WorldWideScience

Sample records for real-time rt-pcr method

  1. A novel method of multiple nucleic acid detection: Real-time RT-PCR coupled with probe-melting curve analysis.

    Science.gov (United States)

    Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan

    2017-11-15

    A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    Directory of Open Access Journals (Sweden)

    Soares Fernando A

    2009-03-01

    Full Text Available Abstract Background HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC and fluorescence in situ hybridization (FISH. These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. Methods To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. Results The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4% and HER-2 transcript overexpression (20%. Moreover, 2+ immunostaining cases presented nonamplified status (50% by CISH and HER-2 downexpression (38.5% by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350. Conclusion Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene.

  3. Quantitative real-time RT-PCR and chromogenic in situ hybridization

    DEFF Research Database (Denmark)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia G T

    2009-01-01

    . METHODS: To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. RESULTS: The concordance...

  4. Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA

    Directory of Open Access Journals (Sweden)

    Bruynseels Peggy

    2009-07-01

    Full Text Available Abstract We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5' exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.

  5. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    International Nuclear Information System (INIS)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia GT; Bérgamo, Nádia A; Neto, Francisco A Moraes; Domingues, Maria AC; Soares, Fernando A; Caldeira, José RF; Rogatto, Silvia R

    2009-01-01

    HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH). These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization) is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4%) and HER-2 transcript overexpression (20%). Moreover, 2+ immunostaining cases presented nonamplified status (50%) by CISH and HER-2 downexpression (38.5%) by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350). Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene

  6. A real-time RT-PCR method to detect viable Giardia lamblia cysts in environmental waters.

    Science.gov (United States)

    Baque, Robert H; Gilliam, Amy O; Robles, Liza D; Jakubowski, Walter; Slifko, Theresa R

    2011-05-01

    Currently, USEPA Method 1623 is the standard assay used for simultaneous detection of Giardia cysts and Cryptosporidium oocysts in various water matrices. However, the method is unable to distinguish between species, genotype, or to assess viability. Therefore, the objective of the present study was to address the shortcomings of USEPA Method 1623 by developing a novel molecular-based method that can assess viability of Giardia cysts in environmental waters and identify genotypes that pose a human health threat (assemblage groups A and B). Primers and TaqMan(®) probes were designed to target the beta-giardin gene in order to discriminate among species and assemblages. Viability was determined by detection of de-novo mRNA synthesis after heat induction. The beta-giardin primer/probe sets were able to detect and differentiate between Giardia lamblia assemblages A and B, and did not detect Giardia muris (mouse species) or G. lamblia assemblages C, D, E and F (non-human), with the exception of Probe A which did detect G. lamblia assemblage F DNA. Additionally, DNA or cDNA of other waterborne organisms were not detected, suggesting that the method is specific to Giardia assemblages. Assay applicability was demonstrated by detection of viable G. lamblia cysts in spiked (assemblage B) and unspiked (assemblage A and B) reclaimed water samples. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    OpenAIRE

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  8. Intra-laboratory validation of chronic bee paralysis virus quantitation using an accredited standardised real-time quantitative RT-PCR method.

    Science.gov (United States)

    Blanchard, Philippe; Regnault, Julie; Schurr, Frank; Dubois, Eric; Ribière, Magali

    2012-03-01

    Chronic bee paralysis virus (CBPV) is responsible for chronic bee paralysis, an infectious and contagious disease in adult honey bees (Apis mellifera L.). A real-time RT-PCR assay to quantitate the CBPV load is now available. To propose this assay as a reference method, it was characterised further in an intra-laboratory study during which the reliability and the repeatability of results and the performance of the assay were confirmed. The qPCR assay alone and the whole quantitation method (from sample RNA extraction to analysis) were both assessed following the ISO/IEC 17025 standard and the recent XP U47-600 standard issued by the French Standards Institute. The performance of the qPCR assay and of the overall CBPV quantitation method were validated over a 6 log range from 10(2) to 10(8) with a detection limit of 50 and 100 CBPV RNA copies, respectively, and the protocol of the real-time RT-qPCR assay for CBPV quantitation was approved by the French Accreditation Committee. Copyright © 2011 Elsevier B.V. All rights reserved.

  9. Detection of Tomato black ring virus by real-time one-step RT-PCR.

    Science.gov (United States)

    Harper, Scott J; Delmiglio, Catia; Ward, Lisa I; Clover, Gerard R G

    2011-01-01

    A TaqMan-based real-time one-step RT-PCR assay was developed for the rapid detection of Tomato black ring virus (TBRV), a significant plant pathogen which infects a wide range of economically important crops. Primers and a probe were designed against existing genomic sequences to amplify a 72 bp fragment from RNA-2. The assay amplified all isolates of TBRV tested, but no amplification was observed from the RNA of other nepovirus species or healthy host plants. The detection limit of the assay was estimated to be around nine copies of the TBRV target region in total RNA. A comparison with conventional RT-PCR and ELISA, indicated that ELISA, the current standard test method, lacked specificity and reacted to all nepovirus species tested, while conventional RT-PCR was approximately ten-fold less sensitive than the real-time RT-PCR assay. Finally, the real-time RT-PCR assay was tested using five different RT-PCR reagent kits and was found to be robust and reliable, with no significant differences in sensitivity being found. The development of this rapid assay should aid in quarantine and post-border surveys for regulatory agencies. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. Laboratory validation of two real-time RT-PCR methods with 5'-tailed primers for an enhanced detection of foot-and-mouth disease virus.

    Science.gov (United States)

    Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris

    2017-08-01

    The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Real-time RT-PCR, a necessary tool to support the diagnosis and surveillance of rotavirus in Mexico.

    Science.gov (United States)

    De La Cruz Hernández, Sergio Isaac; Anaya Molina, Yazmin; Gómez Santiago, Fabián; Terán Vega, Heidi Lizbeth; Monroy Leyva, Elda; Méndez Pérez, Héctor; García Lozano, Herlinda

    2018-04-01

    Rotavirus produces diarrhea in children under 5 years old. Most of those conventional methods such as polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) have been used for rotavirus detection. However, these techniques need a multi-step process to get the results. In comparison with conventional methods, the real-time RT-PCR is a highly sensitive method, which allows getting the results in only one day. In this study a real-time RT-PCR assay was tested using a panel of 440 samples from patients with acute gastroenteritis, and characterized by PAGE and RT-PCR. The results show that the real-time RT-PCR detected rotavirus from 73% of rotavirus-negative samples analyzed by PAGE and RT-PCR; thus, the percentage of rotavirus-positive samples increased to 81%. The results indicate that this real-time RT-PCR should be part of a routine analysis, and as a support of the diagnosis of rotavirus in Mexico. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Real time RT-PCR assay for detection of different serotypes of FMDV in Egypt

    Directory of Open Access Journals (Sweden)

    Laila El-Shehawy

    Full Text Available Aim: The present study indicated that rRT-PCR could be provided for the detection of FMDV in infected, contact and carrier cattle and also provide a rapid sensitive tool aiming to aid in rapid disease detection and control. Foot and Mouth disease virus serotypes O and A still existing in Egypt. In January 2012, sever outbreaks struck the animal population in most Egyptian 1 governorates. The causative virus was identified as FMDV SAT2. Material and Methods: Five samples of tongue epithelium (ET and five oesophageal-pharyngeal (OP fluid samples were collected from FMD suspected cattle in infected farm at El-Fayoum and 20 OP samples from in-contact cattle at the same farm in addition to 30 OP samples from apparently healthy cattle at three different localities in El-Fayoum governorate (12 from Fayoum; 9 from Sinoras and 9 from Edsa in order to detect carrier cattle. All of these samples were collected during November and December 2011 and January 2012. Results: All the ET and OP samples were inoculated on BHK cell culture and baby mice. The obtained results were identified using complement fixation test in addition to real-time reverse transcriptase polymerase chain reaction (rRT-PCR. In the infected farm at El-Fayoum FMDV type SAT2 was detected in cattle which are considered as the first introduction of this type while FMDV type O and SAT2 were detected in the in-contact cattle in the same farm. The sensitivity of rRT-PCR was cleared in the in-contact cattle as 13 out of 20 OP samples were positive to FMDV by rRT-PCR while 11 out of 20 OP samples were positive to FMDV by CFT. The OP samples collected from apparently healthy cattle from Fayoum, Sinoras and Edsa localities in Fayoum governorate demonstrate the circulation of the FMDV type A, O and the recent SAT2 in carrier cattle which threaten cattle population in Fayoum governorate. Also the sensitivity of real time RT-PCR over the CFT in detection of FMDV carrier cattle was clearly noticed in

  13. Ring trial 2016 for Bluetongue virus detection by real-time RT-PCR in France.

    Science.gov (United States)

    Sailleau, Corinne; Viarouge, Cyril; Breard, Emmanuel; Vitour, Damien; Zientara, Stephan

    2017-05-01

    Since the unexpected emergence of BTV-8 in Northern Europe and the incursion of BTV-8 and 1 in France in 2006-2007, molecular diagnosis has considerably evolved. Several real-time RT-PCR (rtRT-PCR) methods have been developed and published, and are currently being used in many countries across Europe for BTV detection and typing. In France, the national reference laboratory (NRL) for orbiviruses develops and validates 'ready-to-use' kits with private companies for viral RNA detection. The regional laboratories network that was set up to deal with a heavy demand for analyses has used these available kits. From 2007, ring tests were organized to monitor the performance of the French laboratories. This study presents the results of 63 regional laboratories in the ring trial organized in 2016. Blood samples were sent to the laboratories. Participants were asked to use the rtRT-PCR methods in place in their laboratory, for detection of all BTV serotypes and specifically BTV-8. The French regional laboratories are able to detect and genotype BTV in affected animals. Despite the use of several methods (i.e. RNA extraction and different commercial rtRT-PCRs), the network is homogeneous. The ring trial demonstrated that the French regional veterinary laboratories have reliable and robust BTV diagnostic tools for BTV genome detection.

  14. Comparative Evaluation Of Conventional Rt-pcr And Real-time Rt-pcr (rrt-pcr) For Detection Of Avian Metapneumovirus Subtype A [comparação Entre As Técnicas De Rt-pcr Convencional E Rt-pcr Em Tempo Real Para A Detecção Do Metapneumovírus Aviários Subtipo A

    OpenAIRE

    Ferreira H.L.; Spilki F.R.; dos Santos M.M.A.B.; de Almeida R.S.; Arns C.W.

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  15. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    International Nuclear Information System (INIS)

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  16. Detection of ROS1 Gene Rearrangement in Lung Adenocarcinoma: Comparison of IHC, FISH and Real-Time RT-PCR

    OpenAIRE

    Shan, Ling; Lian, Fang; Guo, Lei; Qiu, Tian; Ling, Yun; Ying, Jianming; Lin, Dongmei

    2015-01-01

    Aims To compare fluorescence in situ hybridization (FISH), immunohistochemistry (IHC) and quantitative real-time reverse transcription-PCR (qRT-PCR) assays for detection of ROS1 fusion in a large number of ROS1-positive lung adenocatcinoma (ADC) patients. Methods Using IHC analysis, sixty lung ADCs including 16 cases with ROS1 protein expression and 44 cases without ROS1 expression were selected for this study. The ROS1 fusion status was examined by FISH and qRT-PCR assay. Results Among 60 ca...

  17. Single reaction, real time RT-PCR detection of all known avian and human metapneumoviruses.

    Science.gov (United States)

    Lemaitre, E; Allée, C; Vabret, A; Eterradossi, N; Brown, P A

    2018-01-01

    Current molecular methods for the detection of avian and human metapneumovirus (AMPV, HMPV) are specifically targeted towards each virus species or individual subgroups of these. Here a broad range SYBR Green I real time RT-PCR was developed which amplified a highly conserved fragment of sequence in the N open reading frame. This method was sufficiently efficient and specific in detecting all MPVs. Its validation according to the NF U47-600 norm for the four AMPV subgroups estimated low limits of detection between 1000 and 10copies/μL, similar with detection levels described previously for real time RT-PCRs targeting specific subgroups. RNA viruses present a challenge for the design of durable molecular diagnostic test due to the rate of change in their genome sequences which can vary substantially in different areas and over time. The fact that the regions of sequence for primer hybridization in the described method have remained sufficiently conserved since the AMPV and HMPV diverged, should give the best chance of continued detection of current subgroups and of potential unknown or future emerging MPV strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Development and implementation of the quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network in mainland China

    Directory of Open Access Journals (Sweden)

    Wang Wei

    2011-03-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR and real time RT-PCR (rRT-PCR have been indispensable methods for influenza surveillance, especially for determination of avian influenza. The movement of testing beyond reference lab introduced the need of quality control, including the implementation of an evaluation system for validating personal training and sample proficiency testing. Methods We developed a panel with lysates of seasonal influenza virus (H1N1, H3N2 and B, serials of diluted H5N1 virus lysates, and in-vitro transcribed H5 hemaglutinin (HA and an artificial gene RNAs for RT-PCR and rRT-PCR quality control assessment. The validations of stability and reproducibility were performed on the panel. Additionally, the panel was implemented to assess the detection capability of Chinese human avian influenza networks. Results The panel has relatively high stability and good reproducibility demonstrated by kappa's tests. In the implementation of panel on Chinese human avian influenza networks, the results suggested that there were a relatively low number of discrepancies for both concise and reproducibility in Chinese avian influenza virus net works. Conclusions A quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network was developed. An availably statistical data, which are used to assess the detection capability of networks on avian influenza virus (H5N1, can be obtained relatively easily through implementation of the panel on networks.

  19. Real-Time RT-PCR for the Detection of Lyssavirus Species

    Directory of Open Access Journals (Sweden)

    A. Deubelbeiss

    2014-01-01

    Full Text Available The causative agents of rabies are single-stranded, negative-sense RNA viruses in the genus Lyssavirus of Rhabdoviridae, consisting of twelve classified and three as yet unclassified species including classical rabies virus (RABV. Highly neurotropic RABV causes rapidly progressive encephalomyelitis with nearly invariable fatal outcome. Rapid and reliable diagnosis of rabies is highly relevant for public and veterinary health. Due to growing variety of the genus Lyssavirus observed, the development of suitable molecular assays for diagnosis and differentiation is challenging. This work focused on the establishment of a suitable real-time RT-PCR technique for rabies diagnosis as a complement to fluorescent antibody test and rabies tissue culture infection test as gold standard for diagnosis and confirmation. The real-time RT-PCR was adapted with the goal to detect the whole spectrum of lyssavirus species, for nine of which synthesized DNA fragments were used. For the detection of species, seven probes were developed. Serial dilutions of the rabies virus strain CVS-11 showed a 100-fold higher sensitivity of real-time PCR compared to heminested RT-PCR. Using a panel of thirty-one lyssaviruses representing four species, the suitability of the protocol could be shown. Phylogenetic analysis of the sequences obtained by heminested PCR allowed correct classification of all viruses used.

  20. Real-time RT-PCR high-resolution melting curve analysis and multiplex RT-PCR to detect and differentiate grapevine leafroll-associated associated virus 3 variant groups I, II, III and VI

    Directory of Open Access Journals (Sweden)

    Bester Rachelle

    2012-09-01

    Full Text Available Abstract Background Grapevine leafroll-associated virus 3 (GLRaV-3 is the main contributing agent of leafroll disease worldwide. Four of the six GLRaV-3 variant groups known have been found in South Africa, but their individual contribution to leafroll disease is unknown. In order to study the pathogenesis of leafroll disease, a sensitive and accurate diagnostic assay is required that can detect different variant groups of GLRaV-3. Methods In this study, a one-step real-time RT-PCR, followed by high-resolution melting (HRM curve analysis for the simultaneous detection and identification of GLRaV-3 variants of groups I, II, III and VI, was developed. A melting point confidence interval for each variant group was calculated to include at least 90% of all melting points observed. A multiplex RT-PCR protocol was developed to these four variant groups in order to assess the efficacy of the real-time RT-PCR HRM assay. Results A universal primer set for GLRaV-3 targeting the heat shock protein 70 homologue (Hsp70h gene of GLRaV-3 was designed that is able to detect GLRaV-3 variant groups I, II, III and VI and differentiate between them with high-resolution melting curve analysis. The real-time RT-PCR HRM and the multiplex RT-PCR were optimized using 121 GLRaV-3 positive samples. Due to a considerable variation in melting profile observed within each GLRaV-3 group, a confidence interval of above 90% was calculated for each variant group, based on the range and distribution of melting points. The intervals of groups I and II could not be distinguished and a 95% joint confidence interval was calculated for simultaneous detection of group I and II variants. An additional primer pair targeting GLRaV-3 ORF1a was developed that can be used in a subsequent real-time RT-PCR HRM to differentiate between variants of groups I and II. Additionally, the multiplex RT-PCR successfully validated 94.64% of the infections detected with the real-time RT-PCR HRM

  1. Detection panel for identification of twelve hemorrhagic viruses using real-time RT-PCR.

    Science.gov (United States)

    Fajfr, M; Neubauerová, V; Pajer, P; Kubíčková, P; Růžek, D

    2014-09-01

    Viral hemorrhagic fevers are caused by viruses from four viral families and develop diseases with high fatality rates. However, no commercial diagnostic assay for these pathogens is available. We developed real-time RT-PCR assays for viruses Ebola, Marburg, Lassa, Guanarito, Machupo, Junin, Sabiá, Seoul, Puumala, Hantaan, Crimean-Congo hemorrhagic fever virus and Rift Valley fever virus. The assays were optimized for identical reaction conditions and can be performed using several types of real-time PCR instruments, both capillary and plate, including a portable Ruggedized Advanced Pathogen Identification Device (R.A.P.I.D.) (Idaho Technology, Inc.). In combination with primers and probes from previously published studies, we present a simple system for rapid identification of hemorrhagic filoviruses, arenaviruses and bunyaviruses with sufficient sensitivity for first contact laboratory and diagnosis under field conditions.

  2. Identification of genes for normalization of real-time RT-PCR data in breast carcinomas

    DEFF Research Database (Denmark)

    Lyng, Maria B; Laenkholm, Anne-Vibeke; Pallisgaard, Niels

    2008-01-01

    BACKGROUND: Quantitative real-time RT-PCR (RT-qPCR) has become a valuable molecular technique in basic and translational biomedical research, and is emerging as an equally valuable clinical tool. Correlation of inter-sample values requires data normalization, which can be accomplished by various...... means, the most common of which is normalization to internal, stably expressed, reference genes. Recently, such traditionally utilized reference genes as GAPDH and B2M have been found to be regulated in various circumstances in different tissues, emphasizing the need to identify genes independent...... of factors influencing the tissue, and that are stably expressed within the experimental milieu. In this study, we identified genes for normalization of RT-qPCR data for invasive breast cancer (IBC), with special emphasis on estrogen receptor positive (ER+) IBC, but also examined their applicability to ER...

  3. Development of duplex real-time RT-PCR based on Taqman technology for detecting simultaneously the genome of pan-enterovirus and enterovirus 71.

    Science.gov (United States)

    Hwang, Seoyeon; Kang, Byunghak; Hong, Jiyoung; Kim, Ahyoun; Kim, Hyejin; Kim, Kisang; Cheon, Doo-Sung

    2013-07-01

    Human enterovirus (EV) 71 is the main etiological agent of hand, foot, and mouth disease (HFMD). It is associated with neurological complications, and caused fatalities during recent outbreaks in the Asia-Pacific region. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. In this study, a duplex real-time RT-PCR assay was developed in order to simultaneously detect pan-EV and EV71. EV71-specific primers and probes were designed based on the highly conserved VP1 region of EV71. Five EV71 strains were detected as positive, and no positive fluorescence signal was observed in the duplex real-time RT-PCR for other viral RNA, which showed 100% specificity for the selected panel, and no cross-reactions were observed in this duplex real-time RT-PCR. The EV71-specific duplex real-time RT-PCR was more sensitive than conventional RT-PCR, and detected viral titers that were 10-fold lower than those measured by the latter. Of the 381 HFMD clinical specimens, 196 (51.4%) cases were pan-EV-positive, of which 170 (86.7%) were EV71-positive when tested by pan-EV and EV71-specific duplex real-time RT-PCR. EV71-specific duplex real-time RT-PCR offers a rapid and sensitive method to detect EV71 from clinical specimens, and will allow quarantine measures to be taken more effectively during outbreaks. Copyright © 2013 Wiley Periodicals, Inc.

  4. Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

    Directory of Open Access Journals (Sweden)

    Borges-Pérez Andrés

    2008-12-01

    Full Text Available Abstract Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC, SGN-U321250 (TIP41, SGN-U346908 ("Expressed" and SGN-U316474 (SAND genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real-time

  5. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  6. Microdroplet sandwich real-time rt-PCR for detection of pandemic and seasonal influenza subtypes.

    Directory of Open Access Journals (Sweden)

    Stephanie L Angione

    Full Text Available As demonstrated by the recent 2012/2013 flu epidemic, the continual emergence of new viral strains highlights the need for accurate medical diagnostics in multiple community settings. If rapid, robust, and sensitive diagnostics for influenza subtyping were available, it would help identify epidemics, facilitate appropriate antiviral usage, decrease inappropriate antibiotic usage, and eliminate the extra cost of unnecessary laboratory testing and treatment. Here, we describe a droplet sandwich platform that can detect influenza subtypes using real-time reverse-transcription polymerase chain reaction (rtRT-PCR. Using clinical samples collected during the 2010/11 season, we effectively differentiate between H1N1p (swine pandemic, H1N1s (seasonal, and H3N2 with an overall assay sensitivity was 96%, with 100% specificity for each subtype. Additionally, we demonstrate the ability to detect viral loads as low as 10(4 copies/mL, which is two orders of magnitude lower than viral loads in typical infected patients. This platform performs diagnostics in a miniaturized format without sacrificing any sensitivity, and can thus be easily developed into devices which are ideal for small clinics and pharmacies.

  7. Evaluation of RIDA®GENE norovirus GI/GII real time RT-PCR using stool specimens collected from children and adults with acute gastroenteritis.

    Science.gov (United States)

    Kanwar, N; Hassan, F; Barclay, L; Langley, C; Vinjé, J; Bryant, P W; George, K St; Mosher, L; Matthews-Greer, J M; Rocha, M A; Beenhouwer, D O; Harrison, C J; Moffatt, M; Shastri, N; Selvarangan, R

    2018-04-10

    Norovirus is the leading cause of epidemic and sporadic acute gastroenteritis (AGE) in the United States. Widespread prevalence necessitates implementation of accurate norovirus detection assays in clinical diagnostic laboratories. To evaluate RIDA ® GENE norovirus GI/GII real-time RT-PCR assay (RGN RT-PCR) using stool samples from patients with sporadic AGE. Patients between 14 days to 101 years of age with symptoms of AGE were enrolled prospectively at four sites across the United States during 2014-2015. Stool specimens were screened for the presence of norovirus RNA by the RGN RT-PCR assay. Results were compared with a reference method that included conventional RT-PCR and sequencing of a partial region of the 5'end of the norovirus ORF2 gene. A total of 259 (36.0%) of 719 specimens tested positive for norovirus by the reference method. The RGN RT-PCR assay detected norovirus in 244 (94%) of these 259 norovirus positive specimens. The sensitivity and specificity (95% confidence interval) of the RGN RT-PCR assay for detecting norovirus genogroup (G) I was 82.8% (63.5-93.5) and 99.1% (98.0-99.6) and for GII was 94.8% (90.8-97.2) and 98.6% (96.9-99.4), respectively. Seven specimens tested positive by the RGN-RT PCR that were negative by the reference method. The fifteen false negative samples were typed as GII.4 Sydney, GII.13, GI.3, GI.5, GI.2, GII.1, and GII.3 in the reference method. The RGN RT-PCR assay had a high sensitivity and specificity for the detection of norovirus in stool specimens from patients with sporadic AGE. Copyright © 2018. Published by Elsevier B.V.

  8. Comparison of ELISA and dual stage real time RT-PCR to differentiate Sabin like and non-Sabin like poliovirus isolates.

    Science.gov (United States)

    Kaundal, Nirmal; Sarkate, Purva; Prakash, Charu; Rishi, Narayan

    2017-06-01

    Environmental surveillance of polioviruses has been used as an important tool in monitoring circulation of wild polioviruses and/or Vaccine derived polioviruses in sewage samples. It is important to distinguish Sabin like isolates from non-Sabin like; ELISA & dual stage real time RT-PCR have been used for the same. Current study was carried out on sewage isolates to compare ELISA & RT-PCR with sequencing to distinguish Sabin like from non-Sabin like. Out of 468 sewage specimens, 91 (19.44%) were non-polio enteroviruses positive and 377 (80.56%) were polio positive by virus isolation method. A total of 488 polio virus isolates were detected by L20B and RD route which were further subjected to ELISA and RT-PCR. The results were compared with sequencing. On comparison, the specificity of ELISA was only 66.67% in spite of very low sensitivity (3.43%). The sensitivity of RT-PCR was 97.71% which makes it a good primary screening test for detection of non-Sabin like viruses. However, the specificity was only 33.33%. RT-PCR appears to be a sensitive tool for detecting non-Sabin like viruses however; the isolates which are non-Sabin like by RT-PCR may not necessarily be mutated viruses. ELISA cannot be used for differentiation of Sabin likes from non-Sabin likes due to low sensitivity.

  9. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa

    DEFF Research Database (Denmark)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R.; Wadsworth, Jemma

    2016-01-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping...... methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within...... sequencing. Samples (n = 71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious...

  10. Absolute estimation of initial concentrations of amplicon in a real-time RT-PCR process

    Directory of Open Access Journals (Sweden)

    Kohn Michael

    2007-10-01

    Full Text Available Abstract Background Since real time PCR was first developed, several approaches to estimating the initial quantity of template in an RT-PCR reaction have been tried. While initially only the early thermal cycles corresponding to exponential duplication were used, lately there has been an effort to use all of the cycles in a PCR. The efforts have included both fitting empirical sigmoid curves and more elaborate mechanistic models that explore the chemical reactions taking place during each cycle. The more elaborate mechanistic models require many more parameters than can be fit from a single amplification, while the empirical models provide little insight and are difficult to tailor to specific reactants. Results We directly estimate the initial amount of amplicon using a simplified mechanistic model based on chemical reactions in the annealing step of the PCR. The basic model includes the duplication of DNA with the digestion of Taqman probe and the re-annealing between previously synthesized DNA strands of opposite orientation. By modelling the amount of Taqman probe digested and matching that with the observed fluorescence, the conversion factor between the number of fluorescing dye molecules and observed fluorescent emission can be estimated, along with the absolute initial amount of amplicon and the rate parameter for re-annealing. The model is applied to several PCR reactions with known amounts of amplicon and is shown to work reasonably well. An expanded version of the model allows duplication of amplicon without release of fluorescent dye, by adding 1 more parameter to the model. The additional process is helpful in most cases where the initial primer concentration exceeds the initial probe concentration. Software for applying the algorithm to data may be downloaded at http://www.niehs.nih.gov/research/resources/software/pcranalyzer/ Conclusion We present proof of the principle that a mechanistically based model can be fit to observations

  11. Table 1. Primer sequences used for real-time qRT-PCR analysis of ...

    Indian Academy of Sciences (India)

    User

    TGTCCCAGTAAACCGCTC. GAATCCAGCACGATACCAGT. Figure 1. Expression analysis of candidate CsActin and CsFbox genes by qRT-PCR in response to 4°C treatment. The y-axis indicates Cq values, and error bars represent standard deviations of the mean values of four replicates. Rt, roots; St, stems; Le, leaves; Fl ...

  12. A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

    Science.gov (United States)

    Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-03-01

    The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Selection of reference genes for quantitative real time RT-PCR during dimorphism in the zygomycete Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco I; Jácome-Galarza, Irvin E; Gutiérrez-Corona, Félix; Ramírez-Díaz, Martha I; Campos-García, Jesús; Meza-Carmen, Víctor

    2015-03-01

    Mucor circinelloides is a dimorphic fungal model for studying several biological processes including cell differentiation (yeast-mold transitions) as well as biodiesel and carotene production. The recent release of the first draft sequence of the M. circinelloides genome, combined with the availability of analytical methods to determine patterns of gene expression, such as quantitative Reverse transcription-Polymerase chain reaction (qRT-PCR), and the development of molecular genetic tools for the manipulation of the fungus, may help identify M. circinelloides gene products and analyze their relevance in different biological processes. However, no information is available on M. circinelloides genes of stable expression that could serve as internal references in qRT-PCR analyses. One approach to solve this problem consists in the use of housekeeping genes as internal references. However, validation of the usability of these reference genes is a fundamental step prior to initiating qRT-PCR assays. This work evaluates expression of several constitutive genes by qRT-PCR throughout the morphological differentiation stages of M. circinelloides; our results indicate that tfc-1 and ef-1 are the most stable genes for qRT-PCR assays during differentiation studies and they are proposed as reference genes to carry out gene expression studies in this fungus.

  14. Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

    Directory of Open Access Journals (Sweden)

    Ren Chen

    2010-01-01

    Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

  15. A real time Taqman RT-PCR for the detection of rabbit hemorrhagic disease virus 2 (RHDV2).

    Science.gov (United States)

    Duarte, Margarida Dias; Carvalho, Carina L; Barros, Silvia C; Henriques, Ana M; Ramos, Fernanda; Fagulha, Teresa; Luís, Tiago; Duarte, Elsa L; Fevereiro, Miguel

    2015-07-01

    A specific real time RT-PCR for the detection of RHDV2 was developed and validated using RHDV and RHDV2 RNA preparations from positive field samples. The system was designed to amplify a 127 nucleotide-long RNA region located within the vp60 gene, based on the alignment of six sequences originated in Portugal, obtained in our laboratory, and 11 sequences from France and Italy. The primers and probe target sequences are highly conserved in the vast majority of the RHDV2 sequences presently known. In the sequences showing variability, only one mismatch is found per strain, usually outlying the 3' end of the primer or probe hybridization sequences. The specificity of the method was demonstrated in vitro with a panel of common rabbit pathogens. Standardization was performed with RNA transcripts obtained from a recombinant plasmid harboring the target sequence. The method was able to detected nine RNA molecules with an efficiency of 99.4% and a R(2) value of 1. Repeatability and reproducibility of the method were very high, with coefficients of variation lower than 2.40%. The assay was proven a valuable tool to diagnose most of RDVH2 circulating strains, and may be also useful to monitor viral loads, and consequently, disease progression and vaccination efficacy. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

    Science.gov (United States)

    Wadhwa, Ashutosh; Wilkins, Kimberly; Gao, Jinxin; Condori Condori, Rene Edgar; Gigante, Crystal M; Zhao, Hui; Ma, Xiaoyue; Ellison, James A; Greenberg, Lauren; Velasco-Villa, Andres; Orciari, Lillian; Li, Yu

    2017-01-01

    Rabies, resulting from infection by Rabies virus (RABV) and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA) test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR) based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N) coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses, its high

  17. A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

    Directory of Open Access Journals (Sweden)

    Ashutosh Wadhwa

    2017-01-01

    Full Text Available Rabies, resulting from infection by Rabies virus (RABV and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses

  18. Selection of reference genes for quantitative real-time RT-PCR studies in tomato fruit of the genotype MT-Rg1

    Directory of Open Access Journals (Sweden)

    Karla L. González-Aguilera

    2016-09-01

    Full Text Available Quantitative real-time RT-PCR (qRT-PCR has become one of the most widely used methods for accurate quantification of gene expression. Since there are no universal reference genes for normalization, the optimal strategy to normalize raw qRT-PCR data is to perform an initial comparison of a set of independent reference genes to assess the most stable ones in each biological model. Normalization of a qRT-PCR experiment helps to ensure that the results are both statistically significant and biologically meaningful. Tomato is the model of choice to study fleshy fruit development. The miniature tomato (Solanum lycopersicum L. cultivar Micro-Tom (MT is considered a model system for tomato genetics and functional genomics. A new genotype, containing the Rg1 allele, improves tomato in vitro regeneration. In this work, we evaluated the expression stability of four tomato reference genes, namely CAC, SAND, Expressed and ACTIN2. We showed that the genes CAC and Exp are the best reference genes of the four we tested during fruit development in the MT-Rg1 genotype. Furthermore, we validated the reference genes by showing that the expression profiles of the transcription factors FRUITFULL1 (FUL1 and APETALA2c (AP2c during fruit development are comparable to previous reports using other tomato cultivars.

  19. Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

    Directory of Open Access Journals (Sweden)

    Anita Chakravarti

    2016-01-01

    Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

  20. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR for detection of avian metapneumovirus subtype A Comparação entre as técnicas de RT-PCR convencional e RT-PCR em tempo real para a detecção do metapneumovírus aviários subtipo A

    Directory of Open Access Journals (Sweden)

    Helena Lage Ferreira

    2009-08-01

    Full Text Available Avian metapneumovirus (AMPV belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F gene and nucleocapsid (N gene were compared with an established test for the attachment (G gene. All the RT-PCR tested assays were able to detect the AMPV/A. The lower detection limits were observed using the N-, F- based RRT-PCR and F-based conventional RT-PCR (10(0.3 to 10¹ TCID50 mL-1. The present study suggests that the conventional F-based RT-PCR presented similar detection limit when compared to N- and F-based RRT-PCR and they can be successfully used for AMPV/A detection.O metapneumovírus aviário (AMPV pertence ao gênero Metapneumovirus, família Paramyxoviridae. Isolamento viral, sorologia e detecção do RNA genômico são atualmente as técnicas utilizadas para o diagnóstico desse agente. O objetivo do presente estudo foi comparar a detecção de RNA viral de seis isolados de AMPV, subtipo A (AMPV/A, utilizando diferentes métodos de RT-PCR convencional e real time RT-PCR (RRT-PCR. Duas novas técnicas de RT-PCR convencional e duas técnicas de RRT-PCR, ambas para a detecção dos genes da nucleoproteína (N e da proteína de fusão (F, foram comparadas com um RT-PCR previamente estabelecido para a detecção do AMPV (gene da glicoproteína -G. Todos esses métodos foram capazes de detectar os isolados AMPV/A. As técnicas RRT-PCR (genes F e N mostraram os menores limites de detecção (10(0.3 to 10¹ TCID50 mL-1. Os resultados sugerem que as técnicas RT-PCR convencional (gene F e as técnicas de RRT-PCR (gene F e N desenvolvidas no presente estudo podem ser utilizadas com sucesso para a detecção do

  1. Detection, quantitation and identification of enteroviruses from surface waters and sponge tissue from the Florida Keys using real-time RT-PCR

    Science.gov (United States)

    Donaldson, K.A.; Griffin, Dale W.; Paul, J.H.

    2002-01-01

    A method was developed for the quantitative detection of pathogenic human enteroviruses from surface waters in the Florida Keys using Taqman (R) one-step Reverse transcription (RT)-PCR with the Model 7700 ABI Prism (R) Sequence Detection System. Viruses were directly extracted from unconcentrated grab samples of seawater, from seawater concentrated by vortex flow filtration using a 100kD filter and from sponge tissue. Total RNA was extracted from the samples, purified and concentrated using spin-column chromatography. A 192-196 base pair portion of the 5??? untranscribed region was amplified from these extracts. Enterovirus concentrations were estimated using real-time RT-PCR technology. Nine of 15 sample sites or 60% were positive for the presence of pathogenic human enteroviruses. Considering only near-shore sites, 69% were positive with viral concentrations ranging from 9.3viruses/ml to 83viruses/g of sponge tissue (uncorrected for extraction efficiency). Certain amplicons were selected for cloning and sequencing for identification. Three strains of waterborne enteroviruses were identified as Coxsackievirus A9, Coxsackievirus A16, and Poliovirus Sabin type 1. Time and cost efficiency of this one-step real-time RT-PCR methodology makes this an ideal technique to detect, quantitate and identify pathogenic enteroviruses in recreational waters. Copyright ?? 2002 Elsevier Science Ltd.

  2. Evaluation of FTA cards as a laboratory and field sampling device for the detection of foot-and-mouth disease virus and serotyping by RT-PCR and real-time RT-PCR.

    Science.gov (United States)

    Muthukrishnan, Madhanmohan; Singanallur, Nagendrakumar B; Ralla, Kumar; Villuppanoor, Srinivasan A

    2008-08-01

    Foot-and-mouth disease virus (FMDV) samples transported to the laboratory from far and inaccessible areas for serodiagnosis pose a major problem in a tropical country like India, where there is maximum temperature fluctuation. Inadequate storage methods lead to spoilage of FMDV samples collected from clinically positive animals in the field. Such samples are declared as non-typeable by the typing laboratories with the consequent loss of valuable epidemiological data. The present study evaluated the usefulness of FTA Classic Cards for the collection, shipment, storage and identification of the FMDV genome by RT-PCR and real-time RT-PCR. The stability of the viral RNA, the absence of infectivity and ease of processing the sample for molecular methods make the FTA cards a useful option for transport of FMDV genome for identification and serotyping. The method can be used routinely for FMDV research as it is economical and the cards can be transported easily in envelopes by regular document transport methods. Live virus cannot be isolated from samples collected in FTA cards, which is a limitation. This property can be viewed as an advantage as it limits the risk of transmission of live virus.

  3. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil.

    Science.gov (United States)

    Fischer, Carlo; Torres, Maria C; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A; Charrel, Rémi N; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C; Rodrigues, Cintia D S; Kümmerer, Beate M; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-11-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  4. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil

    OpenAIRE

    Fischer, Carlo; Torres, Maria C.; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A.; Charrel, Rémi N.; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C.; Rodrigues, Cintia D.S.; Kümmerer, Beate M.; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-01-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  5. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa.

    Science.gov (United States)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R; Wadsworth, Jemma; Mioulet, Valerie; Sallu, Raphael; Belsham, Graham J; Kasanga, Christopher J; Knowles, Nick J; King, Donald P

    2016-11-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within the VP1-coding region that share high intra-lineage identity, but do not cross-react with FMD viruses from other serotypes that circulate in the region. These serotype-specific assays operate with the same thermal profile as the pan-diagnostic tests making it possible to run them in parallel to produce C T values comparable to the pan-diagnostic test detecting the 3D-coding region. These assays were evaluated alongside the established pan-specific molecular test using field samples and virus isolates collected from Tanzania, Kenya and Ethiopia that had been previously characterised by nucleotide sequencing. Samples (n=71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious virus could still be serotyped using these assays. These serotype-specific real-time RT-PCR assays can detect and characterise FMDVs currently circulating in East Africa and hence improve disease control in this region. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Development of a duplex real-time RT-PCR for the simultaneous detection and differentiation of Theiler's murine encephalomyelitis virus and rat theilovirus.

    Science.gov (United States)

    Yuan, Wen; Wang, Jing; Xu, Fengjiao; Huang, Bihong; Lian, Yuexiao; Rao, Dan; Yin, Xueqin; Wu, Miaoli; Zhu, Yujun; Zhang, Yu; Huang, Ren; Guo, Pengju

    2016-10-01

    Theiler's murine encephalomyelitis virus (TMEV) and rat theilovirus (RTV), the member of the genus Cardiovirus, are widespread in laboratory mice and rats, and are potential contaminants of biological materials. Cardioviruses infection may cause serious complications in biomedical research. To improve the efficiency of routine screening for Cardioviruses infection, a duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection and differentiation of TMEV and RTV. The duplex assay was specific for reference strains of TMEV and RTV, and no cross-reaction was found with seven other rodent viruses. The limits of detection of both TMEV and RTV were 4×10(1) copies RNA/reaction. Reproducibility was estimated using standard dilutions, with coefficients of variation duplex real-time RT-PCR and conventional RT-PCR. For 439 clinical samples,95 samples were positive for TMEV and 72 samples were positive for RTV using duplex real-time RT-PCR approach, whereas only 77 samples were positive for TMEV and 66 samples were positive for RTV when conventional RT-PCR was applied. Mixed infections were found in 20 samples when analyzed by conventional RT-PCR whereas 30 samples were found to be mixed infection when duplex real-time RT-PCR was applied. This duplex assay provides a useful tool for routine health monitoring and screening of contaminated biological materials of these two viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus.

    Science.gov (United States)

    Faye, Martin; Dacheux, Laurent; Weidmann, Manfred; Diop, Sylvie Audrey; Loucoubar, Cheikh; Bourhy, Hervé; Sall, Amadou Alpha; Faye, Ousmane

    2017-05-01

    Rabies virus (RABV) remains one of the most important global zoonotic pathogens. RABV causes rabies, an acute encephalomyelitis associated with a high rate of mortality in humans and animals and affecting different parts of the world, particularly in Asia and Africa. Confirmation of rabies diagnosis relies on laboratory diagnosis, in which molecular techniques such as detection of viral RNA by reverse transcription polymerase chain reaction (RT-PCR) are increasingly being used. In this study, two real-time quantitative RT-PCR assays were developed for large-spectrum detection of RABV, with a focus on African isolates. The primer and probe sets were targeted highly conserved regions of the nucleoprotein (N) and polymerase (L) genes. The results indicated the absence of non-specific amplification and cross-reaction with a range of other viruses belonging to the same taxonomic family, i.e. Rhabdoviridae, as well as negative brain tissues from various host species. Analytical sensitivity ranged between 100 to 10 standard RNA copies detected per reaction for N-gene and L-gene assays, respectively. Effective detection and high sensitivity of these assays on African isolates showed that they can be successfully applied in general research and used in diagnostic process and epizootic surveillance in Africa using a double-check strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland.

    LENUS (Irish Health Repository)

    Menton, John F

    2007-01-01

    BACKGROUND: Noroviruses are the most common cause of non-bacterial gastroenteritis. Improved detection methods have seen a large increase in the number of human NoV genotypes in the last ten years. The objective of this study was to develop a fast method to detect, quantify and genotype positive NoV samples from Irish hospitals. RESULTS: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on the ORF1-ORF2 region. The sensitivity and reactivity of the two assays used was validated using a reference stool panel containing 14 NoV genotypes. The assays were then used to investigate two outbreaks of gastroenteritis in two Irish hospitals. 56 samples were screened for NoV using a real-time RT-PCR assay and 26 samples were found to be positive. Genotyping of these positive samples found that all positives belonged to the GII\\/4 variant of NoV. CONCLUSION: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method to investigate a NoV associated outbreak. It was concluded that the predominant genotype circulating in these Irish hospitals was GII\\/4 which has been associated with the majority of NoV outbreaks worldwide. The assays developed in this study are useful tools for investigating NoV infection.

  9. Correlation of immune activation with HIV-1 RNA levels assayed by real-time RT-PCR in HIV-1 Subtype C infected patients in Northern India

    Science.gov (United States)

    Agarwal, Atima; Sankaran, Sumathi; Vajpayee, Madhu; Sreenivas, V; Seth, Pradeep; Dandekar, Satya

    2014-01-01

    Background Assays with specificity and cost effectiveness are needed for the measurement of HIV-1 burden to monitor disease progression or response to anti-retroviral therapy (ART) in HIV-1 subtype C infected patients. Objectives The objective of this study was to develop and validate an affordable; one step Real-Time RT-PCR assay with high specificity and sensitivity to measure plasma HIV-1 loads in HIV-1 subtype C infected patients. Results We developed an RT-PCR assay to detect and quantitate plasma HIV-1 levels in HIV-1 subtype C infected patients. An inverse correlation between plasma viral loads (PVL) and CD4+ T-cell numbers was detected at all CDC stages. Significant correlations were found between CD8+ T-cell activation and PVL, as well as with the clinical and immunological status of the patients. Conclusions The RT-PCR assay provides a sensitive method to measure PVL in HIV-1 subtype C infected patients. Viral loads correlated with immune activation and can be used to monitor HIV care in India. PMID:17962068

  10. Early diagnosis of dengue in travelers: comparison of a novel real-time RT-PCR, NS1 antigen detection and serology.

    Science.gov (United States)

    Huhtamo, Eili; Hasu, Essi; Uzcátegui, Nathalie Y; Erra, Elina; Nikkari, Simo; Kantele, Anu; Vapalahti, Olli; Piiparinen, Heli

    2010-01-01

    The increased traveling to dengue endemic regions and the numerous epidemics have led to a rise in imported dengue. The laboratory diagnosis of acute dengue requires several types of tests and often paired samples are needed for obtaining reliable results. Although several diagnostic methods are available, proper comparative data on their performance are lacking. To compare the performance of novel methods including a novel pan-DENV real-time RT-PCR and a commercially available NS1 capture-EIA in regard to IgM detection for optimizing the early diagnosis of DENV in travelers. A panel of 99 selected early phase serum samples of dengue patients was studied by real-time RT-PCR, NS1 antigen ELISA, IgM-EIA, IgG-IFA and cell culture virus isolation. The novel real-time RT-PCR was shown specific and sensitive for detection of DENV-1-4 RNA and suitable for diagnostic use. The diagnostic rate using combination of RNA and IgM detection was 99% and using NS1 and IgM detection 95.9%. The results of RNA and NS1 antigen detection disagreed in 15.5% of samples that had only RNA or NS1 antigen detected. The diagnostic rates of early samples are higher when either RNA or NS1 antigen detection is combined with IgM detection. Besides the differences in the RNA and NS1 detection assays, the observed discrepancy of results could suggest individual variation or differences in timing of these markers in patient serum. Copyright (c) 2009 Elsevier B.V. All rights reserved.

  11. Evaluation of candidate reference genes for gene expression normalization in Brassica juncea using real time quantitative RT-PCR.

    Directory of Open Access Journals (Sweden)

    Ruby Chandna

    Full Text Available The real time quantitative reverse transcription PCR (qRT-PCR is becoming increasingly important to gain insight into function of genes. Given the increased sensitivity, ease and reproducibility of qRT-PCR, the requirement of suitable reference genes for normalization has become important and stringent. It is now known that the expression of internal control genes in living organism vary considerably during developmental stages and under different experimental conditions. For economically important Brassica crops, only a couple of reference genes are reported till date. In this study, expression stability of 12 candidate reference genes including ACT2, ELFA, GAPDH, TUA, UBQ9 (traditional housekeeping genes, ACP, CAC, SNF, TIPS-41, TMD, TSB and ZNF (new candidate reference genes, in a diverse set of 49 tissue samples representing different developmental stages, stress and hormone treated conditions and cultivars of Brassica juncea has been validated. For the normalization of vegetative stages the ELFA, ACT2, CAC and TIPS-41 combination would be appropriate whereas TIPS-41 along with CAC would be suitable for normalization of reproductive stages. A combination of GAPDH, TUA, TIPS-41 and CAC were identified as the most suitable reference genes for total developmental stages. In various stress and hormone treated samples, UBQ9 and TIPS-41 had the most stable expression. Across five cultivars of B. juncea, the expression of CAC and TIPS-41 did not vary significantly and were identified as the most stably expressed reference genes. This study provides comprehensive information that the new reference genes selected herein performed better than the traditional housekeeping genes. The selection of most suitable reference genes depends on the experimental conditions, and is tissue and cultivar-specific. Further, to attain accuracy in the results more than one reference genes are necessary for normalization.

