CO 2 emissions at the 1 × 1 km scale for the Boston, MA region and tested our approach with surface-level CO 2 observations. Using two previously constructed emissions inventories with differing spatial patterns and underlying data sources, we developed regression models based on impervious surface area and volume-weighted road density that could be scaled to any resolution. We found that the models accurately reflected the inventories at their original scales (R 2 = 0.63 for both models) and exhibited a strong relationship with observed CO 2 mixing ratios when downscaled across the region. Moreover, the improved spatial agreement of the models over the original inventories confirmed that either product represents a viable basis for downscaling in other metropolitan regions, even with limited data. - Highlights: ► We model two on-road CO 2 emissions inventories using common spatial parameters. ► Independent CO 2 observations are used to validate the emissions models. ► The downscaled emissions models capture the urban spatial heterogeneity of Boston. ► Emissions estimates show a strong non-linear relationship with observed CO 2 . ► Our study is repeatable, even in areas with limited data. - This work presents a new, reproducible methodology for downscaling and validating on-road CO 2 emissions estimates.
Current Landscape of Antiviral Drug Discovery [version 1; referees: 2 approved
Directory of Open Access Journals (Sweden)
Wade Blair
2016-02-01
Full Text Available Continued discovery and development of new antiviral medications are paramount for global human health, particularly as new pathogens emerge and old ones evolve to evade current therapeutic agents. Great success has been achieved in developing effective therapies to suppress human immunodeficiency virus (HIV and hepatitis B virus (HBV; however, the therapies are not curative and therefore current efforts in HIV and HBV drug discovery are directed toward longer-acting therapies and/or developing new mechanisms of action that could potentially lead to cure, or eradication, of the virus. Recently, exciting early clinical data have been reported for novel antivirals targeting respiratory syncytial virus (RSV and influenza (flu. Preclinical data suggest that these new approaches may be effective in treating high-risk patients afflicted with serious RSV or flu infections. In this review, we highlight new directions in antiviral approaches for HIV, HBV, and acute respiratory virus infections.
DISCOVERY OF A GALAXY CLUSTER WITH A VIOLENTLY STARBURSTING CORE AT z = 2.506
Energy Technology Data Exchange (ETDEWEB)
Wang, Tao; Elbaz, David; Daddi, Emanuele; Valentino, Francesco; Burg, Remco van der; Zanella, Anita; Ciesla, Laure; Brun, Amandine Le [Laboratoire AIM-Paris-Saclay, CEA/DSM/Irfu, CNRS, Université Paris Diderot, Saclay, pt courrier 131, F-91191 Gif-sur-Yvette (France); Finoguenov, Alexis [Department of Physics, University of Helsinki, Gustaf Hällströmin katu 2a, FI-0014 Helsinki (Finland); Liu, Daizhong; Tan, Qinghua [Purple Mountain Observatory, Chinese Academy of Sciences, 2 West Beijing Road, Nanjing 210008 (China); Schreiber, Corentin [Leiden Observatory, Leiden University, NL-2300 RA Leiden (Netherlands); Martín, Sergio [European Southern Observatory, Alonso de Córdova 3107, Vitacura, Santiago (Chile); Strazzullo, Veronica; Pannella, Maurilio [Department of Physics, Ludwig-Maximilians-Universität, Scheinerstr. 1, D-81679 München (Germany); Gobat, Raphael [School of Physics, Korea Institute for Advanced Study, Hoegiro 85, Dongdaemun-gu, Seoul 130-722 (Korea, Republic of); Sargent, Mark [Department of Physics and Astronomy, University of Sussex, Brighton BN1 9QH (United Kingdom); Shu, Xinwen [Department of Physics, Anhui Normal University, Wuhu, Anhui, 241000 (China); Cappelluti, Nico [Department of Astronomy, Yale University, New Haven, CT 06511 (United States); Li, Yanxia, E-mail: tao.wang@cea.fr [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States)
2016-09-01
We report the discovery of a remarkable concentration of massive galaxies with extended X-ray emission at z {sub spec} = 2.506, which contains 11 massive (M {sub *} ≳ 10{sup 11} M {sub ⊙}) galaxies in the central 80 kpc region (11.6 σ overdensity). We have spectroscopically confirmed 17 member galaxies with 11 from CO and the remaining ones from H α . The X-ray luminosity, stellar mass content, and velocity dispersion all point to a collapsed, cluster-sized dark matter halo with mass M {sub 200} {sub c} = 10{sup 13.9±0.2} M {sub ⊙}, making it the most distant X-ray-detected cluster known to date. Unlike other clusters discovered so far, this structure is dominated by star-forming galaxies (SFGs) in the core with only 2 out of the 11 massive galaxies classified as quiescent. The star formation rate (SFR) in the 80 kpc core reaches ∼3400 M {sub ⊙} yr{sup −1} with a gas depletion time of ∼200 Myr, suggesting that we caught this cluster in rapid build-up of a dense core. The high SFR is driven by both a high abundance of SFGs and a higher starburst fraction (∼25%, compared to 3%–5% in the field). The presence of both a collapsed, cluster-sized halo and a predominant population of massive SFGs suggests that this structure could represent an important transition phase between protoclusters and mature clusters. It provides evidence that the main phase of massive galaxy passivization will take place after galaxies accrete onto the cluster, providing new insights into massive cluster formation at early epochs. The large integrated stellar mass at such high redshift challenges our understanding of massive cluster formation.
2010-01-01
... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Discovery. 280.210 Section 280.210... STANDARDS AND TECHNOLOGY, DEPARTMENT OF COMMERCE ACCREDITATION AND ASSESSMENT PROGRAMS FASTENER QUALITY Enforcement § 280.210 Discovery. (a) General. The parties are encouraged to engage in voluntary discovery...
Very Large Array H I Zeeman Observations of the Cygnus X Region: DR 22 and ON 2
Mayo, E. A.; Troland, T. H.
2012-02-01
We have used the Very Large Array to study the Zeeman effect in 21 cm H I absorption lines from two star-forming regions in the Cygnus X complex, DR 22 and ON 2. We measure the line-of-sight magnetic field toward these regions, finding B los = -84 ± 11 μG toward the DR 22 H II region and B los < 50 μG toward each of the two H II regions in ON 2. We interpret these results in terms of two different models. In one model, we assume that the H I Zeeman effect is a measure of magnetic fields in the associated molecular clouds. If so, then the DR 22 molecular cloud is magnetically subcritical, that is, magnetically dominated. The ON 2 molecular clouds are magnetically supercritical. In a second model, we assume that the H I Zeeman effect is a measure of magnetic fields in photon-dominated regions where the gas has been compressed (and the field amplified) by absorption of stellar radiation. We find that this second model, where the measured field strength has been affected by star formation, accounts well for the DR 22 H I Zeeman effect. This same model, however, overpredicts the magnetic field in ON 2. ON 2 may be a region where the magnetic field is energetically insignificant or where the field happens to lie nearly in the plane of the sky.
X-Ray Astronomy Discovery Experiments, III*
Fisher, P. C.
2011-04-01
The first paper established the existence of concurrent discovery experiments by Riccardo Giacconi and myself at the start of x-ray astronomy.footnotetextR. Giacconi et al., Phys. Rev. Lett. 9, 439 (1962).^,footnotetextP. C. Fisher et al., Quasars and High Energy Astronomy including Proceedings of the 2^nd Texas Symposium on Relativistic Astrophysics 15 - 19 December 1964 (K. N. Douglas et. al., eds.) Gordon and Breach Science Publishers, New York, p. 253 (1969).^,footnotetextP. C. Fisher, BAPS 53 No. 2, 165 (2008). Paper II footnotetextP.C. Fisher, http://www.aps.org/units/fhp/index.cfm plus FHP link to April 2009 presentation H14.00006. described some acts by some individuals/institutions over four decades that may have caused the illusion that I had not made a discovery. Some additional data about this illusion, and the first possible measurement of x-ray emission from a black hole, will be presented. This paper's primary goal is for the American Physical Society to have Giacconi comment on several questions of a historical nature. [4pt] *Work supported by NASA contracts NAS5-1174 and NASw-909, the Lockheed Independent Research Program, and Ruffner Associates.
Price discovery in European natural gas markets
International Nuclear Information System (INIS)
Schultz, Emma; Swieringa, John
2013-01-01
We provide the first high-frequency investigation of price discovery within the physical and financial layers of Europe's natural gas markets. Testing not only looks at short-term return dynamics, but also considers each security's contribution to price equilibrium in the longer-term. Results show that UK natural gas futures traded on the Intercontinental Exchange display greater price discovery than physical trading at various hubs throughout Europe. - Highlights: • We use intraday data to gauge price discovery in European natural gas markets. • We explore short and long-term dynamics in physical and financial market layers. • Results show ICE's UK natural gas futures are the main venue for price discovery
Mycological discoveries in the Middle East region in the second part of the last century
Directory of Open Access Journals (Sweden)
Mouchacca J
2016-12-01
Full Text Available The arid Middle East extends over 9 million km² in the Eastern part of the Mediterranean Sea. Interest in the fungi of this region after the Second World War led to the discovery of species then regarded as being new to Science. A scan of the Index of Fungi issued in the period running from 1940-2000 revealed that 240 novel taxa had then been proposed. The recorded novelties were examined following the chronology of their introduction, their distribution in the local fifteen political states and their gross taxonomic characters at the Class level. These new additions were characterised at the rate of 40 units / decade. Most originated from Egypt, Iraq and the Palestine-Israel area and relate to the Classes Mitosporic Fungi, Ascomycetes and Basidiomycetes. All together 145 generic names are reported in this group of novelties; twelve were based on type material collected in Egypt (5 genera, the Palestine-Israel area, Iraq, Kuwait, Lebanon and Sudan. The present group of novelties was also surveyed in relation to the nature of the substrate sustaining the selected holotypes. The relevant Mitosporic fungi (93 taxa were equally isolated from soil or from living or decaying plant parts. For Ascomycetous novelties (86 taxa, although their soil-borne elements outnumber the plant related ones, several also developed on other types of substrates. In the case of novel Basidiomycetes (37 taxa, the plant-parasitic species encompass those collected on the ground surface. Finally, a limited number of these novelties disclosed notable thermotolerant abilities and some even qualify as thermophiles. The main features of these novel records underlines that in Egypt more attention was awarded to the local Mitosporic fungi and to Ascomycetes inhabiting its soil-borne communities. For the Basidiomycetes (sensu lato marked interest developed solely in the Palestine-Israel area while in Iraq taxonomic studies focussed on Ascomycetes including those developing on dung
2010-01-01
... 10 Energy 4 2010-01-01 2010-01-01 false Discovery. 1013.21 Section 1013.21 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) PROGRAM FRAUD CIVIL REMEDIES AND PROCEDURES § 1013.21 Discovery. (a) The following types of discovery are authorized: (1) Requests for production of documents for inspection and...
2010-10-01
... 46 Shipping 9 2010-10-01 2010-10-01 false Discovery. 550.502 Section 550.502 Shipping FEDERAL... Proceedings § 550.502 Discovery. The Commission may authorize a party to a proceeding to use depositions, written interrogatories, and discovery procedures that, to the extent practicable, are in conformity with...
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Discovery. 35.21 Section 35.21 Foreign Relations DEPARTMENT OF STATE CLAIMS AND STOLEN PROPERTY PROGRAM FRAUD CIVIL REMEDIES § 35.21 Discovery. (a) The following types of discovery are authorized: (1) Requests for production of documents for...
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Discovery. 96.65 Section 96.65 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION BLOCK GRANTS Hearing Procedure § 96.65 Discovery. The use of interrogatories, depositions, and other forms of discovery shall not be allowed. ...
2010-10-01
... 49 Transportation 1 2010-10-01 2010-10-01 false Discovery. 31.21 Section 31.21 Transportation Office of the Secretary of Transportation PROGRAM FRAUD CIVIL REMEDIES § 31.21 Discovery. (a) The following types of discovery are authorized: (1) Requests for production of documents for inspection and...
43 CFR 4.1130 - Discovery methods.
2010-10-01
... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Discovery methods. 4.1130 Section 4.1130... Special Rules Applicable to Surface Coal Mining Hearings and Appeals Discovery § 4.1130 Discovery methods. Parties may obtain discovery by one or more of the following methods— (a) Depositions upon oral...
A Complete Census of the ~7000 Milky Way HII Regions
Armentrout, William Paul; Anderson, Loren Dean; Wenger, Trey; Bania, Thomas; Balser, Dana; Dame, Thomas; Dickey, John M.; Dawson, Joanne; Jordan, Christopher H.; McClure-Griffiths, Naomi M.; Andersen, Morten
2018-01-01
HII regions are the archetypical tracers of high-mass star formation. Because of their high luminosities, they can be seen across the entire Galactic disk from mid-infrared to radio wavelengths. A uniformly sensitive survey of Galactic HII regions would allow us to constrain the properties of Galactic structure and star formation. We have cataloged over 8000 HII regions and candidates in the WISE Catalog of Galactic HII Regions (astro.phys.wvu.edu/wise), but only 2000 of these are confirmed HII regions to date.To bring us closer to a complete census of high-mass star formation regions in the Milky Way, we have several ongoing observational campaigns. These efforts include (1) Green Bank Telescope radio recombination line (RRL) observations as part of the HII Region Discovery Survey (HRDS); (2) Australia Telescope Compact Array observations of southern HII region candidates in the Southern HII Region Discovery Survey (SHRDS); (3) Green Bank and Gemini North Telescope observations of star formation regions thought to reside at the edge of the star forming disk in the Outer Scutum-Centaurus Arm (OSC); and (4) Very Large Array continuum observations of the faintest HII region candidates in the second and third Galactic quadrants.Together, these observations will detect the RRL emission from all Galactic HII regions with peak cm-wavelength flux densities > 60mJy, establish the outer edge of Galactic high-mass star formation, and determine the number of HII regions in the Galaxy. The HRDS and SHRDS surveys have more than doubled the known population of Galactic HII regions. We use the OSC observations to determine the properties of high-mass star formation in the extreme outer Galaxy and our VLA observations to determine how many of our faint candidates are indeed HII regions. We combine the completeness limits we obtain through these HII region surveys with an HII region population synthesis model to estimate the total number of Galactic HII regions. From this, we
120 YEARS SINCE THE DISCOVERY OF X-RAYS.
Babic, Rade R; Stankovic Babic, Gordana; Babic, Strahinja R; Babic, Nevena R
2016-09-01
This paper is intended to celebrate the 120th anniversary of the discovery of X-rays. X-rays (Roentgen-rays) were discovered on the 8th ofNovember, 1895 by the German physicist Wilhelm Conrad Roentgen. Fifty days after the discovery of X-ray, on December 28, 1895. Wilhelm Conrad Roentgen published a paper about the discovery of X-rays - "On a new kind of rays" (Wilhelm Conrad Roentgen: Ober eine neue Art von Strahlen. In: Sitzungsberichte der Wurzburger Physik.-Medic.- Gesellschaft. 1895.). Therefore, the date of 28th ofDecember, 1895 was taken as the date of X-rays discovery. This paper describes the work of Wilhelm Conrad Roentgen, Nikola Tesla, Mihajlo Pupin and Maria Sklodowska-Curie about the nature of X-rays . The fantastic four - Wilhelm Conrad Roentgen, NikolaTesla, Mihajlo ldvorski Pupin and Maria Sklodowska-Curie set the foundation of radiology with their discovery and study of X-rays. Five years after the discovery of X-rays, in 1900, Dr Avram Vinaver had the first X-ray machine installed in abac, in Serbia at the time when many developed countries did not have an X-ray machine and thus set the foundation of radiology in Serbia.
Fatokun, K. V. F.; Eniayeju, P. A.
2014-01-01
This study investigates the effects of Concept Mapping-Guided Discovery Integrated Teaching Approach on the achievement and retention of chemistry students. The sample comprised 162 Senior Secondary two (SS 2) students drawn from two Science Schools in Nasarawa State, Central Nigeria with equivalent mean scores of 9.68 and 9.49 in their pre-test.…
Maximum Entropy in Drug Discovery
Directory of Open Access Journals (Sweden)
Chih-Yuan Tseng
2014-07-01
Full Text Available Drug discovery applies multidisciplinary approaches either experimentally, computationally or both ways to identify lead compounds to treat various diseases. While conventional approaches have yielded many US Food and Drug Administration (FDA-approved drugs, researchers continue investigating and designing better approaches to increase the success rate in the discovery process. In this article, we provide an overview of the current strategies and point out where and how the method of maximum entropy has been introduced in this area. The maximum entropy principle has its root in thermodynamics, yet since Jaynes’ pioneering work in the 1950s, the maximum entropy principle has not only been used as a physics law, but also as a reasoning tool that allows us to process information in hand with the least bias. Its applicability in various disciplines has been abundantly demonstrated. We give several examples of applications of maximum entropy in different stages of drug discovery. Finally, we discuss a promising new direction in drug discovery that is likely to hinge on the ways of utilizing maximum entropy.
2003-01-01
Many people don't realise quite how much is going on at CERN. Would you like to gain first-hand knowledge of CERN's scientific and technological activities and their many applications? Try out some experiments for yourself, or pick the brains of the people in charge? If so, then the «Lundis Découverte» or Discovery Mondays, will be right up your street. Starting on May 5th, on every first Monday of the month you will be introduced to a different facet of the Laboratory. CERN staff, non-scientists, and members of the general public, everyone is welcome. So tell your friends and neighbours and make sure you don't miss this opportunity to satisfy your curiosity and enjoy yourself at the same time. You won't have to listen to a lecture, as the idea is to have open exchange with the expert in question and for each subject to be illustrated with experiments and demonstrations. There's no need to book, as Microcosm, CERN's interactive museum, will be open non-stop from 7.30 p.m. to 9 p.m. On the first Discovery M...
2010-01-01
... 6 Domestic Security 1 2010-01-01 2010-01-01 false Discovery. 13.21 Section 13.21 Domestic Security DEPARTMENT OF HOMELAND SECURITY, OFFICE OF THE SECRETARY PROGRAM FRAUD CIVIL REMEDIES § 13.21 Discovery. (a) In general. (1) The following types of discovery are authorized: (i) Requests for production of...
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Discovery. 99.23 Section 99.23 Public Welfare... DEVELOPMENT FUND Hearing Procedures § 99.23 Discovery. The Department, the Lead Agency, and any individuals or groups recognized as parties shall have the right to conduct discovery (including depositions) against...
2010-01-01
... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Discovery. 134.310 Section 134.310 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION RULES OF PROCEDURE GOVERNING CASES BEFORE THE... Designations § 134.310 Discovery. Discovery will not be permitted in appeals from size determinations or NAICS...
2010-07-01
... 34 Education 1 2010-07-01 2010-07-01 false Discovery. 33.21 Section 33.21 Education Office of the Secretary, Department of Education PROGRAM FRAUD CIVIL REMEDIES ACT § 33.21 Discovery. (a) The following types of discovery are authorized: (1) Requests for production of documents for inspection and copying...
2010-07-01
... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Discovery. 18.7 Section 18.7 Judicial Administration DEPARTMENT OF JUSTICE OFFICE OF JUSTICE PROGRAMS HEARING AND APPEAL PROCEDURES § 18.7 Discovery.... Such order may be entered upon a showing that the deposition is necessary for discovery purposes, and...
2010-10-01
... 45 Public Welfare 4 2010-10-01 2010-10-01 false Discovery. 1386.103 Section 1386.103 Public... Hearing Procedures § 1386.103 Discovery. The Department and any party named in the Notice issued pursuant to § 1386.90 has the right to conduct discovery (including depositions) against opposing parties as...
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Discovery. 79.21 Section 79.21 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PROGRAM FRAUD CIVIL REMEDIES § 79.21 Discovery. (a) The following types of discovery are authorized: (1) Requests for production of documents for...
2010-10-01
... 47 Telecommunication 1 2010-10-01 2010-10-01 false Discovery. 1.729 Section 1.729..., and Reports Involving Common Carriers Formal Complaints § 1.729 Discovery. (a) Subject to paragraph (i... seek discovery of any non-privileged matter that is relevant to the material facts in dispute in the...
2010-01-01
... 7 Agriculture 4 2010-01-01 2010-01-01 false Discovery. 283.12 Section 283.12 Agriculture... of $50,000 or More § 283.12 Discovery. (a) Dispositions—(1) Motion for taking deposition. Only upon a... exist if the information sought appears reasonably calculated to lead to the discovery of admissible...
Ferreira, C.; Da Silva, A. L.; Nunes, A.; Haddad, J.; Lawler, S.
2014-12-01
Enabling effective data use and re-use in scientific investigations relies heavily not only on data availability but also on efficient data sharing discovery. The CUAHSI led Hydrological Information Systems (HIS) and supporting products have paved the way to efficient data sharing and discovery in the hydrological sciences. Based on the CUAHSI-HIS framework concepts for hydrologic data sharing we developed a unique system devoted to the George Mason University scientific community to support university wide data sharing and discovery as well as real time data access for extreme events situational awareness. The internet-based system will provide an interface where the researchers will input data collected from the measurement stations and present them to the public in form of charts, tables, maps, and documents. Moreover, the system is developed in ASP.NET MVC 4 using as Database Management System, Microsoft SQL Server 2008 R2, and hosted by Amazon Web Services. Currently the system is supporting the Mason Watershed Project providing historical hydrological, atmospheric and water quality data for the campus watershed and real time flood conditions in the campus. The system is also a gateway for unprecedented data collection of hurricane storm surge hydrodynamics in coastal wetlands in the Chesapeake Bay providing not only access to historical data but recent storms such as Hurricane Arthur. Future research includes coupling the system to a real-time flood alert system on campus, and besides providing data on the World Wide Web, to foment and provide a venue for interdisciplinary collaboration within the water scientists in the region.
The heat is on: thermodynamic analysis in fragment-based drug discovery
Edink, E.S.; Jansen, C.J.W.; Leurs, R.; De Esch, I.J.
2010-01-01
Thermodynamic analysis provides access to the determinants of binding affinity, enthalpy and entropy. In fragment-based drug discovery (FBDD), thermodynamic analysis provides a powerful tool to discriminate fragments based on their potential for successful optimization. The thermodynamic data
2010-10-01
... 42 Public Health 5 2010-10-01 2010-10-01 false Discovery. 1005.7 Section 1005.7 Public Health... OF EXCLUSIONS, CIVIL MONEY PENALTIES AND ASSESSMENTS § 1005.7 Discovery. (a) A party may make a... and any forms of discovery, other than those permitted under paragraph (a) of this section, are not...
2010-07-01
... 29 Labor 4 2010-07-01 2010-07-01 false Discovery. 1603.210 Section 1603.210 Labor Regulations... GOVERNMENT EMPLOYEE RIGHTS ACT OF 1991 Hearings § 1603.210 Discovery. (a) Unless otherwise ordered by the administrative law judge, discovery may begin as soon as the complaint has been transmitted to the administrative...
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Discovery. 150.435 Section 150.435 Public Welfare... AND INDIVIDUAL INSURANCE MARKETS Administrative Hearings § 150.435 Discovery. (a) The parties must identify any need for discovery from the opposing party as soon as possible, but no later than the time for...
2010-07-01
... 34 Education 1 2010-07-01 2010-07-01 false Discovery. 81.16 Section 81.16 Education Office of the... Discovery. (a) The parties to a case are encouraged to exchange relevant documents and information voluntarily. (b) The ALJ, at a party's request, may order compulsory discovery described in paragraph (c) of...
2010-07-01
... 29 Labor 5 2010-07-01 2010-07-01 false Discovery. 1905.25 Section 1905.25 Labor Regulations... OCCUPATIONAL SAFETY AND HEALTH ACT OF 1970 Hearings § 1905.25 Discovery. (a) Depositions. (1) For reasons of... discovery. Whenever appropriate to a just disposition of any issue in a hearing, the presiding hearing...
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Discovery. 160.516 Section 160.516 Public Welfare... ADMINISTRATIVE REQUIREMENTS Procedures for Hearings § 160.516 Discovery. (a) A party may make a request to... forms of discovery, other than those permitted under paragraph (a) of this section, are not authorized...
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Discovery. 430.86 Section 430.86 Public Health... Plans and Practice to Federal Requirements § 430.86 Discovery. CMS and any party named in the notice issued under § 430.70 has the right to conduct discovery (including depositions) against opposing parties...
Circuits and electronics hands-on learning with analog discovery
Okyere Attia, John
2018-01-01
The book provides instructions on building circuits on breadboards, connecting the Analog Discovery wires to the circuit under test, and making electrical measurements. Various measurement techniques are described and used in this book, including: impedance measurements, complex power measurements, frequency response measurements, power spectrum measurements, current versus voltage characteristic measurements of diodes, bipolar junction transistors, and Mosfets. The book includes end-of-chapter problems for additional exercises geared towards hands-on learning, experimentation, comparisons between measured results and those obtained from theoretical calculations.
Proteomic and metabolomic approaches to biomarker discovery
Issaq, Haleem J
2013-01-01
Proteomic and Metabolomic Approaches to Biomarker Discovery demonstrates how to leverage biomarkers to improve accuracy and reduce errors in research. Disease biomarker discovery is one of the most vibrant and important areas of research today, as the identification of reliable biomarkers has an enormous impact on disease diagnosis, selection of treatment regimens, and therapeutic monitoring. Various techniques are used in the biomarker discovery process, including techniques used in proteomics, the study of the proteins that make up an organism, and metabolomics, the study of chemical fingerprints created from cellular processes. Proteomic and Metabolomic Approaches to Biomarker Discovery is the only publication that covers techniques from both proteomics and metabolomics and includes all steps involved in biomarker discovery, from study design to study execution. The book describes methods, and presents a standard operating procedure for sample selection, preparation, and storage, as well as data analysis...
DEFF Research Database (Denmark)
Bukh, Per Nikolaj
2009-01-01
Anmeldelse af Discovery Driven Growh : A breakthrough process to reduce risk and seize opportunity, af Rita G. McGrath & Ian C. MacMillan, Boston: Harvard Business Press. Udgivelsesdato: 14 august......Anmeldelse af Discovery Driven Growh : A breakthrough process to reduce risk and seize opportunity, af Rita G. McGrath & Ian C. MacMillan, Boston: Harvard Business Press. Udgivelsesdato: 14 august...
