WorldWideScience

Sample records for receptor homologue m33

  1. Functional analysis of the murine cytomegalovirus chemokine receptor homologue M33: ablation of constitutive signaling is associated with an attenuated phenotype in vivo

    DEFF Research Database (Denmark)

    Case, Ruth; Sharp, Emma; Benned-Jensen, Tau

    2007-01-01

    the salivary glands. In this study, we probed N- and C-terminal regions of M33 as well as known 7TMR signature motifs in transmembrane (TM) II and TM III to determine the impact on cell surface expression, constitutive signaling, and in vivo phenotype. The region between amino acids R(340) and A(353) of the C...

  2. Partial functional complementation between human and mouse cytomegalovirus chemokine receptor homologues

    DEFF Research Database (Denmark)

    Farrell, Helen E; Abraham, Alexander M; Cardin, Rhonda D

    2011-01-01

    The human cytomegalovirus (CMV) proteins US28 and UL33 are homologous to chemokine receptors (CKRs). Knockout of the mouse CMV M33 protein (UL33 homologue) results in substantial attenuation of salivary gland infection/replication and reduced efficiency of reactivation from tissue explants. M33-m...

  3. The urokinase receptor and its structural homologue C4.4A in human cancer

    DEFF Research Database (Denmark)

    Jacobsen, B; Ploug, M

    2008-01-01

    The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

  4. Star Formation in M 33 (HerM33es)

    Science.gov (United States)

    Kramer, C.; Boquien, M.; Braine, J.; Buchbender, C.; Calzetti, D.; Gratier, P.; Mookerjea, B.; Relaño, M.; Verley, S.

    2011-11-01

    Within the key project "Herschel M 33 extended survey" (HerM33es), we are studying the physical and chemical processes driving star formation and galactic evolution in the nearby galaxy M 33, combining the study of local conditions affecting individual star formation with properties only becoming apparent on global scales. Here, we present recent results obtained by the HerM33es team. Combining Spitzer and Herschel data ranging from 3.6 μm to 500μm, along with H i, Hα, and GALEX UV data, we have studied the dust at high spatial resolutions of 150 pc, providing estimators of the total infrared (TIR) brightness and of the star formation rate. While the temperature of the warm dust at high brightness is driven by young massive stars, evolved stellar populations appear to drive the temperature of the cold dust. Plane-parallel models of photon dominated regions (PDRs) fail to reproduce fully the [C ii], [O i], and CO maps obtained in a first spectroscopic study of one 2' × 2' subregion of M 33, located on the inner, northern spiral arm and encompassing the H ii region BCLMP 302.

  5. Planck Observations of M33

    Science.gov (United States)

    Tibbs, C. T.; Israel, F. P.; Laureijs, R. J.; Tauber, J. A.; Partridge, B.; Peel, M. W.; Fauvet, L.

    2018-03-01

    We have performed a comprehensive investigation of the global integrated flux density of M33 from radio to ultraviolet wavelengths, finding that the data between ˜100 GHz and 3 THz are accurately described by a single modified blackbody curve with a dust temperature of Tdust = 21.67 ± 0.30 K and an effective dust emissivity index of βeff = 1.35 ± 0.10, with no indication of an excess of emission at millimeter/sub-millimeter wavelengths. However, sub-dividing M33 into three radial annuli, we found that the global emission curve is highly degenerate with the constituent curves representing the sub-regions of M33. We also found gradients in Tdust and βeff across the disk of M33, with both quantities decreasing with increasing radius. Comparing the M33 dust emissivity with that of other Local Group members, we find that M33 resembles the Magellanic Clouds rather than the larger galaxies, i.e., the Milky Way and M31. In the Local Group sample, we find a clear correlation between global dust emissivity and metallicity, with dust emissivity increasing with metallicity. A major aspect of this analysis is the investigation into the impact of fluctuations in the Cosmic Microwave Background (CMB) on the integrated flux density spectrum of M33. We found that failing to account for these CMB fluctuations would result in a significant over-estimate of Tdust by ˜5 K and an under-estimate of βeff by ˜0.4.

  6. Exploring M33 Through RR Lyrae Stars

    OpenAIRE

    Pritzl, Barton J.

    2013-01-01

    Recent surveys have detected RR Lyrae stars in M33, the Triangulum Galaxy. These variable stars are excellent tracers of ancient stellar populations. The RR Lyrae stars have been used to estimate metallicities at various locations within M33, as well as determining the distance to the galaxy. A summary of the M33 RR Lyrae stars is presented here as well as an analysis on what their properties imply for the unique M33 galaxy

  7. Conformationally restrained carbamoylcholine homologues. Synthesis, pharmacology at neuronal nicotinic acetylcholine receptors and biostructural considerations

    DEFF Research Database (Denmark)

    de la Fuente Revenga, M; Balle, Thomas; Jensen, Anders A.

    2015-01-01

    Exploration of small selective ligands for the nicotinic acetylcholine receptors (nAChRs) based on acetylcholine (ACh) has led to the development of potent agonists with clear preference for the α4β2 nAChR, the most prevalent nAChR subtype in the central nervous system. In this work we present...

  8. Molecular pharmacology of homologues of ibotenic acid at cloned metabotropic glutamic acid receptors

    DEFF Research Database (Denmark)

    Bräuner-Osborne, Hans; Nielsen, B; Krogsgaard-Larsen, P

    1998-01-01

    We have studied the effects of the enantiomers of 2-amino-3-(3-hydroxyisoxazol-5-yl)propionic acid (homoibotenic acid, HIBO) and analogues substituted with a methyl, bromo or butyl group in the four position of the ring at cloned metabotropic glutamate (mGlu) receptors expressed in Chinese hamster...... ovary (CHO) cells. In contrast to the parent compound ibotenic acid, which is a potent group I and II agonist, the (S)-forms of homoibotenic acid and its analogues are selective and potent group I antagonists whereas the (R)-forms are inactive both as agonists and antagonists at group I, II, and III m......Glu receptors. Interestingly, (S)-homoibotenic acid and the analogues display equal potency at both mGlu1alpha and mGlu5a with Ki values in the range of 97 to 490 microM, (S)-homoibotenic acid and (S)-2-amino-3-(4-butyl-3-hydroxyisoxazol-5-yl)propionic acid [(S)-4-butylhomoibotenic acid] displaying the lowest...

  9. The monomeric orphan nuclear receptor Schistosoma mansoni Ftz-F1 dimerizes specifically and functionally with the schistosome RXR homologue, SmRXR1

    International Nuclear Information System (INIS)

    Bertin, Benjamin; Caby, Stephanie; Oger, Frederik; Sasorith, Souphatta; Wurtz, Jean-Marie; Pierce, Raymond J.

    2005-01-01

    In an attempt to understand development and differentiation processes of the parasitic blood fluke Schistosoma mansoni, several members of the nuclear receptor superfamily were cloned, including SmFtz-F1 (S. mansoni Fushi Tarazu-factor 1). The Ftz-F1 nuclear receptor subfamily only contains orphan receptors that bind to their response element as monomers. Whereas SmFtz-F1 displays these basic functional properties, we have identified an original and specific interaction between SmFtz-F1 and the schistosome RXR homologue, SmRXR1. The mammalian two-hybrid assay showed that the D, E, and F domains of SmFtz-F1 were capable of interacting specifically with the E domain of SmRXR1 but not with that of mouse RXRα. Using three-dimensional LBD homology modelling and structure-guided mutagenesis, we were able to demonstrate the essential role of exposed residues located in the dimerization interfaces of both receptors in the maintenance of the interaction. Cotransfection experiments with constructions encoding full-length nuclear receptors show that SmRXR1 potentiates the transcriptional activity of SmFtz-F1 from various promoters. Nevertheless, the lack of identification of a dimeric response element for this SmFtz-F1/SmRXR1 heterodimer seems to indicate a 'tethering' mechanism. Thus, our results suggest for the first time that a member of the Ftz-F1 family could heterodimerize functionally with a homologue of the universal heterodimerization partner of nuclear receptors. This unique property confirms that SmFtz-F1 may be involved in the development and differentiation of schistosome-specific structures

  10. Wolf--Rayet stars of M33

    International Nuclear Information System (INIS)

    Corso, G.J. Jr.

    1975-01-01

    A comprehensive study of the 54 known Wolf--Rayet stars of M33 is undertaken with the intention of improving our knowledge of the Wolf--Rayet phenomenon, identifying significant features of their distribution in an Sc galaxy, and discerning possible trends in the variation of chemical composition of the interstellar medium from place to place within that galaxy. Thirty-seven of these stars were classified for the first time into carbon and nitrogen sequences on the basis of photographic photometry of image tube plates obtained with the Kitt Peak 84-inch telescope and an ITT magnetically focused image tube equipped with a set of narrow-band interference filters designed to isolate the broad emission features between 4640 A and 4686 A due to N III, C III-IV, and He II. The subclasses WC6-9, missing in the Large Magellanic Cloud, were found in M33, although there is a tendency for the known stars of both sequences to belong to the high-excitation subclasses. The distribution of these stars was compared with the distributions of luminous blue stars, dust, and H II regions. Star counts on the image tube plates indicated that one out of every 75 stars in M33 brighter than M/sub B/ = --4.5 is a Wolf--Rayet star

  11. GEI-8, a homologue of vertebrate nuclear receptor corepressor NCoR/SMRT, regulates gonad development and neuronal functions in Caenorhabditis elegans.

    Directory of Open Access Journals (Sweden)

    Pavol Mikoláš

    Full Text Available NCoR and SMRT are two paralogous vertebrate proteins that function as corepressors with unliganded nuclear receptors. Although C. elegans has a large number of nuclear receptors, orthologues of the corepressors NCoR and SMRT have not unambiguously been identified in Drosophila or C. elegans. Here, we identify GEI-8 as the closest homologue of NCoR and SMRT in C. elegans and demonstrate that GEI-8 is expressed as at least two isoforms throughout development in multiple tissues, including neurons, muscle and intestinal cells. We demonstrate that a homozygous deletion within the gei-8 coding region, which is predicted to encode a truncated protein lacking the predicted NR domain, results in severe mutant phenotypes with developmental defects, slow movement and growth, arrested gonadogenesis and defects in cholinergic neurotransmission. Whole genome expression analysis by microarrays identified sets of de-regulated genes consistent with both the observed mutant phenotypes and a role of GEI-8 in regulating transcription. Interestingly, the upregulated transcripts included a predicted mitochondrial sulfide:quinine reductase encoded by Y9C9A.16. This locus also contains non-coding, 21-U RNAs of the piRNA class. Inhibition of the expression of the region coding for 21-U RNAs leads to irregular gonadogenesis in the homozygous gei-8 mutants, but not in an otherwise wild-type background, suggesting that GEI-8 may function in concert with the 21-U RNAs to regulate gonadogenesis. Our results confirm that GEI-8 is the orthologue of the vertebrate NCoR/SMRT corepressors and demonstrate important roles for this putative transcriptional corepressor in development and neuronal function.

  12. Structural domains required for channel function of the mouse transient receptor potential protein homologue TRP1beta.

    Science.gov (United States)

    Engelke, Michael; Friedrich, Olaf; Budde, Petra; Schäfer, Christina; Niemann, Ursula; Zitt, Christof; Jüngling, Eberhard; Rocks, Oliver; Lückhoff, Andreas; Frey, Jürgen

    2002-07-17

    Transient receptor potential proteins (TRP) are supposed to participate in the formation of store-operated Ca(2+) influx channels by co-assembly. However, little is known which domains facilitate the interaction of subunits. Contribution of the N-terminal coiled-coil domain and ankyrin-like repeats and the putative pore region of the mouse TRP1beta (mTRP1beta) variant to the formation of functional cation channels were analyzed following overexpression in HEK293 (human embryonic kidney) cells. MTRP1beta expressing cells exhibited enhanced Ca(2+) influx and enhanced whole-cell membrane currents compared to mTRP1beta deletion mutants. Using a yeast two-hybrid assay only the coiled-coil domain facilitated homodimerization of the N-terminus. These results suggest that the N-terminus of mTRP1beta is required for structural organization thus forming functional channels.

  13. Three newly identified galectin homologues from triangle sail mussel (Hyriopsis cumingii) function as potential pattern-recognition receptors.

    Science.gov (United States)

    Zhao, Ling-Ling; Hui, Kaimin; Wang, Yu-Qing; Wang, Yue; Ren, Qian; Li, Xin-Cang

    2018-05-01

    Galactoside-binding lectins, also known as galectins, play crucial roles in innate immune response in invertebrates. In this study, three cDNA sequences from Hyriopsis cumingii were identified and collectively called HcGalec genes. Each of the three deduced HcGalec proteins contained a galactose-binding lectin domain or a GLECT domain. All the three HcGalec genes are mainly present in the hepatopancreas and gills, and their expression is induced at 24 h after bacterial challenge. Three recombinant HcGalec proteins can bind and agglutinate (Ca 2+ -dependent) various microorganisms, including Gram-positive and Gram-negative bacteria. These proteins can attach to mannan and peptidoglycan. Meanwhile, the expression of the three HcGalec genes in the gills were significantly down-regulated after dsRNA interference (HcGalec1-RNAi, HcGalec2-RNAi, and HcGalec3-RNAi) and Vibrio parahaemolyticus injection. The expression levels of some antimicrobial peptides, including lysozyme 1 and lysozyme 2, were also markedly decreased after dsRNA interference. Overall, these results suggested that these three HcGalec proteins may function as potential receptors participating in the innate immune responses of H. cumingii against bacterial infection. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. Pepsin homologues in bacteria

    Directory of Open Access Journals (Sweden)

    Bateman Alex

    2009-09-01

    Full Text Available Abstract Background Peptidase family A1, to which pepsin belongs, had been assumed to be restricted to eukaryotes. The tertiary structure of pepsin shows two lobes with similar folds and it has been suggested that the gene has arisen from an ancient duplication and fusion event. The only sequence similarity between the lobes is restricted to the motif around the active site aspartate and a hydrophobic-hydrophobic-Gly motif. Together, these contribute to an essential structural feature known as a psi-loop. There is one such psi-loop in each lobe, and so each lobe presents an active Asp. The human immunodeficiency virus peptidase, retropepsin, from peptidase family A2 also has a similar fold but consists of one lobe only and has to dimerize to be active. All known members of family A1 show the bilobed structure, but it is unclear if the ancestor of family A1 was similar to an A2 peptidase, or if the ancestral retropepsin was derived from a half-pepsin gene. The presence of a pepsin homologue in a prokaryote might give insights into the evolution of the pepsin family. Results Homologues of the aspartic peptidase pepsin have been found in the completed genomic sequences from seven species of bacteria. The bacterial homologues, unlike those from eukaryotes, do not possess signal peptides, and would therefore be intracellular acting at neutral pH. The bacterial homologues have Thr218 replaced by Asp, a change which in renin has been shown to confer activity at neutral pH. No pepsin homologues could be detected in any archaean genome. Conclusion The peptidase family A1 is found in some species of bacteria as well as eukaryotes. The bacterial homologues fall into two groups, one from oceanic bacteria and one from plant symbionts. The bacterial homologues are all predicted to be intracellular proteins, unlike the eukaryotic enzymes. The bacterial homologues are bilobed like pepsin, implying that if no horizontal gene transfer has occurred the duplication

  15. THE DISCOVERY OF REMOTE GLOBULAR CLUSTERS IN M33

    International Nuclear Information System (INIS)

    Huxor, A.; Ferguson, A. M. N.; Barker, M. K.; Tanvir, N. R.; Irwin, M. J.; Chapman, S. C.; Ibata, R.; Lewis, G.

    2009-01-01

    We present the discovery of four remote star clusters in M33, one of which is of an extended nature. Three of the clusters were discovered using survey data from the Isaac Newton Telescope Wide-Field Camera while one was discovered serendipitously in a deep image taken with the Hubble Space Telescope's Advanced Camera for Surveys. With projected radii of 38-113 arcmin (9.6-28.5 kpc for an assumed M33 distance of 870 kpc), these clusters lie significantly beyond all but one of the currently confirmed clusters in M33. The clusters have magnitudes and colors consistent with their being old to intermediate-age globular clusters (GCs). Indeed, they bear a strong resemblance to the outer halo GC population of the Milky Way and M31 in terms (V - I) 0 color. The three outermost clusters are projected on the far side of M33 with respect to M31, an asymmetry that could suggest tidal interactions have affected M33's GC distribution at large radii.

  16. BVI photometry of star clusters in M33

    International Nuclear Information System (INIS)

    Christian, C.A.; Schommer, R.A.

    1988-01-01

    CCD images of candidate star clusters in M33 were obtained for 13 fields in the B, V, and I bandpasses. The integrated visual colors and magnitudes are used to study the clusters, and evidence for extended giant branches and possibly carbon stars in several of the intermediate-aged clusters is presented. The colors, magnitudes, and positions are used to analyze stellar population of M33 and confirm the existence of massive star clusters with a 0.1-10-Gyr age range. That is, the cluster system of M33 shares some similarities to that of the Magellanic Clouds in that relatively massive clusters are found at all ages. In addition, more than 20 true (i.e., old, massive) globulars are identified. A substantial population of intermediate-color clusters are found, and it is argued that the cluster-formation rate for clusters less than 10 Gyr old may be more continuous in M33 than in the Magellanic Clouds. The chemical evolution of M33 as traced by the clusters suggests that an abundance gradient existed at all ages, in that the outer regions of the disk (i.e., R greater than 10 arcmin or 2 kpc) follow a slow enhancement history similar to the SMC, while the inner regions were enriched more dramatically. 59 references

  17. The chicken type III GnRH receptor homologue is predominantly expressed in the pituitary, and exhibits similar ligand selectivity to the type I receptor

    Science.gov (United States)

    Joseph, Nerine T; Morgan, Kevin; Sellar, Robin; McBride, Derek; Millar, Robert P; Dunn, Ian C

    2009-01-01

    Two GnRH isoforms (cGnRH-I and GnRH-II) and two GnRH receptor subtypes (cGnRH-R-I and cGnRH-R-III) occur in chickens. Differential roles for these molecules in regulating gonadotrophin secretion or other functions are unclear. To investigate this we cloned cGnRH-R-III from a broiler chicken and compared its structure, expression and pharmacological properties with cGnRH-R-I. The broiler cGnRH-R-III cDNA was 100% identical to the sequence reported in the red jungle fowl and white leghorn breed. Pituitary cGnRH-R-III mRNA was ∼1400-fold more abundant than cGnRH-R-I mRNA. Northern analysis indicated a single cGnRH-R-III transcript. A pronounced sex and age difference existed, with higher pituitary transcript levels in sexually mature females versus juvenile females. In contrast, higher expression levels occurred in juvenile males versus sexually mature males. Functional studies in COS-7 cells indicated that cGnRH-R-III has a higher binding affinity for GnRH-II than cGnRH-I (Kd: 0·57 vs 19·8 nM) with more potent stimulation of inositol phosphate production (ED50: 0·8 vs 4·38 nM). Similar results were found for cGnRH-R-I, (Kd: 0·51 vs 10·8 nM) and (ED50: 0·7 vs 2·8 nM). The initial rate of internalisation was faster for cGnRH-R-III than cGnRH-R-I (26 vs 15·8%/min). Effects of GnRH antagonists were compared at the two receptors. Antagonist #27 distinguished between cGnRH-R-I and cGnRH-R-III (IC50: 2·3 vs 351 nM). These results suggest that cGnRH-R-III is probably the major mediator of pituitary gonadotroph function, that antagonist #27 may allow delineation of receptor subtype function in vitro and in vivo and that tissue-specific recruitment of cGnRH-R isoforms has occurred during evolution. PMID:19380456

  18. The M33 Synoptic Stellar Survey. II. Mira Variables

    Energy Technology Data Exchange (ETDEWEB)

    Yuan, Wenlong; Macri, Lucas M. [George P. and Cynthia W. Mitchell Institute for Fundamental Physics and Astronomy, Department of Physics and Astronomy, Texas A and M University, College Station, TX 77843 (United States); He, Shiyuan; Long, James; Huang, Jianhua Z., E-mail: lmacri@tamu.edu [Department of Statistics, Texas A and M University, College Station, TX 77843 (United States)

    2017-04-01

    We present the discovery of 1847 Mira candidates in the Local Group galaxy M33 using a novel semi-parametric periodogram technique coupled with a random forest classifier. The algorithms were applied to ∼2.4 × 10{sup 5} I -band light curves previously obtained by the M33 Synoptic Stellar Survey. We derive preliminary period–luminosity relations at optical, near-infrared, and mid-infrared wavelengths and compare them to the corresponding relations in the Large Magellanic Cloud.

  19. ON THE SPECTROSCOPIC CLASSES OF NOVAE IN M33

    International Nuclear Information System (INIS)

    Shafter, A. W.; Darnley, M. J.; Bode, M. F.; Ciardullo, R.

    2012-01-01

    We report the initial results from an ongoing multi-year spectroscopic survey of novae in M33. The survey resulted in the spectroscopic classification of six novae (M33N 2006-09a, 2007-09a, 2009-01a, 2010-10a, 2010-11a, and 2011-12a) and a determination of rates of decline (t 2 times) for four of them (2006-09a, 2007-09a, 2009-01a, and 2010-10a). When these data are combined with existing spectroscopic data for two additional M33 novae (2003-09a and 2008-02a), we find that five of the eight novae with available spectroscopic class appear to be members of either the He/N or Fe IIb (hybrid) classes, with only two clear members of the Fe II spectroscopic class. This initial finding is very different from what would be expected based on the results for M31 and the Galaxy where Fe II novae dominate, and the He/N and Fe IIb classes together make up only ∼20% of the total. It is plausible that the increased fraction of He/N and Fe IIb novae observed in M33 thus far may be the result of the younger stellar population that dominates this galaxy, which is expected to produce novae that harbor generally more massive white dwarfs than those typically associated with novae in M31 or the Milky Way.

  20. Molecular clouds in M31 and M33

    International Nuclear Information System (INIS)

    Blitz, L.

    1985-01-01

    In order to determine the properties of the molecular clouds in nearby spiral galaxies, 49 H II regions in M31 and 6 H II regions in M33 were observed using the J = 1→0 transition of CO. Of these, 17 were detected in M31 and two in M33. For the CO detection in M31, = 0.14 K, = 12.5 km s -1 , and = 2.1 K km s -1 . The two detections in M33, which are toward the giant H II regions NGC 604 and NGC 595, are somewhat weaker than the mean values for clouds in M31, neither T(/sub R/ nor ΔV shows any gradient with galactic radius, but is a decreasing function of radius. The mean values of and are considerably larger than the values that would be obtained by extrapolating local giant molecular clouds to the distance of M31. It is suggested that most of the CO emission is from small clouds in the beam which overwhelm the emission from the giant molecular clouds. Some observational tests of this suggestion are proposed. Like the molecular clouds in the Milky Way, the giant molecular clouds in M31 appear to be tidally limited. In M33 the larger inclination angle would make the observed contribution from small molecular clouds less significant, which is consistent with the observations

  1. PACS and SPIRE photometer maps of M33 : First results of the HERschel M33 Extended Survey (HERM33ES)

    NARCIS (Netherlands)

    Kramer, C.; Buchbender, C.; Xilouris, E. M.; Boquien, M.; Braine, J.; Calzetti, D.; Lord, S.; Mookerjea, B.; Quintana-Lacaci, G.; Relano, M.; Stacey, G.; Tabatabaei, F. S.; Verley, S.; Aalto, S.; Akras, S.; Albrecht, M.; Anderl, S.; Beck, R.; Bertoldi, F.; Combes, F.; Dumke, M.; Garcia-Burillo, S.; Gonzalez, M.; Gratier, P.; Guesten, R.; Henkel, C.; Israel, F. P.; Koribalski, B.; Lundgren, A.; Martin-Pintado, J.; Roellig, M.; Rosolowsky, E.; Schuster, K. F.; Sheth, K.; Sievers, A.; Stutzki, J.; Tilanus, R.P.J.; van der Tak, F.; Wiedner, M. C.; van der Werf, Paul P.

    Context. Within the framework of the HERM33ES key program, we are studying the star forming interstellar medium in the nearby, metal-poor spiral galaxy M33, exploiting the high resolution and sensitivity of Herschel. Aims. We use PACS and SPIRE maps at 100, 160, 250, 350, and 500 mu m wavelength, to

  2. Analysis of WFCAM images of M33 galaxy

    Directory of Open Access Journals (Sweden)

    Najme Golabtooni

    2014-03-01

    Full Text Available In this study, 1200 images and catalogues of M33 spiral galaxy taken by WFCAM camera at UKIRT telescope in J, H and K bands. Cross correlation methods were employed to identify stars in overlapping regions from among images taken in different dates. Careful astrometric and photometric analysis was made to calibrate stellar positions and magnitudes using their 2MASS near infra red survey. The final catalogue consisted of 445303 stars and covered more than 0.75 square degrees of sky centered on M33 core, which included the bulge and spiral arms. This is the biggest catalogue ever made from a nearby spiral galaxy in near infrared. A color magnitude diagram in near infrared was plotted, which shows a bunch of very red stars that extended to J-K = 4.

  3. Neutral hydrogen and spiral structure in M33

    International Nuclear Information System (INIS)

    Newton, K.

    1980-01-01

    Observations of neutral hydrogen (H I) in the galaxy M33 are presented which have sufficient angular resolution (47 x 93 arcsec) to distinguish detailed H I spiral structure for the first time. H I spiral features extend over the entire disc; the pattern is broken and multi-armed with the best-defined arms lying at radii outside the brightest optical features. Several very narrow spiral 'filaments' are unresolved by the beam, implying true widths -1 , is perturbed near the inner spiral arms. These perturbations agree with the predictions of density-wave theory but may simply arise from the self-gravity of massive arms whether or not they are a quasi-stationary wave phenomenon. If the outer spiral features form a rigidly rotating density-wave pattern, the absence of large radial streaming motions along the features implies a small pattern speed ( -1 kpc -1 ), with corotation in the outer parts of the disc. (author)

  4. Improved optical spectrophotometry of supernova remnants in M33

    Science.gov (United States)

    Blair, W. P.; Kirshner, R. P.

    1985-01-01

    Optical spectra of SNRs in M33 have been used to investigate abundance gradients and SNR evolution in this galaxy. Abundances of O, N, and S are derived from the spectra using new shock models by Dopita et al. (1984). The results for N and S show abundance gradients similar to those in NGC 300 and the Galaxy. The O abundances may be affected by possible contamination from H II regions and low-velocity shocks. Electron densities derived from the forbidden S II 6717 A/6731 A line ratio are used with a pressure equilibrium argument to estimate the initial explosion energy for each SNR. Evolutionary models for the remnants are investigated, and the distribution of the number of remnants with diameter is found to be consistent with free expansion of the SNRs to diameters of about 26 pc. The results may also be consistent with Sedov evolution if the ranges of initial supernova energies and surrounding interstellar medium densities are large enough.

  5. Cloning of a protein arginine methyltransferase PRMT1 homologue from Schistosoma mansoni: Evidence for roles in nuclear receptor signaling and RNA metabolism

    International Nuclear Information System (INIS)

    Mansure, Jose Joao; Furtado, Daniel Rodrigues; Bastos de Oliveira, Francisco Meirelles; Rumjanek, Franklin David; Franco, Gloria Regina; Fantappie, Marcelo Rosado

    2005-01-01

    The most studied arginine methyltransferase is the type I enzyme, which catalyzes the transfer of an S-adenosyl-L-methionine to a broad spectrum of substrates, including histones, RNA-transporting proteins, and nuclear hormone receptor coactivators. We cloned a cDNA encoding a protein arginine methyltransferase in Schistosoma mansoni (SmPRMT1). SmPRMT1 is highly homologous to the vertebrate PRMT1 enzyme. In vitro methylation assays showed that SmPRMT1 recombinant protein was able to specifically methylate histone H4. Two schistosome proteins likely to be involved in RNA metabolism, SMYB1 and SmSmD3, that display a number of RGG motifs, were strongly methylated by SmPRMT1. In vitro GST pull-down assays showed that SMYB1 and SmSmD3 physically interacted with SmPRMT1. Additional GST pull-down assay suggested the occurrence of a ternary complex including SmPRMT1, SmRXR1 nuclear receptor, and the p160 (SRC-1) nuclear receptor coactivator. Together, these data suggest a mechanism by which SmPRMT1 plays a role in nuclear receptor-mediated chromatin remodeling and RNA transactions

  6. ANGULAR MOMENTUM IN GIANT MOLECULAR CLOUDS. II. M33

    International Nuclear Information System (INIS)

    Imara, Nia; Bigiel, Frank; Blitz, Leo

    2011-01-01

    We present an analysis comparing the properties of 45 giant molecular clouds (GMCs) in M33 and the atomic hydrogen (H I) with which they are associated. High-resolution Very Large Array observations are used to measure the properties of H I in the vicinity of GMCs and in regions where GMCs have not been detected. The majority of molecular clouds coincide with a local peak in the surface density of atomic gas, though 7% of GMCs in the sample are not associated with high surface density atomic gas. The mean H I surface density in the vicinity of GMCs is 10 M sun pc -2 and tends to increase with GMC mass as Σ HI ∝ M 0.27 GMC . Thirty-nine of the 45 H I regions surrounding GMCs have linear velocity gradients of ∼0.05 km s -1 pc -1 . If the linear gradients previously observed in the GMCs result from rotation, 53% are counterrotating with respect to the local H I. And if the linear gradients in these local H I regions are also from rotation, 62% are counterrotating with respect to the galaxy. If magnetic braking reduced the angular momentum of GMCs early in their evolution, the angular velocity of GMCs would be roughly one order of magnitude lower than what is observed. Based on our observations, we consider the possibility that GMCs may not be rotating. Atomic gas not associated with GMCs has gradients closer to 0.03 km s -1 pc -1 , suggesting that events occur during the course of GMC evolution that may increase the shear in the atomic gas.

  7. Combination of Hypomorphic Mutations of the Drosophila Homologues of Aryl Hydrocarbon Receptor and Nucleosome Assembly Protein Family Genes Disrupts Morphogenesis, Memory and Detoxification

    OpenAIRE

    Kuzin, Boris A.; Nikitina, Ekaterina A.; Cherezov, Roman O.; Vorontsova, Julia E.; Slezinger, Mikhail S.; Zatsepina, Olga G.; Simonova, Olga B.; Enikolopov, Grigori N.; Savvateeva-Popova, Elena V.

    2014-01-01

    Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response...

  8. Fisetin up-regulates the expression of adiponectin in 3T3-L1 adipocytes via the activation of silent mating type information regulation 2 homologue 1 (SIRT1)-deacetylase and peroxisome proliferator-activated receptors (PPARs).

    Science.gov (United States)

    Jin, Taewon; Kim, Oh Yoen; Shin, Min-Jeong; Choi, Eun Young; Lee, Sung Sook; Han, Ye Sun; Chung, Ji Hyung

    2014-10-29

    Adiponectin, an adipokine, has been described as showing physiological benefits against obesity-related malfunctions and vascular dysfunction. Several natural compounds that promote the expression and secretion of adipokines in adipocytes could be useful for treating metabolic disorders. This study investigated the effect of fisetin, a dietary flavonoid, on the regulation of adiponectin in adipocytes using 3T3-L1 preadipocytes. The expression and secretion of adiponectin increased in 3T3-L1 cells upon treatment with fisetin in a dose-dependent manner. Fisetin-induced adiponectin secretion was inhibited by peroxisome proliferator-activated receptor (PPAR) antagonists. It was also revealed that fisetin increased the activities of PPARs and silent mating type information regulation 2 homologue 1 (SIRT1) in a dose-dependent manner. Furthermore, the up-regulation of adiponectin and the activation of PPARs induced by fisetin were prevented by a SIRT1 inhibitor. Fisetin also promoted deacetylation of PPAR γ coactivator 1 (PGC-1) and its interaction with PPARs. SIRT knockdown by siRNA significantly decreased both adiponectin production and PPARs-PGC-1 interaction. These results provide evidence that fisetin promotes the gene expression of adiponectin through the activation of SIRT1 and PPARs in adipocytes.

  9. Combination of hypomorphic mutations of the Drosophila homologues of aryl hydrocarbon receptor and nucleosome assembly protein family genes disrupts morphogenesis, memory and detoxification.

    Science.gov (United States)

    Kuzin, Boris A; Nikitina, Ekaterina A; Cherezov, Roman O; Vorontsova, Julia E; Slezinger, Mikhail S; Zatsepina, Olga G; Simonova, Olga B; Enikolopov, Grigori N; Savvateeva-Popova, Elena V

    2014-01-01

    Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response and long-term memory formation in Drosophila melanogaster. Oxidative stress was induced by low doses of X-ray irradiation of flies carrying hypomorphic mutation of spineless, mutation of CG5017, and their combination. To determine the sensitivity of these mutants to pharmacological modifiers of the irradiation effect, we irradiated flies growing on standard medium supplemented by radiosensitizer furazidin and radioprotector serotonin. The effects of irradiation were investigated by analyzing leg and antenna morphological structures and by using real-time PCR to measure mRNA expression levels for spineless, Cyp6g1 and Gst-theta genes. We also examined long-term memory in these mutants using conditioned courtship suppression paradigm. Our results show that the interaction of spineless and CG5017 is important for regulation of morphogenesis, long-term memory formation, and detoxification during oxidative stress. Since spineless and CG5017 are evolutionary conserved, these results must be considered when evaluating the risk of combining similar mutations in other organisms, including humans.

  10. Combination of hypomorphic mutations of the Drosophila homologues of aryl hydrocarbon receptor and nucleosome assembly protein family genes disrupts morphogenesis, memory and detoxification.

    Directory of Open Access Journals (Sweden)

    Boris A Kuzin

    Full Text Available Aryl hydrocarbon receptor is essential for biological responses to endogenous and exogenous toxins in mammals. Its Drosophila homolog spineless plays an important role in fly morphogenesis. We have previously shown that during morphogenesis spineless genetically interacts with CG5017 gene, which encodes a nucleosome assembly factor and may affect cognitive function of the fly. We now demonstrate synergistic interactions of spineless and CG5017 in pathways controlling oxidative stress response and long-term memory formation in Drosophila melanogaster. Oxidative stress was induced by low doses of X-ray irradiation of flies carrying hypomorphic mutation of spineless, mutation of CG5017, and their combination. To determine the sensitivity of these mutants to pharmacological modifiers of the irradiation effect, we irradiated flies growing on standard medium supplemented by radiosensitizer furazidin and radioprotector serotonin. The effects of irradiation were investigated by analyzing leg and antenna morphological structures and by using real-time PCR to measure mRNA expression levels for spineless, Cyp6g1 and Gst-theta genes. We also examined long-term memory in these mutants using conditioned courtship suppression paradigm. Our results show that the interaction of spineless and CG5017 is important for regulation of morphogenesis, long-term memory formation, and detoxification during oxidative stress. Since spineless and CG5017 are evolutionary conserved, these results must be considered when evaluating the risk of combining similar mutations in other organisms, including humans.

  11. AN UPDATED CATALOG OF M33 CLUSTERS AND CANDIDATES: UBVRI PHOTOMETRY AND SOME STATISTICAL RESULTS

    International Nuclear Information System (INIS)

    Ma Jun

    2012-01-01

    We present UBVRI photometry for 392 star clusters and candidates in the field of M33, which are selected from the most recent star cluster catalog. In this catalog, the authors listed star clusters' parameters such as cluster positions, magnitudes, colors in the UBVRIJHK s filters, and so on. However, a large fraction of objects in this catalog do not have previously published photometry. Photometry is performed using archival images from the Local Group Galaxies Survey, which covers 0.8 deg 2 along the major axis of M33. Detailed comparisons show that, in general, our photometry is consistent with previous measurements. Positions (right ascension and declination) for some clusters are corrected here. Combined with previous literature, ours constitute a large sample of M33 star clusters. Based on this cluster sample, we present some statistical results: none of the youngest M33 clusters (∼10 7 yr) have masses approaching 10 5 M ☉ ; roughly half the star clusters are consistent with the 10 4 -10 5 M ☉ mass models; the continuous distribution of star clusters along the model line indicates that M33 star clusters have been formed continuously from the epoch of the first star cluster formation until recent times; and there are ∼50 star clusters which are overlapped with the Galactic globular clusters on the color-color diagram, and these clusters are old globular cluster candidates in M33.

  12. Distance to M33 determined from magnitude corrections to Hubble's original cepheid photometry

    International Nuclear Information System (INIS)

    Sandage, A.

    1983-01-01

    New photoelectric photometry in Selected Area 45, and transfers from a faint photoelectric sequence adjacent to the south-preceding arm in M33 have been made to the comparison stars for Hubble's Cepheids in M33. Progressive magnitude corrections are required to Hubble's M33 scales, reaching 2.8 mag at the limit of the Mount Wilson 2.5-m Hooker reflector. Hubble's Cepheid light curves have been corrected to the B photoelectric system, and new photometric parameters are given for 35 of his variables. The P-L relation agrees in zero point to within 0.2 mag of the P-L relation from independent data by Sandage and Carlson for 12 new Cepheids in an outlying region of M33. Application of an adopted absolute P-L relation, calibrated by Martin, Warren, and Feast, to these data gives an apparent blue modulus of (m-M)/sup AB//sub M33/ = 25.35, which is 0.67 mag fainter than a previously adopted value, and represents a factor of 4.2 increase of Hubble's earliest distance. Three consequences of this larger apparent distance modulus are (1) the mean absolute magnitude of the first three brightest red supergiants is M/sup max//sub left-angle-bracketV/(3)> = -8.7 rather than approx.-8.0 in M33, complicating but not destroying use of red supergiants as distance indicators, (2) the mean absolute magnitude of the two brightest blue irregular supergiant variables is M/sub left-angle-bracketB/(2)> = -9.95, which is close to the value for the brightest known supergiants in the galaxy, and (3) the absolute magnitude of M33 itself is brighter than heretofore assumed

  13. Monitoring pulsating giant stars in M33: star formation history and chemical enrichment

    Science.gov (United States)

    Javadi, A.; van Loon, J. Th

    2017-06-01

    We have conducted a near-infrared monitoring campaign at the UK InfraRed Telescope (UKIRT), of the Local Group spiral galaxy M33 (Triangulum). A new method has been developed by us to use pulsating giant stars to reconstruct the star formation history of galaxies over cosmological time as well as using them to map the dust production across their host galaxies. In first Instance the central square kiloparsec of M33 was monitored and long period variable stars (LPVs) were identified. We give evidence of two epochs of a star formation rate enhanced by a factor of a few. These stars are also important dust factories, we measure their dust production rates from a combination of our data with Spitzer Space Telescope mid-IR photometry. Then the monitoring survey was expanded to cover a much larger part of M33 including spiral arms. Here we present our methodology and describe results for the central square kiloparsec of M33 [1-4] and disc of M33 [5-8].

  14. Monitoring pulsating giant stars in M33: star formation history and chemical enrichment

    International Nuclear Information System (INIS)

    Javadi, A; Van Loon, J Th

    2017-01-01

    We have conducted a near-infrared monitoring campaign at the UK InfraRed Telescope (UKIRT), of the Local Group spiral galaxy M33 (Triangulum). A new method has been developed by us to use pulsating giant stars to reconstruct the star formation history of galaxies over cosmological time as well as using them to map the dust production across their host galaxies. In first Instance the central square kiloparsec of M33 was monitored and long period variable stars (LPVs) were identified. We give evidence of two epochs of a star formation rate enhanced by a factor of a few. These stars are also important dust factories, we measure their dust production rates from a combination of our data with Spitzer Space Telescope mid-IR photometry. Then the monitoring survey was expanded to cover a much larger part of M33 including spiral arms. Here we present our methodology and describe results for the central square kiloparsec of M33 [1–4] and disc of M33 [5–8]. (paper)

  15. THE M33 GLOBULAR CLUSTER SYSTEM WITH PAndAS DATA: THE LAST OUTER HALO CLUSTER?

    International Nuclear Information System (INIS)

    Cockcroft, Robert; Harris, William E.; Ferguson, Annette M. N.

    2011-01-01

    We use CFHT/MegaCam data to search for outer halo star clusters in M33 as part of the Pan-Andromeda Archaeological Survey. This work extends previous studies out to a projected radius of 50 kpc and covers over 40 deg 2 . We find only one new unambiguous star cluster in addition to the five previously known in the M33 outer halo (10 kpc ≤ r ≤ 50 kpc). Although we identify 2440 cluster candidates of various degrees of confidence from our objective image search procedure, almost all of these are likely background contaminants, mostly faint unresolved galaxies. We measure the luminosity, color, and structural parameters of the new cluster in addition to the five previously known outer halo clusters. At a projected radius of 22 kpc, the new cluster is slightly smaller, fainter, and redder than all but one of the other outer halo clusters, and has g' ∼ 19.9, (g' - i') ∼ 0.6, concentration parameter c ∼ 1.0, a core radius r c ∼ 3.5 pc, and a half-light radius r h ∼ 5.5 pc. For M33 to have so few outer halo clusters compared to M31 suggests either tidal stripping of M33's outer halo clusters by M31, or a very different, much calmer accretion history of M33.

  16. Comparison of M33 and NGC7793: stochastic models of spiral galaxies modulated by density waves

    International Nuclear Information System (INIS)

    Smith, G.; Elmegreen, B.G.; Elmegreen, D.M.

    1984-01-01

    Two late-type spiral galaxies with similar kinematic and photometric properties but different spiral arm structures, M33 and NGC7793, are compared to model galaxies with stochastic self-propagating star formation. The spontaneous probability, Psub(sp), representing the rate of primary star formation, is modulated by a smooth, density wave-like spiral pattern in the models of M33. When propagating star formation is included, these models show no age gradients in the underlying spiral arms. Models which have no imposed spiral modulation to Psub(sp) resemble the observed structure of NGC7793. (author)

  17. THE PHOTOMETRIC PROPERTIES OF A VAST STELLAR SUBSTRUCTURE IN THE OUTSKIRTS OF M33

    International Nuclear Information System (INIS)

    McConnachie, Alan W.; Ferguson, Annette M. N.; Irwin, Michael J.; Dubinski, John; Widrow, Lawrence M.; Dotter, Aaron; Ibata, Rodrigo; Lewis, Geraint F.

    2010-01-01

    We have surveyed approximately 40 deg 2 surrounding M33 with Canada-France-Hawaii Telescope MegaCam/MegaPrime in the g and i filters out to a maximum projected radius from this galaxy of 50 kpc, as part of the Pan-Andromeda Archaeological Survey (PAndAS). Our observations are deep enough to resolve the top ∼4 mag of the red giant branch population in this galaxy. We have previously shown that the disk of M33 is surrounded by a large, irregular, low surface brightness substructure. Here, we quantify the stellar populations and structure of this feature using the PAndAS data. We show that the stellar populations of this feature are consistent with an old population with ([Fe/H]) ∼ -1.6 dex and an interquartile range in metallicity of ∼0.5 dex. We construct a surface brightness map of M33 that traces this feature to μ V ≅ 33 mag arcsec -2 . At these low surface brightness levels, the structure extends to projected radii of ∼40 kpc from the center of M33 in both the northwest and southeast quadrants of the galaxy. Overall, the structure has an 'S-shaped' appearance that broadly aligns with the orientation of the H I disk warp. We calculate a lower limit to the integrated luminosity of the structure of -12.7 ± 0.5 mag, comparable to a bright dwarf galaxy such as Fornax or Andromeda II and slightly less than 1% of the total luminosity of M33. Further, we show that there is tentative evidence for a distortion in the distribution of young stars near the edge of the H I disk that occurs at similar azimuth to the warp in H I. The data also hint at a low-level, extended stellar component at larger radius that may be an M33 halo component. We revisit studies of M33 and its stellar populations in light of these new results and discuss possible formation scenarios for the vast stellar structure. Our favored model is that of the tidal disruption of M33 in its orbit around M31.

  18. Simulations of the flocculent spiral M33: what drives the spiral structure?

    Science.gov (United States)

    Dobbs, C. L.; Pettitt, A. R.; Corbelli, E.; Pringle, J. E.

    2018-05-01

    We perform simulations of isolated galaxies in order to investigate the likely origin of the spiral structure in M33. In our models, we find that gravitational instabilities in the stars and gas are able to reproduce the observed spiral pattern and velocity field of M33, as seen in HI, and no interaction is required. We also find that the optimum models have high levels of stellar feedback which create large holes similar to those observed in M33, whilst lower levels of feedback tend to produce a large amount of small scale structure, and undisturbed long filaments of high surface density gas, hardly detected in the M33 disc. The gas component appears to have a significant role in producing the structure, so if there is little feedback, both the gas and stars organise into clear spiral arms, likely due to a lower combined Q (using gas and stars), and the ready ability of cold gas to undergo spiral shocks. By contrast models with higher feedback have weaker spiral structure, especially in the stellar component, compared to grand design galaxies. We did not see a large difference in the behaviour of Qstars with most of these models, however, because Qstars stayed relatively constant unless the disc was more strongly unstable. Our models suggest that although the stars produce some underlying spiral structure, this is relatively weak, and the gas physics has a considerable role in producing the large scale structure of the ISM in flocculent spirals.

  19. UNUSUALLY LUMINOUS GIANT MOLECULAR CLOUDS IN THE OUTER DISK OF M33

    International Nuclear Information System (INIS)

    Bigiel, F.; Blitz, L.; Plambeck, R. L.; Bolatto, A. D.; Leroy, A. K.; Walter, F.; Rosolowsky, E. W.; Lopez, L. A.

    2010-01-01

    We use high spatial resolution (∼7 pc) observations from the Combined Array for Research in Millimeter Wave Astronomy (CARMA) to derive detailed properties for eight giant molecular clouds (GMCs) at a galactocentric radius corresponding to approximately two CO scale lengths, or ∼0.5 optical radii (r 25 ), in the Local Group spiral galaxy M33. At this radius, molecular gas fraction, dust-to-gas ratio, and metallicity are much lower than in the inner part of M33 or in a typical spiral galaxy. This allows us to probe the impact of environment on GMC properties by comparing our measurements to previous data from the inner disk of M33, the Milky Way, and other nearby galaxies. The outer disk clouds roughly fall on the size-linewidth relation defined by extragalactic GMCs, but are slightly displaced from the luminosity-virial mass relation in the sense of having high CO luminosity compared to the inferred virial mass. This implies a different CO-to-H 2 conversion factor, which is on average a factor of 2 lower than the inner disk and the extragalactic average. We attribute this to significantly higher measured brightness temperatures of the outer disk clouds compared to the ancillary sample of GMCs, which is likely an effect of enhanced radiation levels due to massive star formation in the vicinity of our target field. Apart from brightness temperature, the properties we determine for the outer disk GMCs in M33 do not differ significantly from those of our comparison sample. In particular, the combined sample of inner and outer disk M33 clouds covers roughly the same range in size, line width, virial mass, and CO luminosity than the sample of Milky Way GMCs. When compared to the inner disk clouds in M33, however, we find even the brightest outer disk clouds to be smaller than most of their inner disk counterparts. This may be due to incomplete sampling or a potentially steeper cloud mass function at larger radii.

  20. Stochastic 2-D galaxy disk evolution models. Resolved stellar populations in the galaxy M33

    Science.gov (United States)

    Mineikis, T.; Vansevičius, V.

    We improved the stochastic 2-D galaxy disk models (Mineikis & Vansevičius 2014a) by introducing enriched gas outflows from galaxies and synthetic color-magnitude diagrams of stellar populations. To test the models, we use the HST/ACS stellar photometry data in four fields located along the major axis of the galaxy M33 (Williams et al. 2009) and demonstrate the potential of the models to derive 2-D star formation histories in the resolved disk galaxies.

  1. The Stellar Populations Inside Expanding HI Shells in the Spiral Galaxy M33

    Science.gov (United States)

    Walterbos, Rene

    1997-07-01

    Because of its vigorous star formation activity, favorable inclination, and relative proximity, M33 is an ideal laboratory for the study of expanding HI shells in spiral galaxies. Theoretical models show that the energy deposited into the ISM by high mass stars in OB associations is capable of creating HI superbubbles. However, sparse observational evidence exists to test these models in detail. One essential ingredient of such a test is an improved census of stellar populations inside expanding HI shells. Using multi-color archival HST images of M33, we will {1} verify that association ages are consistent with dynamical ages of related shells and with ages from model predictions for bubbles of matching size and kinematics; {2} Constrain the IMF for each association by combining integrated ground-based HAlpha fluxes with the population age, present day mass function, and luminosity function derived from WFPC2 data; {3} Use this information to infer which fraction of the integrated stellar mechanical luminosity is transferred to a shell over its lifetime. Ground-based observations of associations inside expanding shells lack the UV-sensitivity and spatial resolution to adequately address these issues. Our sample of expanding neutral shells in M33 was selected using a new automated method for analysis of HI datacubes. From this robust catalog we have identified more than 30 HI supershells in M33 already imaged with WFPC2 in suitable broadband filters {F160BW, F170W, F336W, F439W, F555W, and F814W}.

  2. Supernova remnants in M33: X-ray properties as observed by XMM-Newton

    Science.gov (United States)

    Garofali, Kristen; Williams, Benjamin F.; Plucinsky, Paul P.; Gaetz, Terrance J.; Wold, Brian; Haberl, Frank; Long, Knox S.; Blair, William P.; Pannuti, Thomas G.; Winkler, P. Frank; Gross, Jacob

    2017-11-01

    We have carried out a study of the X-ray properties of the supernova remnant (SNR) population in M33 with XMM-Newton, comprising deep observations of eight fields in M33 covering all of the area within the D25 contours, and with a typical luminosity of 7.1 × 1034 erg s-1 (0.2-2.0 keV). Here, we report our work to characterize the X-ray properties of the previously identified SNRs in M33, as well as our search for new X-ray detected SNRs. With our deep observations and large field of view we have detected 105 SNRs at the 3σ level, of which 54 SNRs are newly detected in X-rays, and three are newly discovered SNRs. Combining XMM-Newton data with deep Chandra survey data allows detailed spectral fitting of 15 SNRs, for which we have measured temperatures, ionization time-scales and individual abundances. This large sample of SNRs allows us to construct an X-ray luminosity function, and compare its shape to luminosity functions from host galaxies of differing metallicities and star formation rates to look for environmental effects on SNR properties. We conclude that while metallicity may play a role in SNR population characteristics, differing star formation histories on short time-scales, and small-scale environmental effects appear to cause more significant differences between X-ray luminosity distributions. In addition, we analyse the X-ray detectability of SNRs, and find that in M33 SNRs with higher [S II]/H α ratios, as well as those with smaller galactocentric distances, are more detectable in X-rays.

  3. The formation and evolution of M33 as revealed by its star clusters

    Science.gov (United States)

    San Roman, Izaskun

    2012-03-01

    Numerical simulations based on the Lambda-Cold Dark Matter (Λ-CDM) model predict a scenario consistent with observational evidence in terms of the build-up of Milky Way-like halos. Under this scenario, large disk galaxies derive from the merger and accretion of many smaller subsystems. However, it is less clear how low-mass spiral galaxies fit into this picture. The best way to answer this question is to study the nearest example of a dwarf spiral galaxy, M33. We will use star clusters to understand the structure, kinematics and stellar populations of this galaxy. Star clusters provide a unique and powerful tool for studying the star formation histories of galaxies. In particular, the ages and metallicities of star clusters bear the imprint of the galaxy formation process. We have made use of the star clusters to uncover the formation and evolution of M33. In this dissertation, we have carried out a comprehensive study of the M33 star cluster system, including deep photometry as well as high signal-to-noise spectroscopy. In order to mitigate the significant incompleteness presents in previous catalogs, we have conducted ground-based and space-based photometric surveys of M33 star clusters. Using archival images, we have analyzed 12 fields using the Advanced Camera for Surveys Wide Field Channel onboard the Hubble Space Telescope (ACS/HST) along the major axis of the galaxy. We present integrated photometry and color-magnitude diagrams for 161 star clusters in M33, of which 115 were previously uncataloged. This survey extends the depth of the existing M33 cluster catalogs by ˜ 1 mag. We have expanded our search through a photometric survey in a 1° x 1° area centered on M33 using the MegaCam camera on the 3.6m Canada-France-Hawaii Telescope (CFHT). In this work we discuss the photometric properties of the sample, including color-color diagrams of 599 new candidate stellar clusters, and 204 confirmed clusters. Comparisons with models of simple stellar populations

  4. An Arecibo Search for Pulsars and Transient Sources in M33

    Science.gov (United States)

    Bhat, N. D. R.; Cordes, J. M.; Cox, P. J.; Deneva, J. S.; Hankins, T. H.; Lazio, T. J. W.; McLaughlin, M. A.

    2011-05-01

    We report on a systematic and sensitive search for pulsars and transient sources in the nearby spiral galaxy M33, conducted at 1.4 GHz with the Arecibo telescope's seven-beam receiver system, ALFA. Data were searched for both periodic and aperiodic sources, up to 1000 pc cm-3 in dispersion measure and on timescales from ~50 μs to several seconds. The galaxy was sampled with 12 ALFA pointings, or 84 pixels in total, each of which was searched for 2-3 hr. We describe the observations, search methodologies, and analysis strategies applicable to multibeam systems, and comment on the data quality and statistics of spurious events that arise due to radio frequency interference. While these searches have not led to any conclusive signals of periodic or transient nature that originate in the galaxy, they illustrate some of the underlying challenges and difficulties in such searches and the efficacy of simultaneous multiple beams in the analysis of search output. The implied limits are lsim5 μJy Mpc2 in luminosity (at 1400 MHz) for periodic sources in M33 with duty cycles lsim5%. For short-duration transient signals (with pulse widths lsim100 μs ), the limiting peak flux density is 100 mJy, which would correspond to a 5σ detection of bright giant pulses (~20 kJy) from Crab-like pulsars if located at the distance of M33. We discuss the implications of our null results for various source populations within the galaxy and comment on the future prospects to conduct even more sensitive searches with the upcoming next-generation instruments including the Square Kilometer Array and its pathfinders.

  5. AN ARECIBO SEARCH FOR PULSARS AND TRANSIENT SOURCES IN M33

    International Nuclear Information System (INIS)

    Bhat, N. D. R.; Cox, P. J.; Cordes, J. M.; Deneva, J. S.; Hankins, T. H.; Lazio, T. J. W.; McLaughlin, M. A.

    2011-01-01

    We report on a systematic and sensitive search for pulsars and transient sources in the nearby spiral galaxy M33, conducted at 1.4 GHz with the Arecibo telescope's seven-beam receiver system, ALFA. Data were searched for both periodic and aperiodic sources, up to 1000 pc cm -3 in dispersion measure and on timescales from ∼50 μs to several seconds. The galaxy was sampled with 12 ALFA pointings, or 84 pixels in total, each of which was searched for 2-3 hr. We describe the observations, search methodologies, and analysis strategies applicable to multibeam systems, and comment on the data quality and statistics of spurious events that arise due to radio frequency interference. While these searches have not led to any conclusive signals of periodic or transient nature that originate in the galaxy, they illustrate some of the underlying challenges and difficulties in such searches and the efficacy of simultaneous multiple beams in the analysis of search output. The implied limits are ∼ 2 in luminosity (at 1400 MHz) for periodic sources in M33 with duty cycles ∼<5%. For short-duration transient signals (with pulse widths ∼<100 μs ), the limiting peak flux density is 100 mJy, which would correspond to a 5σ detection of bright giant pulses (∼20 kJy) from Crab-like pulsars if located at the distance of M33. We discuss the implications of our null results for various source populations within the galaxy and comment on the future prospects to conduct even more sensitive searches with the upcoming next-generation instruments including the Square Kilometer Array and its pathfinders.

  6. Planetary nebulae search in the outskirts of M33: looking for the farthest candidates

    Science.gov (United States)

    Galera Rosillo, Rebeca; Corradi, Romano L. M.; Mampaso Recio, Antonio

    2015-08-01

    The nearby disc galaxy M33 is one of the best laboratories for testing chemical evolution models in galaxies and for understanding disc formation mechanisms. In this galaxy, planetary nebulae (PNe) were previously extensively studied only within a galactocentric radius of 8 kpc.In the framework of a broad study of the population of PNe in Local Group disc galaxies, we present the results of a deep narrow-band imaging of the outer regions of M33, performed using the Wide Field Camera at the 2.5 m Isaac Newton Telescope (INT).The INT images were obtained in the narrow-band filters selecting the [OIII] 5007 Å and Hα 6563 Å lines, plus broad-band filters SDSS g and i. A photometric catalog of around 150000 sources covering a total area of 5 square degrees, and extending out to 2 deg (30 kpc at the adopted distance of 840 kpc) from the centre of the galaxy is presented.PNe candidates are selected in the [OIII]-g vs Hα-r colour-colour diagram as bright emitters in the narrowband filters. A number of candidates with similar colours to those of known PNe, and with an apparent [OIII] magnitude > 21 have been selected for future follow-up. Three of these have been already spectroscopically confirmed at the William Herschel Telescope (WHT).Our survey will improve the knowledge of the PNe population in the outskirts of M33, constraining the properties of its metal-poor halo and of the extended disc substructures that have been proposed to be related to a relatively recent interaction with M31.

  7. Spitzer Observations of M33 & M83 and the Hot Star, Hii Region Connection

    Science.gov (United States)

    Rubin, R.; Simpson, J.; Colgan, S.; Dufour, R.; Citron, R.; Ray, K.; Erickson, E.; Haas, M.; Pauldrach, A.

    2007-05-01

    H II regions play a crucial role in the measurement of current interstellar abundances. They also serve as laboratories for atomic physics and provide fundamental data about heavy element abundances that serve to constrain models of galactic chemical evolution. We observed emission lines of [S IV] 10.5, H (7-6) 12.4, [Ne II] 12.8, [Ne III] 15.6, & [S III] 18.7 micron cospatially with the Spitzer Space Telescope using the Infrared Spectrograph (IRS) in short-high mode (SH). Here we concentrate on the galaxy M33 and compare the results with our earlier similar study of M83. In each of these substantially face-on spirals, we observed ˜25 H II regions, covering a full range of galactocentric radii (RG). For most of the M33 H II regions, we were able to measure the H (7-6) line while none were detectable in M83. This limited our M83 study to a determination of the Ne++/Ne+, /, and S3+/S++ abundance ratios vs. RG. Angular brackets denote fractional ionizations. As well as having the addition of fluxes for the H(7-6) line, the M33 H II regions are generally of much higher ionization than those in M83, resulting in larger Ne++/Ne+ and S3+/ S++ abundance ratios. For M33, in addition to what we derived for those nebulae in M83, we are also able to derive Ne/H, S/H and Ne/S vs. RG. Important advantages compared with prior optical studies are: 1) the IR lines have a weak and similar electron temperature (Te) dependence while optical lines vary exponentially with Te and 2) the IR lines suffer far less from interstellar extinction. Additionally, these data may be used as constraints on the ionizing spectral energy distribution for the stars exciting these nebulae by comparing the above ionic ratios with predictions using stellar atmosphere models from several different non-LTE model sets. This work is based on observations made with the Spitzer Space Telescope, which is operated by the Jet Propulsion Laboratory, California Institute of Technology under NASA contract 1407

  8. A SPECTROSCOPIC SURVEY OF MASSIVE STARS IN M31 AND M33

    Energy Technology Data Exchange (ETDEWEB)

    Massey, Philip; Neugent, Kathryn F.; Smart, Brianna M., E-mail: phil.massey@lowell.edu, E-mail: kneugent@lowell.edu, E-mail: bsmart@astro.wisc.edu [Lowell Observatory, 1400 W Mars Hill Road, Flagstaff, AZ 86001 (United States)

    2016-09-01

    We describe our spectroscopic follow-up to the Local Group Galaxy Survey (LGGS) photometry of M31 and M33. We have obtained new spectroscopy of 1895 stars, allowing us to classify 1496 of them for the first time. Our study has identified many foreground stars, and established membership for hundreds of early- and mid-type supergiants. We have also found nine new candidate luminous blue variables and a previously unrecognized Wolf–Rayet star. We republish the LGGS M31 and M33 catalogs with improved coordinates, and including spectroscopy from the literature and our new results. The spectroscopy in this paper is responsible for the vast majority of the stellar classifications in these two nearby spiral neighbors. The most luminous (and hence massive) of the stars in our sample are early-type B supergiants, as expected; the more massive O stars are more rare and fainter visually, and thus mostly remain unobserved so far. The majority of the unevolved stars in our sample are in the 20–40 M {sub ⊙} range.

  9. Triggering the formation of the supergiant H II region NGC 604 in M 33

    Science.gov (United States)

    Tachihara, Kengo; Gratier, Pierre; Sano, Hidetoshi; Tsuge, Kisetsu; Miura, Rie E.; Muraoka, Kazuyuki; Fukui, Yasuo

    2018-05-01

    Formation mechanism of a supergiant H II region NGC 604 is discussed in terms of collision of H I clouds in M 33. An analysis of the archival H I data obtained with the Very Large Array (VLA) reveals complex velocity distributions around NGC 604. The H I clouds are composed of two velocity components separated by ˜20 km s-1 for an extent of ˜700 pc, beyond the size of the the H II region. Although the H I clouds are not easily separated in velocity with some mixed component represented by merged line profiles, the atomic gas mass amounts to 6 × 106 M_{⊙} and 9 × 106 M_{⊙} for each component. These characteristics of H I gas and the distributions of dense molecular gas in the overlapping regions of the two velocity components suggest that the formation of giant molecular clouds and the following massive cluster formation have been induced by the collision of H I clouds with different velocities. Referring to the existence of a gas bridging feature connecting M 33 with M 31 reported by large-scale H I surveys, the disturbed atomic gas possibly represents the result of past tidal interaction between the two galaxies, which is analogous to the formation of the R 136 cluster in the LMC.

  10. The Mycobacterium tuberculosis homologue of the Mycobacterium ...

    African Journals Online (AJOL)

    With the completion of genome sequencing of Mycobacterium tuberculosis and upsurge in the incidence of M. tuberculosis infection worldwide partly as a result of HIV pandemic, there is need for rationale approach to vaccine and chemotherapy discoveries for M. tuberculosis. The homologue of mig gene of. Mycobacterium ...

  11. Spatially resolving the dust properties and submillimetre excess in M 33

    Science.gov (United States)

    Relaño, M.; De Looze, I.; Kennicutt, R. C.; Lisenfeld, U.; Dariush, A.; Verley, S.; Braine, J.; Tabatabaei, F.; Kramer, C.; Boquien, M.; Xilouris, M.; Gratier, P.

    2018-05-01

    Context. The relative abundance of the dust grain types in the interstellar medium is directly linked to physical quantities that trace the evolution of galaxies. Because of the poor spatial resolution of the infrared and submillimetre data, we are able to study the dependence of the resolved infrared spectral energy distribution (SED) across regions of the interstellar medium (ISM) with different physical properties in just a few objects. Aims: We aim to study the dust properties of the whole disc of M 33 at spatial scales of 170 pc. This analysis allows us to infer how the relative dust grain abundance changes with the conditions of the ISM, study the existence of a submillimetre excess and look for trends of the gas-to-dust mass ratio (GDR) with other physical properties of the galaxy. Methods: For each pixel in the disc of M 33 we have fitted the infrared SED using a physically motivated dust model that assumes an emissivity index β close to two. We applied a Bayesian statistical method to fit the individual SEDs and derived the best output values from the study of the probability density function of each parameter. We derived the relative amount of the different dust grains in the model, the total dust mass, and the strength of the interstellar radiation field (ISRF) heating the dust at each spatial location. Results: The relative abundance of very small grains tends to increase, and for big grains to decrease, at high values of Hα luminosity. This shows that the dust grains are modified inside the star-forming regions, in agreement with a theoretical framework of dust evolution under different physical conditions. The radial dependence of the GDR is consistent with the shallow metallicity gradient observed in this galaxy. The strength of the ISRF derived in our model correlates with the star formation rate in the galaxy in a pixel by pixel basis. Although this is expected, it is the first time that a correlation between the two quantities has been reported

  12. Evolution of LMC/M33-mass dwarf galaxies in the EAGLE simulation

    Science.gov (United States)

    Shao, Shi; Cautun, Marius; Deason, Alis J.; Frenk, Carlos S.; Theuns, Tom

    2018-06-01

    We investigate the population of dwarf galaxies with stellar masses similar to the Large Magellanic Cloud (LMC) and M33 in the EAGLE galaxy formation simulation. In the field, galaxies reside in haloes with stellar-to-halo mass ratios of 1.03^{+0.50}_{-0.31}× 10^{-2} (68% confidence level); systems like the LMC, which have an SMC-mass satellite, reside in haloes about 1.3 times more massive, which suggests an LMC halo mass at infall, M_{200}=3.4^{+1.8}_{-1.2}× 10^{11}{ M_⊙ } (68% confidence level). The colour distribution of dwarfs is bimodal, with the red galaxies (g - r > 0.6) being mostly satellites. The fraction of red LMC-mass dwarfs is 15% for centrals, and for satellites this fraction increases rapidly with host mass: from 10% for satellites of Milky Way (MW)-mass haloes to nearly 90% for satellites of groups and clusters. The quenching timescale, defined as the time after infall when half of the satellites have acquired red colours, decreases with host mass from >5 Gyrs for MW-mass hosts to 2.5 Gyrs for cluster mass hosts. The satellites of MW-mass haloes have higher star formation rates and bluer colours than field galaxies. This is due to enhanced star formation triggered by gas compression shortly after accretion. Both the LMC and M33 have enhanced recent star formation that could be a manifestation of this process. After infall into their MW-mass hosts, the g - r colours of LMC-mass dwarfs become bluer for the first 2 Gyrs, after which they rapidly redden. LMC-mass dwarfs fell into their MW-mass hosts only relatively recently, with more than half having an infall time of less than 3.5 Gyrs.

  13. Deep narrow band imagery of the diffuse ISM in M33

    Science.gov (United States)

    Hester, J. Jeff; Kulkarni, Shrinivas R.

    1990-01-01

    Very deep narrow band images were obtained for several fields in the local group spiral galaxy M33 using a wide field reimaging Charge Coupled Device (CCD) camera on the 1.5 m telescope at Palomar Observatory. The reimaging system uses a 306 mm collimator and a 58 mm camera lens to put a 16 minute by 16 minute field onto a Texas Instruments 800 x 800 pixel CCD at a resolution of 1.2 arcseconds pixel (-1). The overall system is f/1.65. Images were obtained in the light of H alpha (S II) lambda lambda 6717, 6731, (O III) lambda 5007, and line-free continuum bands 100A wide, centered at 6450A and 5100A. Assuming a distance of 600 kpc to M33 (Humphreys 1980, Ap. J., 241, 587), this corresponds to a linear scale of 3.5 pc pixel (-1), and a field size of 2.8 kpc x 2.8 kpc. Researchers discuss the H alpha imagery of a field centered approx. equal to 8 minutes NE of the nucleus, including the supergiant HII region complex NGC 604. Two 2000 second H alpha images and two 300 second red continuum images were obtained of two slightly offset fields. The fields were offset to allow for discrimination between real emission and possible artifacts in the images. All images were resampled to align them with one of the H alpha frames. The continuum images were normalized to the line images using the results of aperture photometry on a grid of stars in the field, then the rescaled continuum data were directly subtracted from the line data.

  14. A deep narrowband survey for planetary nebulae at the outskirts of M 33

    Science.gov (United States)

    Galera-Rosillo, R.; Corradi, R. L. M.; Mampaso, A.

    2018-04-01

    Context. Planetary nebulae (PNe) are excellent tracers of stellar populations with low surface brightness, and therefore provide a powerful method to detect and explore the rich system of substructures discovered around the main spiral galaxies of the local group. Aim. We searched the outskirts of the local group spiral galaxy M 33 (the Triangulum) for PNe to gain new insights into the extended stellar substructure on the northern side of the disc and to study the existence of a faint classical halo. Methods: The search is based on wide field imaging covering a 4.5 square degree area out to a maximum projected distance of about 40 kpc from the centre of the galaxy. The PN candidates are detected by the combination of images obtained in narrowband filters selecting the [OIII]λ5007 Å and Hα + [NII] nebular lines and in the continuum g' and r' broadband filters. Results: Inside the bright optical disc of M 33, eight new PN candidates were identified, three of which were spectroscopically confirmed. No PN candidates were found outside the limits of the disc. Fourteen additional sources showing [OIII] excess were also discovered. Conclusions: The absence of bright PN candidates in the area outside the galaxy disc covered by this survey sets an upper limit to the luminosity of the underlying population of 1.6 × 107 L⊙, suggesting the lack of a massive classical halo, which is in agreement with the results obtained using the red giant branch population. Based on observations made with the Isaac Newton Telescope and service observations made with the William Herschel Telescope operated on the island of La Palma by the Isaac Newton Group of Telescopes in the Spanish Observatorio del Roque de los Muchachos of the Instituto de Astrofísica de Canarias.

  15. The integrated radio continuum spectrum of M33 - Evidence for free-free absorption by cool ionized gas

    Science.gov (United States)

    Israel, F. P.; Mahoney, M. J.; Howarth, N.

    1992-01-01

    We present measurements of the integrated radio continuum flux density of M33 at frequencies between 22 and 610 MHz and discuss the radio continuum spectrum of M33 between 22 MHz and 10 GHz. This spectrum has a turnover between 500 and 900 MHz, depending on the steepness of the high frequency radio spectrum of M33. Below 500 MHz the spectrum is relatively flat. We discuss possible mechanisms to explain this spectral shape and consider efficient free-free absorption of nonthermal emission by a cool (not greater than 1000 K) ionized gas to be a very likely possibility. The surface filling factor of both the nonthermal and the thermal material appears to be small (of order 0.001), which could be explained by magnetic field/density fluctuations in the M 33 interstellar medium. We briefly speculate on the possible presence of a nuclear radio source with a steep spectrum.

  16. A VLA Search for Radio Signals from M31 and M33

    Science.gov (United States)

    Gray, Robert H.; Mooley, Kunal

    2017-03-01

    Observing nearby galaxies would facilitate the search for artificial radio signals by sampling several billions of stars simultaneously, but few efforts have been made to exploit this opportunity. An added attraction is that the Milky Way is the second largest member of the Local Group, so our galaxy might be a probable target for hypothetical broadcasters in nearby galaxies. We present the first relatively high spectral resolution (intelligent radio signals of complete galaxies in the Local Group with the Jansky VLA, observing the galaxies M31 (Andromeda) and M33 (Triangulum)—the first and third largest members of the group, respectively—sampling more stars than any prior search of this kind. We used 122 Hz channels over a 1 MHz spectral window in the target galaxy velocity frame of reference, and 15 Hz channels over a 125 kHz window in our local standard of rest. No narrowband signals were detected above a signal-to-noise ratio of 7, suggesting the absence of continuous narrowband flux greater than approximately 0.24 and 1.33 Jy in the respective spectral windows illuminating our part of the Milky Way during our observations in 2014 December and 2015 January. This is also the first study in which the upgraded VLA has been used for SETI.