  12. Use of quantitative real-time RT-PCR to investigate the correlation between viremia and viral shedding of canine distemper virus, and infection outcomes in experimentally infected dogs.

    Science.gov (United States)

    Sehata, Go; Sato, Hiroaki; Ito, Toshihiro; Imaizumi, Yoshitaka; Noro, Taichi; Oishi, Eiji

    2015-07-01

    We used real-time RT-PCR and virus titration to examine canine distemper virus (CDV) kinetics in peripheral blood and rectal and nasal secretions from 12 experimentally infected dogs. Real-time RT-PCR proved extremely sensitive, and the correlation between the two methods for rectal and nasal (r=0.78, 0.80) samples on the peak day of viral RNA was good. Although the dogs showed diverse symptoms, viral RNA kinetics were similar; the peak of viral RNA in the symptomatic dogs was consistent with the onset of symptoms. These results indicate that real-time RT-PCR is sufficiently sensitive to monitor CDV replication in experimentally infected dogs regardless of the degree of clinical manifestation and suggest that the peak of viral RNA reflects active CDV replication.

  13. Cross-platform evaluation of commercial real-time SYBR green RT-PCR kits for sensitive and rapid detection of European bat Lyssavirus type 1.

    Science.gov (United States)

    Picard-Meyer, Evelyne; Peytavin de Garam, Carine; Schereffer, Jean Luc; Marchal, Clotilde; Robardet, Emmanuelle; Cliquet, Florence

    2015-01-01

    This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R (2) values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  14. Cross-Platform Evaluation of Commercial Real-Time SYBR Green RT-PCR Kits for Sensitive and Rapid Detection of European Bat Lyssavirus Type 1

    Directory of Open Access Journals (Sweden)

    Evelyne Picard-Meyer

    2015-01-01

    Full Text Available This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R2 values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  15. European interlaboratory comparison of Schmallenberg virus (SBV) real-time RT-PCR detection in experimental and field samples: The method of extraction is critical for SBV RNA detection in semen

    NARCIS (Netherlands)

    Schulz, C.; Poel, van der W.H.M.; Ponsart, C.; Cay, A.B.; Steinbach, F.; Zientara, S.; Beer, M.; Hoffmann, B.

    2015-01-01

    Molecular methods for the detection of Schmallenberg virus (SBV) RNA were rapidly developed after the emergence of this novel orthobunyavirus in Europe. The SBV epizootic wave has declined, but infectious SBV in SBV RNA–positive semen remains a possible risk for the distribution of SBV. However, the

  16. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    Directory of Open Access Journals (Sweden)

    Qin E-de

    2010-06-01

    Full Text Available Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009 influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same as that of each single-target RT-PCR for pandemic H1N1 and even more sensitive for H5N1 with the same primers and probes. No cross reactivity of detecting other subtype influenza viruses or respiratory tract viruses was observed. Two hundred and thirty-six clinical specimens were tested by comparing with single real-time RT-PCR and result from the duplex assay was 100% consistent with the results of single real-time RT-PCR and sequence analysis.

  17. RT-PCR Protocols - Methods in Molecular Biology

    Directory of Open Access Journals (Sweden)

    Manuela Monti

    2011-03-01

    Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

  18. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    OpenAIRE

    Kang, Xiao-ping; Jiang, Tao; Li, Yong-qiang; Lin, Fang; Liu, Hong; Chang, Guo-hui; Zhu, Qing-yu; Qin, E-de; Qin, Cheng-feng; Yang, Yin-hui

    2010-01-01

    Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009) influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose) for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same a...

  19. Identification of Dobrava, Hantaan, Seoul, and Puumala viruses by one-step real-time RT-PCR.

    Science.gov (United States)

    Aitichou, Mohamed; Saleh, Sharron S; McElroy, Anita K; Schmaljohn, C; Ibrahim, M Sofi

    2005-03-01

    We developed four assays for specifically identifying Dobrava (DOB), Hantaan (HTN), Puumala (PUU), and Seoul (SEO) viruses. The assays are based on the real-time one-step reverse transcriptase polymerase chain reaction (RT-PCR) with the small segment used as the target sequence. The detection limits of DOB, HTN, PUU, and SEO assays were 25, 25, 25, and 12.5 plaque-forming units, respectively. The assays were evaluated in blinded experiments, each with 100 samples that contained Andes, Black Creek Canal, Crimean-Congo hemorrhagic fever, Rift Valley fever and Sin Nombre viruses in addition to DOB, HTN, PUU and SEO viruses. The sensitivity levels of the DOB, HTN, PUU, and SEO assays were 98%, 96%, 92% and 94%, respectively. The specificity of DOB, HTN and SEO assays was 100% and the specificity of the PUU assay was 98%. Because of the high levels of sensitivity, specificity, and reproducibility, we believe that these assays can be useful for diagnosing and differentiating these four Old-World hantaviruses.

  20. Real-time onestep RT-PCR for the detection and differentiation of European and North American types of PRRSV in boar semen

    DEFF Research Database (Denmark)

    Hjulsager, Charlotte Kristiane; Larsen, Lars Erik

    and safe diagnostic procedure, since cDNA synthesis and PCR is performed sequentially without inbetween opening of the PCR-tubes, thus eliminating a substantial contamination risk. The aim of the present study was to validate a real-time OneStep RT-PCR assay for the simultaneous detection...

  1. Development of a real-time RT-PCR assay based on primer-probe energy transfer for the detection of all serotypes of bluetongue virus

    DEFF Research Database (Denmark)

    Leblanc, N; Rasmussen, Thomas Bruun; Fernandez, J

    2010-01-01

    A real-time RT-PCR assay based on the primer–probe energy transfer (PriProET) was developed to detect all 24 serotypes of bluetongue virus (BTV). BTV causes serious disease, primarily in sheep, but in other ruminants as well. A distinguishing characteristic of the assay is its tolerance toward...

  2. Development of a novel quantitative real-time RT-PCR assay for the simultaneous detection of all serotypes of Foot-and-mouth disease virus

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; de Stricker, K.

    2003-01-01

    Foot-and-mouth disease virus (FMDV) spreads extremely fast and the need for rapid and robust diagnostic virus detection systems was obvious during the recent European epidemic. Using a novel real-time RT-PCR system based on primer-probe energy transfer (PriProET) we present here an assay targeting...

  3. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR

    Directory of Open Access Journals (Sweden)

    Nagorsen Dirk

    2003-12-01

    Full Text Available Abstract The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV and Influenza (Flu, were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ, Interleukin-2 (IL-2, Interleukin-4 (IL-4, and Interleukin-10 (IL-10. We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization.

  4. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR)

    Science.gov (United States)

    Provenzano, Maurizio; Mocellin, Simone; Bonginelli, Paola; Nagorsen, Dirk; Kwon, Seog-Woon; Stroncek, David

    2003-01-01

    The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA) polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs) from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV) and Influenza (Flu), were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR) was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ), Interleukin-2 (IL-2), Interleukin-4 (IL-4), and Interleukin-10 (IL-10). We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization. PMID:14675481

  5. Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

    Science.gov (United States)

    Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

    2017-06-01

    A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

    Science.gov (United States)

    Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

    2011-01-01

    Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

  7. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Directory of Open Access Journals (Sweden)

    Gilberto A Santiago

    Full Text Available Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV. There are four genetically distinct DENVs (DENV-1-4 that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  8. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Science.gov (United States)

    Santiago, Gilberto A; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L

    2013-01-01

    Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1-4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  9. Development of a novel real-time RT-PCR assay to detect Seneca Valley virus-1 associated with emerging cases of vesicular disease in pigs.

    Science.gov (United States)

    Fowler, Veronica L; Ransburgh, Russell H; Poulsen, Elizabeth G; Wadsworth, Jemma; King, Donald P; Mioulet, Valerie; Knowles, Nick J; Williamson, Susanna; Liu, Xuming; Anderson, Gary A; Fang, Ying; Bai, Jianfa

    2017-01-01

    Seneca Valley virus 1 (SVV-1) can cause vesicular disease that is clinically indistinguishable from foot-and-mouth disease, vesicular stomatitis and swine vesicular disease. SVV-1-associated disease has been identified in pigs in several countries, namely USA, Canada, Brazil and China. Diagnostic tests are required to reliably detect this emerging virus, and this report describes the development and evaluation of a novel real-time (r) reverse-transcription (RT) PCR assay (rRT-PCR), targeting the viral polymerase gene (3D) of SVV-1. This new assay detected all historical and contemporary SVV-1 isolates examined (n=8), while no cross-reactivity was observed with nucleic acid templates prepared from other vesicular disease viruses or common swine pathogens. The analytical sensitivity of the rRT-PCR was 0.79 TCID 50 /ml and the limit of detection was equivalent using two different rRT-PCR master-mixes. The performance of the test was further evaluated using pig nasal (n=25) and rectal swab samples (n=25), where concordant results compared to virus sequencing were generated for 43/50 samples. The availability of this assay, will enable laboratories to rapidly detect SVV-1 in cases of vesicular disease in pigs, negated for notifiable diseases, and could enable existing knowledge gaps to be investigated surrounding the natural epidemiology of SVV-1. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. [Detecting HB-1 Expression Level in Bone Marrow of Acute Leukemia Patients by Real-Time Fluorescence Quantitative RT-PCR].

    Science.gov (United States)

    Wang, Qing-Yun; Li, Yuan; Ji, Li; Liang, Ze-Yin; Liu, Wei; Ren, Han-Yun; Qiu, Zhi-Xiang

    2018-02-01

    To investigate the expression level of HB-1 gene in patients with acute lymphoblastic leukemia (ALL) and the significance of HB-1 gene in monitoring of minimal residual disease (MRD). The method of real-time fluorescence quantitative RT-PCR (Taqman probe) was established to detect the expression levels of HB-1 gene; then the sensitivity, specificity and repeatability of this assay were evaluated and verified. The HB-1 gene expression levels in bone marrow of 183 cases of ALL, 70 cases of acute myeloid leukemias (AML), 52 cases of non-malignant hematologic diseases and 24 healthy hematopoietic stem cell donors were detected. The correlation of HB-1 level with diagnosis and relapse was analyzed by detecting bone marrow samples of 33 B-ALL. The sensitivity of this assay reached the 10 -4 level. The coefficient of variation for inter-batch and inter-tube of HB-1 were 6.79% and 4.80%, respectively. It was found that HB-1 gene specifically expressed in acute B lymphoblastic leukemia. The median expression levels of HB-1 gene in newly diagnosed and relapsed B-ALL patients were statistically significantly higher than those in ALL in complete remission(CR), newly diagnosed T-ALL, newly diagnosed AML, non-malignant hematologic diseases, and healthy hematopoietic stem cell donors(33.0% vs 0.68%, 0.07%, 0.02%, 0.58% and 0, respectively) (P0.05). The expression level of HB-1 gene declined sharply when B-ALL patients reached complete remission (0-7.99%, with median level 0.68%), but increased when relapsed (7.69%, 8.08% and 484.0% in 3 relapsed samples), which was in accordance with results of flow cytometry. HB-1 gene specifically expressed in acute B lymphoblastic leukemia cells. The established real-time fluorescence quantitative RT-PCR assay shows good sensitivity, specificity and repeatability, thus, can be used as a biological marker in the clinical detection, monitoring MRD and predicting of early relapse for B-ALL patients.

  11. Conventional and real time RT-PCR assays for the detection and differentiation of variant rabbit hemorrhagic disease virus (RHDVb) and its recombinants.

    Science.gov (United States)

    Dalton, K P; Arnal, J L; Benito, A A; Chacón, G; Martín Alonso, J M; Parra, F

    2018-01-01

    Since its emergence, variant RHDV (RHDVb/RHDV2) has spread throughout the Iberian Peninsula aided by the apparent lack of cross protection provided by classic (genogroup 1; G1) strain derived vaccines. In addition to RHDVb, full-length genome sequencing of RHDV strains has recently revealed the circulation of recombinant viruses on the Iberian Peninsula. These recombinant viruses contain the RHDVb structural protein encoding sequences and the non-structural coding regions of either pathogenic RHDV-G1 strains or non-pathogenic (np) rabbit caliciviruses. The aim of the work was twofold: firstly to validate a diagnostic real time RT-PCR developed in 2012 for the detection of RHDVb strains and secondly, to design a conventional RT-PCR for the differentiation of RHDVb strains from RHDVb recombinants by subsequent sequencing of the amplicon. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Quantitation of O6-methylguanine-DNA methyltransferase gene messenger RNA in gliomas by means of real-time RT-PCR and clinical response to nitrosoureas.

    Science.gov (United States)

    Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi

    2005-09-01

    1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.

  13. Novel Molecular Beacon Probe-Based Real-Time RT-PCR Assay for Diagnosis of Crimean-Congo Hemorrhagic Fever Encountered in India

    Directory of Open Access Journals (Sweden)

    Aman Kamboj

    2014-01-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is an emerging zoonotic disease in India and requires immediate detection of infection both for preventing further transmission and for controlling the infection. The present study describes development, optimization, and evaluation of a novel molecular beacon-based real-time RT-PCR assay for rapid, sensitive, and specific diagnosis of Crimean-Congo hemorrhagic fever virus (CCHFV. The developed assay was found to be a better alternative to the reported TaqMan assay for routine diagnosis of CCHF.

  14. Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

    Science.gov (United States)

    Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

    2016-09-01

    Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

    Science.gov (United States)

    Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

    2017-10-01

    Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Evaluation of 793/B-like and Mass-like vaccine strain kinetics in experimental and field conditions by real-time RT-PCR quantification.

    Science.gov (United States)

    Tucciarone, C M; Franzo, G; Berto, G; Drigo, M; Ramon, G; Koutoulis, K C; Catelli, E; Cecchinato, M

    2018-01-01

    Infectious bronchitis virus (IBV) is a great economic burden both for productive losses and costs of the control strategies. Many different vaccination protocols are applied in the same region and even in consecutive cycles on the same farm in order to find the perfect balance between costs and benefits. In Northern Italy, the usual second vaccination is more and more often moved up to the chick's first d of life. The second strain administration together with the common Mass priming by spray at the hatchery allows saving money and time and reducing animal stress. The present work compared the different vaccine strains (Mass-like or B48, and 1/96) kinetics both in field conditions and in a 21-day-long experimental trial in broilers, monitoring the viral replication by upper respiratory tract swabbing and vaccine specific real time reverse transcription PCR (RT-PCR) quantification. In both field and experimental conditions, titers for all the vaccines showed an increasing trend in the first 2 wk and then a decrease, though still remaining detectable during the whole monitored period. IBV field strain and avian Metapneumovirus (aMPV) presence also was also investigated by RT-PCR and sequencing, and by multiplex real-time RT-PCR, respectively, revealing a consistency in the pathogen introduction timing at around 30 d, in correspondence with the vaccine titer's main decrease. These findings suggest the need for an accurate knowledge of live vaccine kinetics, whose replication can compete with the other pathogen one, providing additional protection to be added to what is conferred by the adaptive immune response. © 2017 Poultry Science Association Inc.

  17. Comparison of the genexpert enterovirus assay (GXEA) with real-time one step RT-PCR for the detection of enteroviral RNA in the cerebrospinal fluid of patients with meningitis.

    Science.gov (United States)

    Hong, JiYoung; Kim, Ahyoun; Hwang, Seoyeon; Cheon, Doo-Sung; Kim, Jong-Hyen; Lee, June-Woo; Park, Jae-Hak; Kang, Byunghak

    2015-02-13

    Enteroviruses (EVs) are the leading cause of aseptic meningitis worldwide. Detection of enteroviral RNA in clinical specimens has been demonstrated to improve the management of patient care, especially that of neonates and young children. To establish a sensitive and reliable assay for routine laboratory diagnosis, we compared the sensitivity and specificity of the GeneXpert Enterovirus Assay (GXEA) with that of the reverse transcription polymerase chain reaction (RT-PCR) based assay referred to as real-time one step RT-PCR (RTo-PCR). The sensitivity/specificity produced by GXEA and RTo-PCR were 100%/100% and 65%/100%, respectively. Both methods evaluated in this article can be used for detection of enterovirus in clinical specimens and these nucleic acid amplification methods are useful assays for the diagnosis of enteroviral infection.

  18. Detection and characterization of Newcastle disease virus in clinical samples using real time RT-PCR and melting curve analysis based on matrix and fusion genes amplification

    Directory of Open Access Journals (Sweden)

    Saad Sharawi

    2013-10-01

    Full Text Available Aim: Newcastle disease is still one of the major threats for poultry industry allover the world. Therefore, attempt was made in this study to use the SYBR Green I real-time PCR with melting curves analysis as for detection and differentiation of NDV strains in suspected infected birds. Materials and Methods: Two sets of primers were used to amplify matrix and fusion genes in samples collected from suspectly infected birds (chickens and pigeons. Melting curve analysis in conjunction with real time PCR was conducted for identifying different pathotypes of the isolated NDVs. Clinical samples were propagated on specific pathogen free ECE and tested for MDT and ICIP. Results: The velogenic NDVs isolated from chickens and pigeons were distinguished with mean T 85.03±0.341 and m 83.78±0.237 respectively for M-gene amplification and for F-gene amplification the mean T were 84.04±0.037 and m 84.53±0.223. On the other hand the lentogenic NDV isolates including the vaccinal strains (HB1 and LaSota have a higher mean T (86.99±0.021 for M-gene amplification and 86.50±0.063 for F-gene amplification. The test showed no reaction with m unrelated RNA samples. In addition, the results were in good agreement with both virus isolation and biological pathotyping (MDT and ICIP. The assay offers an attractive alternative method for the diagnosis of NDV that can be easily applied in laboratory diagnosis as a screening test for the detection and differentiation of NDV infections. Conclusion: As was shown by the successful rapid detection and pathotyping of 15 NDV strains in clinical samples representing velogenic and lentogenic NDV strains, and the agreement with the results of virus isolation , biological pathotyping and pathogenicity indices. The results of this report suggests that the described SybrGreen I real-time RT-PCR assay in conjunction with Melting curve analysis used as a rapid, specific and simple diagnostic tools for detection and pathotyping of

  19. Multiplex real-time RT-PCR assay for bovine viral diarrhea virus type 1, type 2 and HoBi-like pestivirus.

    Science.gov (United States)

    Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola

    2016-03-01

    HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Validation of reference genes for quantitative expression analysis by real-time rt-PCR in four lepidopteran insects.

    Science.gov (United States)

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae), Chilo suppressalis Walker (Crambidae), and Spodoptera exigua Hübner (Noctuidae) to study their expression stability. The algorithms of geNorm, NormFinder, stability index, and ΔCt analysis were used to evaluate these HKGs. Across different developmental stages, actin A1 was the most stable in P. xylostella and C. suppressalis, but it was the least stable in B. mori and S. exigua. Rp49 and GAPDH were the most stable in B. mori and S. exigua, respectively. In different tissues, GAPDH, E2F, and Rp49 were the most stable in B. mori, S. exigua, and C. suppressalis, respectively. The relative abundances of Siwi genes estimated by 2(-ΔΔCt) method were tested with different HKGs as the reference gene, proving the importance of internal controls in qPCR data analysis. The results not only presented a list of suitable reference genes in four lepidopteran insects, but also proved that the expression stabilities of HKGs were different among evolutionarily close species. There was no single universal reference gene that could be used in all situations. It is indispensable to validate the expression of HKGs before using them as the internal control in qPCR.

  1. Validation of Reference Genes for Quantitative Expression Analysis by Real-Time RT-PCR in Four Lepidopteran Insects

    OpenAIRE

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae...

  2. The effect of various disinfectants on detection of avian influenza virus by real time RT-PCR.

    Science.gov (United States)

    Suarez, D L; Spackman, E; Senne, D A; Bulaga, L; Welsch, A C; Froberg, K

    2003-01-01

    An avian influenza (AI) real time reverse transcriptase-polymerase chain reaction (RRT-PCR) test was previously shown to be a rapid and sensitive method to identify AI virus-infected birds in live-bird markets (LBMs). The test can also be used to identify avian influenza virus (AIV) from environmental samples. Consequently, the use of RRT-PCR was being considered as a component of the influenza eradication program in the LBMs to assure that each market was properly cleaned and disinfected before allowing the markets to be restocked. However, the RRT-PCR test cannot differentiate between live and inactivated virus, particularly in environmental samples where the RRT-PCR test potentially could amplify virus that had been inactivated by commonly used disinfectants, resulting in a false positive test result. To determine whether this is a valid concern, a study was conducted in three New Jersey LBMs that were previously shown to be positive for the H7N2 AIV. Environmental samples were collected from all three markets following thorough cleaning and disinfection with a phenolic disinfectant. Influenza virus RNA was detected in at least one environmental sample from two of the three markets when tested by RRT-PCR; however, all samples were negative by virus isolation using the standard egg inoculation procedure. As a result of these findings, laboratory experiments were designed to evaluate several commonly used disinfectants for their ability to inactivate influenza as well as disrupt the RNA so that it could not be detected by the RRT-PCR test. Five disinfectants were tested: phenolic disinfectants (Tek-trol and one-stroke environ), a quaternary ammonia compound (Lysol no-rinse sanitizer), a peroxygen compound (Virkon-S), and sodium hypochlorite (household bleach). All five disinfectants were effective at inactivating AIV at the recommended concentrations, but AIV RNA in samples inactivated with phenolic and quaternary ammonia compounds could still be detected by RRT

  3. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum using quantitative real-time RT-PCR.

    Directory of Open Access Journals (Sweden)

    Jacinta Gimeno

    Full Text Available Switchgrass (Panicum virgatum has received a lot of attention as a forage and bioenergy crop during the past few years. Gene expression studies are in progress to improve new traits and develop new cultivars. Quantitative real time PCR (qRT-PCR has emerged as an important technique to study gene expression analysis. For accurate and reliable results, normalization of data with reference genes is essential. In this work, we evaluate the stability of expression of genes to use as reference for qRT-PCR in the grass P. virgatum. Eleven candidate reference genes, including eEF-1α, UBQ6, ACT12, TUB6, eIF-4a, GAPDH, SAMDC, TUA6, CYP5, U2AF, and FTSH4, were validated for qRT-PCR normalization in different plant tissues and under different stress conditions. The expression stability of these genes was verified by the use of two distinct algorithms, geNorm and NormFinder. Differences were observed after comparison of the ranking of the candidate reference genes identified by both programs but eEF-1α, eIF-4a, CYP5 and U2AF are ranked as the most stable genes in the samples sets under study. Both programs discard the use of SAMDC and TUA6 for normalization. Validation of the reference genes proposed by geNorm and NormFinder were performed by normalization of transcript abundance of a group of target genes in different samples. Results show similar expression patterns when the best reference genes selected by both programs were used but differences were detected in the transcript abundance of the target genes. Based on the above research, we recommend the use of different statistical algorithms to identify the best reference genes for expression data normalization. The best genes selected in this study will help to improve the quality of gene expression data in a wide variety of samples in switchgrass.

  4. Identification of normalization factors for quantitative real-time RT-PCR analysis of gene expression in Pacific abalone Haliotis discus hannai

    Science.gov (United States)

    Qiu, Reng; Sun, Boguang; Fang, Shasha; Sun, Li; Liu, Xiao

    2013-03-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is widely used in studies of gene expression. In most of these studies, housekeeping genes are used as internal references without validation. To identify appropriate reference genes for qRT-PCR in Pacific abalone Haliotis discus hannai, we examined the transcription stability of six housekeeping genes in abalone tissues in the presence and absence of bacterial infection. For this purpose, abalone were infected with the bacterial pathogen Vibrio anguillarum for 12 h and 48 h. The mRNA levels of the housekeeping genes in five tissues (digestive glands, foot muscle, gill, hemocyte, and mantle) were determined by qRT-PCR. The PCR data was subsequently analyzed with the geNorm and NormFinder algorithms. The results show that in the absence of bacterial infection, elongation factor-1-alpha and beta-actin were the most stably expressed genes in all tissues, and thus are suitable as cross-tissue type normalization factors. However, we did not identify any universal reference genes post infection because the most stable genes varied between tissue types. Furthermore, for most tissues, the optimal reference genes identified by both algorithms at 12 h and 48 h post-infection differed. These results indicate that bacterial infection induced significant changes in the expression of abalone housekeeping genes in a manner that is dependent on tissue type and duration of infection. As a result, different normalization factors must be used for different tissues at different infection points.

  5. Diagnosis of Barmah Forest Virus Infection by a Nested Real-Time SYBR Green RT-PCR Assay

    OpenAIRE

    Hueston, Linda; Toi, Cheryl S.; Jeoffreys, Neisha; Sorrell, Tania; Gilbert, Gwendolyn

    2013-01-01

    Barmah Forest virus (BFV) is a mosquito borne (+) ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR ne...

  6. Development of a highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus 71 in hand, foot, and mouth disease.

    Science.gov (United States)

    Niu, Peihua; Qi, Shunxiang; Yu, Benzhang; Zhang, Chen; Wang, Ji; Li, Qi; Ma, Xuejun

    2016-11-01

    Enterovirus 71 (EV71) is one of the major causative agents of outbreaks of hand, foot, and mouth disease (HFMD). A commercial TaqMan probe-based real-time PCR assay has been widely used for the differential detection of EV71 despite its relatively high cost and failure to detect samples with a low viral load (Ct value > 35). In this study, a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of EV71 in HFMD was developed. The sensitivity and specificity of this assay were evaluated using a reference EV71 stock and a panel of controls consisting of coxsackievirus A16 (CVA16) and common respiratory viruses, respectively. The clinical performance of this assay was evaluated and compared with those of a commercial TaqMan probe-based real-time PCR (qRT-PCR) assay and a traditional two-step nested RT-PCR assay. The limit of detection for the RTN RT-PCR assay was 0.01 TCID50/ml, with a Ct value of 38.3, which was the same as that of the traditional two-step nested RT-PCR assay and approximately tenfold lower than that of the qRT-PCR assay. When testing the reference strain EV71, this assay showed favorable detection reproducibility and no obvious cross-reactivity. The testing results of 100 clinical throat swabs from HFMD-suspected patients revealed that 41 samples were positive for EV71 by both RTN RT-PCR and traditional two-step nested RT-PCR assays, whereas only 29 were EV71 positive by qRT-PCR assay.

  7. Pandemic preparedness in Hawaii: a multicenter verification of real-time RT-PCR for the direct detection of influenza virus types A and B.

    Science.gov (United States)

    Whelen, A Christian; Bankowski, Matthew J; Furuya, Glenn; Honda, Stacey; Ueki, Robert; Chan, Amelia; Higa, Karen; Kumashiro, Diane; Moore, Nathaniel; Lee, Roland; Koyamatsu, Terrie; Effler, Paul V

    2010-01-01

    We integrated multicenter, real-time (RTi) reverse transcription polymerase chain reaction (RT-PCR) screening into a statewide laboratory algorithm for influenza surveillance and response. Each of three sites developed its own testing strategy and was challenged with one randomized and blinded panel of 50 specimens previously tested for respiratory viruses. Following testing, each participating laboratory reported its results to the Hawaii State Department of Health, State Laboratories Division for evaluation and possible discrepant analysis. Two of three laboratories reported a 100% sensitivity and specificity, resulting in a 100% positive predictive value and a 100% negative predictive value (NPV) for influenza type A. The third laboratory showed a 71% sensitivity for influenza type A (83% NPV) with 100% specificity. All three laboratories were 100% sensitive and specific for the detection of influenza type B. Discrepant analysis indicated that the lack of sensitivity experienced by the third laboratory may have been due to the analyte-specific reagent probe used by that laboratory. Use of a newer version of the product with a secondary panel of 20 specimens resulted in a sensitivity and specificity of 100%. All three laboratories successfully verified their ability to conduct clinical testing for influenza using diverse nucleic acid extraction and RTi RT-PCR platforms. Successful completion of the verification by all collaborating laboratories paved the way for the integration of those facilities into a statewide laboratory algorithm for influenza surveillance and response.

  8. Diagnosis of Barmah Forest virus infection by a nested real-time SYBR green RT-PCR assay.

    Directory of Open Access Journals (Sweden)

    Linda Hueston

    Full Text Available Barmah Forest virus (BFV is a mosquito borne (+ ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR negative. Two culture-positive (neutralizing antibody negative samples were positive on first round PCR, while one sample (IgM and neutralizing antibody strongly positive, IgG negative was positive on second round PCR, suggesting that viral RNA is detectable and transiently present in early infection. PCR can provide results faster than culture, is capable of high throughput and by sequencing the PCR product strain variants can be characterized.

  9. Real-time RT-PCR analysis of mRNA decay: half-life of Beta-actin mRNA in human leukemia CCRF-CEM and Nalm-6 cell lines

    Directory of Open Access Journals (Sweden)

    Barredo Julio C

    2002-03-01

    Full Text Available Abstract Background We describe an alternative method to determine mRNA half-life (t1/2 based on the Real-Time RT-PCR procedure. This approach was evaluated by using the β-actin gene as a reference molecule for measuring of mRNA stability. Results Human leukemia Nalm-6 and CCRF-CEM cells were treated with various concentrations of Actinomycin D to block transcription and aliquots were removed periodically. Total RNA was isolated and quantified using the RiboGreen® fluorescent dye with the VersaFluor Fluorometer System. One μg of total RNA was reverse transcribed and used as template for the amplification of a region of the β-actin gene (231 bp. To generate the standard curve, serial ten-fold dilutions of the pBactin-231 vector containing the cDNA amplified fragment were employed, β-actin mRNAs were quantified by Real-Time RT-PCR using the SYBR® Green I fluorogenic dye and data analyzed using the iCycle iQ system software. Using this method, the β-actin mRNA exhibited a half-life of 6.6 h and 13.5 h in Nalm-6 and CCRF-CEM cells, respectively. The t1/2 value obtained for Nalm-6 is comparable to those estimated from Northern blot studies, using normal human leukocytes (5.5 h. Conclusions We have developed a rapid, sensitive, and reliable method based on Real-Time RT-PCR for measuring mRNA half-life. Our results confirm that β-actin mRNA half-life can be affected by the cellular growth rate.

  10. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  11. Simultaneous detection of Zika, Chikungunya and Dengue viruses by a multiplex real-time RT-PCR assay.

    Science.gov (United States)

    Pabbaraju, Kanti; Wong, Sallene; Gill, Kara; Fonseca, Kevin; Tipples, Graham A; Tellier, Raymond

    2016-10-01

    In the recent past, arboviruses such as Chikungunya (CHIKV) and Zika (ZIKV) have increased their area of endemicity and presented as an emerging global public health threat. To design an assay for the simultaneous detection of ZIKV, CHIKV and Dengue (DENV) 1-4 from patients with symptoms of arboviral infection. This would be advantageous because of the similar clinical presentation typically encountered with these viruses and their co-circulation in endemic areas. In this study we have developed and validated a triplex real time reverse transcription PCR assay using hydrolysis probes targeting the non-structural 5 (NS5) region of ZIKV, non-structural protein 4 (nsP4) from CHIKV and 3' untranslated region (3'UTR) of DENV 1-4. The 95% LOD by the triplex assay was 15 copies/reaction for DENV-1 and less than 10 copies/reaction for all other viruses. The triplex assay was 100% specific and did not amplify any of the other viruses tested. The assay was reproducible and adaptable to testing different specimen types including serum, plasma, urine, placental tissue, brain tissue and amniotic fluid. This assay can be easily implemented for diagnostic testing of patient samples, even in a high throughput laboratory. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Development of a real-time RT-PCR assay for the simultaneous identification, quantitation and differentiation of avian metapneumovirus subtypes A and B.

    Science.gov (United States)

    Cecchinato, Mattia; Lupini, Caterina; Munoz Pogoreltseva, Olga Svetlana; Listorti, Valeria; Mondin, Alessandra; Drigo, Michele; Catelli, Elena

    2013-01-01

    In recent years, special attention has been paid to real-time polymerase chain reaction (PCR) for avian metapneumovirus (AMPV) diagnosis, due to its numerous advantages over classical PCR. A new multiplex quantitative real-time reverse transcription-PCR (qRT-PCR) with molecular beacon probe assay, designed to target the SH gene, was developed. The test was evaluated in terms of specificity, sensitivity and repeatability, and compared with conventional RT nested-PCR based on the G gene. All of the AMPV subtype A and B strains tested were amplified and specifically detected while no amplification occurred with other non-target bird respiratory pathogens. The detection limit of the assay was 10(-0.41) median infectious dose/ml and 10(1.15) median infectious dose/ml when the AMPV-B strain IT/Ty/B/Vr240/87 and the AMPV-A strain IT/Ty/A/259-01/03 were used, respectively, as templates. In all cases, the amplification efficiency was approximately 2 and the error values were 0.9375) between crossing point values and virus quantities, making the assay herein designed reliable for quantification. When the newly developed qRT-PCR was compared with a conventional RT nested-PCR, it showed greater sensitivity with RNA extracted from both positive controls and from experimentally infected birds. This assay can be effectively used for the detection, identification, differentiation and quantitation of AMPV subtype A or subtype B to assist in disease diagnosis and to carry out rapid surveillance with high levels of sensitivity and specificity.

  13. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Directory of Open Access Journals (Sweden)

    Radtke Arnold

    2008-11-01

    Full Text Available Abstract Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR. The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC is presented. Methods Six genes, beta-2-microglobulin (B2M, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, hydroxymethyl-bilane synthase (HMBS, hypoxanthine phosphoribosyl-transferase 1 (HPRT1, succinate dehydrogenase complex, subunit A (SDHA and ubiquitin C (UBC, with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the

  14. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Science.gov (United States)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Methods Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues

  15. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  16. Estudio comparativo entre una prueba rápida y RT-PCR tiempo real en el diagnóstico de influenza AH1N1 2009 Comparative study of a rapid testing with real time RT-PCR for diagnosis of influenza AH1N1 2009

    Directory of Open Access Journals (Sweden)

    Luz Araceli Castro-Cárdenas

    2011-08-01

    Full Text Available OBJETIVO: Comparar la prueba QuickVue Influenza A+B empleando como estándar la RT-PCR tiempo real para influenza AH1N1 2009. MATERIAL Y MÉTODOS: Estudio retrospectivo-comparativo de 135 muestras de vías respiratorias de individuos sintomáticos para influenza procesadas de mayo 2009 a octubre 2010.Las pruebas citadas se realizaron simultáneamente. Se utilizó el software Confidence Interval Analysis 2000. RESULTADOS: Sensibilidad 62.96; especificidad 94.44; valor predictivo negativo 62.9; valor predictivo positivo 94.44; razón de probabilidad positiva 11.33 y razón de probabilidad negativa 0.39. Se calcularon intervalos de confianza a 95. DISCUSIÓN: Los valores obtenidos concuerdan con otros estudios donde la sensibilidad fluctúa de 50 a 70 y especificidad entre 90 y 95 por ciento. La prueba QuickVue Influenza A+B es rápida, simple y de menor costo que el RT-PCR tiempo real, útil para identificar el tipo de virus en brotes de influenza de una población determinadaOBJECTIVE: Compare QuickVue Influenza A+B test with real-time RT-PCR for the diagnosis of influenza AH1N1 2009. MATERIAL AND METHODS: Retrospective-comparative study of 135 respiratory specimens from individuals with symptoms of influenza processed from May 2009 to October 2010.The above mentioned tests were performed simultaneously. For statistic analysisthe softwareof Confidence IntervalAnalysis 2000 was used. RESULTS: The parameters obtained were: sensitivity 62.96; specificity 94.44; negative predictive value 62.9; positive predictive value 94.44; positive likelihood ratio 11.33; negative likelihood ratio 0.39. Confidence intervals to 95,were calculated to all of the above data. DISCUSSION: The test QuickVue InfluenzaA+B is a rapid,simple test,with lower cost than real-time RT-PCR useful for identifying the type of virus outbreaks of influenza in a given population.It correlates well with more specific test and similar reports.

  17. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  18. One-step multiplex real-time RT-PCR assay for detecting and genotyping wild-type group A rotavirus strains and vaccine strains (Rotarix® and RotaTeq®) in stool samples

    Science.gov (United States)

    Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.

    2016-01-01

    Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8

  19. Characterization of human coronavirus etiology in Chinese adults with acute upper respiratory tract infection by real-time RT-PCR assays.

    Directory of Open Access Journals (Sweden)

    Roujian Lu

    Full Text Available BACKGROUND: In addition to SARS associated coronaviruses, 4 non-SARS related human coronaviruses (HCoVs are recognized as common respiratory pathogens. The etiology and clinical impact of HCoVs in Chinese adults with acute upper respiratory tract infection (URTI needs to be characterized systematically by molecular detection with excellent sensitivity. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we detected 4 non-SARS related HCoV species by real-time RT-PCR in 981 nasopharyngeal swabs collected from March 2009 to February 2011. All specimens were also tested for the presence of other common respiratory viruses and newly identified viruses, human metapneumovirus (hMPV and human bocavirus (HBoV. 157 of the 981 (16.0% nasopharyngeal swabs were positive for HCoVs. The species detected were 229E (96 cases, 9.8%, OC43 (42 cases, 4.3%, HKU1 (16 cases, 1.6% and NL63 (11 cases, 1.1%. HCoV-229E was circulated in 21 of the 24 months of surveillance. The detection rates for both OC43 and NL63 were showed significantly year-to-year variation between 2009/10 and 2010/11, respectively (P<0.001 and P = 0.003, and there was a higher detection frequency of HKU1 in patients aged over 60 years (P = 0.03. 48 of 157(30.57% HCoV positive patients were co-infected. Undifferentiated human rhinoviruses and influenza (Flu A were the most common viruses detected (more than 35% in HCoV co-infections. Respiratory syncytial virus (RSV, human parainfluenza virus (PIV and HBoV were detected in very low rate (less than 1% among adult patients with URTI. CONCLUSIONS/SIGNIFICANCE: All 4 non-SARS-associated HCoVs were more frequently detected by real-time RT-PCR assay in adults with URTI in Beijing and HCoV-229E led to the most prevalent infection. Our study also suggested that all non-SARS-associated HCoVs contribute significantly to URTI in adult patients in China.

  20. High-level expression of podoplanin in benign and malignant soft tissue tumors: immunohistochemical and quantitative real-time RT-PCR analysis.

    Science.gov (United States)

    Xu, Yongjun; Ogose, Akira; Kawashima, Hiroyuki; Hotta, Tetsuo; Ariizumi, Takashi; Li, Guidong; Umezu, Hajime; Endo, Naoto

    2011-03-01

    Podoplanin is a 38 kDa mucin-type transmembrane glycoprotein that was first identified in rat glomerular epithelial cells (podocytes). It is expressed in normal lymphatic endothelium, but is absent from vascular endothelial cells. D2-40 is a commercially available mouse monoclonal antibody which binds to an epitope on human podoplanin. D2-40 immunoreactivity is therefore highly sensitive and specific for lymphatic endothelium. Recent investigations have shown widespread applications of immunohistochemical staining with D2-40 in evaluating podoplanin expression as an immunohistochemical marker for diagnosis and prognosis in various tumors. To determine whether the podoplanin (D2-40) antibody may be useful for the diagnosis of soft tissue tumors, 125 cases, including 4 kinds of benign tumors, 15 kinds of malignant tumors and 3 kinds of tumor-like lesions were immunostained using the D2-40 antibody. Total RNA was extracted from frozen tumor tissue obtained from 41 corresponding soft tissue tumor patients and 12 kinds of soft tissue tumor cell lines. Quantitative real-time PCR reactions were performed. Immunohistochemical and quantitative real-time RT-PCR analyses demonstrated the expression of the podoplanin protein and mRNA in the majority of benign and malignant soft tissue tumors and tumor-like lesions examined, with the exception of alveolar soft part sarcoma, embryonal and alveolar rhabdomyosarcoma, extraskeletal Ewing's sarcoma/peripheral primitive neuro-ectodermal tumor and lipoma, which were completely negative for podoplanin. Since it is widely and highly expressed in nearly all kinds of soft tissue tumors, especially in spindle cell sarcoma, myxoid type soft tissue tumors and soft tissue tumors of the nervous system, podoplanin is considered to have little value in the differential diagnosis of soft tissue tumors.

  1. Validation of reference genes for gene expression analysis in olive (Olea europaea) mesocarp tissue by quantitative real-time RT-PCR

    Science.gov (United States)

    2014-01-01

    Background Gene expression analysis using quantitative reverse transcription PCR (qRT-PCR) is a robust method wherein the expression levels of target genes are normalised using internal control genes, known as reference genes, to derive changes in gene expression levels. Although reference genes have recently been suggested for olive tissues, combined/independent analysis on different cultivars has not yet been tested. Therefore, an assessment of reference genes was required to validate the recent findings and select stably expressed genes across different olive cultivars. Results A total of eight candidate reference genes [glyceraldehyde 3-phosphate dehydrogenase (GAPDH), serine/threonine-protein phosphatase catalytic subunit (PP2A), elongation factor 1 alpha (EF1-alpha), polyubiquitin (OUB2), aquaporin tonoplast intrinsic protein (TIP2), tubulin alpha (TUBA), 60S ribosomal protein L18-3 (60S RBP L18-3) and polypyrimidine tract-binding protein homolog 3 (PTB)] were chosen based on their stability in olive tissues as well as in other plants. Expression stability was examined by qRT-PCR across 12 biological samples, representing mesocarp tissues at various developmental stages in three different olive cultivars, Barnea, Frantoio and Picual, independently and together during the 2009 season with two software programs, GeNorm and BestKeeper. Both software packages identified GAPDH, EF1-alpha and PP2A as the three most stable reference genes across the three cultivars and in the cultivar, Barnea. GAPDH, EF1-alpha and 60S RBP L18-3 were found to be most stable reference genes in the cultivar Frantoio while 60S RBP L18-3, OUB2 and PP2A were found to be most stable reference genes in the cultivar Picual. Conclusions The analyses of expression stability of reference genes using qRT-PCR revealed that GAPDH, EF1-alpha, PP2A, 60S RBP L18-3 and OUB2 are suitable reference genes for expression analysis in developing Olea europaea mesocarp tissues, displaying the highest level

  2. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

    Science.gov (United States)

    Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

    2005-01-01

    Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

  3. Gene expression analysis of the rat testis after treatment with di(2-ethylhexyl) phthalate using cDNA microarray and real-time RT-PCR

    International Nuclear Information System (INIS)

    Kijima, Kazuyasu; Toyosawa, Kaoru; Yasuba, Masashi; Matsuoka, Nobuo; Adachi, Tetsuya; Komiyama, Masatoshi; Mori, Chisato

    2004-01-01

    To investigate the effects of di(2-ethylhexyl) phthalate (DEHP) on gene expression in rat testis, 6-week-old male Sprague-Dawley rats were given a single oral dose of 20 or 2000 mg/kg and euthanized 3, 6, 24, or 72 h thereafter. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive cells were significantly increased in the testis at 24 and 72 h after the exposure to 2000 mg/kg of DEHP. On cDNA microarray analysis, in addition to apoptosis-related genes, genes associated with atrophy, APEX nuclease, MutS homologue (E. coli), testosterone-repressed-prostatic-message-2 (TRPM-2), connective tissue growth factor, collagen alpha 2 type V, and cell adhesion kinase were differentially expressed. To investigate the relationship between histopathological alteration and gene expression, we selected genes associated with apoptosis and analyzed their expression by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR). With 20 mg/kg of DEHP treatment, bcl-2, key gene related to apoptosis, was increased. Up-regulation of bcl-2, inhibitor of Apaf-1/caspase-9/caspase-2 cascade of apoptosis, may be related to the fact that no morphological apoptotic change was induced after dosing of 20 mg/kg DEHP. With 2000 mg/kg of DEHP treatment, the apoptotic activator cascade, Fas/FasL, FADD/caspase-8/caspase-3 cascade, and Apaf-1/caspase-9/caspase-2 cascade were increased and bcl-2 was decreased. Thus, these gene regulations might lead the cells into apoptosis in the case of high exposure to DEHP. In contrast, FADD/caspase-10/caspase-6 cascade and caspase-11/caspase-3 cascade were not increased. These results indicate that the cascades of FADD/caspase-10/caspase-6 and caspase-11/caspase-3 are not related to apoptosis with DEHP treatment

  4. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    International Nuclear Information System (INIS)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues or cells under investigation

  5. Selection of housekeeping genes for normalization by real-time RT-PCR: analysis of Or-MYB1 gene expression in Orobanche ramosa development.

    Science.gov (United States)

    González-Verdejo, C I; Die, J V; Nadal, S; Jiménez-Marín, A; Moreno, M T; Román, B

    2008-08-15

    Real-time PCR has become the method of choice for accurate and in-depth expression studies of candidate genes. To avoid bias, real-time PCR is referred to one or several internal control genes that should not fluctuate among treatments. A need for reference genes in the parasitic plant Orobanche ramosa has emerged, and the studies in this area have not yet been evaluated. In this study, the genes 18S rRNA, Or-act1, Or-tub1, and Or-ubq1 were compared in terms of expression stability using the BestKeeper software program. Among the four common endogenous control genes, Or-act1 and Or-ubq1 were the most stable in O. ramosa samples. In parallel, a study was carried out studying the expression of the transcription factor Or-MYB1 that seemed to be implicated during preinfection stages. The normalization strategy presented here is a prerequisite to accurate real-time PCR expression profiling that, among other things, opens up the possibility of studying messenger RNA levels of low-copy-number-like transcription factors.

  6. Detection of EML4-ALK in lung adenocarcinoma using pleural effusion with FISH, IHC, and RT-PCR methods.

    Directory of Open Access Journals (Sweden)

    Leilei Liu

    Full Text Available Anaplastic lymphoma kinase (ALK and echinoderm microtubule-associated protein-like 4 (EML4 gene rearrangements occur in approximately 5% of non-small-cell lung cancers (NSCLC, leading to the overexpression of anaplastic lymphoma kinase and predicting a response to the targeted inhibitor, crizotinib. Malignant pleural effusion occurs in most patients with advanced lung cancer, especially adenocarcinoma, and tissue samples are not always available from these patients. We attempted to clarify the feasibility of detecting the EML4-ALK fusion gene in pleural effusion cells using different methods. We obtained 66 samples of pleural effusion from NSCLC patients. The pleural effusion fluid was centrifuged, and the cellular components obtained were formalin fixed and paraffin embedded. The EML4-ALK fusion gene status was determined with fluorescent in situ hybridization (FISH, reverse transcription-polymerase chain reaction (RT-PCR, and immunohistochemistry (IHC. EML4-ALK was detected in three of 66 patient samples (4.5% with RT-PCR. When the RT-PCR data were used as the standard, one false positive and one false negative samples were identified with IHC; and one false negative sample was identified with FISH. These results suggest that a block of pleural effusion cells can be used to detect the EML4-ALK fusion gene. IHC had good sensitivity, but low specificity. FISH had low sensitivity, but high specificity. RT-PCR is a good candidate method for detecting EML4-ALK in blocks of pleural effusion cells from lung cancer patients.