2010-10-01
... 42 Public Health 1 2010-10-01 2010-10-01 false Discovery. 93.512 Section 93.512 Public Health... Process § 93.512 Discovery. (a) Request to provide documents. A party may only request another party to...) Responses to a discovery request. Within 30 days of receiving a request for the production of documents, a...
2010-10-01
... 42 Public Health 1 2010-10-01 2010-10-01 false Discovery. 3.516 Section 3.516 Public Health PUBLIC... AND PATIENT SAFETY WORK PRODUCT Enforcement Program § 3.516 Discovery. (a) A party may make a request... and any forms of discovery, other than those permitted under paragraph (a) of this section, are not...
Computational methods in drug discovery
Directory of Open Access Journals (Sweden)
Sumudu P. Leelananda
2016-12-01
Full Text Available The process for drug discovery and development is challenging, time consuming and expensive. Computer-aided drug discovery (CADD tools can act as a virtual shortcut, assisting in the expedition of this long process and potentially reducing the cost of research and development. Today CADD has become an effective and indispensable tool in therapeutic development. The human genome project has made available a substantial amount of sequence data that can be used in various drug discovery projects. Additionally, increasing knowledge of biological structures, as well as increasing computer power have made it possible to use computational methods effectively in various phases of the drug discovery and development pipeline. The importance of in silico tools is greater than ever before and has advanced pharmaceutical research. Here we present an overview of computational methods used in different facets of drug discovery and highlight some of the recent successes. In this review, both structure-based and ligand-based drug discovery methods are discussed. Advances in virtual high-throughput screening, protein structure prediction methods, protein–ligand docking, pharmacophore modeling and QSAR techniques are reviewed.
Solution NMR Spectroscopy in Target-Based Drug Discovery.
Li, Yan; Kang, Congbao
2017-08-23
Solution NMR spectroscopy is a powerful tool to study protein structures and dynamics under physiological conditions. This technique is particularly useful in target-based drug discovery projects as it provides protein-ligand binding information in solution. Accumulated studies have shown that NMR will play more and more important roles in multiple steps of the drug discovery process. In a fragment-based drug discovery process, ligand-observed and protein-observed NMR spectroscopy can be applied to screen fragments with low binding affinities. The screened fragments can be further optimized into drug-like molecules. In combination with other biophysical techniques, NMR will guide structure-based drug discovery. In this review, we describe the possible roles of NMR spectroscopy in drug discovery. We also illustrate the challenges encountered in the drug discovery process. We include several examples demonstrating the roles of NMR in target-based drug discoveries such as hit identification, ranking ligand binding affinities, and mapping the ligand binding site. We also speculate the possible roles of NMR in target engagement based on recent processes in in-cell NMR spectroscopy.
African Journals Online (AJOL)
Discovery and Innovation is a journal of the African Academy of Sciences (AAS) ... World (TWAS) meant to focus attention on science and technology in Africa and the ... of Non-wood Forest Products: Potential Impacts and Challenges in Africa ...
Intelligent Content Discovery on the Mobile Internet: Experiences and Lessons Learned
Smyth, Barry; Cotter, Paul; Oman, Stephen
2008-01-01
The mobile Internet represents a massive opportunity for mobile operators and content providers. Today there are more than 2 billion mobile subscribers, with 3 billion predicted by the end of 2007. However, despite significant improvements in handsets, infrastructure, content, and charging models, mobile users are still struggling to access and locate relevant content and services. An important part of this so-called content-discovery problem relates to the navigation effort that users must i...
Discovery stories in the science classroom
Arya, Diana Jaleh
School science has been criticized for its lack of emphasis on the tentative, dynamic nature of science as a process of learning more about our world. This criticism is the guiding force for this present body of work, which focuses on the question: what are the educational benefits for middle school students of reading texts that highlight the process of science in the form of a discovery narrative? This dissertation traces my journey through a review of theoretical perspectives of narrative, an analysis of first-hand accounts of scientific discovery, the complex process of developing age-appropriate, cohesive and engaging science texts for middle school students, and a comparison study (N=209) that seeks to determine the unique benefits of the scientific discovery narrative for the interest in and retained understanding of conceptual information presented in middle school science texts. A total of 209 middle school participants in nine different classrooms from two different schools participated in the experimental study. Each subject read two science texts that differed in topic (the qualities of and uses for radioactive elements and the use of telescopic technology to see planets in space) and genre (the discovery narrative and the "conceptually known exposition" comparison text). The differences between the SDN and CKE versions for each topic were equivalent in all possible ways (initial introduction, overall conceptual accuracy, elements of human interest, coherence and readability level), save for the unique components of the discovery narrative (i.e., love for their work, acknowledgement of the known, identification of the unknown and the explorative or experimental process to discovery). Participants generally chose the discovery narrative version as the more interesting of the two texts. Additional findings from the experimental study suggest that science texts in the form of SDNs elicit greater long-term retention of key conceptual information, especially
ALMA Discovery of Solar Umbral Brightness Enhancement at λ = 3 mm
Energy Technology Data Exchange (ETDEWEB)
Iwai, Kazumasa [Institute for Space-Earth Environmental Research, Nagoya University, Furo-cho, Chikusa-ku, Nagoya, 464-8601 (Japan); Loukitcheva, Maria [Center for Solar-Terrestrial Research, New Jersey Institute of Technology, 323 Martin Luther King Boulevard, Newark, NJ 07102 (United States); Shimojo, Masumi [Chile Observatory, National Astronomical Observatory of Japan, Mitaka, Tokyo 181-8588 (Japan); Solanki, Sami K. [Max Planck Institute for Solar System Research, Justus-von-Liebig-Weg 3, D-37073 Göttingen (Germany); White, Stephen M., E-mail: k.iwai@isee.nagoya-u.ac.jp [Space Vehicles Directorate, Air Force Research Laboratory, Albuquerque, NM (United States)
2017-06-01
We report the discovery of a brightness enhancement in the center of a large sunspot umbra at a wavelength of 3 mm using the Atacama Large Millimeter/sub-millimeter Array (ALMA). Sunspots are among the most prominent features on the solar surface, but many of their aspects are surprisingly poorly understood. We analyzed a λ = 3 mm (100 GHz) mosaic image obtained by ALMA that includes a large sunspot within the active region AR12470, on 2015 December 16. The 3 mm map has a 300″ × 300″ field of view and 4.″9 × 2.″2 spatial resolution, which is the highest spatial resolution map of an entire sunspot in this frequency range. We find a gradient of 3 mm brightness from a high value in the outer penumbra to a low value in the inner penumbra/outer umbra. Within the inner umbra, there is a marked increase in 3 mm brightness temperature, which we call an umbral brightness enhancement. This enhanced emission corresponds to a temperature excess of 800 K relative to the surrounding inner penumbral region and coincides with excess brightness in the 1330 and 1400 Å slit-jaw images of the Interface Region Imaging Spectrograph ( IRIS ), adjacent to a partial lightbridge. This λ = 3 mm brightness enhancement may be an intrinsic feature of the sunspot umbra at chromospheric heights, such as a manifestation of umbral flashes, or it could be related to a coronal plume, since the brightness enhancement was coincident with the footpoint of a coronal loop observed at 171 Å.
DISCOVERY OF A NEW SOFT GAMMA REPEATER: SGR J0418 + 5729
International Nuclear Information System (INIS)
Van der Horst, A. J.; Connaughton, V.; Briggs, M. S.; Kouveliotou, C.; Goegues, E.; Kaneko, Y.; Wachter, S.; Granot, J.; Ramirez-Ruiz, E.; Woods, P. M.; Aptekar, R. L.; Frederiks, D. D.; Golenetskii, S.; Barthelmy, S. D.; Cummings, J. R.; Gehrels, N.; Finger, M. H.; Gelino, C. R.; Gelino, D. M.; Hurley, K.
2010-01-01
On 2009 June 5, the Gamma-ray Burst Monitor (GBM) onboard the Fermi Gamma-ray Space Telescope triggered on two short and relatively dim bursts with spectral properties similar to soft gamma repeater (SGR) bursts. Independent localizations of the bursts by triangulation with the Konus-RF and with the Swift satellite confirmed their origin from the same, previously unknown, source. The subsequent discovery of X-ray pulsations with the Rossi X-ray Timing Explorer confirmed the magnetar nature of the new source, SGR J0418 + 5729. We describe here the Fermi/GBM observations, the discovery and the localization of this new SGR, and our infrared and Chandra X-ray observations. We also present a detailed temporal and spectral study of the two GBM bursts. SGR J0418 + 5729 is the second source discovered in the same region of the sky in the last year, the other one being SGR J0501 + 4516. Both sources lie in the direction of the galactic anti-center and presumably at the nearby distance of ∼2 kpc (assuming they reside in the Perseus arm of our Galaxy). The near-threshold GBM detection of bursts from SGR J0418 + 5729 suggests that there may be more such 'dim' SGRs throughout our Galaxy, possibly exceeding the population of 'bright' SGRs. Finally, using sample statistics, we conclude that the number of observable active magnetars in our Galaxy at any given time is ∼<10, in agreement with our earlier estimates.
Optimizing Neighbor Discovery for Ad hoc Networks based on the Bluetooth PAN Profile
DEFF Research Database (Denmark)
Kuijpers, Gerben; Nielsen, Thomas Toftegaard; Prasad, Ramjee
2002-01-01
IP layer neighbor discovery mechanisms rely highly on broadcast/multicast capabilities of the underlying link layer. The Bluetooth personal area network (PAN) profile has no native link layer broadcast/multicast capabilities and can only emulate this by repeatedly unicast link layer frames....... This paper introduces a neighbor discovery mechanism that utilizes the resources in the Bluetooth PAN profile more efficient. The performance of the new mechanism is investigated using a IPv6 network simulator and compared with emulated broadcasting. It is shown that the signaling overhead can...
Optical Pulsars and Black Arrows: Discoveries as Occasioned Productions
Koschmann, Timothy; Zemel, Alan
2009-01-01
The current article represents a methodological proposal. It seeks to address the question of how one might recognize a discovery as a discovery without knowing in advance what is available to be discovered. We propose a solution and demonstrate it using data from a study previously reported by J. Roschelle (1992). Roschelle investigated 2…
9 CFR 95.2 - Region of origin.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Region of origin. 95.2 Section 95.2... BYPRODUCTS (EXCEPT CASINGS), AND HAY AND STRAW, OFFERED FOR ENTRY INTO THE UNITED STATES § 95.2 Region of... Administrator, Veterinary Services, the name of the region of origin of such product or material: Provided, That...
International Nuclear Information System (INIS)
Six, J.
1987-01-01
The neutron: who had first the idea, who discovered it, who established its main properties. To these apparently simple questions, multiple answers exist. The progressive discovery of the neutron is a marvellous illustration of some characteristics of the scientific research, where the unforeseen may be combined with the expected. This discovery is replaced in the context of the 1930's scientific effervescence that succeeded the revolutionary introduction of quantum mechanics. This book describes the works of Bothe, the Joliot-Curie and Chadwick which led to the neutron in an unexpected way. A historical analysis allows to give a new interpretation on the hypothesis suggested by the Joliot-Curie. Some texts of these days will help the reader to revive this fascinating story [fr
2010-01-01
... 10 Energy 3 2010-01-01 2010-01-01 false Discovery. 205.198 Section 205.198 Energy DEPARTMENT OF... of Proposed Disallowance, and Order of Disallowance § 205.198 Discovery. (a) If a person intends to file a Motion for Discovery, he must file it at the same time that he files his Statement of Objections...
2010-04-01
... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Discovery. 17.23 Section 17.23 Food and Drugs FOOD... HEARINGS § 17.23 Discovery. (a) No later than 60 days prior to the hearing, unless otherwise ordered by the..., depositions, and any forms of discovery, other than those permitted under paragraphs (a) and (e) of this...
Baraglia, Ranieri; Dazzi, Patrizio; Mordacchini, Matteo; Ricci, Laura
2013-01-01
ATLAAS-P2P is a two-layered P2P architecture for developing systems providing resource aggregation and approximated discovery in P2P networks. Such systems allow users to search the desired resources by specifying their requirements in a flexible and easy way. From the point of view of resource providers, this system makes available an effective solution supporting providers in being reached by resource requests.
Comparison of regional and ecosystem CO{sub 2} fluxes
Energy Technology Data Exchange (ETDEWEB)
Gryning, S. E. (Wind Energy Department, Risoe National Laboratory for Sustainable Energy, Technical Univ. of Denmark, Roskilde (Denmark)); Soegaard, H. (Institute of Geography and Geology, University of Copenhagen, Copenhagen (Denmark)); Batchvarova, E. (National Institute of Meteorology and Hydrology, Bulgarian Academy of Sciences, Sofia (Bulgaria))
2009-07-01
A budget method to derive the regional surface flux of CO{sub 2} from the evolution of the boundary layer is presented and applied. The necessary input for the method can be deduced from a combination of vertical profile measurements of CO{sub 2} concentrations by i.e. an airplane, successive radio-soundings and standard measurements of the CO{sub 2} concentration near the ground. The method was used to derive the regional flux of CO{sub 2} over an agricultural site at Zealand in Denmark during an experiment on 12-13 June 2006. The regional fluxes of CO{sub 2} represent a combination of agricultural and forest surface conditions. It was found that the regional flux of CO{sub 2} in broad terms follows the behavior of the flux of CO{sub 2} at the agricultural (grassland) and the deciduous forest station. The regional flux is comparable not only in size but also in the diurnal (daytime) cycle of CO{sub 2} fluxes at the two stations. (orig.)
Engineering Application Way of Faults Knowledge Discovery Based on Rough Set Theory
International Nuclear Information System (INIS)
Zhao Rongzhen; Deng Linfeng; Li Chao
2011-01-01
For the knowledge acquisition puzzle of intelligence decision-making technology in mechanical industry, to use the Rough Set Theory (RST) as a kind of tool to solve the puzzle was researched. And the way to realize the knowledge discovery in engineering application is explored. A case extracting out the knowledge rules from a concise data table shows out some important information. It is that the knowledge discovery similar to the mechanical faults diagnosis is an item of complicated system engineering project. In where, first of all-important tasks is to preserve the faults knowledge into a table with data mode. And the data must be derived from the plant site and should also be as concise as possible. On the basis of the faults knowledge data obtained so, the methods and algorithms to process the data and extract the knowledge rules from them by means of RST can be processed only. The conclusion is that the faults knowledge discovery by the way is a process of rising upward. But to develop the advanced faults diagnosis technology by the way is a large-scale knowledge engineering project for long time. Every step in which should be designed seriously according to the tool's demands firstly. This is the basic guarantees to make the knowledge rules obtained have the values of engineering application and the studies have scientific significance. So, a general framework is designed for engineering application to go along the route developing the faults knowledge discovery technology.
Fragment virtual screening based on Bayesian categorization for discovering novel VEGFR-2 scaffolds.
Zhang, Yanmin; Jiao, Yu; Xiong, Xiao; Liu, Haichun; Ran, Ting; Xu, Jinxing; Lu, Shuai; Xu, Anyang; Pan, Jing; Qiao, Xin; Shi, Zhihao; Lu, Tao; Chen, Yadong
2015-11-01
The discovery of novel scaffolds against a specific target has long been one of the most significant but challengeable goals in discovering lead compounds. A scaffold that binds in important regions of the active pocket is more favorable as a starting point because scaffolds generally possess greater optimization possibilities. However, due to the lack of sufficient chemical space diversity of the databases and the ineffectiveness of the screening methods, it still remains a great challenge to discover novel active scaffolds. Since the strengths and weaknesses of both fragment-based drug design and traditional virtual screening (VS), we proposed a fragment VS concept based on Bayesian categorization for the discovery of novel scaffolds. This work investigated the proposal through an application on VEGFR-2 target. Firstly, scaffold and structural diversity of chemical space for 10 compound databases were explicitly evaluated. Simultaneously, a robust Bayesian classification model was constructed for screening not only compound databases but also their corresponding fragment databases. Although analysis of the scaffold diversity demonstrated a very unevenly distribution of scaffolds over molecules, results showed that our Bayesian model behaved better in screening fragments than molecules. Through a literature retrospective research, several generated fragments with relatively high Bayesian scores indeed exhibit VEGFR-2 biological activity, which strongly proved the effectiveness of fragment VS based on Bayesian categorization models. This investigation of Bayesian-based fragment VS can further emphasize the necessity for enrichment of compound databases employed in lead discovery by amplifying the diversity of databases with novel structures.
Demographically-Based Evaluation of Genomic Regions under Selection in Domestic Dogs.
Directory of Open Access Journals (Sweden)
Adam H Freedman
2016-03-01
Full Text Available Controlling for background demographic effects is important for accurately identifying loci that have recently undergone positive selection. To date, the effects of demography have not yet been explicitly considered when identifying loci under selection during dog domestication. To investigate positive selection on the dog lineage early in the domestication, we examined patterns of polymorphism in six canid genomes that were previously used to infer a demographic model of dog domestication. Using an inferred demographic model, we computed false discovery rates (FDR and identified 349 outlier regions consistent with positive selection at a low FDR. The signals in the top 100 regions were frequently centered on candidate genes related to brain function and behavior, including LHFPL3, CADM2, GRIK3, SH3GL2, MBP, PDE7B, NTAN1, and GLRA1. These regions contained significant enrichments in behavioral ontology categories. The 3rd top hit, CCRN4L, plays a major role in lipid metabolism, that is supported by additional metabolism related candidates revealed in our scan, including SCP2D1 and PDXC1. Comparing our method to an empirical outlier approach that does not directly account for demography, we found only modest overlaps between the two methods, with 60% of empirical outliers having no overlap with our demography-based outlier detection approach. Demography-aware approaches have lower-rates of false discovery. Our top candidates for selection, in addition to expanding the set of neurobehavioral candidate genes, include genes related to lipid metabolism, suggesting a dietary target of selection that was important during the period when proto-dogs hunted and fed alongside hunter-gatherers.
The circumstances of minor planet discovery
International Nuclear Information System (INIS)
Pilcher, F.
1989-01-01
The circumstances of discoveries of minor planets are presented in tabular form. Complete data are given for planets 2125-4044, together with notes pertaining to these planets. Information in the table includes the permanent number; the official name; for planets 330 and forward, the table includes the provisional designation attached to the discovery apparition and the year, month, the day of discovery, and the discovery place
Liao, Chun-Chih; Xiao, Furen; Wong, Jau-Min; Chiang, I.-Jen
Computed tomography (CT) of the brain is preferred study on neurological emergencies. Physicians use CT to diagnose various types of intracranial hematomas, including epidural, subdural and intracerebral hematomas according to their locations and shapes. We propose a novel method that can automatically diagnose intracranial hematomas by combining machine vision and knowledge discovery techniques. The skull on the CT slice is located and the depth of each intracranial pixel is labeled. After normalization of the pixel intensities by their depth, the hyperdense area of intracranial hematoma is segmented with multi-resolution thresholding and region-growing. We then apply C4.5 algorithm to construct a decision tree using the features of the segmented hematoma and the diagnoses made by physicians. The algorithm was evaluated on 48 pathological images treated in a single institute. The two discovered rules closely resemble those used by human experts, and are able to make correct diagnoses in all cases.
On the impact of network dynamics on a discovery protocol for ad-hoc networks
Liu, F.; Heijenk, Geert
A very promising approach to discovering services and context information in ad-hoc networks is based on the use of Attenuated Bloom filters. In this paper we analyze the impact of changes in the connectivity of an ad-hoc network on this approach. We evaluate the performance of the discovery
Nonuniversal gaugino masses and seminatural supersymmetry in view of the Higgs boson discovery
Energy Technology Data Exchange (ETDEWEB)
Martin, Stephen P. [Santa Barbara, KITP
2014-02-20
I consider models with non-universal gaugino masses at the gauge coupling unification scale, taking into account the Higgs boson discovery. Viable regions of parameter space are mapped and studied in the case of non-universality following from an F-term in a linear combination of singlet and adjoint representations of SU(5). I consider, in particular, "semi-natural" models that have small \\mu, with gaugino masses dominating the supersymmetry breaking terms at high energies. Higgsino-like particles are then much lighter than all other superpartners, and the prospects for discovery at the Large Hadron Collider can be extremely challenging.
Fragment-based drug discovery and its application to challenging drug targets.
Price, Amanda J; Howard, Steven; Cons, Benjamin D
2017-11-08
Fragment-based drug discovery (FBDD) is a technique for identifying low molecular weight chemical starting points for drug discovery. Since its inception 20 years ago, FBDD has grown in popularity to the point where it is now an established technique in industry and academia. The approach involves the biophysical screening of proteins against collections of low molecular weight compounds (fragments). Although fragments bind to proteins with relatively low affinity, they form efficient, high quality binding interactions with the protein architecture as they have to overcome a significant entropy barrier to bind. Of the biophysical methods available for fragment screening, X-ray protein crystallography is one of the most sensitive and least prone to false positives. It also provides detailed structural information of the protein-fragment complex at the atomic level. Fragment-based screening using X-ray crystallography is therefore an efficient method for identifying binding hotspots on proteins, which can then be exploited by chemists and biologists for the discovery of new drugs. The use of FBDD is illustrated here with a recently published case study of a drug discovery programme targeting the challenging protein-protein interaction Kelch-like ECH-associated protein 1:nuclear factor erythroid 2-related factor 2. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.
Research on hotspot discovery in internet public opinions based on improved K-means.
Wang, Gensheng
2013-01-01
How to discover hotspot in the Internet public opinions effectively is a hot research field for the researchers related which plays a key role for governments and corporations to find useful information from mass data in the Internet. An improved K-means algorithm for hotspot discovery in internet public opinions is presented based on the analysis of existing defects and calculation principle of original K-means algorithm. First, some new methods are designed to preprocess website texts, select and express the characteristics of website texts, and define the similarity between two website texts, respectively. Second, clustering principle and the method of initial classification centers selection are analyzed and improved in order to overcome the limitations of original K-means algorithm. Finally, the experimental results verify that the improved algorithm can improve the clustering stability and classification accuracy of hotspot discovery in internet public opinions when used in practice.
Research on Hotspot Discovery in Internet Public Opinions Based on Improved K-Means
2013-01-01
How to discover hotspot in the Internet public opinions effectively is a hot research field for the researchers related which plays a key role for governments and corporations to find useful information from mass data in the Internet. An improved K-means algorithm for hotspot discovery in internet public opinions is presented based on the analysis of existing defects and calculation principle of original K-means algorithm. First, some new methods are designed to preprocess website texts, select and express the characteristics of website texts, and define the similarity between two website texts, respectively. Second, clustering principle and the method of initial classification centers selection are analyzed and improved in order to overcome the limitations of original K-means algorithm. Finally, the experimental results verify that the improved algorithm can improve the clustering stability and classification accuracy of hotspot discovery in internet public opinions when used in practice. PMID:24106496
On the discovery of the gravitational field equations by Einstein and Hilbert: new materials
International Nuclear Information System (INIS)
Vizgin, Vladimir P
2001-01-01
This article describes the history of discovery of the equations of gravitational field by Albert Einstein and David Hilbert in November 1915. The proof sheet of Hilbert's lecture report, made on 20 November 1915 and published in March 1916, rediscovered in 1997 in the archive of the university of Goettingen, throws new light on the history of this discovery. We also discuss the early history of the general theory of relativity that led to the expression of the general covariant equations of gravitational field. (from the history of physics)
Discovery of a remarkable subpulse drift pattern in PSR B0818-41
Bhattacharyya, B.; Gupta, Y.; Gil, J.; Sendyk, M.
2007-05-01
We report the discovery of a remarkable subpulse drift pattern in the relatively less-studied wide profile pulsar B0818-41 using high-sensitivity Giant Metrewave Radio Telescope (GMRT) observations. We find simultaneous occurrences of three drift regions with two different drift rates: an inner region with steeper apparent drift rate flanked on each side by a region of slower apparent drift rate. Furthermore, these closely spaced drift bands always maintain a constant phase relationship. Though these drift regions have significantly different values for the measured P2, the measured P3 value is the same and equal to 18.3P1. We interpret the unique drift pattern of this pulsar as being created by the intersection of our line of sight (LOS) with two conal rings on the polar cap of a fairly aligned rotator (inclination angle α ~ 11°), with an `inner' LOS geometry (impact angle ). We argue that both rings have the same values for the carousel rotation periodicity P4 and the number of sparks Nsp. We find that Nsp is 19-21 and show that it is very likely that P4 is the same as the measured P3, making it a truly unique pulsar. We present results from simulations of the radiation pattern using the inferred parameters, which support our interpretations and reproduce the average profile as well as the observed features in the drift pattern quite well.
mHealth Visual Discovery Dashboard.
Fang, Dezhi; Hohman, Fred; Polack, Peter; Sarker, Hillol; Kahng, Minsuk; Sharmin, Moushumi; al'Absi, Mustafa; Chau, Duen Horng
2017-09-01
We present Discovery Dashboard, a visual analytics system for exploring large volumes of time series data from mobile medical field studies. Discovery Dashboard offers interactive exploration tools and a data mining motif discovery algorithm to help researchers formulate hypotheses, discover trends and patterns, and ultimately gain a deeper understanding of their data. Discovery Dashboard emphasizes user freedom and flexibility during the data exploration process and enables researchers to do things previously challenging or impossible to do - in the web-browser and in real time. We demonstrate our system visualizing data from a mobile sensor study conducted at the University of Minnesota that included 52 participants who were trying to quit smoking.
Bioinformatics for discovery of microbiome variation
DEFF Research Database (Denmark)
Brejnrod, Asker Daniel
of various molecular methods to build hypotheses about the impact of a copper contaminated soil. The introduction is a broad introduction to the field of microbiome research with a focus on the technologies that enable these discoveries and how some of the broader issues have related to this thesis......Sequencing based tools have revolutionized microbiology in recent years. Highthroughput DNA sequencing have allowed high-resolution studies on microbial life in many different environments and at unprecedented low cost. These culture-independent methods have helped discovery of novel bacteria...... 1 ,“Large-scale benchmarking reveals false discoveries and count transformation sensitivity in 16S rRNA gene amplicon data analysis methods used in microbiome studies”, benchmarked the performance of a variety of popular statistical methods for discovering differentially abundant bacteria . between...