  17. Gas, dust, stars, star formation, and their evolution in M 33 at giant molecular cloud scales

    Science.gov (United States)

    Komugi, Shinya; Miura, Rie E.; Kuno, Nario; Tosaki, Tomoka

    2018-04-01

    We report on a multi-parameter analysis of giant molecular clouds (GMCs) in the nearby spiral galaxy M 33. A catalog of GMCs identifed in 12CO(J = 3-2) was used to compile associated 12CO(J = 1-0), dust, stellar mass, and star formation rate. Each of the 58 GMCs are categorized by their evolutionary stage. Applying the principal component analysis on these parameters, we construct two principal components, PC1 and PC2, which retain 75% of the information from the original data set. PC1 is interpreted as expressing the total interstellar matter content, and PC2 as the total activity of star formation. Young (activity compared to intermediate-age and older clouds. Comparison of average cloud properties in different evolutionary stages imply that GMCs may be heated or grow denser and more massive via aggregation of diffuse material in their first ˜ 10 Myr. The PCA also objectively identified a set of tight relations between ISM and star formation. The ratio of the two CO lines is nearly constant, but weakly modulated by massive star formation. Dust is more strongly correlated with the star formation rate than the CO lines, supporting recent findings that dust may trace molecular gas better than CO. Stellar mass contributes weakly to the star formation rate, reminiscent of an extended form of the Schmidt-Kennicutt relation with the molecular gas term substituted by dust.

  18. Luminous and Variable Stars in M31 and M33. V. The Upper HR Diagram

    Energy Technology Data Exchange (ETDEWEB)

    Humphreys, Roberta M.; Davidson, Kris; Hahn, David [Minnesota Institute for Astrophysics, 116 Church St SE, University of Minnesota, Minneapolis, MN 55455 (United States); Martin, John C. [Barber Observatory, University of Illinois, Springfield, IL 62703 (United States); Weis, Kerstin, E-mail: roberta@umn.edu [Astronomical Institute, Ruhr-Universitaet Bochum (Germany)

    2017-07-20

    We present HR diagrams for the massive star populations in M31 and M33, including several different types of emission-line stars: the confirmed luminous blue variables (LBVs), candidate LBVs, B[e] supergiants, and the warm hypergiants. We estimate their apparent temperatures and luminosities for comparison with their respective massive star populations and evaluate the possible relationships of these different classes of evolved, massive stars, and their evolutionary state. Several of the LBV candidates lie near the LBV/S Dor instability strip that supports their classification. Most of the B[e] supergiants, however, are less luminous than the LBVs. Many are very dusty with the infrared flux contributing one-third or more to their total flux. They are also relatively isolated from other luminous OB stars. Overall, their spatial distribution suggests a more evolved state. Some may be post-RSGs (red supergiants) like the warm hypergiants, and there may be more than one path to becoming a B[e] star. There are sufficient differences in the spectra, luminosities, spatial distribution, and the presence or lack of dust between the LBVs and B[e] supergiants to conclude that one group does not evolve into the other.

  19. The star-formation law at GMC scales in M33, the Triangulum Galaxy

    Science.gov (United States)

    Williams, Thomas G.; Gear, Walter K.; Smith, Matthew W. L.

    2018-06-01

    We present a high spatial resolution study, on scales of ˜100pc, of the relationship between star-formation rate (SFR) and gas content within Local Group galaxy M33. Combining deep SCUBA-2 observations with archival GALEX, SDSS, WISE, Spitzer and submillimetre Herschel data, we are able to model the entire SED from UV to sub-mm wavelengths. We calculate the SFR on a pixel-by-pixel basis using the total infrared luminosity, and find a total SFR of 0.17 ± 0.06 {M}_⊙/yr, somewhat lower than our other two measures of SFR - combined FUV and 24μ SFR (0.25^{+0.10}_{-0.07} {M}_⊙/yr) and SED-fitting tool MAGPHYS (0.33^{+0.05}_{-0.06} {M}_⊙/yr). We trace the total gas using a combination of the 21cm HI line for atomic hydrogen, and CO(J=2-1) data for molecular hydrogen. We have also traced the total gas using dust masses. We study the star-formation law in terms of molecular gas, total gas, and gas from dust. We perform an analysis of the star-formation law on a variety of pixel scales, from 25" to 500" (100pc to 2kpc). At kpc scales, we find that a linear Schmidt-type power law index is suitable for molecular gas, but the index appears to be much higher with total gas, and gas from dust. Whilst we find a strong scale dependence on the Schmidt index, the gas depletion timescale is invariant with pixel scale.

  20. Extra-galactic Distances with Massive Stars: The Role of Stellar Variability in the Case of M33

    International Nuclear Information System (INIS)

    Lee Chien-Hsiu

    2017-01-01

    In modern cosmology, determining the Hubble constant (H 0 ) using a distance ladder to percent level and comparing with the results from the Planck  satellite can shed light on the nature of dark energy, physics of the neutrino, and curvature of the universe. Thanks to the endeavor of the SH0ES team, the uncertainty of the H 0 has be dramatically reduced, from 10% to 2.4%, and with the promise of even reaching 1% in the near future. In this regard, it is fundamentally important to investigate the systematics. This is best done using other good independent distance indicators. One promising method is the flux-weighted gravity luminosity relation (FGLR) of the blue supergiants (BSGs). As BSGs are the brightest objects in galaxies, they can probe distances up to 10 Mpc with negligible blending effects. While the FGLR method delivered distance is in good agreement with other distance indicators, it has been shown that this method delivers greater distances in the cases of M33 and NGC 55. Here, we investigate whether the M33 distance estimate of FGLR suffers systematics from stellar variability. Using CFHT M33 monitoring data, we found that 9 out of 22 BSGs showed variability during the course of 500 days, although with amplitudes as small as 0.05 mag. This suggests that stellar variability plays a negligible role in the FGLR distance determination.

  1. Extra-galactic Distances with Massive Stars: The Role of Stellar Variability in the Case of M33

    Energy Technology Data Exchange (ETDEWEB)

    Lee Chien-Hsiu, E-mail: leech@naoj.org [Subaru Telescope, NAOJ, 650 N Aohoku Pl, Hilo, HI 96720 (United States)

    2017-08-01

    In modern cosmology, determining the Hubble constant (H{sub 0}) using a distance ladder to percent level and comparing with the results from the Planck  satellite can shed light on the nature of dark energy, physics of the neutrino, and curvature of the universe. Thanks to the endeavor of the SH0ES team, the uncertainty of the H{sub 0} has be dramatically reduced, from 10% to 2.4%, and with the promise of even reaching 1% in the near future. In this regard, it is fundamentally important to investigate the systematics. This is best done using other good independent distance indicators. One promising method is the flux-weighted gravity luminosity relation (FGLR) of the blue supergiants (BSGs). As BSGs are the brightest objects in galaxies, they can probe distances up to 10 Mpc with negligible blending effects. While the FGLR method delivered distance is in good agreement with other distance indicators, it has been shown that this method delivers greater distances in the cases of M33 and NGC 55. Here, we investigate whether the M33 distance estimate of FGLR suffers systematics from stellar variability. Using CFHT M33 monitoring data, we found that 9 out of 22 BSGs showed variability during the course of 500 days, although with amplitudes as small as 0.05 mag. This suggests that stellar variability plays a negligible role in the FGLR distance determination.

  2. The UK Infrared Telescope M 33 monitoring project - V. The star formation history across the galactic disc

    Science.gov (United States)

    Javadi, Atefeh; van Loon, Jacco Th.; Khosroshahi, Habib G.; Tabatabaei, Fatemeh; Hamedani Golshan, Roya; Rashidi, Maryam

    2017-01-01

    We have conducted a near-infrared monitoring campaign at the UK Infrared Telescope of the Local Group spiral galaxy M 33 (Triangulum). On the basis of their variability, we have identified stars in the very final stage of their evolution, and for which the luminosity is more directly related to the birth mass than the more numerous less-evolved giant stars that continue to increase in luminosity. In this fifth paper of the series, we construct the birth mass function and hence derive the star formation history across the galactic disc of M 33. The star formation rate has varied between ˜0.010 ± 0.001 (˜0.012 ± 0.007) and 0.060±0.005 (0.052±0.009) M⊙ yr-1 kpc-2 statistically (systematically) in the central square kiloparsec of M 33, comparable with the values derived previously with another camera. The total star formation rate in M 33 within a galactocentric radius of 14 kpc has varied between ˜0.110 ± 0.005 (˜0.174 ± 0.060) and ˜0.560 ± 0.028 (˜0.503 ± 0.100) M⊙ yr-1 statistically (systematically). We find evidence of two epochs during which the star formation rate was enhanced by a factor of a few - one that started ˜6 Gyr ago and lasted ˜3 Gyr and produced ≥71 per cent of the total mass in stars, and one ˜250 Myr ago that lasted ˜200 Myr and formed ≤13 per cent of the mass in stars. Radial star formation history profiles suggest that the inner disc of M 33 was formed in an inside-out formation scenario. The outskirts of the disc are dominated by the old population, which may be the result of dynamical effects over many Gyr. We find correspondence to spiral structure for all stars, but enhanced only for stars younger than ˜100 Myr; this suggests that the spiral arms are transient features and not a part of a global density wave potential.

  3. Is the Prosthetic Homologue Necessary for Embodiment?

    Science.gov (United States)

    Dornfeld, Chelsea; Swanston, Michelle; Cassella, Joseph; Beasley, Casey; Green, Jacob; Moshayev, Yonatan; Wininger, Michael

    2016-01-01

    Embodiment is the process by which patients with limb loss come to accept their peripheral device as a natural extension of self. However, there is little guidance as to how exacting the prosthesis must be in order for embodiment to take place: is it necessary for the prosthetic hand to look just like the absent hand? Here, we describe a protocol for testing whether an individual would select a hand that looks like their own from among a selection of five hands, and whether the hand selection (regardless of homology) is consistent across multiple exposures to the same (but reordered) set of candidate hands. Pilot results using healthy volunteers reveals that hand selection is only modestly consistent, and that selection of the prosthetic homologue is atypical (61 of 192 total exposures). Our protocol can be executed in minutes, and makes use of readily available equipment and softwares. We present both a face-to-face and a virtual protocol, for maximum flexibility of implementation.

  4. The supernova progenitor mass distributions of M31 and M33: further evidence for an upper mass limit

    Energy Technology Data Exchange (ETDEWEB)

    Jennings, Zachary G.; Weisz, Daniel R. [University of California Observatories, Santa Cruz, CA 95064 (United States); Williams, Benjamin F.; Dalcanton, Julianne J.; Gilbert, Karoline M.; Fouesneau, Morgan [Box 351580, The University of Washington Seattle, WA 98195 (United States); Murphy, Jeremiah W. [Department of Physics, Florida State University, Tallahassee, FL 32306 (United States); Dolphin, Andrew E., E-mail: zgjennin@ucsc.edu, E-mail: adolphin@raytheon.com [Raytheon, 1151 E. Hermans Road, Tucson, AZ 85706 (United States)

    2014-11-10

    Using Hubble Space Telescope photometry to measure star formation histories, we age-date the stellar populations surrounding supernova remnants (SNRs) in M31 and M33. We then apply stellar evolution models to the ages to infer the corresponding masses for their supernova progenitor stars. We analyze 33 M33 SNR progenitors and 29 M31 SNR progenitors in this work. We then combine these measurements with 53 previously published M31 SNR progenitor measurements to bring our total number of progenitor mass estimates to 115. To quantify the mass distributions, we fit power laws of the form dN/dM∝M {sup –α}. Our new larger sample of M31 progenitors follows a distribution with α=4.4{sub −0.4}{sup +0.4}, and the M33 sample follows a distribution with α=3.8{sub −0.5}{sup +0.4}. Thus both samples are consistent within the uncertainties, and the full sample across both galaxies gives α=4.2{sub −0.3}{sup +0.3}. Both the individual and full distributions display a paucity of massive stars when compared to a Salpeter initial mass function, which we would expect to observe if all massive stars exploded as SN that leave behind observable SNR. If we instead fix α = 2.35 and treat the maximum mass as a free parameter, we find M {sub max} ∼ 35-45 M {sub ☉}, indicative of a potential maximum cutoff mass for SN production. Our results suggest that either SNR surveys are biased against finding objects in the youngest (<10 Myr old) regions, or the highest mass stars do not produce SNe.

  5. The LAMOST spectroscopic survey of globular clusters in M31 and M33. I. catalog and new identifications

    International Nuclear Information System (INIS)

    Chen, Bing-Qiu; Liu, Xiao-Wei; Xiang, Mao-Sheng; Huang, Yang; Sun, Ning-Chen; Wang, Chun; Ren, Juan-Juan; Zhang, Hua-Wei; Yuan, Hai-Bo; Rebassa-Mansergas, Alberto; Huo, Zhi-Ying; Yang, Ming; Zhang, Yong; Hou, Yong-Hui; Wang, Yue-Fei

    2015-01-01

    We present a catalog of 908 objects observed with the Large Sky Area Multi-Object Fiber Spectroscopic Telescope (LAMOST) in fields in the vicinity of M31 and M33, targeted as globular clusters (GCs) and candidates. The targets include known GCs and candidates selected from the literature, as well as new candidates selected from the Sloan Digital Sky Survey (SDSS). Analysis shows that 356 of them are likely GCs with various confidence levels, while the remaining ones turn out to be background galaxies and quasars, stars and H ii regions in M31 or foreground Galactic stars. The 356 likely GCs include 298 bona fide GCs and 26 candidates known in the literature. Three candidates, selected from the Revised Bologna Catalog of M31 GCs and candidates (RBC) and one possible cluster from Johnson et al., are confirmed to be bona fide clusters. We search for new GCs in the halo of the M31 among the new candidates selected from the SDSS photometry. Based on radial velocities yielded by LAMOST spectra and visual examination of the SDSS images, we find 28 objects, 5 bona fide and 23 likely GCs. Among the five bona fide GCs, three have been recently discovered independently by others, and the remaining 25 are our new identifications, including two bona fide ones. The newly identified objects fall at projected distances ranging from 13 to 265kpc from M31. Of the two newly discovered bona fide GCs, one is located near M33, probably a GC belonging to M33. The other bona fide GC falls on the Giant Stream with a projected distance of 78 kpc from M31. Of the 23 newly identified likely GCs, one has a projected distance of about 265 kpc from M31 and could be an intergalactic cluster. (paper)

  6. The close binary frequency of Wolf-Rayet stars as a function of metallicity in M31 and M33

    Energy Technology Data Exchange (ETDEWEB)

    Neugent, Kathryn F.; Massey, Philip, E-mail: kneugent@lowell.edu, E-mail: phil.massey@lowell.edu [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States)

    2014-07-01

    Massive star evolutionary models generally predict the correct ratio of WC-type and WN-type Wolf-Rayet stars at low metallicities, but underestimate the ratio at higher (solar and above) metallicities. One possible explanation for this failure is perhaps single-star models are not sufficient and Roche-lobe overflow in close binaries is necessary to produce the 'extra' WC stars at higher metallicities. However, this would require the frequency of close massive binaries to be metallicity dependent. Here we test this hypothesis by searching for close Wolf-Rayet binaries in the high metallicity environments of M31 and the center of M33 as well as in the lower metallicity environments of the middle and outer regions of M33. After identifying ∼100 Wolf-Rayet binaries based on radial velocity variations, we conclude that the close binary frequency of Wolf-Rayets is not metallicity dependent and thus other factors must be responsible for the overabundance of WC stars at high metallicities. However, our initial identifications and observations of these close binaries have already been put to good use as we are currently observing additional epochs for eventual orbit and mass determinations.

  7. PAndAS IN THE MIST: THE STELLAR AND GASEOUS MASS WITHIN THE HALOS OF M31 AND M33

    International Nuclear Information System (INIS)

    Lewis, Geraint F.; Braun, Robert; McConnachie, Alan W.; Irwin, Michael J.; Chapman, Scott C.; Ibata, Rodrigo A.; Martin, Nicolas F.; Ferguson, Annette M. N.; Fardal, Mark; Dubinski, John; Widrow, Larry; Mackey, A. Dougal; Babul, Arif; Tanvir, Nial R.; Rich, Michael

    2013-01-01

    Large-scale surveys of the prominent members of the Local Group have provided compelling evidence for the hierarchical formation of massive galaxies, revealing a wealth of substructure that is thought to be the debris from ancient and ongoing accretion events. In this paper, we compare two extant surveys of the M31-M33 subgroup of galaxies: the Pan-Andromeda Archaeological Survey of the stellar structure, and a combination of observations of the H I gaseous content, detected at 21 cm. Our key finding is a marked lack of spatial correlation between these two components on all scales, with only a few potential overlaps between stars and gas. The paucity of spatial correlation significantly restricts the analysis of kinematic correlations, although there does appear to be H I kinematically associated with the Giant Stellar Stream where it passes the disk of M31. These results demonstrate that different processes must significantly influence the dynamical evolution of the stellar and H I components of substructures, such as ram pressure driving gas away from a purely gravitational path. Detailed modeling of the offset between the stellar and gaseous substructures will provide a determination of the properties of the gaseous halos of M31 and M33.

  8. PAndAS IN THE MIST: THE STELLAR AND GASEOUS MASS WITHIN THE HALOS OF M31 AND M33

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, Geraint F. [Sydney Institute for Astronomy, School of Physics A28, The University of Sydney, NSW 2006 (Australia); Braun, Robert [CSIRO Astronomy and Space Science, P.O. Box 76, Epping, NSW 1710 (Australia); McConnachie, Alan W. [Dominion Astrophysical Observatory, 5071 West Saanich Road, Victoria, BC V9E 2E7 (Canada); Irwin, Michael J.; Chapman, Scott C. [Institute of Astronomy, University of Cambridge, Madingley Road, Cambridge CB3 0HA (United Kingdom); Ibata, Rodrigo A.; Martin, Nicolas F. [Observatoire de Strasbourg, 11, rue de l' Universite, F-67000 Strasbourg (France); Ferguson, Annette M. N. [Institute for Astronomy, University of Edinburgh, Blackford Hill, Edinburgh EH9 3HJ (United Kingdom); Fardal, Mark [Department of Astronomy, University of Massachusetts, Amherst, MA 01003-9305 (United States); Dubinski, John [Department of Astronomy and Astrophysics, 50 St. George Street, University of Toronto, ON M5S 3H4 (Canada); Widrow, Larry [Department of Physics, Queen' s University, 99 University Avenue, Kingston, ON K7L 3N6 (Canada); Mackey, A. Dougal [Research School of Astronomy and Astrophysics, Mount Stromlo Observatory, Cotter Road, Weston Creek, ACT 2611 (Australia); Babul, Arif [Department of Physics and Astronomy, University of Victoria, Victoria, BC V8W 3P6 (Canada); Tanvir, Nial R. [Department of Physics and Astronomy, University of Leicester, Leicester LE1 7RH (United Kingdom); Rich, Michael, E-mail: geraint.lewis@sydney.edu.au [Division of Astronomy, University of California, 8979 Math Sciences, Los Angeles, CA 90095-1562 (United States)

    2013-01-20

    Large-scale surveys of the prominent members of the Local Group have provided compelling evidence for the hierarchical formation of massive galaxies, revealing a wealth of substructure that is thought to be the debris from ancient and ongoing accretion events. In this paper, we compare two extant surveys of the M31-M33 subgroup of galaxies: the Pan-Andromeda Archaeological Survey of the stellar structure, and a combination of observations of the H I gaseous content, detected at 21 cm. Our key finding is a marked lack of spatial correlation between these two components on all scales, with only a few potential overlaps between stars and gas. The paucity of spatial correlation significantly restricts the analysis of kinematic correlations, although there does appear to be H I kinematically associated with the Giant Stellar Stream where it passes the disk of M31. These results demonstrate that different processes must significantly influence the dynamical evolution of the stellar and H I components of substructures, such as ram pressure driving gas away from a purely gravitational path. Detailed modeling of the offset between the stellar and gaseous substructures will provide a determination of the properties of the gaseous halos of M31 and M33.

  9. Formation of the black-hole binary M33 X-7 through mass exchange in a tight massive system.

    Science.gov (United States)

    Valsecchi, Francesca; Glebbeek, Evert; Farr, Will M; Fragos, Tassos; Willems, Bart; Orosz, Jerome A; Liu, Jifeng; Kalogera, Vassiliki

    2010-11-04

    The X-ray source M33 X-7 in the nearby galaxy Messier 33 is among the most massive X-ray binary stellar systems known, hosting a rapidly spinning, 15.65M(⊙) black hole orbiting an underluminous, 70M(⊙) main-sequence companion in a slightly eccentric 3.45-day orbit (M(⊙), solar mass). Although post-main-sequence mass transfer explains the masses and tight orbit, it leaves unexplained the observed X-ray luminosity, the star's underluminosity, the black hole's spin and the orbital eccentricity. A common envelope phase, or rotational mixing, could explain the orbit, but the former would lead to a merger and the latter to an overluminous companion. A merger would also ensue if mass transfer to the black hole were invoked for its spin-up. Here we report simulations of evolutionary tracks which reveal that if M33 X-7 started as a primary body of 85M(⊙)-99M(⊙) and a secondary body of 28M(⊙)-32M(⊙), in a 2.8-3.1-d orbit, its observed properties can be consistently explained. In this model, the main-sequence primary transfers part of its envelope to the secondary and loses the rest in a wind; it ends its life as a ∼16M(⊙) helium star with an iron-nickel core that collapses to a black hole (with or without an accompanying supernova). The release of binding energy, and possibly collapse asymmetries, 'kick' the nascent black hole into an eccentric orbit. Wind accretion explains the X-ray luminosity, and the black-hole spin can be natal.

  10. Monolayer structures of alkyl aldehydes: Odd-membered homologues

    International Nuclear Information System (INIS)

    Phillips, T.K.; Clarke, S.M.; Bhinde, T.; Castro, M.A.; Millan, C.; Medina, S.

    2011-01-01

    Crystalline monolayers of three aldehydes with an odd number of carbon atoms in the alkyl chain (C 7 , C 9 and C 11 ) at low coverages are observed by a combination of X-ray and neutron diffraction. Analysis of the diffraction data is discussed and possible monolayer crystal structures are proposed; although unique structures could not be ascertained for all molecules. We conclude that the structures are flat on the surface, with the molecules lying in the plane of the layer. The C 11 homologue is determined to have a plane group of either p2, pgb or pgg, and for the C 7 homologue the p2 plane group is preferred.

  11. Detection of a Yersinia pestis gene homologue in rodent samples

    Directory of Open Access Journals (Sweden)

    Timothy A. Giles

    2016-08-01

    Full Text Available A homologue to a widely used genetic marker, pla, for Yersinia pestis has been identified in tissue samples of two species of rat (Rattus rattus and Rattus norvegicus and of mice (Mus musculus and Apodemus sylvaticus using a microarray based platform to screen for zoonotic pathogens of interest. Samples were from urban locations in the UK (Liverpool and Canada (Vancouver. The results indicate the presence of an unknown bacterium that shares a homologue for the pla gene of Yersinia pestis, so caution should be taken when using this gene as a diagnostic marker.

  12. Phosphatase and tensin homologue deleted on chromosome 10 ...

    African Journals Online (AJOL)

    Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) is a tumor suppressor gene deleted or mutated in many human cancers such as glioblastoma, spinal tumors, prostate, bladder, adrenals, thyroid, breast, endometrium, and colon cancers. They result from loss of heterozygosity (LOH) for the PTEN ...

  13. Isolation and characterization of an AGAMOUS homologue from cocoa

    NARCIS (Netherlands)

    Chaidamsari, T.; Sugiarit, H.; Santoso, D.; Angenent, G.C.; Maagd, de R.A.

    2006-01-01

    We report the cloning of a cDNA from TcAG, an AG (Arabidopsis thaliana MADS-box C-type transcription factor gene AGAMOUS) homologue from cocoa (Theobroma cacao L.). TcAG was in the cocoa flower expressed primarily in stamens and ovaries, comparable to AG in Arabidopsis. Additionally, we found that

  14. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  15. Identification of a candidate CD5 homologue in the amphibian Xenopus laevis.

    Science.gov (United States)

    Jürgens, J B; Gartland, L A; Du Pasquier, L; Horton, J D; Göbel, T W; Cooper, M D

    1995-11-01

    We identified a novel T cell Ag in the South African clawed toad (Xenopus laevis) by a mAb designated 2B1. This Ag is present in relatively high levels on most thymocytes, approximately 65% of splenocytes, 55% of PBL, and 65% of intestinal lymphocytes, but is rarely seen on IgM+ B cells in any of these tissues. Lymphocytes bearing the 2B1 Ag proliferate in response to stimulation with Con A or PHA, whereas the 2B1- lymphocytes are reactive to LPS. Biochemical analysis indicates that this Ag is a differentially phosphorylated glycoprotein of 71 to 82 kDa. The protein core of 64 kDa bears both N- and O-linked carbohydrate side chains. The amino-terminal protein sequence of the 2B1 Ag shares significant homology with both the macrophage scavenger receptor type 1 motif and the mammalian CD5/CD6 family. The biochemical characteristics and cellular distribution of the 2B1 Ag suggest that it represents the CD5 homologue in X. laevis. While T cells constitutively express this highly conserved molecule, Xenopus B cells acquire the CD5 homologue only when they are stimulated in the presence of T cells.

  16. The UK Infrared Telescope M33 monitoring project - I. Variable red giant stars in the central square kiloparsec

    Science.gov (United States)

    Javadi, Atefeh; van Loon, Jacco Th.; Mirtorabi, Mohammad Taghi

    2011-02-01

    We have conducted a near-infrared monitoring campaign at the UK Infrared Telescope (UKIRT), of the Local Group spiral galaxy M33 (Triangulum). The main aim was to identify stars in the very final stage of their evolution, and for which the luminosity is more directly related to the birth mass than the more numerous less-evolved giant stars that continue to increase in luminosity. The most extensive data set was obtained in the K band with the UIST instrument for the central 4 × 4 arcmin2 (1 kpc2) - this contains the nuclear star cluster and inner disc. These data, taken during the period 2003-2007, were complemented by J- and H-band images. Photometry was obtained for 18 398 stars in this region; of these, 812 stars were found to be variable, most of which are asymptotic giant branch (AGB) stars. Our data were matched to optical catalogues of variable stars and carbon stars and to mid-infrared photometry from the Spitzer Space Telescope. In this first of a series of papers, we present the methodology of the variability survey and the photometric catalogue - which is made publicly available at the Centre de Données astronomiques de Strasbourg - and discuss the properties of the variable stars. The most dusty AGB stars had not been previously identified in optical variability surveys, and our survey is also more complete for these types of stars than the Spitzer survey.

  17. THE ARAUCARIA PROJECT. A DISTANCE DETERMINATION TO THE LOCAL GROUP SPIRAL M33 FROM NEAR-INFRARED PHOTOMETRY OF CEPHEID VARIABLES

    Energy Technology Data Exchange (ETDEWEB)

    Gieren, Wolfgang; Pietrzynski, Grzegorz; Graczyk, Dariusz, E-mail: wgieren@astro-udec.cl, E-mail: pietrzyn@hubble.cfm.udec.cl [Warsaw University Observatory, Al. Ujazdowskie 4, 00-478 Warsaw (Poland); and others

    2013-08-10

    Motivated by an amazing range of reported distances to the nearby Local Group spiral galaxy M33, we have obtained deep near-infrared photometry for 26 long-period Cepheids in this galaxy with the ESO Very Large Telescope. From the data, we constructed period-luminosity relations in the J and K bands which together with previous optical VI photometry for the Cepheids by Macri et al. were used to determine the true distance modulus of M33, and the mean reddening affecting the Cepheid sample with the multiwavelength fit method developed in the Araucaria Project. We find a true distance modulus of 24.62 for M33, with a total uncertainty of {+-}0.07 mag which is dominated by the uncertainty on the photometric zero points in our photometry. The reddening is determined as E(B - V) = 0.19 {+-} 0.02, in agreement with the value used by the Hubble Space Telescope Key Project of Freedman et al. but in some discrepancy with other recent determinations based on blue supergiant spectroscopy and an O-type eclipsing binary which yielded lower reddening values. Our derived M33 distance modulus is extremely insensitive to the adopted reddening law. We show that the possible effects of metallicity and crowding on our present distance determination are both at the 1%-2% level and therefore minor contributors to the total uncertainty of our distance result for M33.

  18. The LAMOST survey of background quasars in the vicinity of M31 and M33 – III. results from the 2013 regular survey

    International Nuclear Information System (INIS)

    Huo, Zhi-Ying; Shi, Jian-Rong; Yang, Ming; Liu, Xiao-Wei; Xiang, Mao-Sheng; Huang, Yang; Yuan, Hai-Bo; Zhang, Yong; Hou, Yong-Hui; Wang, Yue-Fei

    2015-01-01

    In this work, we report new quasars discovered in fields in the vicinity of the Andromeda (M31) and Triangulum (M33) galaxies with the Large Sky Area Multi-Object Fiber Spectroscopic Telescope (LAMOST, also called the Guo Shou Jing Telescope) during the 2013 observational season, the second year of the regular survey. In total, 1330 new quasars are discovered in an area of ∼133 deg 2 around M31 and M33. With i magnitudes ranging from 14.79 to 20.0 and redshifts from 0.08 to 4.85, the 1330 new quasars represent a significant increase in the number of identified quasars in fields in the vicinity of M31 and M33. Up to now, there have been a total of 1870 quasars discovered by LAMOST in this area. The much enlarged sample of known quasars in this area can potentially be utilized to construct a precise astrometric reference frame for the measurement of minute proper motions of M31, M33 and their associated substructures, which are vital for understanding the formation and evolution of M31, M33 and the Local Group of galaxies. Moreover, in the sample, there are a total of 45, 98 and 225 quasars with i magnitudes brighter than 17.0, 17.5 and 18.0 respectively. In the aforementioned brightness bins, 15, 35 and 84 quasars are reported here for the first time, and 6, 21 and 81 are reported in our pervious work. In addition, 0, 1 and 6 are from the Sloan Digital Sky Survey and 24, 41 and 54 are from the NED database. These bright quasars provide an invaluable sample to study the kinematics and chemistry of the interstellar/intergalactic medium of the Local Group. (paper)

  19. receptores

    Directory of Open Access Journals (Sweden)

    Salete Regina Daronco Benetti

    2006-01-01

    Full Text Available Se trata de un estudio etnográfico, que tuvo lo objetivo de interpretar el sistema de conocimiento y del significado atribuidos a la sangre referente a la transfusión sanguínea por los donadores y receptores de un banco de sangre. Para la colecta de las informaciones se observaron los participantes y la entrevista etnográfica se realizó el análisis de dominio, taxonómicos y temáticos. Los dominios culturales fueron: la sangre es vida: fuente de vida y alimento valioso; creencias religiosas: fuentes simbólicas de apoyos; donación sanguínea: un gesto colaborador que exige cuidarse, gratifica y trae felicidad; donación sanguínea: fuente simbólica de inseguridad; estar enfermo es una condición para realizar transfusión sanguínea; transfusión sanguínea: esperanza de vida; Creencias populares: transfusión sanguínea como riesgo para la salud; donadores de sangre: personas benditas; donar y recibir sangre: como significado de felicidad. Temática: “líquido precioso que origina, sostiene, modifica la vida, provoca miedo e inseguridad”.

  20. Identification of aldehyde oxidase 1 and aldehyde oxidase homologue 1 as dioxin-inducible genes

    International Nuclear Information System (INIS)

    Rivera, Steven P.; Choi, Hyun Ho; Chapman, Brett; Whitekus, Michael J.; Terao, Mineko; Garattini, Enrico; Hankinson, Oliver

    2005-01-01

    Aldehyde oxidases are a family of highly related molybdo-flavoenzymes acting upon a variety of compounds of industrial and medical importance. We have identified aldehyde oxidase 1 (AOX1) as a 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) inducible gene in the mouse hepatoma cell line Hepa-1. AOX1 mRNA levels were not increased by dioxin in mutant derivatives of the Hepa-1 cell line lacking either functional aryl hydrocarbon receptor (AHR) or aryl hydrocarbon receptor nuclear translocator (ARNT) proteins, thus demonstrating that transcriptional induction of AOX1 in response to dioxin occurs through the AHR pathway. Dioxin induction of AOX1 mRNA was also observed in mouse liver. In addition, levels of AOX1 protein as well as those of aldehyde oxidase homologue 1 (AOH1), a recently identified homolog of AOX1, were elevated in mouse liver in response to dioxin. Employing an aldehyde oxidase specific substrate, AOX1/AOH1 activity was shown to be induced by dioxin in mouse liver. This activity was inhibited by a known inhibitor of aldehyde oxidases, and eliminated by including tungstate in the mouse diet, which is known to lead to inactivation of molybdoflavoenzymes, thus confirming that the enzymatic activity was attributable to AOX1/AOH1. Our observations thus identify two additional xenobiotic metabolizing enzymes induced by dioxin

  1. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    OpenAIRE

    Apte, Manasi S.; Meller, Victoria H.

    2011-01-01

    Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will co...

  2. Toxicities of emamectin benzoate homologues and photodegradates to Lepidoptera.

    Science.gov (United States)

    Argentine, Joseph A; Jansson, Richard K; Starner, Van R; Halliday, W Ross

    2002-12-01

    The toxicity of a number of emamectin benzoate homologues and photodegradates to five species of Lepidoptera was investigated using diet and foliar bioassays. The emamectin benzoate homologues B1a and B1b were equally toxic in the diet and foliar assays to Spodoptera exigua (Hübner), Heliothis virescens (F.), Tricoplusia ni (Hübner), and Spodoptera frugiperda (J. E. Smith), within each of these species. Plutella xylostella (L.) was the most sensitive species to emamectin benzoate. The AB1a photodegradate of emamectin benzoate was as toxic as the parent compound in the diet assay. However, in the foliage assay AB1a was 4.4-fold less toxic to S. exigua than the parent compound. The MFB1a photodegradate of emamectin benzoate was as toxic as the parent compound to P. xylostella, and 3.1 to 6.2 times as toxic as the parent compound to the other species in the diet assay. The order of toxicity of the photodegradates were AB1a > MFB1a > FAB1a > 8,9-Z-MAB1a > PAB1a.

  3. Homologue Pairing in Flies and Mammals: Gene Regulation When Two Are Involved

    Directory of Open Access Journals (Sweden)

    Manasi S. Apte

    2012-01-01

    Full Text Available Chromosome pairing is usually discussed in the context of meiosis. Association of homologues in germ cells enables chromosome segregation and is necessary for fertility. A few organisms, such as flies, also pair their entire genomes in somatic cells. Most others, including mammals, display little homologue pairing outside of the germline. Experimental evidence from both flies and mammals suggests that communication between homologues contributes to normal genome regulation. This paper will contrast the role of pairing in transmitting information between homologues in flies and mammals. In mammals, somatic homologue pairing is tightly regulated, occurring at specific loci and in a developmentally regulated fashion. Inappropriate pairing, or loss of normal pairing, is associated with gene misregulation in some disease states. While homologue pairing in flies is capable of influencing gene expression, the significance of this for normal expression remains unknown. The sex chromosomes pose a particularly interesting situation, as females are able to pair X chromosomes, but males cannot. The contribution of homologue pairing to the biology of the X chromosome will also be discussed.

  4. Targeting the Enhancer of Zeste Homologue 2 in Medulloblastoma

    Science.gov (United States)

    Alimova, Irina; Venkataraman, Sujatha; Harris, Peter; Marquez, Victor E.; Northcott, Paul A; Dubuc, Adrian; Taylor, Michael D; Foreman, Nicholas K; Vibhakar, Rajeev

    2012-01-01

    Enhancer of zeste homologue 2 (EZH2) is the catalytic subunit of Polycomb repressive complex 2 that catalyzes the trimethylation of histone H3 on Lys 27, and represses gene transcription. EZH2 enhances cancer-cell proliferation and regulates stem cell maintenance and differentiation. Here, we demonstrate that EZH2 is highly expressed in medulloblastoma, a highly malignant brain tumor of childhood, and this altered expression is correlated with genomic gain of chromosome 7 in a subset of medulloblastoma. Inhibition of EZH2 by RNAi suppresses medulloblastoma tumor cell growth. We show that 3-deazaneplanocin A, a chemical inhibitor of EZH2, can suppress medulloblastoma cell growth partially by inducing apoptosis. Suppression of EZH2 expression diminishes the ability of tumor cells to form spheres in culture and strongly represses the ability of known oncogenes to transform neural stem cells. These findings establish a role of EZH2 in medulloblastoma and identify EZH2 as a potential therapeutic target especially in high-risk tumors. PMID:22287205

  5. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    Energy Technology Data Exchange (ETDEWEB)

    Singh,S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 {angstrom} above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the

  6. Antidepressant Binding Site in a Bacterial Homologue of Neurotransmitter Transporters

    International Nuclear Information System (INIS)

    Singh, S.; Yamashita, A.; Gouaux, E.

    2007-01-01

    Sodium-coupled transporters are ubiquitous pumps that harness pre-existing sodium gradients to catalyse the thermodynamically unfavourable uptake of essential nutrients, neurotransmitters and inorganic ions across the lipid bilayer. Dysfunction of these integral membrane proteins has been implicated in glucose/galactose malabsorption, congenital hypothyroidism, Bartter's syndrome, epilepsy, depression, autism and obsessive-compulsive disorder. Sodium-coupled transporters are blocked by a number of therapeutically important compounds, including diuretics, anticonvulsants and antidepressants, many of which have also become indispensable tools in biochemical experiments designed to probe antagonist binding sites and to elucidate transport mechanisms. Steady-state kinetic data have revealed that both competitive and noncompetitive modes of inhibition exist. Antagonist dissociation experiments on the serotonin transporter (SERT) have also unveiled the existence of a low-affinity allosteric site that slows the dissociation of inhibitors from a separate high-affinity site. Despite these strides, atomic-level insights into inhibitor action have remained elusive. Here we screen a panel of molecules for their ability to inhibit LeuT, a prokaryotic homologue of mammalian neurotransmitter sodium symporters, and show that the tricyclic antidepressant (TCA) clomipramine noncompetitively inhibits substrate uptake. Cocrystal structures show that clomipramine, along with two other TCAs, binds in an extracellular-facing vestibule about 11 (angstrom) above the substrate and two sodium ions, apparently stabilizing the extracellular gate in a closed conformation. Off-rate assays establish that clomipramine reduces the rate at which leucine dissociates from LeuT and reinforce our contention that this TCA inhibits LeuT by slowing substrate release. Our results represent a molecular view into noncompetitive inhibition of a sodium-coupled transporter and define principles for the rational

  7. Enhancer of rudimentary homologue interacts with scaffold attachment factor B at the nuclear matrix to regulate SR protein phosphorylation.

    Science.gov (United States)

    Drakouli, Sotiria; Lyberopoulou, Aggeliki; Papathanassiou, Maria; Mylonis, Ilias; Georgatsou, Eleni

    2017-08-01

    Scaffold attachment factor B1 (SAFB1) is an integral component of the nuclear matrix of vertebrate cells. It binds to DNA on scaffold/matrix attachment region elements, as well as to RNA and a multitude of different proteins, affecting basic cellular activities such as transcription, splicing and DNA damage repair. In the present study, we show that enhancer of rudimentary homologue (ERH) is a new molecular partner of SAFB1 and its 70% homologous paralogue, scaffold attachment factor B2 (SAFB2). ERH interacts directly in the nucleus with the C-terminal Arg-Gly-rich region of SAFB1/2 and co-localizes with it in the insoluble nuclear fraction. ERH, a small ubiquitous protein with striking homology among species and a unique structure, has also been implicated in fundamental cellular mechanisms. Our functional analyses suggest that the SAFB/ERH interaction does not affect SAFB1/2 function in transcription (e.g. as oestrogen receptor α co-repressors), although it reverses the inhibition exerted by SAFB1/2 on the splicing kinase SR protein kinase 1 (SRPK1), which also binds on the C-terminus of SAFB1/2. Accordingly, ERH silencing decreases lamin B receptor and SR protein phosphorylation, which are major SRPK1 substrates, further substantiating the role of SAFB1 and SAFB2 in the co-ordination of nuclear function. © 2017 Federation of European Biochemical Societies.

  8. The Orphan Nuclear Receptor TLX/NR2E1 in Neural Stem Cells and Diseases.

    Science.gov (United States)

    Wang, Tao; Xiong, Jian-Qiong

    2016-02-01

    The human TLX gene encodes an orphan nuclear receptor predominantly expressed in the central nervous system. Tailess and Tlx, the TLX homologues in Drosophila and mouse, play essential roles in body-pattern formation and neurogenesis during early embryogenesis and perform crucial functions in maintaining stemness and controlling the differentiation of adult neural stem cells in the central nervous system, especially the visual system. Multiple target genes and signaling pathways are regulated by TLX and its homologues in specific tissues during various developmental stages. This review aims to summarize previous studies including many recent updates from different aspects concerning TLX and its homologues in Drosophila and mouse.

  9. From Cell Death to Metabolism: Holin-Antiholin Homologues with New Functions

    DEFF Research Database (Denmark)

    van den Esker, Marielle H.; Kovács, Ákos T.; Kuipers, Oscar P.

    2017-01-01

    , but their functions can be different, depending on the species. Using a series of biochemical and genetic approaches, in a recent article in mBio, Charbonnier et al. (mBio 8:e00976-17, 2017, https://doi.org/10.1128/mBio.00976-17) demonstrate that the antiholin homologue in Bacillus subtilis transports pyruvate...

  10. Behaviour of the homologues of Rf and Db in complexing media

    International Nuclear Information System (INIS)

    Trubert, D.; Monroy Guzman, F.; Hussonnois, M.; Brillard, L.; Le Naour, C.; Servajean, V.; Constantinescu, O.; Constantinescu, M.; Ardisson, G.; Barci, V.; Weiss, B.

    1999-01-01

    In order to study the chemical behaviour of the trans-actinide elements, the chemical properties of their most probable homologues have been investigated by ion exchange methods in various complexing media. A new chromatographic method allowing the determination of distribution coefficients in the case o short-lived isotopes has been developed and successfully tested with the RACHEL device. (authors)

  11. A lesion mimic phenotype in tomato obtained by isolating and silencing an Lls1 homologue

    NARCIS (Netherlands)

    Spassieva, S; Hille, J

    Lesion mimic phenotypes serve as a tool to study the regulation of cell death in plants. In order to obtain a tomato lesion mimic phenotype, we used the conservation of the lethal leaf spot 1 (Lls1) genes between plant species. The tomato Lls1 homologue was cloned, sequenced and analyzed. It showed

  12. The actin homologue MreB organizes the bacterial cell membrane

    NARCIS (Netherlands)

    Strahl, H.; Burmann, F.; Hamoen, L.W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate

  13. Cloning and characterization of maize ZmSPK1, a homologue to ...

    African Journals Online (AJOL)

    hope&shola

    2006-03-15

    Mar 15, 2006 ... homologue to nonfermenting1-related protein kinase2 ... RT-PCR analysis showed that the ZmSPK1 expression was induced by mannitol, salt and ... MAPKKK in which each component is activated by .... It has been one of the main ... Protein kinase ATP-binding region signature is shown in gray box.

  14. A Hexose Transporter Homologue Controls Glucose Repression in the Methylotrophic Yeast Hansenula polymorpha

    NARCIS (Netherlands)

    Stasyk, Oleh V.; Stasyk, Olena G.; Komduur, Janet; Veenhuis, Marten; Cregg, James M.; Sibirny, Andrei A.

    2004-01-01

    Peroxisome biogenesis and synthesis of peroxisomal enzymes in the methylotrophic yeast Hansenula polymorpha are under the strict control of glucose repression. We identified an H. polymorpha glucose catabolite repression gene (HpGCR1) that encodes a hexose transporter homologue. Deficiency in GCR1

  15. Structure of HLA-A*1101 in complex with a hepatitis B peptide homologue

    DEFF Research Database (Denmark)

    Blicher, Thomas; Kastrup, Jette Sandholm; Pedersen, Lars Østergaard

    2006-01-01

    A high-resolution structure of the human MHC-I molecule HLA-A*1101 is presented in which it forms a complex with a sequence homologue of a peptide that occurs naturally in hepatitis B virus DNA polymerase. The sequence of the bound peptide is AIMPARFYPK, while that of the corresponding natural...

  16. Structural studies on a non-toxic homologue of type II RIPs from ...

    Indian Academy of Sciences (India)

    Structural studies on a non-toxic homologue of type II RIPs from bitter gourd: Molecular basis of non-toxicity, conformational selection and glycan structure. MS accepted http://www.ias.ac.in/jbiosci. THYAGESHWAR CHANDRAN, ALOK SHARMA and M VIJAYAN. J. Biosci. 40(5), October 2015, 929–941, © Indian Academy of ...

  17. Characterization of four RecQ homologues from rice (Oryza sativa L. cv. Nipponbare)

    International Nuclear Information System (INIS)

    Saotome, Ai; Kimura, Seisuke; Mori, Yoko; Uchiyama, Yukinobu; Morohashi, Kengo; Sakaguchi, Kengo

    2006-01-01

    The RecQ family of DNA helicases is conserved throughout the biological kingdoms. In this report, we have characterized four RecQ homologues clearly expressed in rice. OsRecQ1, OsRecQ886, and OsRecQsim expressions were strongly detected in meristematic tissues. Transcription of the OsRecQ homologues was differentially induced by several types of DNA-damaging agents. The expression of four OsRecQ homologues was induced by MMS and bleomycin. OsRecQ1 and OsRecQ886 were induced by H 2 O 2 , and MitomycinC strongly induced the expression of OsRecQ1. Transient expression of OsRecQ/GFP fusion proteins demonstrated that OsRecQ2 and OsRecQ886 are found in nuclei, whereas OsRecQ1 and OsRecQsim are found in plastids. Neither OsRecQ1 nor OsRecQsim are induced by light. These results indicate that four of the RecQ homologues have different and specific functions in DNA repair pathways, and that OsRecQ1 and OsRecQsim may not involve in plastid differentiation but different aspects of a plastid-specific DNA repair system

  18. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  19. The role of the leukemia-associated ETO homologue repressors in hematopoiesis

    OpenAIRE

    Olsson, André

    2006-01-01

    The fusion protein AML1-ETO is observed in acute myeloid patients with the chromosomal translocation t(8;21). Cells with this chimeric protein have impaired granulocytic and erythroid differentiation with accumulation of myeloblasts. The transcriptional co-repressor ETO (Eight Twenty One) was identified from the cloning of AML1-ETO. Subsequently, MTGR1 (Myeloid Translocation Gene-Related protein 1) and MTG16 (Myeloid Translocation Gene on chromosome 16) were found to be homologues to ETO, all...

  20. Periodontal status of teeth restored with crowns and its contralateral homologue, Valdivia- Chile.

    OpenAIRE

    Israel Antonio Juárez; Sofía Larroulet; Makarena Ojeda; Cristian Rosas

    2015-01-01

    ABSTRACT Aim: To determine periodontal status of fixes single prostheses (FSP) made during the year 2013 in Austral University of Chile, and its contralateral homologue (CH).Methods: All patients with FSP made during 2013, that met the selection criteria and agreed to participate were evaluated. During the year 2014 was measured: probing depth, attachment level; bleeding on probing and dental plaque index for each FSP and CH; and consigned biological width invasion. Were measured one FSP...

  1. The actin homologue MreB organizes the bacterial cell membrane

    OpenAIRE

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W.

    2014-01-01

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lip...

  2. Crystal structure of myotoxin-II: a myotoxic phospholipase A2 - homologue from Bothrops moojeni venom

    International Nuclear Information System (INIS)

    Azevedo, W.F.; Ward, R.J.; Lombardi, F.R.; Arni, R.K.; Soares, A.M.; Giglio, J.R.; Fontes, M.R.M.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ; E C 3.1.1.4, phosphatides s n-2 acyl hydrolases) hydrolysis the s n-2 ester bond of phospholipids showing enhanced activity at lamellar or membrane surfaces. Intracellular PLA 2 s are involved at phospholipid metabolism and signal transduction, whereas extracellular PLA 2 s are found in mammalian pancreatic juices, the venoms of snakes, lizards and insects. Based on their high primary sequence similarity, extracellular PLA 2 s are separated into Classes I, II and III. Class II PLA 2 s are found in snake venoms of Crotalidae an Viperidae species, and include the sub-family of Lys PLA 2 s homologue. he coordination of the Ca 2+ ion in the PLA 2 calcium-binding loop includes and aspartate at position 49. In the catalytically active PLA 2 s, this calcium ion plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The conservative substitution Asp49-Lys results in a decreased calcium affinity with a concomitant loss of catalytic activity, and naturally occurring PLA 2 s-homologues showing the same substitution are catalytically inactive. However, the Lys PLA 2 s possess cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid layers by a ca 2+ -independent mechanism for which there is no evidence of lipid hydrolysis. Lys 49 PLA 2 homologues have been isolated from several Bothrops spp. venoms including B. moojeni. Therefore, in order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ independent membrane damaging activities we have determined the crystal structure of MjTX-II, a Lys 49 homologue from the venom of B. moojeni. The model presented has been determined at 2.0 A resolution and refined to a crystallographic residual of 19.7% (R f ree=28.1%). (author)

  3. Three TFL1 homologues regulate floral initiation in the biofuel plant Jatropha curcas

    Science.gov (United States)

    Li, Chaoqiong; Fu, Qiantang; Niu, Longjian; Luo, Li; Chen, Jianghua; Xu, Zeng-Fu

    2017-01-01

    Recent research revealed that TERMINAL FLOWER 1 (TFL1) homologues are involved in the critical developmental process of floral initiation in several plant species. In this study, the functions of three putative TFL1 homologues (JcTFL1a, JcTFL1b and JcTFL1c) in the biofuel plant Jatropha curcas were analysed using the transgenic approach. JcTFL1b and JcTFL1c, but not JcTFL1a, could complement the TFL1 function and rescue early flowering and determinate inflorescence phenotype in tfl1-14 Arabidopsis mutant, thus suggesting that JcTFL1b and JcTFL1c may be homologues of TFL1. Transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c showed late flowering, whereas only JcTFL1b and JcTFL1c overexpression delayed flowering in transgenic Arabidopsis. JcTFL1b-RNAi transgenic Jatropha consistently exhibited moderately early flowering phenotype. JcFT and JcAP1 were significantly downregulated in transgenic Jatropha overexpressing JcTFL1a, JcTFL1b or JcTFL1c, which suggested that the late flowering phenotype of these transgenic Jatropha may result from the repressed expression of JcFT and JcAP1. Our results indicate that these three JcTFL1 genes play redundant roles in repressing flowering in Jatropha. PMID:28225036

  4. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3) gene: a novel mammalian homologue of ACE

    OpenAIRE

    Rella, Monika; Elliot, Joann L; Revett, Timothy J; Lanfear, Jerry; Phelan, Anne; Jackson, Richard M; Turner, Anthony J; Hooper, Nigel M

    2007-01-01

    Abstract Background Mammalian angiotensin converting enzyme (ACE) plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple ...

  5. The role of the Saccharomyces cerevisiae lipoate protein ligase homologue, Lip3, in lipoic acid synthesis.

    Science.gov (United States)

    Hermes, Fatemah A; Cronan, John E

    2013-10-01

    The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  6. Primary structure and functional characterization of a Drosophila dopamine receptor with high homology to human D1/5 receptors.

    Science.gov (United States)

    Gotzes, F; Balfanz, S; Baumann, A

    1994-01-01

    Members of the superfamily of G-protein coupled receptors share significant similarities in sequence and transmembrane architecture. We have isolated a Drosophila homologue of the mammalian dopamine receptor family using a low stringency hybridization approach. The deduced amino acid sequence is approximately 70% homologous to the human D1/D5 receptors. When expressed in HEK 293 cells, the Drosophila receptor stimulates cAMP production in response to dopamine application. This effect was mimicked by SKF 38393, a specific D1 receptor agonist, but inhibited by dopaminergic antagonists such as butaclamol and flupentixol. In situ hybridization revealed that the Drosophila dopamine receptor is highly expressed in the somata of the optic lobes. This suggests that the receptor might be involved in the processing of visual information and/or visual learning in invertebrates.

  7. The plant PTS1 receptor : similarities and differences to its human and yeast counterparts

    NARCIS (Netherlands)

    Wimmer, C; Schmid, Markus; Veenhuis, M; Gietl, C

    1998-01-01

    Two targeting signals, PTS1 and PTS2, mediate import of proteins into the peroxisomal matrix. We have cloned and sequenced the watermelon (Citrullus vulgaris) cDNA homologue to the PTS1 receptor gene (PEX5). Its gene product, CvPex5p, belongs to the family of tetratricopeptide repeat (TPR)

  8. Crystal structure of a bacterial homologue of glucose transporters GLUT1-4.

    Science.gov (United States)

    Sun, Linfeng; Zeng, Xin; Yan, Chuangye; Sun, Xiuyun; Gong, Xinqi; Rao, Yu; Yan, Nieng

    2012-10-18

    Glucose transporters are essential for metabolism of glucose in cells of diverse organisms from microbes to humans, exemplified by the disease-related human proteins GLUT1, 2, 3 and 4. Despite rigorous efforts, the structural information for GLUT1-4 or their homologues remains largely unknown. Here we report three related crystal structures of XylE, an Escherichia coli homologue of GLUT1-4, in complex with d-xylose, d-glucose and 6-bromo-6-deoxy-D-glucose, at resolutions of 2.8, 2.9 and 2.6 Å, respectively. The structure consists of a typical major facilitator superfamily fold of 12 transmembrane segments and a unique intracellular four-helix domain. XylE was captured in an outward-facing, partly occluded conformation. Most of the important amino acids responsible for recognition of D-xylose or d-glucose are invariant in GLUT1-4, suggesting functional and mechanistic conservations. Structure-based modelling of GLUT1-4 allows mapping and interpretation of disease-related mutations. The structural and biochemical information reported here constitutes an important framework for mechanistic understanding of glucose transporters and sugar porters in general.

  9. Self-assembly of diphenylalanine backbone homologues and their combination with functionalized carbon nanotubes.

    Science.gov (United States)

    Dinesh, Bhimareddy; Squillaci, Marco A; Ménard-Moyon, Cécilia; Samorì, Paolo; Bianco, Alberto

    2015-10-14

    The integration of carbon nanotubes (CNTs) into organized nanostructures is of great interest for applications in materials science and biomedicine. In this work we studied the self-assembly of β and γ homologues of diphenylalanine peptides under different solvent and pH conditions. We aimed to investigate the role of peptide backbone in tuning the formation of different types of nanostructures alone or in combination with carbon nanotubes. In spite of having the same side chain, β and γ peptides formed distinctively different nanofibers, a clear indication of the role played by the backbone homologation on the self-assembly. The variation of the pH allowed to transform the nanofibers into spherical structures. Moreover, the co-assembly of β and γ peptides with carbon nanotubes covalently functionalized with the same peptide generated unique dendritic assemblies. This comparative study on self-assembly using diphenylalanine backbone homologues and of the co-assembly with CNT covalent conjugates is the first example exploring the capacity of β and γ peptides to adopt precise nanostructures, particularly in combination with carbon nanotubes. The dendritic organization obtained by mixing carbon nanotubes and peptides might find interesting applications in tissue engineering and neuronal interfacing.

  10. Inhibition of hydroxyapatite growth by casein, a potential salivary phosphoprotein homologue.

    Science.gov (United States)

    Romero, Maria J R H; Nakashima, Syozi; Nikaido, Toru; Ichinose, Shizuko; Sadr, Alireza; Tagami, Junji

    2015-08-01

    Salivary phosphoproteins are essential in tooth mineral regulation but are often overlooked in vitro. This study aimed to evaluate the effect of casein, as a salivary phosphoprotein homologue, on the deposition and growth of hydroxyapatite (HA) on tooth surfaces. Hydroxyapatite growth was quantified using seeded crystal systems. Artificial saliva (AS) containing HA powder and 0, 10, 20, 50, or 100 μg ml(-1) of casein, or 100 μg ml(-1) of dephosphorylated casein (Dcasein), was incubated for 0-8 h at 37°C, pH 7.2. Calcium concentrations were measured using atomic absorption spectroscopy (AAS). Surface precipitation of HA on bovine enamel and dentine blocks, incubated in similar conditions for 7 d, was examined using field emission scanning electron microscopy (FE-SEM) and transmission electron microscopy (TEM) with selected area electron diffraction (SAED). Casein adsorption was assessed using modified Lowry assays and zeta-potential measurements. The AAS results revealed a concentration-dependent inhibition of calcium consumption. Hydroxyapatite precipitation occurred when no casein was present, whereas precipitation of HA was apparently completely inhibited in casein-containing groups. Adsorption data demonstrated increasingly negative zeta-potential with increased casein concentration and an affinity constant similar to proline-rich proteins with Langmuir modelling. Casein inhibited the deposition and growth of HA primarily through the binding of esterized phosphate to HA active sites, indicating its potential as a mineral-regulating salivary phosphoprotein homologue in vitro. © 2015 Eur J Oral Sci.

  11. The use of polynuclear aromatic hydrocarbon (PAH) alkyl homologues in determining petroleum source identification and weathering

    International Nuclear Information System (INIS)

    Brown, J.S.; Boehm, P.D.; Sauer, T.C.; Wong, W.M.C.

    1993-01-01

    Techniques utilizing double ratio plots of selected polynuclear aromatic hydrocarbon (PAH) alkyl homologues were used to identify and distinguish crude oils and refined petroleum products from each other and to distinguish petroleum sources in complex pollutant regimes. Petroleum samples were fractionated by high performance liquid chromatography (HPLC) into saturated and aromatic (PAH) hydrocarbon fractions. The saturated hydrocarbon fractions were then analyzed by gas chromatography/flame ionization detection (GC/FID) to obtain a resolved/unresolved alkane fingerprint of each oil. The aromatic fractions of the oils were analyzed by gas chromatography/mass spectrometry (GC/MS) for PAH and selected alkyl homologues. Comparisons of the saturated hydrocarbon fingerprints indicated that some oils were indistinguishable based on the alkane fingerprint alone. Another double ratio plot of the alkyl chrysenes and alkyl dibenzothiophenes was effective in establishing the weathering of oil in environmental samples which were processed using the same analytical techniques, since the dibenzothiophenes are degraded more rapidly than the chrysenes. The application of selected ratios in oil spill source identification in complex environmental samples from Suisin Bay California and Boston Harbor are discussed. The use of ratios to measure the extent of weathering in oil spill samples from Prince William Sound and the Gulf of Alaska is examined

  12. Biodegradation of diesel fuel by a microbial consortium in the presence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues

    DEFF Research Database (Denmark)

    Chrzanowski, L; Stasiewicz, M; Owsianiak, Mikolaj

    2009-01-01

    hypothesize that in the presence of diesel fuel low-water-soluble ionic liquids may become more toxic to hydrocarbon-degrading microorganisms. In this study the influence of 1-alkoxymethyl-2-methyl-5-hydroxypyridinium chloride homologues (side-chain length from C-3 to C-18) on biodegradation of diesel fuel...... by a bacterial consortium was investigated. Whereas test performed for the consortium cultivated on disodium succinate showed that toxicity of the investigated ionic liquids decreased with increase in side-chain length, only higher homologues (C-8-C-18) caused a decrease in diesel fuel biodegradation......, respectively. We conclude that in the presence of hydrocarbons acting as a solvent, the increased bioavailability of hydrophobic homologues is responsible for the decrease in biodegradation efficiency of diesel fuel....

  13. TOR1 and TOR2 are structurally and functionally similar but not identical phosphatidylinositol kinase homologues in yeast

    OpenAIRE

    Helliwell, S. B.; Wagner, P.; Kunz, J.; Deuter-Reinhard, M.; Henriquez, R.; Hall, M. N.

    1994-01-01

    The Saccharomyces cerevisiae genes TOR1 and TOR2 were originally identified by mutations that confer resistance to the immunosuppressant rapamycin. TOR2 was previously shown to encode an essential 282-kDa phosphatidylinositol kinase (PI kinase) homologue. The TOR1 gene product is also a large (281 kDa) PI kinase homologue, with 67% identity to TOR2. TOR1 is not essential, but a TOR1 TOR2 double disruption uniquely confers a cell cycle (G1) arrest as does exposure to rapamycin; disruption of T...

  14. Assembly of Oligomeric Death Domain Complexes during Toll Receptor Signaling*

    OpenAIRE

    Moncrieffe, Martin C.; Grossmann, J. Günter; Gay, Nicholas J.

    2008-01-01

    The Drosophila Toll receptor is activated by the endogenous protein ligand Spätzle in response to microbial stimuli in immunity and spatial cues during embryonic development. Downstream signaling is mediated by the adaptor proteins Tube, the kinase Pelle, and the Drosophila homologue of myeloid differentiation primary response protein (dMyD88). Here we have characterized heterodimeric (dMyD88-Tube) and heterotrimeric (dMyD88-Tube-Pelle) death domain complexes. We show ...

  15. Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves

    Energy Technology Data Exchange (ETDEWEB)

    Y Chen; L Hu; M Punta; R Bruni; B Hillerich; B Kloss; B Rost; J Love; S Siegelbaum; W Hendrickson

    2011-12-31

    The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated by an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.

  16. The actin homologue MreB organizes the bacterial cell membrane.

    Science.gov (United States)

    Strahl, Henrik; Bürmann, Frank; Hamoen, Leendert W

    2014-03-07

    The eukaryotic cortical actin cytoskeleton creates specific lipid domains, including lipid rafts, which determine the distribution of many membrane proteins. Here we show that the bacterial actin homologue MreB displays a comparable activity. MreB forms membrane-associated filaments that coordinate bacterial cell wall synthesis. We noticed that the MreB cytoskeleton influences fluorescent staining of the cytoplasmic membrane. Detailed analyses combining an array of mutants, using specific lipid staining techniques and spectroscopic methods, revealed that MreB filaments create specific membrane regions with increased fluidity (RIFs). Interference with these fluid lipid domains (RIFs) perturbs overall lipid homeostasis and affects membrane protein localization. The influence of MreB on membrane organization and fluidity may explain why the active movement of MreB stimulates membrane protein diffusion. These novel MreB activities add additional complexity to bacterial cell membrane organization and have implications for many membrane-associated processes.

  17. Isolation of a cotton NADP(H oxidase homologue induced by drought stress

    Directory of Open Access Journals (Sweden)

    NEPOMUCENO ALEXANDRE LIMA

    2000-01-01

    Full Text Available The aim of this study was to identify and isolate genes that are differentially expressed in four selected cotton (Gossypium hirsutum L. genotypes contrasting according to their tolerance to water deficit. The genotypes studied were Siokra L-23, Stoneville 506, CS 50 and T-1521. Physiological, morphological and developmental changes that confer drought tolerance in plants must have a molecular genetic basis. To identify and isolate the genes, the mRNA Differential Display (DD technique was used. Messenger RNAs differentially expressed during water deficit were identified, isolated, cloned and sequenced. The cloned transcript A12B15-5, a NADP(H oxidase homologue, was up regulated only during the water deficit stress and only in Siokra L-23, a drought tolerant genotype. Ribonuclease protection assay confirmed that transcription.

  18. Conservation of Oxidative Protein Stabilization in an Insect Homologue of Parkinsonism-Associated Protein DJ-1

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)

    2012-08-21

    DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.

  19. 4-Oxalocrotonate tautomerase, its homologue YwhB, and active vinylpyruvate hydratase : Synthesis and evaluation of 2-fluoro substrate analogues

    NARCIS (Netherlands)

    Johnson, William H; Wang, Susan C; Stanley, Thanuja M; Czerwinski, Robert M; Almrud, Jeffrey J; Poelarends, Gerrit J; Murzin, Alexey G; Whitman, Christian P

    2004-01-01

    A series of 2-fluoro-4-alkene and 2-fluoro-4-alkyne substrate analogues were synthesized and examined as potential inhibitors of three enzymes: 4-oxalocrotonate tautomerase (4-OT) and vinylpyruvate hydratase (VPH) from the catechol meta-fission pathway and a closely related 4-OT homologue found in

  20. Towards structural studies of the old yellow enzyme homologue SYE4 from Shewanella oneidensis and its complexes at atomic resolution

    International Nuclear Information System (INIS)

    Elegheert, Jonathan; Hemel, Debbie van den; Dix, Ina; Stout, Jan; Van Beeumen, Jozef; Brigé, Ann; Savvides, Savvas N.

    2009-01-01

    Of the four old yellow enzyme homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. Shewanella oneidensis is an environmentally versatile Gram-negative γ-proteobacterium that is endowed with an unusually large proteome of redox proteins. Of the four old yellow enzyme (OYE) homologues found in S. oneidensis, SYE4 is the homologue most implicated in resistance to oxidative stress. SYE4 was recombinantly expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to the orthorhombic space group P2 1 2 1 2 1 and were moderately pseudo-merohedrally twinned, emulating a P422 metric symmetry. The native crystals of SYE4 were of exceptional diffraction quality and provided complete data to 1.10 Å resolution using synchrotron radiation, while crystals of the reduced enzyme and of the enzyme in complex with a wide range of ligands typically led to high-quality complete data sets to 1.30–1.60 Å resolution, thus providing a rare opportunity to dissect the structure–function relationships of a good-sized enzyme (40 kDa) at true atomic resolution. Here, the attainment of a number of experimental milestones in the crystallographic studies of SYE4 and its complexes are reported, including isolation of the elusive hydride–Meisenheimer complex

  1. Insulin receptors

    International Nuclear Information System (INIS)

    Kahn, C.R.; Harrison, L.C.

    1988-01-01

    This book contains the proceedings on insulin receptors. Part A: Methods for the study of structure and function. Topics covered include: Method for purification and labeling of insulin receptors, the insulin receptor kinase, and insulin receptors on special tissues

  2. An exploration of Glb1 Homologue AntibodyLevels in Children at Increased Risk for Type 1 Diabetes mellitus

    Science.gov (United States)

    Simpson, M.; Mojibian, M.; Barriga, K.; Scott, F.W.; Fasano, A.; Rewers, M.; Norris, J.M.

    2010-01-01

    Aims To determine whether Glb1 homologue antibodies are associated with islet autoimmunity (IA) in children at increased risk for type 1 diabetes (T1D), and to investigate their relation with putative environmental correlates of T1D. Methods We selected a sample from the Diabetes Autoimmunity Study in the Young (DAISY), a prospective study of children at increased risk for T1D. Cases were those who were positive for insulin, glutamic acid decarboxylase (GAD), or insulinoma-associated antigen-2 (IA-2) autoantibodies on two consecutive visits and either diagnosed with diabetes mellitus or still autoantibody positive when selected. Controls were from the same increased risk group, of similar age as the cases but negative for autoantibodies. Sera from 91 IA cases and 82 controls were analyzed in a blinded manner for immunoglobulin G (IgG) antibodies to Glb1 homologue by ELISA. Results Adjusting for family history of T1D and HLA-DR4 positivity, Glb1 homologue antibodies were not associated with IA case status (OR: 1.01, 95% CI: 0.99 – 1.03). Adjusting for age, family history of T1D, and HLA-DR4 positivity, Glb1 homologue antibody levels were inversely associated with breast-feeding duration (beta = −0.08, p = 0.001) and directly associated with current intake of foods containing gluten (beta = 0.24, p = 0.007) in IA cases but not in controls. Zonulin, a biomarker of gut permeability, was directly associated with Glb1 homologue antibody levels in cases (beta = 0.73, p = 0.003) but not in controls. Conclusion Differences in correlates of Glb1 antibodies in IA cases and controls suggest an underlying difference in mucosal immune response. PMID:19622083

  3. Identification of possible targets of the Aspergillus fumigatus CRZ1 homologue, CrzA

    Directory of Open Access Journals (Sweden)

    Goldman Gustavo H

    2010-01-01

    Full Text Available Abstract Background Calcineurin, a serine/threonine-specific protein phosphatase, plays an important role in the control of cell morphology and virulence in fungi. Calcineurin regulates localization and activity of a transcription factor called CRZ1. Recently, we characterize Aspergillus fumigatus CRZ1 homologue, AfCrzA. Here, we investigate which pathways are influenced by A. fumigatus AfCrzA during a short pulse of calcium by comparatively determining the transcriptional profile of A. fumigatus wild type and ΔAfcrzA mutant strains. Results We were able to observe 3,622 genes modulated in at least one timepoint in the mutant when compared to the wild type strain (3,211 and 411 at 10 and 30 minutes, respectively. Decreased mRNA abundance in the ΔcrzA was seen for genes encoding calcium transporters, transcription factors and genes that could be directly or indirectly involved in calcium metabolism. Increased mRNA accumulation was observed for some genes encoding proteins involved in stress response. AfCrzA overexpression in A. fumigatus increases the expression of several of these genes. The deleted strain of one of these genes, AfRcnA, belonging to a class of endogenous calcineurin regulators, calcipressins, had more calcineurin activity after exposure to calcium and was less sensitive to menadione 30 μM, hydrogen peroxide 2.5 mM, EGTA 25 mM, and MnCl2 25 mM. We constructed deletion, overexpression, and GFP fusion protein for the closely related A. nidulans AnRcnA. GFP::RcnA was mostly detected along the germling, did not accumulate in the nuclei and its location is not affected by the cellular response to calcium chloride. Conclusion We have performed a transcriptional profiling analysis of the A. fumigatus ΔAfcrzA mutant strain exposed to calcium stress. This provided an excellent opportunity to identify genes and pathways that are under the influence of AfCrzA. AfRcnA, one of these selected genes, encodes a modulator of calcineurin

  4. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  5. Equilibrium evaporation behavior of polonium and its homologue tellurium in liquid lead-bismuth eutectic

    International Nuclear Information System (INIS)

    Ohno, Shuji; Miyahara, Shinya; Kurata, Yuji; Katsura, Ryoei; Yoshida, Shigeru

    2006-01-01

    Experimental study using the transpiration method investigates equilibrium evaporation behavior of radionuclide polonium ( 210 Po) generated and accumulated in liquid lead-bismuth eutectic (LBE) cooled nuclear systems. The experiment consists of two series of tests: preliminary evaporation tests for homologue element tellurium (Te) in LBE, and evaporation tests for 210 Po-accumulated LBE in which test specimens are prepared by neutron irradiation. The evaporation tests of Te in LBE provide the suggestion that Te exists in a chemical form of PbTe as well as the information for confirming the validity of technique and conditions of Po test. From the evaporation tests of 210 Po in LBE, we obtain fundamental data and empirical equations such as 210 Po vapor concentration in the gas phase, 210 Po partial vapor pressure, thermodynamic activity coefficients, and gas-liquid equilibrium partition coefficient of 210 Po in LBE in the temperature range from 450 to 750degC. Additionally, radioactivity concentration of 210 Po and 210m Bi vapor in a cover gas region of a typical LBE-cooled nuclear system is specifically estimated based on the obtained experimental results, and the importance of 210 Po evaporation behavior is quantitatively demonstrated. (author)

  6. Crystal structure of a bacterial homologue of the bile acid sodium symporter ASBT

    Science.gov (United States)

    Hu, Nien-Jen; Iwata, So; Cameron, Alexander D.; Drew, David

    2011-01-01

    High cholesterol levels greatly increase the risk of cardiovascular disease. By its conversion into bile acids, about 50% of cholesterol is eliminated from the body. However bile acids released from the bile duct are constantly recycled, being reabsorbed in the intestine via the Apical Sodium dependent Bile acid Transporter (ASBT). It has been shown in animal models that plasma cholesterol levels are significantly lowered by specific inhibitors of ASBT1,2, thus ASBT is a target for hypercholesterolemia drugs. Here, we describe the crystal structure of a bacterial homologue of ASBT from Neisseria meningitidis (ASBTNM) at 2.2Å. ASBTNM contains two inverted structural repeats of five transmembrane helices. A Core domain of six helices harbours two sodium ions while the remaining helices form a Panel-like domain. Overall the architecture of the protein is remarkably similar to the sodium-proton antiporter NhaA3 despite no detectable sequence homology. A bile acid molecule is situated between the Core and Panel domains in a large hydrophobic cavity. Residues near to this cavity have been shown to affect the binding of specific inhibitors of human ASBT4. The position of the bile acid together with the molecular architecture suggests the rudiments of a possible transport mechanism. PMID:21976025

  7. Edge profiles in K shell photoabsorption spectra of gaseous hydrides of 3p elements and homologues

    Science.gov (United States)

    Hauko, R.; Gomilšek, J. Padežnik; Kodre, A.; Arčon, I.; Aquilanti, G.