  7. Performance of a commercial assay for the diagnosis of influenza A (H1N1 infection in comparison to the Centers for Disease Control and Prevention protocol of real time RT-PCR

    Directory of Open Access Journals (Sweden)

    María G Barbás

    2012-03-01

    Full Text Available At the time of influenza A (H1N1 emergency, the WHO responded with remarkable speed by releasing guidelines and a protocol for a real-time RT-PCR assay (rRT-PCR. The aim of the present study was to evalúate the performance of the "Real Time Ready Influenza A/H1N1 Detection Set" (June 2009-Roche kit in comparison to the CDC reference rRT-PCR protocol. The overall sensitivity of the Roche assay for detection of the Inf A gene in the presence or absence of the H1 gene was 74.5 %. The sensitivity for detecting samples that were only positive for the Inf A gene (absence of the H1 gene was 53.3 % whereas the sensitivity for H1N1-positive samples (presence of the Inf A gene and any other swine gene was 76.4 %. The specificity of the assay was 97.1 %. A new version of the kit (November 2009 is now available, and a recent evaluation of its performance showed good sensitivity to detect pandemic H1N1 compared to other molecular assays.Durante la pandemia de influenza A (H1N1, la OMS recomendó algoritmos y protocolos de detección del virus mediante RT-PCR en tiempo real. El objetivo del presente estudio fue evaluar el desempeño del equipo que comercializa la empresa Roche, Real Time Ready Influenza A/H1N1 Detection Set (junio de 2009, en comparación con el protocolo de RT-PCR en tiempo real de los CDC. La sensibilidad global del ensayo de Roche para la detección del gen Inf A en presencia o ausencia del gen H1 fue 74,5 %. La sensibilidad para la detección de muestras positivas solo para el gen Inf A (ausencia del gen H1 fue 53,3 % y la sensibilidad para la detección de muestras positivas para H1N1 (presencia del gen Inf A y cualquier otro gen porcino fue 76,4 %. La especificidad fue 97,1 %. Existe una nueva versión del equipo (noviembre 2009 que, según se ha descrito, presenta buena sensibilidad en comparación con otros ensayos moleculares para detectar H1N1 pandémica.

  8. Real-time RT-PCR systems for CTC detection from blood samples of breast cancer and gynaecological tumour patients (Review).

    Science.gov (United States)

    Andergassen, Ulrich; Kölbl, Alexandra C; Mahner, Sven; Jeschke, Udo

    2016-04-01

    Cells, which detach from a primary epithelial tumour and migrate through lymphatic vessels and blood stream are called 'circulating tumour cells'. These cells are considered to be the main root of remote metastasis and are correlated to a worse prognosis concerning progression-free and overall survival of the patients. Therefore, the detection of the minimal residual disease is of great importance regarding therapeutic decisions. Many different detection strategies are already available, but only one method, the CellSearch® system, reached FDA approval. The present review focusses on the detection of circulating tumour cells by means of real-time PCR, a highly sensitive method based on differences in gene expression between normal and malignant cells. Strategies for an enrichment of tumour cells are mentioned, as well as a large panel of potential marker genes. Drawbacks and advantages of the technique are elucidated, whereas, the greatest advantage might be, that by selection of appropriate marker genes, also tumour cells, which have already undergone epithelial to mesenchymal transition can be detected. Finally, the application of real-time PCR in different gynaecological malignancies is described, with breast cancer being the most studied cancer entity.

  9. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East.

    Science.gov (United States)

    Reid, Scott M; Mioulet, Valerie; Knowles, Nick J; Shirazi, Nazeem; Belsham, Graham J; King, Donald P

    2014-10-01

    Rapid and accurate diagnosis is essential for effective control of foot-and-mouth disease (FMD). In countries where FMD is endemic, identification of the serotypes of the causative virus strains is important for vaccine selection and tracing the source of outbreaks. In this study, real-time reverse transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative field samples of serotype O strains belonging exclusively to the PanAsia-2 lineage, serotype A strains of the Iran-05 lineage and serotype Asia-1 viruses from three relevant sub-groups. When RNA extracted from archival and contemporary field strains was tested using one- or two-step rRT-PCR assays, all three primer/probe sets detected the RNA from homotypic viruses and no cross-reactivity was observed with heterotypic viruses. Similar results were obtained using both single- and multiplex assay formats. Using plasmid standards, the minimum detection level of these tests was found to be lower than two copies. The results illustrate the potential of tailored rRT-PCR tools for the detection and categorization of viruses circulating in the Middle East belonging to distinct subgroups of serotypes O, A and Asia-1. These assays can also overcome the problem of serotyping samples which are found positive by the generic rRT-PCR diagnostic assays but negative by virus isolation and antigen-detection ELISA which would otherwise have to be serotyped by nucleotide sequencing. A similar approach could be used to develop serotyping assays for FMDV strains circulating in other regions of the world. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  10. Real Time RT-PCR with a Newly Designed Set of Promers Confirmed the Presence of 2b and 2x/d Myosim Heavy Chain mRNAs in the Rat Slow Soleus Muscle

    Czech Academy of Sciences Publication Activity Database

    Žurmanová, Jitka; Půta, F.; Stopková, R.; Soukup, Tomáš

    2008-01-01

    Roč. 57, č. 6 (2008), s. 973-978 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LC554; GA ČR(CZ) GA305/06/1115; GA ČR(CZ) GA304/08/0256 Grant - others:EC(XE) LSH-CT-2004-511978 Institutional research plan: CEZ:AV0Z50110509 Keywords : rat slow soleus muscle * myosin heavy chain isoforms * real time RT-PCR Subject RIV: ED - Physiology Impact factor: 1.653, year: 2008

  11. Selection of reference genes for normalisation of real-time RT-PCR in brain-stem death injury in Ovis aries

    Directory of Open Access Journals (Sweden)

    Fraser John F

    2009-07-01

    Full Text Available Abstract Background Heart and lung transplantation is frequently the only therapeutic option for patients with end stage cardio respiratory disease. Organ donation post brain stem death (BSD is a pre-requisite, yet BSD itself causes such severe damage that many organs offered for donation are unusable, with lung being the organ most affected by BSD. In Australia and New Zealand, less than 50% of lungs offered for donation post BSD are suitable for transplantation, as compared with over 90% of kidneys, resulting in patients dying for lack of suitable lungs. Our group has developed a novel 24 h sheep BSD model to mimic the physiological milieu of the typical human organ donor. Characterisation of the gene expression changes associated with BSD is critical and will assist in determining the aetiology of lung damage post BSD. Real-time PCR is a highly sensitive method involving multiple steps from extraction to processing RNA so the choice of housekeeping genes is important in obtaining reliable results. Little information however, is available on the expression stability of reference genes in the sheep pulmonary artery and lung. We aimed to establish a set of stably expressed reference genes for use as a standard for analysis of gene expression changes in BSD. Results We evaluated the expression stability of 6 candidate normalisation genes (ACTB, GAPDH, HGPRT, PGK1, PPIA and RPLP0 using real time quantitative PCR. There was a wide range of Ct-values within each tissue for pulmonary artery (15–24 and lung (16–25 but the expression pattern for each gene was similar across the two tissues. After geNorm analysis, ACTB and PPIA were shown to be the most stably expressed in the pulmonary artery and ACTB and PGK1 in the lung tissue of BSD sheep. Conclusion Accurate normalisation is critical in obtaining reliable and reproducible results in gene expression studies. This study demonstrates tissue associated variability in the selection of these

  12. Circadian transitions in radiation dose-dependent augmentation of mRNA levels for DNA damage-induced genes elicited by accurate real-time RT-PCR quantification

    International Nuclear Information System (INIS)

    Ishihara, Hiroshi; Tanaka, Izumi; Yakumaru, Haruko

    2010-01-01

    Molecular mechanisms of intracellular response after DNA-damage by exposure to ionizing radiation have been studied. In the case of cells isolated from living body of human and experimental animals, alteration of the responsiveness by physiological oscillation such as circadian rhythm must be considered. To examine the circadian variation in the response of p53-responsible genes p21, mdm2, bax, and puma, we established a method to quantitate their mRNA levels with high reproducibility and accuracy based on real-time reverse transcription polymerase chain reaction (RT-PCR) and compared the levels of responsiveness in mouse hemocytes after diurnal irradiation to that after nocturnal irradiation. Augmentations of p21 and mdm2 mRNA levels with growth-arrest and of puma mRNA before apoptosis were confirmed by time-course experiment in RAW264.7, and dose-dependent increases in the peak levels of all the RNA were shown. Similarly, the relative RNA levels of p21, mdm2, bax, and puma per glyceraldehyde-3-phosphate dehydrogenase (GAPDH) also increased dose-dependently in peripheral blood and bone marrow cells isolated from whole-body-irradiated mice. Induction levels of all messages reduced by half after nighttime irradiation as compared with daytime irradiation in blood cells. In marrow cells, nighttime irradiation enhanced the p21 and mdm2 mRNA levels than daytime irradiation. No significant difference in bax or puma mRNA levels was observed between nighttime and daytime irradiation in marrow cells. This suggests that early-stage cellular responsiveness in DNA damage-induced genes is modulated between diurnal and nocturnal irradiation. (author)

  13. Development of an in situ magnetic beads based RT-PCR method for electrochemiluminescent detection of rotavirus

    Science.gov (United States)

    Zhan, Fangfang; Zhou, Xiaoming

    2012-12-01

    Rotaviruses are double-stranded RNA viruses belonging to the family of enteric pathogens. It is a major cause of diarrhoeal disease in infants and young children worldwide. Consequently, rapid and accurate detection of rotaviruses is of great importance in controlling and preventing food- and waterborne diseases and outbreaks. Reverse transcription-polymerase chain reaction (RT-PCR) is a reliable method that possesses high specificity and sensitivity. It has been widely used to detection of viruses. Electrochemiluminescence (ECL) can be considered as an important and powerful tool in analytical and clinical application with high sensitivity, excellent specificity, and low cost. Here we have developed a method for the detection of rotavirus by combining in situ magnetic beads (MBs) based RT-PCR with ECL. RT of rotavirus RNA was carried out in a traditional way and the resulting cDNA was directly amplified on MBs. Forward primers were covalently bounded to MBs and reverse primers were labeled with tris-(2, 2'-bipyridyl) ruthenium (TBR). During the PCR cycling, the TBR labeled products were directly loaded and enriched on the surface of MBs. Then the MBs-TBR complexes could be analyzed by a magnetic ECL platform without any post-modification or post-incubation which avoid some laborious manual operations and achieve rapid yet sensitive detection. In this study, rotavirus from fecal specimens was successfully detected within 2 h, and the limit of detection was estimated to be 104copies/μL. This novel in situ MBs based RT-PCR with ECL detection method can be used for pathogen detection in food safety field and clinical diagnosis.

  14. Evaluation of the Xpert Flu test and comparison with in-house real-time RT-PCR assays for detection of influenza virus from 2008 to 2011 in Marseille, France.

    Science.gov (United States)

    Salez, N; Ninove, L; Thirion, L; Gazin, C; Zandotti, C; de Lamballerie, X; Charrel, R N

    2012-04-01

    Rapid documentation of respiratory specimens can have an impact on the management of patients and their relatives in terms of preventive and curative measures. We compared the results of the Xpert(®) Flu assay (Cepheid) with three real-time RT-PCR assays using 127 nasopharyngeal samples, of which 75 were positive for influenza A (with 52 identified as A/H1N1-2009) and 52 were positive for influenza B. The Xpert(®) Flu assay presented a quasi-absence of non-interpretable tests, and showed sensitivity and specificity of 100% and 100% for Flu A, 98.4% and 100% for A/H1N1-2009, and 80.7% and 100% for Flu B. © 2012 The Authors. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.

  15. [Validation of a real time RT-PCR assay to detect foot-and-mouth disease virus and assessment of its performance in acute infection].

    Science.gov (United States)

    Fondevila, Norberto; Compaired, Diego; Maradei, Eduardo; Duffy, Sergio

    2014-01-01

    A specific real time reverse transcription polymerase chain reaction (RT-PCRrt) for the detection of foot-and-mouth disease virus was validated using the LightCycler thermocycler 2.0 and its reagents as recommended by the World Organization for Animal Health and was assessed for the detection of the virus in acute infection of cattle experimentally vaccinated and challenged with virus A Argentina/2001 or A24 Cruzeiro. The technique proved to be robust, showing coefficients of variation lower than 4% for different ARN extractions, days or repetitions and was able to detect up to 0,4 TCID 50%, and/or up to 100 RNA molecules. In probang samples, diagnostic sensitivity was 93.1 (95% CI 86.5-96.6) and diagnostic specificity 100 (95% CI 96.3-100). The results of the challenge in vaccinated or multivaccinated bovines showed that although there were high levels of clinical protection in the vaccinated group, FMDV could be detected in all challenged groups. However, detection was 100 times lower in immunized animals. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

  16. Validation of a norovirus multiplex real-time RT-PCR assay for the detection of norovirus GI and GII from faeces samples.

    LENUS (Irish Health Repository)

    Jones, S

    2011-01-01

    Norovirus is a leading cause of infectious non-bacterial gastroenteritis. The virus is highly contagious and has multiple modes of transmission, presenting a growing challenge to hospital-based healthcare. In this study, a total of 120 stool samples are tested for the presence of norovirus GI and GII by the Roche two-step Lightcycler 2.0 assay incorporating primers and probes produced by TIB Molbiol, and the results are compared with results from the National Virus Reference Laboratory. The Roche\\/TIB Molbiol assay produced 51 positive results and 69 negative results. Discrepancy analysis was performed for six conflicting results using a second real-time polymerase chain reaction (PCR) assay (Roche\\/TIB Molbiol) and this confirmed that four of the five discrepant positive results were true positives. A single discrepant negative result generated by the Roche assay remained negative using the second assay. Sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) were calculated to be 98%, 98.6%, 98.0% and 98.6%, respectively. Melting curve analysis was used to differentiate genogroups I and II and this showed that 92% of strains belonged to genogroup II.

  17. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Directory of Open Access Journals (Sweden)

    Shiyin Zhang

    Full Text Available The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD, which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71 and coxsackie A16 (CA16 are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  18. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Science.gov (United States)

    Zhang, Shiyin; Wang, Jin; Yan, Qiang; He, Shuizhen; Zhou, Wenbin; Ge, Shengxiang; Xia, Ningshao

    2014-01-01

    The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD), which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71) and coxsackie A16 (CA16) are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs) in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  19. Accuracy of rapid influenza diagnostic test and immunofluorescence assay compared to real time RT-PCR in children with influenza A(H1N1pdm09 infection 

    Directory of Open Access Journals (Sweden)

    Aneta Nitsch-Osuch

    2012-10-01

    Full Text Available  Introduction:The influenza burden among children is underestimated. The aim of our study was to estimate the accuracy of the rapid influenza detection test (RIDT BD Directigen™ EZ Flu A B® and direct immunofluorescence assay (DFA used among children with influenza-like illness (ILI consulted in the ambulatory care clinic.Material/Methods:A total of 150 patients were enrolled in the study. Inclusion criteria were: age less than 59 months, presentation of ILI according to the CDC (Centers for Disease Control and Prevention definition (fever >37.8°C, cough and/or sore throat in the absence of another known cause of illness, duration of symptoms shorter than 96 hours. Two nasal swabs and one pharyngeal swab were obtained from patients and tested by RIDT, DFA and real time RT-PCR as the reference method.Results:For influenza A (H1N1pdm09 virus sensitivity of RIDT was 62.2�0(95�0CI 46.5–76.2� specificity 97.1�0(95�0CI 91.8–99.4� PPV 90.3�0(95�0CI 74.3–98� NPV 85.7�0(95�0CI 78.1–91.5� for DFA sensitivity was 60�0(95�0CI 51.9–63.2� specificity 96�0(95�0CI 88.7–98.8� PPV 93.1�0(95�0CI 80.5–98� NPV 72.7�0(95�0CI 67.2–74.9� Analysis of logistic regression revealed that the chance of receiving a true positive result of RIDT was twice as high when the test was conducted during the first 48 hours of symptoms (OR 0.40 vs OR 0.22.Conclusions:The accuracy of RIDT is comparable with DFA and both methods are very specific but moderately sensitive in diagnosis of influenza in young children. Both methods may be recommended for screening for influenza among children.

  20. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data

    Directory of Open Access Journals (Sweden)

    Alves-Ferreira Marcio

    2010-03-01

    Full Text Available Abstract Background Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR. Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. Results By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1α5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhβTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. Conclusion We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references

  1. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data.

    Science.gov (United States)

    Artico, Sinara; Nardeli, Sarah M; Brilhante, Osmundo; Grossi-de-Sa, Maria Fátima; Alves-Ferreira, Marcio

    2010-03-21

    Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR). Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1alpha5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhbetaTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references for normalization of gene expression measures in

  2. Virus isolation vs RT-PCR: which method is more successful in detecting VHSV and IHNV in fish tissue sampled under field conditions?

    DEFF Research Database (Denmark)

    Knüsel, R.; Bergmann, S. M.; Einer-Jensen, Katja

    2007-01-01

    in Switzerland. Compared to SPNT, the RT-PCR method detected, as with virus isolation, a much lower number of positive cases; reasons for this discrepancy are discussed. Our results indicate that RT-PCR can not only be successfully applied in field surveys, but may also be slightly more sensitive than virus......This study compared the results of reverse transcription-polymerase chain reaction (RT-PCR) and traditional virus isolation on cell culture in detection of viral haemorrhagic septicaemia virus (VHSV) and infectious haematopoietic necrosis virus (IHNV). RT-PCR was used for 172 tissue sample pools...... (total of 859 fish) originating from a field survey on the occurrence of VHSV and IHNV in farmed and wild salmonids in Switzerland. These samples represented all sites with fish that were either identified as virus-positive by means of virus isolation (three sites, four positive tissue sample pools) and...

  3. Transcript Quantification of Genes Involved in Steviol Glycoside Biosynthesis in Stevia rebaudiana Bertoni by Real-Time Polymerase Chain Reaction (RT-PCR).

    Science.gov (United States)

    Modi, Arpan; Kumar, Nitish; Narayanan, Subhash

    2016-01-01

    Stevia (Stevia rebaudiana Bertoni) is a medicinal plant having sweet, diterpenoid glycosides known as steviol glycosides which are 200-300 times sweeter than sucrose (0.4 % solution). They are synthesized mainly in the leaves via plastid localized 2-C-methyl-D-erythrose-4-phosphate pathway (MEP pathway). Fifteen genes are involved in the formation of these glycosides. In the present protocol, a method for the quantification of transcripts of these genes is shown. The work involves RNA extraction and cDNA preparation, and therefore, procedures for the confirmation of DNA-free cDNA preparation have also been illustrated. Moreover, details of plant treatments are not mentioned as this protocol may apply to relative gene expression profile in any medicinal plant with any treatment. The treatments are numbered as T0 (Control), T1, T2, T3, and T4.

  4. Real-time RT-PCR expression analysis of chitinase and endoglucanase genes in the three-way interaction between the biocontrol strain Clonostachys rosea IK726, Botrytis cinera and strawberry

    DEFF Research Database (Denmark)

    Mamarabadi, Mojtaba; Jensen, Birgit; Jensen, Søren Dan Funck

    2008-01-01

    Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two endoglucan......Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two...... endoglucanase genes from C. rosea strain IK726 was analyzed using real-time RT-PCR in vitro and in strawberry leaves during interaction with B. cinerea. Specific primers were designed for ß-tubulin genes from C. rosea and B. cinerea, respectively, and a gene encoding a DNA-binding protein (DBP) from strawberry......, allowing in situ activity assessment of each fungus in vitro and during their interaction on strawberry leaves. Growth of B. cinerea was inhibited in all pathogen-antagonist interactions while the activity of IK726 was slightly increased. In all in vitro interactions, four of the six genes were upregulated...

  5. Evaluation of NGS and RT-PCR methods for ALK rearrangement in European NSCLC patients

    DEFF Research Database (Denmark)

    Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota

    2018-01-01

    INTRODUCTION: The reported prevalence of ALK rearrangement in NSCLC ranges from 2%-7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proven to be a reproducible and sensitive technique. Reverse transcriptase...

  6. AN INTEGRATED CELL CULTURE/RT-PCR METHOD FOR DETECTING ENTEROVIRUS IN WATER

    Science.gov (United States)

    Echovirus and coxsackievirus can cause mild to severe disease following consumption of contaminated drinking water. However, comprehensive occurrence studies of enteroviruses in drinking water matrices are limited, in part because of the lack of available methods that are rapid, ...

  7. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  8. Development of an In-House Multiplex Nested RT-PCR Method for Detecting Acute HIV-1 Infection in High Risk Populations.

    Science.gov (United States)

    Liu, Zhiying; Li, Wei; Xu, Meng; Sheng, Bo; Yang, Zixuan; Jiao, Yanmei; Zhang, Tong; Mou, Danlei; Chen, Dexi; Wu, Hao

    2015-01-01

    The detection of acute HIV infection (AHI) among high risk populations can help reduce secondary transmission of HIV. The nucleic acid testing (NAT) can shorten the test window period by up to 7-12 days. In this study, we describe an in-house NAT based on the multiplex nested RT-PCR method to detect the HIV RNA. We also evaluated it in a high risk cohort in Beijing. Four primer pairs were designed and evaluated for the detection of different HIV-1 subtypes in group M. Multiplex RT-PCR and nested PCR were performed. The sensitivity, specialty, primers compatibility among HIV subtypes were evaluated simultaneously. In an MSM cohort in Beijing during a 3-year period, a total of 11,808 blood samples that were negative by ELISA or indeterminate by Western blot were analyzed by this multiplex nested RT-PCR with pooling strategy. The multiplex nested RT-PCR was successfully applied for the detection of at least six HIV-1 subtypes. The sensitivity was 40 copies/ml and the specificity was 100%. A total of 29 people were tested HIV-1 positive with acute infection in a MSM cohort of Beijing during a 3 years period. This multiplex nested RT-PCR provides a useful tool for the rapid detection of acute HIV-1 infection. When used in combination with the 3(rd) generation ELISA, it can improve the detection rate of HIV infection, especially in the source limited regions.

  9. Comparative evaluation of the CerTest VIASURE flu A, B & RSV real time RT-PCR detection kit on the BD MAX system versus a routine in-house assay for detection of influenza A and B virus during the 2016/17 influenza season

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Bek-Thomsen, Malene; Andersen, Signe Dalsgaard

    2018-01-01

    laboratory technician "hands on" time but also the laboratory turnaround time is of interest. OBJECTIVES: We evaluated the performance of the VIASURE Flu A, B & RSV Real Time RT-PCR Detection Kit (CerTest Biotec) for detecting Influenza A and B viruses. STUDY DESIGN: During the 2016/17 influenza season 532...

  10. Evaluation of NGS and RT-PCR Methods for ALK Rearrangement in European NSCLC Patients: Results from the European Thoracic Oncology Platform Lungscape Project.

    Science.gov (United States)

    Letovanec, Igor; Finn, Stephen; Zygoura, Panagiota; Smyth, Paul; Soltermann, Alex; Bubendorf, Lukas; Speel, Ernst-Jan; Marchetti, Antonio; Nonaka, Daisuke; Monkhorst, Kim; Hager, Henrik; Martorell, Miguel; Sejda, Aleksandra; Cheney, Richard; Hernandez-Losa, Javier; Verbeken, Eric; Weder, Walter; Savic, Spasenija; Di Lorito, Alessia; Navarro, Atilio; Felip, Enriqueta; Warth, Arne; Baas, Paul; Meldgaard, Peter; Blackhall, Fiona; Dingemans, Anne-Marie; Dienemann, Hendrik; Dziadziuszko, Rafal; Vansteenkiste, Johan; O'Brien, Cathal; Geiger, Thomas; Sherlock, Jon; Schageman, Jeoffrey; Dafni, Urania; Kammler, Roswitha; Kerr, Keith; Thunnissen, Erik; Stahel, Rolf; Peters, Solange

    2018-03-01

    The reported prevalence of ALK receptor tyrosine kinase gene (ALK) rearrangement in NSCLC ranges from 2% to 7%. The primary standard diagnostic method is fluorescence in situ hybridization (FISH). Recently, immunohistochemistry (IHC) has also proved to be a reproducible and sensitive technique. Reverse-transcriptase polymerase chain reaction (RT-PCR) has also been advocated, and most recently, the advent of targeted next-generation sequencing (NGS) for ALK and other fusions has become possible. This study compares anaplastic lymphoma kinase (ALK) evaluation with all four techniques in resected NSCLC from the large European Thoracic Oncology Platform Lungscape cohort. A total of 96 cases from the European Thoracic Oncology Platform Lungscape iBiobank, with any ALK immunoreactivity were examined by FISH, central RT-PCR, and NGS. An H-score higher than 120 defines IHC positivity. RNA was extracted from the same formalin-fixed, paraffin-embedded tissues. For RT-PCR, primers covered the most frequent ALK translocations. For NGS, the Oncomine Solid Tumour Fusion Transcript Kit (Thermo Fisher Scientific, Waltham, MA) was used. The concordance was assessed using the Cohen κ coefficient (two-sided α ≤ 5%). NGS provided results for 77 of the 95 cases tested (81.1%), whereas RT-PCR provided results for 77 of 96 (80.2%). Concordance occurred in 55 cases of the 60 cases tested with all four methods (43 ALK negative and 12 ALK positive). Using ALK copositivity for IHC and FISH as the criterion standard, we derived a sensitivity for RT-PCR/NGS of 70.0%/85.0%, with a specificity of 87.1%/79.0%. When either RT-PCR or NGS was combined with IHC, the sensitivity remained the same, whereas the specificity increased to 88.7% and 83.9% respectively. NGS evaluation with the Oncomine Solid Tumour Fusion transcript kit and RT-PCR proved to have high sensitivity and specificity, advocating their use in routine practice. For maximal sensitivity and specificity, ALK status should be

  11. Monitoring and improving the sensitivity of dengue nested RT-PCR used in longitudinal surveillance in Thailand.

    Science.gov (United States)

    Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan

    2015-02-01

    AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.

  12. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East

    DEFF Research Database (Denmark)

    Reid, Scott M.; Mioulet, Valerie; Knowles, Nick J.

    2014-01-01

    transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative...... by the generic rRT-PCR diagnostic assays but negative by virus isolation and antigen-detection ELISA which would otherwise have to be serotyped by nucleotide sequencing. A similar approach could be used to develop serotyping assays for FMDV strains circulating in other regions of the world....

  13. Study of the Efficacy of Real Time-PCR Method for Amikacin Determination Using Microbial Assay

    Directory of Open Access Journals (Sweden)

    Farzaneh Lotfipour

    2015-06-01

    Full Text Available Purpose: Microbial assay is used to determine the potency of antibiotics and vitamins. In spite of its advantages like simplicity and easiness, and to reveal the slight changes in the molecules, the microbial assay suffers from significant limitations; these methods are of lower specificity, accuracy and sensitivity. The objective of the present study is to evaluate the efficacy of real time-PCR technique in comparison with turbidimetric method for microbial assay of amikacin. Methods: Microbial determination of amikacin by turbidimetric method was performed according to USP. Also amikacin concentrations were determined by microbial assay using taq-man quantitative PCR method. Standard curves in different concentration for both methods were plotted and method validation parameters of linearity, precision and accuracy were calculated using statistical procedures. Results: The RT-PCR method was linear in the wider concentration range (5.12 – 38.08 for RT-PCR versus 8.00 – 30.47 for turbidimetric method with a better correlation coefficient (0.976 for RT-PCR versus 0.958 for turbidimetric method. RT-PCR method with LOQ of 5.12 ng/ml was more sensitive than turbidimetric method with LOQ of 8.00 ng/ml and the former could detect and quantify low concentrations of amikacin. The results of accuracy and precision evaluation showed that the RT-PCR method was accurate and precise in all of the tested concentration. Conclusion: The RT-PCR method described here provided an accurate and precise technique for measurement of amikacin potency and it can be a candidate for microbial determination of the antibiotics with the same test organism.

  14. Comparison of IHC, FISH and RT-PCR methods for detection of ALK rearrangements in 312 non-small cell lung cancer patients in Taiwan.

    Directory of Open Access Journals (Sweden)

    Yi-Cheng Wu

    Full Text Available BACKGROUND: Recently Echinoderm microtubule-associated protein-like 4- anaplastic lymphoma kinase (EML4-ALK fusion gene has become an important biomarker for ALK tyrosine kinase inhibitor (crizotinib treatment in NSCLC. However, the best detection method and the significance of EML4-ALK variant types remain uncertain. METHODS: Reverse transcriptase-polymerase chain reaction (RT-PCR, fluorescence in Situ hybridization (FISH and Immunohistochemical (IHC stain were performed on tumor tissues of 312 NSCLC patients for detection of ALK rearrangements. Mutation analyses for EGFR and KRAS genes were also performed. RESULTS: Thirteen of the 312 patients (4.17% had ALK rearrangements detected by RT-PCR. If RT-PCR data was used as the gold standard, FISH tests had a low sensitivity (58.33%, but very good specificity (99.32%. IHC stain had better sensitivity (91.67% than FISH, but lower specificity (79.52%, when the cut off was IHC2+. All of the 8 patients with high abundance of EML4-ALK positive cells in tumor tissues (assessed by the signal intensities of the RT-PCR product, were also have high expression of ALK protein (IHC3+, and positive for FISH, except one failed in FISH. Variants 3a+3b (4/5, 80% of EML4-ALK fusion gene were more common to have high abundance of EML4-ALK positive cells in tumor tissues than variant 1 (1/3, 33.3%. Meta-analysis of the published data of 2273 NSCLC patients revealed that variant 3 (23/44, 52.3% was the most common type in Chinese population, while variant 1 (28/37, 75.7% was most common in Caucasian. CONCLUSIONS: Among the three detection methods, RT-PCR could detect not only the presence of EML4-ALK fusion gene and their variant types, but also the abundance of EML4-ALK positive cells in NSCLC tumor tissues. The latter two factors might affect the treatment response to anti-ALK inhibitor. Including RT-PCR as a diagnostic test for ALK inhibitor treatment in the prospective clinical trials is recommended.

  15. Comparison of IHC, FISH and RT-PCR methods for detection of ALK rearrangements in 312 non-small cell lung cancer patients in Taiwan.

    Science.gov (United States)

    Wu, Yi-Cheng; Chang, Il-Chi; Wang, Chi-Liang; Chen, Tai-Di; Chen, Ya-Ting; Liu, Hui-Ping; Chu, Yen; Chiu, Yu-Ting; Wu, Tzu-Hua; Chou, Li-Hui; Chen, Yi-Rong; Huang, Shiu-Feng

    2013-01-01

    Recently Echinoderm microtubule-associated protein-like 4- anaplastic lymphoma kinase (EML4-ALK) fusion gene has become an important biomarker for ALK tyrosine kinase inhibitor (crizotinib) treatment in NSCLC. However, the best detection method and the significance of EML4-ALK variant types remain uncertain. Reverse transcriptase-polymerase chain reaction (RT-PCR), fluorescence in Situ hybridization (FISH) and Immunohistochemical (IHC) stain were performed on tumor tissues of 312 NSCLC patients for detection of ALK rearrangements. Mutation analyses for EGFR and KRAS genes were also performed. Thirteen of the 312 patients (4.17%) had ALK rearrangements detected by RT-PCR. If RT-PCR data was used as the gold standard, FISH tests had a low sensitivity (58.33%), but very good specificity (99.32%). IHC stain had better sensitivity (91.67%) than FISH, but lower specificity (79.52%), when the cut off was IHC2+. All of the 8 patients with high abundance of EML4-ALK positive cells in tumor tissues (assessed by the signal intensities of the RT-PCR product), were also have high expression of ALK protein (IHC3+), and positive for FISH, except one failed in FISH. Variants 3a+3b (4/5, 80%) of EML4-ALK fusion gene were more common to have high abundance of EML4-ALK positive cells in tumor tissues than variant 1 (1/3, 33.3%). Meta-analysis of the published data of 2273 NSCLC patients revealed that variant 3 (23/44, 52.3%) was the most common type in Chinese population, while variant 1 (28/37, 75.7%) was most common in Caucasian. Among the three detection methods, RT-PCR could detect not only the presence of EML4-ALK fusion gene and their variant types, but also the abundance of EML4-ALK positive cells in NSCLC tumor tissues. The latter two factors might affect the treatment response to anti-ALK inhibitor. Including RT-PCR as a diagnostic test for ALK inhibitor treatment in the prospective clinical trials is recommended.

  16. Development of Real-Time PCR Methods for the Detection of Bacterial Meningitis Pathogens without DNA Extraction.

    Directory of Open Access Journals (Sweden)

    Jeni Vuong

    Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.

  17. A rapid silica spin column-based method of RNA extraction from fruit trees for RT-PCR detection of viruses.

    Science.gov (United States)

    Yang, Fan; Wang, Guoping; Xu, Wenxing; Hong, Ni

    2017-09-01

    Efficient recovery of high quality RNA is very important for successful RT-PCR detection of plant RNA viruses. High levels of polyphenols and polysaccharides in plant tissues can irreversibly bind to and/or co-precipitate with RNA, which influences RNA isolation. In this study, a silica spin column-based RNA isolation method was developed by using commercially available silica columns combined with the application of a tissue lysis solution, and binding and washing buffers with high concentration guanidinium thiocyanate (GuSCN, 50% w/v), which helps remove plant proteins, polysaccharides and polyphenolic compounds. The method was successfully used to extract high quality RNA from citrus (Citrus aurantifolia), grapevine (Vitis vinifera), peach (Prunus persica), pear (Pyrus spp.), taro (Colocosia esculenta) and tobacco (Nicotiana benthamiana) samples. The method was comparable to conventional CTAB method in RNA isolation efficiency, but it was more sample-adaptable and cost-effective than commercial kits. High quality RNA isolated using silica spin column-based method was successfully used for the RT-PCR and/or multiplex RT-PCR amplification of woody fruit tree viruses and a viroid. The study provided a useful tool for the detection and characterization of plant viruses. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. A rapid method of accurate detection and differentiation of Newcastle disease virus pathotypes by demonstrating multiple bands in degenerate primer based nested RT-PCR.

    Science.gov (United States)

    Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K

    2015-02-01

    A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Establishment and in-house validation of stem-loop RT PCR method for MicroRNA398 expression analysis

    Directory of Open Access Journals (Sweden)

    Timotijević Gordana S.

    2015-01-01

    Full Text Available MicroRNAs (miRNAs belong to the class of small non-coding RNAs which have important roles throughout development as well as in plant response to diverse environmental stresses. Some of plant miRNAs are essential for regulation and maintenance of nutritive homeostasis when nutrients are in excess or shortage comparing to optimal concentration for certain plant species. Better understanding of miRNAs functions implies development of efficient technology for profiling their gene expression. We set out to establish validate the methodology for miRNA gene expression analysis in cucumber grown under suboptimal mineral nutrient regimes, including iron deficiency. Reverse transcription by “stem-loop” primers in combination with Real time PCR method is one of potential approaches for quantification of miRNA gene expression. In this paper we presented a method for “stem loop” primer design specific for miR398, as well as reaction optimization and determination of Real time PCR efficiency. Proving the accuracy of this method was imperative as “stem loop” RT which consider separate transcription of target and endogenous control. The method was verified by comparison of the obtained data with results of miR398 expression achieved using a commercial kit based on simultaneous conversion of all RNAs in cDNAs. [Projekat Ministarstva nauke Republike Srbije, br. 173005 i br. ON-173028

  20. A quantitative method to evaluate mesenchymal stem cell lipofection using real-time PCR.

    Science.gov (United States)

    Ribeiro, S C; Mendes, R; Madeira, C; Monteiro, G A; da Silva, C L; Cabral, J M S

    2010-01-01

    Genetic modification of human mesenchymal stem cells (MSC) is a powerful tool to improve the therapeutic utility of these cells and to increase the knowledge on their regulation mechanisms. In this context, strong efforts have been made recently to develop efficient nonviral gene delivery systems. Although several studies addressed this question most of them use the end product of a reporter gene instead of the DNA uptake quantification to test the transfection efficiency. In this study, we established a method based on quantitative real-time PCR (RT-PCR) to determine the intracellular plasmid DNA copy number in human MSC after lipofection. The procedure requires neither specific cell lysis nor DNA purification. The influence of cell number on the RT-PCR sensitivity was evaluated. The method showed good reproducibility, high sensitivity, and a wide linear range of 75-2.5 x 10⁶ plasmid DNA copies per cell. RT-PCR results were then compared with the percentage of transfected cells assessed by flow cytometry analysis, which showed that flow cytometry-based results are not always proportional to plasmid cellular uptake determined by RT-PCR. This work contributed for the establishment of a rapid quantitative assay to determine intracellular plasmid DNA in stem cells, which will be extremely beneficial for the optimization of gene delivery strategies. © 2010 American Institute of Chemical Engineers

  1. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    Science.gov (United States)

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Development and evaluation of a real-time RT-PCR assay for the detection of Ebola virus (Zaire) during an Ebola outbreak in Guinea in 2014-2015.

    Science.gov (United States)

    Dedkov, V G; Magassouba, N' F; Safonova, M V; Deviatkin, A A; Dolgova, A S; Pyankov, O V; Sergeev, A A; Utkin, D V; Odinokov, G N; Safronov, V A; Agafonov, A P; Maleev, V V; Shipulin, G A

    2016-02-01

    In early February 2014, an outbreak of the Ebola virus disease caused by Zaire ebolavirus (EBOV) occurred in Guinea; cases were also recorded in other West African countries with a combined population of approximately 25 million. A rapid, sensitive and inexpensive method for detecting EBOV is needed to effectively control such outbreak. Here, we report a real-time reverse-transcription PCR assay for Z. ebolavirus detection used by the Specialized Anti-epidemic Team of the Russian Federation during the Ebola virus disease prevention mission in the Republic of Guinea. The analytical sensitivity of the assay is 5 × 10(2) viral particles per ml, and high specificity is demonstrated using representative sampling of viral, bacterial and human nucleic acids. This assay can be applied successfully for detecting the West African strains of Z. ebolavirus as well as on strains isolated in the Democratic Republic of the Congo in 2014. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Relative quantification of PIK3CA gene expression level in fine-needle aspiration biopsy thyroid specimens collected from patients with papillary thyroid carcinoma and non-toxic goitre by real-time RT-PCR

    Directory of Open Access Journals (Sweden)

    Wojciechowska-Durczyńska Katarzyna

    2010-08-01

    Full Text Available Abstract Background Recent studies have shown that the phosphatidylinositol 3-kinase (PI3K signaling pathway is important regulator of many cellular events, including apoptosis, proliferation and motility. PI3K pathway alterations (PIK3CA gene mutations and/or amplification have been observed in various human tumours. In the majority of diagnosed cases, mutations are localized in one of the three "hot spots" in the gene, responsible for coding catalytic subunit α of class I PI3K (PIK3CA. Mutations and amplification of PIK3CA gene are characteristic for thyroid cancer, as well. Methods The aim of our study was to examine a gene expression level of PIK3CA in fine-needle aspiration biopsy (FNAB thyroid specimens in two types of thyroid lesions, papillary thyroid carcinoma (PTC and non-toxic goitre (NTG. Following conventional cytological examination, 42 thyroid FNAB specimens, received from patients with PTC (n = 20 and NTG (n = 22, were quantitatively evaluated regarding PIK3CA expression level by real-time PCR in the ABI PRISM® 7500 Sequence Detection System. Results Significantly higher expression level (RQ of PIK3CA in PTC group has been noted in comparison with NTG group (p Conclusion These observations may suggest role of PIK3CA alterations in PTC carcinogenesis.

  4. TaqMan探针荧光定量PCR检测花生油中掺入棕榈油的研究%Determination of palm oil adulterated in peanut oil with the TaqMan probe -based RT- PCR method

    Institute of Scientific and Technical Information of China (English)

    周慧; 梁宇斌; 吴苏喜; 李晓明; 裴伟; 杨涛

    2011-01-01

    The method of Real - time fluorescence quantitative polymerase chain reaction ( RT - PCR) with TaqMan fluorescent probe was chosen to fast detect the amount of palm oil mixed in peanut oil. MT3 - B gene of palm was selected as target gene to detect palm oil from peanut oil. The primers of MT3 - B and TaqMan probe were designed, MT3 - B gene reconstructed plasmid was built as absolute quantitative criteria for quantitative RT - PCR to establish standard curve. Peanut oil blended with 1% -40% concentration gradient palm oil was extracted DNA to test palm content by RT - PCR. The result showed that the correlation coefficient (R1) of standard curve with logarithmic linear regression analysis was 0.996. When the adulteration of palm oil in peanut oil reached 5% volume, MT3 - B gene of 17.431 copies per milli-liter of mixed oil could be detected . The method showed good sensitivity, specificity and repeatability.%根据棕榈内源基因MT3 -B设计引物和TaqMan探针,采用基因重组技术构建用于检测棕榈基因MT3 -B的重组质粒作为绝对定量标准品,建立标准曲线,对花生油中掺入棕榈油1% ~40%梯度混合油品提取DNA进行棕榈成分定量检测.结果表明,重组质粒标准品荧光定量标准曲线对数线性回归分析相关系数(R2)为0.996;花生油中掺入棕榈油达到5%时,可检出每亳升混合油品中棕榈MT3 -B基因17.431 copies,检测的重复性和特异性好.

  5. Evaluation of the suitability of six host genes as internal control in real-time RT-PCR assays in chicken embryo cell cultures infected with infectious bursal disease virus

    DEFF Research Database (Denmark)

    Li, Yiping; Bang, Dang Duong; Handberg, Kurt

    2005-01-01

    following a 7-day IBDV infection. The CE cells were inoculated with various multiplicity of infection (MOI) of IBDV vaccine strain Bursine-2, the expression of genes was measured by quantitative real-time PCR-based on cDNA synthesized from either normalized (100 ng) or non-normalized (10 mu l) total RNA...

  6. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  7. A probe-based qRT-PCR method to profile immunological gene expression in blood of captive beluga whales (Delphinapterus leucas

    Directory of Open Access Journals (Sweden)

    Ming-An Tsai

    2017-09-01

    Full Text Available Cytokines are fundamental for a functioning immune system, and thus potentially serve as important indicators of animal health. Quantitation of mRNA using quantitative reverse transcription polymerase chain reaction (qRT-PCR is an established immunological technique. It is particularly suitable for detecting the expression of proteins against which monoclonal antibodies are not available. In this study, we developed a probe-based quantitative gene expression assay for immunological assessment of captive beluga whales (Delphinapterus leucas that is one of the most common cetacean species on display in aquariums worldwide. Six immunologically relevant genes (IL-2Rα, -4, -10, -12, TNFα, and IFNγ were selected for analysis, and two validated housekeeping genes (PGK1 and RPL4 with stable expression were used as reference genes. Sixteen blood samples were obtained from four animals with different health conditions and stored in RNAlater™ solution. These samples were used for RNA extraction followed by qRT-PCR analysis. Analysis of gene transcripts was performed by relative quantitation using the comparative Cq method with the integration of amplification efficiency and two reference genes. The expression levels of each gene in the samples from clinically healthy animals were normally distributed. Transcript outliers for IL-2Rα, IL-4, IL-12, TNFα, and IFNγ were noticed in four samples collected from two clinically unhealthy animals. This assay has the potential to identify immune system deviation from normal state, which is caused by health problems. Furthermore, knowing the immune status of captive cetaceans could help both trainers and veterinarians in implementing preventive approaches prior to disease onset.

  8. Field evaluation of an open and polyvalent universal HIV-1/SIVcpz/SIVgor quantitative RT-PCR assay for HIV-1 viral load monitoring in comparison to Abbott RealTime HIV-1 in Cameroon.

    Science.gov (United States)

    Guichet, Emilande; Aghokeng, Avelin; Eymard-Duvernay, Sabrina; Vidal, Nicole; Ayouba, Ahidjo; Mpoudi Ngole, Eitel; Delaporte, Eric; Ciaffi, Laura; Peeters, Martine

    2016-11-01

    With the increasing demand of HIV viral load (VL) tests in resource-limited countries (RLCs) there is a need for assays at affordable cost and able to quantify all known HIV-1 variants. VLs obtained with a recently developed open and polyvalent universal HIV-1/SIVcpz/SIVgor RT-qPCR were compared to Abbott RealTime HIV-1 assay in Cameroon. On 474 plasma samples, characterized by a wide range of VLs and a broad HIV-1 group M genetic diversity, 97.5% concordance was observed when using the lower detection limit of each assay. When using the threshold of 3.00 log 10 copies/mL, according to WHO guidelines to define virological failure (VF) in RLCs, the concordance was 94.7%, 360/474 versus 339/474 patients were identified with VF with the new assay and Abbott RealTime HIV-1, respectively. Higher VLs were measured with the new assay, +0.47 log 10 copies/mL (95% CI; 0.42-0.52) as shown with Bland-Altman analysis. Eleven samples from patients on VF with drug resistance were not detected by Abbott RealTime HIV-1 versus two only with the new assay. Overall, our study showed that the new assay can be easily implemented in a laboratory in RLCs with VL experience and showed good performance on a wide diversity of HIV-1 group M variants. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Outcome on EPIZONE Extension on VER/ VNN: Diagnostics, proficiency test and qRT-PCR validation

    DEFF Research Database (Denmark)

    Bigarré, Laurent; Panzarin, Valentina; Baud, Marine

    2012-01-01

    1 is to bring valuable genetic information on the second genome component of a given isolate. ANSES has developed new DNA probes targeting RNA1 with the goal of detecting all genotypes of nodaviruses. The aim of the project is thus: - To organize, conduct and report an inter-laboratory proficiency...... test for detection of aquatic nodaviruses by real time RT-PCR targeting RNA1 and RNA2, respectively. - To test a newly developed real-time RT-PCR targeting RNA1: sensitivity, specificity, range of detection and genetic information provided by sequencing the PCR product. Materials & methods Primers...... to be extracted by each partner. In the meantime, ANSES produced and distributed RNA extracted from healthy or infected fish (2 genogroups), or cell culture; one sample from cell culture had to be serially diluted to test the sensitivity of each method in partners’ hands. Samples were tested in duplicates...