KEGS Discovery of 28 Supernova Candidates in the K2 Campaign 17 Field with DECam
Narayan, G.; Rest, A.; Strampelli, G. M.; Zenteno, A.; James, D. J.; Smith, R. C.; Tucker, B. E.; Garnavich, P.; Margheim, S.; Kasen, D.; Olling, R.; Shaya, E.; Buron, F. Forster; Villar, V. A.
2018-05-01
The Kepler Extra-Galactic Survey (KEGS, see http://www.mso.anu.edu.au/kegs/ ) reports the discovery of 28 supernova candidates with the Dark Energy Camera (DECam, NOAO 2017B-0285) on the 4m Blanco Telescope at Cerro Tololo Inter-American Observatory (CTIO).
International Nuclear Information System (INIS)
Perl, M.L.
1994-08-01
Several previous papers have given the history of the discovery of the τ lepton at the Stanford Linear Accelerator Center (SLAC). These papers emphasized (a) the experiments which led to our 1975 publication of the first evidence for the existence of the τ, (b) the subsequent experiments which confirmed the existence of the r, and (c) the experiments which elucidated the major properties of the τ. That history will be summarized in Part 2 of this talk. In this Part 1, I describe the earlier thoughts and work of myself and my colleagues at SLAC in the 1960's and early 1970's which led to the discovery. I also describe the theoretical and experimental events in particle physics in the 1960's in which our work was immersed. I will also try to describe for the younger generations of particle physicists, the atmosphere in the 1960's. That was before the elucidation of the quark model of hadrons, before the development of the concept of particle generations The experimental paths to program we hot as clear as they are today and we had to cast a wide experimental net
Perl, M. L.
1994-08-01
Several previous papers have given the history of the discovery of the {tau} lepton at the Stanford Linear Accelerator Center (SLAC). These papers emphasized (a) the experiments which led to our 1975 publication of the first evidence for the existence of the {tau}, (b) the subsequent experiments which confirmed the existence of the r, and (c) the experiments which elucidated the major properties of the {tau}. That history will be summarized in Part 2 of this talk. In this Part 1, I describe the earlier thoughts and work of myself and my colleagues at SLAC in the 1960's and early 1970's which led to the discovery. I also describe the theoretical and experimental events in particle physics in the 1960's in which our work was immersed. I will also try to describe for the younger generations of particle physicists, the atmosphere in the 1960's. That was before the elucidation of the quark model of hadrons, before the development of the concept of particle generations The experimental paths to program we hot as clear as they are today and we had to cast a wide experimental net.
Sundramoorthy, V.; Scholten, Johan; Jansen, P.G.; Hartel, Pieter H.
2003-01-01
Service discovery is a fairly new field that kicked off since the advent of ubiquitous computing and has been found essential in the making of intelligent networks by implementing automated discovery and remote control between devices. This paper provides an overview and comparison of several
Discovery, characterization, and clinical development of the glucagon-like peptides
DEFF Research Database (Denmark)
Drucker, Daniel J; Habener, Joel F; Holst, Jens Juul
2017-01-01
that GLP-2 promotes mucosal growth in the intestine is described, and key findings from both preclinical studies and the GLP-2 clinical development program for short bowel syndrome (SBS) are reviewed. Finally, we summarize recent progress in GLP biology, highlighting emerging concepts and scientific......The discovery, characterization, and clinical development of glucagon-like-peptide-1 (GLP-1) spans more than 30 years and includes contributions from multiple investigators, science recognized by the 2017 Harrington Award Prize for Innovation in Medicine. Herein, we provide perspectives...... on the historical events and key experimental findings establishing the biology of GLP-1 as an insulin-stimulating glucoregulatory hormone. Important attributes of GLP-1 action and enteroendocrine science are reviewed, with emphasis on mechanistic advances and clinical proof-of-concept studies. The discovery...
Directory of Open Access Journals (Sweden)
Hendra Erik Rudyanto
2016-11-01
Full Text Available This Study aims to produce a model learning device discovery learning with scientific approach to improve the character charged valid creative thinking, practical and effective. The model refers to a model of learning development includes activities Plomp initial investigation, design, realization/contruction, testing, evaluation and revision. The results showed that (1 learning tools developed valid; syllabus ehit an average of 3,3 (very good; RPP with an average of 3,2 (good; LKS with an average of 3,2 (good; textbook student with an average of 3,3 (very good; and TKBK with an average of 3,5 (good.; (2 the stated learning practical , namely: 1 the activity of student on both criteria, an average score 74,1%; 2 the activity of the teacher are very good on the criterion, the average score of 98,25; 3 positive teacher response, a score of 97,14; 4 positive students response, average 89,73.; (3 the learning of mathematics is declared effective the indicator 1 traffic to think creatively achieve mastery with the average value of 71,55 and a classical completeness reaches 90%; 2 the average grade of creative thinking ability model of discovery learning with scientific approachis better than ekspositori class; 3 the character of the curiosity and skills to communicate a positive influence on the ability to think creatively; and 4 an increase in the ability to think creatively in class models discovery learning with scientific approach. Keywords: discovery learning, scientific approach, creative thinking ability.
To question of radiation factors on onco-epidemiology in regions of Georgia
International Nuclear Information System (INIS)
Vepxadze, N.R.; Maqradze, Q.M.; Qoncilasvili, I.P.
2002-01-01
Full text: Planning of anticancer service is impossible without studying the actual dynamics and prognosis of diseases we have analyzed the morbidity and mortality rates for different regions conditioned by different ecological conditions in these regions. We have studied the space-structural features of extension of cancer as base of programme for recreative and preventive measures. It is shown that the dynamic of oncologic diseases in Georgian regions has a natural character and is not conditioned much by anthropogenic factor. 1. For regions exceeds death-rate that and points to validity processing statistical information, real reflecting regional particularities. 2.Simultaneously possible indicate that where average oncologic diseases exceeds checking point factors, alike death-rate level can point medical service to more high level of. 3.Migration of population, ethnic a spottiness really characteristic of some regions-on this reason insufficiently high general correlation factors and insufficiently mother a mistake prognostic regression equations. 4.As is 'cancer-discomfort' by the region that wholly follows from its ecological, and genetic features. Region is characterized moderate climate; extreme climatic parameters of external ambience here as a whole rare and low-probable; in the region of practically no bad production, polluting intensive surrounding ambience; region is agricultural, without intensive technical cultures already; social conditions of residence - moderate, no high density of population because of presence of greater areas and etc; stevedore is characterized by the person by temperance on fat and calorie content, on the base of wheat and corn bread; a general factor to correlations-a measure of relationship of chosen parameters pointing under investigation features, within 0,5 - 0,6 and above; a mistake of using an prognostic metaaluminate does not exceed 25% that sufficiently high factor, permitting practical using an prognostic equation
Academic Drug Discovery Centres
DEFF Research Database (Denmark)
Kirkegaard, Henriette Schultz; Valentin, Finn
2014-01-01
Academic drug discovery centres (ADDCs) are seen as one of the solutions to fill the innovation gap in early drug discovery, which has proven challenging for previous organisational models. Prior studies of ADDCs have identified the need to analyse them from the angle of their economic...
Sundramoorthy, V.; Scholten, Johan; Jansen, P.G.; Hartel, Pieter H.
Service discovery is a fady new field that kicked off since the advent of ubiquitous computing and has been found essential in the making of intelligent networks by implementing automated discovery and remote control between deviies. This paper provides an ovewiew and comparison of several prominent
NASA Reverb: Standards-Driven Earth Science Data and Service Discovery
Cechini, M. F.; Mitchell, A.; Pilone, D.
2011-12-01
NASA's Earth Observing System Data and Information System (EOSDIS) is a core capability in NASA's Earth Science Data Systems Program. NASA's EOS ClearingHOuse (ECHO) is a metadata catalog for the EOSDIS, providing a centralized catalog of data products and registry of related data services. Working closely with the EOSDIS community, the ECHO team identified a need to develop the next generation EOS data and service discovery tool. This development effort relied on the following principles: + Metadata Driven User Interface - Users should be presented with data and service discovery capabilities based on dynamic processing of metadata describing the targeted data. + Integrated Data & Service Discovery - Users should be able to discovery data and associated data services that facilitate their research objectives. + Leverage Common Standards - Users should be able to discover and invoke services that utilize common interface standards. Metadata plays a vital role facilitating data discovery and access. As data providers enhance their metadata, more advanced search capabilities become available enriching a user's search experience. Maturing metadata formats such as ISO 19115 provide the necessary depth of metadata that facilitates advanced data discovery capabilities. Data discovery and access is not limited to simply the retrieval of data granules, but is growing into the more complex discovery of data services. These services include, but are not limited to, services facilitating additional data discovery, subsetting, reformatting, and re-projecting. The discovery and invocation of these data services is made significantly simpler through the use of consistent and interoperable standards. By utilizing an adopted standard, developing standard-specific adapters can be utilized to communicate with multiple services implementing a specific protocol. The emergence of metadata standards such as ISO 19119 plays a similarly important role in discovery as the 19115 standard
International Nuclear Information System (INIS)
Altarelli, G.; Sjoestrand, T.; Zwirner, F.
1995-01-01
This is final report of the Workshop on Physics at LEP2, held at CERN during 1995. The first part of vol. 1 is devoted to aspects of machine physics of particular relevance to experiments, including the energy, luminosity and interaction regions, as well as the measurement of beam energy. The second part of vol. 1 is a relatively concise, but fairly complete, handbook on the physics of e + e - annihilation above the WW threshold and up to √s∼200 GeV. It contains discussions on WW cross-sections and distributions, W mass determination, Standard Model processes, QCD and gamma-gamma physics, as well as aspects of discovery physics, such as Higgs, new particle searches, triple gauge boson couplings and Z'. The second volume contains a review of the existing Monte Carlo generators for LEP2 physics. These include generators for WW physics, QCD and gamma-gamma processes, Bhabha scattering and discovery physics. A special effort was made to co-ordinate the different parts, with a view to achieving a systematic and balanced review of the subject, rather than just publishing a collection of separate contributions. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Altarelli, G [ed.; Sjoestrand, T [ed.; Zwirner, F [ed.
1995-02-19
This is final report of the Workshop on Physics at LEP2, held at CERN during 1995. The first part of vol. 1 is devoted to aspects of machine physics of particular relevance to experiments, including the energy, luminosity and interaction regions, as well as the measurement of beam energy. The second part of vol. 1 is a relatively concise, but fairly complete, handbook on the physics of e{sup +}e{sup -} annihilation above the WW threshold and up to {radical}s{approx}200 GeV. It contains discussions on WW cross-sections and distributions, W mass determination, Standard Model processes, QCD and gamma-gamma physics, as well as aspects of discovery physics, such as Higgs, new particle searches, triple gauge boson couplings and Z`. The second volume contains a review of the existing Monte Carlo generators for LEP2 physics. These include generators for WW physics, QCD and gamma-gamma processes, Bhabha scattering and discovery physics. A special effort was made to co-ordinate the different parts, with a view to achieving a systematic and balanced review of the subject, rather than just publishing a collection of separate contributions. (orig.).
Louie, Dana; Deming, Drake; Albert, Loic; Bouma, Luke; Bean, Jacob; Lopez-Morales, Mercedes
2018-01-01
The Transiting Exoplanet Survey Satellite (TESS) will embark in 2018 on a 2-year wide-field survey mission of most of the celestial sky, discovering over a thousand super-Earth and sub-Neptune-sized exoplanets potentially suitable for follow-up observations using the James Webb Space Telescope (JWST). Bouma et al. (2017) and Sullivan et al. (2015) used Monte Carlo simulations to predict the properties of the planetary systems that TESS is likely to detect, basing their simulations upon Kepler-derived planet occurrence rates and photometric performance models for the TESS cameras. We employed a JWST Near InfraRed Imager and Slitless Spectrograph (NIRISS) simulation tool to estimate the signal-to-noise (S/N) that JWST/NIRISS will attain in transmission spectroscopy of these anticipated TESS discoveries, and we then compared the S/N for anticipated TESS discoveries to our estimates of S/N for 18 known exoplanets. We analyzed the sensitivity of our results to planetary composition, cloud cover, and presence of an observational noise floor. We find that only a few anticipated TESS discoveries in the terrestrial planet regime will result in better JWST/NIRISS S/N than currently known exoplanets, such as the TRAPPIST-1 planets, GJ1132b, or LHS1140b. However, we emphasize that this outcome is based upon Kepler-derived occurrence rates, and that co-planar compact systems (e.g. TRAPPIST-1) were not included in predicting the anticipated TESS planet yield. Furthermore, our results show that several hundred anticipated TESS discoveries in the super-Earth and sub-Neptune regime will produce S/N higher than currently known exoplanets such as K2-3b or K2-3c. We apply our results to estimate the scope of a JWST follow-up observation program devoted to mapping the transition region between high molecular weight and primordial planetary atmospheres.
Studying Scientific Discovery by Computer Simulation.
1983-03-30
Mendel’s laws of inheritance, the law of Gay- Lussac for gaseous reactions, tile law of Dulong and Petit, the derivation of atomic weights by Avogadro...neceseary mid identify by block number) scientific discovery -ittri sic properties physical laws extensive terms data-driven heuristics intensive...terms theory-driven heuristics conservation laws 20. ABSTRACT (Continue on revere. side It necessary and identify by block number) Scientific discovery
Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.
Nagar, Anurag; Hahsler, Michael
2013-01-01
Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to
Discovery of a Pulsar Wind Nebula Candidate in the Cygnus Loop
Katsuda, Satoru; Tsunemi, Hiroshi; Mori, Koji; Uchida, Hiroyuki; Petre, Robert; Yamada, Shin'ya; Tamagawa, Toru
2012-01-01
We report on a discovery of a diffuse nebula containing a point-like source in the southern blowout region of the Cygnus Loop supernova remnant, based on Suzaku and XMM-Newton observations. The X-ray spectra from the nebula and the point-like source are well represented by an absorbed power-law model with photon indices of 2.2+/-0.1 and 1.6+/-0.2, respectively. The photon indices as well as the flux ratio of F(sub nebula)/F(sub point-like) approx. 4 lead us to propose that the system is a pulsar wind nebula, although pulsations have not yet been detected. If we attribute its origin to the Cygnus Loop supernova, then the 0.5-8 keV luminosity of the nebula is computed to be 2.1x10(exp 31)(d/540pc)(exp 2)ergss/2, where d is the distance to the Loop. This implies a spin-down loss-energy E approx. 2.6x10(exp 35)(d/540pc)(exp 2)ergs/s. The location of the neutron star candidate, approx.2deg away from the geometric center of the Loop, implies a high transverse velocity of approx.1850(theta/2deg)(d/540pc)(t/10kyr)/k/s assuming the currently accepted age of the Cygnus Loop.
International Nuclear Information System (INIS)
Schirmer, M.; Diaz, R.; Levenson, N. A.; Winge, C.; Holhjem, K.
2013-01-01
We report the discovery of Seyfert-2 galaxies in SDSS-DR8 with galaxy-wide, ultraluminous narrow-line regions (NLRs) at redshifts z = 0.2-0.6. With a space density of 4.4 Gpc –3 at z ∼ 0.3, these 'green beans' (GBs) are amongst the rarest objects in the universe. We are witnessing an exceptional and/or short-lived phenomenon in the life cycle of active galactic nuclei (AGNs). The main focus of this paper is on a detailed analysis of the GB prototype galaxy J2240–0927 (z = 0.326). Its NLR extends over 26 × 44 kpc and is surrounded by an extended NLR. With a total [O III] λ5008 luminosity of (5.7 ± 0.9) × 10 43 erg s –1 , this is one of the most luminous NLRs known around any type-2 galaxy. Using VLT/XSHOOTER, we show that the NLR is powered by an AGN, and we derive resolved extinction, density, and ionization maps. Gas kinematics is disturbed on a global scale, and high-velocity outflows are absent or faint. This NLR is unlike any other NLR or extended emission line region known. Spectroscopy with Gemini/GMOS reveals extended, high-luminosity [O III] emission also in other GBs. WISE 24 μm luminosities are 5-50 times lower than predicted by the [O III] fluxes, suggesting that the NLRs reflect earlier, very active quasar states that have strongly subsided in less than a galaxy's light-crossing time. These light echoes, or ionization echoes, are about 100 times more luminous than any other such echo known to date. X-ray data are needed for photoionization modeling and to verify the light echoes.
Gas, gas, gas... discoveries and developments booming worldwide
International Nuclear Information System (INIS)
Maxwell, F.
2000-01-01
Deep water exploration is yielding more than billion barrel oil fields. Unocal's 3 May discovery of 2-3 Tcf of gas in its Kutei block of Indonesia marks the first major discovery of natural gas in the deep water frontier: Wildcats Gula and Gada were drilled in over 1800 m of water as part of an aggressive search for gas instigated by Unocal last year. The author makes a survey of gas exploration and development throughout the world. (author)
Panorama 2017 - New conventional oil and gas discoveries
International Nuclear Information System (INIS)
Hureau, Geoffroy; Vially, Roland
2017-01-01
In 2016, spending on exploration is expected to decline by approximately 35% for the second consecutive year (total exploration-production is down 24%). However, volumes discovered through conventional exploration should only fall by 25% due to several significant discoveries, particularly in Alaska and West Africa. The largest discovery in 2016 was an unconventional Permian shale basin in the United States, which could alone contain as many hydrocarbons as all of the year's conventional discoveries combined
DISCOVERY OF THE PIGTAIL MOLECULAR CLOUD IN THE GALACTIC CENTER
International Nuclear Information System (INIS)
Matsumura, Shinji; Oka, Tomoharu; Tanaka, Kunihiko; Nagai, Makoto; Kamegai, Kazuhisa; Hasegawa, Tetsuo
2012-01-01
This paper reports the discovery of a helical molecular cloud in the central molecular zone (CMZ) of our Galaxy. This 'pigtail' molecular cloud appears at (l, b, V LSR ) ≅ (–0. 0 7, + 0. 0 0, – 70 to –30 km s –1 ), with a spatial size of ∼20 × 20 pc 2 and a mass of (2-6) × 10 5 M ☉ . This is the third helical gaseous nebula found in the Galactic center region to date. Line intensity ratios indicate that the pigtail molecular cloud has slightly higher temperature and/or density than the other normal clouds in the CMZ. We also found a high-velocity wing emission near the footpoint of this cloud. We propose a formation model of the pigtail molecular cloud. It might be associated with a magnetic tube that is twisted and coiled because of the interaction between clouds in the innermost x 1 orbit and ones in the outermost x 2 orbit.
Tumewu, Widya Anjelia; Wulan, Ana Ratna; Sanjaya, Yayan
2017-05-01
The purpose of this study was to know comparing the effectiveness of learning using Project-based learning (PjBL) and Discovery Learning (DL) toward students metacognitive strategies on global warming concept. A quasi-experimental research design with a The Matching-Only Pretest-Posttest Control Group Design was used in this study. The subjects were students of two classes 7th grade of one of junior high school in Bandung City, West Java of 2015/2016 academic year. The study was conducted on two experimental class, that were project-based learning treatment on the experimental class I and discovery learning treatment was done on the experimental class II. The data was collected through questionnaire to know students metacognitive strategies. The statistical analysis showed that there were statistically significant differences in students metacognitive strategies between project-based learning and discovery learning.
Discovery of a Satellite of the Large Trans-Neptunian Object (225088) 2007 OR{sub 10}
Energy Technology Data Exchange (ETDEWEB)
Kiss, Csaba; Marton, Gábor; Farkas-Takács, Anikó; Vinkó, József; Pál, András [Konkoly Observatory, Research Centre for Astronomy and Earth Sciences, Hungarian Academy of Sciences, Konkoly Thege 15-17, H-1121 Budapest (Hungary); Stansberry, John [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Müller, Thomas [Max-Planck-Institut für extraterrestrische Physik, Postfach 1312, Giessenbachstr., D-85741 Garching (Germany); Balog, Zoltán [Max-Planck-Institut für Astronomie, Königstuhl 17, D-69117 Heidelberg (Germany); Ortiz, Jose-Luis, E-mail: kiss.csaba@csfk.mta.hu [Instituto de Astrofísica de Andalucía—CSIC, Apt 3004, E-18080 Granada (Spain)
2017-03-20
2007 OR{sub 10} is currently the third largest known dwarf planet in the trans-Neptunian region, with an effective radiometric diameter of ∼1535 km. It has a slow rotation period of ∼45 hr that was suspected to be caused by tidal interactions with a satellite undetected at that time. Here, we report on the discovery of a likely moon of 2007 OR{sub 10}, identified on archival Hubble Space Telescope WFC3/UVIS system images. Although the satellite is detected at two epochs, this does not allow an unambiguous determination of the orbit and the orbital period. A feasible 1.5–5.8 · 10{sup 21} kg estimate for the system mass leads to a likely 35–100 day orbital period. The moon is about 4.ͫ2 fainter than 2007 OR{sub 10} in HST images that corresponds to a diameter of 237 km assuming equal albedos with the primary. Due to the relatively small size of the moon, the previous size and albedo estimates for the primary remains unchanged. With this discovery all trans-Neptunian objects larger than 1000 km are now known to harbor satellites, an important constraint for moon formation theories in the young solar system.
Energy Technology Data Exchange (ETDEWEB)
Hekkenberg, M. [ECN Policy Studies, Amsterdam (Netherlands); Schram, J. [Energies Demain, Montreuil Sous Bois (France); Amerighi, O. [Italian National Agency for New Technologies, Energy and Sustainable Economic Development ENEA, Rome (Italy); Keppo, I. [University College London UCL, London (United Kingdom); Papagianni, S. [Centre for Renewable Energy Sources and Saving CRES, Pikermi Attiki (Greece); Ten Donkelaar, M. [ENVIROS, Prague (Czech Republic)
2013-03-15
The CO2MPARE model supports national and regional authorities in making balanced decisions for their investment portfolio under their regional development programmes, in particular under their Operational Programmes of EU Regional Policy. The EU's climate objectives require that investments across the EU are channeled towards low-carbon development. The carbon impacts of investments should therefore be seriously considered in the decision making process of regional development programmes. The CO2MPARE model informs national and regional authorities on the impacts that the investments under various Operational Programmes can have in terms of CO2 emissions. Knowing which investments lead either to additional emissions or rather to emission reductions, and what the overall impact of a programme is, represents the first step towards investment decisions that have decarbonisation co-benefits. CO2MPARE estimates the combined carbon impact of all activities that take place under a programme, and provides insights into the relative contributions of the different themes. Through its high aggregation level, it allows comparison of investment scenarios rather than individual projects. As such, it aims to support informed decisions on investment strategies rather than project investment decisions. In doing so, it also helps to build and develop a 'carbon culture' within the authorities directly or indirectly in charge of managing Regional Policy Operational Programmes. The model is primarily aimed at Operational Programmes co-financed by the European Regional Development Fund (ERDF)
Top partner discovery in the T→tZ channel at the LHC
International Nuclear Information System (INIS)
Reuter, Juergen; Tonini, Marco
2014-09-01
In this paper we study the discovery potential of the LHC run II for heavy vector-like top quarks in the decay channel to a top and a Z boson. Despite the usually smaller branching ratio compared to charged-current decays this channel is rather clean and allows a complete mass reconstruction of the heavy top. The latter is achieved in the fully hadronic top channel using boosted jet and jet substructure techniques. To be as model-independent as possible, a simplified model approach with only two free parameters has been applied. The results are presented in terms of parameter space regions for 3σ evidence or 5σ discovery for such new states in that channel.
Antireflective bilayer coatings based on Al2O3 film for UV region
Directory of Open Access Journals (Sweden)
Marszałek Konstanty
2015-03-01
Full Text Available Bilayer antireflective coatings consisting of aluminium oxide Al2O3/MgF2 and Al2O3/SiO2 are presented in this paper. Oxide films were deposited by means of e-gun evaporation in vacuum of 5 × 10-3 Pa in the presence of oxygen, and magnesium fluoride was prepared by thermal evaporation on heated optical lenses made from quartz glass (Corning HPFS. Substrate temperature was maintained at 250 _C during the deposition. Thickness and deposition rate were controlled with a thickness measuring system Inficon XTC/2. The experimental results of the optical measurements carried out during and after the deposition process have been presented. Physical thickness measurements were made during the deposition process and resulted in 44 nm/52 nm for Al2O3/MgF2 and 44 nm/50 nm for Al2O3/SiO2 system. Optimization was carried out for ultraviolet region with minimum of reflectance at 300 nm. The influence of post deposition annealing on the crystal structure was determined by X-ray measurements. In the range from ultraviolet to the beginning of visible region, the reflectance of both systems decreased and reached minimum at 290 nm. The value of reflectance at this point, for the coating Al2O3/MgF2 was equal to R290nm = 0.6 % and for Al2O3/SiO2R290nm = 1.1 %. Despite the difference between these values both are sufficient for applications in the UV optical systems for medicine and UV laser technology.
A brief history of the ''Delayed'' discovery of nuclear fission
International Nuclear Information System (INIS)
Holden, N.E.
1989-08-01
This year marks the Fiftieth Anniversary of the discovery of Nuclear Fission. In the early 1930's, the neutron was discovered, followed by the discovery of artificial radioactivity and then the use of the neutron to produce artificial radioactivity. The first experiments resulting in the fission of uranium took place in 1934. A paper which speculated on fission as an explanation was almost immediately published, yet no one took it seriously not even the author herself. Why did it take an additional five years before anyone realized what had occurred? This is an abnormally long time in a period when discoveries, particularly in nuclear physics, seemed to be almost a daily occurrence. The events which led up to the discovery are recounted, with an attempt made to put them into their historical perspective. The role played by Mendeleev's Periodic Table, the role of the natural radioactive decay chain of uranium, the discovery of protactinium, the apparent discovery of masurium (technetium) and a speculation on the reason why Irene Curie may have missed the discovery of nuclear fission will all be discussed. 43 refs
Mass spectrometry-driven drug discovery for development of herbal medicine.