    2017-10-01

    Photoabsorption spectra of gaseous hydrides of 3p elements (PH3, H2S, HCl) are measured in the energy region of photoexcitations pertaining to K edge. The analysis of the edge profile is extended to hydrides of 4p series (GeH4, AsH3, H2Se, HBr) from an earlier experiment, and to published spectra of 2p hydrides (CH4, NH3, H2O, HF) and noble gases Ar, Kr and Ne and SiH4. The edge profiles are modelled with a linear combination of lorentzian components, describing excitations to individual bound states and to continuum. Transition energies and probabilities are also calculated in the non-relativistic molecular model of the ORCA code, in good agreement with the experiment. Edge profiles in the heavier homologues are closely similar, the symmetry of the molecule governs the transitions to the lowest unoccupied orbitals. In 2p series the effect of the strong nuclear potential prevails. Transitions to higher, atomic-like levels remain very much the same as in free atoms.

  8. The human homologue of Dictyostelium discoideum phg1A is expressed by human metastatic melanoma cells.

    Science.gov (United States)

    Lozupone, Francesco; Perdicchio, Maurizio; Brambilla, Daria; Borghi, Martina; Meschini, Stefania; Barca, Stefano; Marino, Maria Lucia; Logozzi, Mariantonia; Federici, Cristina; Iessi, Elisabetta; de Milito, Angelo; Fais, Stefano

    2009-12-01

    Tumour cannibalism is a characteristic of malignancy and metastatic behaviour. This atypical phagocytic activity is a crucial survival option for tumours in conditions of low nutrient supply, and has some similarities to the phagocytic activity of unicellular microorganisms. In fact, Dictyostelium discoideum has been used widely as a model to study phagocytosis. Recently, phg1A has been described as a protein that is primarily involved in the phagocytic process of this microorganism. The closest human homologue to phg1A is transmembrane 9 superfamily protein member 4 (TM9SF4). Here, we report that TM9SF4 is highly expressed in human malignant melanoma cells deriving from metastatic lesions, whereas it is undetectable in healthy human tissues and cells. TM9SF4 is predominantly expressed in acidic vesicles of melanoma cells, in which it co-localizes with the early endosome antigens Rab5 and early endosome antigen 1. TM9SF4 silencing induced marked inhibition of cannibal activity, which is consistent with a derangement of intracellular pH gradients, with alkalinization of acidic vesicles and acidification of the cell cytosol. We propose TM9SF4 as a new marker of malignancy, representing a potential new target for anti-tumour strategies with a specific role in tumour cannibalism and in the establishment of a metastatic phenotype.

  9. The oil palm Shell gene controls oil yield and encodes a homologue of SEEDSTICK

    Science.gov (United States)

    Singh, Rajinder; Leslie Low, Eng-Ti; Ooi, Leslie Cheng-Li; Ong-Abdullah, Meilina; Chin, Ting Ngoot; Nagappan, Jayanthi; Nookiah, Rajanaidu; Amiruddin, Mohd Din; Rosli, Rozana; Abdul Manaf, Mohamad Arif; Chan, Kuang-Lim; Halim, Mohd Amin; Azizi, Norazah; Lakey, Nathan; Smith, Steven W; Budiman, Muhammad A; Hogan, Michael; Bacher, Blaire; Van Brunt, Andrew; Wang, Chunyan; Ordway, Jared M; Sambanthamurthi, Ravigadevi; Martienssen, Robert A

    2014-01-01

    A key event in the domestication and breeding of the oil palm, Elaeis guineensis, was loss of the thick coconut-like shell surrounding the kernel. Modern E. guineensis has three fruit forms, dura (thick-shelled), pisifera (shell-less) and tenera (thin-shelled), a hybrid between dura and pisifera1–4. The pisifera palm is usually female-sterile but the tenera yields far more oil than dura, and is the basis for commercial palm oil production in all of Southeast Asia5. Here, we describe the mapping and identification of the Shell gene responsible for the different fruit forms. Using homozygosity mapping by sequencing we found two independent mutations in the DNA binding domain of a homologue of the MADS-box gene SEEDSTICK (STK) which controls ovule identity and seed development in Arabidopsis. The Shell gene is responsible for the tenera phenotype in both cultivated and wild palms from sub-Saharan Africa, and our findings provide a genetic explanation for the single gene heterosis attributed to Shell, via heterodimerization. This gene mutation explains the single most important economic trait in oil palm, and has implications for the competing interests of global edible oil production, biofuels and rainforest conservation6. PMID:23883930

  10. Contribution of polycomb homologues Bmi-1 and Mel-18 to medulloblastoma pathogenesis.

    Science.gov (United States)

    Wiederschain, Dmitri; Chen, Lin; Johnson, Brett; Bettano, Kimberly; Jackson, Dowdy; Taraszka, John; Wang, Y Karen; Jones, Michael D; Morrissey, Michael; Deeds, James; Mosher, Rebecca; Fordjour, Paul; Lengauer, Christoph; Benson, John D

    2007-07-01

    Bmi-1 and Mel-18 are structural homologues that belong to the Polycomb group of transcriptional regulators and are believed to stably maintain repression of gene expression by altering the state of chromatin at specific promoters. While a number of clinical and experimental observations have implicated Bmi-1 in human tumorigenesis, the role of Mel-18 in cancer cell growth has not been investigated. We report here that short hairpin RNA-mediated knockdown of either Bmi-1 or Mel-18 in human medulloblastoma DAOY cells results in the inhibition of proliferation, loss of clonogenic survival, anchorage-independent growth, and suppression of tumor formation in nude mice. Furthermore, overexpression of both Bmi-1 and Mel-18 significantly increases the clonogenic survival of Rat1 fibroblasts. In contrast, stable downregulation of Bmi-1 or Mel-18 alone does not affect the growth of normal human WI38 fibroblasts. Proteomics-based characterization of Bmi-1 and Mel-18 protein complexes isolated from cancer cells revealed substantial similarities in their respective compositions. Finally, gene expression analysis identified a number of cancer-relevant pathways that may be controlled by Bmi-1 and Mel-18 and also showed that these Polycomb proteins regulate a set of common gene targets. Taken together, these results suggest that Bmi-1 and Mel-18 may have overlapping functions in cancer cell growth.

  11. Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

    Energy Technology Data Exchange (ETDEWEB)

    Kurz, M. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); Iturbe-Ormaetxe, I. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Jarrott, R. [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia); O’Neill, S. L. [School of Integrative Biology, The University of Queensland, St Lucia, QLD 4072 (Australia); Byriel, K. A.; Martin, J. L., E-mail: j.martin@imb.uq.edu.au; Heras, B., E-mail: j.martin@imb.uq.edu.au [Institute for Molecular Bioscience and ARC Special Research Centre for Functional and Applied Genomics, University of Queensland, St Lucia, QLD 4072 (Australia)

    2008-02-01

    The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, b = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.

  12. Stereoselectivity of the demethylation of nicotine piperidine homologues by Nicotiana plumbaginifolia cell suspension cultures.

    Science.gov (United States)

    Bartholomeusz, Trixie Ann; Molinié, Roland; Roscher, Albrecht; Felpin, François-Xavier; Gillet, Françoise; Lebreton, Jacques; Mesnard, François; Robins, Richard J

    2005-08-01

    The metabolism of (R,S)-N-methylanabasine and (R,S)-N-methylanatabine has been studied in a cell suspension culture of Nicotiana plumbaginifolia. Both substrates are effectively demethylated, anabasine or anatabine, respectively, accumulating in the medium. Similarly, there is strong stereoselectivity for the (R)-isomers of both substrates. The kinetics of metabolism of (R,S)-N-methylanabasine differ significantly from those of nicotine in that no further degradation of the initial demethylation product occurs. (R,S)-N-Methylanatabine, however, shows kinetics closer to those of nicotine, with loss of alkaloid from the system. Further more, (R,S)-N-methylanabasine does not diminish (S)-nicotine demethylation, indicating a lack of competition. However, the metabolism of (S)-nicotine is affected by the presence of (R,S)-N-methylanabasine. Hence, the demethylation of the piperidine homologues of nicotine is seen to be similar but not identical to that of the pyridine analogues. The implications of these different metabolic profiles in relation to the demethylation activity are discussed.

  13. Validating tyrosinase homologue MelA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert; Zemp, Roger

    2015-03-01

    Antibiotic drug resistance is a major worldwide issue. Development of new therapies against pathogenic bacteria requires appropriate research tools for replicating and characterizing infections. Previously fluorescence and bioluminescence modalities have been used to image infectious burden in animal models but scattering significantly limits imaging depth and resolution. We hypothesize that photoacoustic imaging, which has improved depth-toresolution ratio, could be useful for visualizing MelA-expressing bacteria since MelA is a bacterial tyrosinase homologue involved in melanin production. Using an inducible expression system, E. coli expressing MelA were visibly black in liquid culture. Phosphate buffered saline (PBS), MelA-expressing bacteria (at different dilutions in PBS), and chicken embryo blood were injected in plastic tubes which were imaged using a VisualSonics Vevo LAZR system. Photoacoustic imaging at 6 different wavelengths (680, 700, 750, 800, 850 and 900nm) enabled spectral de-mixing to distinguish melanin signals from blood. The signal to noise ratio of 9x diluted MelA bacteria was 55, suggesting that ~20 bacteria cells could be detected with our system. When MelA bacteria were injected as a 100 μL bolus into a chicken embryo, photoacoustic signals from deoxy- and oxy- hemoglobin as well as MelA-expressing bacteria could be separated and overlaid on an ultrasound image, allowing visualization of the bacterial location. Photoacoustic imaging may be a useful tool for visualizing bacterial infections and further work incorporating photoacoustic reporters into infectious bacterial strains is warranted.

  14. DNA methyltransferase homologue TRDMT1 in Plasmodium falciparum specifically methylates endogenous aspartic acid tRNA.

    Science.gov (United States)

    Govindaraju, Gayathri; Jabeena, C A; Sethumadhavan, Devadathan Valiyamangalath; Rajaram, Nivethika; Rajavelu, Arumugam

    2017-10-01

    In eukaryotes, cytosine methylation regulates diverse biological processes such as gene expression, development and maintenance of genomic integrity. However, cytosine methylation and its functions in pathogenic apicomplexan protozoans remain enigmatic. To address this, here we investigated the presence of cytosine methylation in the nucleic acids of the protozoan Plasmodium falciparum. Interestingly, P. falciparum has TRDMT1, a conserved homologue of DNA methyltransferase DNMT2. However, we found that TRDMT1 did not methylate DNA, in vitro. We demonstrate that TRDMT1 methylates cytosine in the endogenous aspartic acid tRNA of P. falciparum. Through RNA bisulfite sequencing, we mapped the position of 5-methyl cytosine in aspartic acid tRNA and found methylation only at C38 position. P. falciparum proteome has significantly higher aspartic acid content and a higher proportion of proteins with poly aspartic acid repeats than other apicomplexan pathogenic protozoans. Proteins with such repeats are functionally important, with significant roles in host-pathogen interactions. Therefore, TRDMT1 mediated C38 methylation of aspartic acid tRNA might play a critical role by translational regulation of important proteins and modulate the pathogenicity of the malarial parasite. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. The ontogeny of nanos homologue expression in the oligochaete annelid Tubifex tubifex.

    Science.gov (United States)

    Mohri, Ki-Ichi; Nakamoto, Ayaki; Shimizu, Takashi

    2016-01-01

    We have cloned and characterized the expression of a nanos homologue (designated Ttu-nos) from the oligochaete annelid Tubifex tubifex. Ttu-nos mRNA is distributed broadly throughout the early cleavage stages. Ttu-nos is expressed in most if not all of the early blastomeres, in which Ttu-nos RNA associates with pole plasms. Ttu-nos transcripts are concentrated to 2d and 4d cells. Shortly after 2d(111) (derived from 2d cell) divides into a bilateral pair of NOPQ proteloblasts, Ttu-nos RNA vanishes from the embryo, which is soon followed by the resumption of Ttu-nos expression in nascent primary blast cells produced by teloblasts. The resumption of Ttu-nos expression occurs only in a subset of teloblast lineages (viz., M, N and Q). After Ttu-nos expression is retained in the germ band for a while, it disappears in anterior-to-posterior progression. At the end of embryogenesis, there is no trace of Ttu-nos expression. Thereafter, growing juveniles do not show any sign of Ttu-nos expression, either. The first sign of Ttu-nos expression is detected in oocytes in the ovary of young adults (ca 40 days after hatching), and its expression continues in growing oocytes that undergo yolk deposition and maturation in the ovisac. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. TRBP and eIF6 homologue in Marsupenaeus japonicus play crucial roles in antiviral response.

    Directory of Open Access Journals (Sweden)

    Shuai Wang

    Full Text Available Plants and invertebrates can suppress viral infection through RNA silencing, mediated by RNA-induced silencing complex (RISC. Trans-activation response RNA-binding protein (TRBP, consisting of three double-stranded RNA-binding domains, is a component of the RISC. In our previous paper, a TRBP homologue in Fenneropenaeus chinensis (Fc-TRBP was reported to directly bind to eukaryotic initiation factor 6 (Fc-eIF6. In this study, we further characterized the function of TRBP and the involvement of TRBP and eIF6 in antiviral RNA interference (RNAi pathway of shrimp. The double-stranded RNA binding domains (dsRBDs B and C of the TRBP from Marsupenaeus japonicus (Mj-TRBP were found to mediate the interaction of TRBP and eIF6. Gel-shift assays revealed that the N-terminal of Mj-TRBP dsRBD strongly binds to double-stranded RNA (dsRNA and that the homodimer of the TRBP mediated by the C-terminal dsRBD increases the affinity to dsRNA. RNAi against either Mj-TRBP or Mj-eIF6 impairs the dsRNA-induced sequence-specific RNAi pathway and facilitates the proliferation of white spot syndrome virus (WSSV. These results further proved the important roles of TRBP and eIF6 in the antiviral response of shrimp.

  17. Short- and medium-chain chlorinated paraffins in biota from the European Arctic -- differences in homologue group patterns.

    Science.gov (United States)

    Reth, Margot; Ciric, Anita; Christensen, Guttorm N; Heimstad, Eldbjørg S; Oehme, Michael

    2006-08-15

    Congener and homologue group patterns of chlorinated paraffins (CPs) in biota can be influenced by different processes, but these are not well studied yet. Short- (SCCPs) and medium-chain chlorinated paraffins (MCCPs) were quantified in liver from Arctic char and seabirds (little auk and kittiwake) collected at Bear Island (European Arctic) as well as in cod from Iceland and Norway. CP concentrations were between 5 and 88 ng/g wet weight (ww) for SCCPs and between 5 and 55 ng/g ww for MCCPs with one exception of 370 ng/g measured in a liver sample from little auk. The SCCP homologue group patterns were compared with those of technical mixtures and of SCCPs present in cod liver from the Baltic Sea. The latter showed a more common SCCP homologue distribution (sum of C(11) and C(12)>60%) in contrast to cod liver from the Northwest of Europe, which had a high abundance of C(10) and C(12) congeners. Seabirds from Bear Island contained an equally distributed SCCP homologue group pattern. In Arctic char, the SCCP distribution was closer to technical products, but with a high proportion (average of 18.9%) of C(10) congeners. A comparison of C(10)/C(12) ratios confirmed the higher abundance of C(10) congeners in samples from higher latitudes. For the first time, MCCPs could be detected in Arctic samples. The average proportion of C(14) congeners was 65.8%. The C(14)/C(15) abundance ratio was similar to technical mixtures. High-chlorinated CPs (Cl(>7)) were also detectable. The average chlorine content of the SCCPs was 61.9% (59.0-63.3%), and that of the MCCPs 55.8% (54.5-57.4%).

  18. Species-specific flight styles of flies are reflected in the response dynamics of a homologue motion sensitive neuron

    Directory of Open Access Journals (Sweden)

    Bart eGeurten

    2012-03-01

    Full Text Available Hoverflies and blowflies have distinctly different flight styles. Yet, both species have been shown to structure their flight behaviour in a way that facilitates extraction of 3D information from the image flow on the retina (optic flow. Neuronal candidates to analyse the optic flow are the tangential cells in the third optical ganglion – the lobula complex. These neurons are directionally selective and integrate the optic flow over large parts of the visual field. Homologue tangential cells in hoverflies and blowflies have a similar morphology. Because blowflies and hoverflies have similar neuronal layout but distinctly different flight behaviours, they are an ideal substrate to pinpoint potential neuronal adaptations to the different flight styles.In this article we describe the relationship between locomotion behaviour and motion vision on three different levels:1.We compare the different flight styles based on the categorisation of flight behaviour into prototypical movements.2.We measure the species specific dynamics of the optic flow under naturalistic flight conditions. We found the translational optic flow of both species to be very different.3.We describe possible adaptations of a homologue motion sensitive neuron. We stimulate this cell in blowflies (Calliphora and hoverflies (Eristalis with naturalistic optic flow generated by both species during free flight. The characterized hoverfly tangential cell responds faster to transient changes in the optic flow than its blowfly homologue. It is discussed whether and how the different dynamical response properties aid optic flow analysis.

  19. Identification of NoxD/Pro41 as the homologue of the p22phox NADPH oxidase subunit in fungi.

    Science.gov (United States)

    Lacaze, Isabelle; Lalucque, Hervé; Siegmund, Ulrike; Silar, Philippe; Brun, Sylvain

    2015-03-01

    NADPH oxidases (Nox) are membrane complexes that produce O2(-). Researches in mammals, plants and fungi highlight the involvement of Nox-generated ROS in cell proliferation, differentiation and defense. In mammals, the core enzyme gp91(phox)/Nox2 is associated with p22(phox) forming the flavocytochrome b558 ready for activation by a cytosolic complex. Intriguingly, no homologue of the p22(phox) gene has been found in fungal genomes, questioning how the flavoenzyme forms. Using whole genome sequencing combined with phylogenetic analysis and structural studies, we identify the fungal p22(phox) homologue as being mutated in the Podospora anserina mutant IDC(509). Functional studies show that the fungal p22(phox), PaNoxD, acts along PaNox1, but not PaNox2, a second fungal gp91(phox) homologue. Finally, cytological analysis of functional tagged versions of PaNox1, PaNoxD and PaNoxR shows clear co-localization of PaNoxD and PaNox1 and unravel a dynamic assembly of the complex in the endoplasmic reticulum and in the vacuolar system. © 2014 John Wiley & Sons Ltd.

  20. Mono-, di- and trimethylated homologues of isoprenoid tetraether lipid cores in archaea and environmental samples: mass spectrometric identification and significance.

    Science.gov (United States)

    Knappy, Chris; Barillà, Daniela; Chong, James; Hodgson, Dominic; Morgan, Hugh; Suleman, Muhammad; Tan, Christine; Yao, Peng; Keely, Brendan

    2015-12-01

    Higher homologues of widely reported C(86) isoprenoid diglycerol tetraether lipid cores, containing 0-6 cyclopentyl rings, have been identified in (hyper)thermophilic archaea, representing up to 21% of total tetraether lipids in the cells. Liquid chromatography-tandem mass spectrometry confirms that the additional carbon atoms in the C(87-88) homologues are located in the etherified chains. Structures identified include dialkyl and monoalkyl ('H-shaped') tetraethers containing C(40-42) or C(81-82) hydrocarbons, respectively, many representing novel compounds. Gas chromatography-mass spectrometric analysis of hydrocarbons released from the lipid cores by ether cleavage suggests that the C(40) chains are biphytanes and the C(41) chains 13-methylbiphytanes. Multiple isomers, having different chain combinations, were recognised among the dialkyl lipids. Methylated tetraethers are produced by Methanothermobacter thermautotrophicus in varying proportions depending on growth conditions, suggesting that methylation may be an adaptive mechanism to regulate cellular function. The detection of methylated lipids in Pyrobaculum sp. AQ1.S2 and Sulfolobus acidocaldarius represents the first reported occurrences in Crenarchaeota. Soils and aquatic sediments from geographically distinct mesotemperate environments that were screened for homologues contained monomethylated tetraethers, with di- and trimethylated structures being detected occasionally. The structural diversity and range of occurrences of the C(87-89) tetraethers highlight their potential as complementary biomarkers for archaea in natural environments. Copyright © 2015 John Wiley & Sons, Ltd.

  1. Crystal structure of pira toxin-I: a calcium-independent, myotoxic phospholipase A2 - homologue from Bothrops pirajai venom

    International Nuclear Information System (INIS)

    Canduri, R.J.; Ward, R.J.; Azevedo Junior, G.W.F. de; Arni, R.K.; Soares, A.M.; Giglio, J.R.

    1997-01-01

    Full text. Phospho lipases A2 (PLA 2 ) are small enzymes that specifically hydrolysed the sn-2 ester bond of phospholipids, preferentially in lamellar or micellar aggregates at membrane surfaces. These enzymes are widely distributed in nature and have been extensively studied. Toxic proteins from venoms from Bothrops species include catalytically active PLA 2 s and calcium independent PLA 2L ys 49 homologues. The substitution of Asp49 by Lys greatly diminishes the ability of these PLA 2 to bind calcium, an ion that plays a critical role in the stabilization of the tetrahedral transition state intermediate in the catalytic mechanism. The Lys 49 PLA 2 homologues and therefore catalytically inactive yet maintain cytolytic and myotoxic activities and furthermore retain the ability to disrupt the integrity of both plasma membranes and model lipid bilayers by a poorly understood Ca 2+ independente mechanism. Lys49 PLA 2 homologues demonstrate a specific toxic activity against skeletal muscle, affecting only muscle fibers and leaving other tissue structure such as connective tissue, nerves and vessels essentially unharmed. In order to improve our understanding of the molecular basis of the myotoxic and Ca 2+ -independent membrane damaging activities, we have determined the crystal structure of Pr TX-I, a Lys49 variant from the venom of B. pirajai. The model presented has been determined at 2.8 angstrom resolution and refined to a crystallographic residual of 19.7% (R free =29.7%). (author)

  2. Structural characterization and expression analysis of a beta-thymosin homologue (Tβ) in disk abalone, Haliotis discus discus.

    Science.gov (United States)

    Kasthuri, Saranya Revathy; Premachandra, H K A; Umasuthan, Navaneethaiyer; Whang, Ilson; Lee, Jehee

    2013-09-15

    Repertoires of proteins and small peptides play numerous physiological roles as hormones, antimicrobial peptides, and cellular signaling factors. The beta-thymosins are a group of small acidic peptides involved in processes such as actin sequestration, neuronal development, wound healing, tissue repair, and angiogenesis. Recent characterization of the beta thymosins as immunological regulators in invertebrates led to our identification and characterization of a beta-thymosin homologue (Tβ) from Haliotis discus discus. The cDNA possessed an ORF of 132 bp encoding a protein of 44 amino acids with a molecular mass of 4977 Da. The amino acid sequence shows high identity with another molluskan beta-thymosin and has a characteristic actin binding motif (LKKTET) and glutamyl donors. Phylogenetic analysis showed a close relationship with molluskan homologues, as well as its distinct identity and common ancestral origin. Genomic analysis revealed a 3 exon-2 intron structure similar to the other homologues. In silico promoter analysis also revealed significant transcription factor binding sites, providing evidence for the expression of this gene under different cellular conditions, including stress or pathogenic attack. Tissue distribution profiling revealed a ubiquitous presence in all the examined tissues, but with the highest expression in mantle and hemocyte. Immune challenge with lipopolysaccharide, poly I:C and Vibrio parahemolyticus induced beta-thymosin expression in gill and hemocytes, affirming an immune-related role in invertebrates. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng; Zhang, Gen; Qian, Pei-Yuan

    2013-01-01

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  4. A La autoantigen homologue is required for the internal ribosome entry site mediated translation of giardiavirus.

    Directory of Open Access Journals (Sweden)

    Srinivas Garlapati

    2011-03-01

    Full Text Available Translation of Giardiavirus (GLV mRNA is initiated at an internal ribosome entry site (IRES in the viral transcript. The IRES localizes to a downstream portion of 5' untranslated region (UTR and a part of the early downstream coding region of the transcript. Recent studies indicated that the IRES does not require a pre-initiation complex to initiate translation but may directly recruit the small ribosome subunit with the help of a number of trans-activating protein factors. A La autoantigen homologue in the viral host Giardia lamblia, GlLa, was proposed as one of the potential trans-activating factors based on its specific binding to GLV-IRES in vitro. In this study, we further elucidated the functional role of GlLa in GLV-IRES mediated translation in Giardia by knocking down GlLa with antisense morpholino oligo, which resulted in a reduction of GLV-IRES activity by 40%. An over-expression of GlLa in Giardia moderately stimulated GLV-IRES activity by 20%. A yeast inhibitory RNA (IRNA, known to bind mammalian and yeast La autoantigen and inhibit Poliovirus and Hepatitis C virus IRES activities in vitro and in vivo, was also found to bind to GlLa protein in vitro and inhibited GLV-IRES function in vivo. The C-terminal domain of La autoantigen interferes with the dimerization of La and inhibits its function. An over-expression of the C-terminal domain (200-348aa of GlLa in Giardia showed a dominant-negative effect on GLV-IRES activity, suggesting a potential inhibition of GlLa dimerization. HA tagged GlLa protein was detected mainly in the cytoplasm of Giardia, thus supporting a primary role of GlLa in translation initiation in Giardiavirus.

  5. Phagosome maturation in unicellular eukaryote Paramecium: the presence of RILP, Rab7 and LAMP-2 homologues

    Directory of Open Access Journals (Sweden)

    E Wyroba

    2009-08-01

    Full Text Available Phagosome maturation is a complex process enabling degradation of internalised particles. Our data obtained at the gene, protein and cellular level indicate that the set of components involved in this process and known up to now in mammalian cells is functioning in unicellular eukaryote. Rab7-interacting partners: homologues of its effector RILP (Rab-interacting lysosomal protein and LAMP-2 (lysosomal membrane protein 2 as well as a7 subunit of the 26S proteasome were revealed in Paramecium phagolysosomal compartment. We identified the gene/transcript fragments encoding RILP-related proteins (RILP1 and RILP2 in Paramecium by PCR/RT-PCR and sequencing. The deduced amino acid sequences of RILP1 and RILP2 show 60.5% and 58.3% similarity, respectively, to the region involved in regulating of lysosomal morphology and dynein-dynactin recruitment of human RILP. RILP colocalised with Rab7 in Paramecium lysosomes and at phagolysosomal membrane during phagocytosis of both the latex beads and bacteria. In the same compartment LAMP-2 was present and its expression during latex internalisation was 2.5-fold higher than in the control when P2 protein fractions (100 000 x g of equal load were quantified by immunoblotting. LAMP-2 crossreacting polypeptide of ~106 kDa was glycosylated as shown by fluorescent and Western analysis of the same blot preceded by PNGase F treatment. The a7 subunit of 26S proteasome was detected close to the phagosomal membrane in the small vesicles, in some of which it colocalised with Rab7. Immunoblotting confirmed presence of RILPrelated polypeptide and a7 subunit of 26S proteasome in Paramecium protein fractions. These results suggest that Rab7, RILP and LAMP-2 may be involved in phagosome maturation in Paramecium.

  6. Characterization of Two 20kDa-Cement Protein (cp20k) Homologues in Amphibalanus amphitrite

    KAUST Repository

    He, Li-Sheng

    2013-05-22

    The barnacle, Amphibalanus amphitrite, is a common marine fouling organism. Understanding the mechanism of barnacle adhesion will be helpful in resolving the fouling problem. Barnacle cement is thought to play a key role in barnacle attachment. Although several adult barnacle cement proteins have been identified in Megabalanus rosa, little is known about their function in barnacle settlement. In this study, two homologous 20k-cement proteins (cp20k) in Amphibalanus amphitrite, named Bamcp20k-1 and Bamcp20k-2, were characterized. The two homologues share primary sequence structure with proteins from other species including Megabalanus rosa and Fistulobalanus albicostatus. The conserved structure included repeated Cys domains and abundant charged amino acids, such as histidine. In this study we demonstrated that Bamcp20k-1 localized at the α secretory cells in the cyprid cement gland, while Bamcp20k-2 localized to the β secretory cells. The differential localizations suggest differential regulation for secretion from the secretory cells. Both Bamcp20k-1 and Bamcp20k-2 from cyprids dissolved in PBS. However, adult Bamcp20k-2, which was dominant in the basal shell of adult barnacles, was largely insoluble in PBS. Solubility increased in the presence of the reducing reagent Dithiothreitol (DTT), suggesting that the formation of disulfide bonds plays a role in Bamcp20k-2 function. In comparison, Bamcp20k-1, which was enriched in soft tissue, could not be easily detected in the shell and base by Western blot and easily dissolved in PBS. These differential solubilities and localizations indicate that Bamcp20k-1 and Bamcp20k-2 have distinct functions in barnacle cementing. © 2013 He et al.

  7. Synthesis, electrochemistry, and electrogenerated chemiluminescence of two BODIPY-appended bipyridine homologues.

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J; Pupillo, Rachel C; Rosenthal, Joel; Bard, Allen J

    2013-09-11

    Two new 2,2'-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5'-positions (BB3) or 6- and 6'-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry, and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993-18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e(-) oxidation and reduction waves, which consist of two closely spaced (50-70 mV) 1e(-) events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2'-bipyridine spacer of each bpy-BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ∼570 nm and is attributed to emission via an S- or T-route. The second band occurs at longer wavelengths and is centered around ∼740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather it suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process.

  8. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis.

    Directory of Open Access Journals (Sweden)

    Yanyan Lu

    2018-04-01

    Full Text Available Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST. Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a 'Solute_trans_a' domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N at the N-terminus and disordered domain (CsOST-C at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes.

  9. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis

    Science.gov (United States)

    Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok

    2018-01-01

    Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646

  10. Regulation of Metalloprotease Gene Expression in Vibrio vulnificus by a Vibrio harveyi LuxR Homologue

    Science.gov (United States)

    Shao, Chung-Ping; Hor, Lien-I

    2001-01-01

    Expression of the Vibrio vulnificus metalloprotease gene, vvp, was turned up rapidly when bacterial growth reached the late log phase. A similar pattern of expression has been found in the metalloprotease gene of Vibrio cholerae, and this has been shown to be regulated by a Vibrio harveyi LuxR-like transcriptional activator. To find out whether a LuxR homologue exists in V. vulnificus, a gene library of this organism was screened by colony hybridization using a probe derived from a sequence that is conserved in various luxR-like genes of vibrios. A gene containing a 618-bp open reading frame was identified and found to be identical to the smcR gene of V. vulnificus reported previously. An isogenic SmcR-deficient (RD) mutant was further constructed by an in vivo allelic exchange technique. This mutant exhibited an extremely low level of vvp transcription compared with that of the parent strain. On the other hand, the cytolysin gene, vvhA, was expressed at a higher level in the RD mutant than in the parent strain during the log phase of growth. These data suggested that SmcR might not only be a positive regulator of the protease gene but might also be involved in negative regulation of the cytolysin gene. Virulence of the RD mutant in either normal or iron-overloaded mice challenged by intraperitoneal injection was comparable to that of the parent strain, indicating that SmcR is not required for V. vulnificus virulence in mice. PMID:11157950

  11. Development and mapping of SSR markers linked to resistance-gene homologue clusters in common bean

    Institute of Scientific and Technical Information of China (English)

    Luz; Nayibe; Garzon; Matthew; Wohlgemuth; Blair

    2014-01-01

    Common bean is an important but often a disease-susceptible legume crop of temperate,subtropical and tropical regions worldwide. The crop is affected by bacterial, fungal and viral pathogens. The strategy of resistance-gene homologue(RGH) cloning has proven to be an efficient tool for identifying markers and R(resistance) genes associated with resistances to diseases. Microsatellite or SSR markers can be identified by physical association with RGH clones on large-insert DNA clones such as bacterial artificial chromosomes(BACs). Our objectives in this work were to identify RGH-SSR in a BAC library from the Andean genotype G19833 and to test and map any polymorphic markers to identify associations with known positions of disease resistance genes. We developed a set of specific probes designed for clades of common bean RGH genes and then identified positive BAC clones and developed microsatellites from BACs having SSR loci in their end sequences. A total of 629 new RGH-SSRs were identified and named BMr(bean microsatellite RGH-associated markers). A subset of these markers was screened for detecting polymorphism in the genetic mapping population DOR364 × G19833. A genetic map was constructed with a total of 264 markers,among which were 80 RGH loci anchored to single-copy RFLP and SSR markers. Clusters of RGH-SSRs were observed on most of the linkage groups of common bean and in positions associated with R-genes and QTL. The use of these new markers to select for disease resistance is discussed.

  12. Neurophysiological Evidence That Musical Training Influences the Recruitment of Right Hemispheric Homologues for Speech Perception

    Directory of Open Access Journals (Sweden)

    McNeel Gordon Jantzen

    2014-03-01

    Full Text Available Musicians have a more accurate temporal and tonal representation of auditory stimuli than their non-musician counterparts (Kraus & Chandrasekaran, 2010; Parbery-Clark, Skoe, & Kraus, 2009; Zendel & Alain, 2008; Musacchia, Sams, Skoe, & Kraus, 2007. Musicians who are adept at the production and perception of music are also more sensitive to key acoustic features of speech such as voice onset timing and pitch. Together, these data suggest that musical training may enhance the processing of acoustic information for speech sounds. In the current study, we sought to provide neural evidence that musicians process speech and music in a similar way. We hypothesized that for musicians, right hemisphere areas traditionally associated with music are also engaged for the processing of speech sounds. In contrast we predicted that in non-musicians processing of speech sounds would be localized to traditional left hemisphere language areas. Speech stimuli differing in voice onset time was presented using a dichotic listening paradigm. Subjects either indicated aural location for a specified speech sound or identified a specific speech sound from a directed aural location. Musical training effects and organization of acoustic features were reflected by activity in source generators of the P50. This included greater activation of right middle temporal gyrus (MTG and superior temporal gyrus (STG in musicians. The findings demonstrate recruitment of right hemisphere in musicians for discriminating speech sounds and a putative broadening of their language network. Musicians appear to have an increased sensitivity to acoustic features and enhanced selective attention to temporal features of speech that is facilitated by musical training and supported, in part, by right hemisphere homologues of established speech processing regions of the brain.

  13. Synthesis, Electrochemistry and Electrogenerated Chemiluminesce of two BODIPY-Appended Bipyridine Homologues

    Science.gov (United States)

    Qi, Honglan; Teesdale, Justin J.; Pupillo, Rachel C.

    2014-01-01

    Two new 2,2’-bipyridine (bpy) derivatives containing ancillary BODIPY chromophores attached at the 5- and 5’-positions (BB3) or 6- and 6’-positions (BB4) were prepared and characterized. In this work, the basic photophysics, electrochemistry and electrogenerated chemiluminescence (ECL) of BB3 and BB4 are compared with those previously reported for a related bpy-BODIPY derivative (BB2) (J. Phys. Chem. C 2011, 115, 17993–18001). Cyclic voltammetry revealed that BB3 and BB4 display reversible 2e− oxidation and reduction waves, which consist of two closely spaced (50 – 70 mV) 1e− events. This redox behavior is consistent with the frontier molecular orbitals calculated for BB3 and BB4 and indicates that the 2,2’-bipyridine spacer of each bpy- BODIPY homologue does not facilitate efficient electronic communication between the tethered indacene units. In the presence of a coreactant such as tri-n-propylamine (TPA) or benzoyl peroxide (BPO), BB3 and BB4 exhibit strong ECL and produce spectra that are very similar to their corresponding photoluminescence profiles. The ECL signal obtained under annihilation conditions, however, is significantly different and is characterized by two distinct bands. One of these bands is centered at ~570 nm and is attributed to emission via an S- or T-route. The second band, occurs at longer wavelengths and is centered around ~740 nm. The shape and concentration dependence of this long-wavelength ECL signal is not indicative of emission from an excimer or aggregate, but rather is suggests that a new emissive species is formed from the bpy-BODIPY luminophores during the annihilation process. PMID:23980850

  14. Luminous and Variable Stars in M31 and M33. IV. Luminous Blue Variables, Candidate LBVs, B[e] Supergiants, and the Warm Hypergiants: How to Tell Them Apart

    Energy Technology Data Exchange (ETDEWEB)

    Humphreys, Roberta M.; Gordon, Michael S.; Hahn, David [Minnesota Institute for Astrophysics, 116 Church Street SE, University of Minnesota, Minneapolis, MN 55455 (United States); Martin, John C. [University of Illinois Springfield, Springfield, IL 62703 (United States); Weis, Kerstin, E-mail: roberta@umn.edu [Astronomical Institute, Ruhr-Universitaet Bochum (Germany)

    2017-02-10

    In this series of papers we have presented the results of a spectroscopic survey of luminous stars in the nearby spirals M31 and M33. Here, we present spectroscopy of 132 additional stars. Most have emission-line spectra, including luminous blue variables (LBVs) and candidate LBVs, Fe ii emission line stars, the B[e] supergiants, and the warm hypergiants. Many of these objects are spectroscopically similar and are often confused with each other. We examine their similarities and differences and propose the following guidelines that can be used to help distinguish these stars in future work. (1) The B[e] supergiants have emission lines of [O i] and [Fe ii] in their spectra. Most of the spectroscopically confirmed sgB[e] stars also have warm circumstellar dust in their spectral energy distributions (SEDs). (2) Confirmed LBVs do not have the [O i] emission lines in their spectra. Some LBVs have [Fe ii] emission lines, but not all. Their SEDs show free–free emission in the near-infrared but no evidence for warm dust . Their most important and defining characteristic is the S Dor-type variability. (3) The warm hypergiants spectroscopically resemble the LBVs in their dense wind state and the B[e] supergiants. However, they are very dusty. Some have [Fe ii] and [O i] emission in their spectra like the sgB[e] stars, but are distinguished by their A- and F-type absorption-line spectra. In contrast, the B[e] supergiant spectra have strong continua and few if any apparent absorption lines. Candidate LBVs should share the spectral characteristics of the confirmed LBVs with low outflow velocities and the lack of warm circumstellar dust.

  15. Solid-phase synthesis and pharmacological evaluation of analogues of PhTX-12-A potent and selective nicotinic acetylcholine receptor antagonist

    DEFF Research Database (Denmark)

    Strømgaard, Kristian; Mellor, Ian R; Andersen, Kim

    2002-01-01

    Philanthotoxin-12 (PhTX-12) is a novel potent and selective, noncompetitive antagonist of nicotinic acetylcholine receptors (nAChRs). Homologues of PhTX-12 with 7-11 methylene groups between the primary amino group and the aromatic head-group were synthesized using solid-phase methodology. In vitro...

  16. Somatostatin receptors

    DEFF Research Database (Denmark)

    Møller, Lars Neisig; Stidsen, Carsten Enggaard; Hartmann, Bolette

    2003-01-01

    functional units, receptors co-operate. The total receptor apparatus of individual cell types is composed of different-ligand receptors (e.g. SRIF and non-SRIF receptors) and co-expressed receptor subtypes (e.g. sst(2) and sst(5) receptors) in characteristic proportions. In other words, levels of individual......-peptides, receptor agonists and antagonists. Relatively long half lives, as compared to those of the endogenous ligands, have been paramount from the outset. Motivated by theoretical puzzles or the shortcomings of present-day diagnostics and therapy, investigators have also aimed to produce subtype...

  17. Broad anti-HIV activity of the Oscillatoria agardhii agglutinin homologue lectin family.

    Science.gov (United States)

    Férir, Geoffrey; Huskens, Dana; Noppen, Sam; Koharudin, Leonardus M I; Gronenborn, Angela M; Schols, Dominique

    2014-10-01

    Oscillatoria agardhii agglutinin homologue (OAAH) proteins belong to a recently discovered lectin family. The founding member OAA and a designed hybrid OAAH (OPA) recognize similar but unique carbohydrate structures of Man-9, compared with other antiviral carbohydrate-binding agents (CBAs). These two newly described CBAs were evaluated for their inactivating properties on HIV replication and transmission and for their potential as microbicides. Various cellular assays were used to determine antiviral activity against wild-type and certain CBA-resistant HIV-1 strains: (i) free HIV virion infection in human T lymphoma cell lines and PBMCs; (ii) syncytium formation assay using persistently HIV-infected T cells and non-infected CD4+ T cells; (iii) DC-SIGN-mediated viral capture; and (iv) transmission to uninfected CD4+ T cells. OAA and OPA were also evaluated for their mitogenic properties and potential synergistic effects using other CBAs. OAA and OPA inhibit HIV replication, syncytium formation between HIV-1-infected and uninfected T cells, DC-SIGN-mediated HIV-1 capture and transmission to CD4+ target T cells, thereby rendering a variety of HIV-1 and HIV-2 clinical isolates non-infectious, independent of their coreceptor use. Both CBAs competitively inhibit the binding of the Manα(1-2)Man-specific 2G12 monoclonal antibody (mAb) as shown by flow cytometry and surface plasmon resonance analysis. The HIV-1 NL4.3(2G12res), NL4.3(MVNres) and IIIB(GRFTres) strains were equally inhibited as the wild-type HIV-1 strains by these CBAs. Combination studies indicate that OAA and OPA act synergistically with Hippeastrum hybrid agglutinin, 2G12 mAb and griffithsin (GRFT), with the exception of OPA/GRFT. OAA and OPA are unique CBAs with broad-spectrum anti-HIV activity; however, further optimization will be necessary for microbicidal application. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights

  18. Expression patterns of Passiflora edulis APETALA1/FRUITFULL homologues shed light onto tendril and corona identities

    Directory of Open Access Journals (Sweden)

    Livia C. T. Scorza

    2017-02-01

    Full Text Available Abstract Background Passiflora (passionflowers makes an excellent model for studying plant evolutionary development. They are mostly perennial climbers that display axillary tendrils, which are believed to be modifications of the inflorescence. Passionflowers are also recognized by their unique flower features, such as the extra whorls of floral organs composed of corona filaments and membranes enclosing the nectary. Although some work on Passiflora organ ontogeny has been done, the developmental identity of both Passiflora tendrils and the corona is still controversial. Here, we combined ultrastructural analysis and expression patterns of the flower meristem and floral organ identity genes of the MADS-box AP1/FUL clade to reveal a possible role for these genes in the generation of evolutionary novelties in Passiflora. Results We followed the development of structures arising from the axillary meristem from juvenile to adult phase in P. edulis. We further assessed the expression pattern of P. edulis AP1/FUL homologues (PeAP1 and PeFUL, by RT-qPCR and in situ hybridization in several tissues, correlating it with the developmental stages of P. edulis. PeAP1 is expressed only in the reproductive stage, and it is highly expressed in tendrils and in flower meristems from the onset of their development. PeAP1 is also expressed in sepals, petals and in corona filaments, suggesting a novel role for PeAP1 in floral organ diversification. PeFUL presented a broad expression pattern in both vegetative and reproductive tissues, and it is also expressed in fruits. Conclusions Our results provide new molecular insights into the morphological diversity in the genus Passiflora. Here, we bring new evidence that tendrils are part of the Passiflora inflorescence. This points to the convergence of similar developmental processes involving the recruitment of genes related to flower identity in the origin of tendrils in different plant families. The data obtained also

  19. Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli

    Science.gov (United States)

    Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger

    2015-10-01

    To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and chorioallantoic membrane. Our results suggest that melA is a useful photoacoustic reporter gene for visualizing bacteria, and further work

  20. The Orphan Nuclear Receptor TLX/NR2E1 in Neural Stem Cells and Diseases

    OpenAIRE

    Wang, Tao; Xiong, Jian-Qiong

    2016-01-01

    The human TLX gene encodes an orphan nuclear receptor predominantly expressed in the central nervous system. Tailess and Tlx, the TLX homologues in Drosophila and mouse, play essential roles in body-pattern formation and neurogenesis during early embryogenesis and perform crucial functions in maintaining stemness and controlling the differentiation of adult neural stem cells in the central nervous system, especially the visual system. Multiple target genes and signaling pathways are regulated...

  1. Identification and phylogeny of the tomato receptor-like proteins family

    OpenAIRE

    Ermis Yanes-Paz; Gioser María Ramos-Echazábal; Glay Chinea; Yanelis Capdesuñer Ruiz; Ramón Santos Bermúdez

    2017-01-01

    The receptor-like proteins (RLPs) play multiple roles in development and defense. In the current work 75 RLPs were identified in tomato (Solanum lycopersicum L.) using iterative BLAST searches and domain prediction. A phylogenetic tree including all the identified RLPs from tomato and some functionally characterized RLPs from other species was built to identify their putative homologues in tomato. We first tested whether C3-F-based phylogeny was a good indicator of functional relation between...

  2. Over-expression, purification and characterization of an Asc-1 homologue from Gloeobacter violaceus

    DEFF Research Database (Denmark)

    Wang, Xiaole; Hald, Helle; Ernst, Heidi Asschenfeldt

    2010-01-01

    The human alanine-serine-cysteine transporter 1 (Asc-1) belongs to the slc7a family of solute carrier transporters. Asc-1 mediates the uptake of D-serine in an exchanger-type fashion, coupling the process to the release of alanine and cysteine. Among the bacterial Asc-1 homologues, one transporter...... of auto-induction was crucial for obtaining high yields and purity of the transporter. The transporter was purified with yields in the range of 0.2-0.4 mg per L culture and eluted in a single peak from a size-exclusion column. The circular dichroism spectrum revealed a folded and apparently all...

  3. Protein 4.1, a component of the erythrocyte membrane skeleton and its related homologue proteins forming the protein 4.1/FERM superfamily.

    Directory of Open Access Journals (Sweden)

    Aleksander F Sikorski

    2007-01-01

    Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.

  4. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    International Nuclear Information System (INIS)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo

    2012-01-01

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution

  5. Purification, crystallization and preliminary X-ray analysis of SGR6054, a Streptomyces homologue of the mycobacterial integration host factor mIHF

    Energy Technology Data Exchange (ETDEWEB)

    Nomoto, Ryohei; Tezuka, Takeaki; Miyazono, Ken-ichi; Tanokura, Masaru; Horinouchi, Sueharu; Ohnishi, Yasuo [Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)

    2012-08-31

    A Streptomyces homologue of the mycobacterial integration host factor mIHF was heterologously produced, purified and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The best crystal diffracted X-rays to 2.22 Å resolution and belonged to space group C2. The mycobacterial integration host factor (mIHF) is a small nonspecific DNA-binding protein that is essential for the growth of Mycobacterium smegmatis. mIHF homologues are widely distributed among Actinobacteria, and a Streptomyces homologue of mIHF is involved in control of sporulation and antibiotic production in S. coelicolor A3(2). Despite their important biological functions, a structure of mIHF or its homologues has not been elucidated to date. Here, the S. griseus mIHF homologue (SGR6054) was expressed and purified from Escherichia coli and crystallized in the presence of a 16-mer duplex DNA by the sitting-drop vapour-diffusion method. The plate-shaped crystal belonged to space group C2, with unit-cell parameters a = 88.53, b = 69.35, c = 77.71 Å, β = 96.63°, and diffracted X-rays to 2.22 Å resolution.

  6. Effects of the deletion of the Escherichia coli frataxin homologue CyaY on the respiratory NADH:ubiquinone oxidoreductase

    Directory of Open Access Journals (Sweden)

    Grauman Peter L

    2007-07-01

    Full Text Available Abstract Background Frataxin is discussed as involved in the biogenesis of iron-sulfur clusters. Recently it was discovered that a frataxin homologue is a structural component of the respiratory NADH:ubiquinone oxidoreductase (complex I in Thermus thermophilus. It was not clear whether frataxin is in general a component of complex I from bacteria. The Escherichia coli homologue of frataxin is coined CyaY. Results We report that complex I is completely assembled to a stable and active enzyme complex equipped with all known iron-sulfur clusters in a cyaY mutant of E. coli. However, the amount of complex I is reduced by one third compared to the parental strain. Western blot analysis and live cell imaging of CyaY engineered with a GFP demonstrated that CyaY is located in the cytoplasm and not attached to the membrane as to be expected if it were a component of complex I. Conclusion CyaY plays a non-essential role in the assembly of complex I in E. coli. It is not a structural component but may transiently interact with the complex.

  7. Molecular and functional characterization of a novel gonadotropin-releasing-hormone receptor isolated from the common octopus (Octopus vulgaris)

    OpenAIRE

    Kanda, Atsuhiro; Takahashi, Toshio; Satake, Honoo; Minakata, Hiroyuki

    2006-01-01

    GnRH (gonadotropin-releasing hormone) plays a pivotal role in the regulation of reproduction in vertebrates through interaction with a specific receptor. Previously, we isolated a GnRH homo-logue, oct-GnRH, from the common octopus (Octopus vulgaris). In the present study, we have identified a GnRH receptor (oct-GnRHR) specific for oct-GnRH from Octopus brain. Oct-GnRHR includes domains and motifs typical of vertebrate GnRH receptors. The intron-inserted positions are conserved between oct-GnR...

  8. Synthesis and pharmacological evaluation of conformationally constrained glutamic acid higher homologues

    DEFF Research Database (Denmark)

    Tamborini, Lucia; Cullia, Gregorio; Nielsen, Birgitte

    2016-01-01

    Homologation of glutamic acid chain together with conformational constraint is a commonly used strategy to achieve selectivity towards different types of glutamate receptors. In the present work, starting from two potent and selective unnatural amino acids previously developed by us, we...... investigated the effects on the activity/selectivity profile produced by a further increase in the distance between the amino acidic moiety and the distal carboxylate group. Interestingly, the insertion of an aromatic ring as a spacer produced a low micromolar affinity NMDA ligand that might represent a lead...

  9. Synthesis and pharmacological evaluation of conformationally constrained glutamic acid higher homologues.

    Science.gov (United States)

    Tamborini, Lucia; Cullia, Gregorio; Nielsen, Birgitte; De Micheli, Carlo; Conti, Paola; Pinto, Andrea

    2016-11-15

    Homologation of glutamic acid chain together with conformational constraint is a commonly used strategy to achieve selectivity towards different types of glutamate receptors. In the present work, starting from two potent and selective unnatural amino acids previously developed by us, we investigated the effects on the activity/selectivity profile produced by a further increase in the distance between the amino acidic moiety and the distal carboxylate group. Interestingly, the insertion of an aromatic ring as a spacer produced a low micromolar affinity NMDA ligand that might represent a lead for the development of a new class of NMDA antagonists. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. [Intersection point rule for the retention value with mobile phase composition and boiling point of the homologues and chlorobenzenes in soil leaching column chromatography].

    Science.gov (United States)

    Xu, F; Liang, X; Lin, B; Su, F

    1999-03-01

    Based on the linear retention equation of the logarithm of the capacity factor (logk') vs. the methanol volume fraction (psi) of aqueous binary mobile phase in soil leaching column chromatography, the intersection point rule for the logk' of homologues and weak polar chlorobenzenes, with psi, as well as with boiling point, has been derived due to existence of the similar interactions among solutes of the same series, stationary phase (soil) and eluent (methanol-water). These rules were testified by experimental data of homologues (n-alkylbenzenes, methylbenzenes) and weak polar chlorobenzenes.

  11. Cloning of a cryptochrome homologue from the holoparasitic plant Orobanche minor Sm.

    Science.gov (United States)

    Okazawa, Atsushi; Trakulnaleamsai, Chitra; Hiramatsu, Hiroya; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio

    2005-05-01

    Orobanche minor is a non-photosynthetic root holoparasitic plant. Although it is known that photosynthesis-related genes are inactivated or have been eliminated from the plastid genomes of holoparasites, little is known about the alterations in their genes involved in the signaling networks by which light regulates photosynthesis. Cryptochromes (crys), which are blue-light receptors, appear to control both photosynthesis-related and non-photosynthetic responses to light in higher plants. Because we are interested in to what extent a cry-mediated light signaling network remains in the holoparasites, we cloned CRY homologous cDNA from O. minor (OmCRY1) and used real-time RT-PCR to compare its expression under natural daylight and darkness. We found that the OmCRY1 has a high degree of homology with CRY1 s from photosynthetic plants. Expression of the OmCRY1 gene was higher in plants grown in the dark than that in the plants grown under natural daylight. This is the first report of the gene expression of a blue-light receptor in non-photosynthetic plants.

  12. TMBP200, a XMAP215 homologue of tobacco BY-2 cells, has an essential role in plant mitosis.

    Science.gov (United States)

    Yasuhara, Hiroki; Oe, Yuki

    2011-07-01

    TMBP200 from tobacco BY-2 cells is a member of the highly conserved family of microtubule-associated proteins that includes Xenopus XMAP215, human TOGp, and Arabidopsis MOR1/GEM1. XMAP215 homologues have an essential role in spindle assembly and function in animals and yeast, but their role in plant mitosis is not fully clarified. Here, we show by immunoblot analysis that TMBP200 levels in synchronously cultured BY-2 cells increased when the cells entered mitosis, thus indicating that TMBP200 plays an important role in mitosis in tobacco. To investigate the role of TMBP200 in mitosis, we employed inducible RNA interference to silence TMBP200 expression in BY-2 cells. The resulting depletion of TMBP200 caused severe defects in bipolar spindle formation and resulted in the appearance of multinucleated cells with variable-sized nuclei. This finding indicates that TMBP200 has an essential role in bipolar spindle formation and function.

  13. The expression of the rice (Oryza sativa L.) homologue of Snm1 is induced by DNA damages

    International Nuclear Information System (INIS)

    Kimura, Seisuke; Saotome, Ai; Uchiyama, Yukinobu; Mori, Yoko; Tahira, Yasue; Sakaguchi, Kengo

    2005-01-01

    We isolated and characterized the rice homologue of the DNA repair gene Snm1 (OsSnm1). The length of the cDNA was 1862 bp; the open reading frame encoded a predicted product of 485 amino acid residues with a molecular mass of 53.2 kDa. The OsSnm1 protein contained the conserved β-lactamase domain in its internal region. OsSnm1 was expressed in all rice organs. The expression was induced by MMS, H 2 O 2 , and mitomycin C, but not by UV. Transient expression of an OsSnm1/GFP fusion protein in onion epidermal cells revealed the localization of OsSnm1 to the nucleus. These results suggest that OsSnm1 is involved not only in the repair of DNA interstrand crosslinks, but also in various other DNA repair pathways

  14. Investigation of evaporation characteristics of polonium and its lighter homologues selenium and tellurium from liquid Pb-Bi-eutecticum

    CERN Document Server

    Neuhausen, J; Eichler, B

    2004-01-01

    The evaporation behaviour of polonium and its lighter homologues selenium and tellurium dissolved in liquid Pb-Bi-eutecticum (LBE) has been studied at various temperatures in the range from 482 K up to 1330 K under Ar/H2 and Ar/H2O-atmospheres using γ-ray spectroscopy. Polonium release in the temperature range of interest for technical applications is slow. Within short term (1h) experiments measurable amounts of polonium are evaporated only at temperatures above 973 K. Long term experiments reveal that a slow evaporation of polonium occurs at temperatures around 873 K resulting in a fractional polonium loss of the melt around 1% per day. Evaporation rates of selenium and tellurium are smaller than those of polonium. The presence of H2O does not enhance the evaporation within the error limits of our experiments. The thermodynamics and possible reaction pathways involved in polonium release from LBE are discussed.

  15. Snipper, an Eri1 homologue, affects histone mRNA abundance and is crucial for normal Drosophila melanogaster development.

    Science.gov (United States)

    Alexiadis, Anastasios; Delidakis, Christos; Kalantidis, Kriton

    2017-07-01

    The conserved 3'-5' RNA exonuclease ERI1 is implicated in RNA interference inhibition, 5.8S rRNA maturation and histone mRNA maturation and turnover. The single ERI1 homologue in Drosophila melanogaster Snipper (Snp) is a 3'-5' exonuclease, but its in vivo function remains elusive. Here, we report Snp requirement for normal Drosophila development, since its perturbation leads to larval arrest and tissue-specific downregulation results in abnormal tissue development. Additionally, Snp directly interacts with histone mRNA, and its depletion results in drastic reduction in histone transcript levels. We propose that Snp protects the 3'-ends of histone mRNAs and upon its absence, histone transcripts are readily degraded. This in turn may lead to cell cycle delay or arrest, causing growth arrest and developmental perturbations. © 2017 Federation of European Biochemical Societies.

  16. Identification and characterisation of the angiotensin converting enzyme-3 (ACE3 gene: a novel mammalian homologue of ACE

    Directory of Open Access Journals (Sweden)

    Phelan Anne

    2007-06-01

    Full Text Available Abstract Background Mammalian angiotensin converting enzyme (ACE plays a key role in blood pressure regulation. Although multiple ACE-like proteins exist in non-mammalian organisms, to date only one other ACE homologue, ACE2, has been identified in mammals. Results Here we report the identification and characterisation of the gene encoding a third homologue of ACE, termed ACE3, in several mammalian genomes. The ACE3 gene is located on the same chromosome downstream of the ACE gene. Multiple sequence alignment and molecular modelling have been employed to characterise the predicted ACE3 protein. In mouse, rat, cow and dog, the predicted protein has mutations in some of the critical residues involved in catalysis, including the catalytic Glu in the HEXXH zinc binding motif which is Gln, and ESTs or reverse-transcription PCR indicate that the gene is expressed. In humans, the predicted ACE3 protein has an intact HEXXH motif, but there are other deletions and insertions in the gene and no ESTs have been identified. Conclusion In the genomes of several mammalian species there is a gene that encodes a novel, single domain ACE-like protein, ACE3. In mouse, rat, cow and dog ACE3, the catalytic Glu is replaced by Gln in the putative zinc binding motif, indicating that in these species ACE3 would lack catalytic activity as a zinc metalloprotease. In humans, no evidence was found that the ACE3 gene is expressed and the presence of deletions and insertions in the sequence indicate that ACE3 is a pseudogene.

  17. Ensembles generated from crystal structures of single distant homologues solve challenging molecular-replacement cases in AMPLE.

    Science.gov (United States)

    Rigden, Daniel J; Thomas, Jens M H; Simkovic, Felix; Simpkin, Adam; Winn, Martyn D; Mayans, Olga; Keegan, Ronan M

    2018-03-01

    Molecular replacement (MR) is the predominant route to solution of the phase problem in macromolecular crystallography. Although routine in many cases, it becomes more effortful and often impossible when the available experimental structures typically used as search models are only distantly homologous to the target. Nevertheless, with current powerful MR software, relatively small core structures shared between the target and known structure, of 20-40% of the overall structure for example, can succeed as search models where they can be isolated. Manual sculpting of such small structural cores is rarely attempted and is dependent on the crystallographer's expertise and understanding of the protein family in question. Automated search-model editing has previously been performed on the basis of sequence alignment, in order to eliminate, for example, side chains or loops that are not present in the target, or on the basis of structural features (e.g. solvent accessibility) or crystallographic parameters (e.g. B factors). Here, based on recent work demonstrating a correlation between evolutionary conservation and protein rigidity/packing, novel automated ways to derive edited search models from a given distant homologue over a range of sizes are presented. A variety of structure-based metrics, many readily obtained from online webservers, can be fed to the MR pipeline AMPLE to produce search models that succeed with a set of test cases where expertly manually edited comparators, further processed in diverse ways with MrBUMP, fail. Further significant performance gains result when the structure-based distance geometry method CONCOORD is used to generate ensembles from the distant homologue. To our knowledge, this is the first such approach whereby a single structure is meaningfully transformed into an ensemble for the purposes of MR. Additional cases further demonstrate the advantages of the approach. CONCOORD is freely available and computationally inexpensive, so

  18. An initial biochemical and cell biological characterization of the mammalian homologue of a central plant developmental switch, COP1

    Directory of Open Access Journals (Sweden)

    Wang Haiyang

    2002-12-01

    Full Text Available Abstract Background Constitutive photomorphogenic 1 (COP1 has been defined as a central regulator of photomorphogenic development in plants, which targets key transcription factors for proteasome-dependent degradation. Although COP1 mammalian homologue has been previously reported, its function and distribution in animal kingdom are not known. Results Here we report the characterization of full-length human and mouse COP1 cDNAs and the genomic structures of the COP1 genes from several different species. Mammalian COP1 protein binds to ubiquitinated proteins in vivo and is itself ubiquitinated. Furthermore, mammalian COP1 is predominately nuclear localized and exists primarily as a complex of over 700 kDa. Through mutagenesis studies, we have defined a leucine-rich nuclear export signal (NES within the coiled-coil domain of mammalian COP1 and a nuclear localization signal (NLS, which is composed of two clusters of positive-charged amino acids, bridged by the RING finger. Disruption of the RING finger structure abolishes the nuclear import, while deletion of the entire RING finger restores the nuclear import. Conclusions Our data suggest that mammalian COP1, similar to its plant homologue, may play a role in ubiquitination. Mammalian COP1 contains a classic leucine-rich NES and a novel bipartite NLS bridged by a RING finger domain. We propose a working model in which the COP1 RING finger functions as a structural scaffold to bring two clusters of positive-charged residues within spatial proximity to mimic a bipartite NLS. Therefore, in addition to its well-characterized role in ubiquitination, the RING finger domain may also play a structural role in nuclear import.

  19. The effect of delta-like 1 homologue on the proliferation and odontoblastic differentiation in human dental pulp stem cells.

    Science.gov (United States)

    Qi, Shengcai; Yan, Yanhong; Wen, Yue; Li, Jialiang; Wang, Jing; Chen, Fubo; Tang, Xiaoshan; Shang, Guangwei; Xu, Yuanzhi; Wang, Raorao

    2017-06-01

    This study aimed to investigate the functions of delta-like homologue 1 (DLK1) in the proliferation and differentiation of human dental pulp stem cells (hDPSCs). Immunohistochemical analysis was used to determine the expression of alkaline phosphatase (ALP), dentin sialophosphoprotein (DSPP), DLK1, NOTCH1 and p-ERK1/2 in the mouse first maxillary molar. Recombinant lentivirus was constructed to overexpress DLK1 stably in hDPSCs. The cell viability and proliferation of hDPSCs were examined by CCK8 and EdU incorporation assay respectively. The odontoblastic differentiation of hDPSCs was determined by detection of ALPase activity assay, ALP and alizarin red staining and the expression of mineralization-related genes including ALP, DSPP and dental matrix protein. The mRNA and protein levels of DLK1 and p-ERK1/2 protein expression were detected. ERK inhibitor was used to test the differentiation effect of DLK1 on hDPSCs. Delta-like homologue 1 was highly expressed on the odontoblasts and dental pulp cells on the first maxillary molar; the expression of p-ERK1/2 is similar with the DLK1 in the same process. The expression level of DLK1 increased significantly after the odontoblastic induction of hDPSCs. DLK1 overexpression increased the proliferation ability of hDPSCs and inhibited odontoblastic differentiation of hDPSCs. The protein level of p-ERK1/2 significantly increased in hDPSCs/dlk1-oe group. ERK signalling pathway inhibitor reversed the odontoblastic differentiation effects of DLK1 on hDPSCs. The proliferation of hDPSCs was promoted after DLK1 overexpression. DLK1 inhibited the odontoblastic differentiation of hDPSCs, which maybe through ERK signalling pathway. © 2017 John Wiley & Sons Ltd.

  20. Receptor assay

    Energy Technology Data Exchange (ETDEWEB)

    Kato, K; Ibayashi, H [Kyushu Univ., Fukuoka (Japan). Faculty of Medicine

    1975-05-01

    This paper summarized present status and problems of analysis of hormone receptor and a few considerations on clinical significance of receptor abnormalities. It was pointed that in future clinical field quantitative and qualitative analysis of receptor did not remain only in the etiological discussion, but that it was an epoch-making field of investigation which contained the possiblity of artificial change of sensitivity of living body on drugs and the development connected directly with treatment of various diseases.

  1. CORRELATIONS BETWEEN HOMOLOGUE CONCENTRATIONS OF PCDD/FS AND TOXIC EQUIVALENCY VALUES IN LABORATORY-, PACKAGE BOILER-, AND FIELD-SCALE INCINERATORS

    Science.gov (United States)

    The toxic equivalency (TEQ) values of polychlorinated dibenzo-p-dioxins and polychlorinated dibenzofurans (PCDD/Fs) are predicted with a model based on the homologue concentrations measured from a laboratory-scale reactor (124 data points), a package boiler (61 data points), and ...

  2. Identification and characterization of the ESAT-6 homologue of Mycobacterium leprae and T-cell cross-reactivity with Mycobacterium tuberculosis

    NARCIS (Netherlands)

    Geluk, Annemieke; van Meijgaarden, Krista E.; Franken, Kees L. M. C.; Subronto, Yanri W.; Wieles, Brigitte; Arend, Sandra M.; Sampaio, Elizabeth P.; de Boer, Tjitske; Faber, William R.; Naafs, Ben; Ottenhoff, Tom H. M.

    2002-01-01

    In this paper we describe identification and characterization of Mycobacterium leprae ESAT-6 (L-ESAT-6), the homologue of M. tuberculosis ESAT-6 (T-ESAT-6). T-ESAT-6 is expressed by all pathogenic strains belonging to the M. tuberculosis complex but is absent from virtually all other mycobacterial

  3. An avian homologue of the human β3-adrenoceptor that demonstrates unique pharmacology

    International Nuclear Information System (INIS)

    Broxton, N.M.; Papaioannou, M.; Evans, B.A.; Summers, R.J.

    2001-01-01

    Full text: A novel β-adrenoceptor (AR) in the turkey (Tβ 4 -AR; Chen et al 1994) displays low homology with otherβ-AR subtypes thus appearing to represent a novel subtype. It has intermediate affinity for [ 125 I]-cyanopindolol (CYP), lower than that for β|- or β 2 -ARs but higher than for the hβ 3 -AR. However, the gene structure of the tβ 4 -AR closely resembles that of the rodent β 3 -AR gene. cDNAs containing the coding region of tβ 4 - and hβ 3 -ARs were cloned into the mammalian expression vector pCDNA3.1 and transiently expressed in CHO KI cells. The pharmacological properties of the tβ 4 -AR were investigated with binding ([ 125 I] CYP) and cAMP accumulation assays and compared to that of the human β 3 ,-AR. Both the tβ 4 - and hβ 3 -ARs displayed low affinities for CGP20712A (CGP;β 1 -AR selective; pK i , tβ 4 6.13±0.62; hβ 3 6.10±0.15) and ICI118551 (ICI; β 2 -AR selective; pK i tβ 4 7.12±0.54; hβ 3 6.62±0.33). Theβ 3 -AR selective antagonist SR59230 (pK i tβ 4 7.45±0.07; hβ 3 .0010.50) as well as a non-selective antagonist (-) propranolol (Prop; pK i tβ 4 8.90±0.15; hβ 3 7.40±0.74) had higher affinities for both receptors but showed different rank orders of potency. β-AR agonists isoprenaline (Iso; pK i , tβ 4 6.5810.19; hβ 3 5.95±0.10) and noradrenaline (NA; pK i , tβ 4 6.65±0.29; hβ 3 5.66±10.32) had higher affinity for the tβ 4 -AR. In cAMP accumulation assays, the rank orders of potency of agonists was Iso > NA > BRL37344 >>CL316243 for the tβ 4 -AR and BRL37344, Iso > NA > CL316243 for the hβ 3 -AR. The antagonists had rank orders of affinity similar to those determined from binding experiments; for tβ 4 -AR (-) Prop > SR > ICI > (+) Prop > CGP, and hβ 3 -AR, SR > (-)Prop > ICI> (+) Prop > CGP. Therefore the tβ 4 -AR, although resembling the hβ 3 -AR in gene structure, displays high affinity for (-) propranolol and relatively low affinity for β 3 -AR selective agonists. Copyright (2001) Australasian

  4. Molecular cloning, sequence characterization and expression analysis of a CD63 homologue from the coleopteran beetle, Tenebrio molitor.

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-10-15

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic "Cys-Cys-Gly" motif and "Cys188" residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%-56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  5. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Directory of Open Access Journals (Sweden)

    Yeon Soo Han

    2013-10-01

    Full Text Available CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63 was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens.

  6. Molecular Cloning, Sequence Characterization and Expression Analysis of a CD63 Homologue from the Coleopteran Beetle, Tenebrio molitor

    Science.gov (United States)

    Patnaik, Bharat Bhusan; Kang, Seong Min; Seo, Gi Won; Lee, Hyo Jeong; Patnaik, Hongray Howrelia; Jo, Yong Hun; Tindwa, Hamisi; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Bang, In Seok; Han, Yeon Soo

    2013-01-01

    CD63, a member of the tetraspanin membrane protein family, plays a pivotal role in cell growth, motility, signal transduction, host-pathogen interactions and cancer. In this work, the cDNA encoding CD63 homologue (TmCD63) was cloned from larvae of a coleopteran beetle, Tenebrio molitor. The cDNA is comprised of an open reading frame of 705 bp, encoding putative protein of 235 amino acid residues. In silico analysis shows that the protein has four putative transmembrane domains and one large extracellular loop. The characteristic “Cys-Cys-Gly” motif and “Cys188” residues are highly conserved in the large extracellular loop. Phylogenetic analysis of TmCD63 revealed that they belong to the insect cluster with 50%–56% identity. Analysis of spatial expression patterns demonstrated that TmCD63 mRNA is mainly expressed in gut and Malphigian tubules of larvae and the testis of the adult. Developmental expression patterns of CD63 mRNA showed that TmCD63 transcripts are detected in late larval, pupal and adult stages. Interestingly, TmCD63 transcripts are upregulated to the maximum level of 4.5 fold, in response to DAP-type peptidoglycan during the first 6 h, although other immune elicitors also caused significant increase to the transcript level at later time-points. These results suggest that CD63 might contribute to T. molitor immune response against various microbial pathogens. PMID:24132157

  7. Determination of vitamin K homologues by high-performance liquid chromatography with on-line photoreactor and peroxyoxalate chemiluminescence detection

    International Nuclear Information System (INIS)

    Ahmed, Sameh; Kishikawa, Naoya; Nakashima, Kenichiro; Kuroda, Naotaka

    2007-01-01

    A sensitive and highly selective high-performance liquid chromatography (HPLC) method was developed for the determination of vitamin K homologues including phylloquinone (PK), menaquinone-4 (MK-4) and menaquinone-7 (MK-7) in human plasma using post-column peroxyoxalate chemiluminescence (PO-CL) detection following on-line ultraviolet (UV) irradiation. The method was based on ultraviolet irradiation (254 nm, 15 W) of vitamin K to produce hydrogen peroxide and a fluorescent product at the same time, which can be determined with PO-CL detection. The separation of vitamin K by HPLC was accomplished isocratically on an ODS column within 35 min. The method involves the use of 2-methyl-3-pentadecyl-1,4-naphthoquinone as an internal standard. The detection limits (signal-to-noise ratio = 3) were 32, 38 and 85 fmol for PK, MK-4 and MK-7, respectively. The recoveries of PK, MK-4 and MK-7 were greater than 82% and the inter- and intra-assay R.S.D. values were 1.9-5.4%. The sensitivity and selectivity of this method were sufficient for clinical and nutritional applications

  8. Detection and Characterization of Homologues of Human Hepatitis Viruses and Pegiviruses in Rodents and Bats in Vietnam.