  10. DEVELOPMENT OF AN INTEGRATED CELL CULTURE/RT-PCR METHOD FOR THE DETECTION OF ENTEROVIRUS IN WATER

    Science.gov (United States)

    Virus contamination in environmental samples is believed to be underestimated due to the limitations in the methods available for detection. A major detection method is based upon the formation of cytopathic effect (CPE) in cell culture. The main limitations to this method are ...

  11. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  12. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia

    DEFF Research Database (Denmark)

    Jamal, Syed M.; Belsham, Graham

    2015-01-01

    Asia,A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08)). In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 subline-agewere also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV....... Due to the heterogeneity of FMD viruses (FMDVs) in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysableprobe-based real time reverse transcription quantitative polymerase chain reaction (RTqPCR) assays were developed for specific detection...... and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnosticassays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of OPan...

  13. Probabilistic real-time contingency ranking method

    International Nuclear Information System (INIS)

    Mijuskovic, N.A.; Stojnic, D.

    2000-01-01

    This paper describes a real-time contingency method based on a probabilistic index-expected energy not supplied. This way it is possible to take into account the stochastic nature of the electric power system equipment outages. This approach enables more comprehensive ranking of contingencies and it is possible to form reliability cost values that can form the basis for hourly spot price calculations. The electric power system of Serbia is used as an example for the method proposed. (author)

  14. A practical tissue sampling method using ordinary paper for molecular detection of infectious bursal disease virus RNA by RT-PCR.

    Science.gov (United States)

    Maw, Min Thein; Yamaguchi, Tsuyoshi; Kasanga, Christopher J; Terasaki, Kaori; Fukushi, Hideto

    2006-12-01

    A practical sampling method for bursal tissue using ordinary paper for molecular diagnosis of infectious bursal disease (IBD) was established. IBD virus-infected bursa was directly smeared on chromatography paper, filter paper, or stationery copy paper and was then fixed with absolute ethanol, Tris-HCl-saturated phenol, or phenol:chloroform:isoamyl alcohol (25:24:1). Flinders Technology Associates (FTA) card, which is designed for the collection of biological samples for molecular detection, was also used. After storage at 37 C for up to 30 days, total RNA directly extracted from the tissue fixed on the papers and FTA card were subjected to reverse transcriptase-polymerase chain reaction (RT-PCR) for detection of IBD virus (IBDV) RNA. In addition, the ability of each chemical used in the fixation and the FTA card to inactivate IBDV was evaluated. Regardless of the paper quality, storage period, and fixation method, IBDV RNA was consistently detected in all of the samples. IBDV in the bursal tissue was inactivated with phenol but not with ethanol or the unknown chemicals in FTA card. These results show that ordinary papers sustain the viral RNA, as does FTA card, but phenol fixation is superior to FTA card in inactivating IBDV. The new sampling method using ordinary paper with phenol fixation is safe, inexpensive, simple, and easy, and is thus suitable for conducting a global survey of IBD even where laboratory resources are limited. This practical method should contribute to the control of IBD worldwide.

  15. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia.

    Science.gov (United States)

    Jamal, Syed M; Belsham, Graham J

    2015-01-01

    Rapid and accurate diagnosis of foot-and-mouth disease (FMD) and virus serotyping are of paramount importance for control of this disease in endemic areas where vaccination is practiced. Ideally this virus characterization should be achieved without the need for virus amplification in cell culture. Due to the heterogeneity of FMD viruses (FMDVs) in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysable probe-based real time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays were developed for specific detection and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnostic assays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of O-PanAsia, A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08)). In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 sublineage were also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV and detected the RNA from the target viruses with cycle threshold (CT) values comparable with those obtained with the serotype-independent pan-FMDV diagnostic assays. No cross-reactivity was observed in these assays between the heterotypic viruses circulating in the region. The assays reported here have higher diagnostic sensitivity (100% each for serotypes O and Asia-1, and 92% [95% CI = 81.4-100%] for serotype A positive samples) and specificity (100% each for serotypes O, A and Asia-1 positive samples) for the viruses currently circulating in West Eurasia compared to the serotyping assays reported earlier. Comparisons of the sequences of the primers and probes used in these assays and the corresponding regions of the circulating viruses provided explanations for the poor

  16. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia.

    Directory of Open Access Journals (Sweden)

    Syed M Jamal

    Full Text Available Rapid and accurate diagnosis of foot-and-mouth disease (FMD and virus serotyping are of paramount importance for control of this disease in endemic areas where vaccination is practiced. Ideally this virus characterization should be achieved without the need for virus amplification in cell culture. Due to the heterogeneity of FMD viruses (FMDVs in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysable probe-based real time reverse transcription quantitative polymerase chain reaction (RT-qPCR assays were developed for specific detection and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnostic assays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of O-PanAsia, A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08. In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 sublineage were also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV and detected the RNA from the target viruses with cycle threshold (CT values comparable with those obtained with the serotype-independent pan-FMDV diagnostic assays. No cross-reactivity was observed in these assays between the heterotypic viruses circulating in the region. The assays reported here have higher diagnostic sensitivity (100% each for serotypes O and Asia-1, and 92% [95% CI = 81.4-100%] for serotype A positive samples and specificity (100% each for serotypes O, A and Asia-1 positive samples for the viruses currently circulating in West Eurasia compared to the serotyping assays reported earlier. Comparisons of the sequences of the primers and probes used in these assays and the corresponding regions of the circulating viruses provided explanations for

  17. Examining the hemagglutinin subtype diversity among wild duck-origin influenza A viruses using ethanol-fixed cloacal swabs and a novel RT-PCR method.

    Science.gov (United States)

    Wang, Ruixue; Soll, Lindsey; Dugan, Vivien; Runstadler, Jonathan; Happ, George; Slemons, Richard D; Taubenberger, Jeffery K

    2008-05-25

    This study presents an interconnected approach for circumventing two inherent limitations associated with studies defining the natural history of influenza A viruses in wild birds. The first limiting factor is the ability to maintain a cold chain from specimen collection to the laboratory when study sites are in more remote locations. The second limiting factor is the ability to identify all influenza A virus HA subtypes present in an original sample. We report a novel method for molecular subtyping of avian influenza A virus hemagglutinin genes using degenerate primers designed to amplify all known hemagglutinin subtypes. It was shown previously that templates larger than 200 bp were not consistently amplifiable from ethanol-fixed cloacal swabs. For this study, new primer sets were designed within these constraints. This method was used to perform subtyping RT-PCR on 191 influenza RNA-positive ethanol-fixed cloacal swabs obtained from 880 wild ducks in central Alaska in 2005. Seven different co-circulating hemagglutinin subtypes were identified in this study set, including H1, H3, H4, H5, H6, H8, and H12. In addition, 16% of original cloacal samples showed evidence of mixed infection, with samples yielding from two-to-five different hemagglutinin subtypes. This study further demonstrates the complex ecobiology of avian influenza A viruses in wild birds.

  18. Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

    Directory of Open Access Journals (Sweden)

    Gouri Chaubal

    2018-02-01

    Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

  19. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  20. Foot-and-mouth disease virus: A first inter-laboratory comparison trial to evaluate virus isolation and RT-PCR detection methods.

    NARCIS (Netherlands)

    Ferris, N.P.; King, D.P.; Reid, S.M.; Hutchings, G.H.; Shawa, A.E.; Paton, D.J.; Goris, N.; Haas, B.; Hoffmann, B.; Brocchi, E.; Bugnetti, M.; Dekker, A.; Clerq, De K.

    2006-01-01

    Five European reference laboratories participated in an exercise to evaluate the sensitivity and specificity of their routinely employed RT-PCR tests and cell cultures for the detection and isolation of foot-and-mouth disease (FMD) virus. Five identical sets of 20 coded samples were prepared from 10

  1. Evaluation of Susceptibility of Strains of Candida Albicans Isolated from AIDS Patients to Fluconazole and Determination of CDR2 Resistance Gene in Resistant Strains by RT-PCR Method

    Directory of Open Access Journals (Sweden)

    E Farahbakhsh

    2011-08-01

    Full Text Available Introduction & Objective: Nowadays, opportunistic fungi especially Candida albicans are the most common cause of life-threatening infections in immunodeficiency patients. Increasing Azole-resistant strains of C.albicans are a main problem in human immunodeficiency virus-infected patients. The aim of this study was to evaluate the CDR2 gene in C.albicans azole resistant strains, isolated from AIDS patients with oropharyngeal candidiasis by RT-PCR method. Materials & Methods: The present experimental study was conducted at Tarbiat Modares University of Medical Sciences in 2009. C. albicans isolates from HIV infected patients were identified by standard procedures, including germ tube formation, clamidospor and color of colonies on CHROM agar. At first, susceptibility of C. albicans isolates was assessed by disk diffusion agar technique. Then, CDR2 resistance gene was analyzed by RT-PCR and electrophoresis of the PCR products. Finally, patterns of the resulted bands were compared with standard fluconazole resistant strains. The collected data was analyzed using the SPSS software. Results: The results of drug sensitivity of 66 C. albicans isolates from AIDS patients revealed that 62.6% were susceptible, 8.6% were susceptible-dose dependent (SDD and 28.7% were resistant. In RT-PCR analysis, 6% of patients had the CDR2 gene. Conclusion: The use of phenotypic methods like disk diffusion agar, which is cheaper, along with genotypic methods, like RT-PCR, which provide the possibility of studying the mechanism of drug resistance, is recommended.

  2. Software Design Methods for Real-Time Systems

    Science.gov (United States)

    1989-12-01

    This module describes the concepts and methods used in the software design of real time systems . It outlines the characteristics of real time systems , describes...the role of software design in real time system development, surveys and compares some software design methods for real - time systems , and

  3. Detection and identification of dengue virus isolates from Brazil by a simplified reverse transcription - polymerase chain reaction (RT-PCR method

    Directory of Open Access Journals (Sweden)

    FIGUEIREDO Luiz Tadeu Moraes

    1997-01-01

    Full Text Available We show here a simplified RT-PCR for identification of dengue virus types 1 and 2. Five dengue virus strains, isolated from Brazilian patients, and yellow fever vaccine 17DD as a negative control, were used in this study. C6/36 cells were infected and supernatants were collected after 7 days. The RT-PCR, done in a single reaction vessel, was carried out following a 1/10 dilution of virus in distilled water or in a detergent mixture containing Nonidet P40. The 50 µl assay reaction mixture included 50 pmol of specific primers amplifying a 482 base pair sequence for dengue type 1 and 210 base pair sequence for dengue type 2. In other assays, we used dengue virus consensus primers having maximum sequence similarity to the four serotypes, amplifying a 511 base pair sequence. The reaction mixture also contained 0.1 mM of the four deoxynucleoside triphosphates, 7.5 U of reverse transcriptase, 1U of thermostable Taq DNA polymerase. The mixture was incubated for 5 minutes at 37ºC for reverse transcription followed by 30 cycles of two-step PCR amplification (92ºC for 60 seconds, 53ºC for 60 seconds with slow temperature increment. The PCR products were subjected to 1.7% agarose gel electrophoresis and visualized by UV light after staining with ethidium bromide solution. Low virus titer around 10 3, 6 TCID50/ml was detected by RT-PCR for dengue type 1. Specific DNA amplification was observed with all the Brazilian dengue strains by using dengue virus consensus primers. As compared to other RT-PCRs, this assay is less laborious, done in a shorter time, and has reduced risk of contamination

  4. Detection of human papillomavirus by hybrid capture and real time PCR methods in patients with chronic cervicitis and cervical intraepithelial

    Directory of Open Access Journals (Sweden)

    Elisha Khandker

    2016-07-01

    Full Text Available Background and objectives:Cervical cancer due to Human papillomavirus (HPV is one of the leading causes of morbidity and mortality in women. Testing of HPV can identify women who are at risk of cervical cancer. Nowadays, molecular methods like real time polymerase chain reaction (PCR and hybrid capture technique are applied for detecting HPV in cervical specimens. The objective of the present study was to determine the rate of HPV infection in women with chronic cervicitis and cervical intraepithelial neoplasia (CIN by a commercial real time polymerase chain reaction test kit and by a hybrid capture HPV DNA test. Methods:Women aged between 20 to 55 years with chronic cervicitis and CIN were enrolled in the study after obtaining informed consent. Cervical specimen was collected by using cervical brush and stored in transport medium until used. HPV was detected by High Risk Screen Real-TM Quant 2x (Sacace, Biotechnologies SrI, Italy real time PCR kit (HR RT-PCR and by Hybrid Capture-2 High-Risk HPV DNA (Hc-2; Digene Corporation, USA test. Results: Total 72 women with chronic cervicitis and CIN of different grades were included in the study. Out of this, HPV infection detected by HR RT-PCR was 31 (43% and by Hc-2 was 14 (19.4%. Both the tests were able to detect HPV infection in all the CIN 3 cases and in most of the CIN 2 cases. However, HR RT-PCR detected higher number of HPV in chronic cervicitis and CIN1 cases. Conclusion:The study has shown that HR RT-PCR and Hc-2 tests are equally effective in detecting HPV infection in patients with CIN 2 and CIN 3 lesions. However, HR RT-PCR is more sensitive test for detecting HPV in chronic cervicitis and early CIN lesions and, therefore can be used in epidemiological study to detect presence of HPV in general population. IMC J Med Sci 2016; 10(2: 45-48

  5. Performance of a RT-PCR Assay in Comparison to FISH and Immunohistochemistry for the Detection of ALK in Non-Small Cell Lung Cancer.

    Science.gov (United States)

    Hout, David R; Schweitzer, Brock L; Lawrence, Kasey; Morris, Stephan W; Tucker, Tracy; Mazzola, Rosetta; Skelton, Rachel; McMahon, Frank; Handshoe, John; Lesperance, Mary; Karsan, Aly; Saltman, David L

    2017-08-01

    Patients with lung cancers harboring an activating anaplastic lymphoma kinase ( ALK ) rearrangement respond favorably to ALK inhibitor therapy. Fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) are validated and widely used screening tests for ALK rearrangements but both methods have limitations. The ALK RGQ RT-PCR Kit (RT-PCR) is a single tube quantitative real-time PCR assay for high throughput and automated interpretation of ALK expression. In this study, we performed a direct comparison of formalin-fixed paraffin-embedded (FFPE) lung cancer specimens using all three ALK detection methods. The RT-PCR test (diagnostic cut-off Δ C t of ≤8) was shown to be highly sensitive (100%) when compared to FISH and IHC. Sequencing of RNA detected full-length ALK transcripts or EML4-ALK and KIF5B-ALK fusion variants in discordant cases in which ALK expression was detected by the ALK RT-PCR test but negative by FISH and IHC. The overall specificity of the RT-PCR test for the detection of ALK in cases without full-length ALK expression was 94% in comparison to FISH and sequencing. These data support the ALK RT-PCR test as a highly efficient and reliable diagnostic screening approach to identify patients with non-small cell lung cancer whose tumors are driven by oncogenic ALK.

  6. A combined RT-PCR and dot-blot hybridization method reveals the coexistence of SJNNV and RGNNV betanodavirus genotypes in wild meagre (Argyrosomus regius).

    Science.gov (United States)

    Lopez-Jimena, B; Cherif, N; Garcia-Rosado, E; Infante, C; Cano, I; Castro, D; Hammami, S; Borrego, J J; Alonso, M C

    2010-10-01

    To detect the possible coexistence of striped jack nervous necrosis virus (SJNNV) and red-spotted grouper nervous necrosis virus (RGNNV) genotypes in a single fish, a methodology based on the combination of PCR amplification and blot hybridization has been developed and applied in this study. The degenerate primers designed for the PCR procedure target the T4 region within the capsid gene, resulting in the amplification of both genotypes. The subsequent hybridization of these amplification products with two different specific digoxigenin-labelled probes resulted in the identification of both genotypes separately. The application of the RT-PCR protocol to analyse blood samples from asymptomatic wild meagre (Argyrosomus regius) specimens has shown a 46.87% of viral nervous necrosis virus carriers. The combination of RT-PCR and blot hybridization increases the detection rate up to 90.62%, and, in addition, it has shown the coexistence of both genotypes in 18 out of the 32 specimens analysed (56.25%). This study reports the coexistence of betanodaviruses belonging to two different genotypes (SJNNV and RGNNV) in wild fish specimens. This is the first report demonstrating the presence of SJNNV and RGNNV genotypes in the same specimen. This study also demonstrates a carrier state in this fish species for the first time. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

  7. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples.

    Science.gov (United States)

    Mehta, Rohini; Birerdinc, Aybike; Hossain, Noreen; Afendy, Arian; Chandhoke, Vikas; Younossi, Zobair; Baranova, Ancha

    2010-05-21

    Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  8. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples

    Directory of Open Access Journals (Sweden)

    Afendy Arian

    2010-05-01

    Full Text Available Abstract Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  9. Simultaneous real-time data collection methods

    Science.gov (United States)

    Klincsek, Thomas

    1992-01-01

    This paper describes the development of electronic test equipment which executes, supervises, and reports on various tests. This validation process uses computers to analyze test results and report conclusions. The test equipment consists of an electronics component and the data collection and reporting unit. The PC software, display screens, and real-time data-base are described. Pass-fail procedures and data replay are discussed. The OS2 operating system and Presentation Manager user interface system were used to create a highly interactive automated system. The system outputs are hardcopy printouts and MS DOS format files which may be used as input for other PC programs.

  10. A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

    Directory of Open Access Journals (Sweden)

    Tian Ding

    2017-05-01

    Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

  11. RT-PCR Detection of HIV in Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Golubinka Bosevska

    2008-11-01

    Full Text Available The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works.The total of 33 examined persons were divided in two groups: 1 13 persons seropositive for HIV; and 2 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5.ELFA test for combined detection of HIV p24 antigen and anti HIV-1 + 2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly.In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70°C, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20°C for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is

  12. Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

    Science.gov (United States)

    Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

    2012-10-01

    A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

  13. Formal methods for dependable real-time systems

    Science.gov (United States)

    Rushby, John

    1993-01-01

    The motivation for using formal methods to specify and reason about real time properties is outlined and approaches that were proposed and used are sketched. The formal verifications of clock synchronization algorithms are concluded as showing that mechanically supported reasoning about complex real time behavior is feasible. However, there was significant increase in the effectiveness of verification systems since those verifications were performed, at it is to be expected that verifications of comparable difficulty will become fairly routine. The current challenge lies in developing perspicuous and economical approaches to the formalization and specification of real time properties.

  14. Comparison of RT-PCR-Dot blot hybridization based on radioisotope 32P with conventional RT-PCR and commercial ELISA Assays for blood screening of HIV-1

    International Nuclear Information System (INIS)

    Maria Lina R; Andi Yasmon

    2011-01-01

    There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)

  15. Real-time hybrid simulation using the convolution integral method

    International Nuclear Information System (INIS)

    Kim, Sung Jig; Christenson, Richard E; Wojtkiewicz, Steven F; Johnson, Erik A

    2011-01-01

    This paper proposes a real-time hybrid simulation method that will allow complex systems to be tested within the hybrid test framework by employing the convolution integral (CI) method. The proposed CI method is potentially transformative for real-time hybrid simulation. The CI method can allow real-time hybrid simulation to be conducted regardless of the size and complexity of the numerical model and for numerical stability to be ensured in the presence of high frequency responses in the simulation. This paper presents the general theory behind the proposed CI method and provides experimental verification of the proposed method by comparing the CI method to the current integration time-stepping (ITS) method. Real-time hybrid simulation is conducted in the Advanced Hazard Mitigation Laboratory at the University of Connecticut. A seismically excited two-story shear frame building with a magneto-rheological (MR) fluid damper is selected as the test structure to experimentally validate the proposed method. The building structure is numerically modeled and simulated, while the MR damper is physically tested. Real-time hybrid simulation using the proposed CI method is shown to provide accurate results

  16. Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay

    Directory of Open Access Journals (Sweden)

    Gaya Prasad

    2013-06-01

    Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557

  17. Dengue Virus NS1 Protein as a Diagnostic Marker: Commercially Available ELISA and Comparison to qRT-PCR and Serological Diagnostic Assays Currently Used by the State of Florida

    Directory of Open Access Journals (Sweden)

    Jason H. Ambrose

    2017-01-01

    Full Text Available Background. The proper management of patients infected with dengue virus requires early detection. Here, real-time molecular assays have proven useful but have limitations, whereas ELISAs that detect antibodies are still favored but results are obtained too late to be of clinical value. The production of DENV NS1 peaks early during infection and its detection can combine the advantages of both diagnostic approaches. Methods. This study compared assays currently used for detecting DENV infection at the Florida Department of Health including anti-DENV IgM and IgG ELISAs as well as qRT-PCR, against a commercially available DENV NS1 ELISA. These comparisons were made among a group of 21 human sera. Results. Nine of 14 (64.3% DENV qRT-PCR+ samples were also DENV NS1+. Interestingly, the 5 NS1− samples that were qRT-PCR+ were additionally IgM− and IgG+ suggesting a nonprimary infection. Compared to qRT-PCR, the NS1 assay had a sensitivity of 64.3%, specificity 100%, PPV of 100%, and NPV of 58.3%. Conclusions. The NS1 ELISA performed as expected in known DENV qRT-PCR+ samples; however negative NS1 results for qRT-PCR+ and IgG+ sera seemingly reduced the usefulness of the NS1 ELISA for nonprimary cases. We therefore conclude that diagnosis obtained via DENV NS1 ELISA deserves further investigation.

  18. Sensitive real-time PCR detection of pathogenic Leptospira spp. and a comparison of nucleic acid amplification methods for the diagnosis of leptospirosis.

    Science.gov (United States)

    Waggoner, Jesse J; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A

    2014-01-01

    Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (pLeptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests.

  19. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  20. Design and analysis of Q-RT-PCR assays for haematological malignancies using mixed effects models

    DEFF Research Database (Denmark)

    Bøgsted, Martin; Mandrup, Charlotte; Petersen, Anders

    2009-01-01

    research use and needs qualit control for accuracy and precision. Especially the identification of experimental variations and statistical analysis has recently created discussions. The standard analytical technique is to use the Delta-Delta-Ct method. Although this method accounts for sample specific...... developed based on a linear mixed effects model for factorial designs. The model consists of an analysis of variance where the variation of each fixed effect of interest and identified experimental and biological nuisance variations are split. Hereby it accounts for varying efficiency, inhomogeneous......The recent WHO classification of haematological malignancies includes detection of genetic abnormalities with rognostic significance. Consequently, an increasing number of specific real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR) based assays are in clinical...

  1. Real-Time Pore Pressure Detection: Indicators and Improved Methods

    Directory of Open Access Journals (Sweden)

    Jincai Zhang

    2017-01-01

    Full Text Available High uncertainties may exist in the predrill pore pressure prediction in new prospects and deepwater subsalt wells; therefore, real-time pore pressure detection is highly needed to reduce drilling risks. The methods for pore pressure detection (the resistivity, sonic, and corrected d-exponent methods are improved using the depth-dependent normal compaction equations to adapt to the requirements of the real-time monitoring. A new method is proposed to calculate pore pressure from the connection gas or elevated background gas, which can be used for real-time pore pressure detection. The pore pressure detection using the logging-while-drilling, measurement-while-drilling, and mud logging data is also implemented and evaluated. Abnormal pore pressure indicators from the well logs, mud logs, and wellbore instability events are identified and analyzed to interpret abnormal pore pressures for guiding real-time drilling decisions. The principles for identifying abnormal pressure indicators are proposed to improve real-time pore pressure monitoring.

  2. Reduction Methods for Real-time Simulations in Hybrid Testing

    DEFF Research Database (Denmark)

    Andersen, Sebastian

    2016-01-01

    Hybrid testing constitutes a cost-effective experimental full scale testing method. The method was introduced in the 1960's by Japanese researchers, as an alternative to conventional full scale testing and small scale material testing, such as shake table tests. The principle of the method...... is performed on a glass fibre reinforced polymer composite box girder. The test serves as a pilot test for prospective real-time tests on a wind turbine blade. The Taylor basis is implemented in the test, used to perform the numerical simulations. Despite of a number of introduced errors in the real...... is to divide a structure into a physical substructure and a numerical substructure, and couple these in a test. If the test is conducted in real-time it is referred to as real time hybrid testing. The hybrid testing concept has developed significantly since its introduction in the 1960', both with respect...

  3. Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

    Science.gov (United States)

    Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

    2017-11-01

    Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

  4. Mathematical analysis of the real time array PCR (RTA PCR) process

    NARCIS (Netherlands)

    Dijksman, Johan Frederik; Pierik, A.

    2012-01-01

    Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the

  5. Selection and Validation of Reference Genes for qRT-PCR Expression Analysis of Candidate Genes Involved in Olfactory Communication in the Butterfly Bicyclus anynana

    OpenAIRE

    Arun, Alok; Bauml?, V?ronique; Amelot, Ga?l; Nieberding, Caroline M.

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at ident...

  6. Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

    Directory of Open Access Journals (Sweden)

    Tandale Babasaheb V

    2008-12-01

    Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy

  7. Have you tried spermine? A rapid and cost-effective method to eliminate dextran sodium sulfate inhibition of PCR and RT-PCR.

    Science.gov (United States)

    Krych, Łukasz; Kot, Witold; Bendtsen, Katja M B; Hansen, Axel K; Vogensen, Finn K; Nielsen, Dennis S

    2018-01-01

    The Dextran Sulfate Sodium (DSS) induced colitis mouse model is commonly used to investigate human inflammatory bowel disease (IBD). Nucleic acid extracts originating from these animals are often contaminated with DSS, which is a strong inhibitor of many enzymatic based molecular biology reactions including PCR and reverse-transcription (RT). Methods for removing DSS from nucleic acids extracts exist for RNA, but no effective protocol for DNA or cDNA is currently available. However, spermine has previously been shown to be an effective agent for counteracting DSS inhibition of polynucleotide kinase, which led to the hypothesis, that spermine could be used to counteract DSS inhibition of PCR and RT. We investigated the means of adding spermine in an adequate concentration to PCR based protocols (including qPCR, two-step RT-qPCR, and amplicon sequencing library preparation) to remove DSS inhibition. Within the range up to 0.01g/L, spermine can be added to PCR/qPCR or RT prophylactically without a significant reduction of reaction efficiency. Addition of spermine at the concentration of 0.08g/L can be used to recover qualitative PCR signal inhibited by DSS in concentrations up to 0.32g/L. For optimal quantitative analysis, the concentration of spermine requires fine adjustment. Hence, we present here a simple fluorometric based method for adjusting the concentration of spermine ensuring an optimal efficiency of the reaction exposed to an unknown concentration of DSS. In conclusion, we demonstrate a cost effective and easy method to counteract DSS inhibition in PCR and two-step RT-qPCR. Fixed or fine-tuned concentrations of spermine can be administered depending on the qualitative or quantitative character of the analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Establishment of realtime RT-PCR assay to detect polio virus in the Acute Flaccid Paralysis laboratory surveillance

    Directory of Open Access Journals (Sweden)

    Nike Susanti

    2016-07-01

    Polio Vaccine into Vaccine-Derived Poliovirus still continue. Since 1991, WHO has developedAcute Flaccid Paralysis (AFP laboratory based surveillance. In 2014, the polioviruses identification by real-timeReverse Transcriptase Polymerase Chain Reaction (rRT-PCR, has been introduced to National Polio Laboratory(NPL Center for Biomedical and Basic Technology of Health. The objective of the rRT-PCR application is to havefaster and better diagnostic methods to monitor the circulation and mutation of polio viruses.Methods: Isolate tested by rRT-PCR using a combination of primers and probe mentioned by WHO manual.The viral RNA is converted to cDNA using reverse transcriptase and amplified in a PCR reaction using Taqpolymerase. The PCR products are detected and identified by hybridization with specific probes. The combinationof primers and probes will result in the serotype identification and intratypic differentiation of poliovirus isolates.Results: In 2014 NPL Jakarta received 604 AFP cases through the surveillance system, five cases foundpositive for polio viruses by culture. All of the specimens were positive for polio vaccine viruses. Twocases were polio virus type P2 (40%, one cases polio virus type P1 (20%, 1 case polio virus type P3(20% and one case mix polio viruses type P1+P2 (20%.Conclusion: The real-time PCR assay was able to help the identification of polio viruses rapidly in Jakartalab. The test can be utilized for monitoring the population routinely immunized with OPV. (Health ScienceJournal of Indonesia 2016;7:27-31Keywords: ITD, Poliovirus, Identification, rRT-PCR

  9. Real time simulation method for fast breeder reactors dynamics

    International Nuclear Information System (INIS)

    Miki, Tetsushi; Mineo, Yoshiyuki; Ogino, Takamichi; Kishida, Koji; Furuichi, Kenji.

    1985-01-01

    The development of multi-purpose real time simulator models with suitable plant dynamics was made; these models can be used not only in training operators but also in designing control systems, operation sequences and many other items which must be studied for the development of new type reactors. The prototype fast breeder reactor ''Monju'' is taken as an example. Analysis is made on various factors affecting the accuracy and computer load of its dynamic simulation. A method is presented which determines the optimum number of nodes in distributed systems and time steps. The oscillations due to the numerical instability are observed in the dynamic simulation of evaporators with a small number of nodes, and a method to cancel these oscillations is proposed. It has been verified through the development of plant dynamics simulation codes that these methods can provide efficient real time dynamics models of fast breeder reactors. (author)

  10. Seasonal adjustment methods and real time trend-cycle estimation

    CERN Document Server

    Bee Dagum, Estela

    2016-01-01

    This book explores widely used seasonal adjustment methods and recent developments in real time trend-cycle estimation. It discusses in detail the properties and limitations of X12ARIMA, TRAMO-SEATS and STAMP - the main seasonal adjustment methods used by statistical agencies. Several real-world cases illustrate each method and real data examples can be followed throughout the text. The trend-cycle estimation is presented using nonparametric techniques based on moving averages, linear filters and reproducing kernel Hilbert spaces, taking recent advances into account. The book provides a systematical treatment of results that to date have been scattered throughout the literature. Seasonal adjustment and real time trend-cycle prediction play an essential part at all levels of activity in modern economies. They are used by governments to counteract cyclical recessions, by central banks to control inflation, by decision makers for better modeling and planning and by hospitals, manufacturers, builders, transportat...

  11. Method of parallel processing in SANPO real time system

    International Nuclear Information System (INIS)

    Ostrovnoj, A.I.; Salamatin, I.M.

    1981-01-01

    A method of parellel processing in SANPO real time system is described. Algorithms of data accumulation and preliminary processing in this system as a parallel processes using a specialized high level programming language are described. Hierarchy of elementary processes are also described. It provides the synchronization of concurrent processes without semaphors. The developed means are applied to the systems of experiment automation using SM-3 minicomputers [ru

  12. Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells

    International Nuclear Information System (INIS)

    Raynor, Michael; Stephenson, Sally-Anne; Walsh, David CA; Pittman, Kenneth B; Dobrovic, Alexander

    2002-01-01

    Immunomagnetic enrichment followed by RT-PCR (immunobead RT-PCR) is an efficient methodology to identify disseminated carcinoma cells in the blood and bone marrow. The RT-PCR assays must be both specific for the tumor cells and sufficiently sensitive to enable detection of single tumor cells. We have developed a method to test RT-PCR assays for any cancer. This has been investigated using a panel of RT-PCR markers suitable for the detection of breast cancer cells. In the assay, a single cell line-derived tumor cell is added to 100 peripheral blood mononuclear cells (PBMNCs) after which mRNA is isolated and reverse transcribed for RT-PCR analysis. PBMNCs without added tumor cells are used as specificity controls. The previously studied markers epidermal growth factor receptor (EGFR), mammaglobin 1 (MGB1), epithelial cell adhesion molecule (EpCAM/TACSTD1), mucin 1 (MUC1), carcinoembryonic antigen (CEA) were tested. Two new epithelial-specific markers ELF3 and EphB4 were also tested. MUC1 was unsuitable as strong amplification was detected in 100 cell PBMNC controls. Expression of ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 was found to be both specific for the tumor cell, as demonstrated by the absence of a signal in most 100 cell PBMNC controls, and sensitive enough to detect a single tumor cell in 100 PBMNCs using a single round of RT-PCR. ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 are appropriate RT-PCR markers for use in a marker panel to detect disseminated breast cancer cells after immunomagnetic enrichment

  13. [REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

    Science.gov (United States)

    Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

    2015-01-01

    Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

  14. Detection of bacterial species involved in perimplantitis concerned with cultural and RT-PCR

    Directory of Open Access Journals (Sweden)

    Marcello Gatti

    2010-06-01

    Full Text Available Dental implants offer new treatment options for edentulous either partially or completely, now represent a viable alternative to conventional fixed protheses. Dental implants are colonized by a flora dominated by Gram-positive facultative aerobic, while in patients with bone loss and formation of pockets peri-implant diseases was found a significant difference in the composition of microflora, bacteria, Gram-negative anaerobes in particular Fusobacterium spp., Treponema denticola (Spirochetes, Tannerella forsythensis, Aggregatibacter actinomycetemcomitans, Prevotella intermedia as interim black-pigmented bacteria, Porphyromonas gingivalis, often in high concentrations. Aims. The purpose of this study was to identify those at risk of perimplantitis using 2 techniques: RT-PCR examination of trade and culture. The results were compared taking into consideration the advantages and disadvantages of both methods. Materials and methods.We studied 24 patients (14 women and 10 men, aged, women between 43 and 76 years, with an average of 63.8 + / - 10.9 years, men between 45 and 88 years with a average of 64.3 years + / - 12.5 years. Was performed a double levy of sub-gingival plaque at multiple sites that had an implant CAL (clinical attachment level> 4mm in order to assess the microbiological identification with the two techniques: Examining culture and Real-Time PCR of Commerce ( Gum-Sunstar that identifies 4 bacterial species: A. actinomycetemcomitans (A.a., P.gingivalis (P.g., T.forsythensis (T.f., and T.denticola (T.d.. Results. All patients studied were positive to both tests with charger high: the consideration of tenure, with CFU / ml > 105, was positive in 66.6% of samples by:T.f., and P.g., in 12.5% for A.a., while T.d. not been sought by examining culture, the RT-PCR was positive, with high loads, in 95.8% of samples for T.f., in 79.1% for P.g., in 12.5% for A.a. and 20.8% for T.d.The test crop showed the presence of even P.intermedia in 91

  15. Performance of nested RT-PCR on CSF for tuberculous meningitis diagnosis in HIV-infected patients.

    Science.gov (United States)

    Gualberto, F A S; Gonçalves, M G; Fukasawa, L O; Santos, A M Ramos Dos; Sacchi, C T; Harrison, L H; Boulware, D R; Vidal, J E

    2017-10-01

    Timely diagnosis of tuberculous meningitis (TBM) in patients with human immunodeficiency virus (HIV) infection remains a challenge. Despite the current scale-up of the Xpert® MTB/RIF assay, other molecular diagnostic tools are necessary, particularly in referral centres in low- and middle-income countries without Xpert testing. To determine the diagnostic performance of nested real-time polymerase chain reaction (nRT-PCR) in HIV-infected TBM patients categorised according to standardised clinical case definitions. Based on clinical, laboratory and imaging data, HIV-infected patients with suspected TBM were prospectively categorised as 'definite TBM', 'probable TBM', 'possible TBM' or 'not TBM'. We evaluated nRT-PCR sensitivity and specificity in diagnosing TBM among definite TBM cases, and among definite + probable TBM cases. Ninety-two participants were enrolled in the study. nRT-PCR sensitivity for definite TBM (n = 8) was 100% (95%CI 67-100) and 86% (95%CI 60-96) for both definite and probable TBM (n = 6). Assuming that 'not TBM' patients (n = 74) were true-negatives, nRT-PCR specificity was 100% (95%CI 95-100). The possible TBM group (n = 4) had no nRT-PCR positives. The nRT-PCR is a useful rule-in test for HIV-infected patients with TBM according to international consensus case definitions. As nRT-PCR cannot exclude TBM, studies comparing and combining nRT-PCR with other assays are necessary for a rule-out test.

  16. Diagnosis of intestinal parasites in a rural community of Venezuela : Advantages and disadvantages of using microscopy or RT-PCR

    NARCIS (Netherlands)

    Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia M.; Pinelli, Elena

    2017-01-01

    A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular

  17. Novel methods for real-time 3D facial recognition

    OpenAIRE

    Rodrigues, Marcos; Robinson, Alan

    2010-01-01

    In this paper we discuss our approach to real-time 3D face recognition. We argue the need for real time operation in a realistic scenario and highlight the required pre- and post-processing operations for effective 3D facial recognition. We focus attention to some operations including face and eye detection, and fast post-processing operations such as hole filling, mesh smoothing and noise removal. We consider strategies for hole filling such as bilinear and polynomial interpolation and Lapla...

  18. Quantitative RT-PCR for titration of replication-defective recombinant Semliki Forest virus.

    Science.gov (United States)

    Puglia, Ana L P; Rezende, Alexandre G; Jorge, Soraia A C; Wagner, Renaud; Pereira, Carlos A; Astray, Renato M

    2013-11-01

    Virus titration may constitute a drawback in the development and use of replication-defective viral vectors like Semliki Forest virus (SFV). The standardization and validation of a reverse transcription quantitative PCR (qRT-PCR) method for SFV titration is presented here. The qRT-PCR target is located within the nsp1 gene of the non-structural polyprotein SFV region (SFV RNA), which allows the strategy to be used for several different recombinant SFV constructs. Titer determinations were carried out by performing virus titration and infection assays with SFVs containing an RNA coding region for the rabies virus glycoprotein (RVGP) or green fluorescent protein (GFP). Results showed that the standardized qRT-PCR is applicable for different SFV constructs, and showed good reproducibility. To evaluate the correlation between the amount of functional SFV RNA in a virus lot and its infectivity in BHK-21 cell cultures, a temperature mediated titer decrease was performed and successfully quantitated by qRT-PCR. When used for cell infection at the same multiplicity of infection (MOI), the temperature treated SFV-RVGP samples induced the same levels of RVGP expression. Similarly, when different SFV-GFP lots with different virus titers, as accessed by qRT-PCR, were used for cell infection at the same MOI, the cultures showed comparable amounts of fluorescent cells. The data demonstrate a good correlation between the amount of virus used for infection, as measured by its SFV RNA, and the protein synthesis in the cells. In conclusion, the qRT-PCR method developed here is accurate and enables the titration of replication-defective SFV vectors, an essential aid for viral vector development as well as for establishment of production bioprocesses. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  20. A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

    Science.gov (United States)

    Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

    2013-10-01

    A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

  1. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  2. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  3. RT-PCR for detection of all seven genotypes of Lyssavirus genus.

    Science.gov (United States)

    Vázquez-Morón, S; Avellón, A; Echevarría, J E

    2006-08-01

    The Lyssavirus genus includes seven species or genotypes named 1-7. Rabies genotypes correlate with geographical distribution and specific hosts. Co-circulation of different lyssaviruses, imported cases, and the presence of unknown viruses, such as Aravan, Khujand, Irkut and West Caucasian Bat Virus, make it necessary to use generic methods able to detect all lyssaviruses. Primer sequences were chosen from conserved regions in all genotypes in order to optimise a generic RT-PCR. Serial dilutions of 12 RNA extracts from all seven Lyssavirus genotypes were examined to compare the sensitivity of the RT-PCR standardised in this study with a published RT-PCR optimised for EBLV1 detection and capable of amplifying RNA from all seven lyssaviruses. All seven genotypes were detected by both RT-PCRs, however, the sensitivity was higher with the new version of the test. Twenty samples submitted for rabies diagnosis were tested by the new RT-PCR. Eight out of 20 samples from six dogs, one horse and one bat were found positive, in agreement with immunofluorescence results. Seven samples from terrestrial mammals were genotype 1 and one from a bat was genotype 5. In conclusion, this method can be used to complement immunofluorescence for the diagnosis of rabies, enabling the detection of unexpected lyssaviruses during rabies surveillance.

  4. Exploring Valid Reference Genes for Quantitative Real-Time PCR Analysis in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study...

  5. Galactomannan and Real-Time PCR in the diagnosis of invasive Aspergillosis: preliminary data

    Directory of Open Access Journals (Sweden)

    Cristina Pedrotti

    2014-03-01

    Full Text Available The diagnosis of invasive aspergillosis is notoriously difficult. The standard culture-based methods have shown considerable limitations in performance. For this reason, non-culture methods have been increasingly employed for the diagnosis of invasive aspergillosis, and, among them, the methods based on Real-Time polymerase chain reaction (RT-PCR. In this study we assess the contribution in lowering diagnosis errors provided by the RT-PCR method when run alongside other methods. We analyzed 23 biological samples, 14 serum samples, and 9 bronchoalveolar lavage samples (BAL from 10 immunocompromised patients who were selected according to EORTC/MSG criteria (European Organization for Research and Treatment of Cancer/Mycoses Study Group. On the serum sample we searched the galactomannan (GM (Platelia Aspergillus® and the fungal genome (MycAssayTMAspergillus; the BAL samples were subjected also to the culture tests. In 11 serum samples the results showed concordance between GM and RT–PCR tests, while in 3 samples we report discordance: 2 results were GM positive and RT-PCR negative, and 1 results GM negative and RT-PCR indeterminate. In 5 BAL samples the results showed concordance between the two methods, while 4 were GM positive and RT-PCR negative. The data, although still preliminary, suggest an increased accuracy in the diagnosis of suspected invasive aspergillosis when employing both RT-PCR and GM tests given that the RT-PCR test eliminates the false positive results of the GM test. The PCR methods require, however, further applications of this type of diagnostic because of the severe limit given by the lack of standardization.

  6. Method for Hot Real-Time Sampling of Gasification Products

    Energy Technology Data Exchange (ETDEWEB)

    Pomeroy, Marc D [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2017-09-29

    The Thermochemical Process Development Unit (TCPDU) at the National Renewable Energy Laboratory (NREL) is a highly instrumented half-ton/day pilot scale plant capable of demonstrating industrially relevant thermochemical technologies from lignocellulosic biomass conversion, including gasification. Gasification creates primarily Syngas (a mixture of Hydrogen and Carbon Monoxide) that can be utilized with synthesis catalysts to form transportation fuels and other valuable chemicals. Biomass derived gasification products are a very complex mixture of chemical components that typically contain Sulfur and Nitrogen species that can act as catalysis poisons for tar reforming and synthesis catalysts. Real-time hot online sampling techniques, such as Molecular Beam Mass Spectrometry (MBMS), and Gas Chromatographs with Sulfur and Nitrogen specific detectors can provide real-time analysis providing operational indicators for performance. Sampling typically requires coated sampling lines to minimize trace sulfur interactions with steel surfaces. Other materials used inline have also shown conversion of sulfur species into new components and must be minimized. Sample line Residence time within the sampling lines must also be kept to a minimum to reduce further reaction chemistries. Solids from ash and char contribute to plugging and must be filtered at temperature. Experience at NREL has shown several key factors to consider when designing and installing an analytical sampling system for biomass gasification products. They include minimizing sampling distance, effective filtering as close to source as possible, proper line sizing, proper line materials or coatings, even heating of all components, minimizing pressure drops, and additional filtering or traps after pressure drops.

  7. Evaluation of methods for oligonucleotide array data via quantitative real-time PCR.

    Science.gov (United States)

    Qin, Li-Xuan; Beyer, Richard P; Hudson, Francesca N; Linford, Nancy J; Morris, Daryl E; Kerr, Kathleen F

    2006-01-17

    There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR) is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch) and a sequence-based method of background adjustment (as in gcRMA) as the most important factors in methods' performances. However, we found poor reliability for methods using mismatch probes for low-intensity genes

  8. Evaluation of methods for oligonucleotide array data via quantitative real-time PCR

    Directory of Open Access Journals (Sweden)

    Morris Daryl E

    2006-01-01

    Full Text Available Abstract Background There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. Results We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch and a sequence-based method of background adjustment (as in gcRMA as the most important factors in methods' performances. However, we found poor reliability for methods

  9. Development of real-time PCR and hybridization methods for detection and identification of thermophilic Campylobacter spp. in pig faecal samples

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Andersen, M. T.; Dalsgaard, Anders

    2005-01-01

    species-specific detection of Campylobacter spp. in naturally infected pig faecal samples after an enrichment step, whereas the hybridization approach enhanced the specific isolation of C. jejuni (present in minority to C. coli) from pigs. Conclusions: The rt-PCR was specific for Campylobacter jejuni, C...... by phenotypic methods and the developed rt-PCR provides an easy and fast method for such differentiation. Detection of C. jejuni by colony hybridization may increase the isolation rate of this species from pig faeces....

  10. Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...

    Indian Academy of Sciences (India)

    (TCA)8. GGGTCCGAGTGCCTTAATTT. TGTGGGATGTGTTGTGTGTG 60.32 59.88. HAAS VR 415 BMK.5319. (T)13. GATTCACGTGTGCCATCATC TGGACAATTCATTCAAAAAGAAAA 59.93 59.87 372. HAAS_VR_417 BMK.5329. (AG)6. ATCCCGGGGTGAAAAATAAA AGAAATGGTGCAATGGGTTC 60.36 59.80 157. (GAC)5 ...

  11. Comparative Evaluations of Four Specification Methods for Real-Time Systems

    Science.gov (United States)

    1989-12-01

    December 1989 Comparative Evaluations of Four Specification Methods for Real - Time Systems David P. Wood William G. Wood Specification and Design Methods...Methods for Real - Time Systems Abstract: A number of methods have been proposed in the last decade for the specification of system and software requirements...and software specification for real - time systems . Our process for the identification of methods that meet the above criteria is described in greater

  12. Comparative Evaluation of Three Homogenization Methods for Isolating Middle East Respiratory Syndrome Coronavirus Nucleic Acids From Sputum Samples for Real-Time Reverse Transcription PCR.

    Science.gov (United States)

    Sung, Heungsup; Yong, Dongeun; Ki, Chang Seok; Kim, Jae Seok; Seong, Moon Woo; Lee, Hyukmin; Kim, Mi Na

    2016-09-01

    Real-time reverse transcription PCR (rRT-PCR) of sputum samples is commonly used to diagnose Middle East respiratory syndrome coronavirus (MERS-CoV) infection. Owing to the difficulty of extracting RNA from sputum containing mucus, sputum homogenization is desirable prior to nucleic acid isolation. We determined optimal homogenization methods for isolating viral nucleic acids from sputum. We evaluated the following three sputum-homogenization methods: proteinase K and DNase I (PK-DNase) treatment, phosphate-buffered saline (PBS) treatment, and N-acetyl-L-cysteine and sodium citrate (NALC) treatment. Sputum samples were spiked with inactivated MERS-CoV culture isolates. RNA was extracted from pretreated, spiked samples using the easyMAG system (bioMérieux, France). Extracted RNAs were then subjected to rRT-PCR for MERS-CoV diagnosis (DiaPlex Q MERS-coronavirus, SolGent, Korea). While analyzing 15 spiked sputum samples prepared in technical duplicate, false-negative results were obtained with five (16.7%) and four samples (13.3%), respectively, by using the PBS and NALC methods. The range of threshold cycle (Ct) values observed when detecting upE in sputum samples was 31.1-35.4 with the PK-DNase method, 34.7-39.0 with the PBS method, and 33.9-38.6 with the NALC method. Compared with the control, which were prepared by adding a one-tenth volume of 1:1,000 diluted viral culture to PBS solution, the ranges of Ct values obtained by the PBS and NALC methods differed significantly from the mean control Ct of 33.2 (both Phomogenizing sputum samples prior to RNA extraction.