Zhang, Aihua; Sun, Hui; Wang, Xijun
2018-05-01
Herbal medicine (HM) has made a major contribution to the drug discovery process with regard to identifying products compounds. Currently, more attention has been focused on drug discovery from natural compounds of HM. Despite the rapid advancement of modern analytical techniques, drug discovery is still a difficult and lengthy process. Fortunately, mass spectrometry (MS) can provide us with useful structural information for drug discovery, has been recognized as a sensitive, rapid, and high-throughput technology for advancing drug discovery from HM in the post-genomic era. It is essential to develop an efficient, high-quality, high-throughput screening method integrated with an MS platform for early screening of candidate drug molecules from natural products. We have developed a new chinmedomics strategy reliant on MS that is capable of capturing the candidate molecules, facilitating their identification of novel chemical structures in the early phase; chinmedomics-guided natural product discovery based on MS may provide an effective tool that addresses challenges in early screening of effective constituents of herbs against disease. This critical review covers the use of MS with related techniques and methodologies for natural product discovery, biomarker identification, and determination of mechanisms of action. It also highlights high-throughput chinmedomics screening methods suitable for lead compound discovery illustrated by recent successes. © 2016 Wiley Periodicals, Inc.
Zhang, Han-Zhong; Crogan-Grundy, Candace; May, Chris; Drewe, John; Tseng, Ben; Cai, Sui Xiong
2009-04-01
1-(2-(2,5-Dimethoxyphenylthio)benzylidene)semicarbazide (2a) was discovered as a potent apoptosis inducer through our cell based HTS assay. SAR study led to the discovery of a more aqueous soluble analog (2-(2,5-dimethoxyphenylthio)-6-methoxybenzylideneamino)guanidine (5e) with EC(50) value of 60 nM in the caspase activation assay and GI(50) value of 62 nM in the growth inhibition assay in T47D cells. Compound 5e was found to be an inhibitor of tubulin polymerization and efficacious in a MX-1 breast tumor model.
Chen, Mengmeng; Wu, Sanmang; Lei, Yalin; Li, Shantong
2018-03-08
Jing-Jin-Ji region (i.e., Beijing, Tianjin, and Hebei) is China's key development region, but it is also the leading and most serious air pollution region in China. High fossil fuel consumption is the major source of both carbon dioxide (CO 2 ) emissions and air pollutants. Therefore, it is important to reveal the source of CO 2 emissions to control the air pollution in the Jing-Jin-Ji region. In this study, an interregional input-output model was applied to quantitatively estimate the embodied CO 2 transfer between Jing-Jin-Ji region and other region in China using China's interregional input-output data in 2010. The results indicated that there was a significant difference in the production-based CO 2 emissions in China, and furthermore, the Jing-Jin-Ji region and its surrounding regions were the main regions of the production-based CO 2 emissions in China. Hebei Province exported a large amount of embodied CO 2 to meet the investment, consumption, and export demands of Beijing and Tianjin. The Jing-Jin-Ji regions exported a great deal of embodied CO 2 to the coastal provinces of southeast China and imported it from neighboring provinces.
Computational methods in drug discovery
Sumudu P. Leelananda; Steffen Lindert
2016-01-01
The process for drug discovery and development is challenging, time consuming and expensive. Computer-aided drug discovery (CADD) tools can act as a virtual shortcut, assisting in the expedition of this long process and potentially reducing the cost of research and development. Today CADD has become an effective and indispensable tool in therapeutic development. The human genome project has made available a substantial amount of sequence data that can be used in various drug discovery project...
DEFF Research Database (Denmark)
Larsen, Ann Møller; Venskutonyte, Raminta; Valadés, Elena Antón
2011-01-01
The kainic acid (KA) receptors belong to the class of glutamate (Glu) receptors in the brain and constitute a promising target for the treatment of neurological and/ or psychiatric diseases such as schizophrenia, major depression, and epilepsy. Five KA subtypes have been identified and named GluK1......-5. In this article, we present the discovery of (2S,3R)-3-(3-carboxyphenyl)-pyrrolidine-2-carboxylic acid (1) based on a rational design process. Target compound 1 was synthesized by a stereoselective strategy in 10 steps from commercially available starting materials. Binding affinities of 1 at native ionotropic...
Shaghafi, Michael B; Barrett, David G; Willard, Francis S; Overman, Larry E
2014-02-15
We report the discovery of the glucose-dependent insulin secretogogue activity of a novel class of polycyclic guanidines through phenotypic screening as part of the Lilly Open Innovation Drug Discovery platform. Three compounds from the University of California, Irvine, 1-3, having the 3-arylhexahydropyrrolo[1,2-c]pyrimidin-1-amine scaffold acted as insulin secretagogues under high, but not low, glucose conditions. Exploration of the structure-activity relationship around the scaffold demonstrated the key role of the guanidine moiety, as well as the importance of two lipophilic regions, and led to the identification of 9h, which stimulated insulin secretion in isolated rat pancreatic islets in a glucose-dependent manner. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Investigations into Library Web-Scale Discovery Services
Directory of Open Access Journals (Sweden)
Jason Vaughan
2008-03-01
Full Text Available Web-scale discovery services for libraries provide deep discovery to a library’s local and licensed content, and represent an evolution, perhaps a revolution, for end user information discovery as pertains to library collections. This article frames the topic of web-scale discovery, and begins by illuminating web-scale discovery from an academic library’s perspective – that is, the internal perspective seeking widespread staff participation in the discovery conversation. This included the creation of a discovery task force, a group which educated library staff, conducted internal staff surveys, and gathered observations from early adopters. The article next addresses the substantial research conducted with library vendors which have developed these services. Such work included drafting of multiple comprehensive question lists distributed to the vendors, onsite vendor visits, and continual tracking of service enhancements. Together, feedback gained from library staff, insights arrived at by the Discovery Task Force, and information gathered from vendors collectively informed the recommendation of a service for the UNLV Libraries.
29 CFR 18.13 - Discovery methods.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Discovery methods. 18.13 Section 18.13 Labor Office of the... ADMINISTRATIVE LAW JUDGES General § 18.13 Discovery methods. Parties may obtain discovery by one or more of the following methods: Depositions upon oral examination or written questions; written interrogatories...
Seasonal Variations of Atmospheric CO2 over Fire Affected Regions Based on GOSAT Observations
Shi, Y.; Matsunaga, T.
2016-12-01
Abstract: The carbon dioxide (CO2) emissions released from biomass burning significantly affect the temporal variations of atmospheric CO2 concentrations. Based on a long-term (July 2009-June 2015) retrieved datasets by the Greenhouse Gases Observing Satellite (GOSAT), the seasonal cycle and interannual variations of column-averaged volume mixing ratios of atmospheric carbon dioxide (XCO2) in four fire affected continental regions were investigated. The results showed Northern Africa had the largest seasonal variations after removing its regional long-term trend of XCO2 with peak-to-peak amplitude of 6.2 ppm within the year, higher than central South America (2.4 ppm), Southern Africa (3.8 ppm) and Australia (1.7 ppm). The detrended regional XCO2 was found to be positively correlated with the fire CO2 emissions during fire activity period and negatively correlated with vegetation photosynthesis activity with different seasonal variabilities. Northern Africa recorded the largest change of seasonal variations of detrended XCO2 with a total of 12.8 ppm during fire seasons, higher than central South America, Southern Africa and Australia with 5.4 ppm, 6.7 ppm and 2.2 ppm, respectively. During fire episode, the positive detrended XCO2 was noticed during June-November in central South America, December-June in Northern Africa, May-November in Southern Africa. The Pearson correlation coefficients between the variations of detrended XCO2 and fire CO2 emissions from GFED4 (Global Fire Emissions Database v4) achieved best correlations in Southern Africa (R=0.77, p<0.05). Meanwhile, Southern Africa also experienced a significant negative relationship between the variations of detrended XCO2 and vegetation activity (R=-0.84, p<0.05). This study revealed that fire CO2 emissions and vegetation activity contributed greatly to the seasonal variations of GOSAT XCO2 dataset.
Discovery and Evaluation of Polymorphisms in the and Promoter Regions for Risk of Korean Lung Cancer
Directory of Open Access Journals (Sweden)
Jae Sook Sung
2012-09-01
Full Text Available AKT is a signal transduction protein that plays a central role in the tumorigenesis. There are 3 mammalian isoforms of this serine/threonine protein kinase-AKT1, AKT2, and AKT3-showing a broad tissue distribution. We first discovered 2 novel polymorphisms (AKT2 -9826 C/G and AKT3 -811 A/G, and we confirmed 6 known polymorphisms (AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, AKT3 -675 A/-, and AKT3 -244 C/T of the AKT2 and AKT3 promoter region in 24 blood samples of Korean lung cancer patients using direct sequencing. To evaluate the role of AKT2 and AKT3 polymorphisms in the risk of Korean lung cancer, genotypes of the AKT2 and AKT3 polymorphisms (AKT2 -9826 C/G, AKT2 -9473 C/T, AKT2 -9151 C/T, AKT2 -9025 C/T, AKT2 -8618G/A, and AKT3 -675 A/- were determined in 360 lung cancer patients and 360 normal controls. Statistical analyses revealed that the genotypes and haplotypes in the AKT2 and AKT3 promoter regions were not significantly associated with the risk of lung cancer in the Korean population. These results suggest that polymorphisms of the AKT2 and AKT3 promoter regions do not contribute to the genetic susceptibility to lung cancer in the Korean population.
Context-sensitive service discovery experimental prototype and evaluation
DEFF Research Database (Denmark)
Balken, Robin; Haukrogh, Jesper; L. Jensen, Jens
2007-01-01
The amount of different networks and services available to users today are increasing. This introduces the need for a way to locate and sort out irrelevant services in the process of discovering available services to a user. This paper describes and evaluates a prototype of an automated discovery...... and selection system, which locates services relevant to a user, based on his/her context and the context of the available services. The prototype includes a multi-level, hierarchical system approach and the introduction of entities called User-nodes, Super-nodes and Root-nodes. These entities separate...... the network in domains that handle the complex distributed service discovery, which is based on dynamically changing context information. In the prototype, a method for performing context-sensitive service discovery has been realised. The service discovery part utilizes UPnP, which has been expanded in order...
Nuclear fission - the unexpected discovery seventy years ago
International Nuclear Information System (INIS)
Weis, Michael
2008-01-01
Seventy years ago, on December 17, 1938, Otto Hahn, Lise Meitner, and Fritz Strassmann discovered nuclear fission. It was a serendipitous discovery resulting from the consistent pursuit, for many years, of occasionally unexpected radiochemical experimental findings. Hardly any other scientific discovery has had such direct bearing on our life, changing our view of the world. It over-threw the tenet of physics, believed to be incontestable, that the atom was indivisible. The use of nuclear power it has made possible has given rise to immense benefits, but it has also allowed mankind's most dreadful weapon so far to be developed. All this is ample reason seventy years later to recall the discovery, the discoverers and their times. It will also be shown what later generations have made of this discovery, and what economic and ecological prospects it continues to hold. (orig.)
Discovery of the neutron (to the fiftieth anniversary of neutron discovery)
International Nuclear Information System (INIS)
Pasechnik, M.V.
1984-01-01
Development of neutron physics in the USSR for the recent 50 years from the moment of neutron discovery is considered. History of neutron discovery is presented in brief. Neutron properties and fundamental problems of physics: electric dipole neutron moment, neutron β-decay, neutron interaction with nuclei and potential of nucleon interaction not conserving spatial parity are discussed. Main aspects of neutron physics application in power engineering, nuclear technology and other branches of science and technique are set forth
Directory of Open Access Journals (Sweden)
Ira Vahlia
2017-06-01
Full Text Available Appropriate learning models contribute to student learning interest in math. The purpose of this study is to describe the difference in effectiveness between scientific approach based on group investigation and discovery in terms of student's interest in learning. The research that is conducted is quasi experimental research and the design used is 2 x factorial description. In experimental class I that apply scientific approach model based on study group investigation obtained the average value of learning outcome of 66.60 while in the experimental class II applying the approach Science-based discovery learning obtained the average value of posttest of 76.28. Based on the marginal rate, the scientific approach to discovery-based learning on moderate interest in learning outcomes is higher than the learning outcomes at high and low interest. In the scientific approach based on group study investigation and discovery learning there are differences in average learning outcomes between high, medium and low interest. Scientific approach based on group investigation learning on higher interest in learning outcomes is higher than moderate and low interest.
Pattern Discovery in Time-Ordered Data; TOPICAL
International Nuclear Information System (INIS)
CONRAD, GREGORY N.; BRITANIK, JOHN M.; DELAND, SHARON M.; JENKIN, CHRISTINA L.
2002-01-01
This report describes the results of a Laboratory-Directed Research and Development project on techniques for pattern discovery in discrete event time series data. In this project, we explored two different aspects of the pattern matching/discovery problem. The first aspect studied was the use of Dynamic Time Warping for pattern matching in continuous data. In essence, DTW is a technique for aligning time series along the time axis to optimize the similarity measure. The second aspect studied was techniques for discovering patterns in discrete event data. We developed a pattern discovery tool based on adaptations of the A-priori and GSP (Generalized Sequential Pattern mining) algorithms. We then used the tool on three different application areas-unattended monitoring system data from a storage magazine, computer network intrusion detection, and analysis of robot training data
de Mestre, Neville
2017-01-01
Earlier "Discovery" articles (de Mestre, 1999, 2003, 2006, 2010, 2011) considered patterns from many mathematical situations. This article presents a group of patterns used in 19th century mathematical textbooks. In the days of earlier warfare, cannon balls were stacked in various arrangements depending on the shape of the pile base…
75 FR 66766 - NIAID Blue Ribbon Panel Meeting on Adjuvant Discovery and Development
2010-10-29
..., identifies gaps in knowledge and capabilities, and defines NIAID's goals for the continued discovery...), will convene a Blue Ribbon Panel to provide expertise in developing a strategic plan and research... vaccines. NIAID has developed a draft Strategic Plan and Research Agenda for Adjuvant Discovery and...
Chemogenomic discovery of allosteric antagonists at the GPRC6A receptor
DEFF Research Database (Denmark)
Gloriam, David E.; Wellendorph, Petrine; Johansen, Lars Dan
2011-01-01
and pharmacological character: (1) chemogenomic lead identification through the first, to our knowledge, ligand inference between two different GPCR families, Families A and C; and (2) the discovery of the most selective GPRC6A allosteric antagonists discovered to date. The unprecedented inference of...... pharmacological activity across GPCR families provides proof-of-concept for in silico approaches against Family C targets based on Family A templates, greatly expanding the prospects of successful drug design and discovery. The antagonists were tested against a panel of seven Family A and C G protein-coupled receptors...
Directory of Open Access Journals (Sweden)
Duda Marlena
2012-11-01
Full Text Available Abstract Background Technological leaps in genome sequencing have resulted in a surge in discovery of human disease genes. These discoveries have led to increased clarity on the molecular pathology of disease and have also demonstrated considerable overlap in the genetic roots of human diseases. In light of this large genetic overlap, we tested whether cross-disease research approaches lead to faster, more impactful discoveries. Methods We leveraged several gene-disease association databases to calculate a Mutual Citation Score (MCS for 10,853 pairs of genetically related diseases to measure the frequency of cross-citation between research fields. To assess the importance of cooperative research, we computed an Individual Disease Cooperation Score (ICS and the average publication rate for each disease. Results For all disease pairs with one gene in common, we found that the degree of genetic overlap was a poor predictor of cooperation (r2=0.3198 and that the vast majority of disease pairs (89.56% never cited previous discoveries of the same gene in a different disease, irrespective of the level of genetic similarity between the diseases. A fraction (0.25% of the pairs demonstrated cross-citation in greater than 5% of their published genetic discoveries and 0.037% cross-referenced discoveries more than 10% of the time. We found strong positive correlations between ICS and publication rate (r2=0.7931, and an even stronger correlation between the publication rate and the number of cross-referenced diseases (r2=0.8585. These results suggested that cross-disease research may have the potential to yield novel discoveries at a faster pace than singular disease research. Conclusions Our findings suggest that the frequency of cross-disease study is low despite the high level of genetic similarity among many human diseases, and that collaborative methods may accelerate and increase the impact of new genetic discoveries. Until we have a better
2010-07-01
... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true Discovery. 60-30.33... 11246 Expedited Hearing Procedures § 60-30.33 Discovery. (a) Any party may serve requests for admissions... with § 60-30.8, the Administrative Law Judge may allow the taking of depositions. Other discovery will...
Price Discovery and Risk Management in the U.S. Distiller’s Grain Markets
Etienne, Xiaoli L.; Hoffman, Linwood A.
2015-01-01
In this paper, we evaluate the spatial nature of the price discovery process in regional distiller’s grain markets in the US and the price relationships among distiller’s grains, corn, and soybean meals since the beginning of the biofuel boom. We use multivariate and pairwise cointegration analyses to examine spatial integrations among regions and to investigate whether a stable long-term price relationship exists in the market. Error correction models are estimated to determine the speed of ...
Use of combinatorial chemistry to speed drug discovery.
Rádl, S
1998-10-01
IBC's International Conference on Integrating Combinatorial Chemistry into the Discovery Pipeline was held September 14-15, 1998. The program started with a pre-conference workshop on High-Throughput Compound Characterization and Purification. The agenda of the main conference was divided into sessions of Synthesis, Automation and Unique Chemistries; Integrating Combinatorial Chemistry, Medicinal Chemistry and Screening; Combinatorial Chemistry Applications for Drug Discovery; and Information and Data Management. This meeting was an excellent opportunity to see how big pharma, biotech and service companies are addressing the current bottlenecks in combinatorial chemistry to speed drug discovery. (c) 1998 Prous Science. All rights reserved.
Advancement into the Arctic Region for Bioactive Sponge Secondary Metabolites
Abbas, Samuel; Kelly, Michelle; Bowling, John; Sims, James; Waters, Amanda; Hamann, Mark
2011-01-01
Porifera have long been a reservoir for the discovery of bioactive compounds and drug discovery. Most research in the area has focused on sponges from tropical and temperate waters, but more recently the focus has shifted to the less accessible colder waters of the Antarctic and, to a lesser extent, the Arctic. The Antarctic region in particular has been a more popular location for natural products discovery and has provided promising candidates for drug development. This article reviews groups of bioactive compounds that have been isolated and reported from the southern reaches of the Arctic Circle, surveys the known sponge diversity present in the Arctic waters, and details a recent sponge collection by our group in the Aleutian Islands, Alaska. The collection has yielded previously undescribed sponge species along with primary activity against opportunistic infectious diseases, malaria, and HCV. The discovery of new sponge species and bioactive crude extracts gives optimism for the isolation of new bioactive compounds from a relatively unexplored source. PMID:22163194
DEFF Research Database (Denmark)
Milbo, Christina; Laustsen, Andreas Hougaard; Lohse, Brian
Feared for its highly neurotoxic venom and rapid attack technique, the Black mamba (Dendroaspis polylepis) is Africa’s largest venomous snake. The clinical manifestations of a bitefrom D. polylepis include flaccid paralysis leading to respiratory failure and death due to postsynaptic blockade of ......-neurotoxins. Here, we report the discovery of selective nanobodies targeting α-elapitoxin Dpp2c from D. polylepis through phage display screening....
Representation Discovery using Harmonic Analysis
Mahadevan, Sridhar
2008-01-01
Representations are at the heart of artificial intelligence (AI). This book is devoted to the problem of representation discovery: how can an intelligent system construct representations from its experience? Representation discovery re-parameterizes the state space - prior to the application of information retrieval, machine learning, or optimization techniques - facilitating later inference processes by constructing new task-specific bases adapted to the state space geometry. This book presents a general approach to representation discovery using the framework of harmonic analysis, in particu
Frieswijk, W. W. F.; Shipman, R. F.
Context. Most of what is known about clustered star formation to date comes from well studied star forming regions located relatively nearby, such as Rho-Ophiuchus, Serpens and Perseus. However, the recent discovery of infrared dark clouds may give new insights in our understanding of this dominant
A Metadata Schema for Geospatial Resource Discovery Use Cases
Directory of Open Access Journals (Sweden)
Darren Hardy
2014-07-01
Full Text Available We introduce a metadata schema that focuses on GIS discovery use cases for patrons in a research library setting. Text search, faceted refinement, and spatial search and relevancy are among GeoBlacklight's primary use cases for federated geospatial holdings. The schema supports a variety of GIS data types and enables contextual, collection-oriented discovery applications as well as traditional portal applications. One key limitation of GIS resource discovery is the general lack of normative metadata practices, which has led to a proliferation of metadata schemas and duplicate records. The ISO 19115/19139 and FGDC standards specify metadata formats, but are intricate, lengthy, and not focused on discovery. Moreover, they require sophisticated authoring environments and cataloging expertise. Geographic metadata standards target preservation and quality measure use cases, but they do not provide for simple inter-institutional sharing of metadata for discovery use cases. To this end, our schema reuses elements from Dublin Core and GeoRSS to leverage their normative semantics, community best practices, open-source software implementations, and extensive examples already deployed in discovery contexts such as web search and mapping. Finally, we discuss a Solr implementation of the schema using a "geo" extension to MODS.
Discovery learning with SAVI approach in geometry learning
Sahara, R.; Mardiyana; Saputro, D. R. S.
2018-05-01
Geometry is one branch of mathematics that an important role in learning mathematics in the schools. This research aims to find out about Discovery Learning with SAVI approach to achievement of learning geometry. This research was conducted at Junior High School in Surakarta city. Research data were obtained through test and questionnaire. Furthermore, the data was analyzed by using two-way Anova. The results showed that Discovery Learning with SAVI approach gives a positive influence on mathematics learning achievement. Discovery Learning with SAVI approach provides better mathematics learning outcomes than direct learning. In addition, students with high self-efficacy categories have better mathematics learning achievement than those with moderate and low self-efficacy categories, while student with moderate self-efficacy categories are better mathematics learning achievers than students with low self-efficacy categories. There is an interaction between Discovery Learning with SAVI approach and self-efficacy toward student's mathematics learning achievement. Therefore, Discovery Learning with SAVI approach can improve mathematics learning achievement.
Regional Ecosystem-Atmosphere CO2 Exchange Via Atmospheric Budgets
Energy Technology Data Exchange (ETDEWEB)
Davis, K J; Richardson, S J; Miles, N L
2007-03-07
Inversions of atmospheric CO2 mixing ratio measurements to determine CO2 sources and sinks are typically limited to coarse spatial and temporal resolution. This limits our ability to evaluate efforts to upscale chamber- and stand-level CO2 flux measurements to regional scales, where coherent climate and ecosystem mechanisms govern the carbon cycle. As a step towards the goal of implementing atmospheric budget or inversion methodology on a regional scale, a network of five relatively inexpensive CO2 mixing ratio measurement systems was deployed on towers in northern Wisconsin. Four systems were distributed on a circle of roughly 150-km radius, surrounding one centrally located system at the WLEF tower near Park Falls, WI. All measurements were taken at a height of 76 m AGL. The systems used single-cell infrared CO2 analyzers (Licor, model LI-820) rather than the siginificantly more costly two-cell models, and were calibrated every two hours using four samples known to within ± 0.2 ppm CO2. Tests prior to deployment in which the systems sampled the same air indicate the precision of the systems to be better than ± 0.3 ppm and the accuracy, based on the difference between the daily mean of one system and a co-located NOAA-ESRL system, is consistently better than ± 0.3 ppm. We demonstrate the utility of the network in two ways. We interpret regional CO2 differences using a Lagrangian parcel approach. The difference in the CO2 mixing ratios across the network is at least 2-3 ppm, which is large compared to the accuracy and precision of the systems. Fluxes estimated assuming Lagrangian parcel transport are of the same sign and magnitude as eddy-covariance flux measurements at the centrally-located WLEF tower. These results indicate that the network will be useful in a full inversion model. Second, we present a case study involving a frontal passage through the region. The progression of a front across the network is evident; changes as large as four ppm in one minute
Impact of a Discovery System on Interlibrary Loan
Musser, Linda R.; Coopey, Barbara M.
2016-01-01
Web-scale discovery services such as Summon (Serial Solutions), WorldCat Local (OCLC), EDS (EBSCO), and Primo (Ex Libris) are often touted as a single search solution to connect users to library-owned and -licensed content, improving discoverability and retrieval of resources. Assessing how well these systems achieve this goal can be challenging,…
Impact of the discovery of radioactivity on the evolution of technologies
International Nuclear Information System (INIS)
Kalyazin, E.P.
1996-01-01
Radioactivity discovery and practical application of nuclear power gave impetus to the development of radiation technologies primarily as a by-side trend of radiation materials technology. Paper studies the place occupied by radiation technologies within the system of the modern-day production processes starting from exploration, mining, enrichment and treatment of minerals and ending with production of materials, articles and special devices. Paper shows the promising character of radiation technologies to be used for the purposes linked with the environmental protection, with power and resource savings. 41 refs., 2 figs., 1 tab
Atlas of Astronomical Discoveries
Schilling, Govert
2011-01-01
Four hundred years ago in Middelburg, in the Netherlands, the telescope was invented. The invention unleashed a revolution in the exploration of the universe. Galileo Galilei discovered mountains on the Moon, spots on the Sun, and moons around Jupiter. Christiaan Huygens saw details on Mars and rings around Saturn. William Herschel discovered a new planet and mapped binary stars and nebulae. Other astronomers determined the distances to stars, unraveled the structure of the Milky Way, and discovered the expansion of the universe. And, as telescopes became bigger and more powerful, astronomers delved deeper into the mysteries of the cosmos. In his Atlas of Astronomical Discoveries, astronomy journalist Govert Schilling tells the story of 400 years of telescopic astronomy. He looks at the 100 most important discoveries since the invention of the telescope. In his direct and accessible style, the author takes his readers on an exciting journey encompassing the highlights of four centuries of astronomy. Spectacul...
Secondary Metabolites from Higher Fungi: Discovery, Bioactivity, and Bioproduction
Zhong, Jian-Jiang; Xiao, Jian-Hui
Medicinal higher fungi such as Cordyceps sinensis and Ganoderma lucidum have been used as an alternative medicine remedy to promote health and longevity for people in China and other regions of the world since ancient times. Nowadays there is an increasing public interest in the secondary metabolites of those higher fungi for discovering new drugs or lead compounds. Current research in drug discovery from medicinal higher fungi involves a multifaceted approach combining mycological, biochemical, pharmacological, metabolic, biosynthetic and molecular techniques. In recent years, many new secondary metabolites from higher fungi have been isolated and are more likely to provide lead compounds for new drug discovery, which may include chemopreventive agents possessing the bioactivity of immunomodulatory, anticancer, etc. However, numerous challenges of secondary metabolites from higher fungi are encountered including bioseparation, identification, biosynthetic metabolism, and screening model issues, etc. Commercial production of secondary metabolites from medicinal mushrooms is still limited mainly due to less information about secondary metabolism and its regulation. Strategies for enhancing secondary metabolite production by medicinal mushroom fermentation include two-stage cultivation combining liquid fermentation and static culture, two-stage dissolved oxygen control, etc. Purification of bioactive secondary metabolites, such as ganoderic acids from G. lucidum, is also very important to pharmacological study and future pharmaceutical application. This review outlines typical examples of the discovery, bioactivity, and bioproduction of secondary metabolites of higher fungi origin.