    Science.gov (United States)

    Van Nguyen, Dung; Van Nguyen, Cuong; Bonsall, David; Ngo, Tue Tri; Carrique-Mas, Juan; Pham, Anh Hong; Bryant, Juliet E; Thwaites, Guy; Baker, Stephen; Woolhouse, Mark; Simmonds, Peter

    2018-02-28

    Rodents and bats are now widely recognised as important sources of zoonotic virus infections in other mammals, including humans. Numerous surveys have expanded our knowledge of diverse viruses in a range of rodent and bat species, including their origins, evolution, and range of hosts. In this study of pegivirus and human hepatitis-related viruses, liver and serum samples from Vietnamese rodents and bats were examined by PCR and sequencing. Nucleic acids homologous to human hepatitis B, C, E viruses were detected in liver samples of 2 (1.3%) of 157 bats, 38 (8.1%), and 14 (3%) of 470 rodents, respectively. Hepacivirus-like viruses were frequently detected (42.7%) in the bamboo rat, Rhizomys pruinosus , while pegivirus RNA was only evident in 2 (0.3%) of 638 rodent serum samples. Complete or near-complete genome sequences of HBV, HEV and pegivirus homologues closely resembled those previously reported from rodents and bats. However, complete coding region sequences of the rodent hepacivirus-like viruses substantially diverged from all of the currently classified variants and potentially represent a new species in the Hepacivirus genus. Of the viruses identified, their routes of transmission and potential to establish zoonoses remain to be determined.

  9. Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii.

    Science.gov (United States)

    La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H

    2012-11-30

    Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. PP-O and PP-V, Monascus pigment homologues, production, and phylogenetic analysis in Penicillium purpurogenum.

    Science.gov (United States)

    Arai, Teppei; Kojima, Ryo; Motegi, Yoshiki; Kato, Jun; Kasumi, Takafumi; Ogihara, Jun

    2015-12-01

    The production of pigments as secondary metabolites by microbes is known to vary by species and by physiological conditions within a single strain. The fungus strain Penicillium purpurogenum IAM15392 has been found to produce violet pigment (PP-V) and orange pigment (PP-O),Monascus azaphilone pigment homologues, when grown under specific culture conditions. In this study, we analysed PP-V and PP-O production capability in seven strains of P. purpurogenum in addition to strain IAM15392 under specific culture conditions. The pigment production pattern of five strains cultivated in PP-V production medium was similar to that of strain IAM15392, and all violet pigments produced by these five strains were confirmed to be PP-V. Strains that did not produce pigment were also identified. In addition, two strains cultivated in PP-O production medium produced a violet pigment identified as PP-V. The ribosomal DNA (rDNA) internal transcribed spacer (ITS) region sequences from the eight P. purpurogenum strains were sequenced and used to construct a neighbor-joining phylogenetic tree. PP-O and PP-V production of P. purpurogenum was shown to be related to phylogenetic placement based on rDNA ITS sequence. Based on these results, two hypotheses for the alteration of pigment production of P. purpurogenum in evolution were proposed. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  11. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues.

    Science.gov (United States)

    Nicosia, Aldo; Bennici, Carmelo; Biondo, Girolama; Costa, Salvatore; Di Natale, Marilena; Masullo, Tiziana; Monastero, Calogera; Ragusa, Maria Antonietta; Tagliavia, Marcello; Cuttitta, Angela

    2018-01-11

    Gene family encoding translationally controlled tumour protein (TCTP) is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis . The release of the genome sequence of Acropora digitifera , Exaiptasia pallida , Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis . These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP ( AvTCTP ) after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  12. Characterization of Translationally Controlled Tumour Protein from the Sea Anemone Anemonia viridis and Transcriptome Wide Identification of Cnidarian Homologues

    Directory of Open Access Journals (Sweden)

    Aldo Nicosia

    2018-01-01

    Full Text Available Gene family encoding translationally controlled tumour protein (TCTP is defined as highly conserved among organisms; however, there is limited knowledge of non-bilateria. In this study, the first TCTP homologue from anthozoan was characterised in the Mediterranean Sea anemone, Anemonia viridis. The release of the genome sequence of Acropora digitifera, Exaiptasia pallida, Nematostella vectensis and Hydra vulgaris enabled a comprehensive study of the molecular evolution of TCTP family among cnidarians. A comparison among TCTP members from Cnidaria and Bilateria showed conserved intron exon organization, evolutionary conserved TCTP signatures and 3D protein structure. The pattern of mRNA expression profile was also defined in A. viridis. These analyses revealed a constitutive mRNA expression especially in tissues with active proliferation. Additionally, the transcriptional profile of A. viridis TCTP (AvTCTP after challenges with different abiotic/biotic stresses showed induction by extreme temperatures, heavy metals exposure and immune stimulation. These results suggest the involvement of AvTCTP in the sea anemone defensome taking part in environmental stress and immune responses.

  13. Immune responses of B. malayi thioredoxin (TRX) and venom allergen homologue (VAH) chimeric multiple antigen for lymphatic filariasis.

    Science.gov (United States)

    Anugraha, Gandhirajan; Jeyaprita, Parasurama Jawaharlal; Madhumathi, Jayaprakasam; Sheeba, Tamilvanan; Kaliraj, Perumal

    2013-12-01

    Although multiple vaccine strategy for lymphatic filariasis has provided tremendous hope, the choice of antigens used in combination has determined its success in the previous studies. Multiple antigens comprising key vaccine candidates from different life cycle stages would provide a promising strategy if the antigenic combination is chosen by careful screening. In order to analyze one such combination, we have used a chimeric construct carrying the well studied B. malayi antigens thioredoxin (BmTRX) and venom allergen homologue (BmVAH) as a fusion protein (TV) and evaluated its immune responses in mice model. The efficacy of fusion protein vaccine was explored in comparison with the single antigen vaccines and their cocktail. In mice, TV induced significantly high antibody titer of 1,28,000 compared to cocktail vaccine TRX+VAH (50,000) and single antigen vaccine TRX (16,000) or VAH (50,000). Furthermore, TV elicited higher level of cellular proliferative response together with elevated levels of IFN-γ, IL-4 and IL-5 indicating a Th1/Th2 balanced response. The isotype antibody profile showed significantly high level of IgG1 and IgG2b confirming the balanced response elicited by TV. Immunization with TV antigen induced high levels of both humoral and cellular immune responses compared to either cocktail or antigen given alone. The result suggests that TV is highly immunogenic in mice and hence the combination needs to be evaluated for its prophylactic potential.

  14. Mouse homologue of yeast Prp19 interacts with mouse SUG1, the regulatory subunit of 26S proteasome

    International Nuclear Information System (INIS)

    Sihn, Choong-Ryoul; Cho, Si Young; Lee, Jeong Ho; Lee, Tae Ryong; Kim, Sang Hoon

    2007-01-01

    Yeast Prp19 has been shown to involve in pre-mRNA splicing and DNA repair as well as being an ubiquitin ligase. Mammalian homologue of yeast Prp19 also plays on similar functional activities in cells. In the present study, we isolated mouse SUG1 (mSUG1) as binding partner of mouse Prp19 (mPrp19) by the yeast two-hybrid system. We confirmed the interaction of mPrp9 with mSUG1 by GST pull-down assay and co-immunoprecipitation assay. The N-terminus of mPrp19 including U-box domain was associated with the C-terminus of mSUG1. Although, mSUG1 is a regulatory subunit of 26S proteasome, mPrp19 was not degraded in the proteasome-dependent pathway. Interestingly, GFP-mPrp19 fusion protein was co-localized with mSUG1 protein in cytoplasm as the formation of the speckle-like structures in the presence of a proteasome inhibitor MG132. In addition, the activity of proteasome was increased in cells transfected with mPrp19. Taken together, these results suggest that mPrp19 involves the regulation of protein turnover and may transport its substrates to 26S proteasome through mSUG1 protein

  15. Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

    International Nuclear Information System (INIS)

    Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir; Mayer, Claudine

    2005-01-01

    The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02 Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry

  16. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    Energy Technology Data Exchange (ETDEWEB)

    Monroy G, F. [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C., E-mail: fabiola.monroy@inin.gob.m [Institut de Physique Nucleaire, F-91406 Orsay, France (France)

    2010-07-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH{sub 4}F/HClO{sub 4} medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K{sub d} obtained at different F{sup -} and H{sup +} concentrations. The anionic complexes: [Zr(Hf)F{sub 5}]{sup -}, [Zr(Hf)F{sub 6}]{sup 2-}, [Zr(Hf)F{sub 7}]{sup 3-}, [Ta(Pa)F{sub 6}]{sup -}, [Ta(Pa)F{sub 7}]{sup 2-}, [Ta(Pa)F{sub 8}]{sup 3-}, [NbOF{sub 4}]{sup -} and [NbOF{sub 5}]{sup 2-} are present as predominant species in the HF range over investigation. (Author)

  17. Temperature-sensitive defects of the GSP1gene, yeast Ran homologue, activate the Tel1-dependent pathway

    International Nuclear Information System (INIS)

    Hayashi, Naoyuki; Murakami, Seishi; Tsurusaki, Susumu; Nagaura, Zen-ichiro; Oki, Masaya; Nishitani, Hideo; Kobayashi, Masahiko; Shimizu, Hiroko; Yamamoto, Ken-ichi; Nishimoto, Takeharu

    2007-01-01

    RanGTPase is involved in many cellular processes. It functions in nuclear-cytosolic transport and centrosome formation. Ran also localizes to chromatin as RCC1 does, its guanine nucleotide exchange factor, but Ran's function on chromatin is not known. We found that gsp1, a temperature-sensitive mutant of GSP1, a Saccharomyces cerevisiae Ran homologue, suppressed the hydroxyurea (HU) and ultra violet (UV) sensitivities of the mec1 mutant. In UV-irradiated mec1 gsp1 cells, Rad53 was phosphorylated despite the lack of Mec1. This suppression depended on the TEL1 gene, given that the triple mutant, mec1 gsp1 tel1, was unable to grow. The gsp1 mutations also suppressed the HU sensitivity of the rad9 mutant in a Tel1-dependent manner, but not the HU sensitivity of the rad53 mutant. These results indicated that Rad53 was activated by the Tel1 pathway in mec1 gsp1 cells, suggesting that Gsp1 helps regulate the role switching the ATM family kinases Mec1 and Tel1

  18. Anion exchange behaviour of Zr, Hf, Nb, Ta and Pa as homologues of RF and Db in fluoride medium

    International Nuclear Information System (INIS)

    Monroy G, F.; Trubert, D.; Brillard, L.; Hussonnois, M.; Constantinescu, O.; Le Naour, C.

    2010-01-01

    Studies of the chemical property of trans actinide elements are very difficult due to their short half-lives and extremely small production yields. However it is still possible to obtain considerable information about their chemical properties, such as the most stable oxidation states in aqueous solution, complexing ability, etc., comparing their behaviour with their lighter homologous in the periodic table. In order to obtain a better knowledge of the behaviour of rutherfordium, RF (element 104), dub nium, Db (element 105) in HF medium, the sorption properties of Zr, Hf, Nb, Ta an Pa, homologues of RF and Db, were studied in NH 4 F/HClO 4 medium in this work. Stability constants of the fluoride complexes of these elements were experimentally obtained from K d obtained at different F - and H + concentrations. The anionic complexes: [Zr(Hf)F 5 ] - , [Zr(Hf)F 6 ] 2- , [Zr(Hf)F 7 ] 3- , [Ta(Pa)F 6 ] - , [Ta(Pa)F 7 ] 2- , [Ta(Pa)F 8 ] 3- , [NbOF 4 ] - and [NbOF 5 ] 2- are present as predominant species in the HF range over investigation. (Author)

  19. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen

    2009-10-01

    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  20. Tumour cell expression of C4.4A, a structural homologue of the urokinase receptor, correlates with poor prognosis in non-small cell lung cancer

    DEFF Research Database (Denmark)

    Hansen, Line V.; Skov, Birgit G; Ploug, Michael

    2007-01-01

    expression. In the present study, we therefore explored the possible association between C4.4A expression and prognosis in patients with non-small cell lung cancer (NSCLC). EXPERIMENTAL DESIGN: Tissue sections from 108 NSCLC patients were subjected to immunohistochemical staining using a polyclonal antibody...

  1. Altered expression of the urokinase receptor homologue, C4.4A, in invasive areas of human esophageal squamous cell carcinoma

    DEFF Research Database (Denmark)

    Hansen, L.V.; Laerum, O.D.; Illemann, M.

    2008-01-01

    . In the present study, we have therefore analyzed the expression of C4.4A in 14 esophageal squamous cell carcinomas (ESCC). Normal squamous esophageal epithelium shows a strong cell surface associated C4.4A expression in the suprabasal layers, whereas basal cells are negative. Upon transition to dysplasia...... and carcinoma in situ the expression of C4.4A is abruptly and coordinately weakened. Double immunofluorescence staining of normal and dysplastic tissue showed that C4.4A colocalizes with the epithelial cell surface marker E-cadherin in the suprabasal cells and has a complementary expression pattern compared...... to the proliferation marker Ki-67. A prominent, but frequently intracellular, C4.4A expression reappeared in tumor cells located at the invasive front and local lymph node metastases. Because C4.4A was reported previously to be a putative laminin-5 (LN5) ligand, and both proteins are expressed by invasive tumor cells...

  2. Genetic analysis of the spindle checkpoint genes san-1, mdf-2, bub-3 and the CENP-F homologues hcp-1 and hcp-2 in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Moore Landon L

    2008-02-01

    Full Text Available Abstract Background The spindle checkpoint delays the onset of anaphase until all sister chromatids are aligned properly at the metaphase plate. To investigate the role san-1, the MAD3 homologue, has in Caenorhabditis elegans embryos we used RNA interference (RNAi to identify genes synthetic lethal with the viable san-1(ok1580 deletion mutant. Results The san-1(ok1580 animal has low penetrating phenotypes including an increased incidence of males, larvae arrest, slow growth, protruding vulva, and defects in vulva morphogenesis. We found that the viability of san-1(ok1580 embryos is significantly reduced when HCP-1 (CENP-F homologue, MDF-1 (MAD-1 homologue, MDF-2 (MAD-2 homologue or BUB-3 (predicted BUB-3 homologue are reduced by RNAi. Interestingly, the viability of san-1(ok1580 embryos is not significantly reduced when the paralog of HCP-1, HCP-2, is reduced. The phenotype of san-1(ok1580;hcp-1(RNAi embryos includes embryonic and larval lethality, abnormal organ development, and an increase in abnormal chromosome segregation (aberrant mitotic nuclei, anaphase bridging. Several of the san-1(ok1580;hcp-1(RNAi animals displayed abnormal kinetochore (detected by MPM-2 and microtubule structure. The survival of mdf-2(RNAi;hcp-1(RNAi embryos but not bub-3(RNAi;hcp-1(RNAi embryos was also compromised. Finally, we found that san-1(ok1580 and bub-3(RNAi, but not hcp-1(RNAi embryos, were sensitive to anoxia, suggesting that like SAN-1, BUB-3 has a functional role as a spindle checkpoint protein. Conclusion Together, these data suggest that in the C. elegans embryo, HCP-1 interacts with a subset of the spindle checkpoint pathway. Furthermore, the fact that san-1(ok1580;hcp-1(RNAi animals had a severe viability defect whereas in the san-1(ok1580;hcp-2(RNAi and san-1(ok1580;hcp-2(ok1757 animals the viability defect was not as severe suggesting that hcp-1 and hcp-2 are not completely redundant.

  3. Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

    Science.gov (United States)

    van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

    1997-05-01

    We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

  4. The Neurospora crassa UVS-3 epistasis group encodes homologues of the ATR/ATRIP checkpoint control system.

    Science.gov (United States)

    Kazama, Yusuke; Ishii, Chizu; Schroeder, Alice L; Shimada, Hisao; Wakabayashi, Michiyoshi; Inoue, Hirokazu

    2008-02-01

    The mutagen sensitive uvs-3 and mus-9 mutants of Neurospora show mutagen and hydroxyurea sensitivity, mutator effects and duplication instability typical of recombination repair and DNA damage checkpoint defective mutants. To determine the nature of these genes we used cosmids from a genomic library to clone the uvs-3 gene by complementation for MMS sensitivity. Mutation induction by transposon insertion and RIP defined the coding sequence. RFLP analysis confirmed that this sequence maps in the area of uvs-3 at the left telomere of LG IV. Analysis of the cDNA showed that the UVS-3 protein contains an ORF of 969 amino acids with one intron. It is homologous to UvsD of Aspergillus nidulans, a member of the ATRIP family of checkpoint proteins. It retains the N' terminal coiled-coil motif followed by four basic amino acids typical of these proteins and shows the highest homology in this region. The uvsD cDNA partially complements the defects of the uvs-3 mutation. The uvs-3 mutant shows a higher level of micronuclei in conidia and failure to halt germination and nuclear division in the presence of hydroxyurea than wild type, suggesting checkpoint defects. ATRIP proteins bind tightly to ATR PI-3 kinase (phosphatidylinositol 3-kinase) proteins. Therefore, we searched the Neurospora genome sequence for homologues of the Aspergillus nidulans ATR, UvsB. A uvsB homologous sequence was present in the right arm of chromosome I where the mus-9 gene maps. A cosmid containing this genomic DNA complemented the mus-9 mutation. The putative MUS-9 protein is 2484 amino acids long with eight introns. Homology is especially high in the C-terminal 350 amino acids that correspond to the PI-3 kinase domain. In wild type a low level of constitutive mRNA is present for both genes. It is transiently induced upon UV exposure.

  5. The SPF27 homologue Num1 connects splicing and kinesin 1-dependent cytoplasmic trafficking in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Nikola Kellner

    2014-01-01

    Full Text Available The conserved NineTeen protein complex (NTC is an integral subunit of the spliceosome and required for intron removal during pre-mRNA splicing. The complex associates with the spliceosome and participates in the regulation of conformational changes of core spliceosomal components, stabilizing RNA-RNA- as well as RNA-protein interactions. In addition, the NTC is involved in cell cycle checkpoint control, response to DNA damage, as well as formation and export of mRNP-particles. We have identified the Num1 protein as the homologue of SPF27, one of NTC core components, in the basidiomycetous fungus Ustilago maydis. Num1 is required for polarized growth of the fungal hyphae, and, in line with the described NTC functions, the num1 mutation affects the cell cycle and cell division. The num1 deletion influences splicing in U. maydis on a global scale, as RNA-Seq analysis revealed increased intron retention rates. Surprisingly, we identified in a screen for Num1 interacting proteins not only NTC core components as Prp19 and Cef1, but several proteins with putative functions during vesicle-mediated transport processes. Among others, Num1 interacts with the motor protein Kin1 in the cytoplasm. Similar phenotypes with respect to filamentous and polar growth, vacuolar morphology, as well as the motility of early endosomes corroborate the genetic interaction between Num1 and Kin1. Our data implicate a previously unidentified connection between a component of the splicing machinery and cytoplasmic transport processes. As the num1 deletion also affects cytoplasmic mRNA transport, the protein may constitute a novel functional interconnection between the two disparate processes of splicing and trafficking.

  6. Enhancer of zeste homologue 2 plays an important role in neuroblastoma cell survival independent of its histone methyltransferase activity.

    Science.gov (United States)

    Bate-Eya, Laurel T; Gierman, Hinco J; Ebus, Marli E; Koster, Jan; Caron, Huib N; Versteeg, Rogier; Dolman, M Emmy M; Molenaar, Jan J

    2017-04-01

    Neuroblastoma is predominantly characterised by chromosomal rearrangements. Next to V-Myc Avian Myelocytomatosis Viral Oncogene Neuroblastoma Derived Homolog (MYCN) amplification, chromosome 7 and 17q gains are frequently observed. We identified a neuroblastoma patient with a regional 7q36 gain, encompassing the enhancer of zeste homologue 2 (EZH2) gene. EZH2 is the histone methyltransferase of lysine 27 of histone H3 (H3K27me3) that forms the catalytic subunit of the polycomb repressive complex 2. H3K27me3 is commonly associated with the silencing of genes involved in cellular processes such as cell cycle regulation, cellular differentiation and cancer. High EZH2 expression correlated with poor prognosis and overall survival independent of MYCN amplification status. Unexpectedly, treatment of 3 EZH2-high expressing neuroblastoma cell lines (IMR32, CHP134 and NMB), with EZH2-specific inhibitors (GSK126 and EPZ6438) resulted in only a slight G1 arrest, despite maximum histone methyltransferase activity inhibition. Furthermore, colony formation in cell lines treated with the inhibitors was reduced only at concentrations much higher than necessary for complete inhibition of EZH2 histone methyltransferase activity. Knockdown of the complete protein with three independent shRNAs resulted in a strong apoptotic response and decreased cyclin D1 levels. This apoptotic response could be rescued by overexpressing EZH2ΔSET, a truncated form of wild-type EZH2 lacking the SET transactivation domain necessary for histone methyltransferase activity. Our findings suggest that high EZH2 expression, at least in neuroblastoma, has a survival function independent of its methyltransferase activity. This important finding highlights the need for studies on EZH2 beyond its methyltransferase function and the requirement for compounds that will target EZH2 as a complete protein. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  8. A spinach O-acetylserine(thiollyase homologue, SoCSaseLP, suppresses cysteine biosynthesis catalysed by other enzyme isoforms

    Directory of Open Access Journals (Sweden)

    Miki Noda

    2016-06-01

    Full Text Available An enzyme, O-acetylserine(thiollyase (OASTL, also known as O-acetylserine sulfhydrylase or cysteine synthase (CSase, catalyses the incorporation of sulfide into O-acetylserine and produces cysteine. We previously identified a cDNA encoding an OASTL-like protein from Spinacia oleracea, (SoCSaseLP, but a recombinant SoCSaseLP produced in Escherichia coli did not show OASTL activity. The exon-intron structure of the SoCSaseLP gene shared conserved structures with other spinach OASTL genes. The SoCSaseLP and a Beta vulgaris homologue protein, KMT13462, comprise a unique clade in the phylogenetic tree of the OASTL family. Interestingly, when the SoCSaseLP gene was expressed in tobacco plants, total OASTL activity in tobacco leaves was reduced. This reduction in total OASTL activity was most likely caused by interference by SoCSaseLP with cytosolic OASTL. To investigate the possible interaction of SoCSaseLP with a spinach cytosolic OASTL isoform SoCSaseA, a pull-down assay was carried out. The recombinant glutathione S-transferase (GST-SoCSaseLP fusion protein was expressed in E. coli together with the histidine-tagged SoCSaseA protein, and the protein extract was subjected to glutathione affinity chromatography. The histidine-tagged SoCSaseA was co-purified with the GST-SoCSaseLP fusion protein, indicating the binding of SoCSaseLP to SoCSaseA. Consistent with this interaction, the OASTL activity of the co-purified SoCSaseA was reduced compared with the activity of SoCSaseA that was purified on its own. These results strongly suggest that SoCSaseLP negatively regulates the activity of other cytosolic OASTL family members by direct interaction.

  9. Neuronal SIRT1 (Silent Information Regulator 2 Homologue 1) Regulates Glycolysis and Mediates Resveratrol-Induced Ischemic Tolerance.

    Science.gov (United States)

    Koronowski, Kevin B; Khoury, Nathalie; Saul, Isabel; Loris, Zachary B; Cohan, Charles H; Stradecki-Cohan, Holly M; Dave, Kunjan R; Young, Juan I; Perez-Pinzon, Miguel A

    2017-11-01

    Resveratrol, at least in part via SIRT1 (silent information regulator 2 homologue 1) activation, protects against cerebral ischemia when administered 2 days before injury. However, it remains unclear if SIRT1 activation must occur, and in which brain cell types, for the induction of neuroprotection. We hypothesized that neuronal SIRT1 is essential for resveratrol-induced ischemic tolerance and sought to characterize the metabolic pathways regulated by neuronal Sirt1 at the cellular level in the brain. We assessed infarct size and functional outcome after transient 60 minute middle cerebral artery occlusion in control and inducible, neuronal-specific SIRT1 knockout mice. Nontargeted primary metabolomics analysis identified putative SIRT1-regulated pathways in brain. Glycolytic function was evaluated in acute brain slices from adult mice and primary neuronal-enriched cultures under ischemic penumbra-like conditions. Resveratrol-induced neuroprotection from stroke was lost in neuronal Sirt1 knockout mice. Metabolomics analysis revealed alterations in glucose metabolism on deletion of neuronal Sirt1 , accompanied by transcriptional changes in glucose metabolism machinery. Furthermore, glycolytic ATP production was impaired in acute brain slices from neuronal Sirt1 knockout mice. Conversely, resveratrol increased glycolytic rate in a SIRT1-dependent manner and under ischemic penumbra-like conditions in vitro. Our data demonstrate that resveratrol requires neuronal SIRT1 to elicit ischemic tolerance and identify a novel role for SIRT1 in the regulation of glycolytic function in brain. Identification of robust neuroprotective mechanisms that underlie ischemia tolerance and the metabolic adaptations mediated by SIRT1 in brain are crucial for the translation of therapies in cerebral ischemia and other neurological disorders. © 2017 American Heart Association, Inc.

  10. Genetic link between Cabeza, a Drosophila homologue of Fused in Sarcoma (FUS), and the EGFR signaling pathway

    Energy Technology Data Exchange (ETDEWEB)

    Shimamura, Mai; Kyotani, Akane [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Azuma, Yumiko [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Yoshida, Hideki; Binh Nguyen, Thanh [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Mizuta, Ikuko; Yoshida, Tomokatsu; Mizuno, Toshiki [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Nakagawa, Masanori [North Medical Center, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Tokuda, Takahiko, E-mail: ttokuda@koto.kpu-m.ac.jp [Department of Neurology, Kyoto Prefectural University of Medicine, 465 Kajii-cho,Kamigyo-ku, Kyoto 602-8566 (Japan); Department of Molecular Pathobiology of Brain Diseases, Graduate School of Medical Science, Kyoto Prefectural University of Medicine, 465 Kajii-cho, Kamigyo-ku, Kyoto 602-8566 (Japan); Yamaguchi, Masamitsu, E-mail: myamaguc@kit.ac.jp [Department of Applied Biology, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan); Insect Biomedical Research Center, Kyoto Institute of Technology, Matsugasaki, Sakyo-ku, Kyoto 606-8585 (Japan)

    2014-08-01

    Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease that causes progressive muscular weakness. Fused in Sarcoma (FUS) that has been identified in familial ALS is an RNA binding protein that is normally localized in the nucleus. However, its function in vivo is not fully understood. Drosophila has Cabeza (Caz) as a FUS homologue and specific knockdown of Caz in the eye imaginal disc and pupal retina using a GMR-GAL4 driver was here found to induce an abnormal morphology of the adult compound eyes, a rough eye phenotype. This was partially suppressed by expression of the apoptosis inhibitor P35. Knockdown of Caz exerted no apparent effect on differentiation of photoreceptor cells. However, immunostaining with an antibody to Cut that marks cone cells revealed fusion of these and ommatidia of pupal retinae. These results indicate that Caz knockdown induces apoptosis and also inhibits differentiation of cone cells, resulting in abnormal eye morphology in adults. Mutation in EGFR pathway-related genes, such as rhomboid-1, rhomboid-3 and mirror suppressed the rough eye phenotype induced by Caz knockdown. Moreover, the rhomboid-1 mutation rescued the fusion of cone cells and ommatidia observed in Caz knockdown flies. The results suggest that Caz negatively regulates the EGFR signaling pathway required for determination of cone cell fate in Drosophila. - Highlights: • Knockdown of Cabeza induced rough eye phenotype. • Knockdown of Cabeza induced fusion of cone cells in pupal retinae. • Knockdown of Cabeza induced apoptosis in pupal retinae. • Mutation in EGFR pathway-related genes suppressed the rough eye phenotype. • Cabeza may negatively regulate the EGFR pathway.

  11. OVO homologue-like 1 (Ovol1) transcription factor: a novel target of neurogenin-3 in rodent pancreas.

    Science.gov (United States)

    Vetere, A; Li, W-C; Paroni, F; Juhl, K; Guo, L; Nishimura, W; Dai, X; Bonner-Weir, S; Sharma, A

    2010-01-01

    The basic helix-loop-helix transcription factor neurogenin-3 (NGN3) commits the fates of pancreatic progenitors to endocrine cell types, but knowledge of the mechanisms regulating the choice between proliferation and differentiation of these progenitors is limited. Using a chromatin immunoprecipitation cloning approach, we searched for direct targets of NGN3 and identified a zinc-finger transcription factor, OVO homologue-like 1 (OVOL1). Transactivation experiments were carried out to elucidate the functional role of NGN3 in Ovol1 gene expression. Embryonic and adult rodents pancreases were immunostained for OVOL1, Ki67 and NGN3. We showed that NGN3 negatively regulates transcription of Ovol1 in an E-box-dependent fashion. The presence of either NGN3 or NEUROD1, but not MYOD, reduced endogenous Ovol1 mRNA. OVOL1 was detected in pancreatic tissue around embryonic day 15.5, after which OVOL1 levels dramatically increased. In embryonic pancreas, OVOL1 protein levels were low in NGN3(+) or Ki67(+) cells, but high in quiescent differentiated cells. OVOL1 presence was maintained in adult pancreas, where it was detected in islets, pancreatic ducts and some acinar cells. Additionally OVOL1 presence was lacking in proliferating ductules in regenerating pancreas and induced in cells as they began to acquire their differentiated phenotype. The timing of OVOL1 appearance in pancreas and its increased levels in differentiated cells suggest that OVOL1 promotes the transition of cells from a proliferating, less-differentiated state to a quiescent more-differentiated state. We conclude that OVOL1, a downstream target of NGN3, may play an important role in regulating the balance between proliferation and differentiation of pancreatic cells.

  12. Characterization of interleukin-8 receptors in non-human primates

    Energy Technology Data Exchange (ETDEWEB)

    Alvarez, V.; Coto, E.; Gonzalez-Roces, S.; Lopez-Larrea, C. [Hospital Central de Asturias, Oviedo (Spain)] [and others

    1996-09-01

    Interleukin-8 is a chemokine with a potent neutrophil chemoatractant activity. In humans, two different cDNAs encoding human IL8 receptors designated IL8RA and IL8RB have been cloned. IL8RA binds IL8, while IL8RB binds IL8 as well as other {alpha}-chemokines. Both human IL8Rs are encoded by two genes physically linked on chromosome 2. The IL8RA and IL8RB genes have open reading frames (ORF) lacking introns. By direct sequencing of the polymerase chain reaction products, we sequenced the IL8R genes of cell lines from four non-human primates: chimpanzee, gorilla, orangutan, and macaca. The IL8RB encodes an ORF in the four non-human primates, showing 95%-99% similarity to the human IL8RB sequence. The IL8RA homologue in gorilla and chimpanzee consisted of two ORF 98%-99% identical to the human sequence. The macaca and orangutan IL8RA homologues are pseudogenes: a 2 base pair insertion generated a sequence with several stop codons. In addition, we describe the physical linkage of these genes in the four non-human primates and discuss the evolutionary implications of these findings. 25 refs., 5 figs., 3 tabs.

  13. Cloning and expression of the human N-methyl-D-aspartate receptor subunit NR3A

    DEFF Research Database (Denmark)

    Eriksson, Maria; Nilsson, Anna; Froelich-Fabre, Susanne

    2002-01-01

    Native N-methyl-D-aspartate (NMDA) receptors are heteromeric assemblies of four or five subunits. The NMDA receptor subunits, NR1, NR2A, NR2B, NR2C, and NR2D have been cloned in several species, including man. The NR3A subunit, which in rodents is predominantly expressed during early development......, seems to function by reducing the NMDA receptor response. The human homologue to the rat NR3A, however, had not been cloned. In order to study the functions of the human NR3A (hNR3A), we have cloned and sequenced the hNR3A. It was found to share 88% of the DNA sequence with the rat gene, corresponding...

  14. The first spectroscopically confirmed Mira star in M33

    Czech Academy of Sciences Publication Activity Database

    Barsukova, E.A.; Goranskij, V.P.; Hornoch, Kamil; Fabrika, S.; Pietsch, W.; Sholukhova, O.; Valeev, A.F.

    2011-01-01

    Roč. 413, č. 3 (2011), s. 1797-1802 ISSN 0035-8711 Institutional research plan: CEZ:AV0Z10030501 Keywords : AGB and post AGB * variables stars * general galaxies Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.900, year: 2011

  15. Enhancer of the rudimentary gene homologue (ERH expression pattern in sporadic human breast cancer and normal breast tissue

    Directory of Open Access Journals (Sweden)

    Knüchel Ruth

    2008-05-01

    Full Text Available Abstract Background The human gene ERH (Enhancer of the Rudimentary gene Homologue has previously been identified by in silico analysis of four million ESTs as a gene differentially expressed in breast cancer. The biological function of ERH protein has not been fully elucidated, however functions in cell cycle progression, pyrimidine metabolism a possible interaction with p21(Cip1/Waf1 via the Ciz1 zinc finger protein have been suggested. The aim of the present study was a systematic characterization of ERH expression in human breast cancer in order to evaluate possible clinical applications of this molecule. Methods The expression pattern of ERH was analyzed using multiple tissue northern blots (MTN on a panel of 16 normal human tissues and two sets of malignant/normal breast and ovarian tissue samples. ERH expression was further analyzed in breast cancer and normal breast tissues and in tumorigenic as well as non-tumorigenic breast cancer cell lines, using quantitative RT-PCR and non-radioisotopic in situ hybridization (ISH. Results Among normal human tissues, ERH expression was most abundant in testis, heart, ovary, prostate, and liver. In the two MTN sets of malignant/normal breast and ovarian tissue,ERH was clearly more abundantly expressed in all tumours than in normal tissue samples. Quantitative RT-PCR analyses showed that ERH expression was significantly more abundant in tumorigenic than in non-tumorigenic breast cancer cell lines (4.5-fold; p = 0.05, two-tailed Mann-Whitney U-test; the same trend was noted in a set of 25 primary invasive breast cancers and 16 normal breast tissue samples (2.5-fold; p = 0.1. These findings were further confirmed by non-radioisotopic ISH in human breast cancer and normal breast tissue. Conclusion ERH expression is clearly up-regulated in malignant as compared with benign breast cells both in primary human breast cancer and in cell models of breast cancer. Since similar results were obtained for ovarian

  16. Regulation of Toll-like receptor 2 interaction with Ecgp96 controls Escherichia coli K1 invasion of brain endothelial cells

    OpenAIRE

    Krishnan, Subramanian; Chen, Shuang; Turcatel, Gianluca; Arditi, Moshe; Prasadarao, Nemani V.

    2012-01-01

    The interaction of outer membrane protein A (OmpA) with its receptor, Ecgp96 (a homologue of Hsp90β) is critical for the pathogenesis of E. coli K1 meningitis. Since Hsp90 chaperones Toll-like receptors (TLRs), we examined the role of TLRs in E. coli K1 infection. Herein, we show that newborn TLR2−/− mice are resistant to E. coli K1 meningitis, while TLR4−/− mice succumb to infection sooner. In vitro, OmpA+ E. coli infection selectively upregulates Ecgp96 and TLR2 in human brain microvascular...

  17. Characterization of cogon grass (Imperata cylindrica) pollen extract and preliminary analysis of grass group 1, 4 and 5 homologues using monoclonal antibodies to Phleum pratense.

    Science.gov (United States)

    Kumar, L; Sridhara, S; Singh, B P; Gangal, S V

    1998-11-01

    Previous studies have established the role of Imperata cylindrica (Ic) pollen in type I allergic disorders. However, no systematic information is available on the allergen composition of Ic pollen extract. To characterize the IgE-binding proteins of Ic pollen extract and to detect the presence of grass group 1, 4 and 5 allergen homologues, if any. Pollen extract of Ic was analyzed by in vivo and in vitro procedures such as intradermal tests (ID), enzyme-linked immunosorbent assay (ELISA), ELISA-inhibition, thin-layer isoelectric focusing (TLIEF), sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Dot blot assay was carried out to check the presence of well-known group 1, 4, and 5 allergen homologues in Ic pollen extract. Out of 303 respiratory allergies patients skin-tested, 27 showed sensitivity to Ic pollen extract. Specific IgE levels were elevated in all 15 serum samples tested. The extract prepared for this study was found to be highly potent since it required only 400 ng of homologous proteins for 50% inhibition of binding in ELISA inhibition assays. TLIEF of Ic pollen extract showed 44 silver-stained bands (pI 3.5-7.0) while SDS-PAGE resolved it into 24 Coomassie-Brilliant-Blue-stained bands (MW 100-10 kD). Immunoblotting with individual patient sera recognized 7 major IgE-binding bands (MW 85, 62, 57, 43, 40, 28 and 16 kD) in Ic pollen extract. A panel of monoclonal antibodies, specific to group 1, 4 and 5 allergens from Phleum pratense pollen extract identified group 5 and group 4 homologues in Ic pollen extract. Ic pollen extract was characterized for the protein profile by TLIEF and SDS-PAGE. IgE reactivity was determined by ELISA and immunoblot. Monoclonal antibodies to group 5 and group 4 allergens reacted weakly showing that this pollen contains group 5 and group 4 homologous allergens.

  18. The nuclear receptor gene family in the Pacific oyster, Crassostrea gigas, contains a novel subfamily group.

    Science.gov (United States)

    Vogeler, Susanne; Galloway, Tamara S; Lyons, Brett P; Bean, Tim P

    2014-05-15

    Nuclear receptors are a superfamily of transcription factors important in key biological, developmental and reproductive processes. Several of these receptors are ligand- activated and through their ability to bind endogenous and exogenous ligands, are potentially vulnerable to xenobiotics. Molluscs are key ecological species in defining aquatic and terrestrial habitats and are sensitive to xenobiotic compounds in the environment. However, the understanding of nuclear receptor presence, function and xenobiotic disruption in the phylum Mollusca is limited. Here, forty-three nuclear receptor sequences were mined from the genome of the Pacific oyster, Crassostrea gigas. They include members of NR0-NR5 subfamilies, notably lacking any NR6 members. Phylogenetic analyses of the oyster nuclear receptors have been conducted showing the presence of a large novel subfamily group not previously reported, which is named NR1P. Homologues to all previous identified nuclear receptors in other mollusc species have also been determined including the putative heterodimer partner retinoid X receptor, estrogen receptor and estrogen related receptor. C. gigas contains a highly diverse set of nuclear receptors including a novel NR1 group, which provides important information on presence and evolution of this transcription factor superfamily in invertebrates. The Pacific oyster possesses two members of NR3, the sex steroid hormone receptor analogues, of which there are 9 in humans. This provides increasing evidence that steroid ligand specific expansion of this family is deuterostome specific. This new knowledge on divergence and emergence of nuclear receptors in C. gigas provides essential information for studying regulation of molluscan gene expression and the potential effects of xenobiotics.

  19. Meticillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study.

    Science.gov (United States)

    García-Álvarez, Laura; Holden, Matthew T G; Lindsay, Heather; Webb, Cerian R; Brown, Derek F J; Curran, Martin D; Walpole, Enid; Brooks, Karen; Pickard, Derek J; Teale, Christopher; Parkhill, Julian; Bentley, Stephen D; Edwards, Giles F; Girvan, E Kirsty; Kearns, Angela M; Pichon, Bruno; Hill, Robert L R; Larsen, Anders Rhod; Skov, Robert L; Peacock, Sharon J; Maskell, Duncan J; Holmes, Mark A

    2011-08-01

    Animals can act as a reservoir and source for the emergence of novel meticillin-resistant Staphylococcus aureus (MRSA) clones in human beings. Here, we report the discovery of a strain of S aureus (LGA251) isolated from bulk milk that was phenotypically resistant to meticillin but tested negative for the mecA gene and a preliminary investigation of the extent to which such strains are present in bovine and human populations. Isolates of bovine MRSA were obtained from the Veterinary Laboratories Agency in the UK, and isolates of human MRSA were obtained from diagnostic or reference laboratories (two in the UK and one in Denmark). From these collections, we searched for mecA PCR-negative bovine and human S aureus isolates showing phenotypic meticillin resistance. We used whole-genome sequencing to establish the genetic basis for the observed antibiotic resistance. A divergent mecA homologue (mecA(LGA251)) was discovered in the LGA251 genome located in a novel staphylococcal cassette chromosome mec element, designated type-XI SCCmec. The mecA(LGA251) was 70% identical to S aureus mecA homologues and was initially detected in 15 S aureus isolates from dairy cattle in England. These isolates were from three different multilocus sequence type lineages (CC130, CC705, and ST425); spa type t843 (associated with CC130) was identified in 60% of bovine isolates. When human mecA-negative MRSA isolates were tested, the mecA(LGA251) homologue was identified in 12 of 16 isolates from Scotland, 15 of 26 from England, and 24 of 32 from Denmark. As in cows, t843 was the most common spa type detected in human beings. Although routine culture and antimicrobial susceptibility testing will identify S aureus isolates with this novel mecA homologue as meticillin resistant, present confirmatory methods will not identify them as MRSA. New diagnostic guidelines for the detection of MRSA should consider the inclusion of tests for mecA(LGA251). Department for Environment, Food and Rural Affairs

  20. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  1. Cloning of the cDNA for a human homologue of the Drosophila white gene and mapping to chromosome 21q22.3.

    OpenAIRE

    Chen, H.; Rossier, C.; Lalioti, M. D.; Lynn, A.; Chakravarti, A.; Perrin, G.; Antonarakis, S. E.

    1996-01-01

    In an effort to contribute to the transcript map of human chromosome 21 and the understanding of the pathophysiology of trisomy 21, we have used exon trapping to identify fragments of chromosome 21 genes. Two trapped exons, from pools of chromosome 21-specific cosmids, showed homology to the Drosophila white (w) gene. We subsequently cloned the corresponding cDNA for a human homologue of the Drosophila w gene (hW) from human retina and fetal brain cDNA libraries. The gene belongs to the ATP-b...

  2. Expression of cinnamyl alcohol dehydrogenases and their putative homologues during Arabidopsis thaliana growth and development: lessons for database annotations?

    Science.gov (United States)

    Kim, Sung-Jin; Kim, Kye-Won; Cho, Man-Ho; Franceschi, Vincent R; Davin, Laurence B; Lewis, Norman G

    2007-07-01

    A major goal currently in Arabidopsis research is determination of the (biochemical) function of each of its approximately 27,000 genes. To date, however, 12% of its genes actually have known biochemical roles. In this study, we considered it instructive to identify the gene expression patterns of nine (so-called AtCAD1-9) of 17 genes originally annotated by The Arabidopsis Information Resource (TAIR) as cinnamyl alcohol dehydrogenase (CAD, EC 1.1.1.195) homologues [see Costa, M.A., Collins, R.E., Anterola, A.M., Cochrane, F.C., Davin, L.B., Lewis N.G., 2003. An in silico assessment of gene function and organization of the phenylpropanoid pathway metabolic networks in Arabidopsis thaliana and limitations thereof. Phytochemistry 64, 1097-1112.]. In agreement with our biochemical studies in vitro [Kim, S.-J., Kim, M.-R., Bedgar, D.L., Moinuddin, S.G.A., Cardenas, C.L., Davin, L.B., Kang, C.-H., Lewis, N.G., 2004. Functional reclassification of the putative cinnamyl alcohol dehydrogenase multigene family in Arabidopsis. Proc. Natl. Acad. Sci. USA 101, 1455-1460.], and analysis of a double mutant [Sibout, R., Eudes, A., Mouille, G., Pollet, B., Lapierre, C., Jouanin, L., Séguin A., 2005. Cinnamyl Alcohol Dehydrogenase-C and -D are the primary genes involved in lignin biosynthesis in the floral stem of Arabidopsis. Plant Cell 17, 2059-2076.], both AtCAD5 (At4g34230) and AtCAD4 (At3g19450) were found to have expression patterns consistent with development/formation of different forms of the lignified vascular apparatus, e.g. lignifying stem tissues, bases of trichomes, hydathodes, abscission zones of siliques, etc. Expression was also observed in various non-lignifying zones (e.g. root caps) indicative of, perhaps, a role in plant defense. In addition, expression patterns of the four CAD-like homologues were investigated, i.e. AtCAD2 (At2g21730), AtCAD3 (At2g21890), AtCAD7 (At4g37980) and AtCAD8 (At4g37990), each of which previously had been demonstrated to have low CAD

  3. Molecular evolution of a chordate specific family of G protein-coupled receptors

    Directory of Open Access Journals (Sweden)

    Leese Florian

    2011-08-01

    Full Text Available Abstract Background Chordate evolution is a history of innovations that is marked by physical and behavioral specializations, which led to the development of a variety of forms from a single ancestral group. Among other important characteristics, vertebrates obtained a well developed brain, anterior sensory structures, a closed circulatory system and gills or lungs as blood oxygenation systems. The duplication of pre-existing genes had profound evolutionary implications for the developmental complexity in vertebrates, since mutations modifying the function of a duplicated protein can lead to novel functions, improving the evolutionary success. Results We analyzed here the evolution of the GPRC5 family of G protein-coupled receptors by comprehensive similarity searches and found that the receptors are only present in chordates and that the size of the receptor family expanded, likely due to genome duplication events in the early history of vertebrate evolution. We propose that a single GPRC5 receptor coding gene originated in a stem chordate ancestor and gave rise by duplication events to a gene family comprising three receptor types (GPRC5A-C in vertebrates, and a fourth homologue present only in mammals (GPRC5D. Additional duplications of GPRC5B and GPRC5C sequences occurred in teleost fishes. The finding that the expression patterns of the receptors are evolutionarily conserved indicates an important biological function of these receptors. Moreover, we found that expression of GPRC5B is regulated by vitamin A in vivo, confirming previous findings that linked receptor expression to retinoic acid levels in tumor cell lines and strengthening the link between the receptor expression and the development of a complex nervous system in chordates, known to be dependent on retinoic acid signaling. Conclusions GPRC5 receptors, a class of G protein-coupled receptors with unique sequence characteristics, may represent a molecular novelty that helped non

  4. Genetic and physical mapping of homologues of the virus resistance gene Rx1 and the cyst nematode resistance gene Gpa2 in potato.

    Science.gov (United States)

    Bakker, E; Butterbach, P; Rouppe van der Voort, J; van der Vossen, E; van Vliet, J; Bakker, J; Goverse, A

    2003-05-01

    Nine resistance gene homologues (RGHs) were identified in two diploid potato clones (SH and RH), with a specific primer pair based on conserved motifs in the LRR domain of the potato cyst nematode resistance gene Gpa2 and the potato virus X resistance gene Rx1. A modified AFLP method was used to facilitate the genetic mapping of the RGHs in the four haplotypes under investigation. All nine RGHs appeared to be located in the Gpa2/ Rx1 cluster on chromosome XII. Construction of a physical map using bacterial artificial chromosome (BAC) clones for both the Solanum tuberosum ssp. tuberosum and the S. tuberosum ssp. andigena haplotype of SH showed that the RGHs are located within a stretch of less than 200 kb. Sequence analysis of the RGHs revealed that they are highly similar (93 to 95%) to Gpa2 and Rx1. The sequence identities among all RGHs range from 85 to 100%. Two pairs of RGHs are identical, or nearly so (100 and 99.9%), with each member located in a different genotype. Southern-blot analysis on genomic DNA revealed no evidence for additional homologues outside the Gpa2/ Rx1 cluster on chromosome XII.

  5. Phospholipase C δ-type consists of three isozymes: bovine PLCδ2 is a homologue of human/mouse PLCδ4

    International Nuclear Information System (INIS)

    Irino, Yasuhiro; Cho, Hiroyuki; Nakamura, Yoshikazu; Nakahara, Masamichi; Furutani, Masahiro; Suh, Pann-Ghill; Takenawa, Tadaomi; Fukami, Kiyoko

    2004-01-01

    To date, 12 phospholipase C (PLC) isozymes have been identified in mammals, and they are divided into five classes, β-, γ-, δ-, ε-, and ζ-type. PLCδ-type is reported to be composed of four isozymes, PLCδ1-δ4. Here we report that a screening for mouse PLCδ2 from a BAC library with primers that amplify a specific region of bovine PLCδ2 resulted in isolation of one clone containing the mouse PLCδ4 gene. Furthermore, a database search revealed that there is only one gene corresponding to PLCδ2 and PLCδ4 in the mouse and human genomes, indicating that bovine PLCδ2 is a homologue of human and mouse PLCδ4. However, PLCδ2 Western blot analysis with a widely used commercial anti-PLCδ2 antibody showed an expression pattern distinct from that of PLCδ4 in wild-type mice. In addition, an 80-kDa band, which was recognized by antibody against PLCδ2, was smaller than an 85-kDa band detected by anti-PLCδ4 antibody, and the 80-kDa band was detectable in lysates of brain, testis, and spleen from PLCδ4-deficient mice. We also found that immunoprecipitates from brain lysates with this PLCδ2 antibody contained no PLC activity. From these data, we conclude that bovine PLCδ2 is a homologue of human and mouse PLCδ4, and that three isozymes (δ1, δ3, and δ4) exist in the PLCδ family

  6. Identification and phylogeny of the tomato receptor-like proteins family

    Directory of Open Access Journals (Sweden)

    Ermis Yanes-Paz

    2017-03-01

    Full Text Available The receptor-like proteins (RLPs play multiple roles in development and defense. In the current work 75 RLPs were identified in tomato (Solanum lycopersicum L. using iterative BLAST searches and domain prediction. A phylogenetic tree including all the identified RLPs from tomato and some functionally characterized RLPs from other species was built to identify their putative homologues in tomato. We first tested whether C3-F-based phylogeny was a good indicator of functional relation between related proteins of different species. Indeed, the functionally characterized CLAVATA2 (CLV2, the maize ortholog FASCIATED EAR2 (FEA2 and a putative tomato CLV2 described in Uniprot clustered together, which validates the approach. Using this approach Solyc12g042760.1.1 was identified as the putative tomato homologue of TOO MANY MOUTHS (TMM. It was shown that proteins in the same cluster of the phylogenetic tree share functional relations since several clusters of functionally related proteins i.e. the Ve cluster, the Cf cluster, and the Eix clade were formed.   Keywords: phylogeny, receptors, RLP, tomato

  7. Functional characterization of viral tumor necrosis factor receptors encoded by cyprinid herpesvirus 3 (CyHV3) genome.

    Science.gov (United States)

    Yi, Yang; Qi, Hemei; Yuan, Jimin; Wang, Rui; Weng, Shaoping; He, Jianguo; Dong, Chuanfu

    2015-08-01

    Cyprinid herpesvirus 3 (CyHV3) is a large double-stranded DNA virus of Alloherpesviridae family in the order Herpesvirales. It causes significant morbidity and mortality in common carp and its ornamental koi variety, and threatens the aquaculture industries worldwide. Mimicry of cytokines and cytokine receptors is a particular strategy for large DNA viruses in modulating the host immune response. Here, we report the identification and characterization of two novel viral homologues of tumor necrosis factor receptor (TNFR) encoded by CyHV3-ORF4 and -ORF12, respectively. CyHV3-ORF4 was identified as a homologue of HVEM and CyHV3-ORF12 as a homologue of TNFRSF1. Overexpression of ORF4 and ORF12 in zebrafish embryos results in embryonic lethality, morphological defects and increased apoptosis. Although we failed to identify any interaction between the two vTNFRs and their potential ligands in zebrafish TNF superfamily by yeast two-hybrid system, the expression of some genes in TNF superfamily or TNFR superfamily were mis-regulated in ORF4 or ORF12-overexpressing embryos, especially the death receptor zHDR and its cognate ligand DL1b. Further studies showed that the apoptosis induced by the both CyHV3 vTNFRs is mainly activated through the intrinsic apoptotic pathway and requires the crosstalk between the intrinsic and extrinsic apoptotic pathway. Additionally, using RT-qPCR and Western blot assays, the expression patterns of the both vTNFRs were also analyzed during CyHV3 productive infection. Collectively, this is the first functional study of two unique vTNFRs encoded by a herpesvirus infecting non-mammalian vertebrates, which may provide novel insights into viral immune regulation mechanism and the pathogenesis of CyHV3 infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Assembly of Oligomeric Death Domain Complexes during Toll Receptor Signaling*

    Science.gov (United States)

    Moncrieffe, Martin C.; Grossmann, J. Günter; Gay, Nicholas J.

    2008-01-01

    The Drosophila Toll receptor is activated by the endogenous protein ligand Spätzle in response to microbial stimuli in immunity and spatial cues during embryonic development. Downstream signaling is mediated by the adaptor proteins Tube, the kinase Pelle, and the Drosophila homologue of myeloid differentiation primary response protein (dMyD88). Here we have characterized heterodimeric (dMyD88-Tube) and heterotrimeric (dMyD88-Tube-Pelle) death domain complexes. We show that both the heterodimeric and heterotrimeric complexes form kidney-shaped structures and that Tube is bivalent and has separate high affinity binding sites for dMyD88 and Pelle. Additionally we found no interaction between the isolated death domains of Pelle and dMyD88. These results indicate that the mode of assembly of the heterotrimeric dMyD88-Tube-Pelle complex downstream of the activated Toll receptor is unique. The measured dissociation constants for the interaction between the death domains of dMyD88 and Tube and of Pelle and a preformed dMyD88-Tube complex are used to propose a model of the early postreceptor events in Drosophila Toll receptor signaling. PMID:18829464

  9. Assembly of oligomeric death domain complexes during Toll receptor signaling.

    Science.gov (United States)

    Moncrieffe, Martin C; Grossmann, J Günter; Gay, Nicholas J

    2008-11-28

    The Drosophila Toll receptor is activated by the endogenous protein ligand Spätzle in response to microbial stimuli in immunity and spatial cues during embryonic development. Downstream signaling is mediated by the adaptor proteins Tube, the kinase Pelle, and the Drosophila homologue of myeloid differentiation primary response protein (dMyD88). Here we have characterized heterodimeric (dMyD88-Tube) and heterotrimeric (dMyD88-Tube-Pelle) death domain complexes. We show that both the heterodimeric and heterotrimeric complexes form kidney-shaped structures and that Tube is bivalent and has separate high affinity binding sites for dMyD88 and Pelle. Additionally we found no interaction between the isolated death domains of Pelle and dMyD88. These results indicate that the mode of assembly of the heterotrimeric dMyD88-Tube-Pelle complex downstream of the activated Toll receptor is unique. The measured dissociation constants for the interaction between the death domains of dMyD88 and Tube and of Pelle and a preformed dMyD88-Tube complex are used to propose a model of the early postreceptor events in Drosophila Toll receptor signaling.

  10. The LDL receptor.

    Science.gov (United States)

    Goldstein, Joseph L; Brown, Michael S

    2009-04-01

    In this article, the history of the LDL receptor is recounted by its codiscoverers. Their early work on the LDL receptor explained a genetic cause of heart attacks and led to new ways of thinking about cholesterol metabolism. The LDL receptor discovery also introduced three general concepts to cell biology: receptor-mediated endocytosis, receptor recycling, and feedback regulation of receptors. The latter concept provides the mechanism by which statins selectively lower plasma LDL, reducing heart attacks and prolonging life.

  11. Selective antagonists at group I metabotropic glutamate receptors: synthesis and molecular pharmacology of 4-aryl-3-isoxazolol amino acids

    DEFF Research Database (Denmark)

    Kromann, Hasse; Sløk, Frank A; Stensbøl, Tine B

    2002-01-01

    Homologation of (S)-glutamic acid (Glu, 1) and Glu analogues has previously provided ligands with activity at metabotropic Glu receptors (mGluRs). The homologue of ibotenic acid (7), 2-amino-3-(3-hydroxy-5-isoxazolyl)propionic acid (HIBO, 8), and the 4-phenyl derivative of 8, compound 9a, are bot...... antagonists at group I mGluRs. Here we report the synthesis and molecular pharmacology of HIBO analogues 9b-h containing different 4-aryl substituents. All of these compounds possess antagonist activity at group I mGluRs but are inactive at group II and III mGluRs....

  12. The multiligand α2-macroglobulin receptor/low density lipoprotein receptor-related protein

    DEFF Research Database (Denmark)

    Gliemann, Jørgen; Nykjær, Anders; Petersen, Claus Munck

    1994-01-01

    The fusion of separate lines of research has greatly helped in elucidating the function of the giant members of the low density lipoprotein (LDL) receptor (LDLR) supergene family. The cDNA encoding a large protein structurally closely related to LDLR, and hence named LDLR-related protein (LRP......), was cloned by Herz et al. in 1988.'Evidence was provided demonstrating that LRP can function as a receptor for chylomicron remnants@-migrating very low density lipoproteins (P-VLDL) rich in apolipoprotein E (apoE)?' The a2-macroglobulin (a2M) receptor (a2MR) was purified from rat livep and human p l a~e n t...... from the observation that affinity-purified a2MR/LRP contains a 40-kDa5.8 or 39-kDa6.' protein, designated a2MRAP, in addition to the a2MFULRP a- and P-chains. cDNA cloning" disclosed the 323-residue protein as both the human homologue of mouse heparin binding protein 44 (see reference 11) and...

  13. Feeding and the rhodopsin family G-Protein Coupled Receptors (GPCRs in nematodes and arthropods

    Directory of Open Access Journals (Sweden)

    Joao Carlos dos Reis Cardoso

    2012-12-01

    Full Text Available In vertebrates, receptors of the rhodopsin G-protein coupled superfamily (GPCRs play an important role in the regulation of feeding and energy homeostasis and are activated by peptide hormones produced in the brain-gut axis. These peptides regulate appetite and energy expenditure by promoting or inhibiting food intake. Sequence and function homologues of human GPCRs involved in feeding exist in the nematode roundworm, Caenorhabditis elegans (C. elegans and the arthropod fruit fly, Drosophila melanogaster (D. melanogaster, suggesting that the mechanisms that regulate food intake emerged early and have been conserved during metazoan radiation. Nematodes and arthropods are the most diverse and successful animal phyla on Earth. They can survive in a vast diversity of environments and have acquired distinct life styles and feeding strategies. The aim of the present review is to investigate if this diversity has affected the evolution of invertebrate GPCRs. Homologues of the C. elegans and D. melanogaster rhodopsin receptors were characterized in the genome of other nematodes and arthropods and receptor evolution compared. With the exception of bombesin receptors (BBR that are absent from nematodes, a similar gene complement was found. In arthropods, rhodopsin GPCR evolution is characterized by species-specific gene duplications and deletions and in nematodes by gene expansions in species with a free-living stage and gene deletions in representatives of obligate parasitic taxa. Based upon variation in GPCR gene number and potentially divergent functions within phyla we hypothesize that life style and feeding diversity practiced by nematodes and arthropods was one factor that contributed to rhodopsin GPCR gene evolution. Understanding how the regulation of food intake has evolved in invertebrates will contribute to the development of novel drugs to control nematodes and arthropods and the pests and diseases that use them as vectors.

  14. Interactions of an Arabidopsis RanBPM homologue with LisH-CTLH domain proteins revealed high conservation of CTLH complexes in eukaryotes

    Czech Academy of Sciences Publication Activity Database

    Tomaštíková, Eva; Cenklová, Věra; Kohoutová, Lucie; Petrovská, Beáta; Váchová, Lenka; Halada, Petr; Kočárová, Gabriela; Binarová, Pavla

    2012-01-01

    Roč. 12, č. 83 (2012) ISSN 1471-2229 R&D Projects: GA ČR(CZ) GA204/07/1169; GA ČR GP204/09/P155; GA ČR GAP501/12/2333; GA MŠk(CZ) LC06034; GA MŠk LC545; GA AV ČR IAA500200719 Grant - others:GA MŠk(CZ) ED0007/01/01 Program:ED Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50200510 Keywords : Arabidopsis homologue of RanBPM * CTLH-complex * LisH-CTLH domain proteins Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.354, year: 2012

  15. A density functional theory study of magneto-electric Jones birefringence of noble gases, furan homologues, and mono-substituted benzenes

    International Nuclear Information System (INIS)

    Fahleson, Tobias; Norman, Patrick; Coriani, Sonia; Rizzo, Antonio; Rikken, Geert L. J. A.

    2013-01-01

    We report on the results of a systematic ab initio study of the Jones birefringence of noble gases, of furan homologues, and of monosubstituted benzenes, in the gas phase, with the aim of analyzing the behavior and the trends within a list of systems of varying size and complexity, and of identifying candidates for a combined experimental/theoretical study of the effect. We resort here to analytic linear and nonlinear response functions in the framework of time-dependent density functional theory. A correlation is made between the observable (the Jones constant) and the atomic radius for noble gases, or the permanent electric dipole and a structure/chemical reactivity descriptor as the para Hammett constant for substituted benzenes

  16. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    Energy Technology Data Exchange (ETDEWEB)

    Tsukamoto, Yuta; Katayama, Chisako [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Shinohara, Miki; Shinohara, Akira [Institute for Protein Research, Osaka University, 3-2 Yamadaoka, Suita, Osaka 565-0871 (Japan); Maekawa, Shohei [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Miyamoto, Masaaki, E-mail: miya@kobe-u.ac.jp [Graduate School of Science, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan); Center for Supports to Research and Education Activities, Kobe University, 1-1 Rokkodai-cho Nada, Kobe 657-8501 (Japan)

    2013-11-29

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions.

  17. The small GTPase Rab5 homologue Ypt5 regulates cell morphology, sexual development, ion-stress response and vacuolar formation in fission yeast

    International Nuclear Information System (INIS)

    Tsukamoto, Yuta; Katayama, Chisako; Shinohara, Miki; Shinohara, Akira; Maekawa, Shohei; Miyamoto, Masaaki

    2013-01-01

    Highlights: •Multiple functions of Rab5 GTPase in fission yeast were found. •Roles of Rab5 in fission yeast were discussed. •Relation between Rab5 and actin cytoskeleton were discussed. -- Abstract: Inner-membrane transport is critical to cell function. Rab family GTPases play an important role in vesicle transport. In mammalian cells, Rab5 is reported to be involved in the regulation of endosome formation, phagocytosis and chromosome alignment. Here, we examined the role of the fission yeast Rab5 homologue Ypt5 using a point mutant allele. Mutant cells displayed abnormal cell morphology, mating, sporulation, endocytosis, vacuole fusion and responses to ion stress. Our data strongly suggest that fission yeast Rab5 is involved in the regulation of various types of cellular functions

  18. The Orf virus E3L homologue is able to complement deletion of the vaccinia virus E3L gene in vitro but not in vivo

    International Nuclear Information System (INIS)

    Vijaysri, Sangeetha; Talasela, Latha; Mercer, Andrew A.; Mcinnes, Colin J.; Jacobs, Bertram L.; Langland, Jeffrey O.

    2003-01-01

    Orf virus (OV), the prototypic parapoxvirus, is resistant to the effects of interferon (IFN) and this function of OV has been mapped to the OV20.0L gene. The protein product of this gene shares 31% amino acid identity to the E3L-encoded protein of vaccinia virus (VV) that is required for the broad host range and IFN-resistant phenotype of VV in cells in culture and for virulence of the virus in vivo. In this study we investigated whether the distantly related OV E3L homologue could complement the deletion of E3L in VV. The recombinant VV (VV/ORF-E3L) expressing the OV E3L homologue in place of VV E3L was indistinguishable from wt VV in its cell-culture phenotype. But VV/ORF-E3L was over a 1000-fold less pathogenic than wt VV (LD 50 > 5 x 10 6 PFU, compared to LD 50 of wtVV = 4 x 10 3 PFU) following intranasal infection of mice. While wt VV spread to the lungs and brain and replicated to high titers in the brain of infected mice, VV/ORF-E3L could not be detected in the lungs or brain following intranasal infection. VV/ORF-E3L was at least 100,000-fold less pathogenic than wt VV on intracranial injection. Domain swap experiments demonstrate that the difference in pathogenesis maps to the C-terminal domain of these proteins. This domain has been shown to be required for the dsRNA binding function of the VV E3L

  19. The Ca{sup 2+} channel TRPML3 specifically interacts with the mammalian ATG8 homologue GATE16 to regulate autophagy

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Suzy; Kim, Hyun Jin, E-mail: kimhyunjin@skku.edu

    2014-01-03

    Highlights: •Split-ubiquitin MY2H screen identified GATE16 as an interacting protein of TRPML3. •TRPML3 specifically binds to a mammalian ATG8 homologue GATE16, not to LC3B. •The interaction of TRPML3 with GATE16 facilitates autophagosome formation. •GATE16 is expressed in both autophagosome and extra-autophagosomal compartments. -- Abstract: TRPML3 is a Ca{sup 2+} permeable cation channel expressed in multiple intracellular compartments. Although TRPML3 is implicated in autophagy, how TRPML3 can regulate autophagy is not understood. To search interacting proteins with TRPML3 in autophagy, we performed split-ubiquitin membrane yeast two-hybrid (MY2H) screening with TRPML3-loop as a bait and identified GATE16, a mammalian ATG8 homologue. GST pull-down assay revealed that TRPML3 and TRPML3-loop specifically bind to GATE16, not to LC3B. Co-immunoprecipitation (co-IP) experiments showed that TRPML3 and TRPML3-loop pull down only the lipidated form of GATE16, indicating that the interaction occurs exclusively at the organellar membrane. The interaction of TRPML3 with GATE16 and GATE16-positive vesicle formation were increased in starvation induced autophagy, suggesting that the interaction facilitates the function of GATE16 in autophagosome formation. However, GATE16 was not required for TRPML3 trafficking to autophagosomes. Experiments using dominant-negative (DN) TRPML3(D458K) showed that GATE16 is localized not only in autophagosomes but also in extra-autophagosomal compartments, by contrast with LC3B. Since GATE16 acts at a later stage of the autophagosome biogenesis, our results suggest that TRPML3 plays a role in autophagosome maturation through the interaction with GATE16, by providing Ca{sup 2+} in the fusion process.

  20. In vivo metabolism of the methyl homologues of delta-8-tetrahydrocannabinol, delta-9-tetrahydrocannabinol and abn-delta-8-tetrahydrocannabinol in the mouse.

    Science.gov (United States)

    Brown, N K; Harvey, D J

    1988-04-01

    Methyl-delta-8-tetrahydrocannabinol (methyl-delta-8-THC), methyl-delta-9-THC and abn-methyl-delta-8-THC were synthesized by condensation of orcinol and (1S)-cis-verbenol and were administered to male Charles River CD-1 mice. Extracted hepatic metabolites were isolated by chromatography on Sephadex LH-20 and examined by gas chromatography/mass spectrometry as trimethylsilyl (TMS), (2H9)TMS and methyl ester/TMS derivatives. In addition, metabolic fractions were reduced with lithium aluminium deuteride to convert carboxylic acids to alcohols for structural correlation. Metabolites from methyl-delta-8-THC were similar with respect to the positions substituted to those produced by higher homologues; the major metabolite was methyl-delta-8-THC-11-oic acid. abn-Methyl-delta-8-THC was metabolized in a different manner. The location of the aromatic methyl group at the position adjacent to ring fusion appeared to inhibit metabolism at C(11) to a considerable extent and also to reduce the amount of the resulting alcohol from being oxidized to a carboxylic acid. This caused other metabolic pathways to become dominant, with the result that a compound containing a hydroxy group at the gem-methyl position was the major metabolite. Hydroxylation at this position has not been confirmed with any other cannabinoid, although it is thought to result in trace concentrations of hydroxy metabolites from some compounds. Metabolism of methyl-delta-9-THC was also similar to that of the higher homologues, with the exception that less metabolism occurred at C(8) and a higher percentage of the total metabolic fraction was accounted for by the 11-oic acid metabolite. Minor metabolites were mainly dihydroxy compounds and hydroxylated derivatives of delta-9-THC-11-oic acid.

  1. Drosophila homologues of adenomatous polyposis coli (APC) and the formin diaphanous collaborate by a conserved mechanism to stimulate actin filament assembly.

    Science.gov (United States)

    Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M

    2013-05-10

    Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad

  2. A gonococcal homologue of meningococcal γ-glutamyl transpeptidase gene is a new type of bacterial pseudogene that is transcriptionally active but phenotypically silent

    Directory of Open Access Journals (Sweden)

    Watanabe Haruo

    2005-10-01

    Full Text Available Abstract Background It has been speculated that the γ-glutamyl transpeptidase (ggt gene is present only in Neisseria meningitidis and not among related species such as Neisseria gonorrhoeae and Neisseria lactamica, because N. meningitidis is the only bacterium with GGT activity. However, nucleotide sequences highly homologous to the meningococcal ggt gene were found in the genomes of N. gonorrhoeae isolates. Results The gonococcal homologue (ggt gonococcal homologue; ggh was analyzed. The nucleotide sequence of the ggh gene was approximately 95 % identical to that of the meningococcal ggt gene. An open reading frame in the ggh gene was disrupted by an ochre mutation and frameshift mutations induced by a 7-base deletion, but the amino acid sequences deduced from the artificially corrected ggh nucleotide sequences were approximately 97 % identical to that of the meningococcal ggt gene. The analyses of the sequences flanking the ggt and ggh genes revealed that both genes were localized in a common DNA region containing the fbp-ggt (or ggh-glyA-opcA-dedA-abcZ gene cluster. The expression of the ggh RNA could be detected by dot blot, RT-PCR and primer extension analyses. Moreover, the truncated form of ggh-translational product was also found in some of the gonococcal isolates. Conclusion This study has shown that the gonococcal ggh gene is a pseudogene of the meningococcal ggt gene, which can also be designated as Ψggt. The gonococcal ggh (Ψggt gene is the first identified bacterial pseudogene that is transcriptionally active but phenotypically silent.

  3. acn-1, a C. elegans homologue of ACE, genetically interacts with the let-7 microRNA and other heterochronic genes.

    Science.gov (United States)

    Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J

    2017-10-02

    The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.

  4. Initial characterization of a bolA homologue from Pseudomonas fluorescens indicates different roles for BolA-like proteins in P. fluorescens and Escherichia coli

    DEFF Research Database (Denmark)

    Koch, Birgit; Nybroe, Ole

    2006-01-01

    A expression. The mutant grew slower than the wild-type strain in minimal medium with L-serine as the sole nitrogen source, while growth rates were similar on a mixture of L-serine and L-cysteine. Reverse transcriptase polymerase chain reaction analysis indicated that the bolA homologue is the second gene...