  13. Identification of suitable reference genes for gene expression normalization in qRT-PCR analysis in watermelon.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Watermelon is one of the major Cucurbitaceae crops and the recent availability of genome sequence greatly facilitates the fundamental researches on it. Quantitative real-time reverse transcriptase PCR (qRT-PCR is the preferred method for gene expression analyses, and using validated reference genes for normalization is crucial to ensure the accuracy of this method. However, a systematic validation of reference genes has not been conducted on watermelon. In this study, transcripts of 15 candidate reference genes were quantified in watermelon using qRT-PCR, and the stability of these genes was compared using geNorm and NormFinder. geNorm identified ClTUA and ClACT, ClEF1α and ClACT, and ClCAC and ClTUA as the best pairs of reference genes in watermelon organs and tissues under normal growth conditions, abiotic stress, and biotic stress, respectively. NormFinder identified ClYLS8, ClUBCP, and ClCAC as the best single reference genes under the above experimental conditions, respectively. ClYLS8 and ClPP2A were identified as the best reference genes across all samples. Two to nine reference genes were required for more reliable normalization depending on the experimental conditions. The widely used watermelon reference gene 18SrRNA was less stable than the other reference genes under the experimental conditions. Catalase family genes were identified in watermelon genome, and used to validate the reliability of the identified reference genes. ClCAT1and ClCAT2 were induced and upregulated in the first 24 h, whereas ClCAT3 was downregulated in the leaves under low temperature stress. However, the expression levels of these genes were significantly overestimated and misinterpreted when 18SrRNA was used as a reference gene. These results provide a good starting point for reference gene selection in qRT-PCR analyses involving watermelon.

  14. Selection and validation of endogenous reference genes for qRT-PCR analysis in leafy spurge (Euphorbia esula.

    Directory of Open Access Journals (Sweden)

    Wun S Chao

    Full Text Available Quantitative real-time polymerase chain reaction (qRT-PCR is the most important tool in measuring levels of gene expression due to its accuracy, specificity, and sensitivity. However, the accuracy of qRT-PCR analysis strongly depends on transcript normalization using stably expressed reference genes. The aim of this study was to find internal reference genes for qRT-PCR analysis in various experimental conditions for seed, adventitious underground bud, and other organs of leafy spurge. Eleven candidate reference genes (BAM4, PU1, TRP-like, FRO1, ORE9, BAM1, SEU, ARF2, KAPP, ZTL, and MPK4 were selected from among 171 genes based on expression stabilities during seed germination and bud growth. The other ten candidate reference genes were selected from three different sources: (1 3 stably expressed leafy spurge genes (60S, bZIP21, and MD-100 identified from the analyses of leafy spurge microarray data; (2 3 orthologs of Arabidopsis "general purpose" traditional reference genes (GAPDH_1, GAPDH_2, and UBC; and (3 4 orthologs of Arabidopsis stably expressed genes (UBC9, SAND, PTB, and F-box identified from Affymetrix ATH1 whole-genome GeneChip studies. The expression stabilities of these 21 genes were ranked based on the C(T values of 72 samples using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ΔC(T method. Our analyses revealed SAND, PTB, ORE9, and ARF2 to be the most appropriate reference genes for accurate normalization of gene expression data. Since SAND and PTB were obtained from 4 orthologs of Arabidopsis, while ORE9 and ARF2 were selected from 171 leafy spurge genes, it was more efficient to identify good reference genes from the orthologs of other plant species that were known to be stably expressed than that of randomly testing endogenous genes. Nevertheless, the two newly identified leafy spurge genes, ORE9 and ARF2, can serve as orthologous candidates in the search for reference genes

  15. Method for Hot Real-Time Sampling of Pyrolysis Vapors

    Energy Technology Data Exchange (ETDEWEB)

    Pomeroy, Marc D [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2017-09-29

    Biomass Pyrolysis has been an increasing topic of research, in particular as a replacement for crude oil. This process utilizes moderate temperatures to thermally deconstruct the biomass which is then condensed into a mixture of liquid oxygenates to be used as fuel precursors. Pyrolysis oils contain more than 400 compounds, up to 60 percent of which do not re-volatilize for subsequent chemical analysis. Vapor chemical composition is also complicated as additional condensation reactions occur during the condensation and collection of the product. Due to the complexity of the pyrolysis oil, and a desire to catalytically upgrade the vapor composition before condensation, online real-time analytical techniques such as Molecular Beam Mass Spectrometry (MBMS) are of great use. However, in order to properly sample hot pyrolysis vapors, many challenges must be overcome. Sampling must occur within a narrow range of temperatures to reduce product composition changes from overheating or partial condensation or plugging of lines from condensed products. Residence times must be kept at a minimum to reduce further reaction chemistries. Pyrolysis vapors also form aerosols that are carried far downstream and can pass through filters resulting in build-up in downstream locations. The co-produced bio-char and ash from the pyrolysis process can lead to plugging of the sample lines, and must be filtered out at temperature, even with the use of cyclonic separators. A practical approach for considerations and sampling system design, as well as lessons learned are integrated into the hot analytical sampling system of the National Renewable Energy Laboratory's (NREL) Thermochemical Process Development Unit (TCPDU) to provide industrially relevant demonstrations of thermochemical transformations of biomass feedstocks at the pilot scale.

  16. The incidence and distribution characteristics of MLL rearrangements in Chinese acute myeloid leukemia patients by multiplex nested RT-PCR.

    Science.gov (United States)

    Yang, Hua; Cao, Tingting; Gao, Li; Wang, Lili; Zhu, Chengying; Xu, Yuanyuan; Jing, Yu; Zhu, Haiyan; Lv, Na; Yu, Li

    2017-07-20

    Occurrence of MLL (Mixed Lineage Leukemia) gene rearrangements indicates poor prognosis in acute myeloid leukemia (AML) patients. This is the first study to report the positive rate and distribution characteristics of MLL rearrangements in AML patients in north China. We used multiplex nested real time PCR (RT-PCR) to screen for incidence of 11 MLL rearrangements in 433 AML patients. Eleven MLL rearrangements included (MLL-PTD, MLL-AF9, MLL-ELL, MLL-AF10, MLL-AF17, MLL-AF6, MLL-ENL, MLL-AF1Q, MLL-CBP, MLL-AF1P, MLL-AFX1). There were 68 AML patients with MLL rearrangements, and the positive rate was 15.7%. MLL-PTD (4.84%) was detected in 21 patients, MLL-AF9 in 15, (3.46%), MLL-ELL in 10 (2.31%), MLL-AF10 in 8 (1.85%), MLL-AF1Q in 2 (0.46%), 3 cases each of MLL-AF17, MLL-AF6, MLL-ENL (0.69% each), a and single case each of MLL-CBP, MLL-AF1P, and MLL-AFX1 (0.23% each). The highest rate of MLL rearrangements was found in 24 patients with M5 subtype AML, occurring in 24 cases (35.3%). MLL rearrangements occurred in 21 patients with M2 subtype AML (30.9%), and in 10 patients with M4 subtype AML (14.7%). Screening fusion genes by multiplex nested RT-PCR is a convenient, fast, economical, and accurate method for diagnosis and predicting prognosis of AML.

  17. Real-time reverse transcription polymerase chain reaction method for detection of Canine distemper virus modified live vaccine shedding for differentiation from infection with wild-type strains.

    Science.gov (United States)

    Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A

    2014-01-01

    Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.

  18. Comparison of in-house and commercial real time-PCR based carbapenemase gene detection methods in Enterobacteriaceae and non-fermenting gram-negative bacterial isolates.

    Science.gov (United States)

    Smiljanic, M; Kaase, M; Ahmad-Nejad, P; Ghebremedhin, B

    2017-07-10

    Carbapenemase-producing gram-negative bacteria are increasing globally and have been associated with outbreaks in hospital settings. Thus, the accurate detection of these bacteria in infections is mandatory for administering the adequate therapy and infection control measures. This study aimed to establish and evaluate a multiplex real-time PCR assay for the simultaneous detection of carbapenemase gene variants in gram-negative rods and to compare the performance with a commercial RT-PCR assay (Check-Direct CPE). 116 carbapenem-resistant Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii isolates were genotyped for carbapenemase genes by PCR and sequencing. The defined isolates were used for the validation of the in-house RT-PCR by use of designed primer pairs and probes. Among the carbapenem-resistant isolates the genes bla KPC , bla VIM , bla NDM or bla OXA were detected. Both RT-PCR assays detected all bla KPC , bla VIM and bla NDM in the isolates. The in-house RT-PCR detected 53 of 67 (79.0%) whereas the commercial assay detected only 29 (43.3%) of the OXA genes. The in-house sufficiently distinguished the most prevalent OXA types (23-like and 48-like) in the melting curve analysis and direct detection of the genes from positive blood culture vials. The Check-Direct CPE and the in-house RT-PCR assay detected the carbapenem resistance from solid culture isolates. Moreover, the in-house assay enabled the identification of carbapenemase genes directly from positive blood-culture vials. However, we observed insufficient detection of various OXA genes in both assays. Nevertheless, the in-house RT-PCR detected the majority of the OXA type genes in Enterobacteriaceae and A. baumannii.

  19. Investigation of the Adaptability of Transient Stability Assessment Methods to Real-Time Operation

    DEFF Research Database (Denmark)

    Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Sommer, Stefan

    2012-01-01

    In this paper, an investigation of the adaptability of available transient stability assessment methods to real-time operation and their real-time performance is carried out. Two approaches based on Lyapunov’s method and the equal area criterion are analyzed. The results allow to determine...

  20. Real-time trajectory analysis using stacked invariance methods

    OpenAIRE

    Kitts, B.

    1998-01-01

    Invariance methods are used widely in pattern recognition as a preprocessing stage before algorithms such as neural networks are applied to the problem. A pattern recognition system has to be able to recognise objects invariant to scale, translation, and rotation. Presumably the human eye implements some of these preprocessing transforms in making sense of incoming stimuli, for example, placing signals onto a log scale. This paper surveys many of the commonly used invariance methods, and asse...

  1. Real-time earthquake monitoring using a search engine method.

    Science.gov (United States)

    Zhang, Jie; Zhang, Haijiang; Chen, Enhong; Zheng, Yi; Kuang, Wenhuan; Zhang, Xiong

    2014-12-04

    When an earthquake occurs, seismologists want to use recorded seismograms to infer its location, magnitude and source-focal mechanism as quickly as possible. If such information could be determined immediately, timely evacuations and emergency actions could be undertaken to mitigate earthquake damage. Current advanced methods can report the initial location and magnitude of an earthquake within a few seconds, but estimating the source-focal mechanism may require minutes to hours. Here we present an earthquake search engine, similar to a web search engine, that we developed by applying a computer fast search method to a large seismogram database to find waveforms that best fit the input data. Our method is several thousand times faster than an exact search. For an Mw 5.9 earthquake on 8 March 2012 in Xinjiang, China, the search engine can infer the earthquake's parameters in <1 s after receiving the long-period surface wave data.

  2. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  3. Improved Real-time Denoising Method Based on Lifting Wavelet Transform

    Directory of Open Access Journals (Sweden)

    Liu Zhaohua

    2014-06-01

    Full Text Available Signal denoising can not only enhance the signal to noise ratio (SNR but also reduce the effect of noise. In order to satisfy the requirements of real-time signal denoising, an improved semisoft shrinkage real-time denoising method based on lifting wavelet transform was proposed. The moving data window technology realizes the real-time wavelet denoising, which employs wavelet transform based on lifting scheme to reduce computational complexity. Also hyperbolic threshold function and recursive threshold computing can ensure the dynamic characteristics of the system, in addition, it can improve the real-time calculating efficiency as well. The simulation results show that the semisoft shrinkage real-time denoising method has quite a good performance in comparison to the traditional methods, namely soft-thresholding and hard-thresholding. Therefore, this method can solve more practical engineering problems.

  4. Quantitative RT-PCR analysis of estrogen receptor gene expression in laser microdissected prostate cancer tissue.

    Science.gov (United States)

    Walton, Thomas J; Li, Geng; McCulloch, Thomas A; Seth, Rashmi; Powe, Desmond G; Bishop, Michael C; Rees, Robert C

    2009-06-01

    Real-time quantitative RT-PCR analysis of laser microdissected tissue is considered the most accurate technique for determining tissue gene expression. The discovery of estrogen receptor beta (ERbeta) has focussed renewed interest on the role of estrogen receptors in prostate cancer, yet few studies have utilized the technique to analyze estrogen receptor gene expression in prostate cancer. Fresh tissue was obtained from 11 radical prostatectomy specimens and from 6 patients with benign prostate hyperplasia. Pure populations of benign and malignant prostate epithelium were laser microdissected, followed by RNA isolation and electrophoresis. Quantitative RT-PCR was performed using primers for androgen receptor (AR), estrogen receptor beta (ERbeta), estrogen receptor alpha (ERalpha), progesterone receptor (PGR) and prostate specific antigen (PSA), with normalization to two housekeeping genes. Differences in gene expression were analyzed using the Mann-Whitney U-test. Correlation coefficients were analyzed using Spearman's test. Significant positive correlations were seen when AR and AR-dependent PSA, and ERalpha and ERalpha-dependent PGR were compared, indicating a representative population of RNA transcripts. ERbeta gene expression was significantly over-expressed in the cancer group compared with benign controls (P cancer group (P prostate cancer specimens. In concert with recent studies the findings suggest differential production of ERbeta splice variants, which may play important roles in the genesis of prostate cancer. (c) 2009 Wiley-Liss, Inc.

  5. Real-time biscuit tile image segmentation method based on edge detection.

    Science.gov (United States)

    Matić, Tomislav; Aleksi, Ivan; Hocenski, Željko; Kraus, Dieter

    2018-05-01

    In this paper we propose a novel real-time Biscuit Tile Segmentation (BTS) method for images from ceramic tile production line. BTS method is based on signal change detection and contour tracing with a main goal of separating tile pixels from background in images captured on the production line. Usually, human operators are visually inspecting and classifying produced ceramic tiles. Computer vision and image processing techniques can automate visual inspection process if they fulfill real-time requirements. Important step in this process is a real-time tile pixels segmentation. BTS method is implemented for parallel execution on a GPU device to satisfy the real-time constraints of tile production line. BTS method outperforms 2D threshold-based methods, 1D edge detection methods and contour-based methods. Proposed BTS method is in use in the biscuit tile production line. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

  6. Evaluation of ALK gene rearrangement in central nervous system metastases of non-small-cell lung cancer using two-step RT-PCR technique.

    Science.gov (United States)

    Nicoś, M; Krawczyk, P; Wojas-Krawczyk, K; Bożyk, A; Jarosz, B; Sawicki, M; Trojanowski, T; Milanowski, J

    2017-12-01

    RT-PCR technique has showed a promising value as pre-screening method for detection of mRNA containing abnormal ALK sequences, but its sensitivity and specificity is still discussable. Previously, we determined the incidence of ALK rearrangement in CNS metastases of NSCLC using IHC and FISH methods. We evaluated ALK gene rearrangement using two-step RT-PCR method with EML4-ALK Fusion Gene Detection Kit (Entrogen, USA). The studied group included 145 patients (45 females, 100 males) with CNS metastases of NSCLC and was heterogeneous in terms of histology and smoking status. 21% of CNS metastases of NSCLC (30/145) showed presence of mRNA containing abnormal ALK sequences. FISH and IHC tests confirmed the presence of ALK gene rearrangement and expression of ALK abnormal protein in seven patients with positive result of RT-PCR analysis (4.8% of all patients, 20% of RT-PCR positive patients). RT-PCR method compared to FISH analysis achieved 100% of sensitivity and only 82.7% of specificity. IHC method compared to FISH method indicated 100% of sensitivity and 97.8% of specificity. In comparison to IHC, RT-PCR showed identical sensitivity with high number of false positive results. Utility of RT-PCR technique in screening of ALK abnormalities and in qualification patients for molecularly targeted therapies needs further validation.

  7. Investigation of the Adaptability of Transient Stability Assessment Methods to Real-Time Operation

    OpenAIRE

    Weckesser, Johannes Tilman Gabriel; Jóhannsson, Hjörtur; Sommer, Stefan; Østergaard, Jacob

    2012-01-01

    In this paper, an investigation of the adaptability of available transient stability assessment methods to real-time operation and their real-time performance is carried out. Two approaches based on Lyapunov’s method and the equal area criterion are analyzed. The results allow to determine the runtime of each method with respect to the number of inputs. Furthermore, it allows to identify, which method is preferable in case of changes in the power system such as the integration of distributed ...

  8. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Directory of Open Access Journals (Sweden)

    Alok Arun

    Full Text Available Real-time quantitative reverse transcription PCR (qRT-PCR is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae, two developmental stages (pupal and adult and two sexes (male and female, all of which were subjected to two food treatments (food stress and control feeding ad libitum. The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the

  9. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Science.gov (United States)

    Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression

  10. Embedded and real time system development a software engineering perspective concepts, methods and principles

    CERN Document Server

    Saeed, Saqib; Darwish, Ashraf; Abraham, Ajith

    2014-01-01

    Nowadays embedded and real-time systems contain complex software. The complexity of embedded systems is increasing, and the amount and variety of software in the embedded products are growing. This creates a big challenge for embedded and real-time software development processes and there is a need to develop separate metrics and benchmarks. “Embedded and Real Time System Development: A Software Engineering Perspective: Concepts, Methods and Principles” presents practical as well as conceptual knowledge of the latest tools, techniques and methodologies of embedded software engineering and real-time systems. Each chapter includes an in-depth investigation regarding the actual or potential role of software engineering tools in the context of the embedded system and real-time system. The book presents state-of-the art and future perspectives with industry experts, researchers, and academicians sharing ideas and experiences including surrounding frontier technologies, breakthroughs, innovative solutions and...

  11. Enhancing the sensitivity of Dengue virus serotype detection by RT-PCR among infected children in India.

    Science.gov (United States)

    Ahamed, Syed Fazil; Vivek, Rosario; Kotabagi, Shalini; Nayak, Kaustuv; Chandele, Anmol; Kaja, Murali-Krishna; Shet, Anita

    2017-06-01

    Dengue surveillance relies on reverse transcription-polymerase chain reaction (RT-PCR), for confirmation of dengue virus (DENV) serotypes. We compared efficacies of published and modified primer sets targeting envelope (Env) and capsid-premembrane (C-prM) genes for detection of circulating DENV serotypes in southern India. Acute samples from children with clinically-diagnosed dengue were used for RT-PCR testing. All samples were also subjected to dengue serology (NS1 antigen and anti-dengue-IgM/IgG rapid immunochromatographic assay). Nested RT-PCR was performed on viral RNA using three methods targeting 654bp C-prM, 511bp C-prM and 641bp Env regions, respectively. RT-PCR-positive samples were validated by population sequencing. Among 171 children with suspected dengue, 121 were dengue serology-positive and 50 were dengue serology-negative. Among 121 serology-positives, RT-PCR detected 91 (75.2%) by CprM654, 72 (59.5%) by CprM511, and 74 (61.1%) by Env641. Among 50 serology-negatives, 10 (20.0%) were detected by CprM654, 12 (24.0%) by CprM511, and 11 (22.0%) by Env641. Overall detection rate using three methods sequentially was 82.6% (100/121) among serology-positive and 40.0% (20/50) among serology-negative samples; 6.6% (8/120) had co-infection with multiple DENV serotypes. We conclude that detection of acute dengue was enhanced by a modified RT-PCR method targeting the 654bp C-prM region, and further improved by using all three methods sequentially. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Biomarker discovery for colon cancer using a 761 gene RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Hackett James R

    2007-08-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR is widely recognized to be the gold standard method for quantifying gene expression. Studies using RT-PCR technology as a discovery tool have historically been limited to relatively small gene sets compared to other gene expression platforms such as microarrays. We have recently shown that TaqMan® RT-PCR can be scaled up to profile expression for 192 genes in fixed paraffin-embedded (FPE clinical study tumor specimens. This technology has also been used to develop and commercialize a widely used clinical test for breast cancer prognosis and prediction, the Onco typeDX™ assay. A similar need exists in colon cancer for a test that provides information on the likelihood of disease recurrence in colon cancer (prognosis and the likelihood of tumor response to standard chemotherapy regimens (prediction. We have now scaled our RT-PCR assay to efficiently screen 761 biomarkers across hundreds of patient samples and applied this process to biomarker discovery in colon cancer. This screening strategy remains attractive due to the inherent advantages of maintaining platform consistency from discovery through clinical application. Results RNA was extracted from formalin fixed paraffin embedded (FPE tissue, as old as 28 years, from 354 patients enrolled in NSABP C-01 and C-02 colon cancer studies. Multiplexed reverse transcription reactions were performed using a gene specific primer pool containing 761 unique primers. PCR was performed as independent TaqMan® reactions for each candidate gene. Hierarchal clustering demonstrates that genes expected to co-express form obvious, distinct and in certain cases very tightly correlated clusters, validating the reliability of this technical approach to biomarker discovery. Conclusion We have developed a high throughput, quantitatively precise multi-analyte gene expression platform for biomarker discovery that approaches low density DNA arrays in numbers of

  13. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets

    Directory of Open Access Journals (Sweden)

    Xin Liu

    2018-04-01

    Full Text Available Background Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported. Method In this study, 10 candidate RGs namely, 18S, 60S, CYP, GAPCP1, GAPDH2, EF1B, MDH, SAND, TUA1, and TUA6, were singled out from the transcriptome database of S. chamaejasme, and their expression stability under three abiotic stresses (drought, cold, and salt and three hormone treatments (abscisic acid, ABA; gibberellin, GA; ethephon, ETH were estimated with the programs geNorm, NormFinder, and BestKeeper. Result Our results showed that GAPCP1 and EF1B were the best combination for the three abiotic stresses, whereas TUA6 and SAND, TUA1 and CYP, GAPDH2 and 60S were the best choices for ABA, GA, and ETH treatment, respectively. Moreover, GAPCP1 and 60S were assessed to be the best combination for all samples, and 18S was the least stable RG for use as an internal control in all of the experimental subsets. The expression patterns of two target genes (P5CS2 and GI further verified that the RGs that we selected were suitable for gene expression normalization. Discussion

  14. Power System Real-Time Monitoring by Using PMU-Based Robust State Estimation Method

    DEFF Research Database (Denmark)

    Zhao, Junbo; Zhang, Gexiang; Das, Kaushik

    2016-01-01

    Accurate real-time states provided by the state estimator are critical for power system reliable operation and control. This paper proposes a novel phasor measurement unit (PMU)-based robust state estimation method (PRSEM) to real-time monitor a power system under different operation conditions...... the system real-time states with good robustness and can address several kinds of BD.......-based bad data (BD) detection method, which can handle the smearing effect and critical measurement errors, is presented. We evaluate PRSEM by using IEEE benchmark test systems and a realistic utility system. The numerical results indicate that, in short computation time, PRSEM can effectively track...

  15. Real-time tumor ablation simulation based on the dynamic mode decomposition method

    KAUST Repository

    Bourantas, George C.; Ghommem, Mehdi; Kagadis, George C.; Katsanos, Konstantinos H.; Loukopoulos, Vassilios C.; Burganos, Vasilis N.; Nikiforidis, George C.

    2014-01-01

    Purpose: The dynamic mode decomposition (DMD) method is used to provide a reliable forecasting of tumor ablation treatment simulation in real time, which is quite needed in medical practice. To achieve this, an extended Pennes bioheat model must

  16. Simultaneous VENTANA IHC and RT-PCR testing of ALK status in Chinese non-small cell lung cancer patients and response to crizotinib.

    Science.gov (United States)

    Xu, Chun-Wei; Wang, Wen-Xian; Chen, Yan-Ping; Chen, Yu; Liu, Wei; Zhong, Li-Hua; Chen, Fang-Fang; Zhuang, Wu; Song, Zheng-Bo; Chen, Xiao-Hui; Huang, Yun-Jian; Guan, Yan-Fang; Yi, Xin; Lv, Tang-Feng; Zhu, Wei-Feng; Lu, Jian-Ping; Wang, Xiao-Jiang; Shi, Yi; Lin, Xian-Dong; Chen, Gang; Song, Yong

    2018-04-11

    ALK rearrangement-advanced NSCLC patients respond to crizotinib. ALK rearrangement is currently determined with RT-PCR. VENTANA IHC is a standard method to identify ALK protein overexpression in NSCLC; however, VENTANA IHC has rarely been used to determine the response to crizotinib in Chinese patients with NSCLC and ALK overexpression. To better clarify the clinical implication of VENTANA IHC to detect ALK rearrangements, we conducted this study to analyze VENTANA IHC and RT-PCR in a large cohort of Chinese patients with NSCLC undergoing screening for ALK rearrangements. A total of 1720 patients with NSCLC who had ALK rearrangements detected by VENTANA IHC and/or RT-PCR were included in this analysis. We compared the efficacy and survival of ALK-positive patients detected by VENTANA IHC and RT-PCR. We used NGS to identify patients in whom the two methods were inconsistent. Among 1720 patients, 187 (10.87%) were shown to be ALK-positive by VENTANA IHC and/or RT-PCR, and 66 received crizotinib treatment. We identified 10.27% (172/1674) of patients as ALK-positive by the VENTANA IHC method, and 12.73% (41/322) of patients had ALK rearrangements by the RT-PCR method. Twenty-nine of 276 (10.51%) ALK-positive patients were simultaneously analyzed using VENTANA IHC and RT-PCR. The overall response rates were 65.90% (29/44) by VENTANA IHC and 55.88% (19/34) by RT-PCR. The disease control rates were 86.36% (38/44) by VENTANA IHC and 76.47% (26/34) by RT-PCR. In contrast, the median progression-free survival for VENTANA IHC and RT-PCR was 8.5 and 9.2 months, respectively. The VENTANA IHC and RT-PCR results obtained for 6 of 17 ALK-positive patients were inconsistent based on NGS; specifically, 4 patients had EML4-ALK fusions, 2 patients had non EML4-ALK fusions, 1 patient had a KCL1-ALK fusion, and one patient had a FBXO36-ALK fusion. VENTANA IHC is a reliable and rapid screening tool used in routine pathologic laboratories for the identification of suitable candidates for

  17. Quantification of Artifact Reduction With Real-Time Cine Four-Dimensional Computed Tomography Acquisition Methods

    International Nuclear Information System (INIS)

    Langner, Ulrich W.; Keall, Paul J.

    2010-01-01

    Purpose: To quantify the magnitude and frequency of artifacts in simulated four-dimensional computed tomography (4D CT) images using three real-time acquisition methods- direction-dependent displacement acquisition, simultaneous displacement and phase acquisition, and simultaneous displacement and velocity acquisition- and to compare these methods with commonly used retrospective phase sorting. Methods and Materials: Image acquisition for the four 4D CT methods was simulated with different displacement and velocity tolerances for spheres with radii of 0.5 cm, 1.5 cm, and 2.5 cm, using 58 patient-measured tumors and respiratory motion traces. The magnitude and frequency of artifacts, CT doses, and acquisition times were computed for each method. Results: The mean artifact magnitude was 50% smaller for the three real-time methods than for retrospective phase sorting. The dose was ∼50% lower, but the acquisition time was 20% to 100% longer for the real-time methods than for retrospective phase sorting. Conclusions: Real-time acquisition methods can reduce the frequency and magnitude of artifacts in 4D CT images, as well as the imaging dose, but they increase the image acquisition time. The results suggest that direction-dependent displacement acquisition is the preferred real-time 4D CT acquisition method, because on average, the lowest dose is delivered to the patient and the acquisition time is the shortest for the resulting number and magnitude of artifacts.

  18. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba skin biopsies

    Directory of Open Access Journals (Sweden)

    Casini Silvia

    2006-09-01

    Full Text Available Abstract Background Odontocete cetaceans occupy the top position of the marine food-web and are particularly sensitive to the bioaccumulation of lipophilic contaminants. The effects of environmental pollution on these species are highly debated and various ecotoxicological studies have addressed the impact of xenobiotic compounds on marine mammals, raising conservational concerns. Despite its sensitivity, quantitative real-time PCR (qRT-PCR has never been used to quantify gene induction caused by exposure of cetaceans to contaminants. A limitation for the application of qRT-PCR is the need for appropriate reference genes which allow the correct quantification of gene expression. A systematic evaluation of potential reference genes in cetacean skin biopsies is presented, in order to validate future qRT-PCR studies aiming at using the expression of selected genes as non-lethal biomarkers. Results Ten commonly used housekeeping genes (HKGs were partially sequenced in the striped dolphin (Stenella coeruleoalba and, for each gene, PCR primer pairs were specifically designed and tested in qRT-PCR assays. The expression of these potential control genes was examined in 30 striped dolphin skin biopsy samples, obtained from specimens sampled in the north-western Mediterranean Sea. The stability of selected control genes was determined using three different specific VBA applets (geNorm, NormFinder and BestKeeper which produce highly comparable results. Glyceraldehyde-3P-dehydrogenase (GAPDH and tyrosine 3-monooxygenase (YWHAZ always rank as the two most stably expressed HKGs according to the analysis with geNorm and Normfinder, and are defined as optimal control genes by BestKepeer. Ribosomal protein L4 (RPL4 and S18 (RPS18 also exhibit a remarkable stability of their expression levels. On the other hand, transferrin receptor (TFRC, phosphoglycerate kinase 1 (PGK1, hypoxanthine ribosyltransferase (HPRT1 and β-2-microglobin (B2M show variable expression

  19. Research on Control Method Based on Real-Time Operational Reliability Evaluation for Space Manipulator

    Directory of Open Access Journals (Sweden)

    Yifan Wang

    2014-05-01

    Full Text Available A control method based on real-time operational reliability evaluation for space manipulator is presented for improving the success rate of a manipulator during the execution of a task. In this paper, a method for quantitative analysis of operational reliability is given when manipulator is executing a specified task; then a control model which could control the quantitative operational reliability is built. First, the control process is described by using a state space equation. Second, process parameters are estimated in real time using Bayesian method. Third, the expression of the system's real-time operational reliability is deduced based on the state space equation and process parameters which are estimated using Bayesian method. Finally, a control variable regulation strategy which considers the cost of control is given based on the Theory of Statistical Process Control. It is shown via simulations that this method effectively improves the operational reliability of space manipulator control system.

  20. Real-time stability monitoring method for boiling water reactor nuclear power plants

    International Nuclear Information System (INIS)

    Fukunishi, K.; Suzuki, S.

    1987-01-01

    A method for real-time stability monitoring is developed for supervising the steady-state operation of a boiling water reactor core. The decay ratio of the reactor power fluctuation is determined by measuring only the output neutron noise. The concept of an inverse system is introduced to identify the dynamic characteristics of the reactor core. The adoption of an adaptive digital filter is useful in real-time identification. A feasibility test that used measured output noise as an indication of reactor power suggests that this method is useful in a real-time stability monitoring system. Using this method, the tedious and difficult work for modeling reactor core dynamics can be reduced. The method employs a simple algorithm that eliminates the need for stochastic computation, thus making the method suitable for real-time computation with a simple microprocessor. In addition, there is no need to disturb the reactor core during operation. Real-time stability monitoring using the proposed algorithm may allow operation under less stable margins

  1. Avian metapneumovirus RT-nested-PCR: a novel false positive reducing inactivated control virus with potential applications to other RNA viruses and real time methods.

    Science.gov (United States)

    Falchieri, Marco; Brown, Paul A; Catelli, Elena; Naylor, Clive J

    2012-12-01

    Using reverse genetics, an avian metapneumovirus (AMPV) was modified for use as a positive control for validating all stages of a popular established RT-nested PCR, used in the detection of the two major AMPV subtypes (A and B). Resultant amplicons were of increased size and clearly distinguishable from those arising from unmodified virus, thus allowing false positive bands, due to control virus contamination of test samples, to be identified readily. Absorption of the control virus onto filter paper and subsequent microwave irradiation removed all infectivity while its function as an efficient RT-nested-PCR template was unaffected. Identical amplicons were produced after storage for one year. The modified virus is likely to have application as an internal standard as well as in real time methods. Additions to AMPV of RNA from other RNA viruses, including hazardous examples such HIV and influenza, are likely to yield similar safe RT-PCR controls. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. A Comparison of Iterative 2D-3D Pose Estimation Methods for Real-Time Applications

    DEFF Research Database (Denmark)

    Grest, Daniel; Krüger, Volker; Petersen, Thomas

    2009-01-01

    This work compares iterative 2D-3D Pose Estimation methods for use in real-time applications. The compared methods are available for public as C++ code. One method is part of the openCV library, namely POSIT. Because POSIT is not applicable for planar 3Dpoint congurations, we include the planar P...

  3. The inverse method parametric verification of real-time embedded systems

    CERN Document Server

    André , Etienne

    2013-01-01

    This book introduces state-of-the-art verification techniques for real-time embedded systems, based on the inverse method for parametric timed automata. It reviews popular formalisms for the specification and verification of timed concurrent systems and, in particular, timed automata as well as several extensions such as timed automata equipped with stopwatches, linear hybrid automata and affine hybrid automata.The inverse method is introduced, and its benefits for guaranteeing robustness in real-time systems are shown. Then, it is shown how an iteration of the inverse method can solv

  4. A real-time data transmission method based on Linux for physical experimental readout systems

    International Nuclear Information System (INIS)

    Cao Ping; Song Kezhu; Yang Junfeng

    2012-01-01

    In a typical physical experimental instrument, such as a fusion or particle physical application, the readout system generally implements an interface between the data acquisition (DAQ) system and the front-end electronics (FEE). The key task of a readout system is to read, pack, and forward the data from the FEE to the back-end data concentration center in real time. To guarantee real-time performance, the VxWorks operating system (OS) is widely used in readout systems. However, VxWorks is not an open-source OS, which gives it has many disadvantages. With the development of multi-core processor and new scheduling algorithm, Linux OS exhibits performance in real-time applications similar to that of VxWorks. It has been successfully used even for some hard real-time systems. Discussions and evaluations of real-time Linux solutions for a possible replacement of VxWorks arise naturally. In this paper, a real-time transmission method based on Linux is introduced. To reduce the number of transfer cycles for large amounts of data, a large block of contiguous memory buffer for DMA transfer is allocated by modifying the Linux Kernel (version 2.6) source code slightly. To increase the throughput for network transmission, the user software is designed into formation of parallelism. To achieve high performance in real-time data transfer from hardware to software, mapping techniques must be used to avoid unnecessary data copying. A simplified readout system is implemented with 4 readout modules in a PXI crate. This system can support up to 48 MB/s data throughput from the front-end hardware to the back-end concentration center through a Gigabit Ethernet connection. There are no restrictions on the use of this method, hardware or software, which means that it can be easily migrated to other interrupt related applications.

  5. Quantitation of TGF-beta1 mRNA in porcine mesangial cells by comparative kinetic RT/PCR: comparison with ribonuclease protection assay and in situ hybridization.

    Science.gov (United States)

    Ceol, M; Forino, M; Gambaro, G; Sauer, U; Schleicher, E D; D'Angelo, A; Anglani, F

    2001-01-01

    Gene expression can be examined with different techniques including ribonuclease protection assay (RPA), in situ hybridisation (ISH), and quantitative reverse transcription-polymerase chain reaction (RT/PCR). These methods differ considerably in their sensitivity and precision in detecting and quantifying low abundance mRNA. Although there is evidence that RT/PCR can be performed in a quantitative manner, the quantitative capacity of this method is generally underestimated. To demonstrate that the comparative kinetic RT/PCR strategy-which uses a housekeeping gene as internal standard-is a quantitative method to detect significant differences in mRNA levels between different samples, the inhibitory effect of heparin on phorbol 12-myristate 13-acetate (PMA)-induced-TGF-beta1 mRNA expression was evaluated by RT/PCR and RPA, the standard method of mRNA quantification, and the results were compared. The reproducibility of RT/PCR amplification was calculated by comparing the quantity of G3PDH and TGF-beta1 PCR products, generated during the exponential phases, estimated from two different RT/PCR (G3PDH, r = 0.968, P = 0.0000; TGF-beta1, r = 0.966, P = 0.0000). The quantitative capacity of comparative kinetic RT/PCR was demonstrated by comparing the results obtained from RPA and RT/PCR using linear regression analysis. Starting from the same RNA extraction, but using only 1% of the RNA for the RT/PCR compared to RPA, significant correlation was observed (r = 0.984, P = 0.0004). Moreover the morphometric analysis of ISH signal was applied for the semi-quantitative evaluation of the expression and localisation of TGF-beta1 mRNA in the entire cell population. Our results demonstrate the close similarity of the RT/PCR and RPA methods in giving quantitative information on mRNA expression and indicate the possibility to adopt the comparative kinetic RT/PCR as reliable quantitative method of mRNA analysis. Copyright 2001 Wiley-Liss, Inc.

  6. Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

    Science.gov (United States)

    Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

    1995-06-01

    For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

  7. Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses

    Directory of Open Access Journals (Sweden)

    Parida Manmohan

    2008-01-01

    Full Text Available Abstract Background Dengue is emerging as a major public health concern in many parts of the world. The development of a one-step, single tube, rapid, and multiplex reverse transcription polymerase chain reaction (M-RT-PCR for simultaneous detection and typing of dengue virus using serotype specific primers during acute phase of illness is reported. Results An optimal assay condition with zero background was established having no cross-reaction with closely related members of flavivirus (Japanese encephalitis, West Nile, Yellow fever and alphavirus (Chikungunya. The feasibility of M-RT-PCR assay for clinical diagnosis was validated with 620 acute phase dengue patient sera samples of recent epidemics in India. The comparative evaluation vis a vis conventional virus isolation revealed higher sensitivity. None of the forty healthy serum samples screened in the present study revealed any amplification, thereby establishing specificity of the reported assay for dengue virus only. Conclusion These findings clearly suggested that M-RT-PCR assay reported in the present study is the rapid and cost-effective method for simultaneous detection as well as typing of the dengue virus in acute phase patient serum samples. Thus, the M-RT-PCR assay developed in this study will serve as a very useful tool for rapid diagnosis and typing of dengue infections in endemic areas.

  8. A comparison of moving object detection methods for real-time moving object detection

    Science.gov (United States)

    Roshan, Aditya; Zhang, Yun

    2014-06-01

    Moving object detection has a wide variety of applications from traffic monitoring, site monitoring, automatic theft identification, face detection to military surveillance. Many methods have been developed across the globe for moving object detection, but it is very difficult to find one which can work globally in all situations and with different types of videos. The purpose of this paper is to evaluate existing moving object detection methods which can be implemented in software on a desktop or laptop, for real time object detection. There are several moving object detection methods noted in the literature, but few of them are suitable for real time moving object detection. Most of the methods which provide for real time movement are further limited by the number of objects and the scene complexity. This paper evaluates the four most commonly used moving object detection methods as background subtraction technique, Gaussian mixture model, wavelet based and optical flow based methods. The work is based on evaluation of these four moving object detection methods using two (2) different sets of cameras and two (2) different scenes. The moving object detection methods have been implemented using MatLab and results are compared based on completeness of detected objects, noise, light change sensitivity, processing time etc. After comparison, it is observed that optical flow based method took least processing time and successfully detected boundary of moving objects which also implies that it can be implemented for real-time moving object detection.

  9. Adding Timing Requirements to the CODARTS Real-Time Software Design Method

    DEFF Research Database (Denmark)

    Bach, K.R.

    The CODARTS software design method consideres how concurrent, distributed and real-time applications can be designed. Although accounting for the important issues of task and communication, the method does not provide means for expressing the timeliness of the tasks and communication directly...

  10. Detection of Potato Leaf Roll Virus (PLRV), Potato Virus Y (PVY) and Potato Virus X (PVX) on Five Potato Varieties by Using of DAS-ELISA and RT-PCR Methods

    OpenAIRE

    Kuswinanti, Tutik

    2012-01-01

    Potato is a staple food crop that widely grown around the world. Virus infection is main factor that affects great loss of the potato production. Potato virus X(PVX), potato virus Y(PVY),and potato leaf roll virus(PLRV) are top three viruses that result in decreased yield of potato in Indonesia. Therefore, the rapid methods of DAS-ELISA was studied to test tuber samples of five potato varieties, Granola, Atlantik, Raja, Super John, Kalosi, and Masalle. Two simple, rapid, sensitive, reliable...

  11. Real-Time Shop-Floor Production Performance Analysis Method for the Internet of Manufacturing Things

    Directory of Open Access Journals (Sweden)

    Yingfeng Zhang

    2014-04-01

    Full Text Available Typical challenges that manufacturing enterprises are facing now are compounded by lack of timely, accurate, and consistent information of manufacturing resources. As a result, it is difficult to analyze the real-time production performance for the shop-floor. In this paper, the definition and overall architecture of the internet of manufacturing things is presented to provide a new paradigm by extending the techniques of internet of things (IoT to manufacturing field. Under this architecture, the real-time primitive events which occurred at different manufacturing things such as operators, machines, pallets, key materials, and so forth can be easily sensed. Based on these distributed primitive events, a critical event model is established to automatically analyze the real-time production performance. Here, the up-level production performance analysis is regarded as a series of critical events, and the real-time value of each critical event can be easily calculated according to the logical and sequence relationships among these multilevel events. Finally, a case study is used to illustrate how to apply the designed methods to analyze the real-time production performance.

  12. Inter-laboratory ring trial to evaluate real-time reverse transcription polymerase chain reaction methods used for detection of infectious pancreatic necrosis virus in Chile

    Directory of Open Access Journals (Sweden)

    David Tapia

    2017-07-01

    Conclusions: Overall, the ring trial showed high values of sensitivity and specificity, with some problems of repeatability and inter-laboratory variability. This last issue needs to be addressed in order to allow harmonized diagnostic of IPNV within the country. We recommend the use of the NRL methods as validated and reliable qRT-PCR protocols for the detection of IPNV.

  13. A simple RT-PCR-based strategy for screening connexin identity

    Directory of Open Access Journals (Sweden)

    M. Urban

    1999-08-01

    Full Text Available Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

  14. Evaluation of gamma-sterilization (60Co) by RT-PCR by DHFR expression detection

    International Nuclear Information System (INIS)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de; Vieira, Daniel P.

    2007-01-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a 60 Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  15. Evaluation of gamma-sterilization ({sup 60}Co) by RT-PCR by DHFR expression detection

    Energy Technology Data Exchange (ETDEWEB)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de [Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil)]. E-mail: anapaulagconverso@gmail.com; hfandrad@usp.br; Vieira, Daniel P. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil); E-mail: dperezv@usp.br

    2007-07-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a {sup 60}Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  16. Method and apparatus for real-time measurement of fuel gas compositions and heating values

    Science.gov (United States)

    Zelepouga, Serguei; Pratapas, John M.; Saveliev, Alexei V.; Jangale, Vilas V.

    2016-03-22

    An exemplary embodiment can be an apparatus for real-time, in situ measurement of gas compositions and heating values. The apparatus includes a near infrared sensor for measuring concentrations of hydrocarbons and carbon dioxide, a mid infrared sensor for measuring concentrations of carbon monoxide and a semiconductor based sensor for measuring concentrations of hydrogen gas. A data processor having a computer program for reducing the effects of cross-sensitivities of the sensors to components other than target components of the sensors is also included. Also provided are corresponding or associated methods for real-time, in situ determination of a composition and heating value of a fuel gas.

  17. Detection of rabies in camel, goat and cattle in Sudan using Fluorescent antibody test (FAT and hemi nested Polymerase Chain Reaction (hnRT-PCR

    Directory of Open Access Journals (Sweden)

    Baraa Abdalaziz Ahmed

    2016-09-01

    Full Text Available Objective: The objective of this study was to identify rabies virus in camels and other animals in Sudan. Materials and methods: Four camel samples were collected from Garraht Elzawia, Kab-kabia and North Darfur areas in Sudan. The samples were collected based on clinical signs. In addition, two camel samples were obtained from Khartoum and Tambool, one goat sample was collected from El-Fashir, and one cattle sample was obtained from Atbara. The samples were transported to the Veterinary Research Institute (VRI at Khartoum, Sudan for further studies. The samples were subjected for nested and hemi nested RT-PCR (hnRT-PCR along with the gold standard Fluorescent antibody test (FAT to diagnose rabies. Results: Out of eight samples, seven were found to be positive by both FAT and RT-PCR methods. The remaining one sample was positive by FAT but negative by hnRT-PCR indicating the suitablity of hnRT-PCR along with FAT for accurate diagnosis of rabies in animals. Conclusion: The study concluded that FAT and RT-PCR are useful tools for research and diagnosis of rabies. [J Adv Vet Anim Res 2016; 3(3.000: 274-277

  18. European validation of Real-Time PCR method for detection of Salmonella spp. in pork meat.

    Science.gov (United States)

    Delibato, Elisabetta; Rodriguez-Lazaro, David; Gianfranceschi, Monica; De Cesare, Alessandra; Comin, Damiano; Gattuso, Antonietta; Hernandez, Marta; Sonnessa, Michele; Pasquali, Frédérique; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Prukner-Radovcic, Estella; Horvatek Tomic, Danijela; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John E; Chemaly, Marianne; Le Gall, Francoise; González-García, Patricia; Lettini, Antonia Anna; Lukac, Maja; Quesne, Segolénè; Zampieron, Claudia; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Proroga, Yolande T R; Capuano, Federico; Manfreda, Gerardo; De Medici, Dario

    2014-08-01

    The classical microbiological method for detection of Salmonella spp. requires more than five days for final confirmation, and consequently there is a need for an alternative methodology for detection of this pathogen particularly in those food categories with a short shelf-life. This study presents an international (at European level) ISO 16140-based validation study of a non-proprietary Real-Time PCR-based method that can generate final results the day following sample analysis. It is based on an ISO compatible enrichment coupled to an easy and inexpensive DNA extraction and a consolidated Real-Time PCR assay. Thirteen laboratories from seven European Countries participated to this trial, and pork meat was selected as food model. The limit of detection observed was down to 10 CFU per 25 g of sample, showing excellent concordance and accordance values between samples and laboratories (100%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (100%) when the results obtained for the Real-Time PCR-based methods were compared to those of the ISO 6579:2002 standard method. The results of this international trial demonstrate that the evaluated Real-Time PCR-based method represents an excellent alternative to the ISO standard. In fact, it shows an equal and solid performance as well as it reduces dramatically the extent of the analytical process, and can be easily implemented routinely by the Competent Authorities and Food Industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

    Science.gov (United States)

    Spackman, Erica; Suarez, David L

    2005-01-01

    Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

  20. RT-PCR protocols [Methods in molecular biology, v. 193

    National Research Council Canada - National Science Library

    O'Connell, Joseph

    2002-01-01

    .... Here the newcomer will find readily reproducible protocols for highly sensitive detection and quantification of gene expression, the in situ localization of gene expression in tissue, and the cloning...