FERMI DISCOVERY OF GAMMA-RAY EMISSION FROM NGC 1275
International Nuclear Information System (INIS)
Abdo, A. A.; Ackermann, M.; Ajello, M.; Bechtol, K.; Blandford, R. D.; Bloom, E. D.; Borgland, A. W.; Asano, K.; Baldini, L.; Bellazzini, R.; Bregeon, J.; Brez, A.; Ballet, J.; Barbiellini, G.; Bastieri, D.; Baughman, B. M.; Bonamente, E.; Brigida, M.; Bruel, P.; Burnett, T. H.
2009-01-01
We report the discovery of high-energy (E > 100 MeV) γ-ray emission from NGC 1275, a giant elliptical galaxy lying at the center of the Perseus cluster of galaxies, based on observations made with the Large Area Telescope (LAT) of the Fermi Gamma-ray Space Telescope. The positional center of the γ-ray source is only ∼3' away from the NGC 1275 nucleus, well within the 95% LAT error circle of ∼5'. The spatial distribution of γ-ray photons is consistent with a point source. The average flux and power-law photon index measured with the LAT from 2008 August 4 to 2008 December 5 are F γ = (2.10 ± 0.23) x 10 -7 ph (>100 MeV) cm -2 s -1 and Γ = 2.17 ± 0.05, respectively. The measurements are statistically consistent with constant flux during the four-month LAT observing period. Previous EGRET observations gave an upper limit of F γ -8 ph (>100 MeV) cm -2 s -1 to the γ-ray flux from NGC 1275. This indicates that the source is variable on timescales of years to decades, and therefore restricts the fraction of emission that can be produced in extended regions of the galaxy cluster. Contemporaneous and historical radio observations are also reported. The broadband spectrum of NGC 1275 is modeled with a simple one-zone synchrotron/synchrotron self-Compton model and a model with a decelerating jet flow.
Fermi Discovery of Gamma-Ray Emission from NGC 1275
International Nuclear Information System (INIS)
Abdo, Aous A.; Ackermann, M.; Ajello, M.; Asano, K.; Baldini, L.; Ballet, J.; Barbiellini, Guido; Bastieri, Denis; Baughman, B.M.; Bechtol, K.; Bellazzini, R.; Blandford, R.D.; Bloom, Elliott D.; Bonamente, E.; Borgland, A.W.; Bregeon, J.; Brez, A.; Brigida, M.; Bruel, P.; Burnett, Thompson H.; Caliandro, G.A.
2009-01-01
We report the discovery of high-energy (E > 100 MeV) γ-ray emission from NGC 1275, a giant elliptical galaxy lying at the center of the Perseus cluster of galaxies, based on observations made with the Large Area Telescope (LAT) of the Fermi Gamma-ray Space Telescope. The positional center of the γ-ray source is only ∼3(prime) away from the NGC 1275 nucleus, well within the 95% LAT error circle of ∼5(prime). The spatial distribution of γ-ray photons is consistent with a point source. The average flux and power-law photon index measured with the LAT from 2008 August 4 to 2008 December 5 are F γ = (2.10 ± 0.23) x 10 -7 ph (>100 MeV) cm -2 s -1 and Γ = 2.17 ± 0.05, respectively. The measurements are statistically consistent with constant flux during the four-month LAT observing period. Previous EGRET observations gave an upper limit of F γ -8 ph (>100 MeV) cm -2 s -1 to the γ-ray flux from NGC 1275. This indicates that the source is variable on timescales of years to decades, and therefore restricts the fraction of emission that can be produced in extended regions of the galaxy cluster. Contemporaneous and historical radio observations are also reported. The broadband spectrum of NGC 1275 is modeled with a simple one-zone synchrotron/synchrotron self-Compton model and a model with a decelerating jet flow.
Wada, Carol K
2004-01-01
Matrix metalloproteinases (MMPs) have been implicated in several pathologies. At Abbott Laboratories, the matrix metalloproteinases inhibitor drug discovery program has focused on the discovery of a potent, selective, orally bioavailable MMP inhibitor for the treatment of cancer. The program evolved from early succinate-based inhibitors to utilizing in-house technology such as SAR by NMR to develop a novel class of biaryl hydroxamate MMP inhibitors. The metabolic instability of the biaryl hydroxamates led to the discovery of a new class of N-formylhydroxylamine (retrohydroxamate) biaryl ethers, exemplified by ABT-770 (16). Toxicity issues with this pre-clinical candidate led to the discovery of another novel class of retrohydroxamate MMP inhibitors, the phenoxyphenyl sulfones such as ABT-518 (19j). ABT-518 is a potent, orally bioavailable, selective inhibitor of MMP-2 and 9 over MMP-1 that has been evaluated in Phase I clinical trials in cancer patients.
2011-05-09
...-2011-0025] Study on Protection of Certain Railroad Risk Reduction Data From Discovery or Use in... Act of 2008 (RSIA), FRA is soliciting public comment on the issue of whether it is in the public... withhold from discovery or use in litigation in a Federal or State court proceeding for damages involving...
PERFORMANCE EVALUATION OF AN ALTERNATIVE CONTROLLER FOR BLUETOOTH SERVICE DISCOVERY
Directory of Open Access Journals (Sweden)
M. Sughasiny
2012-06-01
Full Text Available Bluetooth is a short range radio technology to form a small wireless system. It is used in low –cost, low power ad-hoc networks and it suffers from long service discovery delay and high power consumption. Bluetooth employs the 2.4 GHz ISM band, sharing the same bandwidth with the wireless LAN implementing the IEEE 802.11 standards. Thus it causes significantly lower interference. For improving the efficiency of SDP, we present an implementation of Bluetooth 2.1 in the NS-2 simulator, discuss the IEEE 802.11b as a Bluetooth controller and propose a new alternative Bluetooth Controller based on Adaptive Frequency Hopping techniques using Amplifier Power. The resulting approach significantly reduces the service discovery time, thereby lowering power consumption and increasing the throughput. We present the benefits of our new approach and compare it with existing approach using NS-2 Simulations and we have presented the comparison graphs in support of our approach.
Angola. Petroleum discovery by Elf on the block number 17 in deep water
International Nuclear Information System (INIS)
Anon.
1996-01-01
This article describes the petroleum discovery in deep water in Angola. The drilling was executed by 1365 meters deep and gave a petroleum of good quality. The Elf company emphasizes that it is its third discovery in deep water in the Guinea gulf after Nkossa and Moho in Congo. (N.C.)
Qin, Lingyun; Liu, Huili; Chen, Rong; Zhou, Jingjing; Cheng, Xiyao; Chen, Yao; Huang, Yongqi; Su, Zhengding
2017-11-07
The oncoprotein MdmX (mouse double minute X) is highly homologous to Mdm2 (mouse double minute 2) in terms of their amino acid sequences and three-dimensional conformations, but Mdm2 inhibitors exhibit very weak affinity for MdmX, providing an excellent model for exploring how protein conformation distinguishes and alters inhibitor binding. The intrinsic conformation flexibility of proteins plays pivotal roles in determining and predicting the binding properties and the design of inhibitors. Although the molecular dynamics simulation approach enables us to understand protein-ligand interactions, the mechanism underlying how a flexible binding pocket adapts an inhibitor has been less explored experimentally. In this work, we have investigated how the intrinsic flexible regions of the N-terminal domain of MdmX (N-MdmX) affect the affinity of the Mdm2 inhibitor nutlin-3a using protein engineering. Guided by heteronuclear nuclear Overhauser effect measurements, we identified the flexible regions that affect inhibitor binding affinity around the ligand-binding pocket on N-MdmX. A disulfide engineering mutant, N-MdmX C25-C110/C76-C88 , which incorporated two staples to rigidify the ligand-binding pocket, allowed an affinity for nutlin-3a higher than that of wild-type N-MdmX (K d ∼ 0.48 vs K d ∼ 20.3 μM). Therefore, this mutant provides not only an effective protein model for screening and designing of MdmX inhibitors but also a valuable clue for enhancing the intermolecular interactions of the pharmacophores of a ligand with pronounced flexible regions. In addition, our results revealed an allosteric ligand-binding mechanism of N-MdmX in which the ligand initially interacts with a compact core, followed by augmenting intermolecular interactions with intrinsic flexible regions. This strategy should also be applicable to many other protein targets to accelerate drug discovery.
Louie, Dana R.; Deming, Drake; Albert, Loic; Bouma, L. G.; Bean, Jacob; Lopez-Morales, Mercedes
2018-04-01
The Transiting Exoplanet Survey Satellite (TESS) will embark in 2018 on a 2 year wide-field survey mission, discovering over a thousand terrestrial, super-Earth and sub-Neptune-sized exoplanets ({R}pl}≤slant 4 {R}\\oplus ) potentially suitable for follow-up observations using the James Webb Space Telescope (JWST). This work aims to understand the suitability of anticipated TESS planet discoveries for atmospheric characterization by JWST’s Near InfraRed Imager and Slitless Spectrograph (NIRISS) by employing a simulation tool to estimate the signal-to-noise (S/N) achievable in transmission spectroscopy. We applied this tool to Monte Carlo predictions of the TESS expected planet yield and then compared the S/N for anticipated TESS discoveries to our estimates of S/N for 18 known exoplanets. We analyzed the sensitivity of our results to planetary composition, cloud cover, and presence of an observational noise floor. We find that several hundred anticipated TESS discoveries with radii 1.5 {R}\\oplus R}pl}≤slant 2.5 {R}\\oplus will produce S/N higher than currently known exoplanets in this radius regime, such as K2-3b or K2-3c. In the terrestrial planet regime, we find that only a few anticipated TESS discoveries will result in higher S/N than currently known exoplanets, such as the TRAPPIST-1 planets, GJ1132b, and LHS1140b. However, we emphasize that this outcome is based upon Kepler-derived occurrence rates, and that co-planar compact multi-planet systems (e.g., TRAPPIST-1) may be under-represented in the predicted TESS planet yield. Finally, we apply our calculations to estimate the required magnitude of a JWST follow-up program devoted to mapping the transition region between hydrogen-dominated and high molecular weight atmospheres. We find that a modest observing program of between 60 and 100 hr of charged JWST time can define the nature of that transition (e.g., step function versus a power law).
Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo
2011-02-10
Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open
BayesMotif: de novo protein sorting motif discovery from impure datasets.
Hu, Jianjun; Zhang, Fan
2010-01-18
Protein sorting is the process that newly synthesized proteins are transported to their target locations within or outside of the cell. This process is precisely regulated by protein sorting signals in different forms. A major category of sorting signals are amino acid sub-sequences usually located at the N-terminals or C-terminals of protein sequences. Genome-wide experimental identification of protein sorting signals is extremely time-consuming and costly. Effective computational algorithms for de novo discovery of protein sorting signals is needed to improve the understanding of protein sorting mechanisms. We formulated the protein sorting motif discovery problem as a classification problem and proposed a Bayesian classifier based algorithm (BayesMotif) for de novo identification of a common type of protein sorting motifs in which a highly conserved anchor is present along with a less conserved motif regions. A false positive removal procedure is developed to iteratively remove sequences that are unlikely to contain true motifs so that the algorithm can identify motifs from impure input sequences. Experiments on both implanted motif datasets and real-world datasets showed that the enhanced BayesMotif algorithm can identify anchored sorting motifs from pure or impure protein sequence dataset. It also shows that the false positive removal procedure can help to identify true motifs even when there is only 20% of the input sequences containing true motif instances. We proposed BayesMotif, a novel Bayesian classification based algorithm for de novo discovery of a special category of anchored protein sorting motifs from impure datasets. Compared to conventional motif discovery algorithms such as MEME, our algorithm can find less-conserved motifs with short highly conserved anchors. Our algorithm also has the advantage of easy incorporation of additional meta-sequence features such as hydrophobicity or charge of the motifs which may help to overcome the limitations of
Discovery of a tidal disruption event candidate from the 2XMM catalog
Directory of Open Access Journals (Sweden)
Farrell S.A.
2012-12-01
Full Text Available Stars approaching a supermassive black hole (SMBH can be tidally disrupted and subsequently accreted, providing a unique way to find and study inactive SMBHs. We report on our discovery of a new tidal disruption event candidate, 2XMMi J184725.1-631724, with unprecedented ultrasoft X-ray spectra near the flare peak. It lies toward the center of an inactive galaxy at z = 0.0353. It was detected serendipitously in two XMM-Newton observations separated by 211 days, with the flux increasing by a factor of ∼9. The source was not detected in X-rays by ROSAT in 1992, indicating a long-term variability factor of >64; neither by Swift in 2011, implying a flux decay factor of >12 since the last XMM-Newton observation. The XMM-Newton X-ray spectra are dominated by a strong cool thermal disk (>80%, tens of eV with the luminosity appearing to follow the L ∝ T4 relation, often seen in the thermal state of the BH X-ray binaries. Both XMM-Newton observations show large variability on timescales of hours. This can be explained as due to fast variations in the mass accretion rate, maybe caused by the shocks during the tidal disruption of the star.
Discoveries by the Fermi Gamma Ray Space Telescope
Gehrels, Neil
2011-01-01
Fermi is a large space gamma-ray mission developed by NASA and the DOE with major contributions from France, Germany, Italy, Japan and Sweden. It was launched in June 2008 and has been performing flawlessly since then. The main instrument is the Large Area Telescope (LAT) operating in the 20 MeV to 300 GeV range and a smaller monitor instrument is the Gamma-ray Burst Monitor (GBM) operating in the 8 keV to 40 MeV range. New findings are occurring every week. Some of the key discoveries are: 1) Discovery of many new gamma-ray pulsars, including gamma-ray only and millisecond pulsars. 2) Detection of high energy gamma-ray emission from globular clusters, most likely due to summed emission from msec pulsars. 3) Discovery of delayed and extended high energy gamma-ray emission from short and long gamma-ray busts. 4) Detection of approximately 250 gamma-ray bursts per year with the GBM instrument. 5) Most accurate measurement of the cosmic ray electron spectrum between 30 GeV and 1 TeV, showing some excess above the conventional diffusion model. The talk will present the new discoveries and their implications.
Impacts of Built-Up Area Expansion in 2D and 3D on Regional Surface Temperature
Directory of Open Access Journals (Sweden)
Hongyan Cai
2017-10-01
Full Text Available Many studies have reported the thermal effects of urban expansion from non-built-up land; however, how changes in building height in built-up land influence the regional thermal environment is still uncertain. Thus, taking the transitional region between the Chinese megacities of Beijing and Tianjin as the study area, this study investigated the impacts of built-up land expansion in 2D and 3D on regional land surface temperature (LST. The expansion in 2D refers to the conversion from non-built-up land to built-up land, whereas the expansion in 3D characterized the building height change in the built-up land, referring to the conversion from low- and moderate-rise building (LMRB to high-rise building (HRB lands. The land use change from 2010 to 2015 was manually interpreted from high spatial resolution SPOT5 and Gaofen2 images, and the LST information in the corresponding period was derived from Landsat5/8 thermal images using an image-based method. The results showed that between 2010 and 2015, approximately 87.25 km2 non-built-up land was transformed to built-up land, and 13.21 km2 LMRB land was built into HRB land. These two types of built-up land expansions have induced opposing thermal effects in regard to regional surface temperature. The built-up land expansions from cropland and urban green land have raised the regional LST. However, the built-up land expansion from LMRB to HRB lands has induced a cooling effect. Thus, this study suggested that for the cooling urban design, the building height should also be considered. Furthermore, for future studies on thermal impacts of urbanization, it should be cautioned that, besides the urban area expansion, the building height change should also be emphasized due to its potential cooling effects.
International conference on the role of the polar regions in global change: Proceedings. Volume 2
Energy Technology Data Exchange (ETDEWEB)
Weller, G.; Wilson, C.L.; Severin, B.A.B. [eds.
1991-12-01
The International Conference on the Role of the Polar Regions in Global Change took place on the campus of the University of Alaska Fairbanks on June 11--15, 1990. The goal of the conference was to define and summarize the state of knowledge on the role of the polar regions in global change, and to identify gaps in knowledge. To this purpose experts in a wide variety of relevant disciplines were invited to present papers and hold panel discussions. While there are numerous conferences on global change, this conference dealt specifically with the polar regions which occupy key positions in the global system. These two volumes of conference proceedings include papers on (1) detection and monitoring of change; (2) climate variability and climate forcing; (3) ocean, sea ice, and atmosphere interactions and processes; and (4) effects on biota and biological feedbacks; (5) ice sheet, glacier and permafrost responses and feedbacks, (6) paleoenvironmental studies; and, (7) aerosol and trace gases.
Introduction to fragment-based drug discovery.
Erlanson, Daniel A
2012-01-01
Fragment-based drug discovery (FBDD) has emerged in the past decade as a powerful tool for discovering drug leads. The approach first identifies starting points: very small molecules (fragments) that are about half the size of typical drugs. These fragments are then expanded or linked together to generate drug leads. Although the origins of the technique date back some 30 years, it was only in the mid-1990s that experimental techniques became sufficiently sensitive and rapid for the concept to be become practical. Since that time, the field has exploded: FBDD has played a role in discovery of at least 18 drugs that have entered the clinic, and practitioners of FBDD can be found throughout the world in both academia and industry. Literally dozens of reviews have been published on various aspects of FBDD or on the field as a whole, as have three books (Jahnke and Erlanson, Fragment-based approaches in drug discovery, 2006; Zartler and Shapiro, Fragment-based drug discovery: a practical approach, 2008; Kuo, Fragment based drug design: tools, practical approaches, and examples, 2011). However, this chapter will assume that the reader is approaching the field with little prior knowledge. It will introduce some of the key concepts, set the stage for the chapters to follow, and demonstrate how X-ray crystallography plays a central role in fragment identification and advancement.
Discovery of massive neutral vector mesons
International Nuclear Information System (INIS)
Anon.
1976-01-01
Personal accounts of the discovery of massive neutral vector mesons (psi particles) are given by researchers S. Ting, G. Goldhaber, and B. Richter. The double-arm spectrometer and the Cherenkov effect are explained in a technical note, and the solenoidal magnetic detector is discussed in an explanatory note for nonspecialists. Reprints of three papers in Physical Review Letters which announced the discovery of the particles are given: Experimental observation of a heavy particle J, Discovery of a narrow resonance in e + e - annihilation, and Discovery of a second narrow resonance in e + e - annihilation. A discussion of subsequent developments and scientific biographies of the three authors are also presented. 25 figures
Functional principles of registry-based service discovery
Sundramoorthy, V.; Tan, C.; Hartel, P.H.; Hartog, den J.I.; Scholten, J.
2005-01-01
As Service Discovery Protocols (SDP) are becoming increasingly important for ubiquitous computing, they must behave according to predefined principles. We present the functional Principles of Service Discovery for robust, registry-based service discovery. A methodology to guarantee adherence to
Materials Discovery | Materials Science | NREL
Discovery Materials Discovery Images of red and yellow particles NREL's research in materials characterization of sample by incoming beam and measuring outgoing particles, with data being stored and analyzed Staff Scientist Dr. Zakutayev specializes in design of novel semiconductor materials for energy
The impact of genetics on future drug discovery in schizophrenia.
Matsumoto, Mitsuyuki; Walton, Noah M; Yamada, Hiroshi; Kondo, Yuji; Marek, Gerard J; Tajinda, Katsunori
2017-07-01
Failures of investigational new drugs (INDs) for schizophrenia have left huge unmet medical needs for patients. Given the recent lackluster results, it is imperative that new drug discovery approaches (and resultant drug candidates) target pathophysiological alterations that are shared in specific, stratified patient populations that are selected based on pre-identified biological signatures. One path to implementing this paradigm is achievable by leveraging recent advances in genetic information and technologies. Genome-wide exome sequencing and meta-analysis of single nucleotide polymorphism (SNP)-based association studies have already revealed rare deleterious variants and SNPs in patient populations. Areas covered: Herein, the authors review the impact that genetics have on the future of schizophrenia drug discovery. The high polygenicity of schizophrenia strongly indicates that this disease is biologically heterogeneous so the identification of unique subgroups (by patient stratification) is becoming increasingly necessary for future investigational new drugs. Expert opinion: The authors propose a pathophysiology-based stratification of genetically-defined subgroups that share deficits in particular biological pathways. Existing tools, including lower-cost genomic sequencing and advanced gene-editing technology render this strategy ever more feasible. Genetically complex psychiatric disorders such as schizophrenia may also benefit from synergistic research with simpler monogenic disorders that share perturbations in similar biological pathways.
Exploring relation types for literature-based discovery.
Preiss, Judita; Stevenson, Mark; Gaizauskas, Robert
2015-09-01
Literature-based discovery (LBD) aims to identify "hidden knowledge" in the medical literature by: (1) analyzing documents to identify pairs of explicitly related concepts (terms), then (2) hypothesizing novel relations between pairs of unrelated concepts that are implicitly related via a shared concept to which both are explicitly related. Many LBD approaches use simple techniques to identify semantically weak relations between concepts, for example, document co-occurrence. These generate huge numbers of hypotheses, difficult for humans to assess. More complex techniques rely on linguistic analysis, for example, shallow parsing, to identify semantically stronger relations. Such approaches generate fewer hypotheses, but may miss hidden knowledge. The authors investigate this trade-off in detail, comparing techniques for identifying related concepts to discover which are most suitable for LBD. A generic LBD system that can utilize a range of relation types was developed. Experiments were carried out comparing a number of techniques for identifying relations. Two approaches were used for evaluation: replication of existing discoveries and the "time slicing" approach.(1) RESULTS: Previous LBD discoveries could be replicated using relations based either on document co-occurrence or linguistic analysis. Using relations based on linguistic analysis generated many fewer hypotheses, but a significantly greater proportion of them were candidates for hidden knowledge. The use of linguistic analysis-based relations improves accuracy of LBD without overly damaging coverage. LBD systems often generate huge numbers of hypotheses, which are infeasible to manually review. Improving their accuracy has the potential to make these systems significantly more usable. © The Author 2015. Published by Oxford University Press on behalf of the American Medical Informatics Association.
Rough – Granular Computing knowledge discovery models
Directory of Open Access Journals (Sweden)
Mohammed M. Eissa
2016-11-01
Full Text Available Medical domain has become one of the most important areas of research in order to richness huge amounts of medical information about the symptoms of diseases and how to distinguish between them to diagnose it correctly. Knowledge discovery models play vital role in refinement and mining of medical indicators to help medical experts to settle treatment decisions. This paper introduces four hybrid Rough – Granular Computing knowledge discovery models based on Rough Sets Theory, Artificial Neural Networks, Genetic Algorithm and Rough Mereology Theory. A comparative analysis of various knowledge discovery models that use different knowledge discovery techniques for data pre-processing, reduction, and data mining supports medical experts to extract the main medical indicators, to reduce the misdiagnosis rates and to improve decision-making for medical diagnosis and treatment. The proposed models utilized two medical datasets: Coronary Heart Disease dataset and Hepatitis C Virus dataset. The main purpose of this paper was to explore and evaluate the proposed models based on Granular Computing methodology for knowledge extraction according to different evaluation criteria for classification of medical datasets. Another purpose is to make enhancement in the frame of KDD processes for supervised learning using Granular Computing methodology.
SNP discovery in the bovine milk transcriptome using RNA-Seq technology.
Cánovas, Angela; Rincon, Gonzalo; Islas-Trejo, Alma; Wickramasinghe, Saumya; Medrano, Juan F
2010-12-01
High-throughput sequencing of RNA (RNA-Seq) was developed primarily to analyze global gene expression in different tissues. However, it also is an efficient way to discover coding SNPs. The objective of this study was to perform a SNP discovery analysis in the milk transcriptome using RNA-Seq. Seven milk samples from Holstein cows were analyzed by sequencing cDNAs using the Illumina Genome Analyzer system. We detected 19,175 genes expressed in milk samples corresponding to approximately 70% of the total number of genes analyzed. The SNP detection analysis revealed 100,734 SNPs in Holstein samples, and a large number of those corresponded to differences between the Holstein breed and the Hereford bovine genome assembly Btau4.0. The number of polymorphic SNPs within Holstein cows was 33,045. The accuracy of RNA-Seq SNP discovery was tested by comparing SNPs detected in a set of 42 candidate genes expressed in milk that had been resequenced earlier using Sanger sequencing technology. Seventy of 86 SNPs were detected using both RNA-Seq and Sanger sequencing technologies. The KASPar Genotyping System was used to validate unique SNPs found by RNA-Seq but not observed by Sanger technology. Our results confirm that analyzing the transcriptome using RNA-Seq technology is an efficient and cost-effective method to identify SNPs in transcribed regions. This study creates guidelines to maximize the accuracy of SNP discovery and prevention of false-positive SNP detection, and provides more than 33,000 SNPs located in coding regions of genes expressed during lactation that can be used to develop genotyping platforms to perform marker-trait association studies in Holstein cattle.
Scientific Prediction and Prophetic Patenting in Drug Discovery.
Curry, Stephen H; Schneiderman, Anne M
2015-01-01
Pharmaceutical patenting involves writing claims based on both discoveries already made, and on prophesy of future developments in an ongoing project. This is necessitated by the very different timelines involved in the drug discovery and product development process on the one hand, and successful patenting on the other. If patents are sought too early there is a risk that patent examiners will disallow claims because of lack of enablement. If patenting is delayed, claims are at risk of being denied on the basis of existence of prior art, because the body of relevant known science will have developed significantly while the project was being pursued. This review examines the role of prophetic patenting in relation to the essential predictability of many aspects of drug discovery science, promoting the concepts of discipline-related and project-related prediction. This is especially directed towards patenting activities supporting commercialization of academia-based discoveries, where long project timelines occur, and where experience, and resources to pay for patenting, are limited. The need for improved collaborative understanding among project scientists, technology transfer professionals in, for example, universities, patent attorneys, and patent examiners is emphasized.