  5. Negative Regulation of Receptor Tyrosine Kinase (RTK Signaling: A Developing Field

    Directory of Open Access Journals (Sweden)

    Fernanda Ledda

    2007-01-01

    Full Text Available ophic factors control cellular physiology by activating specific receptor tyrosine kinases (RTKs. While the over activation of RTK signaling pathways is associated with cell growth and cancer, recent findings support the concept that impaired down-regulation or deactivation of RTKs may also be a mechanism involved in tumor formation. Under this perspective, the molecular determinants of RTK signaling inhibition may act as tumor-suppressor genes and have a potential role as tumor markers to monitor and predict disease progression. Here, we review the current understanding of the physiological mechanisms that attenuate RTK signaling and discuss evidence that implicates deregulation of these events in cancer.Abbreviations: BDP1: Brain-derived phosphatase 1; Cbl: Casitas B-lineage lymphoma; CIN-85: Cbl-interacting protein of 85 kDa; DER: Drosophila EGFR; EGFR: Epidermal growth factor receptor; ERK 1/2: Extracellular signal-regulated kinase 1/2; Grb2: Growth factor receptor-bound protein 2; HER2: Human epidermal growth factor receptor 2; LRIG: Leucine-rich repeats and immunoglobulin-like domain 1; MAPK: Mitogen-activated protein kinase; Mig 6: Mitogen-inducible gene 6; PTEN: Phosphatase and tensin homologue; RET: Rearranged in transformation; RTK: Receptor tyrosine kinase. SH2 domain: Src-homology 2 domain; SH3 domain: Src-homology 3 domain; Spry: Sprouty.

  6. Receptor-receptor interactions within receptor mosaics. Impact on neuropsychopharmacology.

    Science.gov (United States)

    Fuxe, K; Marcellino, D; Rivera, A; Diaz-Cabiale, Z; Filip, M; Gago, B; Roberts, D C S; Langel, U; Genedani, S; Ferraro, L; de la Calle, A; Narvaez, J; Tanganelli, S; Woods, A; Agnati, L F

    2008-08-01

    Future therapies for diseases associated with altered dopaminergic signaling, including Parkinson's disease, schizophrenia and drug addiction or drug dependence may substantially build on the existence of intramembrane receptor-receptor interactions within dopamine receptor containing receptor mosaics (RM; dimeric or high-order receptor oligomers) where it is believed that the dopamine D(2) receptor may operate as the 'hub receptor' within these complexes. The constitutive adenosine A(2A)/dopamine D(2) RM, located in the dorsal striato-pallidal GABA neurons, are of particular interest in view of the demonstrated antagonistic A(2A)/D(2) interaction within these heteromers; an interaction that led to the suggestion and later demonstration that A(2A) antagonists could be used as novel anti-Parkinsonian drugs. Based on the likely existence of A(2A)/D(2)/mGluR5 RM located both extrasynaptically on striato-pallidal GABA neurons and on cortico-striatal glutamate terminals, multiple receptor-receptor interactions within this RM involving synergism between A(2A)/mGluR5 to counteract D(2) signaling, has led to the proposal of using combined mGluR5 and A(2A) antagonists as a future anti-Parkinsonian treatment. Based on the same RM in the ventral striato-pallidal GABA pathways, novel strategies for the treatment of schizophrenia, building on the idea that A(2A) agonists and/or mGluR5 agonists will help reduce the increased dopaminergic signaling associated with this disease, have been suggested. Such treatment may ensure the proper glutamatergic drive from the mediodorsal thalamic nucleus to the prefrontal cortex, one which is believed to be reduced in schizophrenia due to a dominance of D(2)-like signaling in the ventral striatum. Recently, A(2A) receptors also have been shown to counteract the locomotor and sensitizing actions of cocaine and increases in A(2A) receptors have also been observed in the nucleus accumbens after extended cocaine self-administration, probably

  7. Isolation and characterization of CXC receptor genes in a range of elasmobranchs.

    Science.gov (United States)

    Goostrey, Anna; Jones, Gareth; Secombes, Christopher J

    2005-01-01

    The CXC group of chemokines exert their cellular effects via the CXCR group of G-protein coupled receptors. Six CXCR genes have been identified in humans (CXCR1-6), and homologues to some of these have been isolated from a range of vertebrate species. Here we isolate and characterize CXCR genes from a range of elasmobranch species. One CXCR1/2 gene fragment isolated from Scyliorhinus caniculus (lesser spotted catshark), and two CXCR1/2 copies from each of the elasmobranchs, Cetorhinus maximus (basking shark), Carcharodon carcharias (great white shark), and Raja naevus (cuckoo ray), exhibit high similarity to both CXCR1 and CXCR2. The two copies evident in the cuckoo ray and lamniform sharks provide strong evidence of CXCR1/2 lineage specific duplication in rays and sharks. A CXCR fragment isolated from Lamna ditropis (salmon shark) shows high similarity to a range of CXCR4 genes and strong clustering with CXCR4 gene homologues was apparent during phylogenetic reconstruction.

  8. Acetylcholine receptor antibody

    Science.gov (United States)

    ... medlineplus.gov/ency/article/003576.htm Acetylcholine receptor antibody To use the sharing features on this page, please enable JavaScript. Acetylcholine receptor antibody is a protein found in the blood of ...

  9. Cooperative ethylene receptor signaling

    OpenAIRE

    Liu, Qian; Wen, Chi-Kuang

    2012-01-01

    The gaseous plant hormone ethylene is perceived by a family of five ethylene receptor members in the dicotyledonous model plant Arabidopsis. Genetic and biochemical studies suggest that the ethylene response is suppressed by ethylene receptor complexes, but the biochemical nature of the receptor signal is unknown. Without appropriate biochemical measures to trace the ethylene receptor signal and quantify the signal strength, the biological significance of the modulation of ethylene responses ...

  10. Insertion of a specific fungal 3'-phosphoadenosine-5'-phosphatase motif into a plant homologue improves halotolerance and drought tolerance of plants.

    Science.gov (United States)

    Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana

    2013-01-01

    Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should

  11. A receptor tyrosine kinase, UFO/Axl, and other genes isolated by a modified differential display PCR are overexpressed in metastatic prostatic carcinoma cell line DU145.

    Science.gov (United States)

    Jacob, A N; Kalapurakal, J; Davidson, W R; Kandpal, G; Dunson, N; Prashar, Y; Kandpal, R P

    1999-01-01

    We have used a modified differential display PCR protocol for isolating 3' restriction fragments of cDNAs specifically expressed or overexpressed in metastatic prostate carcinoma cell line DU145. Several cDNA fragments were identified that matched to milk fat globule protein, UFO/Axl, a receptor tyrosine kinase, human homologue of a Xenopus maternal transcript, laminin and laminin receptor, human carcinoma-associated antigen, and some expressed sequence tags. The transcript for milk fat globule protein, a marker protein shown to be overexpressed in breast tumors, was elevated in DU145 cells. The expression of UFO/Axl, a receptor tyrosine kinase, was considerably higher in DU145 cells as compared to normal prostate cells and prostatic carcinoma cell line PC-3. The overexpression of UFO oncogene in DU145 cells is discussed in the context of prostate cancer metastasis.

  12. Quantitative autoradiography of muscarinic and benzodiazepine receptors in the forebrain of the turtle, Pseudemys scripta

    International Nuclear Information System (INIS)

    Schlegel, J.R.; Kriegstein, A.R.

    1987-01-01

    The distribution of muscarinic and benzodiazepine receptors was investigated in the turtle forebrain by the technique of in vitro receptor autoradiography. Muscarinic binding sites were labeled with 1 nM 3 H-quinuclidinyl benzilate ( 3 H-QNB), and benzodiazepine sites were demonstrated with the aid of 1 nM 3 H-flunitrazepam ( 3 H-FLU). Autoradiograms generated on 3 H-Ultrofilm apposed to tissue slices revealed regionally specific distributions of muscarinic and benzodiazepine binding sites that are comparable with those for mammalian brain. Dense benzodiazepine binding was found in the anterior olfactory nucleus, the lateral and dorsal cortices, and the dorsal ventricular ridge (DVR), a structure with no clear mammalian homologue. Muscarinic binding sites were most dense in the striatum, accumbens, DVR, lateral geniculate, and the anterior olfactory nucleus. Cortical binding sites were studied in greater detail by quantitative analysis of autoradiograms generated by using emulsion-coated coverslips. Laminar gradients of binding were observed that were specific for each radioligand; 3 H-QNB sites were most dense in the inner molecular layer in all cortical regions, whereas 3 H-FLU binding was generally most concentrated in the outer molecular layer and was least dense through all layers in the dorsomedial cortex. Because pyramidal cells are arranged in register in turtle cortex, the laminar patterns of receptor binding may reflect different receptor density gradients along pyramidal cell dendrites

  13. The systemin receptor SYR1 enhances resistance of tomato against herbivorous insects.

    Science.gov (United States)

    Wang, Lei; Einig, Elias; Almeida-Trapp, Marilia; Albert, Markus; Fliegmann, Judith; Mithöfer, Axel; Kalbacher, Hubert; Felix, Georg

    2018-03-01

    The discovery in tomato of systemin, the first plant peptide hormone 1,2 , was a fundamental change for the concept of plant hormones. Numerous other peptides have since been shown to play regulatory roles in many aspects of the plant life, including growth, development, fertilization and interactions with symbiotic organisms 3-6 . Systemin, an 18 amino acid peptide derived from a larger precursor protein 7 , was proposed to act as the spreading signal that triggers systemic defence responses observed in plants after wounding or attack by herbivores 1,7,8 . Further work culminated in the identification of a leucine-rich repeat receptor kinase (LRR-RK) as the systemin receptor 160 (SR160) 9,10 . SR160 is a tomato homologue of Brassinosteroid Insensitive 1 (BRI1), which mediates the regulation of growth and development in response to the steroid hormone brassinolide 11-13 . However, a role of SR160/BRI1 as systemin receptor could not be corroborated by others 14-16 . Here, we demonstrate that perception of systemin depends on a pair of distinct LRR-RKs termed SYR1 and SYR2. SYR1 acts as a genuine systemin receptor that binds systemin with high affinity and specificity. Further, we show that presence of SYR1, although not decisive for local and systemic wound responses, is important for defence against insect herbivory.

  14. Cloning of Interleukin-10 from African Clawed Frog (Xenopus tropicalis, with the Finding of IL-19/20 Homologue in the IL-10 Locus

    Directory of Open Access Journals (Sweden)

    Zhitao Qi

    2015-01-01

    Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.

  15. The CD11a partner in Sus scrofa lymphocyte function-associated antigen-1 (LFA-1: mRNA cloning, structure analysis and comparison with mammalian homologues

    Directory of Open Access Journals (Sweden)

    Thomas Anne VT

    2005-10-01

    Full Text Available Abstract Background Lymphocyte function-associated antigen-1 (LFA-1, CD11a/CD18, alphaLbeta2, the most abundant and widely expressed beta2-integrin, is required for many cellular adhesive interactions during the immune response. Many studies have shown that LFA-1 is centrally involved in the pathogenesis of several diseases caused by Repeats-in-toxin (RTX -producing bacteria. Results The porcine-LFA-1 CD11a (alpha subunit coding sequence was cloned, sequenced and compared with the available mammalian homologues in this study. Despite some focal differences, it shares all the main characteristics of these latter. Interestingly, as in sheep and humans, an allelic variant with a triplet insertion resulting in an additional Gln-744 was consistently identified, which suggests an allelic polymorphism that might be biologically relevant. Conclusion Together with the pig CD18-encoding cDNA, which has been available for a long time, the sequence data provided here will allow the successful expression of porcine CD11a, thus giving the first opportunity to express the Sus scrofa beta2-integrin LFA-1 in vitro as a tool to examine the specificities of inflammation in the porcine species.

  16. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development

    Directory of Open Access Journals (Sweden)

    Markéta Kostrouchová

    2017-06-01

    Full Text Available The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  17. The phocein homologue SmMOB3 is essential for vegetative cell fusion and sexual development in the filamentous ascomycete Sordaria macrospora.

    Science.gov (United States)

    Bernhards, Yasmine; Pöggeler, Stefanie

    2011-04-01

    Members of the striatin family and their highly conserved interacting protein phocein/Mob3 are key components in the regulation of cell differentiation in multicellular eukaryotes. The striatin homologue PRO11 of the filamentous ascomycete Sordaria macrospora has a crucial role in fruiting body development. Here, we functionally characterized the phocein/Mob3 orthologue SmMOB3 of S. macrospora. We isolated the gene and showed that both, pro11 and Smmob3 are expressed during early and late developmental stages. Deletion of Smmob3 resulted in a sexually sterile strain, similar to the previously characterized pro11 mutant. Fusion assays revealed that ∆Smmob3 was unable to undergo self-fusion and fusion with the pro11 strain. The essential function of the SmMOB3 N-terminus containing the conserved mob domain was demonstrated by complementation analysis of the sterile S. macrospora ∆Smmob3 strain. Downregulation of either pro11 in ∆Smmob3, or Smmob3 in pro11 mutants by means of RNA interference (RNAi) resulted in synthetic sexual defects, demonstrating for the first time the importance of a putative PRO11/SmMOB3 complex in fruiting body development.

  18. An Epichloë festucae homologue of MOB3, a component of the STRIPAK complex, is required for the establishment of a mutualistic symbiotic interaction with Lolium perenne

    Science.gov (United States)

    Green, Kimberly A.; Becker, Yvonne; Fitzsimons, Helen L.

    2016-01-01

    Summary In both Sordaria macrospora and Neurospora crassa, components of the conserved STRIPAK (striatin‐interacting phosphatase and kinase) complex regulate cell–cell fusion, hyphal network development and fruiting body formation. Interestingly, a number of Epichloë festucae genes that are required for hyphal cell–cell fusion, such as noxA, noxR, proA, mpkA and mkkA, are also required for the establishment of a mutualistic symbiotic interaction with Lolium perenne. To determine whether MobC, a homologue of the STRIPAK complex component MOB3 in S. macrospora and N. crassa, is required for E. festucae hyphal fusion and symbiosis, a mobC deletion strain was generated. The ΔmobC mutant showed reduced rates of hyphal cell–cell fusion, formed intrahyphal hyphae and exhibited enhanced conidiation. Plants infected with ΔmobC were severely stunted. Hyphae of ΔmobC showed a proliferative pattern of growth within the leaves of Lolium perenne with increased colonization of the intercellular spaces and vascular bundles. Although hyphae were still able to form expressoria, structures allowing the colonization of the leaf surface, the frequency of formation was significantly reduced. Collectively, these results show that the STRIPAK component MobC is required for the establishment of a mutualistic symbiotic association between E. festucae and L. perenne, and plays an accessory role in the regulation of hyphal cell–cell fusion and expressorium development in E. festucae. PMID:27277141

  19. MicroRNA-15a finetunes the level of Delta-like 1 homologue (DLK1) in proliferating 3T3-L1 preadipocytes

    DEFF Research Database (Denmark)

    Andersen, Ditte C; Jensen, Charlotte H; Schneider, Mikael

    2010-01-01

    Delta like 1 homologue (Dlk1) exists in both transmembrane and soluble molecular forms, and is implicated in cellular growth and plays multiple roles in development, tissue regeneration, and cancer. Thus, DLK1 levels are critical for cell function, and abnormal DLK1 expression can be lethal...... increases with cell density, and peaks at the same stage where membrane DLK1(M) and soluble DLK1(S) are found at maximum levels. Remarkably, miR-15a represses the amount of all Dlk1 variants at the mRNA level but also the level of DLK1(M) protein while it increases the amount of DLK1(S) supporting a direct...... while increasing cell numbers, scenarios that were completely rescued by addition of purified DLK1(S). Our data thus imply that miR-15a regulates cell size and proliferation by fine-tuning Dlk1 among others, and further emphasize miR-15a and DLK1 levels to play important roles in growth signaling...

  20. Induction of MAP Kinase Homologues during Growth and Morphogenetic Development of Karnal Bunt (Tilletia indica) under the Influence of Host Factor(s) from Wheat Spikes

    Science.gov (United States)

    Gupta, Atul K.; Seneviratne, J. M.; Joshi, G. K.; Kumar, Anil

    2012-01-01

    Signaling pathways that activate different mitogen-activated protein kinases (MAPKs) in response to certain environmental conditions, play important role in mating type switching (Fus3) and pathogenicity (Pmk1) in many fungi. In order to determine the roles of such regulatory genes in Tilletia indica, the causal pathogen of Karnal bunt (KB) of wheat, semi-quantitative and quantitative RT-PCR was carried out to isolate and determine the expression of MAP kinase homologues during fungal growth and development under in vitro culture. Maximum expression of TiFus3 and TiPmk1 genes were observed at 14th and 21st days of culture and decreased thereafter. To investigate whether the fungus alters the expression levels of same kinases upon interaction with plants, cultures were treated with 1% of host factors (extracted from S-2 stage of wheat spikes). Such treatment induced the expression of MAPks in time dependent manner compared to the absence of host factors. These results suggest that host factor(s) provide certain signal(s) which activate TiFus3 and TiPmk1 during morphogenetic development of T. indica. The results also provides a clue about the role of host factors in enhancing the disease potential due to induction of MAP kinases involved in fungal development and pathogenecity. PMID:22547988

  1. First report of a thioredoxin homologue in jellyfish: molecular cloning, expression and antioxidant activity of CcTrx1 from Cyanea capillata.

    Directory of Open Access Journals (Sweden)

    Zengliang Ruan

    Full Text Available Thioredoxins (Trx proteins are a family of small, highly-conserved and ubiquitous proteins that play significant roles in the resistance of oxidative damage. In this study, a homologue of Trx was identified from the cDNA library of tentacle of the jellyfish Cyanea capillata and named CcTrx1. The full-length cDNA of CcTrx1 was 479 bp with a 312 bp open reading frame encoding 104 amino acids. Bioinformatics analysis revealed that the putative CcTrx1 protein harbored the evolutionarily-conserved Trx active site 31CGPC34 and shared a high similarity with Trx1 proteins from other organisms analyzed, indicating that CcTrx1 is a new member of Trx1 sub-family. CcTrx1 mRNA was found to be constitutively expressed in tentacle, umbrella, oral arm and gonad, indicating a general role of CcTrx1 protein in various physiological processes. The recombinant CcTrx1 (rCcTrx1 protein was expressed in Escherichia coli BL21 (DE3, and then purified by affinity chromatography. The rCcTrx1 protein was demonstrated to possess the expected redox activity in enzymatic analysis and protection against oxidative damage of supercoiled DNA. These results indicate that CcTrx1 may function as an important antioxidant in C. capillata. To our knowledge, this is the first Trx protein characterized from jellyfish species.

  2. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen; Henderson, Sam W; Tester, Mark A.; Roy, Stuart J; Gilliham, Mathew

    2016-01-01

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  3. The nematode homologue of Mediator complex subunit 28, F28F8.5, is a critical regulator of C. elegans development.

    Science.gov (United States)

    Kostrouchová, Markéta; Kostrouch, David; Chughtai, Ahmed A; Kaššák, Filip; Novotný, Jan P; Kostrouchová, Veronika; Benda, Aleš; Krause, Michael W; Saudek, Vladimír; Kostrouchová, Marta; Kostrouch, Zdeněk

    2017-01-01

    The evolutionarily conserved Mediator complex is a critical player in regulating transcription. Comprised of approximately two dozen proteins, the Mediator integrates diverse regulatory signals through direct protein-protein interactions that, in turn, modulate the influence of Mediator on RNA Polymerase II activity. One Mediator subunit, MED28, is known to interact with cytoplasmic structural proteins, providing a potential direct link between cytoplasmic dynamics and the control of gene transcription. Although identified in many animals and plants, MED28 is not present in yeast; no bona fide MED28 has been described previously in Caenorhabditis elegans. Here, we identify bioinformatically F28F8.5, an uncharacterized predicted protein, as the nematode homologue of MED28. As in other Metazoa, F28F8.5 has dual nuclear and cytoplasmic localization and plays critical roles in the regulation of development. F28F8.5 is a vital gene and its null mutants have severely malformed gonads and do not reproduce. F28F8.5 interacts on the protein level with the Mediator subunits MDT-6 and MDT-30. Our results indicate that F28F8.5 is an orthologue of MED28 and suggest that the potential to link cytoplasmic and nuclear events is conserved between MED28 vertebrate and nematode orthologues.

  4. Drosophila homologue of Diaphanous 1 (DIAPH1) controls the metastatic potential of colon cancer cells by regulating microtubule-dependent adhesion.

    Science.gov (United States)

    Lin, Yuan-Na; Bhuwania, Ridhirama; Gromova, Kira; Failla, Antonio Virgilio; Lange, Tobias; Riecken, Kristoffer; Linder, Stefan; Kneussel, Matthias; Izbicki, Jakob R; Windhorst, Sabine

    2015-07-30

    Drosophila homologue of Diaphanous 1 (DIAPH1) regulates actin polymerization and microtubule (MT) stabilization upon stimulation with lysophosphatidic acid (LPA). Recently, we showed strongly reduced lung metastasis of DIAPH1-depleted colon cancer cells but we found accumulations of DIAPH1-depleted cells in bone marrow. Here, we analyzed possible organ- or tissue-specific metastasis of DIAPH1-depleted HCT-116 cells. Our data confirmed that depletion of DIAPH1 strongly inhibited lung metastasis and revealed that, in contrast to control cells, DIAPH1-depleted cells did not form metastases in further organs. Detailed mechanistic analysis on cells that were not stimulated with LPA to activate the cytoskeleton-modulating activity of DIAPH1, revealed that even under basal conditions DIAPH1 was essential for cellular adhesion to collagen. In non-stimulated cells DIAPH1 did not control actin dynamics but, interestingly, was essential for stabilization of microtubules (MTs). Additionally, DIAPH1 controlled directed vesicle trafficking and with this, local clustering of the adhesion protein integrin-β1 at the plasma membrane. Therefore, we conclude that under non-stimulating conditions DIAPH1 controls cellular adhesion by stabilizing MTs required for local clustering of integrin-β1 at the plasma membrane. Thus, blockade of DIAPH1-tubulin interaction may be a promising approach to inhibit one of the earliest steps in the metastatic cascade of colon cancer.

  5. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  6. Purification of the spliced leader ribonucleoprotein particle from Leptomonas collosoma revealed the existence of an Sm protein in trypanosomes. Cloning the SmE homologue.

    Science.gov (United States)

    Goncharov, I; Palfi, Z; Bindereif, A; Michaeli, S

    1999-04-30

    Trans-splicing in trypanosomes involves the addition of a common spliced leader (SL) sequence, which is derived from a small RNA, the SL RNA, to all mRNA precursors. The SL RNA is present in the cell in the form of a ribonucleoprotein, the SL RNP. Using conventional chromatography and affinity selection with 2'-O-methylated RNA oligonucleotides at high ionic strength, five proteins of 70, 16, 13, 12, and 8 kDa were co-selected with the SL RNA from Leptomonas collosoma, representing the SL RNP core particle. Under conditions of lower ionic strength, additional proteins of 28 and 20 kDa were revealed. On the basis of peptide sequences, the gene coding for a protein with a predicted molecular weight of 11.9 kDa was cloned and identified as homologue of the cis-spliceosomal SmE. The protein carries the Sm motifs 1 and 2 characteristic of Sm antigens that bind to all known cis-spliceosomal uridylic acid-rich small nuclear RNAs (U snRNAs), suggesting the existence of Sm proteins in trypanosomes. This finding is of special interest because trypanosome snRNPs are the only snRNPs examined to date that are not recognized by anti-Sm antibodies. Because of the early divergence of trypanosomes from the eukaryotic lineage, the trypanosome SmE protein represents one of the primordial Sm proteins in nature.

  7. SLAH1, a homologue of the slow type anion channel SLAC1, modulates shoot Cl − accumulation and salt tolerance in Arabidopsis thaliana

    KAUST Repository

    Qiu, Jiaen

    2016-06-23

    Salinity tolerance is correlated with shoot chloride (Cl–) exclusion in multiple crops, but the molecular mechanisms of long-distance Cl– transport are poorly defined. Here, we characterize the in planta role of AtSLAH1 (a homologue of the slow type anion channel-associated 1 (SLAC1)). This protein, localized to the plasma membrane of root stelar cells, has its expression reduced by salt or ABA, which are key predictions for a protein involved with loading Cl– into the root xylem. Artificial microRNA knockdown mutants of AtSLAH1 had significantly reduced shoot Cl− accumulation when grown under low Cl–, whereas shoot Cl– increased and the shoot nitrate/chloride ratio decreased following AtSLAH1 constitutive or stelar-specific overexpression when grown in high Cl–. In both sets of overexpression lines a significant reduction in shoot biomass over the null segregants was observed under high Cl– supply, but not low Cl– supply. Further in planta data showed AtSLAH3 overexpression increased the shoot nitrate/chloride ratio, consistent with AtSLAH3 favouring nitrate transport. Heterologous expression of AtSLAH1 in Xenopus laevis oocytes led to no detectible transport, suggesting the need for post-translational modifications for AtSLAH1 to be active. Our in planta data are consistent with AtSLAH1 having a role in controlling root-to-shoot Cl– transport.

  8. Rasputin, the Drosophila homologue of the RasGAP SH3 binding protein, functions in ras- and Rho-mediated signaling.

    Science.gov (United States)

    Pazman, C; Mayes, C A; Fanto, M; Haynes, S R; Mlodzik, M

    2000-04-01

    The small GTPase Ras plays an important role in many cellular signaling processes. Ras activity is negatively regulated by GTPase activating proteins (GAPs). It has been proposed that RasGAP may also function as an effector of Ras activity. We have identified and characterized the Drosophila homologue of the RasGAP-binding protein G3BP encoded by rasputin (rin). rin mutants are viable and display defects in photoreceptor recruitment and ommatidial polarity in the eye. Mutations in rin/G3BP genetically interact with components of the Ras signaling pathway that function at the level of Ras and above, but not with Raf/MAPK pathway components. These interactions suggest that Rin is required as an effector in Ras signaling during eye development, supporting an effector role for RasGAP. The ommatidial polarity phenotypes of rin are similar to those of RhoA and the polarity genes, e.g. fz and dsh. Although rin/G3BP interacts genetically with RhoA, affecting both photoreceptor differentiation and polarity, it does not interact with the gain-of-function genotypes of fz and dsh. These data suggest that Rin is not a general component of polarity generation, but serves a function specific to Ras and RhoA signaling pathways.

  9. Identification of the Mycobacterium marinum Apa antigen O-mannosylation sites reveals important glycosylation variability with the M. tuberculosis Apa homologue.

    Science.gov (United States)

    Coddeville, Bernadette; Wu, Sz-Wei; Fabre, Emeline; Brassart, Colette; Rombouts, Yoann; Burguière, Adeline; Kremer, Laurent; Khoo, Kay-Hooi; Elass-Rochard, Elisabeth; Guérardel, Yann

    2012-10-22

    The 45/47 kDa Apa, an immuno-dominant antigen secreted by Mycobacterium tuberculosis is O-mannosylated at multiple sites. Glycosylation of Apa plays a key role in colonization and invasion of the host cells by M. tuberculosis through interactions of Apa with the host immune system C-type lectins. Mycobacterium marinum (M.ma) a fish pathogen, phylogenetically close to M. tuberculosis, induces a granulomatous response with features similar to those described for M. tuberculosis in human. Although M.ma possesses an Apa homologue, its glycosylation status is unknown, and whether this represents a crucial element in the pathophysiology induced by M.ma remains to be addressed. To this aim, we have identified two concanavalin A-reactive 45/47 kDa proteins from M.ma, which have been further purified by a two-step anion exchange chromatography process. Advanced liquid chromatography-nanoESI mass spectrometry-based proteomic analyses of peptides, derived from either tryptic digestion alone or in combination with the Asp-N endoproteinase, established that M.ma Apa possesses up to seven distinct O-mannosylated sites with mainly single mannose substitutions, which can be further extended at the Ser/Thr/Pro rich region near the N-terminus. This opens the way to further studies focussing on the involvement and biological functions of Apa O-mannosylation using the M.ma/zebrafish model. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Co-precipitation of phosphate and iron limits mitochondrial phosphate availability in Saccharomyces cerevisiae lacking the yeast frataxin homologue (YFH1).

    Science.gov (United States)

    Seguin, Alexandra; Santos, Renata; Pain, Debkumar; Dancis, Andrew; Camadro, Jean-Michel; Lesuisse, Emmanuel

    2011-02-25

    Saccharomyces cerevisiae cells lacking the yeast frataxin homologue (Δyfh1) accumulate iron in the mitochondria in the form of nanoparticles of ferric phosphate. The phosphate content of Δyfh1 mitochondria was higher than that of wild-type mitochondria, but the proportion of mitochondrial phosphate that was soluble was much lower in Δyfh1 cells. The rates of phosphate and iron uptake in vitro by isolated mitochondria were higher for Δyfh1 than wild-type mitochondria, and a significant proportion of the phosphate and iron rapidly became insoluble in the mitochondrial matrix, suggesting co-precipitation of these species after oxidation of iron by oxygen. Increasing the amount of phosphate in the medium decreased the amount of iron accumulated by Δyfh1 cells and improved their growth in an iron-dependent manner, and this effect was mostly transcriptional. Overexpressing the major mitochondrial phosphate carrier, MIR1, slightly increased the concentration of soluble mitochondrial phosphate and significantly improved various mitochondrial functions (cytochromes, [Fe-S] clusters, and respiration) in Δyfh1 cells. We conclude that in Δyfh1 cells, soluble phosphate is limiting, due to its co-precipitation with iron.

  11. Rapid detection, differentiation and typing of methicillin-resistant Staphylococcus aureus harbouring either mecA or the new mecA homologue mecA(LGA251).

    Science.gov (United States)

    Stegger, M; Andersen, P S; Kearns, A; Pichon, B; Holmes, M A; Edwards, G; Laurent, F; Teale, C; Skov, R; Larsen, A R

    2012-04-01

    The recent finding of a new mecA homologue, mecA(LGA251) , with only 70% nucleotide homology to the conventional mecA gene has brought the routine testing for mecA as a confirmatory test for methicillin-resistant Staphylococcus aureus (MRSA) into question. A multiplex PCR was designed to differentiate mecA(LGA251) from the known mecA together with detection of lukF-PV and the spa gene fragments, enabling direct spa typing by sequencing of the PCR amplicons. The PCR analysis and subsequent spa typing were validated on a large collection (n=185) of contemporary MRSA and methicillin-sensitive S. aureus isolates, including 127 isolates carrying mecA(LGA251) . The mecA(LGA251) gene was situated in staphylococcal cassette chromosome mec type XI elements, and sequence variation within a 631-bp fragment of mecA(LGA251) in 79 isolates indicated a very conserved gene sequence. Following a successful validation, the multiplex PCR strategy was implemented in the routine testing of MRSA for national surveillance. Over a 2-month period, among 203 samples tested, 12 new MRSA cases caused by isolates carrying mecA(LGA251) were identified, emphasizing the clinical importance of testing for these new MRSA isolates. © 2011 STATENS SERUM INSTITUT. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.

  12. α-Tocopherol modulates the low density lipoprotein receptor of human HepG2 cells

    Directory of Open Access Journals (Sweden)

    Bottema Cynthia DK

    2003-05-01

    Full Text Available Abstract The aim of this study was to determine the effects of vitamin E (α-tocopherol on the low density lipoprotein (LDL receptor, a cell surface protein which plays an important role in controlling blood cholesterol. Human HepG2 hepatoma cells were incubated for 24 hours with increasing amounts of α, δ, or γ-tocopherol. The LDL receptor binding activity, protein and mRNA, 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA reductase mRNA, cell cholesterol and cell lathosterol were measured. The effect of α-tocopherol was biphasic. Up to a concentration of 50 μM, α-tocopherol progressively increased LDL receptor binding activity, protein and mRNA to maximum levels 2, 4 and 6-fold higher than control, respectively. The HMG-CoA reductase mRNA and the cell lathosterol concentration, indices of cholesterol synthesis, were also increased by 40% over control by treatment with 50 μM α-tocopherol. The cell cholesterol concentration was decreased by 20% compared to control at 50 μM α-tocopherol. However, at α-tocopherol concentrations higher than 50 μM, the LDL receptor binding activity, protein and mRNA, the HMG-CoA reductase mRNA and the cell lathosterol and cholesterol concentrations all returned to control levels. The biphasic effect on the LDL receptor was specific for α-tocopherol in that δ and γ-tocopherol suppressed LDL receptor binding activity, protein and mRNA at all concentrations tested despite the cells incorporating similar amounts of the three homologues. In conclusion, α-tocopherol, exhibits a specific, concentration-dependent and biphasic "up then down" effect on the LDL receptor of HepG2 cells which appears to be at the level of gene transcription. Cholesterol synthesis appears to be similarly affected and the cell cholesterol concentration may mediate these effects.

  13. The TFIID components human TAF(II)140 and Drosophila BIP2 (TAF(II)155) are novel metazoan homologues of yeast TAF(II)47 containing a histone fold and a PHD finger.

    Science.gov (United States)

    Gangloff, Y G; Pointud, J C; Thuault, S; Carré, L; Romier, C; Muratoglu, S; Brand, M; Tora, L; Couderc, J L; Davidson, I

    2001-08-01

    The RNA polymerase II transcription factor TFIID comprises the TATA binding protein (TBP) and a set of TBP-associated factors (TAF(II)s). TFIID has been extensively characterized for yeast, Drosophila, and humans, demonstrating a high degree of conservation of both the amino acid sequences of the constituent TAF(II)s and overall molecular organization. In recent years, it has been assumed that all the metazoan TAF(II)s have been identified, yet no metazoan homologues of yeast TAF(II)47 (yTAF(II)47) and yTAF(II)65 are known. Both of these yTAF(II)s contain a histone fold domain (HFD) which selectively heterodimerizes with that of yTAF(II)25. We have cloned a novel mouse protein, TAF(II)140, containing an HFD and a plant homeodomain (PHD) finger, which we demonstrated by immunoprecipitation to be a mammalian TFIID component. TAF(II)140 shows extensive sequence similarity to Drosophila BIP2 (dBIP2) (dTAF(II)155), which we also show to be a component of Drosophila TFIID. These proteins are metazoan homologues of yTAF(II)47 as their HFDs selectively heterodimerize with dTAF(II)24 and human TAF(II)30, metazoan homologues of yTAF(II)25. We further show that yTAF(II)65 shares two domains with the Drosophila Prodos protein, a recently described potential dTAF(II). These conserved domains are critical for yTAF(II)65 function in vivo. Our results therefore identify metazoan homologues of yTAF(II)47 and yTAF(II)65.

  14. Single-Crystal X-Ray Diffraction Studies of Homologues in the Series nBa(Nb,Zr)O 3+3 mNbO with n=2, 3, 4, 5 and m=1

    Science.gov (United States)

    Nilsson, G.; Svensson, G.

    2001-01-01

    Single crystals of four homologues in the series nBa(Nb,Zr)O3+3mNbO, with n:m=2:1, 3:1, 4:1, and 5:1, were found in the reduced Ba-Nb-Zr-O system. Single-crystal X-ray diffraction data were collected for all the crystals. For all homologues the space group was found to be P4/mmm. The structures can be described as intergrowths of Ba(Nb,Zr)O3 perovskite and NbO slabs. The refined cell parameters and compositions of the 2:1, 3:1, and 4:1 homologues are a=4.1768(5) Å and c=12.269(2) Å for Ba2Nb4.5(1)Zr0.5(1)O9, a=4.1769(5) Å and c=16.493(3) Å for Ba3+δNb4.8(2)-δ Zr1.2(2)O12-δ (δ=0.098(4)), and a=4.1747(6) Å and c= 20.619(4) Å for Ba4+δNb5.1(4)-δZr1.9(4)O15-δ (δ=0.270(9)). The refined cell parameters of the 5:1 homologue are a=4.1727(3) Å and c=24.804(3) Å. Zr replaces Nb only in the NbO6 octahedra found in the perovskite slabs.

  15. Short-chain chlorinated paraffins in soil, paddy seeds (Oryza sativa) and snails (Ampullariidae) in an e-waste dismantling area in China: Homologue group pattern, spatial distribution and risk assessment.

    Science.gov (United States)

    Yuan, Bo; Fu, Jianjie; Wang, Yawei; Jiang, Guibin

    2017-01-01

    Short-chain chlorinated paraffins (SCCPs) in multi-environmental matrices are studied in Taizhou, Zhejiang Province, China, which is a notorious e-waste dismantling area. The investigated matrices consist of paddy field soil, paddy seeds (Oryza sativa, separated into hulls and rice unpolished) and apple snails (Ampullariidae, inhabiting the paddy fields). The sampling area covered a 65-km radius around the contamination center. C 10 and C 11 are the two predominant homologue groups in the area, accounting for about 35.7% and 33.0% of total SCCPs, respectively. SCCPs in snails and hulls are generally higher than in soil samples (30.4-530 ng/g dw), and SCCPs in hulls are approximate five times higher than in corresponding rice samples (4.90-55.1 ng/g dw). Homologue pattern analysis indicates that paddy seeds (both hull and rice) tend to accumulate relatively high volatile SCCP homologues, especially the ones with shorter carbon chain length, while snails tend to accumulate relatively high lipophilic homologues, especially the ones with more substituted chlorines. SCCPs in both paddy seeds and snails are linearly related to those in the soil. The e-waste dismantling area, which covers a radius of approximate 20 km, shows higher pollution levels for SCCPs according to their spatial distribution in four matrices. The preliminary assessment indicates that SCCP levels in local soils pose no significant ecological risk for soil dwelling organisms, but higher risks from dietary exposure of SCCPs are suspected for people living in e-waste dismantling area. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Two mannose-binding lectin homologues and an MBL-associated serine protease are expressed in the gut epithelia of the urochordate species Ciona intestinalis

    DEFF Research Database (Denmark)

    Skjødt, Mikkel-Ole; Palarasah, Yaseelan; Rasmussen, Karina Juhl

    2010-01-01

    The lectin complement pathway has important functions in vertebrate host defence and accumulating evidence of primordial complement components trace its emergence to invertebrate phyla. We introduce two putative mannose-binding lectin homologues (CioMBLs) from the urochordate species Ciona intest...... protease in the epithelia cells lining the stomach and intestine. In conclusion we present two urochordate MBLs and identify an associated serine protease, which support the concept of an evolutionary ancient origin of the lectin complement pathway....

  17. Drosophila arginine methyltransferase 1 (DART1) is an ecdysone receptor co-repressor

    International Nuclear Information System (INIS)

    Kimura, Shuhei; Sawatsubashi, Shun; Ito, Saya; Kouzmenko, Alexander; Suzuki, Eriko; Zhao, Yue; Yamagata, Kaoru; Tanabe, Masahiko; Ueda, Takashi; Fujiyama, Sari; Murata, Takuya; Matsukawa, Hiroyuki; Takeyama, Ken-ichi; Yaegashi, Nobuo

    2008-01-01

    Histone arginine methylation is an epigenetic marker that regulates gene expression by defining the chromatin state. Arginine methyltransferases, therefore, serve as transcriptional co-regulators. However, unlike other transcriptional co-regulators, the physiological roles of arginine methyltransferases are poorly understood. Drosophila arginine methyltransferase 1 (DART1), the mammalian PRMT1 homologue, methylates the arginine residue of histone H4 (H4R3me2). Disruption of DART1 in Drosophila by imprecise P-element excision resulted in low viability during metamorphosis in the pupal stages. In the pupal stage, an ecdysone hormone signal is critical for developmental progression. DART1 interacted with the nuclear ecdysone receptor (EcR) in a ligand-dependent manner, and co-repressed EcR in intact flies. These findings suggest that DART1, a histone arginine methyltransferase, is a co-repressor of EcR that is indispensable for normal pupal development in the intact fly

  18. Unique variability of tocopherol composition in various seed oils recovered from by-products of apple industry: rapid and simple determination of all four homologues (α, β, γ and δ) by RP-HPLC/FLD.

    Science.gov (United States)

    Górnaś, Paweł

    2015-04-01

    The tocochromanol profile was studied in seed oils recovered from by-products of fruit industry, five dessert and seven crab apple varieties grown in Eastern Europe (Latvia). The seed oils obtained from dessert apples were characterized by higher contents of tocopherols (191.05-379.08 mg/100g oil) when compared to seed oils recovered from crab apples (130.55-202.54 mg/100g oil). The predominant homologues of tocopherol in all the studied samples were α and β over γ and δ. However, seed oils recovered from the apple cultivars 'Antej' and 'Beforest' had a unique profile of four tocopherol homologues (α:β:γ:δ) 91.41:80.55:72.46:79.03 and 114.55:112.84:78.69:73.00 mg/100g oil, respectively. A single dilution of seed oils in 2-propanol facilitated the direct use samples in the DPPH assay as well as injection into the RP-HPLC system containing a PFP (pentafluorophenyl) column, which resulted in a rapid separation of all four tocopherol homologues with excellent repeatability and reproducibility. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. GABA receptor imaging

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jong Doo [Yonsei University College of Medicine, Seoul (Korea, Republic of)

    2007-04-15

    GABA is primary an inhibitory neurotransmitter that is localized in inhibitory interneurons. GABA is released from presynaptic terminals and functions by binding to GABA receptors. There are two types of GABA receptors, GABA{sub A}-receptor that allows chloride to pass through a ligand gated ion channel and GABA{sub B}-receptor that uses G-proteins for signaling. The GABA{sub A}-receptor has a GABA binding site as well as a benzodiazepine binding sites, which modulate GABA{sub A}-receptor function. Benzodiazepine GABAA receptor imaging can be accomplished by radiolabeling derivates that activates benzodiazepine binding sites. There has been much research on flumazenil (FMZ) labeled with {sup 11}C-FMZ, a benzodiazepine derivate that is a selective, reversible antagonist to GABAA receptors. Recently, {sup 18}F-fluoroflumazenil (FFMZ) has been developed to overcome {sup 11}C's short half-life. {sup 18}F-FFMZ shows high selective affinity and good pharmacodynamics, and is a promising PET agent with better central benzodiazepine receptor imaging capabilities. In an epileptic focus, because the GABA/benzodiazepine receptor amount is decreased, using '1{sup 1}C-FMZ PET instead of {sup 18}F-FDG, PET, restrict the foci better and may also help find lesions better than high resolution MR. GABA{sub A} receptors are widely distributed in the cerebral cortex, and can be used as an viable neuronal marker. Therefore it can be used as a neuronal cell viability marker in cerebral ischemia. Also, GABA-receptors decrease in areas where neuronal plasticity develops, therefore, GABA imaging can be used to evaluate plasticity. Besides these usages, GABA receptors are related with psychological diseases, especially depression and schizophrenia as well as cerebral palsy, a motor-related disorder, so further in-depth studies are needed for these areas.

  20. GABA receptor imaging

    International Nuclear Information System (INIS)

    Lee, Jong Doo

    2007-01-01

    GABA is primary an inhibitory neurotransmitter that is localized in inhibitory interneurons. GABA is released from presynaptic terminals and functions by binding to GABA receptors. There are two types of GABA receptors, GABA A -receptor that allows chloride to pass through a ligand gated ion channel and GABA B -receptor that uses G-proteins for signaling. The GABA A -receptor has a GABA binding site as well as a benzodiazepine binding sites, which modulate GABA A -receptor function. Benzodiazepine GABAA receptor imaging can be accomplished by radiolabeling derivates that activates benzodiazepine binding sites. There has been much research on flumazenil (FMZ) labeled with 11 C-FMZ, a benzodiazepine derivate that is a selective, reversible antagonist to GABAA receptors. Recently, 18 F-fluoroflumazenil (FFMZ) has been developed to overcome 11 C's short half-life. 18 F-FFMZ shows high selective affinity and good pharmacodynamics, and is a promising PET agent with better central benzodiazepine receptor imaging capabilities. In an epileptic focus, because the GABA/benzodiazepine receptor amount is decreased, using '1 1 C-FMZ PET instead of 18 F-FDG, PET, restrict the foci better and may also help find lesions better than high resolution MR. GABA A receptors are widely distributed in the cerebral cortex, and can be used as an viable neuronal marker. Therefore it can be used as a neuronal cell viability marker in cerebral ischemia. Also, GABA-receptors decrease in areas where neuronal plasticity develops, therefore, GABA imaging can be used to evaluate plasticity. Besides these usages, GABA receptors are related with psychological diseases, especially depression and schizophrenia as well as cerebral palsy, a motor-related disorder, so further in-depth studies are needed for these areas

  1. Glucocorticoid receptor modulators.

    Science.gov (United States)

    Meijer, Onno C; Koorneef, Lisa L; Kroon, Jan

    2018-06-01

    The glucocorticoid hormone cortisol acts throughout the body to support circadian processes and adaptation to stress. The glucocorticoid receptor is the target of cortisol and of synthetic glucocorticoids, which are used widely in the clinic. Both agonism and antagonism of the glucocorticoid receptor may be beneficial in disease, but given the wide expression of the receptor and involvement in various processes, beneficial effects are often accompanied by unwanted side effects. Selective glucocorticoid receptor modulators are ligands that induce a receptor conformation that allows activation of only a subset of downstream signaling pathways. Such molecules thereby combine agonistic and antagonistic properties. Here we discuss the mechanisms underlying selective receptor modulation and their promise in treating diseases in several organ systems where cortisol signaling plays a role. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  2. Dengue virus receptor

    OpenAIRE

    Hidari, Kazuya I.P.J.; Suzuki, Takashi

    2011-01-01

    Dengue virus is an arthropod-borne virus transmitted by Aedes mosquitoes. Dengue virus causes fever and hemorrhagic disorders in humans and non-human primates. Direct interaction of the virus introduced by a mosquito bite with host receptor molecule(s) is crucial for virus propagation and the pathological progression of dengue diseases. Therefore, elucidation of the molecular mechanisms underlying the interaction between dengue virus and its receptor(s) in both humans and mosquitoes is essent...

  3. Deep mRNA sequencing of the Tritonia diomedea brain transcriptome provides access to gene homologues for neuronal excitability, synaptic transmission and peptidergic signalling.

    Directory of Open Access Journals (Sweden)

    Adriano Senatore

    Full Text Available The sea slug Tritonia diomedea (Mollusca, Gastropoda, Nudibranchia, has a simple and highly accessible nervous system, making it useful for studying neuronal and synaptic mechanisms underlying behavior. Although many important contributions have been made using Tritonia, until now, a lack of genetic information has impeded exploration at the molecular level.We performed Illumina sequencing of central nervous system mRNAs from Tritonia, generating 133.1 million 100 base pair, paired-end reads. De novo reconstruction of the RNA-Seq data yielded a total of 185,546 contigs, which partitioned into 123,154 non-redundant gene clusters (unigenes. BLAST comparison with RefSeq and Swiss-Prot protein databases, as well as mRNA data from other invertebrates (gastropod molluscs: Aplysia californica, Lymnaea stagnalis and Biomphalaria glabrata; cnidarian: Nematostella vectensis revealed that up to 76,292 unigenes in the Tritonia transcriptome have putative homologues in other databases, 18,246 of which are below a more stringent E-value cut-off of 1x10-6. In silico prediction of secreted proteins from the Tritonia transcriptome shotgun assembly (TSA produced a database of 579 unique sequences of secreted proteins, which also exhibited markedly higher expression levels compared to other genes in the TSA.Our efforts greatly expand the availability of gene sequences available for Tritonia diomedea. We were able to extract full length protein sequences for most queried genes, including those involved in electrical excitability, synaptic vesicle release and neurotransmission, thus confirming that the transcriptome will serve as a useful tool for probing the molecular correlates of behavior in this species. We also generated a neurosecretome database that will serve as a useful tool for probing peptidergic signalling systems in the Tritonia brain.

  4. Regulation of the Src Kinase-associated Phosphoprotein 55 Homologue by the Protein Tyrosine Phosphatase PTP-PEST in the Control of Cell Motility*

    Science.gov (United States)

    Ayoub, Emily; Hall, Anita; Scott, Adam M.; Chagnon, Mélanie J.; Miquel, Géraldine; Hallé, Maxime; Noda, Masaharu; Bikfalvi, Andreas; Tremblay, Michel L.

    2013-01-01

    PTP-PEST is a cytosolic ubiquitous protein tyrosine phosphatase (PTP) that contains, in addition to its catalytic domain, several protein-protein interaction domains that allow it to interface with several signaling pathways. Among others, PTP-PEST is a key regulator of cellular motility and cytoskeleton dynamics. The complexity of the PTP-PEST interactome underscores the necessity to identify its interacting partners and physiological substrates in order to further understand its role in focal adhesion complex turnover and actin organization. Using a modified yeast substrate trapping two-hybrid system, we identified a cytosolic adaptor protein named Src kinase-associated phosphoprotein 55 homologue (SKAP-Hom) as a novel substrate of PTP-PEST. To confirm PTP-PEST interaction with SKAP-Hom, in vitro pull down assays were performed demonstrating that the PTP catalytic domain and Proline-rich 1 (P1) domain are respectively binding to the SKAP-Hom Y260 and Y297 residues and its SH3 domain. Subsequently, we generated and rescued SKAP-Hom-deficient mouse embryonic fibroblasts (MEFs) with WT SKAP-Hom, SKAP-Hom tyrosine mutants (Y260F, Y260F/Y297F), or SKAP-Hom SH3 domain mutant (W335K). Given the role of PTP-PEST, wound-healing and trans-well migration assays were performed using the generated lines. Indeed, SKAP-Hom-deficient MEFs showed a defect in migration compared with WT-rescued MEFs. Interestingly, the SH3 domain mutant-rescued MEFs showed an enhanced cell migration corresponding potentially with higher tyrosine phosphorylation levels of SKAP-Hom. These findings suggest a novel role of SKAP-Hom and its phosphorylation in the regulation of cellular motility. Moreover, these results open new avenues by which PTP-PEST regulates cellular migration, a hallmark of metastasis. PMID:23897807

  5. BmajPLA2-II, a basic Lys49-phospholipase A2 homologue from Bothrops marajoensis snake venom with parasiticidal potential.

    Science.gov (United States)

    Grabner, Amy N; Alfonso, Jorge; Kayano, Anderson M; Moreira-Dill, Leandro S; Dos Santos, Ana Paula de A; Caldeira, Cleópatra A S; Sobrinho, Juliana C; Gómez, Ana; Grabner, Fernando P; Cardoso, Fabio F; Zuliani, Juliana Pavan; Fontes, Marcos R M; Pimenta, Daniel C; Gómez, Celeste Vega; Teles, Carolina B G; Soares, Andreimar M; Calderon, Leonardo A

    2017-09-01

    Snake venoms contain various proteins, especially phospholipases A 2 (PLA 2 s), which present potential applications in diverse areas of health and medicine. In this study, a new basic PLA 2 from Bothrops marajoensis with parasiticidal activity was purified and characterized biochemically and biologically. B. marajoensis venom was fractionated through cation exchange followed by reverse phase chromatographies. The isolated toxin, BmajPLA 2 -II, was structurally characterized with MALDI-TOF (Matrix-assisted laser desorption/ionization-time of flight) mass spectrometry, sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by two-dimensional electrophoresis, partial amino acid sequencing, an enzymatic activity assay, circular dichroism, and dynamic light scattering assays. These structural characterization tests presented BmajPLA 2 -II as a basic Lys49 PLA 2 homologue, compatible with other basic snake venom PLA 2 s (svPLA 2 ), with a tendency to form aggregations. The in vitro anti-parasitic potential of B. marajoensis venom and of BmajPLA 2 -II was evaluated against Leishmania infantum promastigotes and Trypanosoma cruzi epimastigotes, showing significant activity at a concentration of 100μg/mL. The venom and BmajPLA 2 -II presented IC 50 of 0.14±0.08 and 6.41±0.64μg/mL, respectively, against intraerythrocytic forms of Plasmodium falciparum with CC 50 cytotoxicity values against HepG2 cells of 43.64±7.94 and >150μg/mL, respectively. The biotechnological potential of these substances in relation to leishmaniasis, Chagas disease and malaria should be more deeply investigated. Copyright © 2017. Published by Elsevier B.V.

  6. An Arabidopsis chloroplast-targeted Hsp101 homologue, APG6, has an essential role in chloroplast development as well as heat-stress response.

    Science.gov (United States)

    Myouga, Fumiyoshi; Motohashi, Reiko; Kuromori, Takashi; Nagata, Noriko; Shinozaki, Kazuo

    2006-10-01

    Analysis of albino or pale-green (apg) mutants is important for identifying nuclear genes responsible for chloroplast development and pigment synthesis. We have identified 38 apg mutants by screening 11 000 Arabidopsis Ds-tagged lines. One mutant, apg6, contains a Ds insertion in a gene encoding APG6 (ClpB3), a homologue of the heat-shock protein Hsp101 (ClpB1). We isolated somatic revertants and identified two Ds-tagged and one T-DNA-tagged mutant alleles of apg6. All three alleles gave the same pale-green phenotype. These results suggest that APG6 is important for chloroplast development. The APG6 protein contains a transit peptide and is localized in chloroplasts. The plastids of apg6 pale-green cells were smaller than those of the wild type, and contained undeveloped thylakoid membranes. APG6 mRNA accumulated in response to heat shock in various organs, but not in response to other abiotic stresses. Under normal conditions, APG6 is constitutively expressed in the root tips, the organ boundary region, the reproductive tissues of mature plants where plastids exist as proplastids, and slightly in the stems and leaves. In addition, constitutive overexpression of APG6 in transgenic plants inhibited chloroplast development and resulted in a mild pale-green phenotype. The amounts of chloroplast proteins related to photosynthesis were markedly decreased in apg6 mutants. These results suggest that APG6 functions as a molecular chaperone involved in plastid differentiation mediating internal thylakoid membrane formation and conferring thermotolerance to chloroplasts during heat stress. The APG6 protein is not only involved in heat-stress response in chloroplasts, but is also essential for chloroplast development.

  7. E3B1, a human homologue of the mouse gene product Abi-1, sensitizes activation of Rap1 in response to epidermal growth factor

    International Nuclear Information System (INIS)

    Jenei, Veronika; Andersson, Tommy; Jakus, Judit; Dib, Karim

    2005-01-01

    E3B1, a human homologue of the mouse gene product Abi-1, has been implicated in growth-factor-mediated regulation of the small GTPases p21 Ras and Rac. E3b1 is a regulator of Rac because it can form a complex with Sos-1 and eps8, and such a Sos-1-e3B1-eps8 complex serves as a guanine nucleotide exchange factor for Rac. In the present study, we found that overexpression of e3B1 in NIH3T3/EGFR cells sensitized EGF-induced activation of Rac1, whereas it had no impact on EGF-induced activation of p21 Ras . Remarkably, we found that EGF-induced activation of the p21 Ras -related GTPase Rap1 was also sensitized in NIH3T3/EGFR-e3B1 cells. Thus, in NIH3T3/EGFR-e3B1 cells, maximal EGF-induced activation of Rap1 occurs with a dose of EGF much lower than in NIH3T3/EGFR cells. We also report that overexpression of e3B1 in NIH3T3/EGFR cells renders EGF-induced activation of Rap1 completely dependent on Src tyrosine kinases but not on c-Abl. However, EGF-induced tyrosine phosphorylation of the Rap GEF C3G occurred regardless of whether e3B1 was overexpressed or not, and this did not involve Src tyrosine kinases. Accordingly, we propose that overexpression of e3B1 in NIH3T3/EGFR cells leads to mobilization of Src tyrosine kinases that participate in EGF-induced activation of Rap1 and inhibition of cell proliferation

  8. Effect of Phosphatase and Tensin Homologue on Chromosome 10 on Angiotensin II-Mediated Proliferation, Collagen Synthesis, and Akt/P27 Signaling in Neonatal Rat Cardiac Fibroblasts

    Directory of Open Access Journals (Sweden)

    Ling Nie

    2016-01-01

    Full Text Available Cardiac fibroblasts (CFs play a key role in cardiac fibrosis by regulating the balance between extracellular matrix synthesis and breakdown. Although phosphatase and tensin homologue on chromosome 10 (PTEN has been found to play an important role in cardiovascular disease, it is not clear whether PTEN is involved in functional regulation of CFs. In the present study, PTEN was overexpressed in neonatal rat CFs via recombinant adenovirus-mediated gene transfer. The effects of PTEN overexpression on cell-cycle progression and angiotensin II- (Ang II- mediated regulation of collagen metabolism, synthesis of matrix metalloproteinases, and Akt/P27 signaling were investigated. Compared with uninfected cells and cells infected with green fluorescent protein-expressing adenovirus (Ad-GFP, cells infected with PTEN-expressing adenovirus (Ad-PTEN significantly increased PTEN protein and mRNA levels in CFs (P<0.05. The proportion of CFs in the G1/S cell-cycle phase was significantly higher for PTEN-overexpressing cells. In addition, Ad-PTEN decreased mRNA expression and the protein synthesis rate of collagen types I and III and antagonized Ang II-induced collagen synthesis. Overexpression of PTEN also decreased Ang II-induced matrix metalloproteinase-2 (MMP-2 and tissue inhibitor of metalloproteinase-1 (TIMP-1 production as well as gelatinase activity. Moreover, Ad-PTEN decreased Akt expression and increased P27 expression independent of Ang II stimulation. These results suggest that PTEN could regulate its functional effects in neonatal rat CFs partially via the Akt/P27 signaling pathway.

  9. Human CD4+ T cell responses to the dog major allergen Can f 1 and its human homologue tear lipocalin resemble each other.

    Directory of Open Access Journals (Sweden)

    Aino L K Liukko

    Full Text Available Lipocalin allergens form a notable group of proteins, as they contain most of the significant respiratory allergens from mammals. The basis for the allergenic capacity of allergens in the lipocalin family, that is, the development of T-helper type 2 immunity against them, is still unresolved. As immunogenicity has been proposed to be a decisive feature of allergens, the purpose of this work was to examine human CD4+ T cell responses to the major dog allergen Can f 1 and to compare them with those to its human homologue, tear lipocalin (TL. For this, specific T cell lines were induced in vitro from the peripheral blood mononuclear cells of Can f 1-allergic and healthy dog dust-exposed subjects with peptides containing the immunodominant T cell epitopes of Can f 1 and the corresponding TL peptides. We found that the frequency of Can f 1 and TL-specific T cells in both subject groups was low and close to each other, the difference being about two-fold. Importantly, we found that the proliferative responses of both Can f 1 and TL-specific T cell lines from allergic subjects were stronger than those from healthy subjects, but that the strength of the responses within the subject groups did not differ between these two antigens. Moreover, the phenotype of the Can f 1 and TL-specific T cell lines, determined by cytokine production and expression of cell surface markers, resembled each other. The HLA system appeared to have a minimal role in explaining the allergenicity of Can f 1, as the allergic and healthy subjects' HLA background did not differ, and HLA binding was very similar between Can f 1 and TL peptides. Along with existing data on lipocalin allergens, we conclude that strong antigenicity is not decisive for the allergenicity of Can f 1.

  10. Occurrence, homologue patterns and source apportionment of short- and medium-chain chlorinated paraffins in suburban soils of Shanghai, China.

    Science.gov (United States)

    Wang, Xue-Tong; Xu, Si-Yue; Wang, Xi-Kui; Hu, Bao-Ping; Jia, Hao-Hao

    2017-08-01

    In order to systematically investigate the spatial distribution, homologue profiles, and sources of short- and medium-chain chlorinated paraffins (SCCPs and MCCPs) in suburban soils in Shanghai, SCCPs and MCCPs in soils were analyzed using gas chromatography coupled with low resolution mass spectrometry in electron capture negative ion (ECNI) mode (GC-ECNI-MS). The CP concentrations in soils were between not detected (ND) - 697 ng g -1 with a median value of 3.52 ng g -1 for SCCPs, and ND - 666 ng g -1 with a median value of 15.3 ng g -1 for MCCPs, respectively. The concentrations of MCCPs in most soils were higher than that of SCCPs. The total CP concentrations (sum of SCCPs and MCCPs) in soils varied from ND to 964 ng g -1 with a median value of 20.5 ng g -1 . The concentration of MCCPs was higher than that of SCCPs in most soils. The levels of SCCPs and MCCPs in suburban soils in Shanghai were at the medium level when compared to other areas around the world. No significant correlation was observed between soil CP concentrations and total organic carbon contents (p > 0.05). For different use type of soils, the median concentrations of CPs in soils were found higher in greenland than that in other areas probably due to busy traffic, sewage sludge application and/or wastewater irrigation. All soils were divided into two groups by hierarchical cluster analysis (HCA) both for SCCPs and MCCPs. Three discharge sources of CPs in suburban soil of Shanghai were identified by PMF model. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

    Science.gov (United States)

    Zebala, John A; Mundell, Alan; Messinger, Linda; Griffin, Craig E; Schuler, Aaron D; Kahn, Stuart J

    2014-01-01

    Options are limited for patients with atopic dermatitis (AD) who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR). However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD. This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg) or twice-weekly (0.007 mg/kg) LD-aminopterin. The primary efficacy outcome was the Global Score (GS), a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01). The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo. Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  12. LD-aminopterin in the canine homologue of human atopic dermatitis: a randomized, controlled trial reveals dosing factors affecting optimal therapy.

    Directory of Open Access Journals (Sweden)

    John A Zebala

    Full Text Available Options are limited for patients with atopic dermatitis (AD who do not respond to topical treatments. Antifolate therapy with systemic methotrexate improves the disease, but is associated with adverse effects. The investigational antifolate LD-aminopterin may offer improved safety. It is not known how antifolate dose and dosing frequency affect efficacy in AD, but a primary mechanism is thought to involve the antifolate-mediated accumulation of 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR. However, recent in vitro studies indicate that AICAR increases then decreases as a function of antifolate concentration. To address this issue and understand how dosing affects antifolate efficacy in AD, we examined the efficacy and safety of different oral doses and schedules of LD-aminopterin in the canine model of AD.This was a multi-center, double-blind trial involving 75 subjects with canine AD randomized to receive up to 12 weeks of placebo, once-weekly (0.007, 0.014, 0.021 mg/kg or twice-weekly (0.007 mg/kg LD-aminopterin. The primary efficacy outcome was the Global Score (GS, a composite of validated measures of disease severity and itch. GS improved in all once-weekly cohorts, with 0.014 mg/kg being optimal and significant (43%, P<0.01. The majority of improvement was seen by 8 weeks. In contrast, GS in the twice-weekly cohort was similar to placebo and worse than all once-weekly cohorts. Adverse events were similar across all treated cohorts and placebo.Once-weekly LD-aminopterin was safe and efficacious in canine AD. Twice-weekly dosing negated efficacy despite having the same daily and weekly dose as effective once-weekly regimens. Optimal dosing in this homologue of human AD correlated with the concentration-selective accumulation of AICAR in vitro, consistent with AICAR mediating LD-aminopterin efficacy in AD.

  13. Isolation and characterization of the human homologue of rig and its pseudogenes: The functional gene has features characteristic of housekeeping genes

    International Nuclear Information System (INIS)

    Shiga, Kiyoto; Yamamoto, Hiroshi; Okamoto, Hiroshi

    1990-01-01

    Rig (rat insulinoma gene) was first isolated from a cDNA library of rat insulinomas and has been found to be activated in various human tumors such as insulinomas, esophageal cancers, and colon cancers. Here the authors isolated the human homologue of rig from a genomic DNA library constructed from a human esophageal carcinoma and determined its complete nucleotide sequence. The gene is composed of about 3,000 nucleotides and divided into four exons separated by three introns: exon 3 encodes the nuclear location signal and the DNA-binding domain of the RIG protein. The transcription initiation site was located at -46 base pairs upstream from the first ATG codon. The 5'-flanking region of the gene has no apparent TATA-box or CAAT-box sequence. However, two GC boxes are found at -189 and -30 base pairs upstream from the transcription initiation site and five GC boxes are also found in introns 1 and 2. The gene is bounded in the 5' region by CpG islands, regions of DNA with a high GC content and a high frequency of CpG dinucleotides relative to the bulk genome. Furthermore, the human genome contains at least six copies of RIG pseudogenes, and four of them have the characteristics of processed pseudogenes. From these results together with the finding that RIG is expressed in a wide variety of tissues and cells, they speculate that RIG belongs to the class of housekeeping genes, whose products are necessary for the growth of all cell types

  14. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

    Directory of Open Access Journals (Sweden)

    Hui Xu

    2010-11-01

    Full Text Available MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  15. MS4a4B, a CD20 homologue in T cells, inhibits T cell propagation by modulation of cell cycle.

    Science.gov (United States)

    Xu, Hui; Yan, Yaping; Williams, Mark S; Carey, Gregory B; Yang, Jingxian; Li, Hongmei; Zhang, Guang-Xian; Rostami, Abdolmohamad

    2010-11-01

    MS4a4B, a CD20 homologue in T cells, is a novel member of the MS4A gene family in mice. The MS4A family includes CD20, FcεRIβ, HTm4 and at least 26 novel members that are characterized by their structural features: with four membrane-spanning domains, two extracellular domains and two cytoplasmic regions. CD20, FcεRIβ and HTm4 have been found to function in B cells, mast cells and hematopoietic cells respectively. However, little is known about the function of MS4a4B in T cell regulation. We demonstrate here that MS4a4B negatively regulates mouse T cell proliferation. MS4a4B is highly expressed in primary T cells, natural killer cells (NK) and some T cell lines. But its expression in all malignant T cells, including thymoma and T hybridoma tested, was silenced. Interestingly, its expression was regulated during T cell activation. Viral vector-driven overexpression of MS4a4B in primary T cells and EL4 thymoma cells reduced cell proliferation. In contrast, knockdown of MS4a4B accelerated T cell proliferation. Cell cycle analysis showed that MS4a4B regulated T cell proliferation by inhibiting entry of the cells into S-G2/M phase. MS4a4B-mediated inhibition of cell cycle was correlated with upregulation of Cdk inhibitory proteins and decreased levels of Cdk2 activity, subsequently leading to inhibition of cell cycle progression. Our data indicate that MS4a4B negatively regulates T cell proliferation. MS4a4B, therefore, may serve as a modulator in the negative-feedback regulatory loop of activated T cells.

  16. Pharmacology of (S)-homoquisqualic acid and (S)-2-amino-5-phosphonopentanoic acid [(S)-AP5] at cloned metabotropic glutamate receptors

    DEFF Research Database (Denmark)

    Bräuner-Osborne, Hans; Krogsgaard-Larsen, P

    1998-01-01

    1 In this study we have determined the pharmacological profile of (S)-quisqualic acid, (S)-2-amino-4-phosphonobutyric acid ((S)-AP4) and their higher homologues (S)-homoquisqualic acid, (S)-2-amino-5-phosphonopentanoic acid ((S)-AP5), respectively, and (R)-AP5 at subtypes of metabotropic (S)-glutamic...... demonstrate that incorporation of an additional carbon atom into the backbone of (S)-glutamic acid and its analogues, to give the corresponding homologues, and replacement of the terminal carboxyl groups by isosteric acidic groups have profound effects on the pharmacological profiles at mGlu receptor subtypes...... acid (mGlu) receptors expressed in Chinese hamster ovary cells. 2 (S)-Quisqualic acid was a potent mGlu1/mGlu5 agonist (EC50 values of 1.1 microM and 0.055 microM, respectively) showing no activity at mGlu2 and weak agonism at mGlu4 (EC50 approximately 1000 microM). 3 (S)-Homoquisqualic acid displayed...

  17. Cloning and characterisation of Schistosoma japonicum insulin receptors.

    Directory of Open Access Journals (Sweden)

    Hong You

    2010-03-01

    Full Text Available Schistosomes depend for growth and development on host hormonal signals, which may include the insulin signalling pathway. We cloned and assessed the function of two insulin receptors from Schistosoma japonicum in order to shed light on their role in schistosome biology.We isolated, from S. japonicum, insulin receptors 1 (SjIR-1 and 2 (SjIR-2 sharing close sequence identity to their S. mansoni homologues (SmIR-1 and SmIR-2. SjIR-1 is located on the tegument basal membrane and the internal epithelium of adult worms, whereas SjIR-2 is located in the parenchyma of males and the vitelline tissue of females. Phylogenetic analysis showed that SjIR-2 and SmIR-2 are close to Echinococcus multilocularis insulin receptor (EmIR, suggesting that SjIR-2, SmIR-2 and EmIR share similar roles in growth and development in the three taxa. Structure homology modelling recovered the conserved structure between the SjIRs and Homo sapiens IR (HIR implying a common predicted binding mechanism in the ligand domain and the same downstream signal transduction processing in the tyrosine kinase domain as in HIR. Two-hybrid analysis was used to confirm that the ligand domains of SjIR-1 and SjIR-2 contain the insulin binding site. Incubation of adult worms in vitro, both with a specific insulin receptor inhibitor and anti-SjIRs antibodies, resulted in a significant decrease in worm glucose levels, suggesting again the same function for SjIRs in regulating glucose uptake as described for mammalian cells.Adult worms of S. japonicum possess insulin receptors that can specifically bind to insulin, indicating that the parasite can utilize host insulin for development and growth by sharing the same pathway as mammalian cells in regulating glucose uptake. A complete understanding of the role of SjIRs in the biology of S. japonicum may result in their use as new targets for drug and vaccine development against schistosomiasis.

  18. In human pseudouridine synthase 1 (hPus1), a C-terminal helical insert blocks tRNA from binding in the same orientation as in the Pus1 bacterial homologue TruA, consistent with their different target selectivities.

    Science.gov (United States)

    Czudnochowski, Nadine; Wang, Amy Liya; Finer-Moore, Janet; Stroud, Robert M

    2013-10-23

    Human pseudouridine (Ψ) synthase Pus1 (hPus1) modifies specific uridine residues in several non-coding RNAs: tRNA, U2 spliceosomal RNA, and steroid receptor activator RNA. We report three structures of the catalytic core domain of hPus1 from two crystal forms, at 1.8Å resolution. The structures are the first of a mammalian Ψ synthase from the set of five Ψ synthase families common to all kingdoms of life. hPus1 adopts a fold similar to bacterial Ψ synthases, with a central antiparallel β-sheet flanked by helices and loops. A flexible hinge at the base of the sheet allows the enzyme to open and close around an electropositive active-site cleft. In one crystal form, a molecule of Mes [2-(N-morpholino)ethane sulfonic acid] mimics the target uridine of an RNA substrate. A positively charged electrostatic surface extends from the active site towards the N-terminus of the catalytic domain, suggesting an extensive binding site specific for target RNAs. Two α-helices C-terminal to the core domain, but unique to hPus1, extend along the back and top of the central β-sheet and form the walls of the RNA binding surface. Docking of tRNA to hPus1 in a productive orientation requires only minor conformational changes to enzyme and tRNA. The docked tRNA is bound by the electropositive surface of the protein employing a completely different binding mode than that seen for the tRNA complex of the Escherichia coli homologue TruA. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Angiotensin type 2 receptors

    DEFF Research Database (Denmark)

    Sumners, Colin; de Kloet, Annette D; Krause, Eric G

    2015-01-01

    In most situations, the angiotensin AT2-receptor (AT2R) mediates physiological actions opposing those mediated by the AT1-receptor (AT1R), including a vasorelaxant effect. Nevertheless, experimental evidence vastly supports that systemic application of AT2R-agonists is blood pressure neutral...