  1. Animal DNA identification in food products and animal feed by real time polymerase chain reaction method

    Directory of Open Access Journals (Sweden)

    Людмила Мар’янівна Іщенко

    2016-11-01

    Full Text Available Approbation of diagnostic tests for species identification of beef, pork and chicken by real time polymerase chain reaction method was done. Meat food, including heat treated and animal feed, was used for research. The fact of inconsistencies was revealed for product composition of some meat products that is marked by manufacturer 

  2. An Approach for Real-time Levee Health Monitoring Using Signal Processing Methods

    NARCIS (Netherlands)

    Pyayt, A.L.; Kozionov, A.P.; Mokhov, I.I.; Lang, B.; Krzhizhanovskaya, V.V.; Sloot, P.M.A.

    2013-01-01

    We developed a levee health monitoring system within the UrbanFlood project funded under the EU 7th Framework Programme. A novel real-time levee health assessment Artificial Intelligence system is developed using data-driven methods. The system is implemented in the UrbanFlood early warning system.

  3. Detection and Analysis of Circular RNAs by RT-PCR.

    Science.gov (United States)

    Panda, Amaresh C; Gorospe, Myriam

    2018-03-20

    Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.

  4. Study on APD real time compensation methods of laser Detection system

    International Nuclear Information System (INIS)

    Feng Ying; Zhang He; Zhang Xiangjin; Liu Kun

    2011-01-01

    their operating principles. The constant false alarm rate compensation can't detect the pulse signal which comes randomly. Therefore real-time performance can't be realized. The noise compensation can meet the request of real-time performance. If it is used in the environment where background light is intense or changes acutely, there is a better effect. The temperature compensation can also achieve the real-time performance request. If it is used in the environment where temperature changes acutely, there is also a better effect. Aim at such problems, this paper presents that different APD real-time compensations should be adopt to adapt to different environments. The exiting temperature compensation adjusts output voltage by using variable resistance to regulate input voltage. Its structure is complex; the real-time performance is worse. In order to remedy these defects, a real-time temperature compensation which is based on switch on-off time of switching power supply is designed. Its feasibility and operating stability are confirmed by plate making and experiment. At last, the comparison experiments between the real-time noise compensation and the real-time temperature compensation is carried out in the environments where temperature is almost invariant and background light acutely changes from5lux to150lux . The result shows that the operating effect of the real-time noise compensation is better here, the noise minifies to a sixth of original noise. The comparison experiments between the real-time noise compensation and the real-time temperature compensation is carried out in darkroom where background light is 5lux and temperature almost rapidly changes from -20 deg. C to 80 deg. C. The result shows that the operating effect of the real-time temperature compensation is better here, the noise minifies to a seventh of original noise. Moreover, these methods can be applied to other type detection systems of weak photoelectric signal; they have high actual application

  5. Study on APD real time compensation methods of laser Detection system

    Energy Technology Data Exchange (ETDEWEB)

    Feng Ying; Zhang He; Zhang Xiangjin; Liu Kun, E-mail: fy_caimi@163.com [ZNDY of Ministerial Key Laboratory, Nanjing University of Science and Technology, Nanjing 210094 (China)

    2011-02-01

    by analyzing their operating principles. The constant false alarm rate compensation can't detect the pulse signal which comes randomly. Therefore real-time performance can't be realized. The noise compensation can meet the request of real-time performance. If it is used in the environment where background light is intense or changes acutely, there is a better effect. The temperature compensation can also achieve the real-time performance request. If it is used in the environment where temperature changes acutely, there is also a better effect. Aim at such problems, this paper presents that different APD real-time compensations should be adopt to adapt to different environments. The exiting temperature compensation adjusts output voltage by using variable resistance to regulate input voltage. Its structure is complex; the real-time performance is worse. In order to remedy these defects, a real-time temperature compensation which is based on switch on-off time of switching power supply is designed. Its feasibility and operating stability are confirmed by plate making and experiment. At last, the comparison experiments between the real-time noise compensation and the real-time temperature compensation is carried out in the environments where temperature is almost invariant and background light acutely changes from5lux to150lux . The result shows that the operating effect of the real-time noise compensation is better here, the noise minifies to a sixth of original noise. The comparison experiments between the real-time noise compensation and the real-time temperature compensation is carried out in darkroom where background light is 5lux and temperature almost rapidly changes from -20 deg. C to 80 deg. C. The result shows that the operating effect of the real-time temperature compensation is better here, the noise minifies to a seventh of original noise. Moreover, these methods can be applied to other type detection systems of weak photoelectric signal; they

  6. Study on APD real time compensation methods of laser Detection system

    Science.gov (United States)

    Ying, Feng; He, Zhang; Xiangjin, Zhang; Kun, Liu

    2011-02-01

    their operating principles. The constant false alarm rate compensation can't detect the pulse signal which comes randomly. Therefore real-time performance can't be realized. The noise compensation can meet the request of real-time performance. If it is used in the environment where background light is intense or changes acutely, there is a better effect. The temperature compensation can also achieve the real-time performance request. If it is used in the environment where temperature changes acutely, there is also a better effect. Aim at such problems, this paper presents that different APD real-time compensations should be adopt to adapt to different environments. The exiting temperature compensation adjusts output voltage by using variable resistance to regulate input voltage. Its structure is complex; the real-time performance is worse. In order to remedy these defects, a real-time temperature compensation which is based on switch on-off time of switching power supply is designed. Its feasibility and operating stability are confirmed by plate making and experiment. At last, the comparison experiments between the real-time noise compensation and the real-time temperature compensation is carried out in the environments where temperature is almost invariant and background light acutely changes from5lux to150lux . The result shows that the operating effect of the real-time noise compensation is better here, the noise minifies to a sixth of original noise. The comparison experiments between the real-time noise compensation and the real-time temperature compensation is carried out in darkroom where background light is 5lux and temperature almost rapidly changes from -20°C to 80°C. The result shows that the operating effect of the real-time temperature compensation is better here, the noise minifies to a seventh of original noise. Moreover, these methods can be applied to other type detection systems of weak photoelectric signal; they have high actual application value.

  7. Change Semantic Constrained Online Data Cleaning Method for Real-Time Observational Data Stream

    Science.gov (United States)

    Ding, Yulin; Lin, Hui; Li, Rongrong

    2016-06-01

    to large estimation error. In order to achieve the best generalization error, it is an important challenge for the data cleaning methodology to be able to characterize the behavior of data stream distributions and adaptively update a model to include new information and remove old information. However, the complicated data changing property invalidates traditional data cleaning methods, which rely on the assumption of a stationary data distribution, and drives the need for more dynamic and adaptive online data cleaning methods. To overcome these shortcomings, this paper presents a change semantics constrained online filtering method for real-time observational data. Based on the principle that the filter parameter should vary in accordance to the data change patterns, this paper embeds semantic description, which quantitatively depicts the change patterns in the data distribution to self-adapt the filter parameter automatically. Real-time observational water level data streams of different precipitation scenarios are selected for testing. Experimental results prove that by means of this method, more accurate and reliable water level information can be available, which is prior to scientific and prompt flood assessment and decision-making.

  8. CHANGE SEMANTIC CONSTRAINED ONLINE DATA CLEANING METHOD FOR REAL-TIME OBSERVATIONAL DATA STREAM

    Directory of Open Access Journals (Sweden)

    Y. Ding

    2016-06-01

    data streams, which may led to large estimation error. In order to achieve the best generalization error, it is an important challenge for the data cleaning methodology to be able to characterize the behavior of data stream distributions and adaptively update a model to include new information and remove old information. However, the complicated data changing property invalidates traditional data cleaning methods, which rely on the assumption of a stationary data distribution, and drives the need for more dynamic and adaptive online data cleaning methods. To overcome these shortcomings, this paper presents a change semantics constrained online filtering method for real-time observational data. Based on the principle that the filter parameter should vary in accordance to the data change patterns, this paper embeds semantic description, which quantitatively depicts the change patterns in the data distribution to self-adapt the filter parameter automatically. Real-time observational water level data streams of different precipitation scenarios are selected for testing. Experimental results prove that by means of this method, more accurate and reliable water level information can be available, which is prior to scientific and prompt flood assessment and decision-making.

  9. Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification.

    Science.gov (United States)

    Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe

    2017-08-15

    Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.

  10. A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza A and the Novel Influenza A(H1N1 Strain

    Directory of Open Access Journals (Sweden)

    Theo P. Sloots

    2009-12-01

    Full Text Available Timely implementation of antiviral treatment and other public health based responses are dependent on accurate and rapid diagnosis of the novel pandemic influenza A(H1N1 strain. In this study we developed a duplex real-time PCR (RT-PCR (dFLU-TM assay for the simultaneous detection of a broad range of influenza A subtypes and specific detection of the novel H1N1 2009 pandemic strain. The assay was compared to the combined results of two previously described monoplex RT-PCR assays using 183 clinical samples and 10 seasonal influenza A isolates. Overall, the results showed that the dFLU-TM RT-PCR method is suitable for detection of influenza A, including the novel H1N1 pandemic strain, in clinical samples.

  11. Rapid diagnosis of avian influenza virus in wild birds: Use of a portable rRT-PCR and freeze-dried reagents in the field

    Science.gov (United States)

    Takekawa, John Y.; Hill, N.J.; Schultz, A.K.; Iverson, S.A.; Cardona, C.J.; Boyce, W.M.; Dudley, J.P.

    2011-01-01

    Wild birds have been implicated in the spread of highly pathogenic avian influenza (HPAI) of the H5N1 subtype, prompting surveillance along migratory flyways. Sampling of wild birds for avian influenza virus (AIV) is often conducted in remote regions, but results are often delayed because of the need to transport samples to a laboratory equipped for molecular testing. Real-time reverse transcriptase polymerase chain reaction (rRT-PCR) is a molecular technique that offers one of the most accurate and sensitive methods for diagnosis of AIV. The previously strict lab protocols needed for rRT-PCR are now being adapted for the field. Development of freeze-dried (lyophilized) reagents that do not require cold chain, with sensitivity at the level of wet reagents has brought on-site remote testing to a practical goal. Here we present a method for the rapid diagnosis of AIV in wild birds using an rRT-PCR unit (Ruggedized Advanced Pathogen Identification Device or RAPID, Idaho Technologies, Salt Lake City, UT) that employs lyophilized reagents (Influenza A Target 1 Taqman; ASAY-ASY-0109, Idaho Technologies). The reagents contain all of the necessary components for testing at appropriate concentrations in a single tube: primers, probes, enzymes, buffers and internal positive controls, eliminating errors associated with improper storage or handling of wet reagents. The portable unit performs a screen for Influenza A by targeting the matrix gene and yields results in 2-3 hours. Genetic subtyping is also possible with H5 and H7 primer sets that target the hemagglutinin gene. The system is suitable for use on cloacal and oropharyngeal samples collected from wild birds, as demonstrated here on the migratory shorebird species, the western sandpiper (Calidrus mauri) captured in Northern California. Animal handling followed protocols approved by the Animal Care and Use Committee of the U.S. Geological Survey Western Ecological Research Center and permits of the U.S. Geological Survey

  12. Real-time GPS seismology using a single receiver: method comparison, error analysis and precision validation

    Science.gov (United States)

    Li, Xingxing

    2014-05-01

    Earthquake monitoring and early warning system for hazard assessment and mitigation has traditional been based on seismic instruments. However, for large seismic events, it is difficult for traditional seismic instruments to produce accurate and reliable displacements because of the saturation of broadband seismometers and problematic integration of strong-motion data. Compared with the traditional seismic instruments, GPS can measure arbitrarily large dynamic displacements without saturation, making them particularly valuable in case of large earthquakes and tsunamis. GPS relative positioning approach is usually adopted to estimate seismic displacements since centimeter-level accuracy can be achieved in real-time by processing double-differenced carrier-phase observables. However, relative positioning method requires a local reference station, which might itself be displaced during a large seismic event, resulting in misleading GPS analysis results. Meanwhile, the relative/network approach is time-consuming, particularly difficult for the simultaneous and real-time analysis of GPS data from hundreds or thousands of ground stations. In recent years, several single-receiver approaches for real-time GPS seismology, which can overcome the reference station problem of the relative positioning approach, have been successfully developed and applied to GPS seismology. One available method is real-time precise point positioning (PPP) relied on precise satellite orbit and clock products. However, real-time PPP needs a long (re)convergence period, of about thirty minutes, to resolve integer phase ambiguities and achieve centimeter-level accuracy. In comparison with PPP, Colosimo et al. (2011) proposed a variometric approach to determine the change of position between two adjacent epochs, and then displacements are obtained by a single integration of the delta positions. This approach does not suffer from convergence process, but the single integration from delta positions to

  13. Real-time Continuous Assessment Method for Mental and Physiological Condition using Heart Rate Variability

    Science.gov (United States)

    Yoshida, Yutaka; Yokoyama, Kiyoko; Ishii, Naohiro

    It is necessary to monitor the daily health condition for preventing stress syndrome. In this study, it was proposed the method assessing the mental and physiological condition, such as the work stress or the relaxation, using heart rate variability at real time and continuously. The instantanuous heart rate (HR), and the ratio of the number of extreme points (NEP) and the number of heart beats were calculated for assessing mental and physiological condition. In this method, 20 beats heart rate were used to calculate these indexes. These were calculated in one beat interval. Three conditions, which are sitting rest, performing mental arithmetic and watching relaxation movie, were assessed using our proposed algorithm. The assessment accuracies were 71.9% and 55.8%, when performing mental arithmetic and watching relaxation movie respectively. In this method, the mental and physiological condition was assessed using only 20 regressive heart beats, so this method is considered as the real time assessment method.

  14. Design of Embedded Real-time Systems: Developing a Method for Practical Software Engineering

    DEFF Research Database (Denmark)

    Løvengreen, Hans Henrik; Ravn, Anders P.; Rischel, Hans

    1990-01-01

    The methodological issues and practical problems in development and industrial use of a theory-based design method for embedded, real-time systems are discussed. The method has been used for several years in a number of smaller industries that develop both electronics and software for a professio......The methodological issues and practical problems in development and industrial use of a theory-based design method for embedded, real-time systems are discussed. The method has been used for several years in a number of smaller industries that develop both electronics and software...... for a professional market. The design is expressed in a notation for communicating sequential processes, while data types and operations are expressed in a notation built on mathematical set theory. The authors present an order in which to use the notations, a technique for deriving states and operations...

  15. Quantification of low-expressed mRNA using 5' LNA-containing real-time PCR primers

    International Nuclear Information System (INIS)

    Malgoyre, A.; Banzet, S.; Mouret, C.; Bigard, A.X.; Peinnequin, A.

    2007-01-01

    Real-time RT-PCR is the most sensitive and accurate method for mRNA quantification. Using specific recombinant DNA as a template, real-time PCR allows accurate quantification within a 7-log range and increased sensitivity below 10 copies. However, when using RT-PCR to quantify mRNA in biological samples, a stochastic off-targeted amplification can occur. Classical adjustments of assay parameters have minimal effects on such amplification. This undesirable amplification appears mostly to be dependent on specific to non-specific target ratio rather than on the absolute quantity of the specific target. This drawback, which decreases assay reliability, mostly appears when quantifying low-expressed transcript in a whole organ. An original primer design using properties of LNA allows to block off-target amplification. 5'-LNA substitution strengthens 5'-hybridization. Consequently on-target hybridization is stabilized and the probability for the off-target to lead to amplification is decreased

  16. Comparison of the performance in detection of HPV infections between the high-risk HPV genotyping real time PCR and the PCR-reverse dot blot assays.

    Science.gov (United States)

    Zhang, Lahong; Dai, Yibei; Chen, Jiahuan; Hong, Liquan; Liu, Yuhua; Ke, Qiang; Chen, Yiwen; Cai, Chengsong; Liu, Xia; Chen, Zhaojun

    2018-01-01

    A new multiplex real-time PCR assay, the high-risk HPV genotyping real time PCR assay (HR HPV RT-PCR), has been developed to detect 15 high-risk HPV types with respective viral loads. In this report, a total of 684 cervical specimens from women diagnosed with vaginitis were assessed by the HR HPV RT-PCR and the PCR reaction and reverse dot blot (PCR-RDB) assays, using a PCR-sequencing method as a reference standard. A total coincidence of 97.7% between the HR HPV RT PCR and the PCR-RDB assays was determined with a Kappa value of 0.953. The HR HPV RT PCR assay had sensitivity, specificity, and concordance rates (accuracy) of 99.7%, 99.7%, and 99.7%, respectively, as confirmed by PCR-sequencing, while the PCR-RDB assay had respective rates of 98.8%, 97.1%, and 98.0%. The overall rate of HPV infection, determined by PCR-sequencing, in women diagnosed with vaginitis was 49.85%, including 36.26% of single infection and 13.6% of multiple infections. The most common infections among the 15 high-risk HPV types in women diagnosed with vaginitis were HPV-52, HPV-16, and HPV-58, with a total detection rate of 10.23%, 7.75%, and 5.85%, respectively. We conclude that the HR HPV RT PCR assay exhibits better clinical performance than the PCR-RDB assay, and is an ideal alternative method for HPV genotyping. In addition, the HR HPV RT PCR assay provides HPV DNA viral loads, and could serve as a quantitative marker in the diagnosis and treatment of single and multiple HPV infections. © 2017 Wiley Periodicals, Inc.

  17. A Real-time Face/Hand Tracking Method for Chinese Sign Language Recognition

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    This paper introduces a new Chinese Sign Language recognition (CSLR) system and a method of real-time tracking face and hand applied in the system. In the method, an improved agent algorithm is used to extract the region of face and hand and track them. Kalman filter is introduced to forecast the position and rectangle of search, and self-adapting of target color is designed to counteract the effect of illumination.

  18. Enhanced least squares Monte Carlo method for real-time decision optimizations for evolving natural hazards

    DEFF Research Database (Denmark)

    Anders, Annett; Nishijima, Kazuyoshi

    The present paper aims at enhancing a solution approach proposed by Anders & Nishijima (2011) to real-time decision problems in civil engineering. The approach takes basis in the Least Squares Monte Carlo method (LSM) originally proposed by Longstaff & Schwartz (2001) for computing American option...... prices. In Anders & Nishijima (2011) the LSM is adapted for a real-time operational decision problem; however it is found that further improvement is required in regard to the computational efficiency, in order to facilitate it for practice. This is the focus in the present paper. The idea behind...... the improvement of the computational efficiency is to “best utilize” the least squares method; i.e. least squares method is applied for estimating the expected utility for terminal decisions, conditional on realizations of underlying random phenomena at respective times in a parametric way. The implementation...

  19. Epidemiology of Human Parechovirus Type1 in Clinical Samples from Children with Gastroenteritis Using RT-PCR

    Directory of Open Access Journals (Sweden)

    Dabirmanesh B

    2011-03-01

    Full Text Available Background and Objectives: Human parechovirus type-1 (HPeV-1 is a genus of picornaviridea with a single stranded positive sense RNA genome. In general it seems to be responsible for more gastrointestinal and respiratory syndromes and less responsible for central nervous system (CNS symptoms. Since there is no accurate information about diagnosis and epidemiology of HPeV-1 in Iran and it is very important to distinguish between viral and bacterial diarrhea to decrease the unnecessary use of antibiotics, this study aimed at rapid detection and epidemiology of HPeV-1 in stool samples from children with gastroenteritis using specific RT-PCR. Methods: Viral RNA was isolated from 472 stool samples from children (under 4 years old with diarrhea; CDNA was prepared and amplified using specific primers from 5′untranslated region (5′ UTR of HPeV-1 genome by nested RT-PCR. Amplified DNA product was electrophoresed on 1% agarose gel and a single band of 265 bp was obtained. Data were analyzed by SPSS software. We also performed a comparison between the cell culture (Vero and RT-PCR method for HPeV1 detection.Results: Out of 472 samples examined during two years, 112 samples were HpeV-1 positive (23.7%. The results showed that the prevalence of this virus was in children under one year (6-12 months old with diarrhea (p=0.036 in spring and autumn (p<0.001. Boys had more positive cases than the girls (p<0.001. Out of 20 samples which were found positive by HPeV1 RT-PCR only three of them showed CPE on Vero Cells after a week.Conclusion: The results revealed that RT-PCR is a more practical and sensitive technique for HPeV-1 detection directly from clinical samples, which is valuable for epidemiology. Also, the rapid detection of HPeV1 by RT-PCR can decrease both the unnecessary use of antibiotics and the costs in clinical practice

  20. Epidemiology of Human Parechovirus Type1 in Clinical Samples from Children with Gastroenteritis Using RT-PCR

    Directory of Open Access Journals (Sweden)

    F Ghazi

    2012-05-01

    Full Text Available

    Background and Objectives: Human parechovirus type-1 (HPeV-1 is a genus of picornaviridea with a single stranded positive sense RNA genome. In general it seems to be responsible for more gastrointestinal and respiratory syndromes and less responsible for central nervous system (CNS symptoms. Since there is no accurate information about diagnosis and epidemiology of HPeV-1 in Iran and it is very important to distinguish between viral and bacterial diarrhea to decrease the unnecessary use of antibiotics, this study aimed at rapid detection and epidemiology of HPeV-1 in stool samples from children with gastroenteritis using specific RT-PCR.

     

    Methods: Viral RNA was isolated from 472 stool samples from children (under 4 years old with diarrhea; CDNA was prepared and amplified using specific primers from 5untranslated region (5 UTR of HPeV-1 genome by nested RT-PCR. Amplified DNA product was electrophoresed on 1% agarose gel and a single band of 265 bp was obtained. Data were analyzed by SPSS software. We also performed a comparison between the cell culture (Vero and RT-PCR method for HPeV1 detection.

     

    Results: Out of 472 samples examined during two years, 112 samples were HpeV-1 positive (23.7%. The results showed that the prevalence of this virus was in children under one year (6-12 months old with diarrhea (p=0.036 in spring and autumn (p<0.001. Boys had more positive cases than the girls (p<0.001. Out of 20 samples which were found positive by HPeV1 RT-PCR only three of them showed CPE on Vero Cells after a week.

     

    Conclusion: The results revealed that RT-PCR is a more practical and sensitive technique for HPeV-1 detection directly from clinical samples, which is valuable for epidemiology. Also, the rapid

  1. Real Time Grouting Control Method. Development and application using Aespoe HRL data

    International Nuclear Information System (INIS)

    Kobayashi, Shinji; Stille, Haakan; Gustafson, Gunnar; Stille, Bjoern

    2008-10-01

    The spread of grout is governed by a number of complex relations. The desired results, such as grout penetration and sealing of fractures, cannot be directly measured during the grouting process. This means that the issue of how or when the injection of grout should be stopped cannot be answered by simple rules of thumb. This is also the background to the great variety of empirical rules used in the grouting sector worldwide. The research during recent years has given a better understanding of the water-bearing structures of the rock mass as well as analytical solutions. In this report the methodology has been further studied and a method for design and control of rock grouting has been proposed. The concept of what we call the 'Real Time Grouting Control Method' is to calculate the grout penetration and control grouting in real time by applying the development of the theories for grout spread. Our intention is to combine our method with a computerized logging tool to acquire an active tool in order to be able to govern the grout spread in real time during the grouting operation. The objectives of this report are: to further develop the theory concerning the relationship between grout penetration and grouting time to describe the real course of grouting, to establish the concept of 'Real Time Grouting Control Method' for design and control for rock grouting based on the developed theory, and to verify the concept by using the field data from the grouting experiment at the 450 m level in the Aespoe HRL. In this report, the approximations and analysis of dimensionality have been checked and further developments of the theory with respect to varying grouting pressure, time-dependent grout properties, changing grout mixes, and changing the flow dimension of the fracture have been carried out. The concept of 'Real Time Grouting Control Method' has been described in order to calculate the grout penetration and to control grouting in real time by applying developed

  2. A standard curve based method for relative real time PCR data processing

    Directory of Open Access Journals (Sweden)

    Krause Andreas

    2005-03-01

    Full Text Available Abstract Background Currently real time PCR is the most precise method by which to measure gene expression. The method generates a large amount of raw numerical data and processing may notably influence final results. The data processing is based either on standard curves or on PCR efficiency assessment. At the moment, the PCR efficiency approach is preferred in relative PCR whilst the standard curve is often used for absolute PCR. However, there are no barriers to employ standard curves for relative PCR. This article provides an implementation of the standard curve method and discusses its advantages and limitations in relative real time PCR. Results We designed a procedure for data processing in relative real time PCR. The procedure completely avoids PCR efficiency assessment, minimizes operator involvement and provides a statistical assessment of intra-assay variation. The procedure includes the following steps. (I Noise is filtered from raw fluorescence readings by smoothing, baseline subtraction and amplitude normalization. (II The optimal threshold is selected automatically from regression parameters of the standard curve. (III Crossing points (CPs are derived directly from coordinates of points where the threshold line crosses fluorescence plots obtained after the noise filtering. (IV The means and their variances are calculated for CPs in PCR replicas. (V The final results are derived from the CPs' means. The CPs' variances are traced to results by the law of error propagation. A detailed description and analysis of this data processing is provided. The limitations associated with the use of parametric statistical methods and amplitude normalization are specifically analyzed and found fit to the routine laboratory practice. Different options are discussed for aggregation of data obtained from multiple reference genes. Conclusion A standard curve based procedure for PCR data processing has been compiled and validated. It illustrates that

  3. Method and apparatus for real time imaging and monitoring of radiotherapy beams

    Science.gov (United States)

    Majewski, Stanislaw [Yorktown, VA; Proffitt, James [Newport News, VA; Macey, Daniel J [Birmingham, AL; Weisenberger, Andrew G [Yorktown, VA

    2011-11-01

    A method and apparatus for real time imaging and monitoring of radiation therapy beams is designed to preferentially distinguish and image low energy radiation from high energy secondary radiation emitted from a target as the result of therapeutic beam deposition. A detector having low sensitivity to high energy photons combined with a collimator designed to dynamically image in the region of the therapeutic beam target is used.

  4. Effective and efficient software development method for real time safety systems for nuclear power plants

    International Nuclear Information System (INIS)

    Manoj, P.; Parimalam, P.; Shanmugam, A.; Murali, N.

    2013-01-01

    The objective of this paper is to present the effective and efficient methods for developing application software for Distributed Real Time Systems for Prototype Fast Breeder Reactor. It discusses the effective ways to reduce the language and syntax errors while capturing the requirements. This paper suggests an efficient way of requirements capture and coding application software for I and C systems so that the quality factors of the software such as reliability, maintainability and testability are improved. (author)

  5. A Dynamic Optimization Method of Indoor Fire Evacuation Route Based on Real-time Situation Awareness

    Directory of Open Access Journals (Sweden)

    DING Yulin

    2016-12-01

    Full Text Available How to provide safe and effective evacuation routes is an important safeguard to correctly guide evacuation and reduce the casualties during the fire situation rapidly evolving in complex indoor environment. The traditional static path finding method is difficult to adjust the path adaptively according to the changing fire situation, which lead to the evacuation decision-making blindness and hysteresis. This paper proposes a dynamic method which can dynamically optimize the indoor evacuation routes based on the real-time situation awareness. According to the real-time perception of fire situation parameters and the changing indoor environment information, the evacuation route is optimized dynamically. The integrated representation of multisource indoor fire monitoring sensor observations oriented fire emergency evacuation is presented at first, real-time fire threat situation information inside building is then extracted from the observation data of multi-source sensors, which is used to constrain the dynamical optimization of the topology of the evacuation route. Finally, the simulation experiments prove that this method can improve the accuracy and efficiency of indoor evacuation routing.

  6. No control genes required: Bayesian analysis of qRT-PCR data.

    Directory of Open Access Journals (Sweden)

    Mikhail V Matz

    Full Text Available Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process.In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts. Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests.Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  7. No control genes required: Bayesian analysis of qRT-PCR data.

    Science.gov (United States)

    Matz, Mikhail V; Wright, Rachel M; Scott, James G

    2013-01-01

    Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR) is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process. In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC) algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts). Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization) but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests. Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  8. A real-time non-contact monitoring method of subsea pipelines

    Directory of Open Access Journals (Sweden)

    Song Dalei

    2015-01-01

    Full Text Available To monitoring the subsea pipeline in real-time, a special potentiometric sensor array and a potential prediction model are presented in this paper. Firstly, to measure the potential of seawater, a special potentiometric sensor array with Ag/AgCl all-solid-state reference electrodes is first developed in this paper. Secondly, according to the obtained distribution law of electric field intensities a prediction model of the pipeline potentials is developed. Finally, the potentiometric sensor array is applied in sink experiment and the prediction model is validated by the sink measurements. The maximum error for pipeline potential prediction model is 1.1 mV. The proposed non-contact monitoring method for subsea pipeline can predict the potential of sea pipeline in real-time, thus providing important information for further subsea pipeline maintenance.

  9. Real Time Monitoring System of Pollution Waste on Musi River Using Support Vector Machine (SVM) Method

    Science.gov (United States)

    Fachrurrozi, Muhammad; Saparudin; Erwin

    2017-04-01

    Real-time Monitoring and early detection system which measures the quality standard of waste in Musi River, Palembang, Indonesia is a system for determining air and water pollution level. This system was designed in order to create an integrated monitoring system and provide real time information that can be read. It is designed to measure acidity and water turbidity polluted by industrial waste, as well as to show and provide conditional data integrated in one system. This system consists of inputting and processing the data, and giving output based on processed data. Turbidity, substances, and pH sensor is used as a detector that produce analog electrical direct current voltage (DC). Early detection system works by determining the value of the ammonia threshold, acidity, and turbidity level of water in Musi River. The results is then presented based on the level group pollution by the Support Vector Machine classification method.

  10. Sampling methods for rumen microbial counts by Real-Time PCR techniques

    Directory of Open Access Journals (Sweden)

    S. Puppo

    2010-02-01

    Full Text Available Fresh rumen samples were withdrawn from 4 cannulated buffalo females fed a fibrous diets in order to quantify bacteria concentration in the rumen by Real-Time PCR techniques. To obtain DNA of a good quality from whole rumen fluid, eight (M1-M8 different pre-filtration methods (cheese cloths, glass-fibre and nylon filter in combination with various centrifugation speeds (1000, 5000 and 14,000 rpm were tested. Genomic DNA extraction was performed either on fresh or frozen samples (-20°C. The quantitative bacteria analysis was realized according to Real-Time PCR procedure for Butyrivibrio fibrisolvens reported in literature. M5 resulted the best sampling procedure allowing to obtain a suitable genomic DNA. No differences were revealed between fresh and frozen samples.

  11. Selection of Reference Genes for qRT-PCR Analysis of Gene Expression in Stipa grandis during Environmental Stresses.

    Directory of Open Access Journals (Sweden)

    Dongli Wan

    Full Text Available Stipa grandis P. Smirn. is a dominant plant species in the typical steppe of the Xilingole Plateau of Inner Mongolia. Selection of suitable reference genes for the quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR is important for gene expression analysis and research into the molecular mechanisms underlying the stress responses of S. grandis. In the present study, 15 candidate reference genes (EF1 beta, ACT, GAPDH, SamDC, CUL4, CAP, SNF2, SKIP1, SKIP5, SKIP11, UBC2, UBC15, UBC17, UCH, and HERC2 were evaluated for their stability as potential reference genes for qRT-PCR under different stresses. Four algorithms were used: GeNorm, NormFinder, BestKeeper, and RefFinder. The results showed that the most stable reference genes were different under different stress conditions: EF1beta and UBC15 during drought and salt stresses; ACT and GAPDH under heat stress; SKIP5 and UBC17 under cold stress; UBC15 and HERC2 under high pH stress; UBC2 and UBC15 under wounding stress; EF1beta and UBC17 under jasmonic acid treatment; UBC15 and CUL4 under abscisic acid treatment; and HERC2 and UBC17 under salicylic acid treatment. EF1beta and HERC2 were the most suitable genes for the global analysis of all samples. Furthermore, six target genes, SgPOD, SgPAL, SgLEA, SgLOX, SgHSP90 and SgPR1, were selected to validate the most and least stable reference genes under different treatments. Our results provide guidelines for reference gene selection for more accurate qRT-PCR quantification and will promote studies of gene expression in S. grandis subjected to environmental stress.

  12. A real-time spike sorting method based on the embedded GPU.

    Science.gov (United States)

    Zelan Yang; Kedi Xu; Xiang Tian; Shaomin Zhang; Xiaoxiang Zheng

    2017-07-01

    Microelectrode arrays with hundreds of channels have been widely used to acquire neuron population signals in neuroscience studies. Online spike sorting is becoming one of the most important challenges for high-throughput neural signal acquisition systems. Graphic processing unit (GPU) with high parallel computing capability might provide an alternative solution for increasing real-time computational demands on spike sorting. This study reported a method of real-time spike sorting through computing unified device architecture (CUDA) which was implemented on an embedded GPU (NVIDIA JETSON Tegra K1, TK1). The sorting approach is based on the principal component analysis (PCA) and K-means. By analyzing the parallelism of each process, the method was further optimized in the thread memory model of GPU. Our results showed that the GPU-based classifier on TK1 is 37.92 times faster than the MATLAB-based classifier on PC while their accuracies were the same with each other. The high-performance computing features of embedded GPU demonstrated in our studies suggested that the embedded GPU provide a promising platform for the real-time neural signal processing.

  13. Suitability of voltage stability study methods for real-time assessment

    DEFF Research Database (Denmark)

    Perez, Angel; Jóhannsson, Hjörtur; Vancraeyveld, Pieter

    2013-01-01

    This paper analyzes the suitability of existing methods for long-term voltage stability assessment for real-time operation. An overview of the relevant methods is followed with a comparison that takes into account the accuracy, computational efficiency and characteristics when used for security...... assessment. The results enable an evaluation of the run time of each method with respect to the number of inputs. Furthermore, the results assist in identifying which of the methods is most suitable for realtime operation in future power system with production based on fluctuating energy sources....

  14. An Evidence-Based Approach to Detection by DASI-ELISA and RT-PCR in Dormant Period

    Directory of Open Access Journals (Sweden)

    Antonio Olmos

    2008-01-01

    Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASI-ELISA and RT-PCR.

  15. Correlation Coefficients Between Different Methods of Expressing Bacterial Quantification Using Real Time PCR

    Directory of Open Access Journals (Sweden)

    Bahman Navidshad

    2012-02-01

    Full Text Available The applications of conventional culture-dependent assays to quantify bacteria populations are limited by their dependence on the inconsistent success of the different culture-steps involved. In addition, some bacteria can be pathogenic or a source of endotoxins and pose a health risk to the researchers. Bacterial quantification based on the real-time PCR method can overcome the above-mentioned problems. However, the quantification of bacteria using this approach is commonly expressed as absolute quantities even though the composition of samples (like those of digesta can vary widely; thus, the final results may be affected if the samples are not properly homogenized, especially when multiple samples are to be pooled together before DNA extraction. The objective of this study was to determine the correlation coefficients between four different methods of expressing the output data of real-time PCR-based bacterial quantification. The four methods were: (i the common absolute method expressed as the cell number of specific bacteria per gram of digesta; (ii the Livak and Schmittgen, ΔΔCt method; (iii the Pfaffl equation; and (iv a simple relative method based on the ratio of cell number of specific bacteria to the total bacterial cells. Because of the effect on total bacteria population in the results obtained using ΔCt-based methods (ΔΔCt and Pfaffl, these methods lack the acceptable consistency to be used as valid and reliable methods in real-time PCR-based bacterial quantification studies. On the other hand, because of the variable compositions of digesta samples, a simple ratio of cell number of specific bacteria to the corresponding total bacterial cells of the same sample can be a more accurate method to quantify the population.

  16. A Method to Predict Compressor Stall in the TF34-100 Turbofan Engine Utilizing Real-Time Performance Data

    Science.gov (United States)

    2015-06-01

    A METHOD TO PREDICT COMPRESSOR STALL IN THE TF34-100 TURBOFAN ENGINE UTILIZING REAL-TIME PERFORMANCE...THE TF34-100 TURBOFAN ENGINE UTILIZING REAL-TIME PERFORMANCE DATA THESIS Presented to the Faculty Department of Systems Engineering and...036 A METHOD TO PREDICT COMPRESSOR STALL IN THE TF34-100 TURBOFAN ENGINE UTILIZING REAL-TIME PERFORMANCE DATA Shuxiang ‘Albert’ Li, BS

  17. A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Redman Julia C

    2008-07-01

    Full Text Available Abstract Background Medicago truncatula is a model legume species that is currently the focus of an international genome sequencing effort. Although several different oligonucleotide and cDNA arrays have been produced for genome-wide transcript analysis of this species, intrinsic limitations in the sensitivity of hybridization-based technologies mean that transcripts of genes expressed at low-levels cannot be measured accurately with these tools. Amongst such genes are many encoding transcription factors (TFs, which are arguably the most important class of regulatory proteins. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is the most sensitive method currently available for transcript quantification, and one that can be scaled up to analyze transcripts of thousands of genes in parallel. Thus, qRT-PCR is an ideal method to tackle the problem of TF transcript quantification in Medicago and other plants. Results We established a bioinformatics pipeline to identify putative TF genes in Medicago truncatula and to design gene-specific oligonucleotide primers for qRT-PCR analysis of TF transcripts. We validated the efficacy and gene-specificity of over 1000 TF primer pairs and utilized these to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species. This community resource will be developed further as more genome sequence becomes available, with the ultimate goal of producing validated, gene-specific primers for all Medicago TF genes. Conclusion High-throughput qRT-PCR using a 384-well plate format enables rapid, flexible, and sensitive quantification of all predicted Medicago transcription factor mRNAs. This resource has been utilized recently by several groups in Europe, Australia, and the USA, and we expect that it will become the 'gold-standard' for TF transcript profiling in Medicago truncatula.

  18. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....

  19. Selection of reference genes for qRT-PCR analysis of gene expression in sea cucumber Apostichopus japonicus during aestivation

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Wang, Tianming; Sun, Lina; Xu, Dongxue; Yang, Hongsheng

    2014-11-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a technique that is widely used for gene expression analysis, and its accuracy depends on the expression stability of the internal reference genes used as normalization factors. However, many applications of qRT-PCR used housekeeping genes as internal controls without validation. In this study, the expression stability of eight candidate reference genes in three tissues (intestine, respiratory tree, and muscle) of the sea cucumber Apostichopus japonicus was assessed during normal growth and aestivation using the geNorm, NormFinder, delta CT, and RefFinder algorithms. The results indicate that the reference genes exhibited significantly different expression patterns among the three tissues during aestivation. In general, the β-tubulin (TUBB) gene was relatively stable in the intestine and respiratory tree tissues. The optimal reference gene combination for intestine was 40S ribosomal protein S18 (RPS18), TUBB, and NADH dehydrogenase (NADH); for respiratory tree, it was β-actin (ACTB), TUBB, and succinate dehydrogenase cytochrome B small subunit (SDHC); and for muscle it was α-tubulin (TUBA) and NADH dehydrogenase [ubiquinone] 1 α subcomplex subunit 13 (NDUFA13). These combinations of internal control genes should be considered for use in further studies of gene expression in A. japonicus during aestivation.

  20. Rapid method for controlling the correct labeling of products containing common octopus (Octopus vulgaris) and main substitute species (Eledone cirrhosa and Dosidicus gigas) by fast real-time PCR.

    Science.gov (United States)

    Espiñeira, Montserrat; Vieites, Juan M

    2012-12-15

    The TaqMan real-time PCR has the highest potential for automation, therefore representing the currently most suitable method for screening, allowing the detection of fraudulent or unintentional mislabeling of species. This work describes the development of a real-time polymerase chain reaction (RT-PCR) system for the detection and identification of common octopus (Octopus vulgaris) and main substitute species (Eledone cirrhosa and Dosidicus gigas). This technique is notable for the combination of simplicity, speed, sensitivity and specificity in an homogeneous assay. The method can be applied to all kinds of products; fresh, frozen and processed, including those undergoing intensive processes of transformation. This methodology was validated to check how the degree of food processing affects the method and the detection of each species. Moreover, it was applied to 34 commercial samples to evaluate the labeling of products made from them. The methodology herein developed is useful to check the fulfillment of labeling regulations for seafood products and to verify traceability in commercial trade and for fisheries control. Copyright © 2012 Elsevier Ltd. All rights reserved.

  1. Reference gene selection for real-time quantitative PCR analysis of the mouse uterus in the peri-implantation period.

    Directory of Open Access Journals (Sweden)

    Pengfei Lin

    Full Text Available The study of uterine gene expression patterns is valuable for understanding the biological and molecular mechanisms that occur during embryo implantation. Real-time quantitative RT-PCR (qRT-PCR is an extremely sensitive technique that allows for the precise quantification of mRNA abundance; however, selecting stable reference genes suitable for the normalization of qRT-PCR data is required to avoid the misinterpretation of experimental results and erroneous analyses. This study employs several mouse models, including an early pregnancy, a pseudopregnancy, a delayed implantation and activation, an artificial decidualization and a hormonal treatment model; ten candidate reference genes (PPIA, RPLP0, HPRT1, GAPDH, ACTB, TBP, B2M, 18S, UBC and TUBA that are found in uterine tissues were assessed for their suitability as internal controls for relative qRT-PCR quantification. GeNorm(PLUS, NormFinder, and BestKeeper were used to evaluate these candidate reference genes, and all of these methods identified RPLP0 and GAPDH as the most stable candidates and B2M and 18S as the least stable candidates. However, when the different models were analyzed separately, the reference genes exhibited some variation in their expression levels.

  2. A generic method for real time detection of magnetic sensor failure on tokamaks

    International Nuclear Information System (INIS)

    Nouailletas, Rémy; Moreau, Philippe; Bremond, Sylvain

    2012-01-01

    Highlights: ► We propose a generic method to detect and correct in real time faults on magnetic sensor. ► This method is applied to Tore Supra and tested offline with real data. ► Then the method is modified to be applied to ITER ex-vessel sensor configuration. ► The method is tested on the ITER case with simulated data. - Abstract: In tokamaks, magnetic field probe sensors are used to measure the plasma position. If a sensor provides a wrong data, the error may propagate through the control loop and cause undesirable contact between the vessel wall and the plasma. In the case of a tokamak with water cooled walls, these types of event may be very serious. Despite of these unlikely faults, the potential damages call for a real time check of magnetic sensor data before using them for control. In this paper a simple and generic method based on the comparison of each sensor to a weighted sum of its neighbors is proposed. From the analysis of the residue (the result of the comparison), the fault can be detected and compensated. The method is tuned and tested against Tore Supra experimental data. Then, the method is adapted to ITER and assessed on a reference ITER scenario using simulated magnetic sensor data.

  3. Tendency for interlaboratory precision in the GMO analysis method based on real-time PCR.

    Science.gov (United States)

    Kodama, Takashi; Kurosawa, Yasunori; Kitta, Kazumi; Naito, Shigehiro

    2010-01-01

    The Horwitz curve estimates interlaboratory precision as a function only of concentration, and is frequently used as a method performance criterion in food analysis with chemical methods. The quantitative biochemical methods based on real-time PCR require an analogous criterion to progressively promote method validation. We analyzed the tendency of precision using a simplex real-time PCR technique in 53 collaborative studies of seven genetically modified (GM) crops. Reproducibility standard deviation (SR) and repeatability standard deviation (Sr) of the genetically modified organism (GMO) amount (%) was more or less independent of GM crops (i.e., maize, soybean, cotton, oilseed rape, potato, sugar beet, and rice) and evaluation procedure steps. Some studies evaluated whole steps consisting of DNA extraction and PCR quantitation, whereas others focused only on the PCR quantitation step by using DNA extraction solutions. Therefore, SR and Sr for GMO amount (%) are functions only of concentration similar to the Horwitz curve. We proposed S(R) = 0.1971C 0.8685 and S(r) = 0.1478C 0.8424, where C is the GMO amount (%). We also proposed a method performance index in GMO quantitative methods that is analogous to the Horwitz Ratio.

  4. A comparative kinetic RT/-PCR strategy for the quantitation of mRNAs in microdissected human renal biopsy specimens.

    Science.gov (United States)

    Del Prete, D; Forino, M; Gambaro, G; D'Angelo, A; Baggio, B; Anglani, F

    1998-01-01

    Molecular biology techniques, to be applicable to a diagnostic renal biopsy specimen, should (1) be highly sensitive to be performed on a very small quantity of tissue; (2) be quantitative because they have to analyze genes normally expressed in the tissue and (3) allow the analysis of as large a number of genes as possible. Among different methods, only the reverse-transcriptase polymerase chain reaction (RT/-PCR) might comply with previous requisites, but the few RT/-PCR examples on renal biopsies in the literature do not allow starting RNA quantification and quality control; furthermore they have the drawback of analyzing only few genes. In an ongoing study to assess the expression of a number of genes in glomeruli and in tubulointerstitium of patients with different nephropathies, we developed a comparative RT/-PCR kinetic strategy based on the purification and quantification of total glomerular and tubulointerstitial RNA and on the use of an internal standard, the housekeeping gene G3PDH. We demonstrate that in microdissected diagnostic renal biopsies (1) glomerular and interstitial starting RNA can be quantified; (2) the G3PDH gene may be used both as an internal standard and as an indirect marker of RNA integrity; (3) as low as 28 ng of total RNA is sufficient to obtain PCR products of eight genes, and (4) it is worth to operate on microdissected biopsy specimens because of the different expression of genes in the two renal compartments.

  5. Improved Thévenin equivalent methods for real-time voltage stability assessment

    DEFF Research Database (Denmark)

    Perez, Angel; Jóhannsson, Hjörtur; Østergaard, Jacob

    2016-01-01

    An improved Thévenin equivalent method for real-time voltage stability assessment that uses wide-area information from synchrophasors is proposed. The improvements are a better modeling of the limited synchronous generators, and a processing that anticipates the effect of field current limiters......, before the latter are activated. Several study cases using detailed dynamic simulations of the Nordic test system have been used to assess the performance of the proposed improvements. Their effectiveness is analyzed and, based on the results, their possible application in combination...