Advances in Chance Discovery : Extended Selection from International Workshops
Abe, Akinori
2013-01-01
Since year 2000, scientists on artificial and natural intelligences started to study chance discovery - methods for discovering events/situations that significantly affect decision making. Partially because the editors Ohsawa and Abe are teaching at schools of Engineering and of Literature with sharing the interest in chance discovery, this book reflects interdisciplinary aspects of progress: First, as an interdisciplinary melting pot of cognitive science, computational intelligence, data mining/visualization, collective intelligence, … etc, chance discovery came to reach new application domains e.g. health care, aircraft control, energy plant, management of technologies, product designs, innovations, marketing, finance etc. Second, basic technologies and sciences including sensor technologies, medical sciences, communication technologies etc. joined this field and interacted with cognitive/computational scientists in workshops on chance discovery, to obtain breakthroughs by stimulating each other. Third, �...
Data on foreign regions where uranium resources are developed, 2 and 3
International Nuclear Information System (INIS)
1982-07-01
This book was published in July, 1976, before, and the revised edition was published at the beginning of 1982 as Part 1, Asia and Africa. This is Part 2, in which the regions of North America, Central and South America are reported, and Part 3 concerning Australian regions. The state of resource exploration and development, the policy of uranium mining, Japanese policy to advance in, the geological features and deposits, and the promising regions in Canada, USA, various countries in Central America and South America and Australia are described. Canada is one of the promising regions in the world regarding uranium deposits, and the exploration activity is brisk. In USA, the joint exploration with US persons having the mining right is the main method, and the companies must be established to develop mines. In Australia, P.N.C. Exploration P/L continues the exploration. (Kako, I.)
Exciting Discoveries on the Health Effects of Family Violence: Where We Are, Where We Need to Go
Kendall-Tackett, Kathleen
2005-01-01
In the 20 years since the founding of the "Journal of Interpersonal Violence," there have been exciting new discoveries on the long-term physical health effects of family violence. As exciting as these discoveries have been, we still know little about why the experience of family violence makes people sick. Some of the most promising areas of…
International Nuclear Information System (INIS)
Newbold, B.T.
1996-01-01
The year 1996 marks the 100th anniversary of the discovery of natural radioactivity by the French physicist Antoine Henri Becquerel while studying the behaviour of a fluorescent uranium salt on exposure to sunlight. The great importance of this development has been underlined by Bagnall who stated that 'The scientific scene at the dawn of the 20th century was dominated by the excitement generated from Becquerel's discovery ... ' [1]. However, the discovery of radioactivity did not attract much attention initially when compared with that accorded to the more penetrating X rays found by the German physicist Wilhelm Konrad Roentgen in 1895. Roentgen received the 1901 Nobel Prize for physics for his outstanding discovery. Fortunately, the significance of Becquerel's contribution was quickly realized and in 1903 he was also awarded the Nobel Prize for physics, which he shared with Pierre Curie and Marie Skoldowska Curie, who were honoured for their research on the radiation phenomenon reported by Becquerel. 9 refs., 1 tab
Energy Technology Data Exchange (ETDEWEB)
Newbold, B T [Moncton Univ., NB (Canada). Dept. of Chemistry and Biochemistry
1996-09-01
The year 1996 marks the 100th anniversary of the discovery of natural radioactivity by the French physicist Antoine Henri Becquerel while studying the behaviour of a fluorescent uranium salt on exposure to sunlight. The great importance of this development has been underlined by Bagnall who stated that `The scientific scene at the dawn of the 20th century was dominated by the excitement generated from Becquerel`s discovery ... ` [1]. However, the discovery of radioactivity did not attract much attention initially when compared with that accorded to the more penetrating X rays found by the German physicist Wilhelm Konrad Roentgen in 1895. Roentgen received the 1901 Nobel Prize for physics for his outstanding discovery. Fortunately, the significance of Becquerel`s contribution was quickly realized and in 1903 he was also awarded the Nobel Prize for physics, which he shared with Pierre Curie and Marie Skoldowska Curie, who were honoured for their research on the radiation phenomenon reported by Becquerel. 9 refs., 1 tab.
A brief history of Alzheimer's disease gene discovery.
Tanzi, Rudolph E
2013-01-01
The rich and colorful history of gene discovery in Alzheimer's disease (AD) over the past three decades is as complex and heterogeneous as the disease, itself. Twin and family studies indicate that genetic factors are estimated to play a role in at least 80% of AD cases. The inheritance of AD exhibits a dichotomous pattern. On one hand, rare mutations inAPP, PSEN1, and PSEN2 are fully penetrant for early-onset (95%) late-onset AD. These four genes account for 30-50% of the inheritability of AD. Genome-wide association studies have recently led to the identification of additional highly confirmed AD candidate genes. Here, I review the past, present, and future of attempts to elucidate the complex and heterogeneous genetic underpinnings of AD along with some of the unique events that made these discoveries possible.
Queen's discovery lauded by top scientific journal
McGrady, S
2002-01-01
A scientific breakthrough at Queen's University's Sudbury Neutrino Observatory has received major international recognition. The journal Science ranked the discovery that cracked the "neutrino problem" second, in the journal's top 10 scientific achievements of 2002 (1/2 page).
DEFF Research Database (Denmark)
Liang, Hanwei; Dong, Liang; Luo, Xiao
2016-01-01
Efficient industrial emissions mitigation strategy is critical for China's national action on climate change and sustainable development, considering its rapid industrialization. Regional disparity brings difficulties and uncertainties to policy implementation in China. Therefore, an investigation...... development, and highlight not only disparity, but also inequity exists. It is concluded that, there is a larger unequal distribution of GDP per unit of air pollutants and CO2 emission between eastern and western regions, reveals that less developed western and central regions suffer from the emission leakage...... on the regional features of industrial emissions is critical to better decision makings. While to date, related studies have been rather few. This paper applies a spatial analysis on regional features of China's industrial emissions (SO2, NOx and PM2.5 and CO2 emission) in 31 provinces. Spatial autocorrelation...
History, Discovery, and Classification of lncRNAs.
Jarroux, Julien; Morillon, Antonin; Pinskaya, Marina
2017-01-01
The RNA World Hypothesis suggests that prebiotic life revolved around RNA instead of DNA and proteins. Although modern cells have changed significantly in 4 billion years, RNA has maintained its central role in cell biology. Since the discovery of DNA at the end of the nineteenth century, RNA has been extensively studied. Many discoveries such as housekeeping RNAs (rRNA, tRNA, etc.) supported the messenger RNA model that is the pillar of the central dogma of molecular biology, which was first devised in the late 1950s. Thirty years later, the first regulatory non-coding RNAs (ncRNAs) were initially identified in bacteria and then in most eukaryotic organisms. A few long ncRNAs (lncRNAs) such as H19 and Xist were characterized in the pre-genomic era but remained exceptions until the early 2000s. Indeed, when the sequence of the human genome was published in 2001, studies showed that only about 1.2% encodes proteins, the rest being deemed "non-coding." It was later shown that the genome is pervasively transcribed into many ncRNAs, but their functionality remained controversial. Since then, regulatory lncRNAs have been characterized in many species and were shown to be involved in processes such as development and pathologies, revealing a new layer of regulation in eukaryotic cells. This newly found focus on lncRNAs, together with the advent of high-throughput sequencing, was accompanied by the rapid discovery of many novel transcripts which were further characterized and classified according to specific transcript traits.In this review, we will discuss the many discoveries that led to the study of lncRNAs, from Friedrich Miescher's "nuclein" in 1869 to the elucidation of the human genome and transcriptome in the early 2000s. We will then focus on the biological relevance during lncRNA evolution and describe their basic features as genes and transcripts. Finally, we will present a non-exhaustive catalogue of lncRNA classes, thus illustrating the vast complexity of
Riandari, F.; Susanti, R.; Suratmi
2018-05-01
This study aimed to find out the information in concerning the influence of discovery learning model application to the higher order thinking skills at the tenth grade students of Srijaya Negara senior high school Palembang on the animal kingdom subject matter. The research method used was pre-experimental with one-group pretest-posttest design. The researchconducted at Srijaya Negara senior high school Palembang academic year 2016/2017. The population sample of this research was tenth grade students of natural science 2. Purposive sampling techniquewas applied in this research. Data was collected by(1) the written test, consist of pretest to determine the initial ability and posttest to determine higher order thinking skills of students after learning by using discovery learning models. (2) Questionnaire sheet, aimed to investigate the response of the students during the learning process by using discovery learning models. The t-test result indicated there was significant increasement of higher order thinking skills students. Thus, it can be concluded that the application of discovery learning modelhad a significant effect and increased to higher order thinking skills students of Srijaya Negara senior high school Palembang on the animal kingdom subject matter.
40 CFR 22.52 - Information exchange and discovery.
2010-07-01
... Procedure Act § 22.52 Information exchange and discovery. Respondent's information exchange pursuant to § 22.19(a) shall include information on any economic benefit resulting from any activity or failure to act... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Information exchange and discovery. 22...
Service discovery using Bloom filters
Goering, P.T.H.; Heijenk, Geert; Lelieveldt, B.P.F.; Haverkort, Boudewijn R.H.M.; de Laat, C.T.A.M.; Heijnsdijk, J.W.J.
A protocol to perform service discovery in adhoc networks is introduced in this paper. Attenuated Bloom filters are used to distribute services to nodes in the neighborhood and thus enable local service discovery. The protocol has been implemented in a discrete event simulator to investigate the
Discovery of the earliest-known tetrapod stapes.
Clack, J A
1989-11-23
The evolution of the middle ear is central to the discussion of how the first tetrapods adapted to life on land as well as their phylogeny. Here I report the discovery of the stapes of Acanthostega gunnari, from the Upper Devonian of east Greenland. This is the earliest tetrapod stapes so far described, and it throws new light on both these aspects of early tetrapod biology. It has been assumed that the common inheritance of all early tetrapods was a light, rod-like stapes associated with a temporal notch in the otic region that was thought to have supported a tympanum, or eardrum. The stapes would have conducted vibrations from the tympanum to the otic capsule. By contrast, the stapes of Acanthostega was stout with a broad distal ramus associated with the temporal notch. I suggest that the temporal notch of Acanthostega and other early tetrapods supported a spiracular opening rather than a tympanum, and that the stapes controlled palatal and spiracular movements in ventilation.
Southwest Regional Partnership on Carbon Sequestration
Energy Technology Data Exchange (ETDEWEB)
Brian McPherson
2006-03-31
The Southwest Partnership on Carbon Sequestration completed its Phase I program in December 2005. The main objective of the Southwest Partnership Phase I project was to evaluate and demonstrate the means for achieving an 18% reduction in carbon intensity by 2012. Many other goals were accomplished on the way to this objective, including (1) analysis of CO{sub 2} storage options in the region, including characterization of storage capacities and transportation options, (2) analysis and summary of CO{sub 2} sources, (3) analysis and summary of CO{sub 2} separation and capture technologies employed in the region, (4) evaluation and ranking of the most appropriate sequestration technologies for capture and storage of CO{sub 2} in the Southwest Region, (5) dissemination of existing regulatory/permitting requirements, and (6) assessing and initiating public knowledge and acceptance of possible sequestration approaches. Results of the Southwest Partnership's Phase I evaluation suggested that the most convenient and practical ''first opportunities'' for sequestration would lie along existing CO{sub 2} pipelines in the region. Action plans for six Phase II validation tests in the region were developed, with a portfolio that includes four geologic pilot tests distributed among Utah, New Mexico, and Texas. The Partnership will also conduct a regional terrestrial sequestration pilot program focusing on improved terrestrial MMV methods and reporting approaches specific for the Southwest region. The sixth and final validation test consists of a local-scale terrestrial pilot involving restoration of riparian lands for sequestration purposes. The validation test will use desalinated waters produced from one of the geologic pilot tests. The Southwest Regional Partnership comprises a large, diverse group of expert organizations and individuals specializing in carbon sequestration science and engineering, as well as public policy and outreach. These partners
Energy Technology Data Exchange (ETDEWEB)
Pizzolato, G; Soncrant, T T; Larson, D M; Rapoport, S I
1987-08-01
Local cerebral glucose utilization (LCGU) was measured, using the quantitative autoradiographic (/sup 14/C)2-deoxy-D-glucose method, in 56 brain regions of 3-month-old, awake Fischer-344 rats, after intraperitoneal administration of sulpiride (SULP) 100 mg/kg. SULP, an atypical neuroleptic, is a selective antagonist of D2 dopamine receptors. LCGU was reduced in a few nondopaminergic regions at 1 h after drug administration. Thereafter, SULP progressively elevated LCGU in many other regions. At 3 h, LCGU was elevated in 23% of the regions examined, most of which are related to the CNS dopaminergic system (caudate-putamen, nucleus accumbens, olfactory tubercle, lateral habenula, median eminence, paraventricular hypothalamic nucleus). Increases of LCGU were observed also in the suprachiasmatic nucleus, lateral geniculate, and inferior olive. These effects of SULP on LCGU differ from the effects of the typical neuroleptic haloperidol, which produces widespread decreases in LCGU in the rat brain. Selective actions on different subpopulations of dopamine receptors may explain the different effects of the two neuroleptics on brain metabolism, which correspond to their different clinical and behavioral actions.
Congestion based mechanism for route discovery in a V2I-V2V system applying smart devices and IoT.
Parrado, Natalia; Donoso, Yezid
2015-03-31
The Internet of Things is a new paradigm in which objects in a specific context can be integrated into traditional communication networks to actively participate in solving a determined problem. The Vehicle-to-Vehicle (V2V) and Vehicle-to-Infrastructure (V2I) technologies are specific cases of IoT and key enablers for Intelligent Transportation Systems (ITS). V2V and V2I have been widely used to solve different problems associated with transportation in cities, in which the most important is traffic congestion. A high percentage of congestion is usually presented by the inappropriate use of resources in vehicular infrastructure. In addition, the integration of traffic congestion in decision making for vehicular traffic is a challenge due to its high dynamic behavior. In this paper, an optimization model over the load balancing in the congestion percentage of the streets is formulated. Later, we explore a fully congestion-oriented route discovery mechanism and we make a proposal on the communication infrastructure that should support it based on V2I and V2V communication. The mechanism is also compared with a modified Dijkstra's approach that reacts at congestion states. Finally, we compare the results of the efficiency of the vehicle's trip with the efficiency in the use of the capacity of the vehicular network.
Congestion Based Mechanism for Route Discovery in a V2I-V2V System Applying Smart Devices and IoT
Directory of Open Access Journals (Sweden)
Natalia Parrado
2015-03-01
Full Text Available The Internet of Things is a new paradigm in which objects in a specific context can be integrated into traditional communication networks to actively participate in solving a determined problem. The Vehicle-to-Vehicle (V2V and Vehicle-to-Infrastructure (V2I technologies are specific cases of IoT and key enablers for Intelligent Transportation Systems (ITS. V2V and V2I have been widely used to solve different problems associated with transportation in cities, in which the most important is traffic congestion. A high percentage of congestion is usually presented by the inappropriate use of resources in vehicular infrastructure. In addition, the integration of traffic congestion in decision making for vehicular traffic is a challenge due to its high dynamic behavior. In this paper, an optimization model over the load balancing in the congestion percentage of the streets is formulated. Later, we explore a fully congestion-oriented route discovery mechanism and we make a proposal on the communication infrastructure that should support it based on V2I and V2V communication. The mechanism is also compared with a modified Dijkstra’s approach that reacts at congestion states. Finally, we compare the results of the efficiency of the vehicle’s trip with the efficiency in the use of the capacity of the vehicular network.
A Sensitive Assay for Virus Discovery in Respiratory Clinical Samples
de Vries, Michel; Deijs, Martin; Canuti, Marta; van Schaik, Barbera D. C.; Faria, Nuno R.; van de Garde, Martijn D. B.; Jachimowski, Loes C. M.; Jebbink, Maarten F.; Jakobs, Marja; Luyf, Angela C. M.; Coenjaerts, Frank E. J.; Claas, Eric C. J.; Molenkamp, Richard; Koekkoek, Sylvie M.; Lammens, Christine; Leus, Frank; Goossens, Herman; Ieven, Margareta; Baas, Frank; van der Hoek, Lia
2011-01-01
In 5–40% of respiratory infections in children, the diagnostics remain negative, suggesting that the patients might be infected with a yet unknown pathogen. Virus discovery cDNA-AFLP (VIDISCA) is a virus discovery method based on recognition of restriction enzyme cleavage sites, ligation of adaptors and subsequent amplification by PCR. However, direct discovery of unknown pathogens in nasopharyngeal swabs is difficult due to the high concentration of ribosomal RNA (rRNA) that acts as competitor. In the current study we optimized VIDISCA by adjusting the reverse transcription enzymes and decreasing rRNA amplification in the reverse transcription, using hexamer oligonucleotides that do not anneal to rRNA. Residual cDNA synthesis on rRNA templates was further reduced with oligonucleotides that anneal to rRNA but can not be extended due to 3′-dideoxy-C6-modification. With these modifications >90% reduction of rRNA amplification was established. Further improvement of the VIDISCA sensitivity was obtained by high throughput sequencing (VIDISCA-454). Eighteen nasopharyngeal swabs were analysed, all containing known respiratory viruses. We could identify the proper virus in the majority of samples tested (11/18). The median load in the VIDISCA-454 positive samples was 7.2 E5 viral genome copies/ml (ranging from 1.4 E3–7.7 E6). Our results show that optimization of VIDISCA and subsequent high-throughput-sequencing enhances sensitivity drastically and provides the opportunity to perform virus discovery directly in patient material. PMID:21283679
A sensitive assay for virus discovery in respiratory clinical samples.
Directory of Open Access Journals (Sweden)
Michel de Vries
Full Text Available In 5-40% of respiratory infections in children, the diagnostics remain negative, suggesting that the patients might be infected with a yet unknown pathogen. Virus discovery cDNA-AFLP (VIDISCA is a virus discovery method based on recognition of restriction enzyme cleavage sites, ligation of adaptors and subsequent amplification by PCR. However, direct discovery of unknown pathogens in nasopharyngeal swabs is difficult due to the high concentration of ribosomal RNA (rRNA that acts as competitor. In the current study we optimized VIDISCA by adjusting the reverse transcription enzymes and decreasing rRNA amplification in the reverse transcription, using hexamer oligonucleotides that do not anneal to rRNA. Residual cDNA synthesis on rRNA templates was further reduced with oligonucleotides that anneal to rRNA but can not be extended due to 3'-dideoxy-C6-modification. With these modifications >90% reduction of rRNA amplification was established. Further improvement of the VIDISCA sensitivity was obtained by high throughput sequencing (VIDISCA-454. Eighteen nasopharyngeal swabs were analysed, all containing known respiratory viruses. We could identify the proper virus in the majority of samples tested (11/18. The median load in the VIDISCA-454 positive samples was 7.2 E5 viral genome copies/ml (ranging from 1.4 E3-7.7 E6. Our results show that optimization of VIDISCA and subsequent high-throughput-sequencing enhances sensitivity drastically and provides the opportunity to perform virus discovery directly in patient material.
Weeber, M; Klein, Henny; de Jong-van den Berg, LTW; Vos, R
Literature-based discovery has resulted in new knowledge. In the biomedical context, Don R. Swanson has generated several literature-based hypotheses that have been corroborated experimentally and clinically. In this paper, we propose a two-step model of the discovery process in which hypotheses are
GeoSearch: A lightweight broking middleware for geospatial resources discovery
Gui, Z.; Yang, C.; Liu, K.; Xia, J.
2012-12-01
With petabytes of geodata, thousands of geospatial web services available over the Internet, it is critical to support geoscience research and applications by finding the best-fit geospatial resources from the massive and heterogeneous resources. Past decades' developments witnessed the operation of many service components to facilitate geospatial resource management and discovery. However, efficient and accurate geospatial resource discovery is still a big challenge due to the following reasons: 1)The entry barriers (also called "learning curves") hinder the usability of discovery services to end users. Different portals and catalogues always adopt various access protocols, metadata formats and GUI styles to organize, present and publish metadata. It is hard for end users to learn all these technical details and differences. 2)The cost for federating heterogeneous services is high. To provide sufficient resources and facilitate data discovery, many registries adopt periodic harvesting mechanism to retrieve metadata from other federated catalogues. These time-consuming processes lead to network and storage burdens, data redundancy, and also the overhead of maintaining data consistency. 3)The heterogeneous semantics issues in data discovery. Since the keyword matching is still the primary search method in many operational discovery services, the search accuracy (precision and recall) is hard to guarantee. Semantic technologies (such as semantic reasoning and similarity evaluation) offer a solution to solve these issues. However, integrating semantic technologies with existing service is challenging due to the expandability limitations on the service frameworks and metadata templates. 4)The capabilities to help users make final selection are inadequate. Most of the existing search portals lack intuitive and diverse information visualization methods and functions (sort, filter) to present, explore and analyze search results. Furthermore, the presentation of the value
Resource Discovery in Activity-Based Sensor Networks
DEFF Research Database (Denmark)
Bucur, Doina; Bardram, Jakob
This paper proposes a service discovery protocol for sensor networks that is specifically tailored for use in humancentered pervasive environments. It uses the high-level concept of computational activities (as logical bundles of data and resources) to give sensors in Activity-Based Sensor Networ....... ABSN enhances the generic Extended Zone Routing Protocol with logical sensor grouping and greatly lowers network overhead during the process of discovery, while keeping discovery latency close to optimal.......This paper proposes a service discovery protocol for sensor networks that is specifically tailored for use in humancentered pervasive environments. It uses the high-level concept of computational activities (as logical bundles of data and resources) to give sensors in Activity-Based Sensor Networks...... (ABSNs) knowledge about their usage even at the network layer. ABSN redesigns classical network-level service discovery protocols to include and use this logical structuring of the network for a more practically applicable service discovery scheme. Noting that in practical settings activity-based sensor...
A large-scale chromosome-specific SNP discovery guideline.
Akpinar, Bala Ani; Lucas, Stuart; Budak, Hikmet
2017-01-01
Single-nucleotide polymorphisms (SNPs) are the most prevalent type of variation in genomes that are increasingly being used as molecular markers in diversity analyses, mapping and cloning of genes, and germplasm characterization. However, only a few studies reported large-scale SNP discovery in Aegilops tauschii, restricting their potential use as markers for the low-polymorphic D genome. Here, we report 68,592 SNPs found on the gene-related sequences of the 5D chromosome of Ae. tauschii genotype MvGB589 using genomic and transcriptomic sequences from seven Ae. tauschii accessions, including AL8/78, the only genotype for which a draft genome sequence is available at present. We also suggest a workflow to compare SNP positions in homologous regions on the 5D chromosome of Triticum aestivum, bread wheat, to mark single nucleotide variations between these closely related species. Overall, the identified SNPs define a density of 4.49 SNPs per kilobyte, among the highest reported for the genic regions of Ae. tauschii so far. To our knowledge, this study also presents the first chromosome-specific SNP catalog in Ae. tauschii that should facilitate the association of these SNPs with morphological traits on chromosome 5D to be ultimately targeted for wheat improvement.
Price discovery in a continuous-time setting
DEFF Research Database (Denmark)
Dias, Gustavo Fruet; Fernandes, Marcelo; Scherrer, Cristina
We formulate a continuous-time price discovery model in which the price discovery measure varies (stochastically) at daily frequency. We estimate daily measures of price discovery using a kernel-based OLS estimator instead of running separate daily VECM regressions as standard in the literature. We...... show that our estimator is not only consistent, but also outperforms the standard daily VECM in finite samples. We illustrate our theoretical findings by studying the price discovery process of 10 actively traded stocks in the U.S. from 2007 to 2013....
Reinen, L. A.; Yule, J. D.
2014-12-01
Student-conducted research in courses during the first two undergraduate years can increase learning and improve student self-confidence in scientific study, and is recommended for engaging and retaining students in STEM fields (PCAST, 2012). At Pomona College, incorporating student research throughout the geology curriculum tripled the number of students conducting research prior to their senior year that culminated in a professional conference presentation (Reinen et al., 2006). Here we present an example of discovery-based research in Neotectonics, a second-tier course predominantly enrolling first-and second-year students; describe the steps involved in the four week project; and discuss early outcomes of student confidence, engagement and retention. In the San Gorgonio Pass region (SGPR) in southern California, the San Andreas fault undergoes a transition from predominantly strike-slip to a complex system of faults with significant dip-slip, resulting in diffuse deformation and raising the question of whether a large earthquake on the San Andreas could propagate through the region (Yule, 2009). In spring 2014, seven students in the Neotectonics course conducted original research investigating quantifiable geomorphic evidence of tectonic activity in the SGPR. Students addressed questions of [1] unequal uplift in the San Bernardino Mountains, [2] fault activity indicated by stream knick points, [3] the role of fault style on mountain front sinuosity, and [4] characteristic earthquake slip determined via fault scarp degradation models. Students developed and revised individual projects, collaborated with each other on methods, and presented results in a public forum. A final class day was spent reviewing the projects and planning future research directions. Pre- and post-course surveys show increases in students' self-confidence in the design, implementation, and presentation of original scientific inquiries. 5 of 6 eligible students participated in research the
Córdova, France A.
2016-01-01
The convergence of emerging advances in astronomical instruments, computational capabilities and talented practitioners (both professional and civilian) is creating an extraordinary new environment for making numerous fundamental discoveries in astronomy, ranging from the nature of exoplanets to understanding the evolution of solar systems and galaxies. The National Science Foundation is playing a critical role in supporting, stimulating, and shaping these advances. NSF is more than an agency of government or a funding mechanism for the infrastructure of science. The work of NSF is a sacred trust that every generation of Americans makes to those of the next generation, that we will build on the body of knowledge we inherit and continue to push forward the frontiers of science. We never lose sight of NSF's obligation to "explore the unexplored" and inspire all of humanity with the wonders of discovery. As the only Federal agency dedicated to the support of basic research and education in all fields of science and engineering, NSF has empowered discoveries across a broad spectrum of scientific inquiry for more than six decades. The result is fundamental scientific research that has had a profound impact on our nation's innovation ecosystem and kept our nation at the very forefront of the world's science-and-engineering enterprise.