  20. Glutamate receptor agonists

    DEFF Research Database (Denmark)

    Vogensen, Stine Byskov; Greenwood, Jeremy R; Bunch, Lennart

    2011-01-01

    The neurotransmitter (S)-glutamate [(S)-Glu] is responsible for most of the excitatory neurotransmission in the central nervous system. The effect of (S)-Glu is mediated by both ionotropic and metabotropic receptors. Glutamate receptor agonists are generally a-amino acids with one or more...... stereogenic centers due to strict requirements in the agonist binding pocket of the activated state of the receptor. By contrast, there are many examples of achiral competitive antagonists. The present review addresses how stereochemistry affects the activity of glutamate receptor ligands. The review focuses...... mainly on agonists and discusses stereochemical and conformational considerations as well as biostructural knowledge of the agonist binding pockets, which is useful in the design of glutamate receptor agonists. Examples are chosen to demonstrate how stereochemistry not only determines how the agonist...

  1. AMPA receptor ligands

    DEFF Research Database (Denmark)

    Strømgaard, Kristian; Mellor, Ian

    2004-01-01

    Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (AMPAR), subtype of the ionotropic glutamate receptors (IGRs), mediate fast synaptic transmission in the central nervous system (CNS), and are involved in many neurological disorders, as well as being a key player in the f......Alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) receptors (AMPAR), subtype of the ionotropic glutamate receptors (IGRs), mediate fast synaptic transmission in the central nervous system (CNS), and are involved in many neurological disorders, as well as being a key player...... in the formation of memory. Hence, ligands affecting AMPARs are highly important for the study of the structure and function of this receptor, and in this regard polyamine-based ligands, particularly polyamine toxins, are unique as they selectively block Ca2+ -permeable AMPARs. Indeed, endogenous intracellular...

  2. A chemokine-binding domain in the tumor necrosis factor receptor from variola (smallpox) virus.

    Science.gov (United States)

    Alejo, Alí; Ruiz-Argüello, M Begoña; Ho, Yin; Smith, Vincent P; Saraiva, Margarida; Alcami, Antonio

    2006-04-11

    Variola virus (VaV) is the causative agent of smallpox, one of the most devastating diseases encountered by man, that was eradicated in 1980. The deliberate release of VaV would have catastrophic consequences on global public health. However, the mechanisms that contribute to smallpox pathogenesis are poorly understood at the molecular level. The ability of viruses to evade the host defense mechanisms is an important determinant of viral pathogenesis. Here we show that the tumor necrosis factor receptor (TNFR) homologue CrmB encoded by VaV functions not only as a soluble decoy TNFR but also as a highly specific binding protein for several chemokines that mediate recruitment of immune cells to mucosal surfaces and the skin, sites of virus entry and viral replication at late stages of smallpox. CrmB binds chemokines through its C-terminal domain, which is unrelated to TNFRs, was named smallpox virus-encoded chemokine receptor (SECRET) domain and uncovers a family of poxvirus chemokine inhibitors. An active SECRET domain was found in another viral TNFR (CrmD) and three secreted proteins encoded by orthopoxviruses. These findings identify a previously undescribed chemokine-binding and inhibitory domain unrelated to host chemokine receptors and a mechanism of immune modulation in VaV that may influence smallpox pathogenesis.

  3. A polycystin-type transient receptor potential (Trp channel that is activated by ATP

    Directory of Open Access Journals (Sweden)

    David Traynor

    2017-02-01

    Full Text Available ATP and ADP are ancient extra-cellular signalling molecules that in Dictyostelium amoebae cause rapid, transient increases in cytosolic calcium due to an influx through the plasma membrane. This response is independent of hetero-trimeric G-proteins, the putative IP3 receptor IplA and all P2X channels. We show, unexpectedly, that it is abolished in mutants of the polycystin-type transient receptor potential channel, TrpP. Responses to the chemoattractants cyclic-AMP and folic acid are unaffected in TrpP mutants. We report that the DIF morphogens, cyclic-di-GMP, GABA, glutamate and adenosine all induce strong cytoplasmic calcium responses, likewise independently of TrpP. Thus, TrpP is dedicated to purinergic signalling. ATP treatment causes cell blebbing within seconds but this does not require TrpP, implicating a separate purinergic receptor. We could detect no effect of ATP on chemotaxis and TrpP mutants grow, chemotax and develop almost normally in standard conditions. No gating ligand is known for the human homologue of TrpP, polycystin-2, which causes polycystic kidney disease. Our results now show that TrpP mediates purinergic signalling in Dictyostelium and is directly or indirectly gated by ATP.

  4. A chemokine-binding domain in the tumor necrosis factor receptor from variola (smallpox) virus

    Science.gov (United States)

    Alejo, Alí; Ruiz-Argüello, M. Begoña; Ho, Yin; Smith, Vincent P.; Saraiva, Margarida; Alcami, Antonio

    2006-01-01

    Variola virus (VaV) is the causative agent of smallpox, one of the most devastating diseases encountered by man, that was eradicated in 1980. The deliberate release of VaV would have catastrophic consequences on global public health. However, the mechanisms that contribute to smallpox pathogenesis are poorly understood at the molecular level. The ability of viruses to evade the host defense mechanisms is an important determinant of viral pathogenesis. Here we show that the tumor necrosis factor receptor (TNFR) homologue CrmB encoded by VaV functions not only as a soluble decoy TNFR but also as a highly specific binding protein for several chemokines that mediate recruitment of immune cells to mucosal surfaces and the skin, sites of virus entry and viral replication at late stages of smallpox. CrmB binds chemokines through its C-terminal domain, which is unrelated to TNFRs, was named smallpox virus-encoded chemokine receptor (SECRET) domain and uncovers a family of poxvirus chemokine inhibitors. An active SECRET domain was found in another viral TNFR (CrmD) and three secreted proteins encoded by orthopoxviruses. These findings identify a previously undescribed chemokine-binding and inhibitory domain unrelated to host chemokine receptors and a mechanism of immune modulation in VaV that may influence smallpox pathogenesis. PMID:16581912

  5. Lipophorin Receptor: The Insect Lipoprotein Receptor

    Indian Academy of Sciences (India)

    IAS Admin

    Director of ... function of the Lp is to deliver lipids throughout the insect body for metabolism ... Lipid is used as a major energy source for development as well as other metabolic .... LpR4 receptor variant was expressed exclusively in the brain and.

  6. The human homologue of unc-93 maps to chromosome 6q27 – characterisation and analysis in sporadic epithelial ovarian cancer

    Directory of Open Access Journals (Sweden)

    Charnock F Mark L

    2002-10-01

    Full Text Available Abstract Background In sporadic ovarian cancer, we have previously reported allele loss at D6S193 (62% on chromosome 6q27, which suggested the presence of a putative tumour suppressor gene. Based on our data and that from another group, the minimal region of allele loss was between D6S264 and D6S149 (7.4 cM. To identify the putative tumour suppressor gene, we established a physical map initially with YACs and subsequently with PACs/BACs from D6S264 to D6S149. To accelerate the identification of genes, we sequenced the entire contig of approximately 1.1 Mb. Seven genes were identified within the region of allele loss between D6S264 and D6S149. Results The human homologue of unc-93 (UNC93A in C. elegans was identified to be within the interval of allele loss centromeric to D6S149. This gene is 24.5 kb and comprises of 8 exons. There are two transcripts with the shorter one due to splicing out of exon 4. It is expressed in testis, small intestine, spleen, prostate, and ovary. In a panel of 8 ovarian cancer cell lines, UNC93A expression was detected by RT-PCR which identified the two transcripts in 2/8 cell lines. The entire coding sequence was examined for mutations in a panel of ovarian tumours and ovarian cancer cell lines. Mutations were identified in exons 1, 3, 4, 5, 6 and 8. Only 3 mutations were identified specifically in the tumour. These included a c.452G>A (W151X mutation in exon 3, c.676C>T (R226X in exon 5 and c.1225G>A(V409I mutation in exon 8. However, the mutations in exon 3 and 5 were also present in 6% and 2% of the normal population respectively. The UNC93A cDNA was shown to express at the cell membrane and encodes for a protein of 60 kDa. Conclusions These results suggest that no evidence for UNC93A as a tumour suppressor gene in sporadic ovarian cancer has been identified and further research is required to evaluate its normal function and role in the pathogenesis of ovarian cancer.

  7. Plant 115-kDa actin-filament bundling protein, P-115-ABP, is a homologue of plant villin and is widely distributed in cells.

    Science.gov (United States)

    Yokota, Etsuo; Vidali, Luis; Tominaga, Motoki; Tahara, Hiroshi; Orii, Hidefumi; Morizane, Yosuke; Hepler, Peter K; Shimmen, Teruo

    2003-10-01

    In many cases, actin filaments are arranged into bundles and serve as tracks for cytoplasmic streaming in plant cells. We have isolated an actin-filament bundling protein, which is composed of 115-kDa polypeptide (P-115-ABP), from the germinating pollen of lily, Lilium longiflorum [Nakayasu et al. (1998) BIOCHEM: Biophys. Res. Commun. 249: 61]. P-115-ABP shared similar antigenicity with a plant 135-kDa actin-filament bundling protein (P-135-ABP), a plant homologue of villin. A full-length cDNA clone (ABP115; accession no. AB097407) was isolated from an expression cDNA library of lily pollen by immuno-screening using antisera against P-115-ABP and P-135-ABP. The amino acid sequence of P-115-ABP deduced from this clone showed high homology with those of P-135-ABP and four villin isoforms of Arabidopsis thaliana (AtVLN1, AtVLN2, AtVLN3 and AtVLN4), especially AtVLN4, indicating that P-115-ABP can also be classified as a plant villin. The P-115-ABP isolated biochemically from the germinating lily pollen was able to arrange F-actin filaments with uniform polarity into bundles and this bundling activity was suppressed by Ca2+-calmodulin (CaM), similar to the actin-filament bundling properties of P-135-ABP. The P-115-ABP type of plant villin was widely distributed in plant cells, from algae to land plants. In root hair cells of Hydrocharis dubia, this type of plant villin was co-localized with actin-filament bundles in the transvacuolar strands and the sub-cortical regions. Microinjection of the antiserum against P-115-ABP into living root hair cells caused the disappearance of transvaculor strands and alteration of the route of cytoplasmic streaming. In internodal cells of Chara corallina in which the P-135-ABP type of plant villin is lacking, the P-115-ABP type showed co-localization with actin-filament cables anchored on the intracellular surface of chloroplasts. These results indicated that plant villins are widely distributed and involved in the organization of actin

  8. Serotonin Receptors in Hippocampus

    Science.gov (United States)

    Berumen, Laura Cristina; Rodríguez, Angelina; Miledi, Ricardo; García-Alcocer, Guadalupe

    2012-01-01

    Serotonin is an ancient molecular signal and a recognized neurotransmitter brainwide distributed with particular presence in hippocampus. Almost all serotonin receptor subtypes are expressed in hippocampus, which implicates an intricate modulating system, considering that they can be localized as autosynaptic, presynaptic, and postsynaptic receptors, even colocalized within the same cell and being target of homo- and heterodimerization. Neurons and glia, including immune cells, integrate a functional network that uses several serotonin receptors to regulate their roles in this particular part of the limbic system. PMID:22629209

  9. A pomegranate (Punica granatum L.) WD40-repeat gene is a functional homologue of Arabidopsis TTG1 and is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development.

    Science.gov (United States)

    Ben-Simhon, Zohar; Judeinstein, Sylvie; Nadler-Hassar, Talia; Trainin, Taly; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

    2011-11-01

    Anthocyanins are the major pigments responsible for the pomegranate (Punica granatum L.) fruit skin color. The high variability in fruit external color in pomegranate cultivars reflects variations in anthocyanin composition. To identify genes involved in the regulation of anthocyanin biosynthesis pathway in the pomegranate fruit skin we have isolated, expressed and characterized the pomegranate homologue of the Arabidopsis thaliana TRANSPARENT TESTA GLABRA1 (TTG1), encoding a WD40-repeat protein. The TTG1 protein is a regulator of anthocyanins and proanthocyanidins (PAs) biosynthesis in Arabidopsis, and acts by the formation of a transcriptional regulatory complex with two other regulatory proteins: bHLH and MYB. Our results reveal that the pomegranate gene, designated PgWD40, recovered the anthocyanin, PAs, trichome and seed coat mucilage phenotype in Arabidopsis ttg1 mutant. PgWD40 expression and anthocyanin composition in the skin were analyzed during pomegranate fruit development, in two accessions that differ in skin color intensity and timing of appearance. The results indicate high positive correlation between the total cyanidin derivatives quantity (red pigments) and the expression level of PgWD40. Furthermore, strong correlation was found between the steady state levels of PgWD40 transcripts and the transcripts of pomegranate homologues of the structural genes PgDFR and PgLDOX. PgWD40, PgDFR and PgLDOX expression also correlated with the expression of pomegranate homologues of the regulatory genes PgAn1 (bHLH) and PgAn2 (MYB). On the basis of our results we propose that PgWD40 is involved in the regulation of anthocyanin biosynthesis during pomegranate fruit development and that expression of PgWD40, PgAn1 and PgAn2 in the pomegranate fruit skin is required to regulate the expression of downstream structural genes involved in the anthocyanin biosynthesis.

  10. Synergistic regulation of the mouse orphan nuclear receptor SHP gene promoter by CLOCK-BMAL1 and LRH-1

    International Nuclear Information System (INIS)

    Oiwa, Ako; Kakizawa, Tomoko; Miyamoto, Takahide; Yamashita, Koh; Jiang, Wei; Takeda, Teiji; Suzuki, Satoru; Hashizume, Kiyoshi

    2007-01-01

    Small heterodimer partner (SHP; NR0B2) is an orphan nuclear receptor and acts as a repressor for wide variety of nuclear hormone receptors. We demonstrated here that mouse SHP mRNA showed a circadian expression pattern in the liver. Transient transfection of the mSHP promoter demonstrated that CLOCK-BMAL1, core circadian clock components, bound to E-box (CACGTG), and stimulated the promoter activity by 4-fold. Liver receptor homologue-1 (LRH-1; NR5A2) stimulated the mSHP promoter, and CLOCK-BMAL1 synergistically enhanced the LRH-1-mediated transactivation. Interestingly, SHP did not affect the CLOCK-BMAL1-mediated promoter activity, but strongly repressed the synergistic activation of CLOCK-BMAL1 and LRH-1. Furthermore, in vitro pull-down assays revealed the existence of direct protein-protein interaction between LRH-1 and CLOCK. In summary, this study shows that CLOCK-BMAL1, LRH-1 and SHP coordinately regulate the mSHP gene to generate the circadian oscillation. The cyclic expression of mSHP may affect daily activity of other nuclear receptors and contribute to circadian liver functions

  11. Cytokine-like factor-1, a novel soluble protein, shares homology with members of the cytokine type I receptor family.

    Science.gov (United States)

    Elson, G C; Graber, P; Losberger, C; Herren, S; Gretener, D; Menoud, L N; Wells, T N; Kosco-Vilbois, M H; Gauchat, J F

    1998-08-01

    In this report we describe the identification, cloning, and expression pattern of human cytokine-like factor 1 (hCLF-1) and the identification and cloning of its murine homologue. They were identified from expressed sequence tags using amino acid sequences from conserved regions of the cytokine type I receptor family. Human CLF-1 and murine CLF-1 shared 96% amino acid identity and significant homology with many cytokine type I receptors. CLF-1 is a secreted protein, suggesting that it is either a soluble subunit within a cytokine receptor complex, like the soluble form of the IL-6R alpha-chain, or a subunit of a multimeric cytokine, e.g., IL-12 p40. The highest levels of hCLF-1 mRNA were observed in lymph node, spleen, thymus, appendix, placenta, stomach, bone marrow, and fetal lung, with constitutive expression of CLF-1 mRNA detected in a human kidney fibroblastic cell line. In fibroblast primary cell cultures, CLF-1 mRNA was up-regulated by TNF-alpha, IL-6, and IFN-gamma. Western blot analysis of recombinant forms of hCLF-1 showed that the protein has the tendency to form covalently linked di- and tetramers. These results suggest that CLF-1 is a novel soluble cytokine receptor subunit or part of a novel cytokine complex, possibly playing a regulatory role in the immune system and during fetal development.

  12. Neurokinin-3 Receptor Binding in Guinea Pig, Monkey, and Human Brain: In Vitro and in Vivo Imaging Using the Novel Radioligand, [18F]Lu AF10628.

    Science.gov (United States)

    Varnäs, Katarina; Finnema, Sjoerd J; Stepanov, Vladimir; Takano, Akihiro; Tóth, Miklós; Svedberg, Marie; Møller Nielsen, Søren; Khanzhin, Nikolay A; Juhl, Karsten; Bang-Andersen, Benny; Halldin, Christer; Farde, Lars

    2016-08-01

    Previous autoradiography studies have suggested a marked interspecies variation in the neuroanatomical localization and expression levels of the neurokinin 3 receptor, with high density in the brain of rat, gerbil, and guinea pig, but at the time offered no conclusive evidence for its presence in the human brain. Hitherto available radioligands have displayed low affinity for the human neurokinin 3 receptor relative to the rodent homologue and may thus not be optimal for cross-species analyses of the expression of this protein. A novel neurokinin 3 receptor radioligand, [(18)F]Lu AF10628 ((S)-N-(cyclobutyl(3-fluorophenyl)methyl)-8-fluoro-2-((3-[(18)F]-fluoropropyl)amino)-3-methyl-1-oxo-1,2-dihydroisoquinoline-4-carboxamide), was synthesized and used for autoradiography studies in cryosections from guinea pig, monkey, and human brain as well as for positron emission tomography studies in guinea pig and monkey. The results confirmed previous observations of interspecies variation in the neurokinin 3 receptor brain localization with more extensive distribution in guinea pig than in primate brain. In the human brain, specific binding to the neurokinin 3 receptor was highest in the amygdala and in the hypothalamus and very low in other regions examined. Positron emission tomography imaging showed a pattern consistent with that observed using autoradiography. The radioactivity was, however, found to accumulate in skull bone, which limits the use of this radioligand for in vivo quantification of neurokinin 3 receptor binding. Species differences in the brain distribution of neurokinin 3 receptors should be considered when using animal models for predicting human neurokinin 3 receptor pharmacology. For positron emission tomography imaging of brain neurokinin 3 receptors, additional work is required to develop a radioligand with more favorable in vivo properties. © The Author 2016. Published by Oxford University Press on behalf of CINP.

  13. Discovery of practical production processes for arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides: Beginning of a new era of “super-trifluoromethyl” arene chemistry and its industry

    Directory of Open Access Journals (Sweden)

    Teruo Umemoto

    2012-03-01

    Full Text Available Various arylsulfur pentafluorides, ArSF5, have long been desired in both academic and industrial areas, and ArSF5 compounds have attracted considerable interest in many areas such as medicines, agrochemicals, and other new materials, since the highly stable SF5 group is considered a “super-trifluoromethyl group” due to its significantly higher electronegativity and lipophilicity. This article describes the first practical method for the production of various arylsulfur pentafluorides and their higher homologues, bis- and tris(sulfur pentafluorides, from the corresponding diaryl disulfides or aryl thiols. The method consists of two steps: (Step 1 treatment of a diaryl disulfide or an aryl thiol with chlorine in the presence of an alkali metal fluoride, and (step 2 treatment of the resulting arylsulfur chlorotetrafluoride with a fluoride source, such as ZnF2, HF, and Sb(III/V fluorides. The intermediate arylsulfur chlorotetrafluorides were isolated by distillation or recrystallization and characterized. The aspects of these new reactions are revealed and reaction mechanisms are discussed. As the method offers considerable improvement over previous methods in cost, yield, practicality, applicability, and large-scale production, the new processes described here can be employed as the first practical methods for the economical production of various arylsulfur pentafluorides and their higher homologues, which could then open up a new era of “super-trifluoromethyl” arene chemistry and its applications in many areas.

  14. Divergent Small Tim Homologues Are Associated with TbTim17 and Critical for the Biogenesis of TbTim17 Protein Complexes in Trypanosoma brucei

    Science.gov (United States)

    Smith, Joseph T.; Singha, Ujjal K.; Misra, Smita

    2018-01-01

    ABSTRACT The small Tim proteins belong to a group of mitochondrial intermembrane space chaperones that aid in the import of mitochondrial inner membrane proteins with internal targeting signals. Trypanosoma brucei, the protozoan parasite that causes African trypanosomiasis, possesses multiple small Tim proteins that include homologues of T. brucei Tim9 (TbTim9) and Tim10 (TbTim10) and a unique small Tim that shares homology with both Tim8 and Tim13 (TbTim8/13). Here, we found that these three small TbTims are expressed as soluble mitochondrial intermembrane space proteins. Coimmunoprecipitation and mass spectrometry analysis showed that the small TbTims stably associated with each other and with TbTim17, the major component of the mitochondrial inner membrane translocase in T. brucei. Yeast two-hybrid analysis indicated direct interactions among the small TbTims; however, their interaction patterns appeared to be different from those of their counterparts in yeast and humans. Knockdown of the small TbTims reduced cell growth and decreased the steady-state level of TbTim17 and T. brucei ADP/ATP carrier (TbAAC), two polytopic mitochondrial inner membrane proteins. Knockdown of small TbTims also reduced the matured complexes of TbTim17 in mitochondria. Depletion of any of the small TbTims reduced TbTim17 import moderately but greatly hampered the stability of the TbTim17 complexes in T. brucei. Altogether, our results revealed that TbTim9, TbTim10, and TbTim8/13 interact with each other, associate with TbTim17, and play a crucial role in the integrity and maintenance of the levels of TbTim17 complexes. IMPORTANCE Trypanosoma brucei is the causative agent of African sleeping sickness. The parasite’s mitochondrion represents a useful source for potential chemotherapeutic targets. Similarly to yeast and humans, mitochondrial functions depend on the import of proteins that are encoded in the nucleus and made in the cytosol. Even though the machinery involved in this

  15. Ionotropic crustacean olfactory receptors.

    Directory of Open Access Journals (Sweden)

    Elizabeth A Corey

    Full Text Available The nature of the olfactory receptor in crustaceans, a major group of arthropods, has remained elusive. We report that spiny lobsters, Panulirus argus, express ionotropic receptors (IRs, the insect chemosensory variants of ionotropic glutamate receptors. Unlike insects IRs, which are expressed in a specific subset of olfactory cells, two lobster IR subunits are expressed in most, if not all, lobster olfactory receptor neurons (ORNs, as confirmed by antibody labeling and in situ hybridization. Ligand-specific ORN responses visualized by calcium imaging are consistent with a restricted expression pattern found for other potential subunits, suggesting that cell-specific expression of uncommon IR subunits determines the ligand sensitivity of individual cells. IRs are the only type of olfactory receptor that we have detected in spiny lobster olfactory tissue, suggesting that they likely mediate olfactory signaling. Given long-standing evidence for G protein-mediated signaling in activation of lobster ORNs, this finding raises the interesting specter that IRs act in concert with second messenger-mediated signaling.

  16. Human Freud-2/CC2D1B: a novel repressor of postsynaptic serotonin-1A receptor expression.

    Science.gov (United States)

    Hadjighassem, Mahmoud R; Austin, Mark C; Szewczyk, Bernadeta; Daigle, Mireille; Stockmeier, Craig A; Albert, Paul R

    2009-08-01

    Altered expression of serotonin-1A (5-HT1A) receptors, both presynaptic in the raphe nuclei and post-synaptic in limbic and cortical target areas, has been implicated in mood disorders such as major depression and anxiety. Within the 5-HT1A receptor gene, a powerful dual repressor element (DRE) is regulated by two protein complexes: Freud-1/CC2D1A and a second, unknown repressor. Here we identify human Freud-2/CC2D1B, a Freud-1 homologue, as the second repressor. Freud-2 distribution was examined with Northern and Western blot, reverse transcriptase polymerase chain reaction, and immunohistochemistry/immunofluorescence; Freud-2 function was examined by electrophoretic mobility shift, reporter assay, and Western blot. Freud-2 RNA was widely distributed in brain and peripheral tissues. Freud-2 protein was enriched in the nuclear fraction of human prefrontal cortex and hippocampus but was weakly expressed in the dorsal raphe nucleus. Freud-2 immunostaining was co-localized with 5-HT1A receptors, neuronal and glial markers. In prefrontal cortex, Freud-2 was expressed at similar levels in control and depressed male subjects. Recombinant hFreud-2 protein bound specifically to 5' or 3' human DRE adjacent to the Freud-1 site. Human Freud-2 showed strong repressor activity at the human 5-HT1A or heterologous promoter in human HEK-293 5-HT1A-negative cells and neuronal SK-N-SH cells, a model of postsynaptic 5-HT1A receptor-positive cells. Furthermore, small interfering RNA knockdown of endogenous hFreud-2 expression de-repressed 5-HT1A promoter activity and increased levels of 5-HT1A receptor protein in SK-N-SH cells. Human Freud-2 binds to the 5-HT1A DRE and represses the human 5-HT1A receptor gene to regulate its expression in non-serotonergic cells and neurons.

  17. Characterization of the receptors for mycobacterial cord factor in Guinea pig.

    Directory of Open Access Journals (Sweden)

    Kenji Toyonaga

    Full Text Available Guinea pig is a widely used animal for research and development of tuberculosis vaccines, since its pathological disease process is similar to that present in humans. We have previously reported that two C-type lectin receptors, Mincle (macrophage inducible C-type lectin, also called Clec4e and MCL (macrophage C-type lectin, also called Clec4d, recognize the mycobacterial cord factor, trehalose-6,6'-dimycolate (TDM. Here, we characterized the function of the guinea pig homologue of Mincle (gpMincle and MCL (gpMCL. gpMincle directly bound to TDM and transduced an activating signal through ITAM-bearing adaptor molecule, FcRγ. Whereas, gpMCL lacked C-terminus and failed to bind to TDM. mRNA expression of gpMincle was detected in the spleen, lymph nodes and peritoneal macrophages and it was strongly up-regulated upon stimulation of zymosan and TDM. The surface expression of gpMincle was detected on activated macrophages by a newly established monoclonal antibody that also possesses a blocking activity. This antibody potently suppressed TNF production in BCG-infected macrophages. Collectively, gpMincle is the TDM receptor in the guinea pig and TDM-Mincle axis is involved in host immune responses against mycobacteria.

  18. Characterization of the receptors for mycobacterial cord factor in Guinea pig.

    Science.gov (United States)

    Toyonaga, Kenji; Miyake, Yasunobu; Yamasaki, Sho

    2014-01-01

    Guinea pig is a widely used animal for research and development of tuberculosis vaccines, since its pathological disease process is similar to that present in humans. We have previously reported that two C-type lectin receptors, Mincle (macrophage inducible C-type lectin, also called Clec4e) and MCL (macrophage C-type lectin, also called Clec4d), recognize the mycobacterial cord factor, trehalose-6,6'-dimycolate (TDM). Here, we characterized the function of the guinea pig homologue of Mincle (gpMincle) and MCL (gpMCL). gpMincle directly bound to TDM and transduced an activating signal through ITAM-bearing adaptor molecule, FcRγ. Whereas, gpMCL lacked C-terminus and failed to bind to TDM. mRNA expression of gpMincle was detected in the spleen, lymph nodes and peritoneal macrophages and it was strongly up-regulated upon stimulation of zymosan and TDM. The surface expression of gpMincle was detected on activated macrophages by a newly established monoclonal antibody that also possesses a blocking activity. This antibody potently suppressed TNF production in BCG-infected macrophages. Collectively, gpMincle is the TDM receptor in the guinea pig and TDM-Mincle axis is involved in host immune responses against mycobacteria.

  19. Costimulatory receptors in a teleost fish: Typical CD28, elusive CTLA4

    Science.gov (United States)

    Bernard, D.; Riteau, B.; Hansen, J.D.; Phillips, R.B.; Michel, F.; Boudinot, P.; Benmansour, A.

    2006-01-01

    T cell activation requires both specific recognition of the peptide-MHC complex by the TCR and additional signals delivered by costimulatory receptors. We have identified rainbow trout sequences similar to CD28 (rbtCD28) and CTLA4 (rbtCTLA4). rbtCD28 and rbtCTLA4 are composed of an extracellular Ig-superfamily V domain, a transmembrane region, and a cytoplasmic tail. The presence of a conserved ligand binding site within the V domain of both molecules suggests that these receptors likely recognize the fish homologues of the B7 family. The mRNA expression pattern of rbtCD28 and rbtCTLA4 in naive trout is reminiscent to that reported in humans and mice, because rbtCTLA4 expression within trout leukocytes was quickly up-regulated following PHA stimulation and virus infection. The cytoplasmic tail of rbtCD28 possesses a typical motif that is conserved in mammalian costimulatory receptors for signaling purposes. A chimeric receptor made of the extracellular domain of human CD28 fused to the cytoplasmic tail of rbtCD28 promoted TCR-induced IL-2 production in a human T cell line, indicating that rbtCD28 is indeed a positive costimulator. The cytoplasmic tail of rtrtCTLA4 lacked obvious signaling motifs and accordingly failed to signal when fused to the huCD28 extracellular domain. Interestingly, rbtCTLA4 and rbtCD28 are not positioned on the same chromosome and thus do not belong to a unique costimulatory cluster as in mammals. Finally, oar results raise questions about the origin and evolution of positive and negative costimulation in vertebrate immune systems. Copyright ?? 2006 by The American Association of Immunologists, Inc.

  20. The plant natriuretic peptide receptor is a guanylyl cyclase and enables cGMP-dependent signaling

    KAUST Repository

    Turek, Ilona

    2016-03-05

    The functional homologues of vertebrate natriuretic peptides (NPs), the plant natriuretic peptides (PNPs), are a novel class of peptidic hormones that signal via guanosine 3′,5′-cyclic monophosphate (cGMP) and systemically affect plant salt and water balance and responses to biotrophic plant pathogens. Although there is increasing understanding of the complex roles of PNPs in plant responses at the systems level, little is known about the underlying signaling mechanisms. Here we report isolation and identification of a novel Leucine-Rich Repeat (LRR) protein that directly interacts with A. thaliana PNP, AtPNP-A. In vitro binding studies revealed that the Arabidopsis AtPNP-A binds specifically to the LRR protein, termed AtPNP-R1, and the active region of AtPNP-A is sufficient for the interaction to occur. Importantly, the cytosolic part of the AtPNP-R1, much like in some vertebrate NP receptors, harbors a catalytic center diagnostic for guanylyl cyclases and the recombinant AtPNP-R1 is capable of catalyzing the conversion of guanosine triphosphate to cGMP. In addition, we show that AtPNP-A causes rapid increases of cGMP levels in wild type (WT) leaf tissue while this response is significantly reduced in the atpnp-r1 mutants. AtPNP-A also causes cGMP-dependent net water uptake into WT protoplasts, and hence volume increases, whereas responses of the protoplasts from the receptor mutant are impaired. Taken together, our results suggest that the identified LRR protein is an AtPNP-A receptor essential for the PNP-dependent regulation of ion and water homeostasis in plants and that PNP- and vertebrate NP-receptors and their signaling mechanisms share surprising similarities. © 2016 Springer Science+Business Media Dordrecht

  1. Assays for calcitonin receptors

    International Nuclear Information System (INIS)

    Teitelbaum, A.P.; Nissenson, R.A.; Arnaud, C.D.

    1985-01-01

    The assays for calcitonin receptors described focus on their use in the study of the well-established target organs for calcitonin, bone and kidney. The radioligand used in virtually all calcitonin binding studies is 125 I-labelled salmon calcitonin. The lack of methionine residues in this peptide permits the use of chloramine-T for the iodination reaction. Binding assays are described for intact bone, skeletal plasma membranes, renal plasma membranes, and primary kidney cell cultures of rats. Studies on calcitonin metabolism in laboratory animals and regulation of calcitonin receptors are reviewed

  2. The GPCR membrane receptor, DopEcR, mediates the actions of both dopamine and ecdysone to control sex pheromone perception in an insect

    Directory of Open Access Journals (Sweden)

    Antoine eAbrieux

    2014-09-01

    Full Text Available Olfactory information mediating sexual behavior is crucial for reproduction in many animals, including insects. In male moths, the macroglomerular complex of the primary olfactory center, the antennal lobe (AL is specialized in the treatment of information on the female-emitted sex pheromone. Evidence is accumulating that modulation of behavioral pheromone responses occurs through neuronal plasticity via the action of hormones and/or catecholamines. We recently showed that a G-protein-coupled receptor (GPCR, AipsDopEcR, with its homologue known in Drosophila for its double affinity to the main insect steroid hormone 20-hydroxyecdysone (20E, and dopamine (DA, present in the ALs, is involved in the behavioral response to pheromone in the moth, Agrotis ipsilon. Here we tested the role of AipsDopEcR as compared to nuclear 20E receptors in central pheromone processing combining receptor inhibition with intracellular recordings of AL neurons. We show that the sensitivity of AL neurons for the pheromone in males decreases strongly after AipsDopEcR-dsRNA injection but also after inhibition of nuclear 20E receptors. Moreover we tested the involvement of 20E and DA in the receptor-mediated behavioral modulation in wind tunnel experiments, using ligand applications and receptor inhibition treatments. We show that both ligands are necessary and act on AipsDopEcR-mediated behavior. Altogether these results indicate that the GPCR membrane receptor, AipsDopEcR, controls sex pheromone perception through the action of both 20E and DA in the central nervous system, probably in concert with 20E action through nuclear receptors.

  3. Angiotensin type 2 receptor (AT2R) and receptor Mas

    DEFF Research Database (Denmark)

    Villela, Daniel; Leonhardt, Julia; Patel, Neal

    2015-01-01

    The angiotensin type 2 receptor (AT2R) and the receptor Mas are components of the protective arms of the renin-angiotensin system (RAS), i.e. they both mediate tissue protective and regenerative actions. The spectrum of actions of these two receptors and their signalling mechanisms display striki...

  4. Superfamily of genes encoding G protein-coupled receptors in the diamondback moth Plutella xylostella (Lepidoptera: Plutellidae).

    Science.gov (United States)

    Wu, S-F; Yu, H-Y; Jiang, T-T; Gao, C-F; Shen, J-L

    2015-08-01

    G protein-coupled receptors (GPCRs) are the largest and most versatile superfamily of cell membrane proteins, which mediate various physiological processes including reproduction, development and behaviour. The diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae), is one of the most notorious insect pests, preferentially feeding on cruciferous plants. P. xylostella is not only one of the world's most widespread lepidopteran insects, but has also developed resistance to nearly all classes of insecticides. Although the mechanisms of insecticide resistance have been studied extensively in many insect species, few investigations have been carried out on GPCRs in P. xylostella. In the present study, we identified 95 putative GPCRs in the P. xylostella genome. The identified GPCRs were compared with their homologues in Bombyx mori and Drosophila melanogaster. Our results suggest that GPCRs in different insect species may have evolved by a birth-and-death process. One of the differences among compared insects is the duplication of short neuropeptide F receptor and adipokinetic hormone receptors in P. xylostella and B. mori. Another divergence is the decrease in quantity and diversity of the stress-tolerance gene, Mth, in P. xylostella. The evolution by the birth-and-death process is probably involved in adaptation to the feeding behaviour, reproduction and stress responses of P. xylostella. Some of the genes identified in the present study could be potential targets for the development of novel pesticides. © 2015 The Royal Entomological Society.

  5. TLX: An elusive receptor.

    Science.gov (United States)

    Benod, Cindy; Villagomez, Rosa; Webb, Paul

    2016-03-01

    TLX (tailless receptor) is a member of the nuclear receptor superfamily and belongs to a class of nuclear receptors for which no endogenous or synthetic ligands have yet been identified. TLX is a promising therapeutic target in neurological disorders and brain tumors. Thus, regulatory ligands for TLX need to be identified to complete the validation of TLX as a useful target and would serve as chemical probes to pursue the study of this receptor in disease models. It has recently been proved that TLX is druggable. However, to identify potent and specific TLX ligands with desirable biological activity, a deeper understanding of where ligands bind, how they alter TLX conformation and of the mechanism by which TLX mediates the transcription of its target genes is needed. While TLX is in the process of escaping from orphanhood, future ligand design needs to progress in parallel with improved understanding of (i) the binding cavity or surfaces to target with small molecules on the TLX ligand binding domain and (ii) the nature of the TLX coregulators in particular cell and disease contexts. Both of these topics are discussed in this review. Copyright © 2015 Elsevier Ltd. All rights reserved.

  6. Glutamate receptor ligands

    DEFF Research Database (Denmark)

    Guldbrandt, Mette; Johansen, Tommy N; Frydenvang, Karla Andrea

    2002-01-01

    Homologation and substitution on the carbon backbone of (S)-glutamic acid [(S)-Glu, 1], as well as absolute stereochemistry, are structural parameters of key importance for the pharmacological profile of (S)-Glu receptor ligands. We describe a series of methyl-substituted 2-aminoadipic acid (AA...

  7. Ginkgolides and glycine receptors

    DEFF Research Database (Denmark)

    Jaracz, Stanislav; Nakanishi, Koji; Jensen, Anders A.

    2004-01-01

    Ginkgolides from the Ginkgo biloba tree are diterpenes with a cage structure consisting of six five-membered rings and a unique tBu group. They exert a variety of biological properties. In addition to being antagonists of the platelet activating factor receptor (PAFR), it has recently been shown ...

  8. adrenergic receptor with preeclampsia

    African Journals Online (AJOL)

    User

    2011-05-09

    May 9, 2011 ... due to a post- receptor defect (Karadas et al., 2007). Several polymorphisms have ... the detection of the Arg16Gly polymorphism, overnight digestion at. 37°C with 10 U ..... DW, Wood AJ, Stein CM (2004). Beta2-adrenoceptor ...

  9. Metformin and insulin receptors

    International Nuclear Information System (INIS)

    Vigneri, R.; Gullo, D.; Pezzino, V.

    1984-01-01

    The authors evaluated the effect of metformin (N,N-dimethylbiguanide), a biguanide known to be less toxic than phenformin, on insulin binding to its receptors, both in vitro and in vivo. Specific 125 I-insulin binding to cultured IM-9 human lymphocytes and MCF-7 human breast cancer cells was determined after preincubation with metformin. Specific 125 I-insulin binding to circulating monocytes was also evaluated in six controls, eight obese subjects, and six obese type II diabetic patients before and after a short-term treatment with metformin. Plasma insulin levels and blood glucose were also measured on both occasions. Metformin significantly increased insulin binding in vitro to both IM-9 lymphocytes and MCF-7 cells; the maximum increment was 47.1% and 38.0%, respectively. Metformin treatment significantly increased insulin binding in vivo to monocytes of obese subjects and diabetic patients. Scatchard analysis indicated that the increased binding was mainly due to an increase in receptor capacity. Insulin binding to monocytes of normal controls was unchanged after metformin as were insulin levels in all groups; blood glucose was significantly reduced after metformin only in diabetic patients. These data indicate that metformin increases insulin binding to its receptors in vitro and in vivo. The effect in vivo is observed in obese subjects and in obese type II diabetic patients, paralleling the clinical effectiveness of this antidiabetic agent, and is not due to receptor regulation by circulating insulin, since no variation in insulin levels was recorded

  10. Olfactory Receptor Database: a sensory chemoreceptor resource

    OpenAIRE

    Skoufos, Emmanouil; Marenco, Luis; Nadkarni, Prakash M.; Miller, Perry L.; Shepherd, Gordon M.

    2000-01-01

    The Olfactory Receptor Database (ORDB) is a WWW-accessible database that has been expanded from an olfactory receptor resource to a chemoreceptor resource. It stores data on six classes of G-protein-coupled sensory chemoreceptors: (i) olfactory receptor-like proteins, (ii) vomeronasal receptors, (iii) insect olfactory receptors, (iv) worm chemoreceptors, (v) taste papilla receptors and (vi) fungal pheromone receptors. A complementary database of the ligands of these receptors (OdorDB) has bee...

  11. CRP-ductin, the mouse homologue of gp-340/deleted in malignant brain tumors 1 (DMBT1), binds gram-positive and gram-negative bacteria and interacts with lung surfactant protein D

    DEFF Research Database (Denmark)

    Madsen, Jens; Tornøe, Ida; Nielsen, Ole

    2003-01-01

    CRP-ductin is a protein expressed mainly by mucosal epithelial cells in the mouse. Sequence homologies indicate that CRP-ductin is the mouse homologue of human gp-340, a glycoprotein that agglutinates microorganisms and binds the lung mucosal collectin surfactant protein-D (SP-D). Here we report...... that purified CRP-ductin binds human SP-D in a calcium-dependent manner and that the binding is not inhibited by maltose. The same properties have previously been observed for gp-340 binding of SP-D. CRP-ductin also showed calcium-dependent binding to both gram-positive and -negative bacteria. A polyclonal...... antibody raised against gp-340 reacted specifically with CRP-ductin in Western blots. Immunoreactivity to CRP-ductin was found in the exocrine pancreas, in epithelial cells throughout the gastrointestinal tract and in the parotid ducts. A panel of RNA preparations from mouse tissues was screened for CRP...

  12. SimCP3—An Advanced Homologue of SimCP2 as a Solution-Processed Small Molecular Host Material for Blue Phosphorescence Organic Light-Emitting Diodes

    Directory of Open Access Journals (Sweden)

    Yi-Ting Lee

    2016-09-01

    Full Text Available We have overcome the synthetic difficulty of 9,9′,9′′,9′′′,9′′′′,9′′′′′-((phenylsilanetriyltris(benzene-5,3,1-triylhexakis(9H-carbazole (SimCP3 an advanced homologue of previously known SimCP2 as a solution-processed, high triplet gap energy host material for a blue phosphorescence dopant. A series of organic light-emitting diodes based on blue phosphorescence dopant iridium (III bis(4,6-difluorophenylpyridinatopicolate, FIrpic, were fabricated and tested to demonstrate the validity of solution-processed SimCP3 in the device fabrication.

  13. Crystallization and preliminary X-ray diffraction studies of the ubiquitin-like (UbL) domain of the human homologue A of Rad23 (hHR23A) protein.

    Science.gov (United States)

    Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla

    2009-09-01

    Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.

  14. The C-type lectin receptor SIGNR3 binds to fungi present in commensal microbiota and influences immune regulation in experimental colitis

    Directory of Open Access Journals (Sweden)

    Magdalena eEriksson

    2013-07-01

    Full Text Available Inflammatory bowel disease is a condition of acute and chronic inflammation of the gut. An important factor contributing to pathogenesis is a dysregulated mucosal immunity against commensal bacteria and fungi. Host pattern recognition receptors sense commensals in the gut and are involved in maintaining the balance between controlled responses to pathogens and overwhelming innate immune activation. C-type lectin receptors (CLRs are pattern recognition receptors recognizing glycan structures on pathogens and self-antigens. Here we examined the role of the murine CLR SIGNR3 in the recognition of commensals and its involvement in intestinal immunity. SIGNR3 is the closest murine homologue of the human DC-SIGN receptor recognizing similar carbohydrate ligands such as terminal fucose or high-mannose glycans. We discovered that SIGNR3 recognizes fungi present in the commensal microbiota. To analyze if this interaction impacts the intestinal immunity against microbiota, the dextran sulfate sodium (DSS-induced colitis model was employed. SIGNR3-/- mice exhibited an increased weight loss associated with more severe colitis symptoms compared to wild-type control mice. The increased inflammation in SIGNR3-/- mice was accompanied by a higher level of TNF-α in colon. Our findings demonstrate for the first time that SIGNR3 recognizes intestinal fungi and has an immune regulatory role in colitis.

  15. Prostaglandin Receptor Signaling in Disease

    Directory of Open Access Journals (Sweden)

    Toshiyuki Matsuoka

    2007-01-01

    Full Text Available Prostanoids, consisting of the prostaglandins (PGs and the thromboxanes (TXs, are a group of lipid mediators formed in response to various stimuli. They include PGD2, PGE2, PGF2α, PGI2, and TXA2. They are released outside of the cells immediately after synthesis, and exert their actions by binding to a G-protein coupled rhodopsin-type receptor on the surface of target cells. There are eight types of the prostanoid receptors conserved in mammals from mouse to human. They are the PGD receptor (DP, four subtypes of the PGE receptor (EP1, EP2, EP3, and EP4, the PGF receptor (FP, PGI receptor (IP, and TXA receptor (TP. Recently, mice deficient in each of these prostanoid receptors were generated and subjected to various experimental models of disease. These studies have revealed the roles of PG receptor signaling in various pathological conditions, and suggest that selective manipulation of the prostanoid receptors may be beneficial in treatment of the pathological conditions. Here we review these recent findings of roles of prostanoid receptor signaling and their therapeutic implications.

  16. The interleukin-4 receptor: signal transduction by a hematopoietin receptor.

    Science.gov (United States)

    Keegan, A D; Pierce, J H

    1994-02-01

    Over the last several years, the receptors for numerous cytokines have been molecularly characterized. Analysis of their amino acid sequences shows that some of these receptors bear certain motifs in their extracellular domains that define a family of receptors called the Hematopoietin receptor superfamily. Significant advances in characterizing the structure, function, and mechanisms of signal transduction have been made for several members of this family. The purpose of this review is to discuss the recent advances made for one of the family members, the interleukin (IL) 4 receptor. Other receptor systems have recently been reviewed elsewhere. The IL-4 receptor consists of, at the minimum, the cloned 140 kDa IL-4-binding chain with the potential for associating with other chains. The IL-4 receptor transduces its signal by activating a tyrosine kinase that phosphorylates cellular substrates, including the receptor itself, and the 170 kDa substrate called 4PS. Phosphorylated 4PS interacts with the SH2 domain of the enzyme PI-3'-kinase and increases its enzymatic activity. These early events in the IL-4 receptor initiated signaling pathway may trigger a series of signals that will ultimately lead to an IL-4 specific biologic outcome.

  17. Meeting report: nuclear receptors

    DEFF Research Database (Denmark)

    Tuckermann, Jan; Bourguet, William; Mandrup, Susanne

    2010-01-01

    The biannual European Molecular Biology Organization (EMBO) conference on nuclear receptors was organized by Beatrice Desvergne and Laszlo Nagy and took place in Cavtat near Dubrovnik on the Adriatic coast of Croatia September 25-29, 2009. The meeting brought together researchers from all over...... the world covering a wide spectrum from fundamental mechanistic studies to metabolism, clinical studies, and drug development. In this report, we summarize the recent and exciting findings presented by the speakers at the meeting....

  18. Neurotransmitter receptor imaging

    International Nuclear Information System (INIS)

    Cordes, M.; Hierholzer, J.; Nikolai-Beyer, K.

    1993-01-01

    The importance of neuroreceptor imaging in vivo using single photon emission tomography (SPECT) and positron emission tomography (PET) has increased enormously. The principal neurotransmitters, such as dopamine, GABA/benzodiazepine, acetylcholine, and serotonin, are presented with reference to anatomical, biochemical, and physiological features. The main radioligands for SPECT and PET are introduced, and methodological characteristics of both PET and SPECT presented. Finally, the results of neurotransmitter receptor imaging obtained so far will be discussed. (orig.) [de

  19. Thyroid Stimulating Hormone Receptor

    Directory of Open Access Journals (Sweden)

    Murat Tuncel

    2017-02-01

    Full Text Available Thyroid stimulating hormone receptor (TSHR plays a pivotal role in thyroid hormone metabolism. It is a major controller of thyroid cell function and growth. Mutations in TSHR may lead to several thyroid diseases, most commonly hyperthyroidism. Although its genetic and epigenetic alterations do not directly lead to carcinogenesis, it has a crucial role in tumor growth, which is initiated by several oncogenes. This article will provide a brief review of TSHR and related diseases.

  20. Scavenger receptors mediate the role of SUMO and Ftz-f1 in Drosophila steroidogenesis.

    Directory of Open Access Journals (Sweden)

    Ana Talamillo

    2013-04-01

    Full Text Available SUMOylation participates in ecdysteroid biosynthesis at the onset of metamorphosis in Drosophila melanogaster. Silencing the Drosophila SUMO homologue smt3 in the prothoracic gland leads to reduced lipid content, low ecdysone titers, and a block in the larval-pupal transition. Here we show that the SR-BI family of Scavenger Receptors mediates SUMO functions. Reduced levels of Snmp1 compromise lipid uptake in the prothoracic gland. In addition, overexpression of Snmp1 is able to recover lipid droplet levels in the smt3 knockdown prothoracic gland cells. Snmp1 expression depends on Ftz-f1 (an NR5A-type orphan nuclear receptor, the expression of which, in turn, depends on SUMO. Furthermore, we show by in vitro and in vivo experiments that Ftz-f1 is SUMOylated. RNAi-mediated knockdown of ftz-f1 phenocopies that of smt3 at the larval to pupal transition, thus Ftz-f1 is an interesting candidate to mediate some of the functions of SUMO at the onset of metamorphosis. Additionally, we demonstrate that the role of SUMOylation, Ftz-f1, and the Scavenger Receptors in lipid capture and mobilization is conserved in other steroidogenic tissues such as the follicle cells of the ovary. smt3 knockdown, as well as ftz-f1 or Scavenger knockdown, depleted the lipid content of the follicle cells, which could be rescued by Snmp1 overexpression. Therefore, our data provide new insights into the regulation of metamorphosis via lipid homeostasis, showing that Drosophila Smt3, Ftz-f1, and SR-BIs are part of a general mechanism for uptake of lipids such as cholesterol, required during development in steroidogenic tissues.

  1. Melatonin Receptor Genes in Vertebrates

    Directory of Open Access Journals (Sweden)

    Hua Dong Yin

    2013-05-01

    Full Text Available Melatonin receptors are members of the G protein-coupled receptor (GPCR family. Three genes for melatonin receptors have been cloned. The MT1 (or Mel1a or MTNR1A and MT2 (or Mel1b or MTNR1B receptor subtypes are present in humans and other mammals, while an additional melatonin receptor subtype, Mel1c (or MTNR1C, has been identified in fish, amphibians and birds. Another melatonin related orphan receptor, GPR50, which does not bind melatonin, is found exclusively in mammals. The hormone melatonin is secreted primarily by the pineal gland, with highest levels occurring during the dark period of a circadian cycle. This hormone acts systemically in numerous organs. In the brain, it is involved in the regulation of various neural and endocrine processes, and it readjusts the circadian pacemaker, the suprachiasmatic nucleus. This article reviews recent studies of gene organization, expression, evolution and mutations of melatonin receptor genes of vertebrates. Gene polymorphisms reveal that numerous mutations are associated with diseases and disorders. The phylogenetic analysis of receptor genes indicates that GPR50 is an outgroup to all other melatonin receptor sequences. GPR50 may have separated from a melatonin receptor ancestor before the split between MTNR1C and the MTNR1A/B ancestor.

  2. Characterization of a Vibrio vulnificus LysR homologue, HupR, which regulates expression of the haem uptake outer membrane protein, HupA.

    Science.gov (United States)

    Litwin, C M; Quackenbush, J

    2001-12-01

    In Vibrio vulnificus, the ability to acquire iron from the host has been shown to correlate with virulence. Here, we show that the DNA upstream of hupA (haem uptake receptor) in V. vulnificus encodes a protein in the inverse orientation to hupA (named hupR). HupR shares homology with the LysR family of positive transcriptional activators. A hupA-lacZ fusion contained on a plasmid was transformed into Fur(-), Fur(+)and HupR(-)strains of V. vulnificus. The beta-galactosidase assays and Northern blot analysis showed that transcription of hupA is negatively regulated by iron and the Fur repressor in V. vulnificus. Under low-iron conditions with added haemin, the expression of hupA in the hupR mutant was significantly lower than in the wild-type. This diminished response to haem was detected by both Northern blot and hupA-lacZ fusion analysis. The haem response of hupA in the hupR mutant was restored to wild-type levels when complemented with hupR in trans. These studies suggest that HupR may act as a positive regulator of hupA transcription under low-iron conditions in the presence of haemin. Copyright 2001 Academic Press.

  3. Flavivirus Entry Receptors: An Update

    Directory of Open Access Journals (Sweden)

    Manuel Perera-Lecoin

    2013-12-01

    Full Text Available Flaviviruses enter host cells by endocytosis initiated when the virus particles interact with cell surface receptors. The current model suggests that flaviviruses use at least two different sets of molecules for infectious entry: attachment factors that concentrate and/or recruit viruses on the cell surface and primary receptor(s that bind to virions and direct them to the endocytic pathway. Here, we present the currently available knowledge regarding the flavivirus receptors described so far with specific attention to C-type lectin receptors and the phosphatidylserine receptors, T-cell immunoglobulin and mucin domain (TIM and TYRO3, AXL and MER (TAM. Their role in flavivirus attachment and entry as well as their implication in the virus biology will be discussed in depth.

  4. The Arecibo Galaxy Environment Survey - X. The structure of halo gas around M33

    Czech Academy of Sciences Publication Activity Database

    Keenan, O.; Davies, J.I.; Taylor, Rhys; Minchin, R.F.

    2016-01-01

    Roč. 456, č. 1 (2016), s. 951-960 ISSN 0035-8711 R&D Projects: GA MŠk LG14013; GA ČR GAP209/12/1795 Institutional support: RVO:67985815 Keywords : galaxies * clusters * radio lines Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.961, year: 2016

  5. Adenosine Receptors and Wound Healing

    Directory of Open Access Journals (Sweden)

    Bruce N. Cronstein

    2004-01-01

    Full Text Available Recent studies have demonstrated that application of topical adenosine A2A receptor agonists promotes more rapid wound closure and clinical studies are currently underway to determine the utility of topical A2A adenosine receptor agonists in the therapy of diabetic foot ulcers. The effects of adenosine A2A receptors on the cells and tissues of healing wounds have only recently been explored. We review here the known effects of adenosine A2A receptor occupancy on the cells involved in wound healing.

  6. Virally encoded 7TM receptors

    DEFF Research Database (Denmark)

    Rosenkilde, M M; Waldhoer, M; Lüttichau, H R

    2001-01-01

    expression of this single gene in certain lymphocyte cell lineages leads to the development of lesions which are remarkably similar to Kaposi's sarcoma, a human herpesvirus 8 associated disease. Thus, this and other virally encoded 7TM receptors appear to be attractive future drug targets.......A number of herpes- and poxviruses encode 7TM G-protein coupled receptors most of which clearly are derived from their host chemokine system as well as induce high expression of certain 7TM receptors in the infected cells. The receptors appear to be exploited by the virus for either immune evasion...

  7. Adenosine receptor desensitization and trafficking.

    Science.gov (United States)

    Mundell, Stuart; Kelly, Eamonn

    2011-05-01

    As with the majority of G-protein-coupled receptors, all four of the adenosine receptor subtypes are known to undergo agonist-induced regulation in the form of desensitization and trafficking. These processes can limit the ability of adenosine receptors to couple to intracellular signalling pathways and thus reduce the ability of adenosine receptor agonists as well as endogenous adenosine to produce cellular responses. In addition, since adenosine receptors couple to multiple signalling pathways, these pathways may desensitize differentially, while the desensitization of one pathway could even trigger signalling via another. Thus, the overall picture of adenosine receptor regulation can be complex. For all adenosine receptor subtypes, there is evidence to implicate arrestins in agonist-induced desensitization and trafficking, but there is also evidence for other possible forms of regulation, including second messenger-dependent kinase regulation, heterologous effects involving G proteins, and the involvement of non-clathrin trafficking pathways such as caveolae. In this review, the evidence implicating these mechanisms is summarized for each adenosine receptor subtype, and we also discuss those issues of adenosine receptor regulation that remain to be resolved as well as likely directions for future research in this field. Copyright © 2010 Elsevier B.V. All rights reserved.

  8. Axonal GABAA receptors.

    Science.gov (United States)

    Trigo, Federico F; Marty, Alain; Stell, Brandon M

    2008-09-01

    Type A GABA receptors (GABA(A)Rs) are well established as the main inhibitory receptors in the mature mammalian forebrain. In recent years, evidence has accumulated showing that GABA(A)Rs are prevalent not only in the somatodendritic compartment of CNS neurons, but also in their axonal compartment. Evidence for axonal GABA(A)Rs includes new immunohistochemical and immunogold data: direct recording from single axonal terminals; and effects of local applications of GABA(A)R modulators on action potential generation, on axonal calcium signalling, and on neurotransmitter release. Strikingly, whereas presynaptic GABA(A)Rs have long been considered inhibitory, the new studies in the mammalian brain mostly indicate an excitatory action. Depending on the neuron that is under study, axonal GABA(A)Rs can be activated by ambient GABA, by GABA spillover, or by an autocrine action, to increase either action potential firing and/or transmitter release. In certain neurons, the excitatory effects of axonal GABA(A)Rs persist into adulthood. Altogether, axonal GABA(A)Rs appear as potent neuronal modulators of the mammalian CNS.

  9. 3-pyrazolone analogues of the 3-isoxazolol metabotropic excitatory amino acid receptor agonist homo-AMPA. Synthesis and pharmacological testing

    DEFF Research Database (Denmark)

    Zimmermann, D.; Janin, Y.L.; Brehm, L.

    1999-01-01

    the terminal carboxyl group has been replaced by various bioisosteric groups, such as phosphonic acid or 3-isoxazolol groups, have been shown to interact selectively with different subtypes of mGlu receptors. In this paper we report the synthesis of the 3-pyrazolone bioisosteres of a-AA, compounds (RS)-2-amino......-4-(1,2-dihydro-5-methyl-3-oxo-3H-pyrazol-4-yl)butyric acid (1) and (RS)-2-amino-4-(1,2-dihydro-1,5-dimethyl-3-oxo-3H-pyrazol-4-yl)butyric acid (2). At a number of steps in the reaction sequences used, the reactions took unexpected courses and provided products which could not be transformed......We have previously shown that the higher homologue of (S)-glutamic acid [(S)-Glu], (S)-a-aminoadipic acid [(S)-a-AA] is selectively recognized by the mGlu and mGlu subtypes of the family of metabotropic glutamic acid (mGlu) receptors. Furthermore, a number of analogues of (S)-a-AA, in which...

  10. Molecular and functional characterization of a novel gonadotropin-releasing-hormone receptor isolated from the common octopus (Octopus vulgaris).

    Science.gov (United States)

    Kanda, Atsuhiro; Takahashi, Toshio; Satake, Honoo; Minakata, Hiroyuki

    2006-04-01

    GnRH (gonadotropin-releasing hormone) plays a pivotal role in the regulation of reproduction in vertebrates through interaction with a specific receptor. Previously, we isolated a GnRH homologue, oct-GnRH, from the common octopus (Octopus vulgaris). In the present study, we have identified a GnRH receptor (oct-GnRHR) specific for oct-GnRH from Octopus brain. Oct-GnRHR includes domains and motifs typical of vertebrate GnRH receptors. The intron-inserted positions are conserved between oct-GnRHR and the chordate GnRHR genes. The oct-GnRHR expressed in Xenopus (South African clawed frog) oocytes was responsive to oct-GnRH, but not to any other HPLC fractions of the Octopus brain extract. These results show that oct-GnRHR is an authentic receptor for oct-GnRH. Southern blotting of reverse-transcription PCR products revealed that the oct-GnRHR mRNA was widely distributed in the central and peripheral nervous systems and in several peripheral tissues. In situ hybridization showed that oct-GnRHR mRNA was expressed in some regions involved in autonomic functions, feeding, memory and movement. Oct-GnRH was shown to induce steroidogenesis of testosterone, progesterone and 17beta-oestradiol in Octopus ovary and testis, where oct-GnRHR was abundantly expressed. These results suggest that oct-GnRH, like its vertebrate counterparts, acts as a multifunctional neurotransmitter, neuromodulator and hormone-like factor, both in Octopus central nervous system and peripheral tissues, and that both structure and functions of the GnRH family are, at least partially, evolutionarily conserved between octopuses and chordates.

  11. Molecular and functional characterization of a novel gonadotropin-releasing-hormone receptor isolated from the common octopus (Octopus vulgaris)

    Science.gov (United States)

    Kanda, Atsuhiro; Takahashi, Toshio; Satake, Honoo; Minakata, Hiroyuki

    2005-01-01

    GnRH (gonadotropin-releasing hormone) plays a pivotal role in the regulation of reproduction in vertebrates through interaction with a specific receptor. Previously, we isolated a GnRH homo-logue, oct-GnRH, from the common octopus (Octopus vulgaris). In the present study, we have identified a GnRH receptor (oct-GnRHR) specific for oct-GnRH from Octopus brain. Oct-GnRHR includes domains and motifs typical of vertebrate GnRH receptors. The intron-inserted positions are conserved between oct-GnRHR and the chordate GnRHR genes. The oct-GnRHR expressed in Xenopus (South African clawed frog) oocytes was responsive to oct-GnRH, but not to any other HPLC fractions of the Octopus brain extract. These results show that oct-GnRHR is an authentic receptor for oct-GnRH. Southern blotting of reverse-transcription PCR products revealed that the oct-GnRHR mRNA was widely distributed in the central and peripheral nervous systems and in several peripheral tissues. In situ hybridiz-ation showed that oct-GnRHR mRNA was expressed in some regions involved in autonomic functions, feeding, memory and movement. Oct-GnRH was shown to induce steroidogenesis of testosterone, progesterone and 17β-oestradiol in Octopus ovary and testis, where oct-GnRHR was abundantly expressed. These results suggest that oct-GnRH, like its vertebrate counterparts, acts as a multifunctional neurotransmitter, neuromodulator and hormone-like factor, both in Octopus central nervous system and peripheral tissues, and that both structure and functions of the GnRH family are, at least partially, evolutionarily conserved between octopuses and chordates. PMID:16367741

  12. Possible Relevance of Receptor-Receptor Interactions between Viral- and Host-Coded Receptors for Viral-Induced Disease

    Directory of Open Access Journals (Sweden)

    Luigi F. Agnati

    2007-01-01

    Full Text Available It has been demonstrated that some viruses, such as the cytomegalovirus, code for G-protein coupled receptors not only to elude the immune system, but also to redirect cellular signaling in the receptor networks of the host cells. In view of the existence of receptor-receptor interactions, the hypothesis is introduced that these viral-coded receptors not only operate as constitutively active monomers, but also can affect other receptor function by interacting with receptors of the host cell. Furthermore, it is suggested that viruses could also insert not single receptors (monomers, but clusters of receptors (receptor mosaics, altering the cell metabolism in a profound way. The prevention of viral receptor-induced changes in host receptor networks may give rise to novel antiviral drugs that counteract viral-induced disease.

  13. Receptor studies in biological psychiatry

    International Nuclear Information System (INIS)

    Fujiwara, Yutaka

    1992-01-01

    Recent advances in the pharmacological treatment of endogenous psychosis have led to the development of biological studies in psychiatry. Studies on neurotransmitter receptors were reviewed in order to apply positron-emission tomograph (PET) for biological psychiatry. The dopamine (DA) hypothesis for schizophrenia was advanced on the basis of the observed effects of neuroleptics and methamphetamine, and DA(D 2 ) receptor supersensitivity measured by PET and receptor binding in the schizophrenic brain. The clinical potencies of neuroleptics for schizophrenia were correlated with their abilities to inhibit the D 2 receptor, and not other receptors. The σ receptor was expected to be a site of antipsychotic action. However, the potency of drugs action on it was not correlated with clinical efficacy. Haloperidol binds with high affinity to the σ receptor, which may mediate acute dystonia, an extrapyramidal side effect of neuroleptics. Behavioral and neurochemical changes induced by methamphetamine treatment were studied as an animal model of schizophrenia, and both a decrease of D 2 receptor density and an increase of DA release were detected. The monoamine hypothesis for manic-depressive psychosis was advanced on the basis of the effect of reserpine, monoamine oxidase inhibitor and antidepressants. 3 H-clonidine binding sites were increased in platelet membranes of depressive patients, 3 H-imipramine binding sites were decreased. The GABA A receptor is the target site for the action of anxiolytics and antiepileptics such as benzodiazepines and barbiturates. Recent developments in molecular biology techniques have revealed the structure of receptor proteins, which are classified into two receptor families, the G-protein coupled type (D 2 ) and the ion-channel type (GABA A ). (J.P.N.)

  14. Fish genomes provide novel insights into the evolution of vertebrate secretin receptors and their ligand.

    Science.gov (United States)

    Cardoso, João C R; Félix, Rute C; Trindade, Marlene; Power, Deborah M

    2014-12-01

    The secretin receptor (SCTR) is a member of Class 2 subfamily B1 GPCRs and part of the PAC1/VPAC receptor subfamily. This receptor has long been known in mammals but has only recently been identified in other vertebrates including teleosts, from which it was previously considered to be absent. The ligand for SCTR in mammals is secretin (SCT), an important gastrointestinal peptide, which in teleosts has not yet been isolated, or the gene identified. This study revises the evolutionary model previously proposed for the secretin-GPCRs in metazoan by analysing in detail the fishes, the most successful of the extant vertebrates. All the Actinopterygii genomes analysed and the Chondrichthyes and Sarcopterygii fish possess a SCTR gene that shares conserved sequence, structure and synteny with the tetrapod homologue. Phylogenetic clustering and gene environment comparisons revealed that fish and tetrapod SCTR shared a common origin and diverged early from the PAC1/VPAC subfamily group. In teleosts SCTR duplicated as a result of the fish specific whole genome duplication but in all the teleost genomes analysed, with the exception of tilapia (Oreochromis niloticus), one of the duplicates was lost. The function of SCTR in teleosts is unknown but quantitative PCR revealed that in both sea bass (Dicentrarchus labrax) and tilapia (Oreochromis mossambicus) transcript abundance is high in the gastrointestinal tract suggesting it may intervene in similar processes to those in mammals. In contrast, no gene encoding the ligand SCT was identified in the ray-finned fishes (Actinopterygii) although it was present in the coelacanth (lobe finned fish, Sarcopterygii) and in the elephant shark (holocephalian). The genes in linkage with SCT in tetrapods and coelacanth were also identified in ray-finned fishes supporting the idea that it was lost from their genome. At present SCTR remains an orphan receptor in ray-finned fishes and it will be of interest in the future to establish why SCT was

  15. The melatonin-MT1 receptor axis modulates tumor growth in PTEN-mutated gliomas.

    Science.gov (United States)

    Ma, Huihui; Wang, Zhen; Hu, Lei; Zhang, Shangrong; Zhao, Chenggang; Yang, Haoran; Wang, Hongzhi; Fang, Zhiyou; Wu, Lijun; Chen, Xueran

    2018-02-19

    More than 40% of glioma patients have tumors that harbor PTEN (phosphatase and tensin homologue deleted on chromosome ten) mutations; this disease is associated with poor therapeutic resistance and outcome. Such mutations are linked to increased cell survival and growth, decreased apoptosis, and drug resistance; thus, new therapeutic strategies focusing on inhibiting glioma tumorigenesis and progression are urgently needed. Melatonin, an indolamine produced and secreted predominantly by the pineal gland, mediates a variety of physiological functions and possesses antioxidant and antitumor properties. Here, we analyzed the relationship between PTEN and the inhibitory effect of melatonin in primary human glioma cells and cultured glioma cell lines. The results showed that melatonin can inhibit glioma cell growth both in culture and in vivo. This inhibition was associated with PTEN levels, which significantly correlated with the expression level of MT1 in patients. In fact, c-fos-mediated MT1 was shown to be a key modulator of the effect of melatonin on gliomas that harbor wild type PTEN. Taken together, these data suggest that melatonin-MT1 receptor complexes represent a potential target for the treatment of glioma. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Promiscuity and selectivity of small-molecule inhibitors across TAM receptor tyrosine kinases in pediatric leukemia.

    Science.gov (United States)

    Liu, Mao-Hua; Chen, Shi-Bing; Yu, Juan; Liu, Cheng-Jun; Zhang, Xiao-Jing

    2017-08-01

    The TAM receptor tyrosine kinase family member Mer has been recognized as an attractive therapeutic target for pediatric leukemia. Beside Mer the family contains other two kinases, namely, Tyro3 and Axl, which are highly homologues with Mer and thus most existing small-molecule inhibitors show moderate or high promiscuity across the three kinases. Here, the structural basis and energetic property of selective binding of small-molecule inhibitors to the three kinases were investigated at molecular level. It is found that the selectivity is primarily determined by the size, shape and configuration of kinase's ATP-binding site; the Mer and Axl possess a small, closed active pocket as compared to the bulky, open pocket of Tyro3. The location and conformation of active-site residues of Mer and Axl are highly consistent, suggesting that small-molecule inhibitors generally have a low Mer-over-Axl selectivity and a high Mer-over-Tyro3 selectivity. We demonstrated that the difference in ATP binding potency to the three kinases is also responsible for inhibitor selectivity. We also found that the long-range interactions and allosteric effect arising from rest of the kinase's active site can indirectly influence inhibitor binding and selectivity. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. The murine ufo receptor: molecular cloning, chromosomal localization and in situ expression analysis.

    Science.gov (United States)

    Faust, M; Ebensperger, C; Schulz, A S; Schleithoff, L; Hameister, H; Bartram, C R; Janssen, J W

    1992-07-01

    We have cloned the mouse homologue of the ufo oncogene. It encodes a novel tyrosine kinase receptor characterized by a unique extracellular domain containing two immunoglobulin-like and two fibronectin type III repeats. Comparison of the predicted ufo amino acid sequences of mouse and man revealed an overall identity of 87.6%. The ufo locus maps to mouse chromosome 7A3-B1 and thereby extends the known conserved linkage group between mouse chromosome 7 and human chromosome 19. RNA in situ hybridization analysis established the onset of specific ufo expression in the late embryogenesis at day 12.5 post coitum (p.c.) and localized ufo transcription to distinct substructures of a broad spectrum of developing tissues (e.g. subepidermal cells of the skin, mesenchymal cells of the periosteum). In adult animals ufo is expressed in cells forming organ capsules as well as in connective tissue structures. ufo may function as a signal transducer between specific cell types of mesodermal origin.

  18. Quantitative analysis of receptor imaging

    International Nuclear Information System (INIS)

    Fu Zhanli; Wang Rongfu

    2004-01-01

    Model-based methods for quantitative analysis of receptor imaging, including kinetic, graphical and equilibrium methods, are introduced in detail. Some technical problem facing quantitative analysis of receptor imaging, such as the correction for in vivo metabolism of the tracer and the radioactivity contribution from blood volume within ROI, and the estimation of the nondisplaceable ligand concentration, is also reviewed briefly

  19. Coronavirus spike-receptor interactions

    NARCIS (Netherlands)

    Mou, H.

    2015-01-01

    Coronaviruses cause important diseases in humans and animals. Coronavirus infection starts with the virus binding with its spike proteins to molecules present on the surface of host cells that act as receptors. This spike-receptor interaction is highly specific and determines the virus’ cell, tissue

  20. Neurobeachin regulates neurotransmitter receptor trafficking to synapses

    NARCIS (Netherlands)

    Nair, R.; Lauks, J.; Jung, S; Cooke, N.E.; de Wit, H.; Brose, N.; Kilimann, M.W.; Verhage, M.; Rhee, J.