  6. A method for real-time three-dimensional vector velocity imaging

    DEFF Research Database (Denmark)

    Jensen, Jørgen Arendt; Nikolov, Svetoslav

    2003-01-01

    The paper presents an approach for making real-time three-dimensional vector flow imaging. Synthetic aperture data acquisition is used, and the data is beamformed along the flow direction to yield signals usable for flow estimation. The signals are cross-related to determine the shift in position...... are done using 16 × 16 = 256 elements at a time and the received signals from the same elements are sampled. Access to the individual elements is done through 16-to-1 multiplexing, so that only a 256 channels transmitting and receiving system are needed. The method has been investigated using Field II...

  7. Evaluation of enhancements to Thevenin equivalent based methods for real-time voltage stability assessment

    DEFF Research Database (Denmark)

    Perez, Angel; Jóhannsson, Hjörtur; Østergaard, Jacob

    2014-01-01

    The possibilities offered by the use of Phasor Measurement Units (PMU) in real - time monitoring provide interesting ways to ensure secure operation of power systems. This paper studies the specific case of voltage stability and the possible improvements to the Thevenin equivalent methods, which...... is applied generally with local measurements. This paper uses the PMU measurements to calculate the grid transformation coefficients to obtain wide - area information. This is achieved by studying the generator's electromo tive force estimated using values in the coefficient transformation matrix...

  8. Electron-phonon thermalization in a scalable method for real-time quantum dynamics

    Science.gov (United States)

    Rizzi, Valerio; Todorov, Tchavdar N.; Kohanoff, Jorge J.; Correa, Alfredo A.

    2016-01-01

    We present a quantum simulation method that follows the dynamics of out-of-equilibrium many-body systems of electrons and oscillators in real time. Its cost is linear in the number of oscillators and it can probe time scales from attoseconds to hundreds of picoseconds. Contrary to Ehrenfest dynamics, it can thermalize starting from a variety of initial conditions, including electronic population inversion. While an electronic temperature can be defined in terms of a nonequilibrium entropy, a Fermi-Dirac distribution in general emerges only after thermalization. These results can be used to construct a kinetic model of electron-phonon equilibration based on the explicit quantum dynamics.

  9. Local study of pollutants dispersion by a real time tracer method

    International Nuclear Information System (INIS)

    Faivre-Pierret, R.X.; Sestier-Carlin, R.; Berne, P.

    1992-01-01

    It is possible to use a Gaussian mathematical model of atmospheric dispersion for calculating atmospheric transfer coefficient (ATC) in long range model, but for proximity models, an experimental model using a tracer technic has to take in account ground effects and natural or artificial obstacles. SF 6 tracer method gives the true plume ground trace in real time. The measured ATC shows a larger ground trace, lower concentration in the axis, and a displacement of the maximum concentration with regard to wind axis in comparison with the calculated ATC. (A.B.). 14 refs., 4 figs., 1 tab

  10. Detecting Newcastle disease virus in combination of RT-PCR with red blood cell absorption

    Directory of Open Access Journals (Sweden)

    Liu Chengqian

    2011-05-01

    Full Text Available Abstract Reverse transcription-polymerase chain reaction (RT-PCR has limited sensitivity when treating complicated samples, such as feces, waste-water in farms, and nucleic acids, protein rich tissue samples, all the factors may interfere with the sensitivity of PCR test or generate false results. In this study, we developed a sensitive RT-PCR, combination of red blood cell adsorption, for detecting Newcastle disease virus (NDV. One pair of primers which was highly homologous to three NDV pathotypes was designed according to the consensus nucleocapsid protein (NP gene sequence. To eliminate the interfere of microbes and toxic substances, we concentrated and purified NDV from varied samples utilizing the ability of NDV binding red blood cells (RBCs. The RT-PCR coupled with red blood cell adsorption was much more sensitive in comparison with regular RT-PCR. The approach could also be used to detect other viruses with the property of hemagglutination, such as influenza viruses.

  11. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  12. Automating Flood Hazard Mapping Methods for Near Real-time Storm Surge Inundation and Vulnerability Assessment

    Science.gov (United States)

    Weigel, A. M.; Griffin, R.; Gallagher, D.

    2015-12-01

    Storm surge has enough destructive power to damage buildings and infrastructure, erode beaches, and threaten human life across large geographic areas, hence posing the greatest threat of all the hurricane hazards. The United States Gulf of Mexico has proven vulnerable to hurricanes as it has been hit by some of the most destructive hurricanes on record. With projected rises in sea level and increases in hurricane activity, there is a need to better understand the associated risks for disaster mitigation, preparedness, and response. GIS has become a critical tool in enhancing disaster planning, risk assessment, and emergency response by communicating spatial information through a multi-layer approach. However, there is a need for a near real-time method of identifying areas with a high risk of being impacted by storm surge. Research was conducted alongside Baron, a private industry weather enterprise, to facilitate automated modeling and visualization of storm surge inundation and vulnerability on a near real-time basis. This research successfully automated current flood hazard mapping techniques using a GIS framework written in a Python programming environment, and displayed resulting data through an Application Program Interface (API). Data used for this methodology included high resolution topography, NOAA Probabilistic Surge model outputs parsed from Rich Site Summary (RSS) feeds, and the NOAA Census tract level Social Vulnerability Index (SoVI). The development process required extensive data processing and management to provide high resolution visualizations of potential flooding and population vulnerability in a timely manner. The accuracy of the developed methodology was assessed using Hurricane Isaac as a case study, which through a USGS and NOAA partnership, contained ample data for statistical analysis. This research successfully created a fully automated, near real-time method for mapping high resolution storm surge inundation and vulnerability for the

  13. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1 ...

    Indian Academy of Sciences (India)

    Department of Molecular Oncology, Cancer Institute (WIA) 38, Sardar Patel Road, Chennai 600 036, India; Department of Biotechnology, Dr M. G. R. Educational and Research Institute, Dr M. G. R. University, Maduravoyal, Chennai 600 095, India; Department of Hemato Immunology, Cancer Institute (WIA) 38, Sardar Patel ...

  14. Sequence Optimized Real-Time RT-PCR Assay for Detection of Crimean-Congo Hemorrhagic Fever Virus

    Science.gov (United States)

    2017-03-21

    on the linear range of the curve 129 using a nonlinear regression analysis. A two-way ANOVA with Sidak’s multiple comparisons test was 130 done to...currently fielded CCHFV assay. 31 TR-17-094 DISTRIBUTION STATEMENT A: Approved for public release; distribution is unlimited. 2 Introduction 32...analyses were performed using GraphPrism 6 (GraphPad Software, San Diego, CA). 128 Assay linearity based on the preliminary LOD was determined based

  15. Norovirus Real Time RT-PCR Detection Technology Transition to the Joint Biological Identification and Diagnosis System (JBAIDS)

    Science.gov (United States)

    2012-09-21

    virus and Southampton virus, and II (GII), which includes Bristol virus, Lordsdale virus, Toronto virus, Mexico virus, Hawaii virus and Snow Mountain...Shigella flexneriATCC12022 1 Negative Shigella sonnei ATCC25931 1 Negative Vibrio cholera (NAG) (Culture) 2 Negative Vibrio cholera (Ogawa...Culture) 1 Negative Vibrio cholera (Inaga) (Culture) 1 Negative Sapovivus (Known specimen extract) 2 Negative Rotavirus (Known specimen extract) 2

  16. VEGF system expression by immunohistochemistry and real-time RT-PCR study on collared peccary placenta

    DEFF Research Database (Denmark)

    Santos, Tatiana C.; Oliveira, Moacir F.; Papa, Paula C.

    2014-01-01

    Vascular endothelial growth factor (VEGF) is known to induce endothelial cell proliferation, to promote cell migration, and to inhibit apoptosis, thus playing a central role in angiogenesis and in the regulation of vasculogenesis. The expression of the VEGF-ligand receptor system was studied in t...

  17. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1 ...

    Indian Academy of Sciences (India)

    2011-08-19

    Aug 19, 2011 ... group of 1–25 years (50 pediatric and 14 young adults). Diagnosis of ... 3% agarose gel to visualize the amplified products of fusion gene transcripts. .... translocation in 13.4% (177/1321, range 9–23%) of child- hood ALL in Far ... to apoptosis, growth factor interactions and alters cell–cell and cell–matrix ...

  18. Field Evaluation of a Deployable RT-PCR Assay System for Real-Time Identification of Dengue Virus

    National Research Council Canada - National Science Library

    McAvin, James C; Blow, Jamie A; Putnam, John L; Swaby, James A

    2004-01-01

    Dengue fever and the more severe form of the disease, dengue hemorrhagic fever, occurs in tropical and subtropical regions globally through infection by one or more of four viral serotypes, DEN-1, DEN-2, DEN-3 and DEN-4...

  19. Real-time prediction of respiratory motion based on local regression methods

    International Nuclear Information System (INIS)

    Ruan, D; Fessler, J A; Balter, J M

    2007-01-01

    Recent developments in modulation techniques enable conformal delivery of radiation doses to small, localized target volumes. One of the challenges in using these techniques is real-time tracking and predicting target motion, which is necessary to accommodate system latencies. For image-guided-radiotherapy systems, it is also desirable to minimize sampling rates to reduce imaging dose. This study focuses on predicting respiratory motion, which can significantly affect lung tumours. Predicting respiratory motion in real-time is challenging, due to the complexity of breathing patterns and the many sources of variability. We propose a prediction method based on local regression. There are three major ingredients of this approach: (1) forming an augmented state space to capture system dynamics, (2) local regression in the augmented space to train the predictor from previous observation data using semi-periodicity of respiratory motion, (3) local weighting adjustment to incorporate fading temporal correlations. To evaluate prediction accuracy, we computed the root mean square error between predicted tumor motion and its observed location for ten patients. For comparison, we also investigated commonly used predictive methods, namely linear prediction, neural networks and Kalman filtering to the same data. The proposed method reduced the prediction error for all imaging rates and latency lengths, particularly for long prediction lengths

  20. Comparative Analysis of Neural Network Training Methods in Real-time Radiotherapy

    Directory of Open Access Journals (Sweden)

    Nouri S.

    2017-03-01

    Full Text Available Background: The motions of body and tumor in some regions such as chest during radiotherapy treatments are one of the major concerns protecting normal tissues against high doses. By using real-time radiotherapy technique, it is possible to increase the accuracy of delivered dose to the tumor region by means of tracing markers on the body of patients. Objective: This study evaluates the accuracy of some artificial intelligence methods including neural network and those of combination with genetic algorithm as well as particle swarm optimization (PSO estimating tumor positions in real-time radiotherapy. Method: One hundred recorded signals of three external markers were used as input data. The signals from 3 markers thorough 10 breathing cycles of a patient treated via a cyber-knife for a lung tumor were used as data input. Then, neural network method and its combination with genetic or PSO algorithms were applied determining the tumor locations using MATLAB© software program. Results: The accuracies were obtained 0.8%, 12% and 14% in neural network, genetic and particle swarm optimization algorithms, respectively. Conclusion: The internal target volume (ITV should be determined based on the applied neural network algorithm on training steps.

  1. Verification of animal species in ham and salami by dna microarray and real time pcr methods

    Directory of Open Access Journals (Sweden)

    Zuzana Drdolová

    2017-01-01

    Full Text Available Consumer protection and detecting of adulteration is very important and has a wide societal impact in the economic sphere. Detection of animal species in meat products and the use of combining different methods is one of the means to achieve relevant product status. The aim of this study was to reveal whether or not the products label clearly meets the content declared by producer. In our study, 29 samples of meat products such as salami and ham obtained from stores and supermarkets in Slovakia were analyzed to detect the existing animal species according to the product label the use of Chipron LCD Array Analysis System, Meat 5.0. Products in which the presence of non-declared animal species has been detected were subjected to testing by the innuDETECT PCR Real-Time Kit, repeatedly. The results showed that 20 (68.96% samples were improperly labeled. From in total 14 tested ham samples 11 (78.57% products exhibited non-conformity with declared composition. Tested salami samples (15 revealed 9 (60% incorrectly labelled products. The results obtained by DNA Microarray and Real Time PCR methods were identical, and both methods should be extensively promoted for the detection of animal species in the meat and meat products. Normal 0 21 false false false EN-GB X-NONE X-NONE

  2. A Dynamic Bioinspired Neural Network Based Real-Time Path Planning Method for Autonomous Underwater Vehicles.

    Science.gov (United States)

    Ni, Jianjun; Wu, Liuying; Shi, Pengfei; Yang, Simon X

    2017-01-01

    Real-time path planning for autonomous underwater vehicle (AUV) is a very difficult and challenging task. Bioinspired neural network (BINN) has been used to deal with this problem for its many distinct advantages: that is, no learning process is needed and realization is also easy. However, there are some shortcomings when BINN is applied to AUV path planning in a three-dimensional (3D) unknown environment, including complex computing problem when the environment is very large and repeated path problem when the size of obstacles is bigger than the detection range of sensors. To deal with these problems, an improved dynamic BINN is proposed in this paper. In this proposed method, the AUV is regarded as the core of the BINN and the size of the BINN is based on the detection range of sensors. Then the BINN will move with the AUV and the computing could be reduced. A virtual target is proposed in the path planning method to ensure that the AUV can move to the real target effectively and avoid big-size obstacles automatically. Furthermore, a target attractor concept is introduced to improve the computing efficiency of neural activities. Finally, some experiments are conducted under various 3D underwater environments. The experimental results show that the proposed BINN based method can deal with the real-time path planning problem for AUV efficiently.

  3. Novel methods of cytokine detection: Real-time PCR, ELISPOT, and intracellular cytokine staining

    Directory of Open Access Journals (Sweden)

    Eliza Turlej

    2009-05-01

    Full Text Available Cytokines are small hormone-like proteins that play important roles in immune system control. Cytokines regulate the proliferation and differentiation of cells and hematopoiesis and act as mediators in the inflammatory reaction. Changes in cytokine levels are found in many diseases, such as sepsis, bowel inflammatory disease, autoimmune diseases, as well as graft-versus-host disease. Cytokines levels can be detected using in vivo, in vitro, and ex vivo techniques. The level of cytokine produced can be measured by immunoenzymatic test (ELISA in supernatant after cell culture with the addition of stimulant and in plasma by techniques that measure the level of cytokine secretion in cells (e.g. immunohistochemical staining, ELISPOT, and intracellular cytokine staining, and by molecular biological methods (RPA, real-time PCR, in situ hybridization, and Northern blot. Detection of cytokine mRNA in tissues is useful in the direct determination of heterogenic populations of cytokine-producing cells. Nowadays the most frequently used methods for measuring cytokine level are ELISPOT, intracellular cytokine staining with flow cytometry detection, and real-time PCR. These methods have an important clinical role in vaccine efficacy, in viral, bacterial, and verminous diagnostics, and in determining the efficacy of cancer treatment.

  4. Red blood cells in cerebrospinal fluid as possible inhibitory factor for enterovirus RT-PCR

    Directory of Open Access Journals (Sweden)

    Sérgio Monteiro de Almeida

    Full Text Available ABSTRACT The presence of hemoglobin in samples are considered an important inhibitory factor for polymerase chain reaction (PCR. The aim of this study was to examine the influence of red blood cells (RBCs in cerebrospinal fluid (CSF as an inhibitory factor to reverse transcription polymerase chain reaction (RT-PCR for enteroviruses (EV. Forty-four CSF samples from patients showing characteristics of viral meningitis were assessed for EV by RT-PCR. Viral RNA extracted with guanidine isothyocianate buffer and virus detection was performed by in-house nested PCR. Positivity for EV RT-PCR was higher in CSF samples without RBCs than in samples with RBCs: 13(26% and 36(9.2%, p = 0.001. In the group with positive EV RT-PCR, the mean + SD CSF RBC was 37 ± 183 cell/mm3; the group with negative results had 580 + 2,890 cell/mm3 (p = 0.007. The acceptable upper limit for CSF RBCs that could not influence RT-PCR was 108 cells/mm3. CSF samples with negative results for EV RT-PCR have more erythrocytes.

  5. A novel method for real-time skin impedance measurement during radiofrequency skin tightening treatments.

    Science.gov (United States)

    Harth, Yoram; Lischinsky, Daniel

    2011-03-01

    The thermal effects of monopolar and bipolar radiofrequency (RF) have been proven to be beneficial in skin tightening. Nevertheless, these effects were frequently partial or unpredictable because of the uncontrolled nature of monopolar or unipolar RF and the superficial nature of energy flow for bipolar or tripolar configurations. One of the hypotheses for lack or predictability of efficacy of the first-generation RF therapy skin tightening systems is lack of adaptation of delivered power to differences in individual skin impedance. A novel multisource phase-controlled system was used (1 MHz, power range 0-65 W) for treatment and real-time skin impedance measurements in 24 patients (EndyMed PRO™; EndyMed, Cesarea, Israel). This system allows continuous real-time measurement of skin impedance delivering constant energy to the patient skin independent of changes in its impedance. More than 6000 unique skin impedance measurements on 22 patients showed an average session impedance range was 215-584 Ohm with an average of 369 Ohm (standard deviation of 49 Ohm). Analyzing individual pulses (total of 600 readings) showed a significant decrease in impedance during the pulse. These findings validate the expected differences in skin impedance between individual patients and in the same patients during the treatment pulse. Clinical study on 30 patients with facial skin aging using the device has shown high predictability of efficacy (86.7% of patients had good results or better at 3 months' follow-up [decrease of 2 or more grades in Fitzpatrick's wrinkle scale]). The real-time customization of energy according to skin impedance allows a significantly more accurate and safe method of nonablative skin tightening with more consistent and predictable results. © 2011 Wiley Periodicals, Inc.

  6. A new method for real-time monitoring of grout spread through fractured rocks

    International Nuclear Information System (INIS)

    Henderson, A. E.; Robertson, I. A.; Whitfield, J. M.; Garrard, G. F. G.; Swannell, N. G.; Fisch, H.

    2008-01-01

    Reducing water ingress into the Shaft at Dounreay is essential for the success of future intermediate level waste (ILW) recovery using the dry retrieval method. The reduction is being realised by forming an engineered barrier of ultrafine cementitious grout injected into the fractured rock surrounding the Shaft. Grout penetration of 6 m in <50μm fractures is being reliably achieved, with a pattern of repeated injections ultimately reducing rock mass permeability by up to three orders of magnitude. An extensive field trials period, involving over 200 grout mix designs and the construction of a full scale demonstration barrier, has yielded several new field techniques that improve the quality and reliability of cementitious grout injection for engineered barriers. In particular, a new method has been developed for tracking in real-time the spread of ultrafine cementitious grout through fractured rock and relating the injection characteristics to barrier design. Fieldwork by the multi-disciplinary international team included developing the injection and real-time monitoring techniques, pre- and post injection hydro-geological testing to quantify the magnitude and extent of changes in rock mass permeability, and correlation of grout spread with injection parameters to inform the main works grouting programme. (authors)

  7. A Novel Real-Time Reference Key Frame Scan Matching Method

    Directory of Open Access Journals (Sweden)

    Haytham Mohamed

    2017-05-01

    Full Text Available Unmanned aerial vehicles represent an effective technology for indoor search and rescue operations. Typically, most indoor missions’ environments would be unknown, unstructured, and/or dynamic. Navigation of UAVs in such environments is addressed by simultaneous localization and mapping approach using either local or global approaches. Both approaches suffer from accumulated errors and high processing time due to the iterative nature of the scan matching method. Moreover, point-to-point scan matching is prone to outlier association processes. This paper proposes a low-cost novel method for 2D real-time scan matching based on a reference key frame (RKF. RKF is a hybrid scan matching technique comprised of feature-to-feature and point-to-point approaches. This algorithm aims at mitigating errors accumulation using the key frame technique, which is inspired from video streaming broadcast process. The algorithm depends on the iterative closest point algorithm during the lack of linear features which is typically exhibited in unstructured environments. The algorithm switches back to the RKF once linear features are detected. To validate and evaluate the algorithm, the mapping performance and time consumption are compared with various algorithms in static and dynamic environments. The performance of the algorithm exhibits promising navigational, mapping results and very short computational time, that indicates the potential use of the new algorithm with real-time systems.

  8. High-speed railway real-time localization auxiliary method based on deep neural network

    Science.gov (United States)

    Chen, Dongjie; Zhang, Wensheng; Yang, Yang

    2017-11-01

    High-speed railway intelligent monitoring and management system is composed of schedule integration, geographic information, location services, and data mining technology for integration of time and space data. Assistant localization is a significant submodule of the intelligent monitoring system. In practical application, the general access is to capture the image sequences of the components by using a high-definition camera, digital image processing technique and target detection, tracking and even behavior analysis method. In this paper, we present an end-to-end character recognition method based on a deep CNN network called YOLO-toc for high-speed railway pillar plate number. Different from other deep CNNs, YOLO-toc is an end-to-end multi-target detection framework, furthermore, it exhibits a state-of-art performance on real-time detection with a nearly 50fps achieved on GPU (GTX960). Finally, we realize a real-time but high-accuracy pillar plate number recognition system and integrate natural scene OCR into a dedicated classification YOLO-toc model.

  9. Procrastination, Flow, and Academic Performance in Real Time Using the Experience Sampling Method.

    Science.gov (United States)

    Sumaya, Isabel C; Darling, Emily

    2018-01-01

    The authors' aim was to first provide an alternative methodology in the assessment of procrastination and flow that would not reply on retrospective or prospective self-reports. Using real-time assessment of both procrastination and flow, the authors investigated how these factors impact academic performance by using the Experience Sampling Method. They assessed flow by measuring student self-reported skill versus challenge, and procrastination by measuring the days to completion of an assignment. Procrastination and flow were measured for six days before a writing assignment due date while students (n = 14) were enrolled in a research methods course. Regardless of status of flow, both the nonflow and flow groups showed high levels of procrastination. Students who experienced flow as they worked on their paper, in real time, earned significantly higher grades (M = 3.05 ± 0.30: an average grade of B) as compared with the nonflow group (M = 1.16 ± 0.33: an average grade of D; p = .007). Additionally, students experiencing flow were more accurate in predicting their grade (difference scores, flow M = 0.12 ± 0.33 vs. nonflow M = 1.39 ± 0.29; p = .015). Students in the nonflow group were nearly a grade and a half off in their prediction of their grade on the paper. To the authors' knowledge, the study is the first to provide experimental evidence showing differences in academic performance between students experiencing flow and nonflow students.

  10. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    Directory of Open Access Journals (Sweden)

    André Moura

    2016-07-01

    Full Text Available ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evaluated when combined with two real time PCRs. The DNeasy Blood & Tissue Kit from QIAGEN showed better performance and sensitivity followed by the DNA Mini Kit RBC and FTA Elute Micro Card. Results suggested that, even when the analytical sensitivity of the qPCR is very high, the extraction method can influence the diagnostic sensitivity.

  11. Novel real-time polymerase chain reaction assay for simultaneous detection of recurrent fusion genes in acute myeloid leukemia.

    Science.gov (United States)

    Dolz, Sandra; Barragán, Eva; Fuster, Óscar; Llop, Marta; Cervera, José; Such, Esperanza; De Juan, Inmaculada; Palanca, Sarai; Murria, Rosa; Bolufer, Pascual; Luna, Irene; Gómez, Inés; López, María; Ibáñez, Mariam; Sanz, Miguel A

    2013-09-01

    The recent World Health Organization classification recognizes different subtypes of acute myeloid leukemia (AML) according to the presence of several recurrent genetic abnormalities. Detection of these abnormalities and other molecular changes is of increasing interest because it contributes to a refined diagnosis and prognostic assessment in AML and enables monitoring of minimal residual disease. These genetic abnormalities can be detected using single RT-PCR, although the screening is still labor intensive and costly. We have developed a novel real-time RT-PCR assay to simultaneously detect 15 AML-associated rearrangements that is a simple and easily applicable method for use in clinical diagnostic laboratories. This method showed 100% specificity and sensitivity (95% confidence interval, 91% to 100% and 92% to 100%, respectively). The procedure was validated in a series of 105 patients with AML. The method confirmed all translocations detected using standard cytogenetics and fluorescence in situ hybridization and some additional undetected rearrangements. Two patients demonstrated two molecular rearrangements simultaneously, with BCR-ABL1 implicated in both, in addition to RUNX1-MECOM in one patient and PML-RARA in another. In conclusion, this novel real-time RT-PCR assay for simultaneous detection of multiple AML-associated fusion genes is a versatile and sensitive method for reliable screening of recurrent rearrangements in AML. Copyright © 2013 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  12. Real-Time Detection Methods to Monitor TRU Compositions in UREX+Process Streams

    Energy Technology Data Exchange (ETDEWEB)

    McDeavitt, Sean; Charlton, William; Indacochea, J Ernesto; taleyarkhan, Rusi; Pereira, Candido

    2013-03-01

    The U.S. Department of Energy has developed advanced methods for reprocessing spent nuclear fuel. The majority of this development was accomplished under the Advanced Fuel Cycle Initiative (AFCI), building on the strong legacy of process development R&D over the past 50 years. The most prominent processing method under development is named UREX+. The name refers to a family of processing methods that begin with the Uranium Extraction (UREX) process and incorporate a variety of other methods to separate uranium, selected fission products, and the transuranic (TRU) isotopes from dissolved spent nuclear fuel. It is important to consider issues such as safeguards strategies and materials control and accountability methods. Monitoring of higher actinides during aqueous separations is a critical research area. By providing on-line materials accountability for the processes, covert diversion of the materials streams becomes much more difficult. The importance of the nuclear fuel cycle continues to rise on national and international agendas. The U.S. Department of Energy is evaluating and developing advanced methods for safeguarding nuclear materials along with instrumentation in various stages of the fuel cycle, especially in material balance areas (MBAs) and during reprocessing of used nuclear fuel. One of the challenges related to the implementation of any type of MBA and/or reprocessing technology (e.g., PUREX or UREX) is the real-time quantification and control of the transuranic (TRU) isotopes as they move through the process. Monitoring of higher actinides from their neutron emission (including multiplicity) and alpha signatures during transit in MBAs and in aqueous separations is a critical research area. By providing on-line real-time materials accountability, diversion of the materials becomes much more difficult. The objective of this consortium was to develop real time detection methods to monitor the efficacy of the UREX+ process and to safeguard the separated

  13. Clinical evaluation of β-tubulin real-time PCR for rapid diagnosis of dermatophytosis, a comparison with mycological methods.

    Science.gov (United States)

    Motamedi, Marjan; Mirhendi, Hossein; Zomorodian, Kamiar; Khodadadi, Hossein; Kharazi, Mahboobeh; Ghasemi, Zeinab; Shidfar, Mohammad Reza; Makimura, Koichi

    2017-10-01

    Following our previous report on evaluation of the beta tubulin real-time PCR for detection of dermatophytosis, this study aimed to compare the real-time PCR assay with conventional methods for the clinical assessment of its diagnostic performance. Samples from a total of 853 patients with suspected dermatophyte lesions were subjected to direct examination (all samples), culture (499 samples) and real-time PCR (all samples). Fungal DNA was extracted directly from clinical samples using a conical steel bullet, followed by purification with a commercial kit and subjected to the Taq-Man probe-based real-time PCR. The study showed that among the 499 specimens for which all three methods were used, 156 (31.2%), 128 (25.6%) and 205 (41.0%) were found to be positive by direct microscopy, culture and real-time PCR respectively. Real-time PCR significantly increased the detection rate of dermatophytes compared with microscopy (288 vs 229) with 87% concordance between the two methods. The sensitivity, specificity, positive predictive value, and negative predictive value of the real-time PCR was 87.5%, 85%, 66.5% and 95.2% respectively. Although real-time PCR performed better on skin than on nail samples, it should not yet fully replace conventional diagnosis. © 2017 Blackwell Verlag GmbH.

  14. Real-time dose compensation methods for scanned ion beam therapy of moving tumors

    International Nuclear Information System (INIS)

    Luechtenborg, Robert

    2012-01-01

    Scanned ion beam therapy provides highly tumor-conformal treatments. So far, only tumors showing no considerable motion during therapy have been treated as tumor motion and dynamic beam delivery interfere, causing dose deteriorations. One proposed technique to mitigate these deteriorations is beam tracking (BT), which adapts the beam position to the moving tumor. Despite application of BT, dose deviations can occur in the case of non-translational motion. In this work, real-time dose compensation combined with beam tracking (RDBT) has been implemented into the control system to compensate these dose changes by adaptation of nominal particle numbers during irradiation. Compared to BT, significantly reduced dose deviations were measured using RDBT. Treatment planning studies for lung cancer patients including the increased biological effectiveness of ions revealed a significantly reduced over-dose level (3/5 patients) as well as significantly improved dose homogeneity (4/5 patients) for RDBT. Based on these findings, real-time dose compensated re-scanning (RDRS) has been proposed that potentially supersedes the technically complex fast energy adaptation necessary for BT and RDBT. Significantly improved conformity compared to re-scanning, i.e., averaging of dose deviations by repeated irradiation, was measured in film irradiations. Simulations comparing RDRS to BT revealed reduced under- and overdoses of the former method.

  15. Exploiting Microwave Imaging Methods for Real-Time Monitoring of Thermal Ablation

    Directory of Open Access Journals (Sweden)

    Rosa Scapaticci

    2017-01-01

    Full Text Available Microwave thermal ablation is a cancer treatment that exploits local heating caused by a microwave electromagnetic field to induce coagulative necrosis of tumor cells. Recently, such a technique has significantly progressed in the clinical practice. However, its effectiveness would dramatically improve if paired with a noninvasive system for the real-time monitoring of the evolving dimension and shape of the thermally ablated area. In this respect, microwave imaging can be a potential candidate to monitor the overall treatment evolution in a noninvasive way, as it takes direct advantage from the dependence of the electromagnetic properties of biological tissues from temperature. This paper explores such a possibility by presenting a proof of concept validation based on accurate simulated imaging experiments, run with respect to a scenario that mimics an ex vivo experimental setup. In particular, two model-based inversion algorithms are exploited to tackle the imaging task. These methods provide independent results in real-time and their integration improves the quality of the overall tracking of the variations occurring in the target and surrounding regions.

  16. Comparison of microscopy, ELISA, and real-time PCR for detection of Giardia intestinalis in human stool specimens

    Science.gov (United States)

    Beyhan, Yunus Emre; Taş Cengiz, Zeynep

    2017-08-23

    Background/aim: This study included patients who had digestive system complaints between August 2015 and October 2015. The research was designed to compare conventional microscopy with an antigen detection ELISA kit and the TaqMan-based real-time PCR (RT-PCR) technique for detection of Giardia intestinalis in human stool specimens. Materials and methods: Samples were concentrated by formalin-ether sedimentation technique and microscopic examinations were carried out on wet mount slides. A commercially available ELISA kit (Giardia CELISA, Cellabs, Brookvale, Australia) was used for immunoassay. DNA was extracted from fecal samples of about 200 mg using the QIAamp Fast DNA Stool Mini Kit (QIAGEN, Hilden, Germany) and the LightCycler Nano system (Roche Diagnostics, Mannheim, Germany) was used for the TaqMan-based RT-PCR assay. Results: A total of 94 stool samples, 38 of them diagnosed positive (40.4%) and 56 of them diagnosed negative by microscopy, were selected for evaluation by antigen detection and molecular assays. The prevalence of G. intestinalis infection was found as 46.8% (n: 44) and 79.8% (n: 75) by ELISA and RT-PCR, respectively. RT-PCR revealed by far the highest positivity rate compared to the other two methods. The difference between these methods was found to be statistically significant (P PCR, the sensitivity and specificity of microscopy and ELISA were 50.7% and 100% and 53.3% and 79%, respectively. Conclusion: RT-PCR seems to be much more sensitive and beneficial for rapid and accurate diagnosis of G. intestinalis in human stools.

  17. Real-time tumor ablation simulation based on the dynamic mode decomposition method

    KAUST Repository

    Bourantas, George C.

    2014-05-01

    Purpose: The dynamic mode decomposition (DMD) method is used to provide a reliable forecasting of tumor ablation treatment simulation in real time, which is quite needed in medical practice. To achieve this, an extended Pennes bioheat model must be employed, taking into account both the water evaporation phenomenon and the tissue damage during tumor ablation. Methods: A meshless point collocation solver is used for the numerical solution of the governing equations. The results obtained are used by the DMD method for forecasting the numerical solution faster than the meshless solver. The procedure is first validated against analytical and numerical predictions for simple problems. The DMD method is then applied to three-dimensional simulations that involve modeling of tumor ablation and account for metabolic heat generation, blood perfusion, and heat ablation using realistic values for the various parameters. Results: The present method offers very fast numerical solution to bioheat transfer, which is of clinical significance in medical practice. It also sidesteps the mathematical treatment of boundaries between tumor and healthy tissue, which is usually a tedious procedure with some inevitable degree of approximation. The DMD method provides excellent predictions of the temperature profile in tumors and in the healthy parts of the tissue, for linear and nonlinear thermal properties of the tissue. Conclusions: The low computational cost renders the use of DMD suitable forin situ real time tumor ablation simulations without sacrificing accuracy. In such a way, the tumor ablation treatment planning is feasible using just a personal computer thanks to the simplicity of the numerical procedure used. The geometrical data can be provided directly by medical image modalities used in everyday practice. © 2014 American Association of Physicists in Medicine.

  18. Análise de citocinas pela RT-PCR em pacientes com rinite alérgica RT-PCR cytokine study in patients with allergic rhinitis

    Directory of Open Access Journals (Sweden)

    Tarcimara Moreira da Silva

    2009-02-01

    knowing the cytokine expressions during this period. MATERIALS AND METHODS: Another prospective and transversal study was carried out, selecting 30 patients, 13 of these patients were pauci-symptomatic and 17 were non atopic. The groups were selected by means of a medical interview, an otolaryngologic clinical exam and allergy skin tests - Prick Test. The cytokines were investigated in fragments of the nasal mucosa, using RT-PCR - chosen because it has good reproducibility and specificity. RESULTS: IL-5, IL-8, IFN-gama cytokine values were kept homogeneous in relation to the control group. Only IL-4 presented significant statistic differences. CONCLUSION: Asymptomatic patients with allergic rhinitis presented with normalization of cytokine expression in the nasal mucosa, with exception of IL-4.

  19. A method of real-time detection for distant moving obstacles by monocular vision

    Science.gov (United States)

    Jia, Bao-zhi; Zhu, Ming

    2013-12-01

    In this paper, we propose an approach for detection of distant moving obstacles like cars and bicycles by a monocular camera to cooperate with ultrasonic sensors in low-cost condition. We are aiming at detecting distant obstacles that move toward our autonomous navigation car in order to give alarm and keep away from them. Method of frame differencing is applied to find obstacles after compensation of camera's ego-motion. Meanwhile, each obstacle is separated from others in an independent area and given a confidence level to indicate whether it is coming closer. The results on an open dataset and our own autonomous navigation car have proved that the method is effective for detection of distant moving obstacles in real-time.

  20. An Efficient Method to Search Real-Time Bulk Data for an Information Processing System

    International Nuclear Information System (INIS)

    Kim, Seong Jin; Kim, Jong Myung; Suh, Yong Suk; Keum, Jong Yong; Park, Heui Youn

    2005-01-01

    The Man Machine Interface System (MMIS) of System-integrated Modular Advanced ReacTor (SMART) is designed with fully digitalized features. The Information Processing System (IPS) of the MMIS acquires and processes plant data from other systems. In addition, the IPS provides plant operation information to operators in the control room. The IPS is required to process bulky data in a real-time. So, it is necessary to consider a special processing method with regards to flexibility and performance because more than a few thousands of Plant Information converges on the IPS. Among other things, the processing time for searching for data from the bulk data consumes much more than other the processing times. Thus, this paper explores an efficient method for the search and examines its feasibility

  1. Evaluation and optimization of SYBR Green real-time reverse transcription polymerase chain reaction as a tool for diagnosis of the Flavivirus genus in Brazil

    Directory of Open Access Journals (Sweden)

    Marilia Farignoli Romeiro

    2016-06-01

    Full Text Available Abstract: INTRODUCTION: The genus Flavivirus includes several pathogenic species that cause severe illness in humans. Therefore, a rapid and accurate molecular method for diagnosis and surveillance of these viruses would be of great importance. Here, we evaluate and optimize a quantitative real-time reverse transcription polymerase chain reaction (RT-PCR method for the diagnosis of the Flavivirus genus. METHODS: We evaluated different commercial kits that use the SYBR Green system for real-time RT-PCR with a primer set that amplifies a fragment of the NS5 flavivirus gene. The specificity and sensitivity of the assay were tested using twelve flaviviruses and ribonucleic acid (RNA transcribed from the yellow fever virus. Additionally, this assay was evaluated using the sera of 410 patients from different regions of Brazil with acute febrile illness and a negative diagnosis for the dengue virus. RESULTS: The real-time RT-PCR amplified all flaviviruses tested at a melting temperature of 79.92 to 83.49°C. A detection limit of 100 copies per ml was determined for this assay. Surprisingly, we detected dengue virus in 4.1% (17/410 of samples from patients with febrile illness and a supposedly negative dengue infection diagnosis. The viral load in patients ranged from 2.1×107to 3.4×103copies per ml. CONCLUSIONS: The real-time RT-PCR method may be very useful for preliminary diagnoses in screenings, outbreaks, and other surveillance studies. Moreover, this assay can be easily applied to monitor viral activity and to measure viral load in pathogenesis studies.

  2. Development of field-based real-time reverse transcription-polymerase chain reaction assays for detection of Chikungunya and O'nyong-nyong viruses in mosquitoes.

    Science.gov (United States)

    Smith, Darci R; Lee, John S; Jahrling, Jordan; Kulesh, David A; Turell, Michael J; Groebner, Jennifer L; O'Guinn, Monica L

    2009-10-01

    Chikungunya (CHIK) and O'nyong-nyong (ONN) are important emerging arthropod-borne diseases. Molecular diagnosis of these two viruses in mosquitoes has not been evaluated, and the effects of extraneous mosquito tissue on assay performance have not been tested. Additionally, no real-time reverse transcription-polymerase chain reaction (RT-PCR) assay exists for detecting ONN virus (ONNV) RNA. We describe the development of sensitive and specific real-time RT-PCR assays for detecting CHIK and ONN viral RNA in mosquitoes, which have application for field use. In addition, we compared three methods for primer/probe design for assay development by evaluating their sensitivity and specificity. This comparison resulted in development of virus-specific assays that could detect less than one plaque-forming unit equivalent of each of the viruses in mosquitoes. The use of these assays will aid in arthropod-borne disease surveillance and in the control of the associated diseases.

  3. Real Time Systems

    DEFF Research Database (Denmark)

    Christensen, Knud Smed

    2000-01-01

    Describes fundamentals of parallel programming and a kernel for that. Describes methods for modelling and checking parallel problems. Real time problems.......Describes fundamentals of parallel programming and a kernel for that. Describes methods for modelling and checking parallel problems. Real time problems....

  4. Probe-based real-time PCR method for multilocus melt typing of Xylella fastidiosa strains.

    Science.gov (United States)

    Brady, Jeff A; Faske, Jennifer B; Ator, Rebecca A; Castañeda-Gill, Jessica M; Mitchell, Forrest L

    2012-04-01

    Epidemiological studies of Pierce's disease (PD) can be confounded by a lack of taxonomic detail on the bacterial causative agent, Xylella fastidiosa (Xf). PD in grape is caused by strains of Xylella fastidiosa subsp. fastidiosa, but is not caused by other subspecies of Xf that typically colonize plants other than grape. Detection assays using ELISA and qPCR are effective at detecting and quantifying Xf presence or absence, but offer no information on Xf subspecies or strain identity. Surveying insects or host plants for Xf by current ELISA or qPCR methods provides only presence/absence and quantity information for any and all Xf subspecies, potentially leading to false assessments of disease threat. This study uses a series of adjacent-hybridizing DNA melt analysis probes that are capable of efficiently discriminating Xf subspecies and strain relationships in rapid real-time PCR reactions. Copyright © 2012 Elsevier B.V. All rights reserved.

  5. Wavelet transform and real-time learning method for myoelectric signal in motion discrimination

    International Nuclear Information System (INIS)

    Liu Haihua; Chen Xinhao; Chen Yaguang

    2005-01-01

    This paper discusses the applicability of the Wavelet transform for analyzing an EMG signal and discriminating motion classes. In many previous works, researchers have dealt with steady EMG and have proposed suitable analyzing methods for the EMG, for example FFT and STFT. Therefore, it is difficult for the previous approaches to discriminate motions from the EMG in the different phases of muscle activity, i.e., pre-activity, in activity, postactivity phases, as well as the period of motion transition from one to another. In this paper, we introduce the Wavelet transform using the Coiflet mother wavelet into our real-time EMG prosthetic hand controller for discriminating motions from steady and unsteady EMG. A preliminary experiment to discriminate three hand motions from four channel EMG in the initial pre-activity and in activity phase is carried out to show the effectiveness of the approach. However, future research efforts are necessary to discriminate more motions much precisely

  6. A method for real-time implementation of HOG feature extraction

    Science.gov (United States)

    Luo, Hai-bo; Yu, Xin-rong; Liu, Hong-mei; Ding, Qing-hai

    2011-08-01

    Histogram of oriented gradient (HOG) is an efficient feature extraction scheme, and HOG descriptors are feature descriptors which is widely used in computer vision and image processing for the purpose of biometrics, target tracking, automatic target detection(ATD) and automatic target recognition(ATR) etc. However, computation of HOG feature extraction is unsuitable for hardware implementation since it includes complicated operations. In this paper, the optimal design method and theory frame for real-time HOG feature extraction based on FPGA were proposed. The main principle is as follows: firstly, the parallel gradient computing unit circuit based on parallel pipeline structure was designed. Secondly, the calculation of arctangent and square root operation was simplified. Finally, a histogram generator based on parallel pipeline structure was designed to calculate the histogram of each sub-region. Experimental results showed that the HOG extraction can be implemented in a pixel period by these computing units.

  7. Real time elastography - a non-invasive diagnostic method of small hepatocellular carcinoma in cirrhosis.

    Science.gov (United States)

    Gheorghe, Liana; Iacob, Speranta; Iacob, Razvan; Dumbrava, Mona; Becheanu, Gabriel; Herlea, Vlad; Gheorghe, Cristian; Lupescu, Ioana; Popescu, Irinel

    2009-12-01

    Small nodules (under 3 cm) detected on ultrasound (US) in cirrhotics represent the most challenging category for noninvasive diagnosis of hepatocellular carcinoma (HCC). To evaluate real-time sonoelastography as a noninvasive tool for the diagnosis of small HCC nodules in cirrhotic patients. 42 cirrhotic patients with 58 nodules (1-3 cm) were evaluated with real-time elastography (Hitachi EUB-6500); the mean intensity of colors red, blue, green were measured using a semi-quantitative method. Analysis of histograms for each color of the sonoelastography images was performed for quantifying the elasticity of nodule tissue in comparison with the cirrhotic liver tissue. AUROC curves were constructed to define the best cut-off points to distinguish malignant features of the nodules. Univariate and multivariate logistic regression analysis was performed. 595 sonoelastography images from 42 patients (25 men; 17 women) were analyzed. The mean age was 56.4 +/- 0.7 years and 69% patients were in Child-Pugh class A, 19% class B, 11% class C. For the mean intensity of green color AUROC=0.81, a cut-off value under 108.7 being diagnostic for HCC with a Sp=91.1%, Se=50%, PPV=92.1%, NPV=47.1%. Mean intensity of blue color proved to be an excellent diagnostic tool for HCC (AUROC=0.94); for a cut-off value greater than 128.9, Sp=92.2%, Se=78.9%, PPV=95.4%, NPV=68%. Independent predictive factors of HCC for a small nodule in cirrhotic patients were: blue color over 128.9 at sonoelastography and hypervascular appearance at Doppler US. US elastography is a promising method for the non-invasive diagnosis of early HCC. Blue color at elastography and hypervascular aspects are independent predictors of HCC.

  8. A rapid and direct real time PCR-based method for identification of Salmonella spp

    DEFF Research Database (Denmark)

    Rodriguez-Lazaro, D.; Hernández, Marta; Esteve, T.

    2003-01-01

    The aim of this work was the validation of a rapid, real-time PCR assay based on TaqMan((R)) technology for the unequivocal identification of Salmonella spp. to be used directly on an agar-grown colony. A real-time PCR system targeting at the Salmonella spp. invA gene was optimized and validated ...

  9. Real time quantitative phase microscopy based on single-shot transport of intensity equation (ssTIE) method

    Science.gov (United States)

    Yu, Wei; Tian, Xiaolin; He, Xiaoliang; Song, Xiaojun; Xue, Liang; Liu, Cheng; Wang, Shouyu

    2016-08-01

    Microscopy based on transport of intensity equation provides quantitative phase distributions which opens another perspective for cellular observations. However, it requires multi-focal image capturing while mechanical and electrical scanning limits its real time capacity in sample detections. Here, in order to break through this restriction, real time quantitative phase microscopy based on single-shot transport of the intensity equation method is proposed. A programmed phase mask is designed to realize simultaneous multi-focal image recording without any scanning; thus, phase distributions can be quantitatively retrieved in real time. It is believed the proposed method can be potentially applied in various biological and medical applications, especially for live cell imaging.

  10. Verifying Real-Time Systems using Explicit-time Description Methods

    Directory of Open Access Journals (Sweden)

    Hao Wang

    2009-12-01

    Full Text Available Timed model checking has been extensively researched in recent years. Many new formalisms with time extensions and tools based on them have been presented. On the other hand, Explicit-Time Description Methods aim to verify real-time systems with general untimed model checkers. Lamport presented an explicit-time description method using a clock-ticking process (Tick to simulate the passage of time together with a group of global variables for time requirements. This paper proposes a new explicit-time description method with no reliance on global variables. Instead, it uses rendezvous synchronization steps between the Tick process and each system process to simulate time. This new method achieves better modularity and facilitates usage of more complex timing constraints. The two explicit-time description methods are implemented in DIVINE, a well-known distributed-memory model checker. Preliminary experiment results show that our new method, with better modularity, is comparable to Lamport's method with respect to time and memory efficiency.

  11. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    Science.gov (United States)

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  12. Direct recovery of infectious Pestivirus from a full-length RT-PCR amplicon

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Reimann, Ilona; Hoffmann, Bernd

    2008-01-01

    This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro, and the result......This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro......, and the resulting RNA transcripts were electroporated into ovine cells. Infectious virus was obtained after one cell culture passage. The rescued viruses had a phenotype similar to the parental Border Disease virus strain. Therefore, direct generation of infectious pestiviruses from full-length RT-PCR cDNA products...