Ma, Fei; Liu, Jian; Zhou, Tingting; Lei, Min; Chen, Jing; Wang, Xiachang; Zhang, Yinan; Shen, Xu; Hu, Lihong
2018-05-25
Type 2 diabetes mellitus (T2DM) is a chronic, complex and multifactorial metabolic disorder, and targeting gluconeogenesis inhibition is a promising strategy for anti-diabetic drug discovery. This study discovered a new class of thieno[2,3-b]pyridine derivatives as hepatic gluconeogenesis inhibitors. First, a hit compound (DMT: IC 50 = 33.8 μM) characterized by a thienopyridine core was identified in a cell-based screening of our privileged small molecule library. Structure activity relationships (SARs) study showed that replaced the CF 3 in the thienopyridine core could improve the potency and led to the discovery of 8e (IC 50 = 16.8 μM) and 9d (IC 50 = 12.3 μM) with potent inhibition of hepatic glucose production and good drug-like properties. Furthermore, the mechanism of 8e for the inhibition of hepatic glucose production was also identified, which could be effective through the reductive expression of the mRNA transcription level of gluconeogenic genes, including glucose-6-phosphatase (G6Pase) and hepatic phosphoenolpyruvate carboxykinase (PEPCK). Additionally, 8e could also reduce the fasting blood glucose and improve the oral glucose tolerance and pyruvate tolerance in db/db mice. The optimization of this class of derivatives had provided us a start point to develop new anti-hepatic gluconeogenesis agents. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Q2 dependence of the spin structure function in the resonance region
International Nuclear Information System (INIS)
Li, Z.; Li, Z.
1994-01-01
In this paper, we show what we can learn from the CEBAF experiments on spin-structure functions, and the transition from the Drell-Hearn-Gerasimov sum rule in the real photon limit to the spin-dependent sum rules in deep inelastic scattering, and how the asymmetry A 1 (x,Q 2 ) approaches the scaling limit in the resonance region. The spin structure function in the resonance region alone cannot determine the spin-dependent sum rule due to the kinematic restriction of the resonance region. The integral ∫ 0 1 {A 1 (x,Q 2 )F 2 (x,Q 2 )/2x[1+R(x,Q 2 )]}dx is estimated from Q 2 =0--2.5 GeV 2 . The result shows that there is a region where both contributions from the baryon resonances and the deep inelastic scattering are important; thus it provides important information on the high twist effects on the spin-dependent sum rule
Usability Test Results for a Discovery Tool in an Academic Library
Directory of Open Access Journals (Sweden)
Jody Condit Fagan
2008-03-01
Full Text Available Discovery tools are emerging in libraries. These tools offer library patrons the ability to concurrently search the library catalog and journal articles. While vendors rush to provide feature-rich interfaces and access to as much content as possible, librarians wonder about the usefulness of these tools to library patrons. In order to learn about both the utility and usability of EBSCO Discovery Service, James Madison University conducted a usability test with eight students and two faculty members. The test consisted of nine tasks focused on common patron requests or related to the utility of specific discovery tool features. Software recorded participants’ actions and time on task, human observers judged the success of each task, and a post-survey questionnaire gathered qualitative feedback and comments from the participants. Overall, participants were successful at most tasks, but specific usability problems suggested some interface changes for both EBSCO Discovery Service and JMU’s customizations of the tool. The study also raised several questions for libraries above and beyond any specific discovery tool interface, including the scope and purpose of a discovery tool versus other library systems, working with the large result sets made possible by discovery tools, and navigation between the tool and other library services and resources. This article will be of interest to those who are investigating discovery tools, selecting products, integrating discovery tools into a library web presence, or performing evaluations of similar systems.
2010-10-01
... Review Under Part 17 of This Title-Nondiscrimination in Federally Assisted Programs of the Department of... the person from whom discovery is sought, and for good cause shown, the administrative law judge may make any order which justice requires to limit or condition discovery in order to protect a party or...
Improving the quality of biomarker discovery research: the right samples and enough of them.
Pepe, Margaret S; Li, Christopher I; Feng, Ziding
2015-06-01
Biomarker discovery research has yielded few biomarkers that validate for clinical use. A contributing factor may be poor study designs. The goal in discovery research is to identify a subset of potentially useful markers from a large set of candidates assayed on case and control samples. We recommend the PRoBE design for selecting samples. We propose sample size calculations that require specifying: (i) a definition for biomarker performance; (ii) the proportion of useful markers the study should identify (Discovery Power); and (iii) the tolerable number of useless markers amongst those identified (False Leads Expected, FLE). We apply the methodology to a study of 9,000 candidate biomarkers for risk of colon cancer recurrence where a useful biomarker has positive predictive value ≥ 30%. We find that 40 patients with recurrence and 160 without recurrence suffice to filter out 98% of useless markers (2% FLE) while identifying 95% of useful biomarkers (95% Discovery Power). Alternative methods for sample size calculation required more assumptions. Biomarker discovery research should utilize quality biospecimen repositories and include sample sizes that enable markers meeting prespecified performance characteristics for well-defined clinical applications to be identified. The scientific rigor of discovery research should be improved. ©2015 American Association for Cancer Research.
Authentic Astronomical Discovery in Planetariums: Bringing Data to Domes
Wyatt, Ryan Jason; Subbarao, Mark; Christensen, Lars; Emmons, Ben; Hurt, Robert
2018-01-01
Planetariums offer a unique opportunity to disseminate astronomical discoveries using data visualization at all levels of complexity: the technical infrastructure to display data and a sizeable cohort of enthusiastic educators to interpret results. “Data to Dome” is an initiative the International Planetarium Society to develop our community’s capacity to integrate data in fulldome planetarium systems—including via open source software platforms such as WorldWide Telescope and OpenSpace. We are cultivating a network of planetarium professionals who integrate data into their presentations and share their content with others. Furthermore, we propose to shorten the delay between discovery and dissemination in planetariums. Currently, the “latest science” is often presented days or weeks after discoveries are announced, and we can shorten this to hours or even minutes. The Data2Dome (D2D) initiative, led by the European Southern Observatory, proposes technical infrastructure and data standards that will streamline content flow from research institutions to planetariums, offering audiences a unique opportunity to access to the latest astronomical data in near real time.
Privacy and User Experience in 21st Century Library Discovery
Directory of Open Access Journals (Sweden)
Shayna Pekala
2017-06-01
Full Text Available Over the last decade, libraries have taken advantage of emerging technologies to provide new discovery tools to help users find information and resources more efficiently. In the wake of this technological shift in discovery, privacy has become an increasingly prominent and complex issue for libraries. The nature of the web, over which users interact with discovery tools, has substantially diminished the library’s ability to control patron privacy. The emergence of a data economy has led to a new wave of online tracking and surveillance, in which multiple third parties collect and share user data during the discovery process, making it much more difficult, if not impossible, for libraries to protect patron privacy. In addition, users are increasingly starting their searches with web search engines, diminishing the library’s control over privacy even further. While libraries have a legal and ethical responsibility to protect patron privacy, they are simultaneously challenged to meet evolving user needs for discovery. In a world where “search” is synonymous with Google, users increasingly expect their library discovery experience to mimic their experience using web search engines. However, web search engines rely on a drastically different set of privacy standards, as they strive to create tailored, personalized search results based on user data. Libraries are seemingly forced to make a choice between delivering the discovery experience users expect and protecting user privacy. This paper explores the competing interests of privacy and user experience, and proposes possible strategies to address them in the future design of library discovery tools.
[From discovery to innovation: the example of hypereosinophilic syndrome].
Goldman, M
2007-01-01
Biomedical research is extremely productive so that each day new discoveries reveal novel (mechanisms and) molecular pathways of diseases. However, the number of innovative therapies approved each year by regulatory authorities is decreasing. The causes of this "innovation breakdown" are multiple and should be explored both in academic institutions and in the industrial world. New initiatives are underway in the Walloon Region to improve this situation, such as the setting up of the BioWin Health Cluster gathering pharmaceutical and biotechnology enterprises and university laboratories. This new vision of the partnership between academia and the private sector should be based on strong fundamental research activities. We illustrate this concept by discussing recent advances in the diagnosis and treatment of the hypereosinophilic syndrome.
The centenary of discovery of radium
International Nuclear Information System (INIS)
Mazeron, J.-J.; Gerbaulet, A.
1998-01-01
Henri Becquerel presented the discovery of radium by Pierre and Marie Curie at the Paris Academy of Science on 26th December 1898. One century later, radium has been abandoned, mainly for radiation protection difficulties. It is, however, likely that modern techniques of brachytherapy have inherited to those designed for radium sources, and that radium has cured thousands and thousands patients all over the world for about eighty years. The history of discovery and medical use of radium is summarised. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)
From the nucleus discovery to DWBA
International Nuclear Information System (INIS)
Fernandez, B.
2007-01-01
The author presents a brief review of the main events in the field of nuclear reactions that are acknowledged as milestones because of their importance due to either experimental setting or physical interpretation. It is shown that the pace of discoveries has been strongly dependent on the technical progress in detection means at the beginning of nuclear physics and now is linked to the development of simulation means. The discovery of the neutron, the development of the Geiger counter, the theory of the compound nucleus or the first direct reactions are among these milestones
Applying Hierarchical Task Analysis Method to Discovery Layer Evaluation
Directory of Open Access Journals (Sweden)
Marlen Promann
2015-03-01
Full Text Available Libraries are implementing discovery layers to offer better user experiences. While usability tests have been helpful in evaluating the success or failure of implementing discovery layers in the library context, the focus has remained on its relative interface benefits over the traditional federated search. The informal site- and context specific usability tests have offered little to test the rigor of the discovery layers against the user goals, motivations and workflow they have been designed to support. This study proposes hierarchical task analysis (HTA as an important complementary evaluation method to usability testing of discovery layers. Relevant literature is reviewed for the discovery layers and the HTA method. As no previous application of HTA to the evaluation of discovery layers was found, this paper presents the application of HTA as an expert based and workflow centered (e.g. retrieving a relevant book or a journal article method to evaluating discovery layers. Purdue University’s Primo by Ex Libris was used to map eleven use cases as HTA charts. Nielsen’s Goal Composition theory was used as an analytical framework to evaluate the goal carts from two perspectives: a users’ physical interactions (i.e. clicks, and b user’s cognitive steps (i.e. decision points for what to do next. A brief comparison of HTA and usability test findings is offered as a way of conclusion.
STS-95 Discovery in the VAB as launch preparations continue
1998-01-01
United Space Alliance Forward Shop workers stand near the orbiter Discovery in the Vehicle Assembly Building . The orbiter is being prepared for mating with the external tank. Discovery displays the recently painted NASA logo, termed the 'meatball,' on its left, or port, wing. The logo also has been painted on both sides of the aft fuselage. Discovery (OV-103), the first of the orbiters to be launched with the new art work, is scheduled for its 25th flight, from Launch Pad 39B, on Oct. 29, 1998, for the STS-95 mission.
Pharmacological screening technologies for venom peptide discovery.
Prashanth, Jutty Rajan; Hasaballah, Nojod; Vetter, Irina
2017-12-01
Venomous animals occupy one of the most successful evolutionary niches and occur on nearly every continent. They deliver venoms via biting and stinging apparatuses with the aim to rapidly incapacitate prey and deter predators. This has led to the evolution of venom components that act at a number of biological targets - including ion channels, G-protein coupled receptors, transporters and enzymes - with exquisite selectivity and potency, making venom-derived components attractive pharmacological tool compounds and drug leads. In recent years, plate-based pharmacological screening approaches have been introduced to accelerate venom-derived drug discovery. A range of assays are amenable to this purpose, including high-throughput electrophysiology, fluorescence-based functional and binding assays. However, despite these technological advances, the traditional activity-guided fractionation approach is time-consuming and resource-intensive. The combination of screening techniques suitable for miniaturization with sequence-based discovery approaches - supported by advanced proteomics, mass spectrometry, chromatography as well as synthesis and expression techniques - promises to further improve venom peptide discovery. Here, we discuss practical aspects of establishing a pipeline for venom peptide drug discovery with a particular emphasis on pharmacology and pharmacological screening approaches. This article is part of the Special Issue entitled 'Venom-derived Peptides as Pharmacological Tools.' Copyright © 2017 Elsevier Ltd. All rights reserved.
CO{sub 2}MPARE. CO2 Model for Operational Programme Assessment in EU Regions. User Tutorial
Energy Technology Data Exchange (ETDEWEB)
Hekkenberg, M. [ECN Policy Studies, Amsterdam (Netherlands); Vincent-Genod, C. [Energies Demain, Montreuil Sous Bois (France); Regina, P. [Italian National Agency for New Technologies, Energy and Sustainable Economic Development ENEA, Rome (Italy); Keppo, I. [University College London UCL, London (United Kingdom); Papagianni, S. [Centre for Renewable Energy Sources and Saving CRES, Pikermi Attiki (Greece); Harnych, J. [ENVIROS, Prague (Czech Republic)
2013-03-15
The CO2MPARE model supports national and regional authorities in making balanced decisions for their investment portfolio under their regional development programmes, in particular under their Operational Programmes of EU Regional Policy. This document is a tutorial for users of the CO2MPARE model and provides step by step guidance on the different functionalities of the model for both basic and expert users.
G-protein-coupled receptors: new approaches to maximise the impact of GPCRS in drug discovery.
Davey, John
2004-04-01
IBC's Drug Discovery Technology Series is a group of conferences highlighting technological advances and applications in niche areas of the drug discovery pipeline. This 2-day meeting focused on G-protein-coupled receptors (GPCRs), probably the most important and certainly the most valuable class of targets for drug discovery. The meeting was chaired by J Beesley (Vice President, European Business Development for LifeSpan Biosciences, Seattle, USA) and included 17 presentations on various aspects of GPCR activity, drug screens and therapeutic analyses. Keynote Addresses covered two of the emerging areas in GPCR regulation; receptor dimerisation (G Milligan, Professor of Molecular Pharmacology and Biochemistry, University of Glasgow, UK) and proteins that interact with GPCRs (J Bockaert, Laboratory of Functional Genomics, CNRS Montpellier, France). A third Keynote Address from W Thomsen (Director of GPCR Drug Screening, Arena Pharmaceuticals, USA) discussed Arena's general approach to drug discovery and illustrated this with reference to the development of an agonist with potential efficacy in Type II diabetes.
Directory of Open Access Journals (Sweden)
Sri Lestari
2016-11-01
Full Text Available This research aimed to determine how is the implementation of discovery learning model with mind mapping media on the basic comptences of clasify kinds of retail business and whether the implementation of the discovery learning model with mind mapping media can increase learning outcomes of student. This research conducted using qualitative approach and quantitative in the planning of class action research by two cycles with research time for every cycle 2 meeting @ 3x45 minute. The result showed that by using discovery learning model with mind mapping media learning outcomes of student was good in the aspect of knowledge, skill, and the attitude have increased. Abstrak : Penelitian ini bertujuan untuk mengetahui bagaimana penerapan model discovery learning dengan menggunakan media mind mapping pada kompetensi dasar mengklasifikasikan jenis bisnis ritel dan apakah penerapan model discovery learning dengan menggunakan media mind mapping dapat meningkatkan hasil belajar siswa. Penelitian dilakukan dengan pendekatan kualitatif dan kuantitatif dalam rancangan penelitian tindakan kelas dengan dua siklus dengan waktu penelitian untuk masing-masing siklus 2 pertemuan @ 3 x 45 menit. yang hasilnya menunjukkan bahwa melalui penggunaan model discovery learning dengan media mind mapping hasil belajar siswa baik dalam ranah pengetahuan, ketrampilan, maupun sikap mengalami peningkatan.
DISCOVERY OF A FAINT QUASAR AT z ∼ 6 AND IMPLICATIONS FOR COSMIC REIONIZATION
Energy Technology Data Exchange (ETDEWEB)
Kim, Yongjung; Im, Myungshin; Jeon, Yiseul; Choi, Changsu; Hong, Jueun; Hyun, Minhee; Jun, Hyunsung David; Kim, Dohyeong; Kim, Duho; Kim, Jae-Woo; Lee, Seong-Kook; Taak, Yoon Chan; Yoon, Yongmin [Center for the Exploration of the Origin of the Universe (CEOU), Building 45, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 151-742 (Korea, Republic of); Kim, Minjin; Park, Won-Kee [Korea Astronomy and Space Science Institute, Daejeon 305-348 (Korea, Republic of); Karouzos, Marios [Astronomy Program, FPRD, Department of Physics and Astronomy, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 151-742 (Korea, Republic of); Kim, Ji Hoon [Subaru Telescope, National Astronomical Observatory of Japan, 650 North A’ohoku Place, Hilo, HI 96720 (United States); Pak, Soojong, E-mail: yjkim@astro.snu.ac.kr, E-mail: mim@astro.snu.ac.kr [School of Space Research and Institute of Natural Sciences, Kyung Hee University, 1732 Deogyeong-daero, Giheung-gu, Yongin-si, Gyeonggi-do 446-701 (Korea, Republic of)
2015-11-10
Recent studies suggest that faint active galactic nuclei may be responsible for the reionization of the universe. Confirmation of this scenario requires spectroscopic identification of faint quasars (M{sub 1450} > −24 mag) at z ≳ 6, but only a very small number of such quasars have been spectroscopically identified so far. Here, we report the discovery of a faint quasar IMS J220417.92+011144.8 at z ∼ 6 in a 12.5 deg{sup 2} region of the SA22 field of the Infrared Medium-deep Survey (IMS). The spectrum of the quasar shows a sharp break at ∼8443 Å, with emission lines redshifted to z = 5.944 ± 0.002 and rest-frame ultraviolet continuum magnitude M{sub 1450} = −23.59 ± 0.10 AB mag. The discovery of IMS J220417.92+011144.8 is consistent with the expected number of quasars at z ∼ 6 estimated from quasar luminosity functions based on previous observations of spectroscopically identified low-luminosity quasars. This suggests that the number of M{sub 1450} ∼ −23 mag quasars at z ∼ 6 may not be high enough to fully account for the reionization of the universe. In addition, our study demonstrates that faint quasars in the early universe can be identified effectively with a moderately wide and deep near-infrared survey such as the IMS.
2010-01-01
... 7 Agriculture 4 2010-01-01 2010-01-01 false Discovery. 283.28 Section 283.28 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE... Appeals of QC Claims of Less Than $50,000 § 283.28 Discovery. Upon motion and as ordered by the ALJ...
Alkaloids as Cyclooxygenase Inhibitors in Anticancer Drug Discovery.
Hashmi, Muhammad Ali; Khan, Afsar; Farooq, Umar; Khan, Sehroon
2018-01-01
Cancer is the leading cause of death worldwide and anticancer drug discovery is a very hot area of research at present. There are various factors which control and affect cancer, out of which enzymes like cyclooxygenase-2 (COX-2) play a vital role in the growth of tumor cells. Inhibition of this enzyme is a very useful target for the prevention of various types of cancers. Alkaloids are a diverse group of naturally occurring compounds which have shown great COX-2 inhibitory activity both in vitro and in vivo. In this mini-review, we have discussed different alkaloids with COX-2 inhibitory activities and anticancer potential which may act as leads in modern anticancer drug discovery. Different classes of alkaloids including isoquinoline alkaloids, indole alkaloids, piperidine alkaloids, quinazoline alkaloids, and various miscellaneous alkaloids obtained from natural sources have been discussed in detail in this review. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Cousin, F.; Tulet, P.; Rosset, R.
2005-03-01
Escompte, a European programme which took place in the Marseille region in June-July 2001, has been designed as an exhaustive database to be used for the development and validation of air pollution models. The air quality Mesoscale NonHydrostatic Chemistry model (Meso-NH-C) is used to simulate 2 days of an Intensive Observation Period (IOP) documented during the Escompte campaign, June 23 and 24, 2001. We first study the synoptic and local meteorological situation on June 23 and 24, using surface and aircraft measurements. Then, we focus on the pollution episode of June 24. This study emphasizes the deep impact of synoptic and local dynamics on observed ozone concentrations. It is shown that ozone levels are due both to regional and local factors, with highlights of the importance of ozone layering. More generally this confirms, even in an otherwise predominant local sea-breeze regime, the need to consider larger scale regional pollutant transport.
DISCOVERY OF GAMMA-RAY ORBITAL MODULATION IN THE BLACK WIDOW PSR J1311–3430
Energy Technology Data Exchange (ETDEWEB)
Xing, Yi; Wang, Zhongxiang [Key Laboratory for Research in Galaxies and Cosmology, Shanghai Astronomical Observatory, Chinese Academy of Sciences, 80 Nandan Road, Shanghai 200030 (China)
2015-05-10
We report our discovery of orbitally modulated γ-ray emission from the black widow system PSR J1311−3430. We analyze the Fermi Large Area Telescope data during the off-pulse phase interval of the pulsar and find the orbital modulation signal at a ∼3σ confidence level. Further spectral analysis shows no significant differences for the spectra obtained during the bright and faint orbital phase ranges. A simple sinusoid-like function can describe the modulation. Given these properties, we suggest that the intrabinary γ-ray emission arises from the region close to the companion and the modulation is caused by the occultation of the emitting region by the companion, similar to that is seen in the transitional millisecond pulsar binary (MSP) PSR J1023+0038. Considering the X-ray detection of intrabinary shock emission from eclipsing MSP binaries recently reported, this discovery further suggests the general existence of intrabinary γ-ray emission from them.
Data mining-aided materials discovery and optimization
Directory of Open Access Journals (Sweden)
Wencong Lu
2017-09-01
Full Text Available Recent developments in data mining-aided materials discovery and optimization are reviewed in this paper, and an introduction to the materials data mining (MDM process is provided using case studies. Both qualitative and quantitative methods in machine learning can be adopted in the MDM process to accomplish different tasks in materials discovery, design, and optimization. State-of-the-art techniques in data mining-aided materials discovery and optimization are demonstrated by reviewing the controllable synthesis of dendritic Co3O4 superstructures, materials design of layered double hydroxide, battery materials discovery, and thermoelectric materials design. The results of the case studies indicate that MDM is a powerful approach for use in materials discovery and innovation, and will play an important role in the development of the Materials Genome Initiative and Materials Informatics.
QSAR studies in the discovery of novel type-II diabetic therapies.
Abuhammad, Areej; Taha, Mutasem O
2016-01-01
Type-II diabetes mellitus (T2DM) is a complex chronic disease that represents a major therapeutic challenge. Despite extensive efforts in T2DM drug development, therapies remain unsatisfactory. Currently, there are many novel and important antidiabetic drug targets under investigation by many research groups worldwide. One of the main challenges to develop effective orally active hypoglycemic agents is off-target effects. Computational tools have impacted drug discovery at many levels. One of the earliest methods is quantitative structure-activity relationship (QSAR) studies. QSAR strategies help medicinal chemists understand the relationship between hypoglycemic activity and molecular properties. Hence, QSAR may hold promise in guiding the synthesis of specifically designed novel ligands that demonstrate high potency and target selectivity. This review aims to provide an overview of the QSAR strategies used to model antidiabetic agents. In particular, this review focuses on drug targets that raised recent scientific interest and/or led to successful antidiabetic agents in the market. Special emphasis has been made on studies that led to the identification of novel antidiabetic scaffolds. Computer-aided molecular design and discovery techniques like QSAR have a great potential in designing leads against complex diseases such as T2DM. Combined with other in silico techniques, QSAR can provide more useful and rational insights to facilitate the discovery of novel compounds. However, since T2DM is a complex disease that includes several faulty biological targets, multi-target QSAR studies are recommended in the future to achieve efficient antidiabetic therapies.
Juvenile Hippocampal CA2 Region Expresses Aggrecan
Directory of Open Access Journals (Sweden)
Asako Noguchi
2017-05-01
Full Text Available Perineuronal nets (PNNs are distributed primarily around inhibitory interneurons in the hippocampus, such as parvalbumin-positive interneurons. PNNs are also present around excitatory neurons in some brain regions and prevent plasticity in these neurons. A recent study demonstrated that PNNs also exist around mouse hippocampal pyramidal cells, which are the principle type of excitatory neurons, in the CA2 subregion and modulate the excitability and plasticity of these neurons. However, the development of PNNs in the CA2 region during postnatal maturation was not fully investigated. This study found that a main component of PNNs, aggrecan, existed in the pyramidal cell layer of the putative CA2 subarea prior to the appearance of the CA2 region, which was defined by the CA2 marker protein regulator of G protein signaling 14 (RGS14. We also found that aggrecan immunoreactivity was more evident in the anterior sections of the CA2 area than the posterior sections, which suggests that the function of CA2 PNNs varies along the anterior-posterior axis.
Promise Fulfilled? An EBSCO Discovery Service Usability Study
Williams, Sarah C.; Foster, Anita K.
2011-01-01
Discovery tools are the next phase of library search systems. Illinois State University's Milner Library implemented EBSCO Discovery Service in August 2010. The authors conducted usability studies on the system in the fall of 2010. The aims of the study were twofold: first, to determine how Milner users set about using the system in order to…
Discovery and molecular characterization of a Bcl-2-regulated cell death pathway in schistosomes.
Lee, Erinna F; Clarke, Oliver B; Evangelista, Marco; Feng, Zhiping; Speed, Terence P; Tchoubrieva, Elissaveta B; Strasser, Andreas; Kalinna, Bernd H; Colman, Peter M; Fairlie, W Douglas
2011-04-26
Schistosomiasis is an infectious disease caused by parasites of the phylum platyhelminthe. Here, we describe the identification and characterization of a Bcl-2-regulated apoptosis pathway in Schistosoma japonicum and S. mansoni. Genomic, biochemical, and cell-based mechanistic studies provide evidence for a tripartite pathway, similar to that in humans including BH3-only proteins that are inhibited by prosurvival Bcl-2-like molecules, and Bax/Bak-like proteins that facilitate mitochondrial outer-membrane permeabilization. Because Bcl-2 proteins have been successfully targeted with "BH3 mimetic" drugs, particularly in the treatment of cancer, we investigated whether schistosome apoptosis pathways could provide targets for future antischistosomal drug discovery efforts. Accordingly, we showed that a schistosome prosurvival protein, sjA, binds ABT-737, a well-characterized BH3 mimetic. A crystal structure of sjA bound to a BH3 peptide provides direct evidence for the feasibility of developing BH3 mimetics to target Bcl-2 prosurvival proteins in schistosomes, suggesting an alternative application for this class of drugs beyond cancer treatment.
Scientific Discoveries: What Is Required for Lasting Impact.