    2013-01-01

    The surface density of neurotransmitter receptors at synapses is a key determinant of synaptic efficacy. Synaptic receptor accumulation is regulated by the transport, postsynaptic anchoring, and turnover of receptors, involving multiple trafficking, sorting, motor, and scaffold proteins. We found

  1. A Novel Mechanism of Androgen Receptor Action

    National Research Council Canada - National Science Library

    Roberts, Jr, Charles T

    2006-01-01

    .... Specifically, the authors had determined that the androgen receptor controls the expression of the cell-surface receptor for the hormone IGF-1 at the level of translation of the IGF-1 receptor mRNA...

  2. Quantitative densitometry of neurotransmitter receptors

    International Nuclear Information System (INIS)

    Rainbow, T.C.; Bleisch, W.V.; Biegon, A.; McEwen, B.S.

    1982-01-01

    An autoradiographic procedure is described that allows the quantitative measurement of neurotransmitter receptors by optical density readings. Frozen brain sections are labeled in vitro with [ 3 H]ligands under conditions that maximize specific binding to neurotransmitter receptors. The labeled sections are then placed against the 3 H-sensitive LKB Ultrofilm to produce the autoradiograms. These autoradiograms resemble those produced by [ 14 C]deoxyglucose autoradiography and are suitable for quantitative analysis with a densitometer. Muscarinic cholinergic receptors in rat and zebra finch brain and 5-HT receptors in rat brain were visualized by this method. When the proper combination of ligand concentration and exposure time are used, the method provides quantitative information about the amount and affinity of neurotransmitter receptors in brain sections. This was established by comparisons of densitometric readings with parallel measurements made by scintillation counting of sections. (Auth.)

  3. Dopamine Receptors and Parkinson's Disease

    Directory of Open Access Journals (Sweden)

    Shin Hisahara

    2011-01-01

    Full Text Available Parkinson's disease (PD is a progressive extrapyramidal motor disorder. Pathologically, this disease is characterized by the selective dopaminergic (DAergic neuronal degeneration in the substantia nigra. Correcting the DA deficiency in PD with levodopa (L-dopa significantly attenuates the motor symptoms; however, its effectiveness often declines, and L-dopa-related adverse effects emerge after long-term treatment. Nowadays, DA receptor agonists are useful medication even regarded as first choice to delay the starting of L-dopa therapy. In advanced stage of PD, they are also used as adjunct therapy together with L-dopa. DA receptor agonists act by stimulation of presynaptic and postsynaptic DA receptors. Despite the usefulness, they could be causative drugs for valvulopathy and nonmotor complication such as DA dysregulation syndrome (DDS. In this paper, physiological characteristics of DA receptor familyare discussed. We also discuss the validity, benefits, and specific adverse effects of pharmaceutical DA receptor agonist.

  4. Molecular characterization of opioid receptors

    Energy Technology Data Exchange (ETDEWEB)

    Howard, A.D.

    1986-01-01

    The aim of this research was to purify and characterize active opioid receptors and elucidate molecular aspects of opioid receptor heterogeneity. Purification to apparent homogeneity of an opioid binding protein from bovine caudate was achieved by solubilization in the non-ionic detergent, digitonin, followed by sequential chromatography on the opiate affinity matrix, ..beta..-naltrexylethylenediamine-CH-Sepharose 4B, and on the lectine affinity matrix, wheat germ agglutinin-agarose. Polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate (SDS-PAGE) followed by autoradiography revealed that radioiodinated purified receptor gave a single band. Purified receptor preparations showed a specific activity of 12,000-15,000 fmol of opiate bound per mg of protein. Radioiodinated human beta-endorphin (/sup 125/I-beta-end/sub H/) was used as a probe to investigate the ligand binding subunits of mu and delta opioid receptors. /sup 125/I-beta-end/sub H/ was shown to bind to a variety of opioid receptor-containing tissues with high affinity and specificity with preference for mu and delta sites, and with little, if any, binding to kappa sites. Affinity crosslinking techniques were employed to covalently link /sup 125/I-beta-end/sub H/ to opioid receptors, utilizing derivatives of bis-succinimidyl esters that are bifunctional crosslinkers with specificities for amino and sulfhydryl groups. This, and competition experiments with high type-selective ligands, permitted the assignment of two labeled peptides to their receptor types, namely a peptide of M/sub r/ = 65,000 for mu receptors and one of M/sub r/ = 53,000 for delta receptors.

  5. Aplasia Ras homologue member Ⅰ overexpression inhibits tumor growth and induces apoptosis through inhibition of PI3K/Akt survival pathways in human osteosarcoma MG-63 cells in culture.

    Science.gov (United States)

    Ye, Kaishan; Wang, Shuanke; Yang, Yong; Kang, Xuewen; Wang, Jing; Han, Hua

    2015-09-01

    Aplasia Ras homologue member Ⅰ (ARHI), an imprinted tumor-suppressor gene, is downregulated in various types of cancer. However, the expression, function and specific mechanisms of ARHI in human osteosarcoma (OS) cells remain unclear. The aim of the present study was to assess the effect of ARHI on OS cell proliferation and apoptosis and its associated mechanism. In the study, ARHI mRNA and protein levels were markedly downregulated in OS cells compared with the human osteoblast precursor cell line hFOB1.19. By generating stable transfectants, ARHI was overexpressed in OS cells that had low levels of ARHI. Overexpression of ARHI inhibited cell viability and proliferation and induced apoptosis. However, caspase‑3 activity was not changed by ARHI overexpression. In addition, phosphorylated Akt protein expression decreased in the ARHI overexpression group compared to that in the control vector group. The knockdown of ARHI also resulted in the promotion of cell proliferation and the attenuation of apoptosis in MG‑63 cells. Additionally, ARHI silencing increased the level of p‑Akt. The present results indicate that ARHI inhibits OS cell proliferation and may have a key role in the development of OS.

  6. The Saccharomyces cerevisiae RAD30 gene, a homologue of Escherichia coli dinB and umuC, is DNA damage inducible and functions in a novel error-free postreplication repair mechanism

    Energy Technology Data Exchange (ETDEWEB)

    McDonald, J. P. [NIH, Bethesda, MD. (United States); Levine, A. S.; Woodgate, R.

    1997-12-15

    Damage-inducible mutagenesis in prokaryotes is largely dependent upon the activity of the UmuD'C-like proteins. Since many DNA repair processes are structurally and/or functionally conserved between prokaryotes and eukaryotes, we investigated the role of RAD30, a previously uncharacterized Saccharomyces cerevisiae DNA repair gene related to the Escherichia coli dinB, umuC and S. cerevisiae REV1 genes, in UV resistance and UV-induced mutagenesis. Similar to its prokaryotic homologues, RAD30 was found to be damage inducible. Like many S. cerevisiae genes involved in error-prone DNA repair, epistasis analysis clearly places RAD30 in the RAD6 group and rad30 mutants display moderate UV sensitivity reminiscent of rev mutants. However, unlike rev mutants, no defect in UV-induced reversion was seen in rad30 strains. While rad6 and rad18 are both epistatic to rad30, no epistasis was observed with rev1, rev3, rev7 or rad5, all of which are members of the RAD6 epistasis group. These findings suggest that RD30 participates in a novel error-free repair pathway dependent on RAD6 and RAD18, but independent of REV1, REV3, REV7 and RAD5. (author)

  7. Stargazin Modulation of AMPA Receptors

    Directory of Open Access Journals (Sweden)

    Sana A. Shaikh

    2016-10-01

    Full Text Available Fast excitatory synaptic signaling in the mammalian brain is mediated by AMPA-type ionotropic glutamate receptors. In neurons, AMPA receptors co-assemble with auxiliary proteins, such as stargazin, which can markedly alter receptor trafficking and gating. Here, we used luminescence resonance energy transfer measurements to map distances between the full-length, functional AMPA receptor and stargazin expressed in HEK293 cells and to determine the ensemble structural changes in the receptor due to stargazin. In addition, we used single-molecule fluorescence resonance energy transfer to study the structural and conformational distribution of the receptor and how this distribution is affected by stargazin. Our nanopositioning data place stargazin below the AMPA receptor ligand-binding domain, where it is well poised to act as a scaffold to facilitate the long-range conformational selection observations seen in single-molecule experiments. These data support a model of stargazin acting to stabilize or select conformational states that favor activation.

  8. Radioiodinated ligands for dopamine receptors

    International Nuclear Information System (INIS)

    Kung, H.F.

    1994-01-01

    The dopamine receptor system is important for normal brain function; it is also the apparent action site for various neuroleptic drugs for the treatment of schizophrenia and other metal disorders. In the past few years radioiodinated ligands for single photon emission tomography (SPECT) have been successfully developed and tested in humans: [ 123 I]TISCH for D1 dopamine receptors; [ 123 I]IBZM, epidepride, IBF and FIDA2, four iodobenzamide derivatives, for D2/D3 dopamine receptors. In addition, [ 123 I]β-CIT (RTI-55) and IPT, cocaine derivatives, for the dopamine reuptake site are potentially useful for diagnosis of loss of dopamine neurons. The first iodinated ligand, (R)trans-7-OH-PIPAT, for D3 dopamine receptors, was synthesized and characterized with cloned cell lines (Spodoptera frugiperda, Sf9) expressing the D2 and D3 dopamine receptors and with rat basal forebrain membrane preparations. Most of the known iodobenzamides displayed similar potency in binding to both D2 and D3 dopamine receptors expressed in the cell lines. Initial studies appear to suggest that by fine tuning the structures it may be possible to develop agents specific for D2 and D3 dopamine receptors. It is important to investigate D2/D3 selectivity for this series of potent ligands

  9. Labeled receptor ligands for spect

    International Nuclear Information System (INIS)

    Kung, H.F.

    1989-01-01

    Receptor specific imaging agents for single photon emission computed tomography (SPECT) can potentially be useful in the understanding of basic biochemistry and pharmacology of receptors. SPECT images may also provide tools for evaluation of density and binding kinetics of a specific receptor, information important for diagnosis and patient management. Basic requirements for receptor imaging agents are: (a) they are labeled with short-lived isotopes, (b) they show high selectivity and specific uptake, (c) they exhibit high target/background ratio, and (d) they can be modeled to obtain quantitative information. Several good examples of CNS receptor specific ligands labeled with I-123 have been developed, including iodoQNB, iodoestrogen iodobenzadiazepine, iodobenazepine, iodobenzamides for muscarinic, estrogen benzadiazepine, D-1 and D-2 dopamine receptors. With the advent of newer and faster SPECT imaging devices, it may be feasible to quantitate the receptor density by in vivo imaging techniques. These new brain imaging agents can provide unique diagnostic information, which may not be available through other imaging modalities, such as CT and MRI

  10. D1 dopamine receptor is involved in shell formation in larvae of Pacific oyster Crassostrea gigas.

    Science.gov (United States)

    Liu, Zhaoqun; Wang, Lingling; Yan, Yunchen; Zheng, Yan; Ge, Wenjing; Li, Meijia; Wang, Weilin; Song, Xiaorui; Song, Linsheng

    2018-07-01

    Dopamine (DA), a significant member of catecholamines, is reported to induce biomineralization of calcium carbonate vaterite microspheres via dopamine receptor (DR) in bivalves, implying the modulation of dopaminergic system on shell formation during larval development. In this research, a homologue of D1 type DR (CgD1DR-1) was identified from oyster Crassostrea gigas, whose full length cDNA was 1197 bp. It was widely expressed in various tissues of C. gigas, with the significantly higher levels in hepatopancreas, mantle, muscle and gill. During developmental stages, the mRNA transcripts of CgD1DR-1 in D-shape larvae were obviously higher (p < 0.05) than those in trochophore and umbo larvae, and CO 2 exposure could inhibit the synthesis of DA and mRNA expression of CgD1DR-1. After cell transfection and DA treatment, intracellular cAMP in cells with the expression of CgD1DR-1 increased significantly (p < 0.05). Furthermore, the incubation with SCH 23390 for the blockage of CgD1DR-1 significantly restrained the expressions of six shell formation-related genes including CgTyrosinase-1, CgTyrosinase-3, CgChitinaseLP, CgAMC, CgBMP and CgBMPR in trochophore and D-shape larvae. These results jointly suggested that DA together with its receptor CgD1DR-1 might be involved in shell formation during oyster larval development from trochophore to D-shape larvae, and CO 2 -induced ocean acidification (OA) might influence marine bivalves by inhibiting the DA-D1DR pathway to prohibit their shell formation. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Polymeric immunoglobulin receptor in intestinal immune defense against the lumen-dwelling protozoan parasite Giardia.

    Science.gov (United States)

    Davids, Barbara J; Palm, J E Daniel; Housley, Michael P; Smith, Jennifer R; Andersen, Yolanda S; Martin, Martin G; Hendrickson, Barbara A; Johansen, Finn-Eirik; Svärd, Staffan G; Gillin, Frances D; Eckmann, Lars

    2006-11-01

    The polymeric Ig receptor (pIgR) is conserved in mammals and has an avian homologue, suggesting evolutionarily important functions in vertebrates. It transports multimeric IgA and IgM across polarized epithelia and is highly expressed in the intestine, yet little direct evidence exists for its importance in defense against common enteric pathogens. In this study, we demonstrate that pIgR can play a critical role in intestinal defense against the lumen-dwelling protozoan parasite Giardia, a leading cause of diarrheal disease. The receptor was essential for the eradication of Giardia when high luminal IgA levels were required. Clearance of Giardia muris, in which IgA plays a dominant role, was severely compromised in pIgR-deficient mice despite significant fecal IgA output at 10% of normal levels. In contrast, eradication of the human strain Giardia lamblia GS/M, for which adaptive immunity is less IgA dependent in mice, was unaffected by pIgR deficiency, indicating that pIgR had no physiologic role when lower luminal IgA levels were sufficient for parasite elimination. Immune IgA was greatly increased in the serum of pIgR-deficient mice, conferred passive protection against Giardia, and recognized several conserved giardial Ags, including ornithine carbamoyltransferase, arginine deiminase, alpha-enolase, and alpha- and beta-giardins, that are also detected in human giardiasis. Corroborative observations were made in mice lacking the J chain, which is required for pIgR-dependent transepithelial IgA transport. These results, together with prior data on pIgR-mediated immune neutralization of luminal cholera toxin, suggest that pIgR is essential in intestinal defense against pathogenic microbes with high-level and persistent luminal presence.

  12. Comparative Biochemical and Functional Analysis of Viral and Human Secreted Tumor Necrosis Factor (TNF) Decoy Receptors*

    Science.gov (United States)

    Pontejo, Sergio M.; Alejo, Ali; Alcami, Antonio

    2015-01-01

    The blockade of tumor necrosis factor (TNF) by etanercept, a soluble version of the human TNF receptor 2 (hTNFR2), is a well established strategy to inhibit adverse TNF-mediated inflammatory responses in the clinic. A similar strategy is employed by poxviruses, encoding four viral TNF decoy receptor homologues (vTNFRs) named cytokine response modifier B (CrmB), CrmC, CrmD, and CrmE. These vTNFRs are differentially expressed by poxviral species, suggesting distinct immunomodulatory properties. Whereas the human variola virus and mouse ectromelia virus encode one vTNFR, the broad host range cowpox virus encodes all vTNFRs. We report the first comprehensive study of the functional and binding properties of these four vTNFRs, providing an explanation for their expression profile among different poxviruses. In addition, the vTNFRs activities were compared with the hTNFR2 used in the clinic. Interestingly, CrmB from variola virus, the causative agent of smallpox, is the most potent TNFR of those tested here including hTNFR2. Furthermore, we demonstrate a new immunomodulatory activity of vTNFRs, showing that CrmB and CrmD also inhibit the activity of lymphotoxin β. Similarly, we report for the first time that the hTNFR2 blocks the biological activity of lymphotoxin β. The characterization of vTNFRs optimized during virus-host evolution to modulate the host immune response provides relevant information about their potential role in pathogenesis and may be used to improve anti-inflammatory therapies based on soluble decoy TNFRs. PMID:25940088

  13. Comparative Biochemical and Functional Analysis of Viral and Human Secreted Tumor Necrosis Factor (TNF) Decoy Receptors.

    Science.gov (United States)

    Pontejo, Sergio M; Alejo, Ali; Alcami, Antonio

    2015-06-26

    The blockade of tumor necrosis factor (TNF) by etanercept, a soluble version of the human TNF receptor 2 (hTNFR2), is a well established strategy to inhibit adverse TNF-mediated inflammatory responses in the clinic. A similar strategy is employed by poxviruses, encoding four viral TNF decoy receptor homologues (vTNFRs) named cytokine response modifier B (CrmB), CrmC, CrmD, and CrmE. These vTNFRs are differentially expressed by poxviral species, suggesting distinct immunomodulatory properties. Whereas the human variola virus and mouse ectromelia virus encode one vTNFR, the broad host range cowpox virus encodes all vTNFRs. We report the first comprehensive study of the functional and binding properties of these four vTNFRs, providing an explanation for their expression profile among different poxviruses. In addition, the vTNFRs activities were compared with the hTNFR2 used in the clinic. Interestingly, CrmB from variola virus, the causative agent of smallpox, is the most potent TNFR of those tested here including hTNFR2. Furthermore, we demonstrate a new immunomodulatory activity of vTNFRs, showing that CrmB and CrmD also inhibit the activity of lymphotoxin β. Similarly, we report for the first time that the hTNFR2 blocks the biological activity of lymphotoxin β. The characterization of vTNFRs optimized during virus-host evolution to modulate the host immune response provides relevant information about their potential role in pathogenesis and may be used to improve anti-inflammatory therapies based on soluble decoy TNFRs. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Etude par génétique inverse du gène codant la protéine TARGET OF RAPAMYCIN d'Arabidopsis thaliana (AtTOR), l'homologue d'une kinase contrôlant la croissance cellulaire chez les eucaryotes

    OpenAIRE

    Menand, Benoit

    2002-01-01

    TOR (target of rapamycin) protein kinases were identified in yeast, mammals and Drosophila as central controllers of cell growth. Thu, G1 to S phases progression through the cell cycle is blocked by rapamycin, a drug which specifically inhibits TOR activity by forming a ternary complex with the peptidyl-prolyl isomerase FKBP12 (FK506 and rapamycin binding protein), and the FKBP-rapamycin binding domain (FRB) of TOR proteins. This work presents the study, the Arabidopsis homologue of yeast and...

  15. XMRV: usage of receptors and potential co-receptors

    Directory of Open Access Journals (Sweden)

    Gaddam Durga

    2011-09-01

    Full Text Available Abstract Background XMRV is a gammaretrovirus first identified in prostate tissues of Prostate Cancer (PC patients and later in the blood cells of patients with Chronic Fatigue Syndrome (CFS. Although XMRV is thought to use XPR1 for cell entry, it infects A549 cells that do not express XPR1, suggesting usage of other receptors or co-receptors. Methods To study the usage of different receptors and co- receptors that could play a role in XMRV infection of lymphoid cells and GHOST (GFP- Human osteosarcoma cells expressing CD4 along with different chemokine receptors including CCR1, CCR2, etc., were infected with XMRV. Culture supernatants and cells were tested for XMRV replication using real time quantitative PCR. Results Infection and replication of XMRV was seen in a variety of GHOST cells, LNCaP, DU145, A549 and Caski cell lines. The levels of XMRV replication varied in different cell lines showing differential replication in different cell lines. However, replication in A549 which lacks XPR1 expression was relatively higher than DU145 but lower than, LNCaP. XMRV replication varied in GHOST cell lines expressing CD4 and each of the co- receptors CCR1-CCR8 and bob. There was significant replication of XMRV in CCR3 and Bonzo although it is much lower when compared to DU145, A549 and LNCaP. Conclusion XMRV replication was observed in GHOST cells that express CD4 and each of the chemokine receptors ranging from CCR1- CCR8 and BOB suggesting that infectivity in hematopoietic cells could be mediated by use of these receptors.

  16. Functional characterization and evolution of PTH/PTHrP receptors: insights from the chicken

    Directory of Open Access Journals (Sweden)

    Pinheiro Pedro LC

    2012-07-01

    P also stimulated intracellular Ca2+ accumulation on activation of PTH1R but not PTH3R. Conclusion Two PTHR homologues of the vertebrate PTH1R and PTH3R were isolated and functionally characterized in chicken. Their distinct pattern of expression during embryo development and in adult tissues, together with their ligand preference, suggests that they have acquired specific functions, which have contributed to their maintenance in the genome. PTH2R and its activating ligand, TIP39, are absent from bird genomes. Nonetheless identification of putative PTH2R and TIP39 in the genome of an ancient agnathan, lamprey, suggests the PTH/PTHrP ligand and receptor family was already present in an early basal paraphyletic group of vertebrates and during the vertebrate radiation diverged via gene/genome duplication and deletion events. Knowledge of the role PTH/PTHrP system in early vertebrates will help to establish evolution of function.

  17. Quantitative receptor radioautography in the study of receptor-receptor interactions in the nucleus tractus solitarii

    Directory of Open Access Journals (Sweden)

    Fior-Chadi D.R.

    1998-01-01

    Full Text Available The nucleus tractus solitarii (NTS in the dorsomedial medulla comprises a wide range of neuropeptides and biogenic amines. Several of them are related to mechanisms of central blood pressure control. Angiotensin II (Ang II, neuropeptide Y (NPY and noradrenaline (NA are found in the NTS cells, as well as their receptors. Based on this observation we have evaluated the modulatory effect of these peptide receptors on a2-adrenoceptors in the NTS. Using quantitative receptor radioautography, we observed that NPY and Ang II receptors decreased the affinity of a2-adrenoceptors for their agonists in the NTS of the rat. Cardiovascular experiments agreed with the in vitro data. Coinjection of a threshold dose of Ang II or of the NPY agonists together with an ED50 dose of adrenergic agonists such as NA, adrenaline and clonidine counteracted the depressor effect produced by the a2-agonist in the NTS. The results provide evidence for the existence of an antagonistic interaction between Ang II at1 receptors and NPY receptor subtypes with the a2-adrenoceptors in the NTS. This receptor interaction may reduce the transduction over the a2-adrenoceptors which can be important in central cardiovascular regulation and in the development of hypertension

  18. Peripheral adrenergic receptors in hypertension

    NARCIS (Netherlands)

    Michel, M. C.; Brodde, O. E.; Insel, P. A.

    1990-01-01

    Increased sympathoadrenal activity appears to play an important role in the development or maintenance of elevated blood pressure in hypertensive patients and various animal models of hypertension. Alterations of adrenergic receptor number or responsiveness might contribute to this increased

  19. Are olfactory receptors really olfactive?

    DEFF Research Database (Denmark)

    Giorgi, Franco; Maggio, Roberto; Bruni, Luis Emilio

    2011-01-01

    environmental conditions. By adopting this standpoint, the functional attribution as olfactory or chemotactic sensors to these receptors should not be seen neither as a cause conditioning receptor gene expression, nor as a final effect resulting from genetically predetermined programs, but as a direct...... and odor-decoding processes. However, this type of explanation does not entirely justify the role olfactory receptors have played during evolution, since they are also expressed ectopically in different organs and/or tissues. Homologous olfactory genes have in fact been found in such diverse cells and....../or organs as spermatozoa, testis and kidney where they are assumed to act as chemotactic sensors or renin modulators. To justify their functional diversity, homologous olfactory receptors are assumed to share the same basic role: that of conferring a self-identity to cells or tissues under varying...

  20. Nuclear Receptor Signaling Atlas (NURSA)

    Data.gov (United States)

    U.S. Department of Health & Human Services — The Nuclear Receptor Signaling Atlas (NURSA) is designed to foster the development of a comprehensive understanding of the structure, function, and role in disease...

  1. L-glutamate Receptor In Paramecium

    Science.gov (United States)

    Bernal-Martínez, Juan; Ortega-Soto, Arturo

    2004-09-01

    Behavioral, electrophysiological and biochemical experiments were performed in order to establish the presence of a glutamate receptor in the ciliate Paramecium. It was found that an AMPA/KA receptor is functionally expressed in Paramecium and that this receptor is immunologically and fillogenetically related to the AMPA/KA receptor present in vertebrates.

  2. Receptor-targeted metalloradiopharmaceuticals. Final technical report

    International Nuclear Information System (INIS)

    Green, Mark A.

    2000-01-01

    Copper (II) and platinum (II) coordination complexes were prepared and characterized. These complexes were designed to afford structural homology with steroidal and non-steroidal estrogens for possible use as receptor-targeted radiopharmaceuticals. While weak affinity for the estrogen receptor was detectable, none would appear to have sufficient receptor-affinity for estrogen-receptor-targeted imaging or therapy

  3. [The receptor theory of atherosclerosis].

    Science.gov (United States)

    Likhoded, V G; Bondarenko, V M; Gintsburg, A L

    2010-01-01

    Lipopolysaccharides of Gram-negative bacteria can interact with Toll-like receptor 4 (TLR4) and induce atheroma formation. The risk of atherosclerosis is decreased in case of TLR4 mutation. Other bacterial ligands and endogenous ligands of TLRs can also be involved in induction of atherogenesis. The general concept of atherosclerosis pathogentsis is presented. According to this concept atherogenesis can be initiated by some reactions resulting from interaction of exogenous and endogenous microbial ligands with Toll-like receptors.

  4. Xenobiotics and the Glucocorticoid Receptor

    International Nuclear Information System (INIS)

    Gulliver, Linda S M

    2017-01-01

    Glucocorticoid Receptor (GR) is present in virtually every human cell type. Representing a nuclear receptor superfamily, GR has several different isoforms essentially acting as ligand-dependent transcription factors, regulating glucocorticoid-responsive gene expression in both a positive and a negative manner. Although the natural ligand of the Glucocorticoid Receptor, glucocorticoids (GC) represent only some of the multiple ligands for GR. Xenobiotics, ubiquitous in the environment, bind to GR and are also capable of activating or repressing GR gene expression, thereby modulating GR cell and tissue-specific downstream effects in a multitude of ways that include responses to inflammatory, allergic, metabolic, neoplastic and autoimmune processes. Many xenobiotics, if inadequately metabolized by xenobiotic metabolizing enzymes and not wholly eliminated, could have deleterious toxic effects with potentially lethal consequences. This review examines GR, the genomic and non-genomic actions of natural and synthetic GC and the body's handling of xenobiotic compounds, before reviewing what is presently known about GR's interactions with many of the more commonly encountered and some of the less well known GR-associated xenobiotics. GR promiscuity and crosstalk with other signaling pathways is discussed, alongside novel roles for GR that include mood disorder and addiction. A knowledge of GR interactions with xenobiotics is increasingly relevant when considering aging populations and the related prevalence of neoplastic disease, together with growing concerns around human exposure to mixtures of chemicals in the environment. Furthermore, escalating rates of obesity, Type 2 diabetes; autoimmune, allergy, addiction and mood disorder-related pathologies, require novel targeted interventions and GR appears a promising pharmacological candidate. - Highlights: • Biological impact of xenobiotics acting through Glucocorticoid Receptor. • Promiscuity of Glucocorticoid

  5. Xenobiotics and the Glucocorticoid Receptor

    Energy Technology Data Exchange (ETDEWEB)

    Gulliver, Linda S M, E-mail: linda.gulliver@otago.ac.nz

    2017-03-15

    Glucocorticoid Receptor (GR) is present in virtually every human cell type. Representing a nuclear receptor superfamily, GR has several different isoforms essentially acting as ligand-dependent transcription factors, regulating glucocorticoid-responsive gene expression in both a positive and a negative manner. Although the natural ligand of the Glucocorticoid Receptor, glucocorticoids (GC) represent only some of the multiple ligands for GR. Xenobiotics, ubiquitous in the environment, bind to GR and are also capable of activating or repressing GR gene expression, thereby modulating GR cell and tissue-specific downstream effects in a multitude of ways that include responses to inflammatory, allergic, metabolic, neoplastic and autoimmune processes. Many xenobiotics, if inadequately metabolized by xenobiotic metabolizing enzymes and not wholly eliminated, could have deleterious toxic effects with potentially lethal consequences. This review examines GR, the genomic and non-genomic actions of natural and synthetic GC and the body's handling of xenobiotic compounds, before reviewing what is presently known about GR's interactions with many of the more commonly encountered and some of the less well known GR-associated xenobiotics. GR promiscuity and crosstalk with other signaling pathways is discussed, alongside novel roles for GR that include mood disorder and addiction. A knowledge of GR interactions with xenobiotics is increasingly relevant when considering aging populations and the related prevalence of neoplastic disease, together with growing concerns around human exposure to mixtures of chemicals in the environment. Furthermore, escalating rates of obesity, Type 2 diabetes; autoimmune, allergy, addiction and mood disorder-related pathologies, require novel targeted interventions and GR appears a promising pharmacological candidate. - Highlights: • Biological impact of xenobiotics acting through Glucocorticoid Receptor. • Promiscuity of Glucocorticoid

  6. Nuclear Receptors, RXR, and the Big Bang.

    Science.gov (United States)

    Evans, Ronald M; Mangelsdorf, David J

    2014-03-27

    Isolation of genes encoding the receptors for steroids, retinoids, vitamin D, and thyroid hormone and their structural and functional analysis revealed an evolutionarily conserved template for nuclear hormone receptors. This discovery sparked identification of numerous genes encoding related proteins, termed orphan receptors. Characterization of these orphan receptors and, in particular, of the retinoid X receptor (RXR) positioned nuclear receptors at the epicenter of the "Big Bang" of molecular endocrinology. This Review provides a personal perspective on nuclear receptors and explores their integrated and coordinated signaling networks that are essential for multicellular life, highlighting the RXR heterodimer and its associated ligands and transcriptional mechanism. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Fibroblast growth factor receptors in breast cancer.

    Science.gov (United States)

    Wang, Shuwei; Ding, Zhongyang

    2017-05-01

    Fibroblast growth factor receptors are growth factor receptor tyrosine kinases, exerting their roles in embryogenesis, tissue homeostasis, and development of breast cancer. Recent genetic studies have identified some subtypes of fibroblast growth factor receptors as strong genetic loci associated with breast cancer. In this article, we review the recent epidemiological findings and experiment results of fibroblast growth factor receptors in breast cancer. First, we summarized the structure and physiological function of fibroblast growth factor receptors in humans. Then, we discussed the common genetic variations in fibroblast growth factor receptors that affect breast cancer risk. In addition, we also introduced the potential roles of each fibroblast growth factor receptors isoform in breast cancer. Finally, we explored the potential therapeutics targeting fibroblast growth factor receptors for breast cancer. Based on the biological mechanisms of fibroblast growth factor receptors leading to the pathogenesis in breast cancer, targeting fibroblast growth factor receptors may provide new opportunities for breast cancer therapeutic strategies.

  8. Prognostic Value of Estrogen Receptor alpha and Progesterone Receptor Conversion in Distant Breast Cancer Metastases

    NARCIS (Netherlands)

    Hoefnagel, Laurien D. C.; Moelans, Cathy B.; Meijer, S. L.; van Slooten, Henk-Jan; Wesseling, Pieter; Wesseling, Jelle; Westenend, Pieter J.; Bart, Joost; Seldenrijk, Cornelis A.; Nagtegaal, Iris D.; Oudejans, Joost; van der Valk, Paul; van Gils, Carla H.; van der Wall, Elsken; van Diest, Paul J.

    2012-01-01

    BACKGROUND: Changes in the receptor profile of primary breast cancers to their metastases (receptor conversion) have been described for the estrogen receptor alpha (ER alpha) and progesterone receptor (PR). The purpose of this study was to evaluate the impact of receptor conversion for ER alpha and

  9. Expression of GABAergic receptors in mouse taste receptor cells.

    Directory of Open Access Journals (Sweden)

    Margaret R Starostik

    Full Text Available BACKGROUND: Multiple excitatory neurotransmitters have been identified in the mammalian taste transduction, with few studies focused on inhibitory neurotransmitters. Since the synthetic enzyme glutamate decarboxylase (GAD for gamma-aminobutyric acid (GABA is expressed in a subset of mouse taste cells, we hypothesized that other components of the GABA signaling pathway are likely expressed in this system. GABA signaling is initiated by the activation of either ionotropic receptors (GABA(A and GABA(C or metabotropic receptors (GABA(B while it is terminated by the re-uptake of GABA through transporters (GATs. METHODOLOGY/PRINCIPAL FINDINGS: Using reverse transcriptase-PCR (RT-PCR analysis, we investigated the expression of different GABA signaling molecules in the mouse taste system. Taste receptor cells (TRCs in the circumvallate papillae express multiple subunits of the GABA(A and GABA(B receptors as well as multiple GATs. Immunocytochemical analyses examined the distribution of the GABA machinery in the circumvallate papillae. Both GABA(A-and GABA(B- immunoreactivity were detected in the peripheral taste receptor cells. We also used transgenic mice that express green fluorescent protein (GFP in either the Type II taste cells, which can respond to bitter, sweet or umami taste stimuli, or in the Type III GAD67 expressing taste cells. Thus, we were able to identify that GABAergic receptors are expressed in some Type II and Type III taste cells. Mouse GAT4 labeling was concentrated in the cells surrounding the taste buds with a few positively labeled TRCs at the margins of the taste buds. CONCLUSIONS/SIGNIFICANCE: The presence of GABAergic receptors localized on Type II and Type III taste cells suggests that GABA is likely modulating evoked taste responses in the mouse taste bud.

  10. Toll-like receptors in neonatal sepsis.

    LENUS (Irish Health Repository)

    O'Hare, Fiona M

    2013-06-01

    Toll-like receptors are vital transmembrane receptors that initiate the innate immune response to many micro-organisms. The discovery of these receptors has improved our understanding of host-pathogen interactions, and these receptors play an important role in the pathogenesis of multiple neonatal conditions such as sepsis and brain injury. Toll-like receptors, especially TLRs 2 and 4, are associated with necrotizing enterocolitis, periventricular leukomalacia and sepsis.

  11. Molecular and functional characterization of a human ATM gene analogue at Arabidopsis thaliana; Caracterisation moleculaire et Fonctionnelle d'un Homologue du gene humain ATM chez Arabidopsis thaliana

    Energy Technology Data Exchange (ETDEWEB)

    Garcia, V.

    2001-12-15

    The human ATM gene, whose inactivation is responsible for the human disease ataxia telangiectasia is conserved throughout the Eukaryotes and plays an important role in the cellular responses to DNA damage, in particular to DNA double-strand breaks (DSBs). Here we describe the identification of an Arabidopsis thaliana homologue of ATM (AtATM), and the molecular and cytological characterization of plants, hereafter called atm, carrying a disrupting T-DNA insertion in this gene. AtATM covers a 32 kb region on chromosome 3. The AtATM transcript has a complex structure, is 12 kb long and formed by 79 exons. The transcriptional level of AtATM is very low in all the tissues tested, and does not vary after exposure to ionizing radiations (IR). In atm plants, the protein is not detected suggesting the mutants are null. The atm mutants are partially sterile. Aberrant segregation of chromosomes during meiosis I on both male and female sides account for this sterility. However, meiotic recombination frequency is normal. Mutant plants are also hypersensitive to gamma rays and methyl methane sulfonate, but not to UV-B, pointing to a specific defect of atm mutants in the response to DNA DSBs. In plants, ionizing radiations induce a strong, rapid and transient transcriptional activation of genes involved in the cellular response to or the repair of DSBs. This transcriptional regulation of AtRAD51, AtPARP1, atGR1 and AtL1G4 is lost in the atm mutants . The absence of AtRAD51 induction associated with ionizing radiation sensitivity suggest that AtAtm play an important function in DSB repair by homologous recombination. In addition we show that homologous intra-chromosomal recombination frequency is elevated in the mutant comparing to wild-type, with or without gamma irradiation. These results show the implication of AtAtm in the genomic stability. (author)

  12. Bombyx mori nucleopolyhedrovirus nucleic acid binding proteins BRO-B and BRO-E associate with host T-cell intracellular antigen 1 homologue BmTRN-1 to influence protein synthesis during infection.

    Science.gov (United States)

    Kotani, Eiji; Muto, Sayaka; Ijiri, Hiroshi; Mori, Hajime

    2015-07-01

    Previous reports have indicated that the Bombyx mori nucleopolyhedrovirus (BmNPV) nucleic acid binding proteins BRO-B and BRO-E are expressed during the early stage of infection and that the BRO family likely supports the regulation of mRNA; however, no study has directly examined the function of BRO family proteins in virus-permissive cells. Here, we show that BRO-B and BRO-E associate with cellular T-cell intracellular antigen 1 homologue (BmTRN-1), a translational regulator, and other cellular translation-related proteins in silkworm cells during viral infection. We created BM-N cells that expressed BRO-B/E to study molecular interactions between BmTRN-1 and BRO-B/E and how they influenced protein synthesis. Fluorescent microscopy revealed that BmTRN-1 was localized in cytoplasmic foci during BmNPV infection. Immunofluorescence studies confirmed that BmTRN-1 and BRO-B/E were colocalized in the amorphous conspicuous cytoplasmic foci. Reporter gene studies revealed that co-expression of BRO-B/E synergistically led to a significant decrease in protein synthesis from a designed transcript carrying the 5'untranslated region of a cellular mRNA with no significant change of transcript abundance. Additionally, RNA interference-mediated knockdown of BmTRN-1 resulted in a marked inhibition of the ability of BRO-B/E to regulate the transcript. These results suggested that the association of BmTRN-1 with BRO-B/E is responsible for the inhibitory regulation of certain mRNAs at the post-transcriptional level and add an additional mechanism for how baculoviruses control protein synthesis during infection.

  13. The SANT2 domain of the murine tumor cell DnaJ-like protein 1 human homologue interacts with alpha1-antichymotrypsin and kinetically interferes with its serpin inhibitory activity.

    Science.gov (United States)

    Kroczynska, Barbara; Evangelista, Christina M; Samant, Shalaka S; Elguindi, Ebrahim C; Blond, Sylvie Y

    2004-03-19

    The murine tumor cell DnaJ-like protein 1 or MTJ1/ERdj1 is a membrane J-domain protein enriched in microsomal and nuclear fractions. We previously showed that its lumenal J-domain stimulates the ATPase activity of the molecular chaperone BiP/GRP78 (Chevalier, M., Rhee, H., Elguindi, E. C., and Blond, S. Y. (2000) J. Biol. Chem. 275, 19620-19627). MTJ1/ERdj1 also contains a large carboxyl-terminal cytosolic extension composed of two tryptophan-mediated repeats or SANT domains for which the function(s) is unknown. Here we describe the cloning of the human homologue HTJ1 and its interaction with alpha(1)-antichymotrypsin (ACT), a member of the serine proteinase inhibitor (serpin) family. The interaction was initially identified in a two-hybrid screening and further confirmed in vitro by dot blots, native electrophoresis, and fluorescence studies. The second SANT domain of HTJ1 (SANT2) was found to be sufficient for binding to ACT, both in yeast and in vitro. Single tryptophan-alanine substitutions at two strictly conserved residues significantly (Trp-497) or totally (Trp-520) abolished the interaction with ACT. SANT2 binds to human ACT with an intrinsic affinity equal to 0.5 nm. Preincubation of ACT with nearly stoichiometric concentrations of SANT2 wild-type but not SANT2: W520A results in an apparent loss of ACT inhibitory activity toward chymotrypsin. Kinetic analysis indicates that the formation of the covalent inhibitory complex ACT-chymotrypsin is significantly delayed in the presence of SANT2 with no change on the catalytic efficiency of the enzyme. This work demonstrates for the first time that the SANT2 domain of MTJ1/HTJ1/ERdj1 mediates stable and high affinity protein-protein interactions.

  14. Expression and Functional Characterization of the RIG-I-Like Receptors MDA5 and LGP2 in Rainbow Trout (Oncorhynchus mykiss) ▿ †

    Science.gov (United States)

    Chang, Mingxian; Collet, Bertrand; Nie, Pin; Lester, Katherine; Campbell, Scott; Secombes, Christopher J.; Zou, Jun

    2011-01-01

    The retinoic acid-inducible gene I (RIG-I)-like receptors (RLR) comprise three homologues: RIG-I, melanoma differentiation-associated gene 5 (MDA5), and laboratory of genetics and physiology 2 (LGP2). They activate the host interferon (IFN) system upon recognition of viral RNA pathogen-associated molecular patterns (PAMPs) in the cytoplasm. Bioinformatic analysis of the sequenced vertebrate genomes suggests that the cytosolic surveillance system is conserved in lower vertebrates, and recent functional studies have confirmed that RIG-I is important to fish antiviral immunity. In this study, we have identified MDA5 and LGP2 homologues from rainbow trout Oncorhynchus mykiss and an additional LGP2 variant with an incomplete C-terminal domain of RIG-I. Trout MDA5 and LGP2 were constitutively produced in fibroblast and macrophage cell lines and upregulated by poly(I:C), recombinant IFN, or infection by RNA viruses (viral hemorrhagic septicemia virus and salmon alphavirus) with a single-stranded positive or negative genome. Overexpression of MDA5 and LGP2 but not of the LGP2 variant resulted in significant accumulation of Mx transcripts in cultured cells, which correlated with a marked enhancement of protection against viral infection. These results demonstrate that both MDA5 and LGP2 are important RLRs in host surveillance against infection of both negative and positive viruses and that the LGP2 variant with a deletion of 54 amino acids at the C terminus acts as a negative regulator for LGP2-elicited antiviral signaling by competing for the viral RNA PAMPs. Interestingly, MDA5 expression was not affected by overexpressed LGP2 in transfected cells and vice versa, suggesting that they likely act in parallel as positive regulators for IFN production. PMID:21680521

  15. Studies on insulin receptor, 2

    International Nuclear Information System (INIS)

    Sakai, Yukio

    1979-01-01

    The present study is to investigate an influence of starvation and high fat diet on insulin receptor of the plasma membrane by means of radioreceptor assay using 125 I-labelled insulin. Male guinea pigs of Hartley strain were employed for the starvation study, and 125 I-insulin binding capacity on the plasma membrane of the liver and kidney was determined at 24, 48 and 72 hours of the fast after the last meal. Male rats of Wistar strain were employed for the high fat study where the diet containing 35% of butter was fed ad libitum for 38 or 68 days. The animals were killed at the fast of 12 hours, and 125 I-insulin binding capacity on the plasma membrane of the liver was determined. The results obtained are summarized as follows: 1) An increase in 125 I-insulin binding capacity on the plasma membrane of the liver and kidney was observed by the starvation for 24 to 72 hours. 2) The mechanism of the increase by starvation was considered to be different by the organs; it was due to an increase in number of insulin receptor in the liver, and due to an increase in affinity of insulin receptor in the kidney. 3) In non-obese rats fed with high fat diet, the number of insulin receptor on the liver plasma membrane showed a decrease, and this observation clearly indicated that the decrease in number of the receptor did not depend on the obesity. 4) Obese rats also fed with high fat diet presented a decrease in number of insulin receptor without an elevation of insulin levels in the circulating blood. This indicated that at least in the obese rats fed with high fat diet, the decrease in number of the receptor was not due to hyperinsulinemia. (author)

  16. Purinergic Receptors in Ocular Inflammation

    Directory of Open Access Journals (Sweden)

    Ana Guzman-Aranguez

    2014-01-01

    Full Text Available Inflammation is a complex process that implies the interaction between cells and molecular mediators, which, when not properly “tuned,” can lead to disease. When inflammation affects the eye, it can produce severe disorders affecting the superficial and internal parts of the visual organ. The nucleoside adenosine and nucleotides including adenine mononucleotides like ADP and ATP and dinucleotides such as P1,P4-diadenosine tetraphosphate (Ap4A, and P1,P5-diadenosine pentaphosphate (Ap5A are present in different ocular locations and therefore they may contribute/modulate inflammatory processes. Adenosine receptors, in particular A2A adenosine receptors, present anti-inflammatory action in acute and chronic retinal inflammation. Regarding the A3 receptor, selective agonists like N6-(3-iodobenzyl-5′-N-methylcarboxamidoadenosine (CF101 have been used for the treatment of inflammatory ophthalmic diseases such as dry eye and uveoretinitis. Sideways, diverse stimuli (sensory stimulation, large intraocular pressure increases can produce a release of ATP from ocular sensory innervation or after injury to ocular tissues. Then, ATP will activate purinergic P2 receptors present in sensory nerve endings, the iris, the ciliary body, or other tissues surrounding the anterior chamber of the eye to produce uveitis/endophthalmitis. In summary, adenosine and nucleotides can activate receptors in ocular structures susceptible to suffer from inflammatory processes. This involvement suggests the possible use of purinergic agonists and antagonists as therapeutic targets for ocular inflammation.

  17. Scavenger receptors in homeostasis and immunity.

    Science.gov (United States)

    Canton, Johnathan; Neculai, Dante; Grinstein, Sergio

    2013-09-01

    Scavenger receptors were originally identified by their ability to recognize and to remove modified lipoproteins; however, it is now appreciated that they carry out a striking range of functions, including pathogen clearance, lipid transport, the transport of cargo within the cell and even functioning as taste receptors. The large repertoire of ligands recognized by scavenger receptors and their broad range of functions are not only due to the wide range of receptors that constitute this family but also to their ability to partner with various co-receptors. The ability of individual scavenger receptors to associate with different co-receptors makes their responsiveness extremely versatile. This Review highlights recent insights into the structural features that determine the function of scavenger receptors and the emerging role that these receptors have in immune responses, notably in macrophage polarization and in the pathogenesis of diseases such as atherosclerosis and Alzheimer's disease.

  18. Photo-antagonism of the GABAA receptor.

    Science.gov (United States)

    Mortensen, Martin; Iqbal, Favaad; Pandurangan, Arun P; Hannan, Saad; Huckvale, Rosemary; Topf, Maya; Baker, James R; Smart, Trevor G

    2014-07-29

    Neurotransmitter receptor trafficking is fundamentally important for synaptic transmission and neural network activity. GABAA receptors and inhibitory synapses are vital components of brain function, yet much of our knowledge regarding receptor mobility and function at inhibitory synapses is derived indirectly from using recombinant receptors, antibody-tagged native receptors and pharmacological treatments. Here we describe the use of a set of research tools that can irreversibly bind to and affect the function of recombinant and neuronal GABAA receptors following ultraviolet photoactivation. These compounds are based on the competitive antagonist gabazine and incorporate a variety of photoactive groups. By using site-directed mutagenesis and ligand-docking studies, they reveal new areas of the GABA binding site at the interface between receptor β and α subunits. These compounds enable the selected inactivation of native GABAA receptor populations providing new insight into the function of inhibitory synapses and extrasynaptic receptors in controlling neuronal excitation.

  19. TAM receptor signaling in development.

    Science.gov (United States)

    Burstyn-Cohen, Tal

    2017-01-01

    TYRO3, AXL and MERTK comprise the TAM family of receptor protein tyrosine kinases. Activated by their ligands, protein S (PROS1) and growth-arrest-specific 6 (GAS6), they mediate numerous cellular functions throughout development and adulthood. Expressed by a myriad of cell types and tissues, they have been implicated in homeostatic regulation of the immune, nervous, vascular, bone and reproductive systems. The loss-of-function of TAM signaling in adult tissues culminates in the destruction of tissue homeostasis and diseased states, while TAM gain-of-function in various tumors promotes cancer phenotypes. Combinatorial ligand-receptor interactions may elicit different molecular and cellular responses. Many of the TAM regulatory functions are essentially developmental, taking place both during embryogenesis and postnatally. This review highlights current knowledge on the role of TAM receptors and their ligands during these developmental processes in the immune, nervous, vascular and reproductive systems.

  20. How calcium makes endocytic receptors attractive

    DEFF Research Database (Denmark)

    Andersen, Christian B F; Moestrup, Søren K

    2014-01-01

    of the receptor. Endosomal acidification and calcium efflux lead to the essential ligand-receptor affinity switch and separation. Recent data, including crystal structures of receptor-ligand complexes, now reveal how calcium, in different types of domain scaffolds, functions in a common way as a removable...... 'lynchpin' that stabilizes favorable positioning of ligand-attractive receptor residues. In addition to explaining how calcium depletion can cause ligand-receptor dissociation, the new data add further insight into how acidification contributes to dissociation through structural changes that affect...... the receptor calcium sites....

  1. Lessons from crystal structures of kainate receptors

    DEFF Research Database (Denmark)

    Møllerud, Stine; Frydenvang, Karla Andrea; Pickering, Darryl S

    2017-01-01

    Kainate receptors belong to the family of ionotropic glutamate receptors. These receptors assemble from five subunits (GluK1-5) into tetrameric ion channels. Kainate receptors are located at both pre- and postsynaptic membranes in the central nervous system where they contribute to excitatory...... synaptic transmission and modulate network excitability by regulating neurotransmitter release. Dysfunction of kainate receptors has been implicated in several neurological disorders such as epilepsy, schizophrenia and depression. Here we provide a review on the current understanding of kainate receptor...

  2. Synthesis, modelling, and mu-opioid receptor affinity of N-3(9)-arylpropenyl-N-9(3)-propionyl-3,9-diazabicycl.

    Science.gov (United States)

    Pinna, G A; Murineddu, G; Curzu, M M; Villa, S; Vianello, P; Borea, P A; Gessi, S; Toma, L; Colombo, D; Cignarella, G

    2000-08-01

    A series of N-3-arylpropenyl-N-9-propionyl-3,9-diazabicyclo[3.3.1]nonanes (1a-g) and of reverted N-3-propionyl-N-9-arylpropenyl isomers (2a-g), as homologues of the previously reported analgesic 3,8-diazabicyclo[3.2.1]octanes (I-II), were synthesized and evaluated for the binding affinity towards opioid receptor subtypes mu, delta and kappa. Compounds 1a-g and 2a-g exhibited a strong selective mu-affinity with Ki values in the nanomolar range, which favourably compared with those of I and II. In addition, contrary to the trend observed for DBO-I, II, the mu-affinity of series 2 is markedly higher than that of the isomeric series 1. This aspect was discussed on the basis of the conformational studies performed on DBN which allowed hypotheses on the mode of interaction of these compounds with the mu receptor.

  3. Nicolas Sarkozy a recu son homologue estonien

    Index Scriptorium Estoniae

    2008-01-01

    Prantsusmaa president Nicolas Sarkozy pakkus 7. aprillil 2008 Elysée palees kohtumisel president Toomas Hendrik Ilvesega Eestile Prantsusmaa abi tuumaenergeetika küsimustes. Vabariigi President töövisiidil Pariisis 6.-8.04.2008

  4. Predominant membrane localization is an essential feature of the bacterial signal recognition particle receptor

    Directory of Open Access Journals (Sweden)

    Graumann Peter

    2009-11-01

    Full Text Available Abstract Background The signal recognition particle (SRP receptor plays a vital role in co-translational protein targeting, because it connects the soluble SRP-ribosome-nascent chain complex (SRP-RNCs to the membrane bound Sec translocon. The eukaryotic SRP receptor (SR is a heterodimeric protein complex, consisting of two unrelated GTPases. The SRβ subunit is an integral membrane protein, which tethers the SRP-interacting SRα subunit permanently to the endoplasmic reticulum membrane. The prokaryotic SR lacks the SRβ subunit and consists of only the SRα homologue FtsY. Strikingly, although FtsY requires membrane contact for functionality, cell fractionation studies have localized FtsY predominantly to the cytosolic fraction of Escherichia coli. So far, the exact function of the soluble SR in E. coli is unknown, but it has been suggested that, in contrast to eukaryotes, the prokaryotic SR might bind SRP-RNCs already in the cytosol and only then initiates membrane targeting. Results In the current study we have determined the contribution of soluble FtsY to co-translational targeting in vitro and have re-analysed the localization of FtsY in vivo by fluorescence microscopy. Our data show that FtsY can bind to SRP-ribosome nascent chains (RNCs in the absence of membranes. However, these soluble FtsY-SRP-RNC complexes are not efficiently targeted to the membrane. In contrast, we observed effective targeting of SRP-RNCs to membrane-bond FtsY. These data show that soluble FtsY does not contribute significantly to cotranslational targeting in E. coli. In agreement with this observation, our in vivo analyses of FtsY localization in bacterial cells by fluorescence microscopy revealed that the vast majority of FtsY was localized to the inner membrane and that soluble FtsY constituted only a negligible species in vivo. Conclusion The exact function of the SRP receptor (SR in bacteria has so far been enigmatic. Our data show that the bacterial SR is

  5. A G-protein-coupled chemokine receptor: A putative insertion site for a multi-pathogen recombinant capripoxvirus vaccine strategy.

    Science.gov (United States)

    Cêtre-Sossah, Catherine; Dickmu, Simon; Kwiatek, Olivier; Albina, Emmanuel

    2017-09-01

    Capripoxviruses (CaPVs) have been shown to be ideal viral vectors for the development of recombinant multivalent vaccines to enable delivery of immunogenic genes from ruminant pathogens. So far, the viral thymidine kinase (TK) gene is the only gene used to generate recombinants. A putative non-essential gene encoding a G-protein-coupled chemokine receptor subfamily homologue (GPCR) was targeted as an additional insertion site. Peste des petits ruminants (PPR) was chosen as a disease model. A new recombinant CaPV expressing the viral attachment hemagglutinin (H) of the PPR virus (PPRV) in the GPCR insertion site (rKS1-HPPR-GPCR) was generated in the backbone North African isolate KS1 strain of lumpy skin disease virus (LSDV). Comparison with the recombinant CaPV expressing the H of PPRV in the TK gene (rKS1-HPPR-TK) shown to induce protection against both PPR and LSD in both sheep and goats was assessed. The suitability of the GPCR gene to be a putative additional insertion site in the CaPV genome is evaluated and discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Tandem duplications of a degenerated GTP-binding domain at the origin of GTPase receptors Toc159 and thylakoidal SRP

    International Nuclear Information System (INIS)

    Hernandez Torres, Jorge; Maldonado, Monica Alexandra Arias; Chomilier, Jacques

    2007-01-01

    The evolutionary origin of some nuclear encoded proteins that translocate proteins across the chloroplast envelope remains unknown. Therefore, sequences of GTPase proteins constituting the Arabidopsis thaliana translocon at the outer membrane of chloroplast (atToc) complexes were analyzed by means of HCA. In particular, atToc159 and related proteins (atToc132, atToc120, and atToc90) do not have proven homologues of prokaryotic or eukaryotic ancestry. We established that the three domains commonly referred to as A, G, and M originate from the GTPase G domain, tandemly repeated, and probably evolving toward an unstructured conformation in the case of the A domain. It resulted from this study a putative common ancestor for these proteins and a new domain definition, in particular the splitting of A into three domains (A1, A2, and A3), has been proposed. The family of Toc159, previously containing A. thaliana and Pisum sativum, has been extended to Medicago truncatula and Populus trichocarpa and it has been revised for Oryza sativa. They have also been compared to GTPase subunits involved in the cpSRP system. A distant homology has been revealed among Toc and cpSRP GTP-hydrolyzing proteins of A. thaliana, and repetitions of a GTPase domain were also found in cpSRP protein receptors, by means of HCA analysis

  7. A medium-chain fatty acid receptor Gpr84 in zebrafish: expression pattern and roles in immune regulation.

    Science.gov (United States)

    Huang, Qiaoyan; Feng, Dong; Liu, Kai; Wang, Peng; Xiao, Hongyan; Wang, Ying; Zhang, Shicui; Liu, Zhenhui

    2014-08-01

    Gpr84 was recently identified as a receptor for medium-chain fatty acids, but its functions remain to be clarified. We reported the identification of a zebrafish Gpr84 homologue (zGpr84), which has a higher gene expression in the tissues of intestine, heart and liver. During embryogenesis, zGpr84 is maternally expressed and a significant increase is observed at segmentation period, and it is mainly restricted to the head region, pectoral fins, branchial arches, intestine and lateral line neuromast. Fasting or treatment with lipopolysaccharide (LPS) can induce significant up-regulation of zGpr84. We further demonstrated that zGpr84 is involved in the accumulation of lipid droplets in cells. Moreover, undecanoic acid (UA) can amplify LPS induced production of the proinflammatory cytokine IL-12 p40 through zGpr84, supporting the proposal that Gpr84 may play a role in directly linking fatty acid metabolism to immunological regulation. The resulting data in fish lay a foundation for a comprehensive exploration of the functions and evolution of Gpr84. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Localization of Mg2+-sensing shark kidney calcium receptor SKCaR in kidney of spiny dogfish, Squalus acanthias.

    Science.gov (United States)

    Hentschel, Hartmut; Nearing, Jacqueline; Harris, H William; Betka, Marlies; Baum, Michelle; Hebert, Steven C; Elger, Marlies

    2003-09-01

    We recently cloned a homologue of the bovine parathyroid calcium receptor from the kidney of a spiny dogfish (Squalus acanthias) and termed this new protein SKCaR. SKCaR senses alterations in extracellular Mg2+ after its expression in human embryonic kidney cells (Nearing J, Betka M, Quinn S, Hentschel H, Elger M, Baum M, Bai M, Chattopadyhay N, Brown E, Hebert S, and Harris HW. Proc Natl Acad. Sci USA 99: 9231-9236, 2002). In this report, we used light and electron microscopic immunocytochemical techniques to study the distribution of SKCaR in dogfish kidney. SKCaR antiserum bound to the apical membranes of shark kidney epithelial cells in the following tubular segments: proximal tubules (PIa and PIIb), late distal tubule, and collecting tubule/collecting duct as well as diffusely labeled cells of early distal tubule. The highly specific distribution of SKCaR in mesial tissue as well as lateral countercurrent bundles of dogfish kidney is compatible with a role for SKCaR to sense local tubular Mg2+ concentrations. This highly specific distribution of SKCaR protein in dogfish kidney could possibly work in concert with the powerful Mg2+ secretory system present in the PIIa segment of elasmobranch fish kidney to affect recycling of Mg2+ from putative Mg2+-sensing/Mg2+-reabsorbing segments. These data provide support for the possible existence of Mg2+ cycling in elasmobranch kidney in a manner analogous to that described for mammals.

  9. The lactate receptor, G-protein-coupled receptor 81/hydroxycarboxylic acid receptor 1

    DEFF Research Database (Denmark)

    Morland, Cecilie; Lauritzen, Knut Huso; Puchades, Maja

    2015-01-01

    We have proposed that lactate is a “volume transmitter” in the brain and underpinned this by showing that the lactate receptor, G-protein-coupled receptor 81 (GPR81, also known as HCA1 or HCAR1), which promotes lipid storage in adipocytes, is also active in the mammalian brain. This includes......, energy metabolism, and energy substrate availability, including a glucose- and glycogen-saving response. HCAR1 may contribute to optimizing the cAMP concentration. For instance, in the prefrontal cortex, excessively high cAMP levels are implicated in impaired cognition in old age, fatigue, stress...

  10. Stability of solubilized benzodiazepine receptors

    NARCIS (Netherlands)

    Janssen, M.J; Ensing, K; de Zeeuw, R.A

    1997-01-01

    According to the observations of other researchers, benzodiazepine receptors solubilized with sodium deoxycholate are unstable, but stability can be improved by exchanging deoxycholate for Triton X-100. In our experiments we conclude that the choice of detergent is not the restrictive factor for the

  11. Serum transferrin receptor in polycythemia.

    Science.gov (United States)

    Manteiga, R; Remacha, A F; Sardà, M P; Ubeda, J

    1998-10-01

    We measured serum transferrin receptor (sTfR) levels in 22 patients with polycythemia vera and in 26 cases of secondary polycythemia. In our study, raised sTfR levels in both polycythemia groups were related to iron deficiency.

  12. FMRFamide receptors of Helix aspersa

    International Nuclear Information System (INIS)

    Payza, K.

    1988-01-01

    A receptor binding assay and an isolated heart bioassay were used to identify and characterize the FMRFamide receptors in Helix. In the heart bioassay, FMRFamide increased myocardial contraction force. A potent FMRFamide analog, desaminoTyr-Phe-norLeu-arg-Phe-amide (daYFnLRFamide), was used as a radioiodinated receptor ligand. The high affinity binding of 125 I-daYFnLRFamide at 0 degree C to Helix brain membranes was reversible, saturable, pH-dependent and specific, with a K D of 13-14 nM. A lower affinity (245 nM) site was also observed. Radioligand binding sites were also identified in the heart, male reproductive organs and digestive organs. The structure-activity relations (SAR) of cardiostimulation correlated with the specificity of 125 I-daYFnLRFamide binding to brain and heart receptors. The SAR were similar to those of other molluscan FMRFamide bioassays, except that they showed a marked preference for some analogs with blocked amino-terminals

  13. Pharmacological approach of the receptors

    International Nuclear Information System (INIS)

    Puech, A.J.

    1989-01-01

    This paper explains the three main goals for clinical positron emission tomography (PET) studies: detection of receptor abnormalities in groups of patients to propose therapeutic indication of new ligands; validation of current hypothesis of drug effect; rational clinical drug development specially for dose-finding studies. (H.W.)

  14. Uncompetitive antagonism of AMPA receptors

    DEFF Research Database (Denmark)

    Andersen, Trine F; Tikhonov, Denis B; Bølcho, Ulrik

    2006-01-01

    Philanthotoxins are uncompetitive antagonists of Ca2+-permeable AMPA receptors presumed to bind to the pore-forming region, but a detailed molecular mechanism for this interaction is missing. Here a small library of novel philanthotoxins was designed and synthesized using a solid-phase strategy. ...

  15. NMDA receptors and memory encoding.

    Science.gov (United States)

    Morris, Richard G M

    2013-11-01

    It is humbling to think that 30 years have passed since the paper by Collingridge, Kehl and McLennan showing that one of Jeff Watkins most interesting compounds, R-2-amino-5-phosphonopentanoate (d-AP5), blocked the induction of long-term potentiation in vitro at synapses from area CA3 of the hippocampus to CA1 without apparent effect on baseline synaptic transmission (Collingridge et al., 1983). This dissociation was one of the key triggers for an explosion of interest in glutamate receptors, and much has been discovered since that collectively contributes to our contemporary understanding of glutamatergic synapses - their biophysics and subunit composition, of the agonists and antagonists acting on them, and their diverse functions in different networks of the brain and spinal cord. It can be fairly said that Collingridge et al.'s (1983) observation was the stimulus that has led, on the one hand, to structural biological work at the atomic scale describing the key features of NMDA receptors that enables their coincidence function to happen; and, on the other, to work with whole animals investigating the contributions that calcium signalling via this receptor can have on rhythmical activities controlled by spinal circuits, memory encoding in the hippocampus (the topic of this article), visual cortical plasticity, sensitization in pain, and other functions. In this article, I lay out how my then interest in long-term potentiation (LTP) as a model of memory enabled me to recognise the importance of Collingridge et al.'s discovery - and how I and my colleagues endeavoured to take things forward in the area of learning and memory. This is in some respects a personal story, and I tell it as such. The idea that NMDA receptor activation is essential for memory encoding, though not for storage, took time to develop and to be accepted. Along the way, there have been confusions, challenges, and surprises surrounding the idea that activation of NMDA receptors can

  16. Ror receptor tyrosine kinases: orphans no more

    OpenAIRE

    Green, Jennifer L.; Kuntz, Steven G.; Sternberg, Paul W.

    2008-01-01

    Receptor tyrosine kinase-like orphan receptor (Ror) proteins are a conserved family of tyrosine kinase receptors that function in developmental processes including skeletal and neuronal development, cell movement and cell polarity. Although Ror proteins were originally named because the associated ligand and signaling pathway were unknown, recent studies in multiple species have now established that Ror proteins are Wnt receptors. Depending on the cellular context, Ror proteins can either act...

  17. Benzodiazepine receptor antagonists for hepatic encephalopathy

    DEFF Research Database (Denmark)

    Als-Nielsen, B; Gluud, L L; Gluud, C

    2004-01-01

    Hepatic encephalopathy may be associated with accumulation of substances that bind to a receptor-complex in the brain resulting in neural inhibition. Benzodiazepine receptor antagonists may have a beneficial effect on patients with hepatic encephalopathy.......Hepatic encephalopathy may be associated with accumulation of substances that bind to a receptor-complex in the brain resulting in neural inhibition. Benzodiazepine receptor antagonists may have a beneficial effect on patients with hepatic encephalopathy....

  18. Synaptic Bistability Due to Nucleation and Evaporation of Receptor Clusters

    KAUST Repository

    Burlakov, V. M.; Emptage, N.; Goriely, A.; Bressloff, P. C.

    2012-01-01

    interacting receptors and is stabilized against clustering by a high nucleation barrier. The other state contains a receptor gas in equilibrium with a large cluster of immobile receptors, which is stabilized by the turnover rate of receptors into and out

  19. Repeated blockade of mineralocorticoid receptors, but not of glucocorticoid receptors impairs food rewarded spatial learning

    NARCIS (Netherlands)

    Douma, B. R.; Korte, S. M.; Buwalda, B.; La Fleur, S. E.; Bohus, B.; Luiten, P. G.

    1998-01-01

    Corticosteroids from the adrenal cortex influence a variety of behaviours including cognition, learning and memory. These hormones act via two intracellular receptors, the mineralo-corticoid receptor (MR) and the glucocorticoid receptor (GR). These two receptor types display a high concentration and

  20. Repeated blockade of mineralocorticoid receptors, but not of glucocorticoid receptors impairs food rewarded spatial learning

    NARCIS (Netherlands)

    Douma, BRK; Korte, SM; Buwalda, B; la Fleur, SE; Bohus, B; Luiten, PGM

    Corticosteroids from the adrenal cortex influence a variety of behaviours including cognition, learning and memory. These hormones act via two intracellular receptors, the mineralo-corticoid receptor (MR) and the glucocorticoid receptor (GR). These two receptor types display a high concentration and

  1. Receptores de progesterona en meningioma.

    Directory of Open Access Journals (Sweden)

    Herminio Ojeda Di Ninno

    1995-04-01

    Full Text Available Objetivo: Determinar la presencia de los receptores de progesterona en meningiomas y su frecuencia mediante la inmunohistoquímica. Material y Métodos: Se analizaron 24 muestras provenientes de pacientes intervenidos quirúrgicamente en el Instituto Nacional de Enfermedades Neoplásicas entre los años 1990 y 1992 con diagnóstico anatomopatológico de meningioma. La determinación de los receptores se hizo mediante una técnica de inmunohistoquímica rápida que permite el estudio de tejidos fijados previamente en parafina. Resultados: De los 24 casos estudiados, nueve resultaron ser positivos en la determinación de receptores de progesterona (37%. Se pudo observar un marcado predominio dentro del grupo femenino quienes constituyeron 8/9 casos positivos. Conclusiones: El empleo de esta reciente técnica de inmunohistoquímica aplicada a tejido de fijado en parafina, nos ha permitido confirmar la presencia de receptores de progesterona en meningiomas con una frecuencia elevada que creemos amerita un estudio más amplio de manera sistemática que incluya la intervención terapéutica mediante el uso de antiprogestágenos, como el Mifepristone o RU 486. De este estudio podrían beneficiarse no sólo pacientes operados recientemente sino aquellos que, intervenidos en el pasado sean detectados como portadores de receptores de progesterona mediante la aplicación de esta novedosa técnica (Rev Med Hered 1995; 6: 121-130.

  2. A new family of insect tyramine receptors

    DEFF Research Database (Denmark)

    Cazzamali, Giuseppe; Klærke, Dan Arne; Grimmelikhuijzen, Cornelis J P

    2005-01-01

    in the genomic databases from the malaria mosquito Anopheles gambiae and the honeybee Apis mellifera. These four tyramine or tyramine-like receptors constitute a new receptor family that is phylogenetically distinct from the previously identified insect octopamine/tyramine receptors. The Drosophila tyramine...

  3. Imaging of receptors in clinical neurosciences

    NARCIS (Netherlands)

    Korf, J

    This article deals with the question why should one determine receptors in the brain with positron and single photon emission tomography (PET and SPECT, respectively). Radiopharmaceuticals for a wide variety of receptors are available now. Receptors studies with PET and SPECT have thus far focused

  4. Receptor conversion in distant breast cancer metastases

    NARCIS (Netherlands)

    Hoefnagel, L.D.C.

    2013-01-01

    The routine pathological work-up of breast cancer includes the evaluation of the estrogen receptor (ERα), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2) which reveals biological information about the tumour as well as provides predictive biomarkers regarding hormonal

  5. Molecular pharmacology of human NMDA receptors

    DEFF Research Database (Denmark)

    Hedegaard, Maiken; Hansen, Kasper Bø; Andersen, Karen Toftegaard

    2012-01-01

    N-methyl-d-aspartate (NMDA) receptors are ionotropic glutamate receptors that mediate excitatory neurotransmission. NMDA receptors are also important drug targets that are implicated in a number of pathophysiological conditions. To facilitate the transition from lead compounds in pre-clinical ani...

  6. A novel toll-like receptor from Mytilus coruscus is induced in response to stress.

    Science.gov (United States)

    Xu, Mengshan; Wu, Jiong; Ge, Delong; Wu, Changwen; Changfeng Chi; Lv, Zhenming; Liao, Zhi; Liu, Huihui

    2018-07-01

    Toll-like receptor (TLR) is considered to be an evolutionarily conserved transmembrane protein which promotes the Toll signal pathway to active the expression of transcription factors in the innate immunity of the organism. In this study, a full length of TLR homologue of 2525bp in Mytilus coruscus (named as McTLR-a, GenBank accession no: KY940571) was characterized. Its ORF was 1815 bp with a 5'untranslated region (UTR) of 128 bp and a 3'UTR of 582 bp, encoding 602 amino acid residues with a calculated molecular weight of 70.870 kDa (pI = 6.10). BLASTn analysis and phylogenetic relationship strongly suggested that this cDNA sequence was a member of TLR family. Quantitative real time RT-PCR showed that constitutive expression of McTLR-a was occurred, with increasing order in hemocyte, gonad, mantle, adducter, gill and hepatopancreas. Bacterial infection and heavy metals stimulation up-regulated the expression of McTLR-a mRNA in hepatopancreas with time-dependent manners. The maximum expression appeared at 12 h after pathogenic bacteria injection, with approximately 22-fold in Aeromonas hydrophila and 17-fold in Vibrio parahemolyticus higher than that of the blank group. In heavy metals stress group, they all reached peaks at 3d, while the diverse concentration caused the maximum expression were different. The highest expression reached approximately 7-fold higher than the blank in low concentration of Pb 2+ exposure. In Cu 2+ treated group, it reached the peak (approximately 12-fold higher than the blank)in middle concentration. These results indicated that McTLR-a might be involved in the defense response and had a significant role in mediating the environmental stress. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Effect of Porphyromonas gingivalis infection on post-transcriptional regulation of the low-density lipoprotein receptor in mice

    Directory of Open Access Journals (Sweden)

    Miyazawa Haruna

    2012-09-01

    Full Text Available Abstract Background Periodontal disease is suggested to increase the risk of atherothrombotic disease by inducing dyslipidemia. Recently, we demonstrated that proprotein convertase subtilisin/kexin type 9 (PCSK9, which is known to play a critical role in the regulation of circulating low-density lipoprotein (LDL cholesterol levels, is elevated in periodontitis patients. However, the underlying mechanisms of elevation of PCSK9 in periodontitis patients are largely unknown. Here, we explored whether Porphyromonas gingivalis, a representative periodontopathic bacterium, -induced inflammatory response regulates serum PCSK9 and cholesterol levels using animal models. Methods We infected C57BL/6 mice intraperitoneally with Porphyromonas gingivalis, a representative strain of periodontopathic bacteria, and evaluated serum PCSK9 levels and the serum lipid profile. PCSK9 and LDL receptor (LDLR gene and protein expression, as well as liver X receptors (Lxrs, inducible degrader of the LDLR (Idol, and sterol regulatory element binding transcription factor (Srebf2 gene expression, were examined in the liver. Results P. gingivalis infection induced a significant elevation of serum PCSK9 levels and a concomitant elevation of total and LDL cholesterol compared with sham-infected mice. The LDL cholesterol levels were significantly correlated with PCSK9 levels. Expression of the Pcsk9, Ldlr, and Srebf2 genes was upregulated in the livers of the P. gingivalis-infected mice compared with the sham-infected mice. Although Pcsk9 gene expression is known to be positively regulated by sterol regulatory element binding protein (SREBP2 (human homologue of Srebf2, whereas Srebf2 is negatively regulated by cholesterol, the elevated expression of Srebf2 found in the infected mice is thought to be mediated by P. gingivalis infection. Conclusions P. gingivalis infection upregulates PCSK9 production via upregulation of Srebf2, independent of cholesterol levels. Further studies

  8. Some theoretical aspects of hormone receptor determination

    International Nuclear Information System (INIS)

    Sluiter, W.J.

    1981-01-01

    Suitable antisera for determination of hormone receptors are not available for the majority of hormone receptors. Therefore, the determination of hormone receptors is mostly performed in terms of binding capacity for the appropriate hormone, using radioactive hormone labels. Some theoretical aspects of such a receptor determination are discussed including the length of incubation (total or unoccupied receptor concentration), single point or multiple point (Scatchard) analysis (regarding the influence of other specific binders), the correction procedure for non-specific binding and the influence of the circulating hormone level. (Auth.)

  9. [Ceruloplasmin receptor on human erythrocytes].

    Science.gov (United States)

    Saenko, E L; Basevich, V V; Iaropolov, A I

    1988-08-01

    The structural fragments of the human ceruloplasmin (CP) molecule and of erythrocyte receptors which provide for the specific interaction of CP with erythrocytes were identified, and their properties were investigated. The interaction of CP with erythrocytes, both intact and treated with neuroaminidase and proteolytic enzymes (trypsin, chymotrypsin, papaine, pronase E) is described. Experiments with CP reception were performed at 4 degrees C, using [125I]CP and [125I]asialo-CP. The parameters of binding were determined in Scatchard plots. It was demonstrated that the specific binding of CP to erythrocyte receptors is determined by its interaction with two structural sites of the carbohydrate moiety of the CP molecule, i.e., the terminal residues of sialic acids and a site, (formula; see text) located at a large distance from the chain terminus.

  10. NGA/Insulin receptor scanning

    International Nuclear Information System (INIS)

    Kurtaran, A.; Virgolini, I.

    1994-01-01

    Tc-99m-galactosyl-neoglycoalbumin (NGA) is one of the first receptor-based radiopharmaceuticals which specifically recognizes the hepatic binding protein (HBP) located on the surface of the hepatocytes. The exclusive interactin of NGA with HBP provided the basis for a kinetic model for the evaluation hepatocellular function. During the last years we have used NGA in more than 300 patients with various liver diseases including liver cirrhosis (Stages Child A to Child C), viral hepatitis, and carcinomas. In these studies, the calculated HBP densities, after i.v.-injection of Tc-99m-NGA, significantly correlated with the clinical course of the diseases. Furthermore, similar to conventional Tc-colloid, NGA provided excellent demonstration of 'cold spots' for hepatic masses. In a further approach we used another hepatocyte receptor-seeking radioligand, I-123-Tyr-A14- insulin, and found, that its in vitro-binding to hepatocellular carcinomas is greatly enhanced over normal hepatic tissue. On this basis, we developed a double-tracer method using NGA and insulin in a single study. Thus, areas of 'cold spots' identifying hepatic masses on NGA scans, take up I-123-Tyr-A14-insulin immediately after i.v.-injection. This was true for hepatocellular hepatomas, but not for adenocarcinomas. In conclusion, NGA/insulin receptor scanning could be a novel and save method for the demonstration of hepatocellular hepatomas. (author)

  11. PAF receptor structure: a hypothesis.

    Science.gov (United States)

    Godfroid, J J; Dive, G; Lamotte-Brasseur, J; Batt, J P; Heymans, F

    1991-12-01

    Different hypotheses of the structure of platelet-activating factor (PAF) receptor based on structure-activity relationships of agonists and antagonists are reviewed. For an agonistic effect, strong hydrophobic interactions and an ether function are required in position-1 of the glycerol backbone; chain length limitations and steric hindrance demand a small group in position-2. The unusual structural properties of non-PAF-like antagonists required 3-D electrostatic potential calculations. This method applied to seven potent antagonists suggests a strong "Cache-orielles" (ear-muff) effect, i.e., two strong electronegative wells (isocontour at -10 Kcal/mole) are located at 180 degrees to each other and at a relatively constant distance. Initial consideration of the "Cache-oreilles" effect implied the structure of a bipolarized cylinder of 10-12 A diameter for the receptor. However, very recent results on studies with agonists and antagonists structurally similar to PAF suggest that the receptor may in fact be a multi-polarized cylinder.

  12. NGA/Insulin receptor scanning

    Energy Technology Data Exchange (ETDEWEB)

    Kurtaran, A; Virgolini, I [Vienna Univ. (Austria). Abt. fuer Nuklearmedizin; Angelberger, P [Ludwig Boltzmann-Institut fuer Nuklearmedizin, Vienna (Austria)

    1994-10-01

    Tc-99m-galactosyl-neoglycoalbumin (NGA) is one of the first receptor-based radiopharmaceuticals which specifically recognizes the hepatic binding protein (HBP) located on the surface of the hepatocytes. The exclusive interactin of NGA with HBP provided the basis for a kinetic model for the evaluation hepatocellular function. During the last years we have used NGA in more than 300 patients with various liver diseases including liver cirrhosis (Stages Child A to Child C), viral hepatitis, and carcinomas. In these studies, the calculated HBP densities, after i.v.-injection of Tc-99m-NGA, significantly correlated with the clinical course of the diseases. Furthermore, similar to conventional Tc-colloid, NGA provided excellent demonstration of `cold spots` for hepatic masses. In a further approach we used another hepatocyte receptor-seeking radioligand, I-123-Tyr-A14- insulin, and found, that its in vitro-binding to hepatocellular carcinomas is greatly enhanced over normal hepatic tissue. On this basis, we developed a double-tracer method using NGA and insulin in a single study. Thus, areas of `cold spots` identifying hepatic masses on NGA scans, take up I-123-Tyr-A14-insulin immediately after i.v.-injection. This was true for hepatocellular hepatomas, but not for adenocarcinomas. In conclusion, NGA/insulin receptor scanning could be a novel and save method for the demonstration of hepatocellular hepatomas. (author).

  13. Lymphocyte receptors for pertussis toxin

    Energy Technology Data Exchange (ETDEWEB)

    Clark, C.G.; Armstrong, G.D. (Univ. of Alberta, Edmonton (Canada))

    1990-12-01

    We have investigated human T-lymphocyte receptors for pertussis toxin by affinity isolation and photoaffinity labeling procedures. T lymphocytes were obtained from peripheral human blood, surface iodinated, and solubilized in Triton X-100. The iodinated mixture was then passed through pertussis toxin-agarose, and the fractions were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Autoradiography of the fixed, dried gels revealed several bands in the pertussis toxin-bound fraction that were not observed in fractions obtained from histone or fetuin-agarose. Further investigations employed a photoaffinity labeling reagent, sulfosuccinimidyl 2-(p-azido-salicylamido)-1,3'-dithiopropionate, to identify pertussis toxin receptors in freshly isolated peripheral blood monocytic cells, T lymphocytes, and Jurkat cells. In all three cell systems, the pertussis toxin affinity probe specifically labeled a single protein species with an apparent molecular weight of 70,000 that was not observed when the procedure was performed in the presence of excess unmodified pertussis toxin. A protein comparable in molecular weight to the one detected by the photoaffinity labeling technique was also observed among the species that bound to pertussis toxin-agarose. The results suggest that pertussis toxin may bind to a 70,000-Da receptor in human T lymphocytes.

  14. The two-state dimer receptor model: a general model for receptor dimers.

    Science.gov (United States)

    Franco, Rafael; Casadó, Vicent; Mallol, Josefa; Ferrada, Carla; Ferré, Sergi; Fuxe, Kjell; Cortés, Antoni; Ciruela, Francisco; Lluis, Carmen; Canela, Enric I

    2006-06-01

    Nonlinear Scatchard plots are often found for agonist binding to G-protein-coupled receptors. Because there is clear evidence of receptor dimerization, these nonlinear Scatchard plots can reflect cooperativity on agonist binding to the two binding sites in the dimer. According to this, the "two-state dimer receptor model" has been recently derived. In this article, the performance of the model has been analyzed in fitting data of agonist binding to A(1) adenosine receptors, which are an example of receptor displaying concave downward Scatchard plots. Analysis of agonist/antagonist competition data for dopamine D(1) receptors using the two-state dimer receptor model has also been performed. Although fitting to the two-state dimer receptor model was similar to the fitting to the "two-independent-site receptor model", the former is simpler, and a discrimination test selects the two-state dimer receptor model as the best. This model was also very robust in fitting data of estrogen binding to the estrogen receptor, for which Scatchard plots are concave upward. On the one hand, the model would predict the already demonstrated existence of estrogen receptor dimers. On the other hand, the model would predict that concave upward Scatchard plots reflect positive cooperativity, which can be neither predicted nor explained by assuming the existence of two different affinity states. In summary, the two-state dimer receptor model is good for fitting data of binding to dimeric receptors displaying either linear, concave upward, or concave downward Scatchard plots.

  15. 阴道毛滴虫Rac1蛋白的cDNA克隆和序列分析%Molecular Cloning and Characterization of a Rac1 Homologue cDNA from Trichomonas vaginalis

    Institute of Scientific and Technical Information of China (English)

    傅玉才; 章家新; 郑晓虹; 刘红

    2004-01-01

    Objective To clone and characterize a Racl homologue from Trichomonas vaginalis for studying cell cycle of the organism. Methods A cDNA library derived from T. vaginalis mRNA was constructed into λ TriplEx2 phage vector. An expression sequence tag program was launched. Sequences of cDNA clones were analyzed using NCBI BLAST algorithms, and ClustalW and Treeview programs. Results A cDNA clone with a length of 714 base pairs was isolated. The sequence analysis showed that the cDNA clone has an open reading frame with 600 bp. The deduced amino acid sequence from the open reading frame contains 200 residuals and is most homologous to Rac1 subfamily of Rho GTPases with > 60% identity. The conserved sequence elements of Rho GTPases, such as GTP-binding sites, GTPase-activating protein (GAP) interaction motifs, GTP-dissociation inhibitors (GDI) interaction motifs, guanine nucleotide exchange factor (GEF) interaction elements, etc, were detected in the amino acid sequence. The phylogenetic analysis showed that the cDNA clone is grouped in the Rac subfamily and is more closely related to Rac1 proteins of protozoa. Conclusion The cDNA clone isolated belongs to Rac subfamily of Rho GTPases and is probably a Rac1 protein of T. vaginalis.%目的获得阴道毛滴虫Rac1蛋白的cDNA克隆,研究其在细胞周期中的调解作用.方法提取阴道毛滴虫总RNA,构建cDNA表达文库,随机分离cDNA克隆并测序.用在线生物分析软件NCBI BLAST、ClustalW以及Treeview等程序进行序列分析.结果获得一株有714 bp的cDNA克隆.序列分析表明,该克隆开放阅读框具600 bp,推测肽链具200个氨基酸.该肽链与Rho家族中Rac1鸟苷三磷酸(GTP)酶同源性最高(>60%),并具多种Rho GTP酶的保守基序,如GTP结合部位、GTP酶激活蛋白作用基序、GTP分离抑制因子作用基序、鸟嘌呤核苷酸交换因子作用基序等.进化树分析显示该克隆属于Rac亚家族GTP酶,与原虫Rac1蛋白最接近.结论该克隆

  16. Localization of mineralocorticoid receptors at mammalian synapses.

    Directory of Open Access Journals (Sweden)

    Eric M Prager

    Full Text Available In the brain, membrane associated nongenomic steroid receptors can induce fast-acting responses to ion conductance and second messenger systems of neurons. Emerging data suggest that membrane associated glucocorticoid and mineralocorticoid receptors may directly regulate synaptic excitability during times of stress when adrenal hormones are elevated. As the key neuron signaling interface, the synapse is involved in learning and memory, including traumatic memories during times of stress. The lateral amygdala is a key site for synaptic plasticity underlying conditioned fear, which can both trigger and be coincident with the stress response. A large body of electrophysiological data shows rapid regulation of neuronal excitability by steroid hormone receptors. Despite the importance of these receptors, to date, only the glucocorticoid receptor has been anatomically localized to the membrane. We investigated the subcellular sites of mineralocorticoid receptors in the lateral amygdala of the Sprague-Dawley rat. Immunoblot analysis revealed the presence of mineralocorticoid receptors in the amygdala. Using electron microscopy, we found mineralocorticoid receptors expressed at both nuclear including: glutamatergic and GABAergic neurons and extra nuclear sites including: presynaptic terminals, neuronal dendrites, and dendritic spines. Importantly we also observed mineralocorticoid receptors at postsynaptic membrane densities of excitatory synapses. These data provide direct anatomical evidence supporting the concept that, at some synapses, synaptic transmission is regulated by mineralocorticoid receptors. Thus part of the stress signaling response in the brain is a direct modulation of the synapse itself by adrenal steroids.

  17. Protein Connectivity in Chemotaxis Receptor Complexes.

    Directory of Open Access Journals (Sweden)

    Stephan Eismann

    2015-12-01

    Full Text Available The chemotaxis sensory system allows bacteria such as Escherichia coli to swim towards nutrients and away from repellents. The underlying pathway is remarkably sensitive in detecting chemical gradients over a wide range of ambient concentrations. Interactions among receptors, which are predominantly clustered at the cell poles, are crucial to this sensitivity. Although it has been suggested that the kinase CheA and the adapter protein CheW are integral for receptor connectivity, the exact coupling mechanism remains unclear. Here, we present a statistical-mechanics approach to model the receptor linkage mechanism itself, building on nanodisc and electron cryotomography experiments. Specifically, we investigate how the sensing behavior of mixed receptor clusters is affected by variations in the expression levels of CheA and CheW at a constant receptor density in the membrane. Our model compares favorably with dose-response curves from in vivo Förster resonance energy transfer (FRET measurements, demonstrating that the receptor-methylation level has only minor effects on receptor cooperativity. Importantly, our model provides an explanation for the non-intuitive conclusion that the receptor cooperativity decreases with increasing levels of CheA, a core signaling protein associated with the receptors, whereas the receptor cooperativity increases with increasing levels of CheW, a key adapter protein. Finally, we propose an evolutionary advantage as explanation for the recently suggested CheW-only linker structures.

  18. Characterization of astrocytic and neuronal benzodiazepine receptors

    Energy Technology Data Exchange (ETDEWEB)

    Bender, A.S.

    1988-01-01

    Primary cultures of astrocytes and neurons express benzodiazepine receptors. Neuronal benzodiazepine receptors were of high-affinity, K{sub D} values were 7.5-43 nM and the densities of receptors (B{sub max}) were 924-4131 fmol/mg protein. Astrocytes posses a high-affinity benzodiazepine receptor, K{sub D} values were 6.6-13 nM. The B{sub max} values were 6,033-12,000 fmol/mg protein. The pharmacological profile of the neuronal benzodiazepine receptor was that of the central-type benzodiazepine receptor, where clonazepam has a high-affinity and Ro 5-4864 (4{prime}-chlorodiazepam) has a low-affinity. Whereas astrocytic benzoidazepine receptor was characteristic of the so called peripheral-type benzodiazepine receptors, which shows a high-affinity towards Ro 5-4863, and a low-affinity towards clonazepam. The astrocytic benzodiazepine receptors was functionally correlated with voltage dependent calcium channels, since dihydropyridines and benzodiazepines interacted with ({sup 3}H) diazepam and ({sup 3}H) nitrendipine receptors with the same rank order of potency, showing a statistically significant correlation. No such correlation was observed in neurons.

  19. TBLR1 regulates the expression of nuclear hormone receptor co-repressors

    Directory of Open Access Journals (Sweden)

    Brown Stuart

    2006-08-01

    Full Text Available Abstract Background Transcription is regulated by a complex interaction of activators and repressors. The effectors of repression are large multimeric complexes which contain both the repressor proteins that bind to transcription factors and a number of co-repressors that actually mediate transcriptional silencing either by inhibiting the basal transcription machinery or by recruiting chromatin-modifying enzymes. Results TBLR1 [GenBank: NM024665] is a co-repressor of nuclear hormone transcription factors. A single highly conserved gene encodes a small family of protein molecules. Different isoforms are produced by differential exon utilization. Although the ORF of the predominant form contains only 1545 bp, the human gene occupies ~200 kb of genomic DNA on chromosome 3q and contains 16 exons. The genomic sequence overlaps with the putative DC42 [GenBank: NM030921] locus. The murine homologue is structurally similar and is also located on Chromosome 3. TBLR1 is closely related (79% homology at the mRNA level to TBL1X and TBL1Y, which are located on Chromosomes X and Y. The expression of TBLR1 overlaps but is distinct from that of TBL1. An alternatively spliced form of TBLR1 has been demonstrated in human material and it too has an unique pattern of expression. TBLR1 and the homologous genes interact with proteins that regulate the nuclear hormone receptor family of transcription factors. In resting cells TBLR1 is primarily cytoplasmic but after perturbation the protein translocates to the nucleus. TBLR1 co-precipitates with SMRT, a co-repressor of nuclear hormone receptors, and co-precipitates in complexes immunoprecipitated by antiserum to HDAC3. Cells engineered to over express either TBLR1 or N- and C-terminal deletion variants, have elevated levels of endogenous N-CoR. Co-transfection of TBLR1 and SMRT results in increased expression of SMRT. This co-repressor undergoes ubiquitin-mediated degradation and we suggest that the stabilization of

  20. Receptor Tyrosine Kinases in Drosophila Development

    Science.gov (United States)

    Sopko, Richelle; Perrimon, Norbert

    2013-01-01

    Tyrosine phosphorylation plays a significant role in a wide range of cellular processes. The Drosophila genome encodes more than 20 receptor tyrosine kinases and extensive studies in the past 20 years have illustrated their diverse roles and complex signaling mechanisms. Although some receptor tyrosine kinases have highly specific functions, others strikingly are used in rather ubiquitous manners. Receptor tyrosine kinases regulate a broad expanse of processes, ranging from cell survival and proliferation to differentiation and patterning. Remarkably, different receptor tyrosine kinases share many of the same effectors and their hierarchical organization is retained in disparate biological contexts. In this comprehensive review, we summarize what is known regarding each receptor tyrosine kinase during Drosophila development. Astonishingly, very little is known for approximately half of all Drosophila receptor tyrosine kinases. PMID:23732470

  1. Receptor binding studies of the living heart

    International Nuclear Information System (INIS)

    Syrota, A.

    1988-01-01

    Receptors form a class of intrinsic membrane proteins (or glycoproteins) defined by the high affinity and specificity with which they bind ligands. Many receptors are associated directly or indirectly with membrane ion channels that open or close after a conformational change of the receptor induced by the binding of the neurotransmitter. Changes in number and/or affinity of cardiac neurotransmitter receptors have been associated with myocardial ischemia and infarction, congestive heart failure, and cardiomyopathy as well as diabetes or thyroid-induced heart muscle disease. These alterations of cardiac receptors have been demonstrated in vitro on membrane homogenates from samples collected mainly during surgery or postmortem. The disadvantage of these in vitro binding techniques is that receptors lose their natural environment and their relationships with the other components of the tissue

  2. Subtype selective kainic acid receptor agonists

    DEFF Research Database (Denmark)

    Bunch, Lennart; Krogsgaard-Larsen, Povl

    2009-01-01

    (S)-Glutamic acid (Glu) is the major excitatory neurotransmitter in the mammalian central nervous system, activating the plethora of glutamate receptors (GluRs). In broad lines, the GluRs are divided into two major classes: the ionotropic Glu receptors (iGluRs) and the metabotropic Glu receptors (m......GluRs). Within the iGluRs, five subtypes (KA1, KA2, iGluR5-7) show high affinity and express full agonist activity upon binding of the naturally occurring amino acid kainic acid (KA). Thus these receptors have been named the KA receptors. This review describes all-to our knowledge-published KA receptor agonists...

  3. Characteristic molecular vibrations of adenosine receptor ligands.

    Science.gov (United States)

    Chee, Hyun Keun; Yang, Jin-San; Joung, Je-Gun; Zhang, Byoung-Tak; Oh, S June

    2015-02-13

    Although the regulation of membrane receptor activation is known to be crucial for molecular signal transduction, the molecular mechanism underlying receptor activation is not fully elucidated. Here we study the physicochemical nature of membrane receptor behavior by investigating the characteristic molecular vibrations of receptor ligands using computational chemistry and informatics methods. By using information gain, t-tests, and support vector machines, we have identified highly informative features of adenosine receptor (AdoR) ligand and corresponding functional amino acid residues such as Asn (6.55) of AdoR that has informative significance and is indispensable for ligand recognition of AdoRs. These findings may provide new perspectives and insights into the fundamental mechanism of class A G protein-coupled receptor activation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  4. Acetylcholine receptors in the human retina

    International Nuclear Information System (INIS)

    Hutchins, J.B.; Hollyfield, J.G.

    1985-01-01

    Evidence for a population of acetylcholine (ACh) receptors in the human retina is presented. The authors have used the irreversible ligand 3 H-propylbenzilylcholine mustard ( 3 H-PrBCM) to label muscarinic receptors. 3 H- or 125 I-alpha-bungarotoxin (alpha-BTx) was used to label putative nicotinic receptors. Muscarinic receptors are apparently present in the inner plexiform layer of the retina. Autoradiographic grain densities are reduced in the presence of saturating concentrations of atropine, quinuclidinyl benzilate or scopolamine; this indicates that 3 H-PrBCM binding is specific for a population of muscarinic receptors in the human retina. Binding sites for radiolabeled alpha-BTx are found predominantly in the inner plexiform layer of the retina. Grain densities are reduced in the presence of d-tubocurarine, indicating that alpha-BTx may bind to a pharmacologically relevant nicotinic ACh receptor. This study provides evidence for cholinergic neurotransmission in the human retina

  5. Studies on insulin receptor, 1

    International Nuclear Information System (INIS)

    Sakai, Yukio

    1979-01-01

    The present study was designed for the purpose of establishing a method of insulin radioreceptor assay using plasma membranes of guinea pigs as receptor sites. The results obtained are as follows: 1) Insulin receptor in the renal plasma membranes of guinea pigs showed a significantly high affinity to porcine insulin compared with that in the plasma membranes of guinea pig liver or rat kidney and liver. 2) In the insulin radioreceptor assay, an optimum condition was observed by the incubation at 4 0 C for 24 - 48 hours with 100 μg membrane protein of guinea pig kidney and 0.08 ng of 125 I-insulin. This assay method was specific for insulin and showed an accurate biological activity of insulin. 3) The recovery rate of insulin radioreceptor assay was 98.4% and dilution check up to 16 times did not influence on the result. An average of coefficient variation was 3.92% within assay. All of these results indicated the method to be satisfactory. 4) Glucose induced insulin release by perfusion method in isolated Langerhans islets of rats showed an identical pattern of reaction curves between radioreceptor assay and radioimmunoassay, although the values of radioreceptor assay was slightly low. 5) Insulin free serum produced by ultra filtration method was added to the standard assay medium. By this procedure, direct measurement of human serum by radioreceptor assay became possible. 6) The value of human serum insulin receptor binding activity by the radioreceptor assay showed a high correlation with that of insulin radioimmunoassay in sera of normal, borderline or diabetic type defined by glucose tolerance test. (author)

  6. Seventh Symposium on Subtypes of Musccarinic Receptors.

    Science.gov (United States)

    1997-01-01

    nociceptive pain, are less than ideal. For mild to moderate pain, the first line of therapy includes aspirin, acetaminophen/ paracetamol , and nonsteroidal...due to receptor degradation triggered by prolonged carbachol occupancy. This down-regulation was accompanied by uncoupling of the M2-receptors after 24...be under control by the m3 mAChR, suggesting a complex receptor regulation of phosphoinositide metabolism, including degradation and synthesis. Future

  7. Molecular identification of the first SIFamide receptor

    DEFF Research Database (Denmark)

    Jørgensen, Lars M; Hauser, Frank; Cazzamali, Giuseppe

    2006-01-01

    , an impressive sequence conservation (67-77% amino acid sequence identities between the seven-transmembrane areas; 82-87% sequence similarities). The identification of well-conserved SIFamide receptor orthologues in all other insects with a sequenced genome, suggests that the SIFamide/receptor couple must have...... an essential function in arthropods. This paper is the first report on the identification of a SIFamide receptor....

  8. Progesterone receptor modulators in breast cancer

    OpenAIRE

    WIEHLE, Ronald D.

    2015-01-01

    Breast cancer has been treated successfully with selective estrogen receptor antagonists (SERMs) such as tamoxifen, receptor-depleting agents such as fulvestrant, and aromatase inhibitors such as anastrozole. Selective progesterone receptor modulators (SPRMs or PRMs) have not been studied as much and are currently under investigation for inhibition of mammary carcinogenesis in animal models and breast cancer prevention trials in women. They might follow tamoxifen and aromatase inhibitors in t...

  9. Androgen Receptor Signaling in Bladder Cancer

    OpenAIRE

    Li, Peng; Chen, Jinbo; Miyamoto, Hiroshi

    2017-01-01

    Emerging preclinical findings have indicated that steroid hormone receptor signaling plays an important role in bladder cancer outgrowth. In particular, androgen-mediated androgen receptor signals have been shown to correlate with the promotion of tumor development and progression, which may clearly explain some sex-specific differences in bladder cancer. This review summarizes and discusses the available data, suggesting the involvement of androgens and/or the androgen receptor pathways in u...

  10. Muscarinic Receptor Agonists and Antagonists

    Directory of Open Access Journals (Sweden)

    David R. Kelly

    2001-02-01

    Full Text Available A comprehensive review of pharmacological and medical aspects of the muscarinic class of acetylcholine agonists and antagonists is presented. The therapeutic benefits of achieving receptor subtype selectivity are outlined and applications in the treatment of Alzheimer’s disease are discussed. A selection of chemical routes are described, which illustrate contemporary methodology for the synthesis of chiral medicinal compounds (asymmetric synthesis, chiral pool, enzymes. Routes to bicyclic intrannular amines and intramolecular Diels-Alder reactions are highlighted.

  11. Hemoglobin and heme scavenger receptors

    DEFF Research Database (Denmark)

    Nielsen, Marianne Jensby; Møller, Holger Jon; Moestrup, Søren Kragh

    2010-01-01

    Heme, the functional group of hemoglobin, myoglobin, and other hemoproteins, is a highly toxic substance when it appears in the extracellular milieu. To circumvent potential harmful effects of heme from hemoproteins released during physiological or pathological cell damage (such as hemolysis...... and rhabdomyolysis), specific high capacity scavenging systems have evolved in the mammalian organism. Two major systems, which essentially function in a similar way by means of a circulating latent plasma carrier protein that upon ligand binding is recognized by a receptor, are represented by a) the hemoglobin...

  12. CERAPP: Collaborative Estrogen Receptor Activity Prediction Project

    Data.gov (United States)

    U.S. Environmental Protection Agency — Data from a large-scale modeling project called CERAPP (Collaborative Estrogen Receptor Activity Prediction Project) demonstrating using predictive computational...

  13. Identification and mechanism of ABA receptor antagonism

    KAUST Repository

    Melcher, Karsten; Xu, Yong; Ng, Ley-Moy; Zhou, X. Edward; Soon, Fen-Fen; Chinnusamy, Viswanathan; Suino-Powell, Kelly M.; Kovach, Amanda; Tham, Fook S.; Cutler, Sean R.; Li, Jun; Yong, Eu-Leong; Zhu, Jian-Kang; Xu, H. Eric

    2010-01-01

    The phytohormone abscisic acid (ABA) functions through a family of fourteen PYR/PYL receptors, which were identified by resistance to pyrabactin, a synthetic inhibitor of seed germination. ABA activates these receptors to inhibit type 2C protein phosphatases, such as ABI1, yet it remains unclear whether these receptors can be antagonized. Here we demonstrate that pyrabactin is an agonist of PYR1 and PYL1 but is unexpectedly an antagonist of PYL2. Crystal structures of the PYL2-pyrabactin and PYL1-pyrabactin-ABI1 complexes reveal the mechanism responsible for receptor-selective activation and inhibition, which enables us to design mutations that convert PYL1 to a pyrabactin-inhibited receptor and PYL2 to a pyrabactin-activated receptor and to identify new pyrabactin-based ABA receptor agonists. Together, our results establish a new concept of ABA receptor antagonism, illustrate its underlying mechanisms and provide a rational framework for discovering novel ABA receptor ligands. © 2010 Nature America, Inc. All rights reserved.

  14. Dehydroepiandrosterone: an ancestral ligand of neurotrophin receptors.

    Science.gov (United States)

    Pediaditakis, Iosif; Iliopoulos, Ioannis; Theologidis, Ioannis; Delivanoglou, Nickoleta; Margioris, Andrew N; Charalampopoulos, Ioannis; Gravanis, Achille

    2015-01-01

    Dehydroepiandosterone (DHEA), the most abundant steroid in humans, affects multiple cellular functions of the endocrine, immune, and nervous systems. However, up to quite recently, no receptor has been described specifically for it, whereas most of its physiological actions have been attributed to its conversion to either androgens or estrogens. DHEA interacts and modulate a variety of membrane and intracellular neurotransmitter and steroid receptors. We have recently reported that DHEA protects neuronal cells against apoptosis, interacting with TrkA, the high-affinity prosurvival receptor of the neurotrophin, nerve growth factor. Intrigued by its pleiotropic effects in the nervous system of a variety of species, we have investigated the ability of DHEA to interact with the other two mammalian neurotrophin receptors, ie, the TrkB and TrkC, as well as their invertebrate counterparts (orthologs) in mollusks Lymnaea and Aplysia and in cephalochordate fish Amphioxus. Amazingly, DHEA binds to all Trk receptors, although with lower affinity by 2 orders of magnitude compared with that of the polypeptidic neurotrophins. DHEA effectively induced the first step of the TrkA and TrkC receptors activation (phosphorylation at tyrosine residues), including the vertebrate neurotrophin nonresponding invertebrate Lymnaea and Aplysia receptors. Based on our data, we hypothesize that early in evolution, DHEA may have acted as a nonspecific neurotrophic factor promoting neuronal survival. The interaction of DHEA with all types of neurotrophin receptors offers new insights into the largely unidentified mechanisms of its actions on multiple tissues and organs known to express neurotrophin receptors.

  15. Characterization of the chicken muscle insulin receptor

    International Nuclear Information System (INIS)

    Adamo, M.; Simon, J.; Rosebrough, R.W.; McMurtry, J.P.; Steele, N.C.; LeRoith, D.

    1987-01-01

    Insulin receptors are present in chicken skeletal muscle. Crude membrane preparations demonstrated specific 125 I-insulin binding. The nonspecific binding was high (36-55% of total binding) and slightly lower affinity receptors were found than are typically observed for crude membrane insulin binding in other chicken tissues. Affinity crosslinking of 125 I-insulin to crude membranes revealed insulin receptor alpha-subunits of Mr 128K, intermediate between those of liver (134K) and brain (124K). When solubilized and partially purified on wheat germ agglutinin (WGA) affinity columns, chicken muscle insulin receptors exhibited typical high affinity binding, with approximately 10(-10) M unlabeled insulin producing 50% inhibition of the specific 125 I-insulin binding. WGA purified chicken muscle insulin receptors also exhibited insulin-stimulated autophosphorylation of the beta-subunit, which appeared as phosphorylated bands of 92- and 81K. Both bands were immunoprecipitated by anti-receptor antiserum (B10). WGA purified membranes also demonstrated dose-dependent insulin-stimulated phosphorylation of the exogenous substrate poly(Glu,Tyr)4:1. However, unlike chicken liver, chicken muscle insulin receptor number and tyrosine kinase activity were unaltered by 48 hr of fasting or 48 hr of fasting and 24 hr of refeeding. Thus, despite the presence of insulin receptors in chicken muscle showing normal coupling to receptor tyrosine kinase activity, nutritional alterations modulate these parameters in a tissue-specific manner in chickens

  16. Human dopamine receptor and its uses

    Energy Technology Data Exchange (ETDEWEB)

    Civelli, Olivier (Portland, OR); Van Tol, Hubert Henri-Marie (Toronto, CA)

    1999-01-01

    The present invention is directed toward the isolation, characterization and pharmacological use of the human D4 dopamine receptor. The nucleotide sequence of the gene corresponding to this receptor and alleleic variant thereof are provided by the invention. The invention also includes recombinant eukaryotic expression constructs capable of expressing the human D4 dopamine receptor in cultures of transformed eukaryotic cells. The invention provides cultures of transformed eukaryotic cells which synthesize the human D4 dopamine receptor, and methods for characterizing novel psychotropic compounds using such cultures.

  17. Chapter 8. Activation mechanisms of chemokine receptors

    DEFF Research Database (Denmark)

    Jensen, Pia C; Rosenkilde, Mette M

    2009-01-01

    binding. Attempts to unravel the activation mechanism of 7TM receptors have led to the conclusion that activation involves movements of the transmembrane segments VI and VII in particular, as recently gathered in the Global Toggle Switch Model. However, to understand the activation mechanism completely......, more research has to be done in this field. Chemokine receptors are interesting tools in this matter. First, the chemokine system has a high degree of promiscuity that allows several chemokines to target one receptor in different ways, as well as a single chemokine ligand to target several receptors...

  18. Identification and mechanism of ABA receptor antagonism

    KAUST Repository

    Melcher, Karsten

    2010-08-22

    The phytohormone abscisic acid (ABA) functions through a family of fourteen PYR/PYL receptors, which were identified by resistance to pyrabactin, a synthetic inhibitor of seed germination. ABA activates these receptors to inhibit type 2C protein phosphatases, such as ABI1, yet it remains unclear whether these receptors can be antagonized. Here we demonstrate that pyrabactin is an agonist of PYR1 and PYL1 but is unexpectedly an antagonist of PYL2. Crystal structures of the PYL2-pyrabactin and PYL1-pyrabactin-ABI1 complexes reveal the mechanism responsible for receptor-selective activation and inhibition, which enables us to design mutations that convert PYL1 to a pyrabactin-inhibited receptor and PYL2 to a pyrabactin-activated receptor and to identify new pyrabactin-based ABA receptor agonists. Together, our results establish a new concept of ABA receptor antagonism, illustrate its underlying mechanisms and provide a rational framework for discovering novel ABA receptor ligands. © 2010 Nature America, Inc. All rights reserved.

  19. Knock-In Mice with NOP-eGFP Receptors Identify Receptor Cellular and Regional Localization.

    Science.gov (United States)

    Ozawa, Akihiko; Brunori, Gloria; Mercatelli, Daniela; Wu, Jinhua; Cippitelli, Andrea; Zou, Bende; Xie, Xinmin Simon; Williams, Melissa; Zaveri, Nurulain T; Low, Sarah; Scherrer, Grégory; Kieffer, Brigitte L; Toll, Lawrence

    2015-08-19

    The nociceptin/orphanin FQ (NOP) receptor, the fourth member of the opioid receptor family, is involved in many processes common to the opioid receptors including pain and drug abuse. To better characterize receptor location and trafficking, knock-in mice were created by inserting the gene encoding enhanced green fluorescent protein (eGFP) into the NOP receptor gene (Oprl1) and producing mice expressing a functional NOP-eGFP C-terminal fusion in place of the native NOP receptor. The NOP-eGFP receptor was present in brain of homozygous knock-in animals in concentrations somewhat higher than in wild-type mice and was functional when tested for stimulation of [(35)S]GTPγS binding in vitro and in patch-clamp electrophysiology in dorsal root ganglia (DRG) neurons and hippocampal slices. Inhibition of morphine analgesia was equivalent when tested in knock-in and wild-type mice. Imaging revealed detailed neuroanatomy in brain, spinal cord, and DRG and was generally consistent with in vitro autoradiographic imaging of receptor location. Multicolor immunohistochemistry identified cells coexpressing various spinal cord and DRG cellular markers, as well as coexpression with μ-opioid receptors in DRG and brain regions. Both in tissue slices and primary cultures, the NOP-eGFP receptors appear throughout the cell body and in processes. These knock-in mice have NOP receptors that function both in vitro and in vivo and appear to be an exceptional tool to study receptor neuroanatomy and correlate with NOP receptor function. The NOP receptor, the fourth member of the opioid receptor family, is involved in pain, drug abuse, and a number of other CNS processes. The regional and cellular distribution has been difficult to determine due to lack of validated antibodies for immunohistochemical analysis. To provide a new tool for the investigation of receptor localization, we have produced knock-in mice with a fluorescent-tagged NOP receptor in place of the native NOP receptor. These

  20. G-protein-coupled receptors for free fatty acids

    DEFF Research Database (Denmark)

    Milligan, Graeme; Ulven, Trond; Murdoch, Hannah

    2014-01-01

    of these receptors. However, ongoing clinical trials of agonists of free fatty acid receptor 1 suggest that this receptor and other receptors for free fatty acids may provide a successful strategy for controlling hyperglycaemia and providing novel approaches to treat diabetes. Receptors responsive to free fatty acid...

  1. Evidence for Heterodimerization and Functional Interaction of the Angiotensin Type 2 Receptor and the Receptor MAS

    DEFF Research Database (Denmark)

    Leonhardt, Julia; Villela, Daniel C.; Teichmann, Anke

    2017-01-01

    The angiotensin type 2 receptor (AT2R) and the receptor MAS are receptors of the protective arm of the renin-angiotensin system. They mediate strikingly similar actions. Moreover, in various studies, AT2R antagonists blocked the effects of MAS agonists and vice versa. Such cross-inhibition may in...

  2. Interaction of epidermal growth factor receptors with the cytoskeleton is related to receptor clustering

    NARCIS (Netherlands)

    van Belzen, N.; Spaargaren, M.; Verkleij, A. J.; Boonstra, J.

    1990-01-01

    Recently it has been established that cytoskeleton-associated epidermal growth factor (EGF) receptors are predominantly of the high-affinity class and that EGF induces a recruitment of low-affinity receptors to the cytoskeleton. The nature of this EGF-induced receptor-cytoskeleton interaction,

  3. Receptor saturation in roentgen films

    Energy Technology Data Exchange (ETDEWEB)

    Strid, K G; Reichmann, S [Sahlgrenska Sjukhuset, Goeteborg (Sweden)

    1980-01-01

    Roentgen-film recording of small object details of low attenuation differences (e.g. pulmonary vessels) is regularly seen to be impaired when the film is exposed to yield high values of optical density (D). This high-density failure is due to receptor saturation, which implies that at high exposure values most silver halide grains of the film are made developable, leaving few grains available to receive additional informative photons. The receptor saturation is analysed by means of a mathematical model of a non-screen film yielding Dsub(max) = 2.0. Optimum recording, defined by maximum signal-to-noise ratio in the image, is found at D approximately 0.64, corresponding to, on an average, 1.6 photons absorbed per grain. On the other hand, maximum contrast occurs at D approximately 1.4, where, on the average, 3.6 photons are absorbed per grain. The detective quantum efficiency of the film, i.e. the fraction of the photons actually contributing to the information content of the image, drops from 41 per cent at maximum signal-to-noise ratio to a mere 10 per cent at maximum contrast.

  4. Androgen receptor drives cellular senescence.

    Directory of Open Access Journals (Sweden)

    Yelena Mirochnik

    Full Text Available The accepted androgen receptor (AR role is to promote proliferation and survival of prostate epithelium and thus prostate cancer progression. While growth-inhibitory, tumor-suppressive AR effects have also been documented, the underlying mechanisms are poorly understood. Here, we for the first time link AR anti-cancer action with cell senescence in vitro and in vivo. First, AR-driven senescence was p53-independent. Instead, AR induced p21, which subsequently reduced ΔN isoform of p63. Second, AR activation increased reactive oxygen species (ROS and thereby suppressed Rb phosphorylation. Both pathways were critical for senescence as was proven by p21 and Rb knock-down and by quenching ROS with N-Acetyl cysteine and p63 silencing also mimicked AR-induced senescence. The two pathways engaged in a cross-talk, likely via PML tumor suppressor, whose localization to senescence-associated chromatin foci was increased by AR activation. All these pathways contributed to growth arrest, which resolved in senescence due to concomitant lack of p53 and high mTOR activity. This is the first demonstration of senescence response caused by a nuclear hormone receptor.

  5. Excitatory amino acid receptor antagonists

    DEFF Research Database (Denmark)

    Johansen, T N; Frydenvang, Karla Andrea; Ebert, B

    1997-01-01

    We have previously shown that (RS)-2-amino-2-(5-tert-butyl-3-hydroxyisoxazol-4-yl)acetic acid (ATAA) is an antagonist at N-methyl-D-aspartic acid (NMDA) and (RS)-2-amino-3-(3-hydroxy-5-methylisoxazol-4-yl)propionic acid (AMPA) receptors. We have now resolved ATAA via diastereomeric salt formation......)-phenylethylamine salt of N-BOC-(R)-ATAA. Like ATAA, neither (R)- nor (S)-ATAA significantly affected (IC50 > 100 microM) the receptor binding of tritiated AMPA, kainic acid, or (RS)-3-(2-carboxypiperazin-4-yl)propyl-1-phosphonic acid, the latter being a competitive NMDA antagonist. Electrophysiological experiments......, using the rat cortical wedge preparation, showed the NMDA antagonist effect as well as the AMPA antagonist effect of ATAA to reside exclusively in the (R)-enantiomer (Ki = 75 +/- 5 microM and 57 +/- 1 microM, respectively). Neither (R)- nor (S)-ATAA significantly reduced kainic acid-induced excitation...

  6. Posttransplant chimeric antigen receptor therapy.

    Science.gov (United States)

    Smith, Melody; Zakrzewski, Johannes; James, Scott; Sadelain, Michel

    2018-03-08

    Therapeutic T-cell engineering is emerging as a powerful approach to treat refractory hematological malignancies. Its most successful embodiment to date is based on the use of second-generation chimeric antigen receptors (CARs) targeting CD19, a cell surface molecule found in most B-cell leukemias and lymphomas. Remarkable complete remissions have been obtained with autologous T cells expressing CD19 CARs in patients with relapsed, chemo-refractory B-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and non-Hodgkin lymphoma. Allogeneic CAR T cells may also be harnessed to treat relapse after allogeneic hematopoietic stem cell transplantation. However, the use of donor T cells poses unique challenges owing to potential alloreactivity. We review different approaches to mitigate the risk of causing or aggravating graft-versus-host disease (GVHD), including CAR therapies based on donor leukocyte infusion, virus-specific T cells, T-cell receptor-deficient T cells, lymphoid progenitor cells, and regulatory T cells. Advances in CAR design, T-cell selection and gene editing are poised to enable the safe use of allogeneic CAR T cells without incurring GVHD. © 2018 by The American Society of Hematology.

  7. Microarray-Based Determination of Estrogen Receptor, Progesterone Receptor, and HER2 Receptor Status in Breast Cancer

    NARCIS (Netherlands)

    Roepman, Paul; Horlings, Hugo M.; Krijgsman, Oscar; Kok, Marleen; Bueno-de-Mesquita, Jolien M.; Bender, Richard; Linn, Sabine C.; Glas, Annuska M.; van de Vijver, Marc J.

    2009-01-01

    Purpose: The level of estrogen receptor (ER), progesterone receptor (PR), and HER2 aids in the determination of prognosis and treatment of breast cancer. Immunohistochemistry is currently the predominant method for assessment, but differences in methods and interpretation can substantially affect

  8. Role of G3BP1 in glucocorticoid receptor-mediated microRNA-15b and microRNA-23a biogenesis in endothelial cells

    KAUST Repository

    Kwok, Hoi-Hin

    2017-05-18

    MicroRNAs (miRNAs) are a family of non-coding RNAs that play crucial roles in regulating various normal cellular responses. Recent studies revealed that the canonical miRNA biogenesis pathway is subject to sophisticated regulation. Hormonal control of miRNA biogenesis by androgen and estrogen has been demonstrated, but the direct effects of the glucocorticoid receptor (GR) on miRNA biogenesis are unknown. This study revealed the role of GR in miRNA maturation. We showed that two GR agonists, dexamethasone and ginsenoside-Rg1 rapidly suppressed the expression of mature miR-15b, miR-23a, and miR-214 in human endothelial cells. RNA pulldown coupled with proteomic analysis identified GTPase-activating protein (SH3 domain) binding protein 1 (G3BP1) as one of the RNA-binding proteins mediating GR-regulated miRNA maturation. Activated GR induced phosphorylation of v-AKT Murine Thymoma Viral Oncogene Homologue (AKT) kinase, which in turn phosphorylated and promoted nuclear translocation of G3BP1. The nuclear G3BP1 bound to the G3BP1 consensus sequence located on primary miR-15b~16-2 and miR-23a~27a~24-2 to inhibit their maturation. The findings from this study have advanced our understanding of the non-genomic effects of GR in the vascular system.

  9. Loss-of-function analyses of the fragile X-related and dopamine receptor genes by RNA interference in the cricket Gryllus bimaculatus.

    Science.gov (United States)

    Hamada, Aska; Miyawaki, Katsuyuki; Honda-sumi, Eri; Tomioka, Kenji; Mito, Taro; Ohuchi, Hideyo; Noji, Sumihare

    2009-08-01

    In order to explore a possibility that the cricket Gryllus bimaculatus would be a useful model to unveil molecular mechanisms of human diseases, we performed loss-of-function analyses of Gryllus genes homologous to human genes that are responsible for human disorders, fragile X mental retardation 1 (fmr1) and Dopamine receptor (DopR). We cloned cDNAs of their Gryllus homologues, Gb'fmr1, Gb'DopRI, and Gb'DopRII, and analyzed their functions with use of nymphal RNA interference (RNAi). For Gb'fmr1, three major phenotypes were observed: (1) abnormal wing postures, (2) abnormal calling song, and (3) loss of the circadian locomotor rhythm, while for Gb'DopRI, defects of wing posture and morphology were found. These results indicate that the cricket has the potential to become a novel model system to explore human neuronal pathogenic mechanisms and to screen therapeutic drugs by RNAi. Copyright (c) 2009 Wiley-Liss, Inc.

  10. Coamplification in tumors of KRAS2, type 2 inositol 1,4,5 triphosphate receptor gene, and a novel human gene, KRAG

    Energy Technology Data Exchange (ETDEWEB)

    Heighway, J.; Betticher, D.C.; Altermatt, H.J. [Univ. Hospital of Berne (Switzerland)] [and others

    1996-07-01

    Analysis of a region of DNA, coamplified in tumors with KRAS2, resulted in the identification of the human homologue of the mouse KRAG gene. The gene was widely expressed in range of cell lines, tumors, and normal tissue and demonstrated a high degree of alternate splicing. A human KRAG cDNA sequence, with a structure similar to that encoded by the amplified gene in mouse Y1 adrenal carcinoma cells, was isolated by RT-PCR. The predicted amino acid similarity between the two sequences was 91%, and hydrophobicity plots suggested a structure closely resembling that of transmembrane 4 superfamily members. Identification of a PCR-based restriction fragment length polymorphism allele-specific splicing differences in tumors. Northern analysis of mRNA derived from a range of tissues suggested high level expression in muscle and confirmed alternate splicing. To facilitate the analysis of exon junctions, a YAC clone encoding the genomic sequence was identified. This allowed the localization of KRAG to human chromosome 12p11.2. Isolation of one end of this nonchimeric clone demonstrated a perfect match with a 247-bp sequence within the 3{prime} untranslated region of the type 2 1,4,5-inositol triphosphate receptor gene. Multiplex PCR confirmed the inclusion of both genes. Multiplex PCR confirmed the inclusion of both genes in the KRAS2 amplicon in human malignancy, suggesting that either may contribute to the malignant phenotypes. 35 refs., 6 figs., 1 tab.

  11. Identifying the receptor subtype selectivity of retinoid X and retinoic acid receptors via quantum mechanics.

    Science.gov (United States)

    Tsuji, Motonori; Shudo, Koichi; Kagechika, Hiroyuki

    2017-03-01

    Understanding and identifying the receptor subtype selectivity of a ligand is an important issue in the field of drug discovery. Using a combination of classical molecular mechanics and quantum mechanical calculations, this report assesses the receptor subtype selectivity for the human retinoid X receptor (hRXR) and retinoic acid receptor (hRAR) ligand-binding domains (LBDs) complexed with retinoid ligands. The calculated energies show good correlation with the experimentally reported binding affinities. The technique proposed here is a promising method as it reveals the origin of the receptor subtype selectivity of selective ligands.

  12. Excitatory amino acid receptors and disease.

    Science.gov (United States)

    Meldrum, B S

    1992-08-01

    Recent advances in the molecular biology of excitatory amino acid receptors are reviewed. Evidence that drugs blocking the excitatory action of glutamate at the N-methyl-D-aspartate (NMDA) and non-NMDA receptors may be of clinical use in epilepsy, Parkinson's disease, cerebral ischaemia and trauma, acquired immune deficiency syndrome (AIDS) encephalopathy and neuropathic pain is summarized.

  13. Docking to flexible nicotinic acetylcholine receptors

    DEFF Research Database (Denmark)

    Sander, Tommy; Bruun, Anne T; Balle, Thomas

    2010-01-01

    Computational docking to nicotinic acetylcholine receptors (nAChRs) and other members of the Cys-loop receptor family is complicated by the flexibility of the so-called C-loop. As observed in the large number of published crystal structures of the acetylcholine binding protein (AChBP), a structural...

  14. Structural Studies of Nicotinic Acetylcholine Receptors

    DEFF Research Database (Denmark)

    Shahsavar, Azadeh; Gajhede, Michael; Kastrup, Jette

    2016-01-01

    Nicotinic acetylcholine receptors (nAChRs) are members of the pentameric ligand-gated ion channel superfamily that play important roles in control of neurotransmitter release in the central and peripheral nervous system. These receptors are important therapeutic targets for development of drugs...

  15. In vivo studies of opiate receptors

    International Nuclear Information System (INIS)

    Frost, J.J.; Dannals, R.F.; Duelfer, T.; Burns, H.D.; Ravert, H.T.; Langstroem, B.; Balasubramanian, V.; Wagner, H.N. Jr.

    1984-01-01

    To study opiate receptors noninvasively in vivo using positron emission tomography, techniques for preferentially labeling opiate receptors in vivo can be used. The rate at which receptor-bound ligand clears from the brain in vivo can be predicted by measuring the equilibrium dissociation constant (KD) at 37 degrees C in the presence of 100 mM sodium chloride and 100 microM guanyl-5'-imidodiphosphate, the drug distribution coefficient, and the molecular weight. A suitable ligand for labeling opiate receptors in vivo is diprenorphine, which binds to mu, delta, and kappa receptors with approximately equal affinity in vitro. However, in vivo diprenorphine may bind predominantly to one opiate receptor subtype, possibly the mu receptor. To predict the affinity for binding to the opiate receptor, a Hansch correlation was determined between the 50% inhibitory concentration for a series of halogen-substituted fentanyl analogs and electronic, lipophilic, and steric parameters. Radiochemical methods for the synthesis of carbon-11-labeled diprenorphine and lofentanil are presented

  16. In vivo studies of opiate receptors

    Energy Technology Data Exchange (ETDEWEB)

    Frost, J.J.; Dannals, R.F.; Duelfer, T.; Burns, H.D.; Ravert, H.T.; Langstroem, B.; Balasubramanian, V.; Wagner, H.N. Jr.

    1984-01-01

    To study opiate receptors noninvasively in vivo using positron emission tomography, techniques for preferentially labeling opiate receptors in vivo can be used. The rate at which receptor-bound ligand clears from the brain in vivo can be predicted by measuring the equilibrium dissociation constant (KD) at 37 degrees C in the presence of 100 mM sodium chloride and 100 microM guanyl-5'-imidodiphosphate, the drug distribution coefficient, and the molecular weight. A suitable ligand for labeling opiate receptors in vivo is diprenorphine, which binds to mu, delta, and kappa receptors with approximately equal affinity in vitro. However, in vivo diprenorphine may bind predominantly to one opiate receptor subtype, possibly the mu receptor. To predict the affinity for binding to the opiate receptor, a Hansch correlation was determined between the 50% inhibitory concentration for a series of halogen-substituted fentanyl analogs and electronic, lipophilic, and steric parameters. Radiochemical methods for the synthesis of carbon-11-labeled diprenorphine and lofentanil are presented.

  17. Receptor study of psychiatric disorders using PET

    International Nuclear Information System (INIS)

    Suhara, Tetsuya

    1992-01-01

    Recent receptor studies of psychiatric disorders using PET have been focused on the change in the number of D 2 dopamine receptors in the striatum of drug-naive schizophrenic patients. One study confirmed an increase in D 2 receptors, while another study denied it. Although there were some differences in the approaches of the two groups, the reason for the discrepancy is not clear yet. Looking to psychiatric disorders other than schizophrenia, our recent study revealed a possible role of dopamine D 1 receptors in bipolar mood disorders. However, some problems must be resolved for further receptor studies with PET. For example, our recent study shows that desipamine decreases the in vivo binding of dopramine D 1 and D 2 receptors whereas these is no effect on dopamine D 1 and D 2 receptors in vitro. Additionally significant methodological problems lie in the method of evaluation of the non-specific binding and the effect of endogenous neurotransmitters. Moreover, difficulties in the diagnosis of psychiatric disorders and ethical problems in psychiatric research are critical factors in receptor studies with PET in psychiatric disorders. (author)

  18. P2X receptors in epithelia

    DEFF Research Database (Denmark)

    Leipziger, Jens Georg

    2015-01-01

    P2X receptors are ubiquitously expressed in all epithelial tissues but their functional roles are less well studied. Here we review the current state of knowledge by focusing on functional effects of P2X receptor in secretory and in absorptive tissues. In glandular tissue like the parotid gland...

  19. Structural Mapping of Adenosine Receptor Mutations

    DEFF Research Database (Denmark)

    Jespers, Willem; Schiedel, Anke C; Heitman, Laura H

    2018-01-01

    The four adenosine receptors (ARs), A1, A2A, A2B, and A3, constitute a subfamily of G protein-coupled receptors (GPCRs) with exceptional foundations for structure-based ligand design. The vast amount of mutagenesis data, accumulated in the literature since the 1990s, has been recently supplemente...

  20. Emerging functions for neuropeptide Y5 receptors

    NARCIS (Netherlands)

    Bischoff, A.; Michel, M. C.

    1999-01-01

    The Y5 subtype of neuropeptide Y (NPY) receptors has raised considerable interest as a mediator of NPY-stimulated food intake, but with the advent of recent data, this hypothesis has come into question. Moreover, Y5 receptor-selective drugs might not be specific for food intake because additional

  1. Immunohistochemical assessment of oestrogen and progesterone receptors

    DEFF Research Database (Denmark)

    Grabau, D A; Thorpe, S M; Knoop, A

    2000-01-01

    Two different methods to determine steroid receptors were analysed with respect to their ability to estimate prognosis in primary breast cancer patients. The immunohistochemical assay (IHA) was compared with the dextran-coated charcoal (DCC) method of receptor determination. A random sample of 28...... distinction between benign and malignant tissue is possible using the IHAmethod. Thus, IHAresults appear to be more clinically relevant....

  2. Lipoprotein receptors in cultured bovine endothelial cells

    International Nuclear Information System (INIS)

    Struempfer, A.E.M.

    1983-07-01

    In this study, receptors that may be involved in the uptake of low density lipoproteins (LDL) and low density lipoproteins which have been modified by acetylation (AcLDL), were characterized. Aortic epithelial cells were used and a cell culture system which closely resembled the in vivo monolayer was established. Endothelial cell and lipoprotein interactions were examined by incubating the cells with 125 l-labelled lipoproteins under various conditions. The receptor affinity of bovine aortic endothelial cells was higher for AcLDL than that for LDL. Competition studies demonstrated that there were two distinct receptors for LDL and AcLDL on the endothelial cells. AcLDL did not compete with LDL for the LDL receptor, and conversely LDL did not compete with AcLDL for the AcLDL receptor. The receptor activities for LDL and AcLDL were examined as a function of culture age. Whereas the LDL receptor could be regulated, the AcLDL receptor was not as susceptible to regulation. Upon exposing endothelial cells for 72 h to either LDL or AcLDL, it was found that the total amount of cellular cholesterol increased by about 50%. However, the increase of total cholesterol was largely in the form of free cholesterol. This is in contrast to macrophages, where the increase in total cholesterol upon exposure to AcLDL is largely in the form cholesteryl esters

  3. Thermogenic characterization of ghrelin receptor null mice

    Science.gov (United States)

    Ghrelin is the only known circulating orexigenic hormone that increases food intake and promotes adiposity, and these physiological functions of ghrelin are mediated through its receptor growth hormone secretagogue receptor (GHS-R). Ghrelin/GHS-R signaling plays a crucial role in energy homeostasis....

  4. Complex Pharmacology of Free Fatty Acid Receptors

    DEFF Research Database (Denmark)

    Milligan, Graeme; Shimpukade, Bharat; Ulven, Trond

    2017-01-01

    pharmacology have shaped understanding of the complex pharmacology of receptors that recognize and are activated by nonesterified or "free" fatty acids (FFAs). The FFA family of receptors is a recently deorphanized set of GPCRs, the members of which are now receiving substantial interest as novel targets...

  5. Neutral anion receptors: design and application

    NARCIS (Netherlands)

    Antonisse, M.M.G.; Reinhoudt, David

    1998-01-01

    After the development of synthetic cation receptors in the late 1960s, only in the past decade has work started on the development of synthetic neutral anion receptors. Combination and preorganization of different anion binding groups, like amides, urea moieties, or Lewis acidic metal centers lead

  6. NRSAS: Nuclear Receptor Structure Analysis Servers.

    NARCIS (Netherlands)

    Bettler, E.J.M.; Krause, R.; Horn, F.; Vriend, G.

    2003-01-01

    We present a coherent series of servers that can perform a large number of structure analyses on nuclear hormone receptors. These servers are part of the NucleaRDB project, which provides a powerful information system for nuclear hormone receptors. The computations performed by the servers include

  7. Transient receptor potential channels in essential hypertension

    DEFF Research Database (Denmark)

    Liu, Daoyan; Scholze, Alexandra; Zhu, Zhiming

    2006-01-01

    The role of nonselective cation channels of the transient receptor potential channel (TRPC) family in essential hypertension has not yet been investigated.......The role of nonselective cation channels of the transient receptor potential channel (TRPC) family in essential hypertension has not yet been investigated....

  8. Receptor tyrosine kinase signaling: a view from quantitative proteomics

    DEFF Research Database (Denmark)

    Dengjel, Joern; Kratchmarova, Irina; Blagoev, Blagoy

    2009-01-01

    Growth factor receptor signaling via receptor tyrosine kinases (RTKs) is one of the basic cellular communication principals found in all metazoans. Extracellular signals are transferred via membrane spanning receptors into the cytoplasm, reversible tyrosine phosphorylation being the hallmark of all...

  9. Steroid Hormone Receptor Signals as Prognosticators for Urothelial Tumor

    Directory of Open Access Journals (Sweden)

    Hiroki Ide

    2015-01-01

    Full Text Available There is a substantial amount of preclinical or clinical evidence suggesting that steroid hormone receptor-mediated signals play a critical role in urothelial tumorigenesis and tumor progression. These receptors include androgen receptor, estrogen receptors, glucocorticoid receptor, progesterone receptor, vitamin D receptor, retinoid receptors, peroxisome proliferator-activated receptors, and others including orphan receptors. In particular, studies using urothelial cancer tissue specimens have demonstrated that elevated or reduced expression of these receptors as well as alterations of their upstream or downstream pathways correlates with patient outcomes. This review summarizes and discusses available data suggesting that steroid hormone receptors and related signals serve as biomarkers for urothelial carcinoma and are able to predict tumor recurrence or progression.

  10. Real-Time G-Protein-Coupled Receptor Imaging to Understand and Quantify Receptor Dynamics

    Directory of Open Access Journals (Sweden)

    María S. Aymerich

    2011-01-01

    Full Text Available Understanding the trafficking of G-protein-coupled receptors (GPCRs and their regulation by agonists and antagonists is fundamental to develop more effective drugs. Optical methods using fluorescent-tagged receptors and spinning disk confocal microscopy are useful tools to investigate membrane receptor dynamics in living cells. The aim of this study was to develop a method to characterize receptor dynamics using this system which offers the advantage of very fast image acquisition with minimal cell perturbation. However, in short-term assays photobleaching was still a problem. Thus, we developed a procedure to perform a photobleaching-corrected image analysis. A study of short-term dynamics of the long isoform of the dopamine type 2 receptor revealed an agonist-induced increase in the mobile fraction of receptors with a rate of movement of 0.08 μm/s For long-term assays, the ratio between the relative fluorescence intensity at the cell surface versus that in the intracellular compartment indicated that receptor internalization only occurred in cells co-expressing G protein-coupled receptor kinase 2. These results indicate that the lateral movement of receptors and receptor internalization are not directly coupled. Thus, we believe that live imaging of GPCRs using spinning disk confocal image analysis constitutes a powerful tool to study of receptor dynamics.

  11. β-Adrenergic receptor-mediated suppression of interleukin 2 receptors in human lymphocytes

    International Nuclear Information System (INIS)

    Feldman, R.D.; Hunninghake, G.W.; McArdle, W.L.

    1987-01-01

    Adrenergic receptor agonists are know to attenuate the proliferative response of human lymphocytes after activation; however, their mechanism of action is unknown. Since expression of interleukin 2 (IL-2) receptors is a prerequisite for proliferation, the effect of β-adrenergic receptor agonists on lymphocyte IL-2 receptors was studied on both mitogen-stimulated lymphocytes and IL-2-dependent T lymphocyte cell lines. In both cell types the β-adrenergic receptor agonist isoproterenol blocked the expression of IL-2 receptors, as determined with the IL-2 receptor anti-TAC antibody. To determine the effect of β-adrenergic agonists on expression of the high affinity IL-2 receptors, [ 125 I]IL-2 binding studies were performed at concentrations selective for high affinity sites. No significant effect of β-adrenergic agonists on high affinity IL-2 receptor sites could be detected. The data demonstrate that β-adrenergic receptor agonists down-regulate IL-2 receptors primarily affecting low affinity sites

  12. Gβ promotes pheromone receptor polarization and yeast chemotropism by inhibiting receptor phosphorylation.

    Science.gov (United States)

    Ismael, Amber; Tian, Wei; Waszczak, Nicholas; Wang, Xin; Cao, Youfang; Suchkov, Dmitry; Bar, Eli; Metodiev, Metodi V; Liang, Jie; Arkowitz, Robert A; Stone, David E

    2016-04-12

    Gradient-directed cell migration (chemotaxis) and growth (chemotropism) are processes that are essential to the development and life cycles of all species. Cells use surface receptors to sense the shallow chemical gradients that elicit chemotaxis and chemotropism. Slight asymmetries in receptor activation are amplified by downstream signaling systems, which ultimately induce dynamic reorganization of the cytoskeleton. During the mating response of budding yeast, a model chemotropic system, the pheromone receptors on the plasma membrane polarize to the side of the cell closest to the stimulus. Although receptor polarization occurs before and independently of actin cable-dependent delivery of vesicles to the plasma membrane (directed secretion), it requires receptor internalization. Phosphorylation of pheromone receptors by yeast casein kinase 1 or 2 (Yck1/2) stimulates their internalization. We showed that the pheromone-responsive Gβγ dimer promotes the polarization of the pheromone receptor by interacting with Yck1/2 and locally inhibiting receptor phosphorylation. We also found that receptor phosphorylation is essential for chemotropism, independently of its role in inducing receptor internalization. A mathematical model supports the idea that the interaction between Gβγ and Yck1/2 results in differential phosphorylation and internalization of the pheromone receptor and accounts for its polarization before the initiation of directed secretion. Copyright © 2016, American Association for the Advancement of Science.

  13. The ABA receptors -- we report you decide.

    Science.gov (United States)

    McCourt, Peter; Creelman, Robert

    2008-10-01

    The plant hormone abscisic acid (ABA) has been implicated in a variety of physiological responses ranging from seed dormancy to stomatal conductance. Recently, three groups have reported the molecular identification of three disparate ABA receptors. Unlike the identification of other hormone receptors, in these three cases high affinity binding to ABA rather than the isolation of ABA insensitive mutants led to these receptor genes. Interestingly, two of the receptors encode genes involved in floral timing and chlorophyll biosynthesis, which are not considered traditional ABA responses. And the third receptor has been clouded in issues of its molecular identity. To clearly determine the roles of these genes in ABA perception it will require placing of these ABA-binding proteins into the rich ABA physiological context that has built up over the years.

  14. Sigma-2 receptor ligands QSAR model dataset

    Directory of Open Access Journals (Sweden)

    Antonio Rescifina

    2017-08-01

    Full Text Available The data have been obtained from the Sigma-2 Receptor Selective Ligands Database (S2RSLDB and refined according to the QSAR requirements. These data provide information about a set of 548 Sigma-2 (σ2 receptor ligands selective over Sigma-1 (σ1 receptor. The development of the QSAR model has been undertaken with the use of CORAL software using SMILES, molecular graphs and hybrid descriptors (SMILES and graph together. Data here reported include the regression for σ2 receptor pKi QSAR models. The QSAR model was also employed to predict the σ2 receptor pKi values of the FDA approved drugs that are herewith included.

  15. Computer modeling of Cannabinoid receptor type 1

    Directory of Open Access Journals (Sweden)

    Sapundzhi Fatima

    2018-01-01

    Full Text Available Cannabinoid receptors are important class of receptors as they are involved in various physiological processes such as appetite, pain-sensation, mood, and memory. It is important to design receptor-selective ligands in order to treat a particular disorder. The aim of the present study is to model the structure of cannabinoid receptor CB1 and to perform docking between obtained models and known ligands. Two models of CBR1 were prepared with two different methods (Modeller of Chimera and MOE. They were used for docking with GOLD 5.2. It was established a high correlation between inhibitory constant Ki of CB1 cannabinoid ligands and the ChemScore scoring function of GOLD, which concerns both models. This suggests that the models of the CB1 receptors obtained could be used for docking studies and in further investigation and design of new potential, selective and active cannabinoids with the desired effects.

  16. The AT2 Receptor and Inflammation

    DEFF Research Database (Denmark)

    Esquitino, Veronica Valero; Danyel, Leon Alexander; Steckelings, Ulrike M.

    2015-01-01

    This chapter summarizes current knowledge about the role of the angiotensin type 2 (AT2) receptor in inflammation. The first section provides an overview about molecular mechanisms underlying the anti-inflammatory action of the AT2 receptor. This section is followed...... by a review of the existing literature addressing the role of the AT2 receptor in a wide range of disorders, in which acute or chronic inflammation is an essential contributor to the pathology. These disorders comprise cardiovascular, cerebrovascular, renal, and autoimmune diseases.Taken as a whole......, the vast majority of data support an anti-inflammatory and immunomodulatory role of the AT2 receptor. In light of the current development of AT2 receptor agonists as future drugs for clinical use, diseases with a marked inflammatory component may become a major area of therapeutic use...

  17. Ror receptor tyrosine kinases: orphans no more.

    Science.gov (United States)

    Green, Jennifer L; Kuntz, Steven G; Sternberg, Paul W

    2008-11-01

    Receptor tyrosine kinase-like orphan receptor (Ror) proteins are a conserved family of tyrosine kinase receptors that function in developmental processes including skeletal and neuronal development, cell movement and cell polarity. Although Ror proteins were originally named because the associated ligand and signaling pathway were unknown, recent studies in multiple species have now established that Ror proteins are Wnt receptors. Depending on the cellular context, Ror proteins can either activate or repress transcription of Wnt target genes and can modulate Wnt signaling by sequestering Wnt ligands. New evidence implicates Ror proteins in planar cell polarity, an alternative Wnt pathway. Here, we review the progress made in understanding these mysterious proteins and, in particular, we focus on their function as Wnt receptors.

  18. Role of retinoic receptors in lung carcinogenesis

    Directory of Open Access Journals (Sweden)

    Renyi-Vamos Ferenc

    2008-07-01

    Full Text Available Abstract Several in vitro and in vivo studies have examined the positive and negative effects of retinoids (vitamin A analogs in premalignant and malignant lesions. Retinoids have been used as chemopreventive and anticancer agents because of their pleiotropic regulator function in cell differentiation, growth, proliferation and apoptosis through interaction with two types of nuclear receptors: retinoic acid receptors and retinoid X receptors. Recent investigations have gradually elucidated the function of retinoids and their signaling pathways and may explain the failure of earlier chemopreventive studies. In this review we have compiled basic and recent knowledge regarding the role of retinoid receptors in lung carcinogenesis. Sensitive and appropriate biological tools are necessary for screening the risk population and monitoring the efficacy of chemoprevention. Investigation of retinoid receptors is important and may contribute to the establishment of new strategies in chemoprevention for high-risk patients and in the treatment of lung cancer.

  19. Androgen insensitivity syndrome: gonadal androgen receptor activity

    International Nuclear Information System (INIS)

    Coulam, C.B.; Graham, M.L.; Spelsberg, T.C.

    1984-01-01

    To determine whether abnormalities of the androgen receptor previously observed in skin fibroblasts from patients with androgen insensitivity syndrome also occur in the gonads of affected individuals, androgen receptor activity in the gonads of a patient with testicular feminization syndrome was investigated. Using conditions for optimal recovery of androgen receptor from human testes established by previous studies, we detected the presence of a high-affinity (dissociation constant . 3.2 X 10(-10) mol/L), low-capacity (4.2 X 10(-12) mol/mg DNA), androgen-binding protein when tritium-labeled R1881 was incubated at 4 degrees C with nuclear extracts from the gonads of control patients or from a patient with testicular feminization syndrome but not when incubated at 37 degrees C. Thus this patient has an androgen receptor with a temperature lability similar to that of receptors from normal persons

  20. Functionally biased signalling properties of 7TM receptors - opportunities for drug development for the ghrelin receptor

    DEFF Research Database (Denmark)

    Sivertsen, B; Holliday, N; Madsen, A N

    2013-01-01

    UNLABELLED: The ghrelin receptor is a 7 transmembrane (7TM) receptor involved in a variety of physiological functions including growth hormone secretion, increased food intake and fat accumulation as well as modulation of reward and cognitive functions. Because of its important role in metabolism...... and energy expenditure, the ghrelin receptor has become an important therapeutic target for drug design and the development of anti-obesity compounds. However, none of the compounds developed so far have been approved for commercial use. Interestingly, the ghrelin receptor is able to signal through several...... review, we have described how ligands and mutations in the 7TM receptor may bias the receptors to favour either one G-protein over another or to promote G-protein independent signalling pathways rather than G-protein-dependent pathways. For the ghrelin receptor, both agonist and inverse agonists have...