Lømo, Terje
2016-01-01
I have been involved in two scientific discoveries of some impact. One is the discovery of long-term potentiation (LTP), the phenomenon that brief, high-frequency impulse activity at synapses in the brain can lead to long-lasting increases in their efficiency of transmission. This finding demonstrated that synapses are plastic, a property thought to be necessary for learning and memory. The other discovery is that nerve-evoked muscle impulse activity, rather than putative trophic factors, controls the properties of muscle fibers. Here I describe how these two discoveries were made, the unexpected difficulties of reproducing the first discovery, and the controversies that followed the second discovery. I discuss why the first discovery took many years to become generally recognized, whereas the second caused an immediate sensation and entered textbooks and major reviews but is now largely forgotten. In the long run, discovering a new phenomenon has greater impact than falsifying a popular hypothesis.
Network-Assisted Device-to-Device (D2D) Direct Proximity Discovery with Underlay Communication
DEFF Research Database (Denmark)
Pratas, Nuno; Popovski, Petar
2015-01-01
) direct communication between proximate devices. While (ii) is treated extensively in the recent literature, (i) has received relatively little attention. In this paper we analyze a network-assisted underlay proximity discovery protocol, where a cellular device can take the role of: announcer (which......Device-to-Device communications are expected to play an important role in current and future cellular generations, by increasing the spatial reuse of spectrum resources and enabling lower latency communication links. This paradigm has two fundamental building blocks: (i) proximity discovery and (ii......, we consider the case where the announcers underlay their messages in the downlink transmissions that are directed towards the monitoring devices. We propose a power control scheme applied to the downlink transmission, which copes with the underlay transmission via additional power expenditure, while...
Martin, Paul S.
1973-01-01
Discusses a model for explaining the spread of human population explosion on North American continent since its discovery 12,000 years ago. The model may help to map the spread of Homo sapiens throughout the New World by using the extinction chronology of the Pleistocene megafauna. (Author/PS)
Reporting Astronomical Discoveries: Past, Now, and Future
Yamaoka, Hitoshi; Green, Daniel W. E.; Samus, Nikolai N.; West, Richard
2015-08-01
Many new astronomical objects have been discovered over the years by amateur astronomers, and this continues to be the case. They have traditionally reported them (as have professional astronomers) to the Central Bureau for Astronomical Telegrams (CBAT), which was established in the 19th century. This procedure has worked very well throughout the 20th century, moving under the umbrella of the newly established IAU in 1920. The discoverers have been honored by the formal announcement of their discoveries in the publications of the CBAT.In recent years, some professional research groups have established other ways of announcing their discoveries of explosive objects such as novae and supernovae; some do not now report their discoveries or spectroscopic confirmations of the transients to the CBAT, including often spectroscopic reports of objects posted to the CBAT "Transient Objects Confirmation Page" -- the highly successful TOCP webpage, which assigns official positional designations to new transients posted there by approved, registered users. This leads to a delay in formal announcements of discoveries by amateur astronomers in many cases, as well as inconsistent designations being put into use by individual groups. Amateur astronomers are feeling frustrated about this situation, and they hope that the IAU will help to settle the situation.We have proposed the new IAU commission NC-52, which will treat these phenomena in a continuation of Commission 6, through the CBAT. We hope to continuously support the reporting of the discoveries by amateur astronomers, as well as professional astronomers, who all deserve and desire proper recognition. Our strategy will maintain the firm trust between the amateur and professional astronomers, which is necessary for true collaboration. The plan is for the CBAT to work with collaborators to assure that discoveries posted on the TOCP are promptly designated and announced by the CBAT, even when confirmations are made elsewhere
Projected Effect of Increased Active Travel in German Urban Regions on the Risk of Type 2 Diabetes
Brinks, Ralph; Hoyer, Annika; Kuss, Oliver; Rathmann, Wolfgang
2015-01-01
Background Future transportation policy is likely to reduce emissions in the cities and urban regions by strengthening active travel. Increased walking and cycling are known to have positive effects on health outcomes. This work estimates effects of increased active travel on type 2 diabetes in Germany, where 64% of the population live in urban regions. Methods Based on the effect size of an increased active travel scenario reported from a recent meta-analysis, we project the change in the life time risk, the proportion of prevented cases and the change in diabetes free life time in a German birth cohort (born 1985) compared to business as usual. Results The absolute risk reduction of developing type 2 diabetes before the age of 80 is 6.4% [95% confidence interval: 3.7-9.7%] for men and 4.7% [2.2-7.7%] for women, respectively. Compared to business as usual, the increased active travel scenario prevents 14.0% [8.1-21.2%] of the future cases of diabetes in men and 15.8% [9.3-23.1%] in women. Diabetes free survival increases by 1.7 [1.0-2.7] years in men and 1.4 [0.6-2.3] in women. Conclusions Our projection predicts a substantial impact of increased active travel on the future burden of type 2 diabetes. The most striking effect may be seen in the number of prevented cases. In all urban regions with an increased active travel transport policy, about one out of seven male and one out of six female cases can be prevented. PMID:25849819
Projected effect of increased active travel in German urban regions on the risk of type 2 diabetes.
Directory of Open Access Journals (Sweden)
Ralph Brinks
Full Text Available Future transportation policy is likely to reduce emissions in the cities and urban regions by strengthening active travel. Increased walking and cycling are known to have positive effects on health outcomes. This work estimates effects of increased active travel on type 2 diabetes in Germany, where 64% of the population live in urban regions.Based on the effect size of an increased active travel scenario reported from a recent meta-analysis, we project the change in the life time risk, the proportion of prevented cases and the change in diabetes free life time in a German birth cohort (born 1985 compared to business as usual.The absolute risk reduction of developing type 2 diabetes before the age of 80 is 6.4% [95% confidence interval: 3.7-9.7%] for men and 4.7% [2.2-7.7%] for women, respectively. Compared to business as usual, the increased active travel scenario prevents 14.0% [8.1-21.2%] of the future cases of diabetes in men and 15.8% [9.3-23.1%] in women. Diabetes free survival increases by 1.7 [1.0-2.7] years in men and 1.4 [0.6-2.3] in women.Our projection predicts a substantial impact of increased active travel on the future burden of type 2 diabetes. The most striking effect may be seen in the number of prevented cases. In all urban regions with an increased active travel transport policy, about one out of seven male and one out of six female cases can be prevented.
iSyTE 2.0: a database for expression-based gene discovery in the eye
Kakrana, Atul; Yang, Andrian; Anand, Deepti; Djordjevic, Djordje; Ramachandruni, Deepti; Singh, Abhyudai; Huang, Hongzhan
2018-01-01
Abstract Although successful in identifying new cataract-linked genes, the previous version of the database iSyTE (integrated Systems Tool for Eye gene discovery) was based on expression information on just three mouse lens stages and was functionally limited to visualization by only UCSC-Genome Browser tracks. To increase its efficacy, here we provide an enhanced iSyTE version 2.0 (URL: http://research.bioinformatics.udel.edu/iSyTE) based on well-curated, comprehensive genome-level lens expression data as a one-stop portal for the effective visualization and analysis of candidate genes in lens development and disease. iSyTE 2.0 includes all publicly available lens Affymetrix and Illumina microarray datasets representing a broad range of embryonic and postnatal stages from wild-type and specific gene-perturbation mouse mutants with eye defects. Further, we developed a new user-friendly web interface for direct access and cogent visualization of the curated expression data, which supports convenient searches and a range of downstream analyses. The utility of these new iSyTE 2.0 features is illustrated through examples of established genes associated with lens development and pathobiology, which serve as tutorials for its application by the end-user. iSyTE 2.0 will facilitate the prioritization of eye development and disease-linked candidate genes in studies involving transcriptomics or next-generation sequencing data, linkage analysis and GWAS approaches. PMID:29036527
Fermi Discovery of Gamma-Ray Emission from NGC 1275
Energy Technology Data Exchange (ETDEWEB)
Abdo, Aous A.; /Naval Research Lab, Wash., D.C.; Ackermann, M.; /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept.; Ajello, M.; /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept.; Asano, K.; /Tokyo Inst. Tech.; Baldini, L.; /INFN, Pisa; Ballet, J.; /DAPNIA, Saclay; Barbiellini, Guido; /INFN, Trieste /Trieste U.; Bastieri, Denis; /INFN, Padua /Padua U.; Baughman, B.M.; /Ohio State U.; Bechtol, K.; /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept.; Bellazzini, R.; /INFN, Pisa; Blandford, R.D.; /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept.; Bloom, Elliott D.; /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept.; Bonamente, E.; /INFN, Perugia /Perugia U.; Borgland, A.W.; /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept.; Bregeon, J.; /INFN, Pisa; Brez, A.; /INFN, Pisa; Brigida, M.; /Bari U. /INFN, Bari; Bruel, P.; /Ecole Polytechnique; Burnett, Thompson H.; /Washington U., Seattle; Caliandro, G.A.; /Bari U. /INFN, Bari /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept. /IASF, Milan /IASF, Milan /DAPNIA, Saclay /ASDC, Frascati /INFN, Perugia /Perugia U. /SISSA, Trieste /George Mason U. /Naval Research Lab, Wash., D.C. /NASA, Goddard /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept. /INFN, Perugia /Perugia U. /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept. /Montpellier U. /ASDC, Frascati /Sonoma State U. /Stockholm U., OKC /Royal Inst. Tech., Stockholm /Stockholm U. /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept. /Naval Research Lab, Wash., D.C. /INFN, Trieste /Bari U. /INFN, Bari /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept. /NASA, Goddard /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept. /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept. /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept. /CENBG, Gradignan /CENBG, Gradignan /Montpellier U. /Bari U. /INFN, Bari /Naval Research Lab, Wash., D.C. /Stanford U., HEPL /KIPAC, Menlo Park /Stanford U., Phys. Dept. /INFN, Trieste /Hiroshima U.; /more authors..
2009-05-15
We report the discovery of high-energy (E > 100 MeV) {gamma}-ray emission from NGC 1275, a giant elliptical galaxy lying at the center of the Perseus cluster of galaxies, based on observations made with the Large Area Telescope (LAT) of the Fermi Gamma-ray Space Telescope. The positional center of the {gamma}-ray source is only {approx}3{prime} away from the NGC 1275 nucleus, well within the 95% LAT error circle of {approx}5{prime}. The spatial distribution of {gamma}-ray photons is consistent with a point source. The average flux and power-law photon index measured with the LAT from 2008 August 4 to 2008 December 5 are F{sub {gamma}} = (2.10 {+-} 0.23) x 10{sup -7} ph (>100 MeV) cm{sup -2} s{sup -1} and {Gamma} = 2.17 {+-} 0.05, respectively. The measurements are statistically consistent with constant flux during the four-month LAT observing period. Previous EGRET observations gave an upper limit of F{sub {gamma}} < 3.72 x 10{sup -8} ph (>100 MeV) cm{sup -2} s{sup -1} to the {gamma}-ray flux from NGC 1275. This indicates that the source is variable on timescales of years to decades, and therefore restricts the fraction of emission that can be produced in extended regions of the galaxy cluster. Contemporaneous and historical radio observations are also reported. The broadband spectrum of NGC 1275 is modeled with a simple one-zone synchrotron/synchrotron self-Compton model and a model with a decelerating jet flow.
Eyes on the Skies 400 Years of Telescopic Discovery
Schilling, Govert
2011-01-01
Adopted as the official book of the International Year of Astronomy (IYA) 2009, this stunningly illustrated history of telescopic discovery spans the range from the first telescopes via the Hubble Space Telescope to next generation platforms, and how they have changed and continue to change our view of the universe, our place in it and where it all came from. Eyes on the Skies features numerous full-page photographs and is printed in high-quality color throughout. Also includes the official IYA DVD with 59 minutes of narrated text, expert comments and interviews, animations, computer simulatio
Grigoriadis, Dimitri E; Hoare, Samuel R J; Lechner, Sandra M; Slee, Deborah H; Williams, John A
2009-01-01
Beginning with the discovery of the structure of deoxyribose nucleic acid in 1953, by James Watson and Francis Crick, the sequencing of the entire human genome some 50 years later, has begun to quantify the classes and types of proteins that may have relevance to human disease with the promise of rapidly identifying compounds that can modulate these proteins so as to have a beneficial and therapeutic outcome. This so called 'drugable space' involves a variety of membrane-bound proteins including the superfamily of G-protein-coupled receptors (GPCRs), ion channels, and transporters among others. The recent number of novel therapeutics targeting membrane-bound extracellular proteins that have reached the market in the past 20 years however pales in magnitude when compared, during the same timeframe, to the advancements made in the technologies available to aid in the discovery of these novel therapeutics. This review will consider select examples of extracellular drugable targets and focus on the GPCRs and ion channels highlighting the corticotropin releasing factor (CRF) type 1 and gamma-aminobutyric acid receptors, and the Ca(V)2.2 voltage-gated ion channel. These examples will elaborate current technological advancements in drug discovery and provide a prospective framework for future drug development.
Bringing your tools to CyVerse Discovery Environment using Docker [version 1; referees: 2 approved
Directory of Open Access Journals (Sweden)
Upendra Kumar Devisetty
2016-06-01
Full Text Available Docker has become a very popular container-based virtualization platform for software distribution that has revolutionized the way in which scientific software and software dependencies (software stacks can be packaged, distributed, and deployed. Docker makes the complex and time-consuming installation procedures needed for scientific software a one-time process. Because it enables platform-independent installation, versioning of software environments, and easy redeployment and reproducibility, Docker is an ideal candidate for the deployment of identical software stacks on different compute environments such as XSEDE and Amazon AWS. CyVerse’s Discovery Environment also uses Docker for integrating its powerful, community-recommended software tools into CyVerse’s production environment for public use. This paper will help users bring their tools into CyVerse Discovery Environment (DE which will not only allows users to integrate their tools with relative ease compared to the earlier method of tool deployment in DE but will also help users to share their apps with collaborators and release them for public use.
2010-01-01
... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Discovery. 509.102 Section 509.102 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY RULES OF PRACTICE AND PROCEDURE IN ADJUDICATORY PROCEEDINGS Local Rules § 509.102 Discovery. (a) In general. A party may take the deposition of an...
The discovery of Halictivirus resolves the Sinaivirus phylogeny.
Bigot, Diane; Dalmon, Anne; Roy, Bronwen; Hou, Chunsheng; Germain, Michèle; Romary, Manon; Deng, Shuai; Diao, Qingyun; Weinert, Lucy A; Cook, James M; Herniou, Elisabeth A; Gayral, Philippe
2017-11-01
By providing pollination services, bees are among the most important insects, both in ecological and economical terms. Combined next-generation and classical sequencing approaches were applied to discover and study new insect viruses potentially harmful to bees. A bioinformatics virus discovery pipeline was used on individual Illumina transcriptomes of 13 wild bees from three species from the genus Halictus and 30 ants from six species of the genera Messor and Aphaenogaster. This allowed the discovery and description of three sequences of a new virus termed Halictus scabiosae Adlikon virus (HsAV). Phylogenetic analyses of ORF1, RNA-dependent RNA-polymerase (RdRp) and capsid genes showed that HsAV is closely related to (+)ssRNA viruses of the unassigned Sinaivirus genus but distant enough to belong to a different new genus we called Halictivirus. In addition, our study of ant transcriptomes revealed the first four sinaivirus sequences from ants (Messor barbarus, M. capitatus and M. concolor). Maximum likelihood phylogenetic analyses were performed on a 594 nt fragment of the ORF1/RdRp region from 84 sinaivirus sequences, including 31 new Lake Sinai viruses (LSVs) from honey bees collected in five countries across the globe and the four ant viral sequences. The phylogeny revealed four main clades potentially representing different viral species infecting honey bees. Moreover, the ant viruses belonged to the LSV4 clade, suggesting a possible cross-species transmission between bees and ants. Lastly, wide honey bee screening showed that all four LSV clades have worldwide distributions with no obvious geographical segregation.
Deep Learning in Drug Discovery.
Gawehn, Erik; Hiss, Jan A; Schneider, Gisbert
2016-01-01
Artificial neural networks had their first heyday in molecular informatics and drug discovery approximately two decades ago. Currently, we are witnessing renewed interest in adapting advanced neural network architectures for pharmaceutical research by borrowing from the field of "deep learning". Compared with some of the other life sciences, their application in drug discovery is still limited. Here, we provide an overview of this emerging field of molecular informatics, present the basic concepts of prominent deep learning methods and offer motivation to explore these techniques for their usefulness in computer-assisted drug discovery and design. We specifically emphasize deep neural networks, restricted Boltzmann machine networks and convolutional networks. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bioinformatics in translational drug discovery.
Wooller, Sarah K; Benstead-Hume, Graeme; Chen, Xiangrong; Ali, Yusuf; Pearl, Frances M G
2017-08-31
Bioinformatics approaches are becoming ever more essential in translational drug discovery both in academia and within the pharmaceutical industry. Computational exploitation of the increasing volumes of data generated during all phases of drug discovery is enabling key challenges of the process to be addressed. Here, we highlight some of the areas in which bioinformatics resources and methods are being developed to support the drug discovery pipeline. These include the creation of large data warehouses, bioinformatics algorithms to analyse 'big data' that identify novel drug targets and/or biomarkers, programs to assess the tractability of targets, and prediction of repositioning opportunities that use licensed drugs to treat additional indications. © 2017 The Author(s).
Energy Technology Data Exchange (ETDEWEB)
Kim, Kihwan, E-mail: kihwankim@kaeri.re.kr [Korea Atomic Energy Research Institute, Daeduk-daero 989-111, Yuseong-Gu, Daejeon 34057 (Korea, Republic of); Kim, Byung-Jae, E-mail: byoungjae@kaeri.re.kr [School of Mechanical Engineering, Chungnam National University, 99 Daehak-ro, Yuseoung-Gu, Daejeon 34134 (Korea, Republic of); Choi, Hae-Seob, E-mail: hschoi@kaeri.re.kr [Korea Atomic Energy Research Institute, Daeduk-daero 989-111, Yuseong-Gu, Daejeon 34057 (Korea, Republic of); Moon, Sang-Ki, E-mail: skmoon@kaeri.re.kr [Korea Atomic Energy Research Institute, Daeduk-daero 989-111, Yuseong-Gu, Daejeon 34057 (Korea, Republic of); Song, Chul-Hwa, E-mail: chsong@kaeri.re.kr [Korea Atomic Energy Research Institute, Daeduk-daero 989-111, Yuseong-Gu, Daejeon 34057 (Korea, Republic of)
2017-02-15
Highlights: • This test was conducted to understand the effect of blockage length on the coolability. • Reflood tests were conducted with blockage simulators for various reflood rates. • The coolability in the downstream of the blockage region is significantly enhanced. - Abstract: If fuel rods are ballooned or rearranged during the reflood phase of a large break loss-of-coolant accident (LBLOCA) in a pressurized-water reactor (PWR), the transient heat transfer behavior is entirely different with those of the intact fuel rods owing to the deformed blockage region. The coolability in the blocked region depends on a complex two-phase heat transfer with various thermal hydraulic conditions. In addition, the blockage characteristics, such as the blockage ratio, length, shape, and configurations, are also significant factors affecting the coolability. In the present study, reflood experiments were carried out to understand the effect of the blockage length upon the coolability by varying the reflooding rates. The experiments were performed in electrically heated 2 × 2 rod bundles with blockage simulators having the same blockage ratio but different blockage lengths. The characteristics of quenching and heat transfer were evaluated to investigate the influence of the blockage region on the coolability. The droplet behaviors were also observed by measuring the droplets velocity and size near the blockage region. The coolability in the downstream region of the blockage was significantly enhanced, owing to the reduced flow area of the sub-channel, intensification of turbulence, and the entrained droplets in the blockage region.
Discovery and first models of the quadruply lensed quasar SDSS J1433+6007
Agnello, Adriano; Grillo, Claudio; Jones, Tucker; Treu, Tommaso; Bonamigo, Mario; Suyu, Sherry H.
2018-03-01
We report the discovery of the quadruply lensed quasar SDSS J1433+6007 (RA = 14:33:22.8, Dec. = +60:07:13.44), mined in the SDSS DR12 photometric catalogues using a novel outlier-selection technique, without prior spectroscopic or ultraviolet excess information. Discovery data obtained at the Nordic Optical Telescope (La Palma) show nearly identical quasar spectra at zs = 2.737 ± 0.003 and four quasar images in a fold configuration, one of which sits on a blue arc, with maximum separation 3.6 arcsec. The deflector redshift is zl = 0.407 ± 0.002, from Keck-ESI spectra. We describe the selection procedure, discovery and follow-up, image positions and BVRi magnitudes, and first results and forecasts from lens model fit to the relative image positions.
International Drug Discovery Science and Technology--BIT's Seventh Annual Congress.
Bodovitz, Steven
2010-01-01
BIT's Seventh Annual International Drug Discovery Science and Technology Congress, held in Shanghai, included topics covering new therapeutic and technological developments in the field of drug discovery. This conference report highlights selected presentations on open-access approaches to R&D, novel and multifactorial targets, and technologies that assist drug discovery. Investigational drugs discussed include the anticancer agents astuprotimut-r (GlaxoSmithKline plc) and AS-1411 (Antisoma plc).
Centennial celebration of the discovery of radioactivity
International Nuclear Information System (INIS)
Bimbot, R.
1999-01-01
Initiated in January 1996 by a ceremony held at the French National Academy of Medicine, the centennial commemoration of the discovery of radioactivity will continue until the end of 1998 when a similar ceremony will take place at the Academy of Sciences. The manifestations are now organized over the whole French territory with the help of 22 regional committees. Educational actions and conferences have been stimulated by the recent edition of the booklet 'Radioactivity' in French, English and Spanish, which has been sent to all the middle and secondary schools in France. A series of international actions are also scheduled in France and abroad, with the help of the French Foreign Affairs Ministry. (authors)
The AIDS and Cancer Specimen Resource: Role in HIV/AIDS scientific discovery
Directory of Open Access Journals (Sweden)
McGrath Michael S
2007-03-01
Full Text Available Abstract The AIDS Cancer and Specimen Resource (ACSR supports scientific discovery in the area of HIV/AIDS-associated malignancies. The ACSR was established as a cooperative agreement between the NCI (Office of the Director, Division of Cancer Treatment and Diagnosis and regional consortia, University of California, San Francisco (West Coast, George Washington University (East Coast and Ohio State University (Mid-Region to collect, preserve and disperse HIV-related tissues and biologic fluids and controls along with clinical data to qualified investigators. The available biological samples with clinical data and the application process are described on the ACSR web site. The ACSR tissue bank has more than 100,000 human HIV positive specimens that represent different processing (43, specimen (15, and anatomical site (50 types. The ACSR provides special biospecimen collections and prepares speciality items, e.g., tissue microarrays (TMA, DNA libraries. Requests have been greatest for Kaposi's sarcoma (32% and non-Hodgkin's lymphoma (26%. Dispersed requests include 83% tissue (frozen and paraffin embedded, 18% plasma/serum and 9% other. ACSR also provides tissue microarrays of, e.g., Kaposi's sarcoma and non-Hodgkin's lymphoma, for biomarker assays and has developed collaborations with other groups that provide access to additional AIDS-related malignancy specimens. ACSR members and associates have completed 63 podium and poster presentations. Investigators have submitted 125 letters of intent requests. Discoveries using ACSR have been reported in 61 scientific publications in notable journals with an average impact factor of 7. The ACSR promotes the scientific exploration of the relationship between HIV/AIDS and malignancy by participation at national and international scientific meetings, contact with investigators who have productive research in this area and identifying, collecting, preserving, enhancing, and dispersing HIV
Effects of Recent Regional Soil Moisture Variability on Global Net Ecosystem CO2 Exchange
Jones, L. A.; Madani, N.; Kimball, J. S.; Reichle, R. H.; Colliander, A.
2017-12-01
Soil moisture exerts a major regional control on the inter-annual variability of the global land sink for atmospheric CO2. In semi-arid regions, annual biomass production is closely coupled to variability in soil moisture availability, while in cold-season-affected regions, summer drought offsets the effects of advancing spring phenology. Availability of satellite solar-induced fluorescence (SIF) observations and improvements in atmospheric inversions has led to unprecedented ability to monitor atmospheric sink strength. However, discrepancies still exist between such top-down estimates as atmospheric inversion and bottom-up process and satellite driven models, indicating that relative strength, mechanisms, and interaction of driving factors remain poorly understood. We use soil moisture fields informed by Soil Moisture Active Passive Mission (SMAP) observations to compare recent (2015-2017) and historic (2000-2014) variability in net ecosystem land-atmosphere CO2 exchange (NEE). The operational SMAP Level 4 Carbon (L4C) product relates ground-based flux tower measurements to other bottom-up and global top-down estimates to underlying soil moisture and other driving conditions using data-assimilation-based SMAP Level 4 Soil Moisture (L4SM). Droughts in coastal Brazil, South Africa, Eastern Africa, and an anomalous wet period in Eastern Australia were observed by L4C. A seasonal seesaw pattern of below-normal sink strength at high latitudes relative to slightly above-normal sink strength for mid-latitudes was also observed. Whereas SMAP-based soil moisture is relatively informative for short-term temporal variability, soil moisture biases that vary in space and with season constrain the ability of the L4C estimates to accurately resolve NEE. Such biases might be caused by irrigation and plant-accessible ground-water. Nevertheless, SMAP L4C daily NEE estimates connect top-down estimates to variability of effective driving factors for accurate estimates of regional
Discovery and History of Amino Acid Fermentation.
Hashimoto, Shin-Ichi
There has been a strong demand in Japan and East Asia for L-glutamic acid as a seasoning since monosodium glutamate was found to present umami taste in 1907. The discovery of glutamate fermentation by Corynebacterium glutamicum in 1956 enabled abundant and low-cost production of the amino acid, creating a large market. The discovery also prompted researchers to develop fermentative production processes for other L-amino acids, such as lysine. Currently, the amino acid fermentation industry is so huge that more than 5 million metric tons of amino acids are manufactured annually all over the world, and this number continues to grow. Research on amino acid fermentation fostered the notion and skills of metabolic engineering which has been applied for the production of other compounds from renewable resources. The discovery of glutamate fermentation has had revolutionary impacts on both the industry and science. In this chapter, the history and development of glutamate fermentation, including the very early stage of fermentation of other amino acids, are reviewed.