  13. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat

    Directory of Open Access Journals (Sweden)

    Porceddu Enrico

    2009-02-01

    Full Text Available Abstract Background Usually the reference genes used in gene expression analysis have been chosen for their known or suspected housekeeping roles, however the variation observed in most of them hinders their effective use. The assessed lack of validated reference genes emphasizes the importance of a systematic study for their identification. For selecting candidate reference genes we have developed a simple in silico method based on the data publicly available in the wheat databases Unigene and TIGR. Results The expression stability of 32 genes was assessed by qRT-PCR using a set of cDNAs from 24 different plant samples, which included different tissues, developmental stages and temperature stresses. The selected sequences included 12 well-known HKGs representing different functional classes and 20 genes novel with reference to the normalization issue. The expression stability of the 32 candidate genes was tested by the computer programs geNorm and NormFinder using five different data-sets. Some discrepancies were detected in the ranking of the candidate reference genes, but there was substantial agreement between the groups of genes with the most and least stable expression. Three new identified reference genes appear more effective than the well-known and frequently used HKGs to normalize gene expression in wheat. Finally, the expression study of a gene encoding a PDI-like protein showed that its correct evaluation relies on the adoption of suitable normalization genes and can be negatively affected by the use of traditional HKGs with unstable expression, such as actin and α-tubulin. Conclusion The present research represents the first wide screening aimed to the identification of reference genes and of the corresponding primer pairs specifically designed for gene expression studies in wheat, in particular for qRT-PCR analyses. Several of the new identified reference genes outperformed the traditional HKGs in terms of expression stability

  14. A comparison of the sensitivities of detection of Plasmodium falciparum gametocytes by magnetic fractionation, thick blood film microscopy, and RT-PCR

    Directory of Open Access Journals (Sweden)

    St-Pierre Tim G

    2009-05-01

    Full Text Available Abstract Background The magnetic properties of Plasmodium-infected erythrocytes have been exploited for different clinical and research purposes. A recent study in a rural clinical setting in Papua New Guinea has demonstrated that Plasmodium falciparum gametocyte detection is facilitated by magnetic deposition microscopy but no study has yet determined the relative sensitivity and limit of detection of a magnetic fractionation technique. The present study compares the detection limit and sensitivity of a technique based on the use of commercially available magnetic fractionation columns with those for thick blood film microscopy and reverse transcriptase polymerase chain reaction (RT-PCR methods. Methods Gametocyte detection in six series of dilutions of cultured P. falciparum parasites with known gametocytaemia was conducted using magnetic fractionation, thick blood film, and RT-PCR techniques. Results The preparations obtained by the magnetic fractionation method were of thin film quality allowing easy gametocyte identification by light microscopy. Magnetic fractionation had a higher sensitivity and approximately two orders of magnitude better limit of detection than thick blood film microscopy. Gametocytes were also more readily detectable on the magnetically fractionated preparations. Magnetic fractionation had a similar limit of detection to that of RT-PCR. Conclusion Magnetic fractionation is a highly sensitive and convenient method for gametocyte detection in comparison with the standard thick blood film and RT-PCR methods, and could readily be adapted to field application.

  15. An anti-disturbing real time pose estimation method and system

    Science.gov (United States)

    Zhou, Jian; Zhang, Xiao-hu

    2011-08-01

    Pose estimation relating two-dimensional (2D) images to three-dimensional (3D) rigid object need some known features to track. In practice, there are many algorithms which perform this task in high accuracy, but all of these algorithms suffer from features lost. This paper investigated the pose estimation when numbers of known features or even all of them were invisible. Firstly, known features were tracked to calculate pose in the current and the next image. Secondly, some unknown but good features to track were automatically detected in the current and the next image. Thirdly, those unknown features which were on the rigid and could match each other in the two images were retained. Because of the motion characteristic of the rigid object, the 3D information of those unknown features on the rigid could be solved by the rigid object's pose at the two moment and their 2D information in the two images except only two case: the first one was that both camera and object have no relative motion and camera parameter such as focus length, principle point, and etc. have no change at the two moment; the second one was that there was no shared scene or no matched feature in the two image. Finally, because those unknown features at the first time were known now, pose estimation could go on in the followed images in spite of the missing of known features in the beginning by repeating the process mentioned above. The robustness of pose estimation by different features detection algorithms such as Kanade-Lucas-Tomasi (KLT) feature, Scale Invariant Feature Transform (SIFT) and Speed Up Robust Feature (SURF) were compared and the compact of the different relative motion between camera and the rigid object were discussed in this paper. Graphic Processing Unit (GPU) parallel computing was also used to extract and to match hundreds of features for real time pose estimation which was hard to work on Central Processing Unit (CPU). Compared with other pose estimation methods, this new

  16. Real-time and online screening method for materials emitting volatile organic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Changhyuk [University of Minnesota, Department of Mechanical Engineering (United States); Sul, Yong Tae [Hoseo University (Korea, Republic of); Pui, David Y. H., E-mail: dyhpui@umn.edu [University of Minnesota, Department of Mechanical Engineering (United States)

    2016-09-15

    In the semiconductor industry, volatile organic compounds (VOCs) in the cleanroom air work as airborne molecular contamination, which reduce the production yield of semiconductor chips by forming nanoparticles and haze on silicon wafers and photomasks under ultraviolet irradiation during photolithography processes. Even though VOCs in outdoor air are removed by gas filters, VOCs can be emitted from many kinds of materials used in cleanrooms, such as organic solvents and construction materials (e.g., adhesives, flame retardants and sealants), threatening the production of semiconductors. Therefore, finding new replacements that emit lower VOCs is now essential in the semiconductor industry. In this study, we developed a real-time and online method to screen materials for developing the replacements by converting VOCs into nanoparticles under soft X-ray irradiation. This screening method was applied to measure VOCs emitted from different kinds of organic solvents and adhesives. Our results showed good repeatability and high sensitivity for VOCs, which come from aromatic compounds, some alcohols and all tested adhesives (Super glue and cleanroom-use adhesives). In addition, the overall trend of measured VOCs from cleanroom-use adhesives was well matched with those measured by a commercial thermal desorption–gas chromatography–mass spectrometry, which is a widely used off-line method for analyzing VOCs. Based on the results, this screening method can help accelerate the developing process for reducing VOCs in cleanrooms.

  17. Evaluation of real-time ice concentration inside pipeline by the refractive index method

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Dong Gyu; Kang, Chae Dong [Chonbuk National University, Jeonju (Korea, Republic of); Chung, Dong Yeol; Peck, Jong Hyeon [KITECH, Cheonan (Korea, Republic of)

    2015-05-15

    Ice fraction (or ice concentration, IC) of the ice slurry flowing through the pipe is very difficult to measure directly and in real time in ice slurry type system in thermal energy storage system. Measuring IC is very important to calculate the capacity of cold energy supplied through a pipeline. Ice fraction measurement methods have been reported as using density, electric resistance, electric conductivity, freezing point etc. However, the conventional methods are not perfect in terms of the resolution and accuracy. In this study, a new method is suggested to measure the IC of the ice slurry flowing through a pipe, which is used for a refractometer with low electrical noise and high resolution. To measure IC of the flowing ice slurry aqueous solution in pipe, it was installed in the test section to mass flow meter, refractometer, cyclone, and RTD Resistance temperature detector) sensor. From the experiment, IC measurement method by using refractive index showed better result than others for the ice slurry in pipeline flowing or slurry tank.

  18. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism a...

  19. Semi-Nested Real-Time Reverse Transcription Polymerase Chain Reaction Methods for the Successful Quantitation of Cytokeratin mRNA Expression Levels for the Subtyping of Non-Small-Cell Lung Carcinoma Using Paraffin-Embedded and Microdissected Lung Biopsy Specimens

    International Nuclear Information System (INIS)

    Nakanishi, Yoko; Shimizu, Tetsuo; Tsujino, Ichiro; Obana, Yukari; Seki, Toshimi; Fuchinoue, Fumi; Ohni, Sumie; Oinuma, Toshinori; Kusumi, Yoshiaki; Yamada, Tsutomu; Takahashi, Noriaki; Hashimoto, Shu; Nemoto, Norimichi

    2013-01-01

    In patients with inoperable advanced non-small cell lung carcinomas (NSCLCs), histological subtyping using small-mount biopsy specimens was often required to decide the indications for drug treatment. The aim of this study was to assess the utility of highly sensitive mRNA quantitation for the subtyping of advanced NSCLC using small formalin fixing and paraffin embedding (FFPE) biopsy samples. Cytokeratin (CK) 6, CK7, CK14, CK18, and thyroid transcription factor (TTF)-1 mRNA expression levels were measured using semi-nested real-time quantitative (snq) reverse-transcribed polymerase chain reaction (RT-PCR) in microdissected tumor cells collected from 52 lung biopsies. Our results using the present snqRT-PCR method showed an improvement in mRNA quantitation from small FFPE samples, and the mRNA expression level using snqRT-PCR was correlated with the immunohistochemical protein expression level. CK7, CK18, and TTF-1 mRNA were expressed at significantly higher levels (P<0.05) in adenocarcinoma (AD) than in squamous cell carcinoma (SQ), while CK6 and CK14 mRNA expression was significantly higher (P<0.05) in SQ than in AD. Each histology-specific CK, particularly CK18 in AD and CK6 in SQ, were shown to be correlated with a poor prognosis (P=0.02, 0.02, respectively). Our results demonstrated that a quantitative CK subtype mRNA analysis from lung biopsy samples can be useful for predicting the histology subtype and prognosis of advanced NSCLC

  20. Diagnosis of intestinal parasites in a rural community of Venezuela: Advantages and disadvantages of using microscopy or RT-PCR.

    Science.gov (United States)

    Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia; Pinelli, Elena

    2017-03-01

    A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular anthelminthic treatments. A total of 228 participants were included in this study. A multiplex RT-PCR was used for the detection of Dientamoeba fragilis, Giardia intestinalis, Cryptosporidium sp. and a monoplex RT-PCR for Entamoeba histolytica. Furthermore, a multiplex PCR was performed for detection of Ascaris lumbricoides, Strongyloides stercoralis, Necator americanus and Ancylostoma duodenale. Combined microscopy-PCR revealed prevalences of 49.3% for A. lumbricoides, 10.1% for N. americanus (no A. duodenale was detected), 2.0% for S. stercoralis, 40.4% for D. fragilis, 35.1% for G. intestinalis, and 7.9% for E. histolytica/dispar. Significant increases in prevalence at PCR vs. microscopy were found for A. lumbricoides, G. intestinalis and D. fragilis. Other parasites detected by microscopy alone were Trichuris trichiura (25.7%), Enterobius vermicularis (3.4%), Blastocystis sp. (65.8%), and the non-pathogenic Entamoeba coli (28.9%), Entamoeba hartmanni (12.3%), Endolimax nana (19.7%) and Iodamoeba bütschlii (7.5%). Age- but no gender-related differences in prevalences were found for A. lumbricoides, T. trichiura, G. intestinalis, and E. histolytica/dispar. The persistently high prevalences of intestinal helminths are probably related to the high faecal pollution as also evidenced by the high prevalences of non-pathogenic intestinal protozoans. These results highlight the importance of using sensitive diagnostic techniques in combination with microscopy to better estimate the prevalence of intestinal parasites, especially in the case of D. fragilis trophozoites, which deteriorate very rapidly and would be missed by microscopy. In addition, the differentiation between

  1. A method for real-time memory efficient implementation of blob detection in large images

    Directory of Open Access Journals (Sweden)

    Petrović Vladimir L.

    2017-01-01

    Full Text Available In this paper we propose a method for real-time blob detection in large images with low memory cost. The method is suitable for implementation on the specialized parallel hardware such as multi-core platforms, FPGA and ASIC. It uses parallelism to speed-up the blob detection. The input image is divided into blocks of equal sizes to which the maximally stable extremal regions (MSER blob detector is applied in parallel. We propose the usage of multiresolution analysis for detection of large blobs which are not detected by processing the small blocks. This method can find its place in many applications such as medical imaging, text recognition, as well as video surveillance or wide area motion imagery (WAMI. We explored the possibilities of usage of detected blobs in the feature-based image alignment as well. When large images are processed, our approach is 10 to over 20 times more memory efficient than the state of the art hardware implementation of the MSER.

  2. Penerapan Metode Diagnosis Cepat Virus Avian Influenza H5N1 dengan Metode Single Step Multiplex RT-PCR

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2010-12-01

    Full Text Available Avian influenza (AI virus is a segmented single stranded (ss RNA virus with negative polarity andbelong to the Orthomyxoviridae family. Diagnose of AI virus can be performed using conventional methodsbut it has low sensitivity and specificity. The objective of the research was to apply rapid, precise, andaccurate diagnostic method for AI virus and also to determine its type and subtype based on the SingleStep Multiplex Reverse Transcriptase-Polymerase Chain Reaction targeting M, H5, and N1 genes. In thismethod M, H5 and NI genes were simultaneously amplified in one PCR tube. The steps of this researchconsist of collecting viral RNAs from 10 different AI samples originated from Maros Disease InvestigationCenter during 2007. DNA Amplification was conducted by Simplex RT-PCR using M primer set. Then, bysingle step multiplex RT-PCR were conducted simultaneously using M, H5 and N1 primers set. The RTPCRproducts were then separated on 1.5% agarose gel, stained by ethidum bromide and visualized underUV transilluminator. Results showed that 8 of 10 RNA virus samples could be amplified by Simplex RTPCRfor M gene which generating a DNA fragment of 276 bp. Amplification using multiplex RT-PCRmethod showed two of 10 samples were AI positive using multiplex RT-PCR, three DNA fragments weregenerated consisting of 276 bp for M gene, 189 bp for H5 gene, and 131 bp for N1. In this study, rapid andeffective diagnosis method for AI virus can be conducted by using simultaneous Single Step Multiplex RTPCR.By this technique type and subtype of AI virus, can also be determined, especially H5N1.

  3. One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

    Science.gov (United States)

    Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

    2018-01-23

    To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

  4. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  5. Methods and tools to support real time risk-based flood forecasting - a UK pilot application

    Directory of Open Access Journals (Sweden)

    Brown Emma

    2016-01-01

    Full Text Available Flood managers have traditionally used probabilistic models to assess potential flood risk for strategic planning and non-operational applications. Computational restrictions on data volumes and simulation times have meant that information on the risk of flooding has not been available for operational flood forecasting purposes. In practice, however, the operational flood manager has probabilistic questions to answer, which are not completely supported by the outputs of traditional, deterministic flood forecasting systems. In a collaborative approach, HR Wallingford and Deltares have developed methods, tools and techniques to extend existing flood forecasting systems with elements of strategic flood risk analysis, including probabilistic failure analysis, two dimensional flood spreading simulation and the analysis of flood impacts and consequences. This paper presents the results of the application of these new operational flood risk management tools to a pilot catchment in the UK. It discusses the problems of performing probabilistic flood risk assessment in real time and how these have been addressed in this study. It also describes the challenges of the communication of risk to operational flood managers and to the general public, and how these new methods and tools can provide risk-based supporting evidence to assist with this process.

  6. Use of real-time PCR to evaluate two DNA extraction methods from food

    Directory of Open Access Journals (Sweden)

    Maria Regina Branquinho

    2012-03-01

    Full Text Available The DNA extraction is a critical step in Genetically Modified Organisms analysis based on real-time PCR. In this study, the CTAB and DNeasy methods provided good quality and quantity of DNA from the texturized soy protein, infant formula, and soy milk samples. Concerning the Certified Reference Material consisting of 5% Roundup Ready® soybean, neither method yielded DNA of good quality. However, the dilution test applied in the CTAB extracts showed no interference of inhibitory substances. The PCR efficiencies of lectin target amplification were not statistically different, and the coefficients of correlation (R² demonstrated high degree of correlation between the copy numbers and the threshold cycle (Ct values. ANOVA showed suitable adjustment of the regression and absence of significant linear deviations. The efficiencies of the p35S amplification were not statistically different, and all R² values using DNeasy extracts were above 0.98 with no significant linear deviations. Two out of three R² values using CTAB extracts were lower than 0.98, corresponding to lower degree of correlation, and the lack-of-fit test showed significant linear deviation in one run. The comparative analysis of the Ct values for the p35S and lectin targets demonstrated no statistical significant differences between the analytical curves of each target.

  7. A Real-Time Analysis Method for Pulse Rate Variability Based on Improved Basic Scale Entropy

    Directory of Open Access Journals (Sweden)

    Yongxin Chou

    2017-01-01

    Full Text Available Base scale entropy analysis (BSEA is a nonlinear method to analyze heart rate variability (HRV signal. However, the time consumption of BSEA is too long, and it is unknown whether the BSEA is suitable for analyzing pulse rate variability (PRV signal. Therefore, we proposed a method named sliding window iterative base scale entropy analysis (SWIBSEA by combining BSEA and sliding window iterative theory. The blood pressure signals of healthy young and old subjects are chosen from the authoritative international database MIT/PhysioNet/Fantasia to generate PRV signals as the experimental data. Then, the BSEA and the SWIBSEA are used to analyze the experimental data; the results show that the SWIBSEA reduces the time consumption and the buffer cache space while it gets the same entropy as BSEA. Meanwhile, the changes of base scale entropy (BSE for healthy young and old subjects are the same as that of HRV signal. Therefore, the SWIBSEA can be used for deriving some information from long-term and short-term PRV signals in real time, which has the potential for dynamic PRV signal analysis in some portable and wearable medical devices.

  8. Improving method of real-time offset tuning for arterial signal coordination using probe trajectory data

    Directory of Open Access Journals (Sweden)

    Jian Zhang

    2016-12-01

    Full Text Available In the environment of intelligent transportation systems, traffic condition data would have higher resolution in time and space, which is especially valuable for managing the interrupted traffic at signalized intersections. There exist a lot of algorithms for offset tuning, but few of them take the advantage of modern traffic detection methods such as probe vehicle data. This study proposes a method using probe trajectory data to optimize and adjust offsets in real time. The critical point, representing the changing vehicle dynamics, is first defined as the basis of this approach. Using the critical points related to different states of traffic conditions, such as free flow, queue formation, and dissipation, various traffic status parameters can be estimated, including actual travel speed, queue dissipation rate, and standing queue length. The offset can then be adjusted on a cycle-by-cycle basis. The performance of this approach is evaluated using a simulation network. The results show that the trajectory-based approach can reduce travel time of the coordinated traffic flow when compared with using well-defined offline offset.

  9. Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

    Science.gov (United States)

    Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

    2014-09-01

    Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We

  10. Wireless and real-time structural damage detection: A novel decentralized method for wireless sensor networks

    Science.gov (United States)

    Avci, Onur; Abdeljaber, Osama; Kiranyaz, Serkan; Hussein, Mohammed; Inman, Daniel J.

    2018-06-01

    Being an alternative to conventional wired sensors, wireless sensor networks (WSNs) are extensively used in Structural Health Monitoring (SHM) applications. Most of the Structural Damage Detection (SDD) approaches available in the SHM literature are centralized as they require transferring data from all sensors within the network to a single processing unit to evaluate the structural condition. These methods are found predominantly feasible for wired SHM systems; however, transmission and synchronization of huge data sets in WSNs has been found to be arduous. As such, the application of centralized methods with WSNs has been a challenge for engineers. In this paper, the authors are presenting a novel application of 1D Convolutional Neural Networks (1D CNNs) on WSNs for SDD purposes. The SDD is successfully performed completely wireless and real-time under ambient conditions. As a result of this, a decentralized damage detection method suitable for wireless SHM systems is proposed. The proposed method is based on 1D CNNs and it involves training an individual 1D CNN for each wireless sensor in the network in a format where each CNN is assigned to process the locally-available data only, eliminating the need for data transmission and synchronization. The proposed damage detection method operates directly on the raw ambient vibration condition signals without any filtering or preprocessing. Moreover, the proposed approach requires minimal computational time and power since 1D CNNs merge both feature extraction and classification tasks into a single learning block. This ability is prevailingly cost-effective and evidently practical in WSNs considering the hardware systems have been occasionally reported to suffer from limited power supply in these networks. To display the capability and verify the success of the proposed method, large-scale experiments conducted on a laboratory structure equipped with a state-of-the-art WSN are reported.

  11. Increased efficacy for in-house validation of real-time PCR GMO detection methods.

    Science.gov (United States)

    Scholtens, I M J; Kok, E J; Hougs, L; Molenaar, B; Thissen, J T N M; van der Voet, H

    2010-03-01

    To improve the efficacy of the in-house validation of GMO detection methods (DNA isolation and real-time PCR, polymerase chain reaction), a study was performed to gain insight in the contribution of the different steps of the GMO detection method to the repeatability and in-house reproducibility. In the present study, 19 methods for (GM) soy, maize canola and potato were validated in-house of which 14 on the basis of an 8-day validation scheme using eight different samples and five on the basis of a more concise validation protocol. In this way, data was obtained with respect to the detection limit, accuracy and precision. Also, decision limits were calculated for declaring non-conformance (>0.9%) with 95% reliability. In order to estimate the contribution of the different steps in the GMO analysis to the total variation variance components were estimated using REML (residual maximum likelihood method). From these components, relative standard deviations for repeatability and reproducibility (RSD(r) and RSD(R)) were calculated. The results showed that not only the PCR reaction but also the factors 'DNA isolation' and 'PCR day' are important factors for the total variance and should therefore be included in the in-house validation. It is proposed to use a statistical model to estimate these factors from a large dataset of initial validations so that for similar GMO methods in the future, only the PCR step needs to be validated. The resulting data are discussed in the light of agreed European criteria for qualified GMO detection methods.

  12. A method for accurate detection of genomic microdeletions using real-time quantitative PCR

    Directory of Open Access Journals (Sweden)

    Bassett Anne S

    2005-12-01

    Full Text Available Abstract Background Quantitative Polymerase Chain Reaction (qPCR is a well-established method for quantifying levels of gene expression, but has not been routinely applied to the detection of constitutional copy number alterations of human genomic DNA. Microdeletions or microduplications of the human genome are associated with a variety of genetic disorders. Although, clinical laboratories routinely use fluorescence in situ hybridization (FISH to identify such cryptic genomic alterations, there remains a significant number of individuals in which constitutional genomic imbalance is suspected, based on clinical parameters, but cannot be readily detected using current cytogenetic techniques. Results In this study, a novel application for real-time qPCR is presented that can be used to reproducibly detect chromosomal microdeletions and microduplications. This approach was applied to DNA from a series of patient samples and controls to validate genomic copy number alteration at cytoband 22q11. The study group comprised 12 patients with clinical symptoms of chromosome 22q11 deletion syndrome (22q11DS, 1 patient trisomic for 22q11 and 4 normal controls. 6 of the patients (group 1 had known hemizygous deletions, as detected by standard diagnostic FISH, whilst the remaining 6 patients (group 2 were classified as 22q11DS negative using the clinical FISH assay. Screening of the patients and controls with a set of 10 real time qPCR primers, spanning the 22q11.2-deleted region and flanking sequence, confirmed the FISH assay results for all patients with 100% concordance. Moreover, this qPCR enabled a refinement of the region of deletion at 22q11. Analysis of DNA from chromosome 22 trisomic sample demonstrated genomic duplication within 22q11. Conclusion In this paper we present a qPCR approach for the detection of chromosomal microdeletions and microduplications. The strategic use of in silico modelling for qPCR primer design to avoid regions of repetitive

  13. DSPACE Real-Time Implementation of MPPT-Based FLC Method

    Directory of Open Access Journals (Sweden)

    Abdullah M. Noman

    2013-01-01

    Full Text Available Maximum power point trackers are so important in photovoltaic systems to improve their overall efficiency. This paper presents a photovoltaic system with maximum power point tracking facility. An intelligent fuzzy logic controller method is proposed in this paper to achieve the maximum power point tracking of PV modules. The system consists of a photovoltaic solar module connected to a DC-DC buck-boost converter. The system is modeled using MATLAB/SIMULINK. The system has been experienced under disturbance in the photovoltaic temperature and irradiation levels. The simulation results show that the proposed maximum power tracker tracks the maximum power accurately and successfully in all conditions tested. The MPPT system is then experimentally implemented. DSPACE is used in the implementation of the MPPT hardware setup for real-time control. Data acquisition and control system is implemented using dSPACE 1104 software and digital signal processor card. The simulation and practical results show that the proposed system tracked the maximum power accurately and successfully under all atmospheric conditions.

  14. A real-time visual inspection method of fastening bolts in freight car operation

    Science.gov (United States)

    Nan, Guo; Yao, JunEn

    2015-10-01

    A real-time inspection of the key components is necessary for ensuring safe operation of freight car. While traditional inspection depends on the trained human inspectors, which is time-consuming and lower efficient. With the development of machine vision, vision-based inspection methods get more railway on-spot applications. The cross rod end fastening bolts are important components on both sides of the train body that fixing locking plates together with the freight car main structure. In our experiment, we get the images containing fastening bolt components, and accurately locate the locking plate position using a linear Support Vector Machine (SVM) locating model trained with Histograms of Oriented Gradients (HOG) features. Then we extract the straight line segment using the Line Segment Detector (LSD) and encoding them in a range, which constitute a straight line segment dataset. Lastly we determine the locking plate's working state by the linear pattern. The experiment result shows that the localization accurate rate is over 99%, the fault detection rate is over 95%, and the module implementation time is 2f/s. The overall performance can completely meet the practical railway safety assurance application.

  15. The Maximum Entropy Method for Optical Spectrum Analysis of Real-Time TDDFT

    International Nuclear Information System (INIS)

    Toogoshi, M; Kano, S S; Zempo, Y

    2015-01-01

    The maximum entropy method (MEM) is one of the key techniques for spectral analysis. The major feature is that spectra in the low frequency part can be described by the short time-series data. Thus, we applied MEM to analyse the spectrum from the time dependent dipole moment obtained from the time-dependent density functional theory (TDDFT) calculation in real time. It is intensively studied for computing optical properties. In the MEM analysis, however, the maximum lag of the autocorrelation is restricted by the total number of time-series data. We proposed that, as an improved MEM analysis, we use the concatenated data set made from the several-times repeated raw data. We have applied this technique to the spectral analysis of the TDDFT dipole moment of ethylene and oligo-fluorene with n = 8. As a result, the higher resolution can be obtained, which is closer to that of FT with practically time-evoluted data as the same total number of time steps. The efficiency and the characteristic feature of this technique are presented in this paper. (paper)

  16. The first clinical treatment with kilovoltage intrafraction monitoring (KIM): A real-time image guidance method

    DEFF Research Database (Denmark)

    Keall, Paul J.; Aun Ng, Jin; O'Brien, Ricky

    2015-01-01

    on September 16, 2014. Methods: KIM uses current and prior 2D x-ray images to estimate the 3D target position during cancer radiotherapy treatment delivery. KIM software was written to process kilovoltage (kV) images streamed from a standard C-arm linear accelerator with a gantry-mounted kV x-ray imaging...... system. A 120° pretreatment kV imaging arc was acquired to build the patient-specific 2D to 3D motion correlation. The kV imager was activated during the megavoltage (MV) treatment, a dual arc VMAT prostate treatment, to estimate the 3D prostate position in real-time. All necessary ethics, legal......, and regulatory requirements were met for this clinical study. The quality assurance processes were completed and peer reviewed. Results: During treatment, a prostate position offset of nearly 3 mm in the posterior direction was observed with KIM. This position offset did not trigger a gating event. After...

  17. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

    Science.gov (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei

    2012-01-01

    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  18. Detecting the Presence of Nora Virus in "Drosophila" Utilizing Single Fly RT-PCR

    Science.gov (United States)

    Munn, Bethany; Ericson, Brad; Carlson, Darby J.; Carlson, Kimberly A.

    2015-01-01

    A single fly RT-PCR protocol has recently been developed to detect the presence of the persistent, horizontally transmitted Nora virus in "Drosophila." Wild-caught flies from Ohio were tested for the presence of the virus, with nearly one-fifth testing positive. The investigation presented can serve as an ideal project for biology…

  19. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected...

  20. Identification and characterization of a novel tospovirus species using a new RT-PCR approach

    NARCIS (Netherlands)

    Cortez, I.; Saaijer, J.; Wonjkaew, K.S.; Pereira, A.M.; Goldbach, R.W.; Peters, D.; Kormelink, R.

    2001-01-01

    Summary. A novel tospovirus serologically distinct from all established tospo- virus species was found in Thailand in Physalis minima L. The S RNA of this virus was cloned by a new RT-PCR approach revealing a nucleotide sequence of 3257 nucleotides. The ambisense RNA segment encoded a nonstructural

  1. A comparison of gantry-mounted x-ray-based real-time target tracking methods.

    Science.gov (United States)

    Montanaro, Tim; Nguyen, Doan Trang; Keall, Paul J; Booth, Jeremy; Caillet, Vincent; Eade, Thomas; Haddad, Carol; Shieh, Chun-Chien

    2018-03-01

    Most modern radiotherapy machines are built with a 2D kV imaging system. Combining this imaging system with a 2D-3D inference method would allow for a ready-made option for real-time 3D tumor tracking. This work investigates and compares the accuracy of four existing 2D-3D inference methods using both motion traces inferred from external surrogates and measured internally from implanted beacons. Tumor motion data from 160 fractions (46 thoracic/abdominal patients) of Synchrony traces (inferred traces), and 28 fractions (7 lung patients) of Calypso traces (internal traces) from the LIGHT SABR trial (NCT02514512) were used in this study. The motion traces were used as the ground truth. The ground truth trajectories were used in silico to generate 2D positions projected on the kV detector. These 2D traces were then passed to the 2D-3D inference methods: interdimensional correlation, Gaussian probability density function (PDF), arbitrary-shape PDF, and the Kalman filter. The inferred 3D positions were compared with the ground truth to determine tracking errors. The relationships between tracking error and motion magnitude, interdimensional correlation, and breathing periodicity index (BPI) were also investigated. Larger tracking errors were observed from the Calypso traces, with RMS and 95th percentile 3D errors of 0.84-1.25 mm and 1.72-2.64 mm, compared to 0.45-0.68 mm and 0.74-1.13 mm from the Synchrony traces. The Gaussian PDF method was found to be the most accurate, followed by the Kalman filter, the interdimensional correlation method, and the arbitrary-shape PDF method. Tracking error was found to strongly and positively correlate with motion magnitude for both the Synchrony and Calypso traces and for all four methods. Interdimensional correlation and BPI were found to negatively correlate with tracking error only for the Synchrony traces. The Synchrony traces exhibited higher interdimensional correlation than the Calypso traces especially in the anterior

  2. A simplified strategy for sensitive detection of Rose rosette virus compatible with three RT-PCR chemistries.

    Science.gov (United States)

    Dobhal, Shefali; Olson, Jennifer D; Arif, Mohammad; Garcia Suarez, Johnny A; Ochoa-Corona, Francisco M

    2016-06-01

    Rose rosette disease is a disorder associated with infection by Rose rosette virus (RRV), a pathogen of roses that causes devastating effects on most garden cultivated varieties, and the wild invasive rose especially Rosa multiflora. Reliable and sensitive detection of this disease in early phases is needed to implement proper control measures. This study assesses a single primer-set based detection method for RRV and demonstrates its application in three different chemistries: Endpoint RT-PCR, TaqMan-quantitative RT-PCR (RT-qPCR) and SYBR Green RT-qPCR with High Resolution Melting analyses. A primer set (RRV2F/2R) was designed from consensus sequences of the nucleocapsid protein gene p3 located in the RNA 3 region of RRV. The specificity of primer set RRV2F/2R was validated in silico against published GenBank sequences and in-vitro against infected plant samples and an exclusivity panel of near-neighbor and other viruses that commonly infect Rosa spp. The developed assay is sensitive with a detection limit of 1fg from infected plant tissue. Thirty rose samples from 8 different states of the United States were tested using the developed methods. The developed methods are sensitive and reliable, and can be used by diagnostic laboratories for routine testing and disease management decisions. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. A multi-mode real-time terrain parameter estimation method for wheeled motion control of mobile robots

    Science.gov (United States)

    Li, Yuankai; Ding, Liang; Zheng, Zhizhong; Yang, Qizhi; Zhao, Xingang; Liu, Guangjun

    2018-05-01

    For motion control of wheeled planetary rovers traversing on deformable terrain, real-time terrain parameter estimation is critical in modeling the wheel-terrain interaction and compensating the effect of wheel slipping. A multi-mode real-time estimation method is proposed in this paper to achieve accurate terrain parameter estimation. The proposed method is composed of an inner layer for real-time filtering and an outer layer for online update. In the inner layer, sinkage exponent and internal frictional angle, which have higher sensitivity than that of the other terrain parameters to wheel-terrain interaction forces, are estimated in real time by using an adaptive robust extended Kalman filter (AREKF), whereas the other parameters are fixed with nominal values. The inner layer result can help synthesize the current wheel-terrain contact forces with adequate precision, but has limited prediction capability for time-variable wheel slipping. To improve estimation accuracy of the result from the inner layer, an outer layer based on recursive Gauss-Newton (RGN) algorithm is introduced to refine the result of real-time filtering according to the innovation contained in the history data. With the two-layer structure, the proposed method can work in three fundamental estimation modes: EKF, REKF and RGN, making the method applicable for flat, rough and non-uniform terrains. Simulations have demonstrated the effectiveness of the proposed method under three terrain types, showing the advantages of introducing the two-layer structure.

  4. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene.

    Science.gov (United States)

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-07-01

    The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher's exact test, and SPSS17 software. The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1.

  5. Outbreak of hepatitis E virus infection in Darfur, Sudan: effectiveness of real-time reverse transcription-PCR analysis of dried blood spots.

    Science.gov (United States)

    Mérens, Audrey; Guérin, Philippe Jean; Guthmann, Jean-Paul; Nicand, Elisabeth

    2009-06-01

    Biological samples collected in refugee camps during an outbreak of hepatitis E were used to compare the accuracy of hepatitis E virus RNA amplification by real-time reverse transcription-PCR (RT-PCR) for sera and dried blood spots (concordance of 90.6%). Biological profiles (RT-PCR and serology) of asymptomatic individuals were also analyzed.

  6. Real-time aircraft continuous descent trajectory optimization with ATC time constraints using direct collocation methods.

    OpenAIRE

    Verhoeven, Ronald; Dalmau Codina, Ramon; Prats Menéndez, Xavier; de Gelder, Nico

    2014-01-01

    1 Abstract In this paper an initial implementation of a real - time aircraft trajectory optimization algorithm is presented . The aircraft trajectory for descent and approach is computed for minimum use of thrust and speed brake in support of a “green” continuous descent and approach flight operation, while complying with ATC time constraints for maintaining runway throughput and co...

  7. RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms.

    Science.gov (United States)

    Green, Clayton B; Cheng, Georgina; Chandra, Jyotsna; Mukherjee, Pranab; Ghannoum, Mahmoud A; Hoyer, Lois L

    2004-02-01

    An RT-PCR assay was developed to analyse expression patterns of genes in the Candida albicans ALS (agglutinin-like sequence) family. Inoculation of a reconstituted human buccal epithelium (RHE) model of mucocutaneous candidiasis with strain SC5314 showed destruction of the epithelial layer by C. albicans and also formation of an upper fungal layer that had characteristics similar to a biofilm. RT-PCR analysis of total RNA samples extracted from C. albicans-inoculated buccal RHE showed that ALS1, ALS2, ALS3, ALS4, ALS5 and ALS9 were consistently detected over time as destruction of the RHE progressed. Detection of transcripts from ALS7, and particularly from ALS6, was more sporadic, but not associated with a strictly temporal pattern. The expression pattern of ALS genes in C. albicans cultures used to inoculate the RHE was similar to that observed in the RHE model, suggesting that contact of C. albicans with buccal RHE does little to alter ALS gene expression. RT-PCR analysis of RNA samples extracted from model denture and catheter biofilms showed similar gene expression patterns to the buccal RHE specimens. Results from the RT-PCR analysis of biofilm RNA specimens were consistent between various C. albicans strains during biofilm development and were comparable to gene expression patterns in planktonic cells. The RT-PCR assay described here will be useful for analysis of human clinical specimens and samples from other disease models. The method will provide further insight into the role of ALS genes and their encoded proteins in the diverse interactions between C. albicans and its host.

  8. A multiplex RT-PCR assay for the rapid and differential diagnosis of classical swine fever and other pestivirus infections.

    Science.gov (United States)

    Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne

    2009-11-18

    Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.

  9. European validation of a real-time PCR-based method for detection of Listeria monocytogenes in soft cheese.

    Science.gov (United States)

    Gianfranceschi, Monica Virginia; Rodriguez-Lazaro, David; Hernandez, Marta; González-García, Patricia; Comin, Damiano; Gattuso, Antonietta; Delibato, Elisabetta; Sonnessa, Michele; Pasquali, Frederique; Prencipe, Vincenza; Sreter-Lancz, Zuzsanna; Saiz-Abajo, María-José; Pérez-De-Juan, Javier; Butrón, Javier; Kozačinski, Lidija; Tomic, Danijela Horvatek; Zdolec, Nevijo; Johannessen, Gro S; Jakočiūnė, Džiuginta; Olsen, John Elmerdahl; De Santis, Paola; Lovari, Sarah; Bertasi, Barbara; Pavoni, Enrico; Paiusco, Antonella; De Cesare, Alessandra; Manfreda, Gerardo; De Medici, Dario

    2014-08-01

    The classical microbiological method for detection of Listeria monocytogenes requires around 7 days for final confirmation, and due to perishable nature of RTE food products, there is a clear need for an alternative methodology for detection of this pathogen. This study presents an international (at European level) ISO 16140-based validation trial of a non-proprietary real-time PCR-based methodology that can generate final results in the following day of the analysis. This methodology is based on an ISO compatible enrichment coupled to a bacterial DNA extraction and a consolidated real-time PCR assay. Twelve laboratories from six European countries participated in this trial, and soft cheese was selected as food model since it can represent a difficult matrix for the bacterial DNA extraction and real-time PCR amplification. The limit of detection observed was down to 10 CFU per 25 of sample, showing excellent concordance and accordance values between samples and laboratories (>75%). In addition, excellent values were obtained for relative accuracy, specificity and sensitivity (82.75%, 96.70% and 97.62%, respectively) when the results obtained for the real-time PCR-based methods were compared to those of the ISO 11290-1 standard method. An interesting observation was that the L. monocytogenes detection by the real-time PCR method was less affected in the presence of Listeria innocua in the contaminated samples, proving therefore to be more reliable than the reference method. The results of this international trial demonstrate that the evaluated real-time PCR-based method represents an excellent alterative to the ISO standard since it shows a higher performance as well as reduce the extent of the analytical process, and can be easily implemented routinely by the competent authorities and food industry laboratories. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Comparison of real-time reverse transcriptase polymerase chain reaction of peripheral blood mononuclear cells, serum and cell-free body cavity effusion for the diagnosis of feline infectious peritonitis.

    Science.gov (United States)

    Doenges, Stephanie J; Weber, Karin; Dorsch, Roswitha; Fux, Robert; Hartmann, Katrin

    2017-04-01

    Objectives Diagnosis of feline infectious peritonitis (FIP) remains challenging, especially in cats without effusions. The objective of this study was to evaluate the sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) detecting feline coronavirus (FCoV) RNA in peripheral blood mononuclear cells (PBMCs) and serum in comparison with the same real-time RT-PCR in cell-free body cavity effusion. Methods This prospective case-control study included 92 cats. Forty-three cats had a definitive diagnosis of FIP, established either by histopathological examination (n = 28) or by positive immunofluorescence staining of FCoV antigen in macrophages of effusions (n = 11), or by both methods (n = 4). Forty-nine control cats had other diseases but similar clinical signs. Real-time RT-PCR was performed on PBMCs of 37 cats (21 cats with FIP, 16 controls), on serum of 51 cats (26 cats with FIP, 25 controls) and on cell-free body cavity effusion of 69 cats (36 cats with FIP, 33 controls). Sensitivity, specificity, positive and negative predictive value, including 95% confidence intervals (CI), were calculated. Results Real-time RT-PCR of PBMCs, serum and cell-free body cavity effusion showed a specificity of 100% (95% CI 79.4-100% in PBMCs, 86.3-100% in serum, 89.4-100% in cell-free body cavity effusion) and a sensitivity of 28.6% (95% CI 11.3-52.2%) in PBMCs, 15.4% (95% CI 4.4-34.9%) in serum and 88.9% (95% CI 73.9-96.9%) in cell-free body cavity effusion to diagnose FIP. Conclusions and relevance Although it is known that RT-PCR can often provide false-positive results in healthy cats, this real-time RT-PCR was shown to be a specific tool for the diagnosis of FIP when applied in a clinical setting. Sensitivity in cell-free body cavity effusion was high but low in PBMCs and serum. PBMC samples showed a higher sensitivity than serum samples, and are therefore a better choice if no effusion is present.

  11. Multiscale Methods, Parallel Computation, and Neural Networks for Real-Time Computer Vision.

    Science.gov (United States)

    Battiti, Roberto

    1990-01-01

    This thesis presents new algorithms for low and intermediate level computer vision. The guiding ideas in the presented approach are those of hierarchical and adaptive processing, concurrent computation, and supervised learning. Processing of the visual data at different resolutions is used not only to reduce the amount of computation necessary to reach the fixed point, but also to produce a more accurate estimation of the desired parameters. The presented adaptive multiple scale technique is applied to the problem of motion field estimation. Different parts of the image are analyzed at a resolution that is chosen in order to minimize the error in the coefficients of the differential equations to be solved. Tests with video-acquired images show that velocity estimation is more accurate over a wide range of motion with respect to the homogeneous scheme. In some cases introduction of explicit discontinuities coupled to the continuous variables can be used to avoid propagation of visual information from areas corresponding to objects with different physical and/or kinematic properties. The human visual system uses concurrent computation in order to process the vast amount of visual data in "real -time." Although with different technological constraints, parallel computation can be used efficiently for computer vision. All the presented algorithms have been implemented on medium grain distributed memory multicomputers with a speed-up approximately proportional to the number of processors used. A simple two-dimensional domain decomposition assigns regions of the multiresolution pyramid to the different processors. The inter-processor communication needed during the solution process is proportional to the linear dimension of the assigned domain, so that efficiency is close to 100% if a large region is assigned to each processor. Finally, learning algorithms are shown to be a viable technique to engineer computer vision systems for different applications starting from

  12. Development of a real-time absorption method for detecting the mercaptan odorizing mixture of natural gas

    NARCIS (Netherlands)

    Kireev, SV; Petrov, NG; Podolyako, EM; Shnyrev, SL

    The absorption of mercaptan mixtures used for odorizing natural gas and mixtures of natural gas is experimentally studied in the spectral range 2.5-20 mu m. An absorption method for the real-time detection of the odorant concentration is proposed. The method is based on intensity measurements of the

  13. Infrastructure and methods for real-time predictions of the 2014 dengue fever season in Thailand

    OpenAIRE

    Reich, Nicholas G.; Lauer, Stephen A.; Sakrejda, Krzysztof; Iamsirithaworn, Sopon; Hinjoy, Soawapak; Suangtho, Paphanij; Suthachana, Suthanun; Clapham, Hannah E.; Salje, Henrik; Cummings, Derek A. T.; Lessler, Justin

    2015-01-01

    Epidemics of communicable diseases place a huge burden on public health infrastructures across the world. Producing accurate and actionable forecasts of infectious disease incidence at short and long time scales will improve public health response to outbreaks. However, scientists and public health officials face many obstacles in trying to create accurate and actionable real-time forecasts of infectious disease incidence. Dengue is a mosquito-borne virus that annually infects over 400 millio...

  14. Analysis of gene expression in small numbers of purified hemopoietic progenitor cells by RT-PCR.

    Science.gov (United States)

    Ziegler, B L; Lamping, C P; Thoma, S J; Fliedner, T M

    1995-05-01

    Primitive hemopoietic stem cells represent the most probable targets for genetic alterations due to exposure to ionizing irradiation or chemical carcinogens. We have applied a two-step protocol for the purification of CD34+HLA-DR-/low hemopoietic progenitor cells from cord blood (CB). CD34+ cells were isolated by monoclonal antibody (mAb) against CD34 (My10) and immunomagnetic beads. Beads were cleaved off the CD34+ cells by enzymatic treatment with chymopapain. Due to chymopapain-resistance of epitopes recognized by the used mAbs purity control of CD34+ cells and separation into CD34+HLA-DR-/low and CD34+HLA-DR+ subsets could be performed by using flow cytometry. Two miniaturized procedures were applied to isolate poly(A)+ mRNA for the reverse transcription polymerase chain reaction (RT-PCR) from small numbers of CD34+HLA-DR-/low cells. In five experiments, the mean purity of immunomagnetically isolated CD34+ cells was 93.8% +/- 3.9. Flow cytometry sorting of CD34+ cells resulted in pure CD34+HLA-DR-/low populations (purity > 98.8%; range 98.8% to 99.9%; viability > 96%) with an average yield of 2600 +/- 800 cells/5 x 10(7) low density CB cells. By RT-PCR using both poly(A)+ mRNA isolation procedures, sequences corresponding to CD34 and beta 2-microglobulin were amplified from as few as 20 cells. Furthermore, a sequence-independent RT-PCR (SIP-RT-PCR) was applied to amplify the cDNA derived from five erythroblasts isolated from a burst-forming unit-erythroid (BFU-E). Upon hybridization, full-length c-fos message was detected in the SIP-RT-PCR amplified material. Our data demonstrate that gene expression can be detected at the transcriptional level in small numbers of hemopoietic progenitor cells. In addition, the SIP-RT-PCR may allow the amplification of unique mRNA species when subtractive hybridization procedures are performed. The presented data should be useful to analyze gene expression in rare subsets of radiation-exposed immature hemopoietic stem

  15. Alternative majority-voting methods for real-time computing systems

    Science.gov (United States)

    Shin, Kang G.; Dolter, James W.

    1989-01-01

    Two techniques that provide a compromise between the high time overhead in maintaining synchronous voting and the difficulty of combining results in asynchronous voting are proposed. These techniques are specifically suited for real-time applications with a single-source/single-sink structure that need instantaneous error masking. They provide a compromise between a tightly synchronized system in which the synchronization overhead can be quite high, and an asynchronous system which lacks suitable algorithms for combining the output data. Both quorum-majority voting (QMV) and compare-majority voting (CMV) are most applicable to distributed real-time systems with single-source/single-sink tasks. All real-time systems eventually have to resolve their outputs into a single action at some stage. The development of the advanced information processing system (AIPS) and other similar systems serve to emphasize the importance of these techniques. Time bounds suggest that it is possible to reduce the overhead for quorum-majority voting to below that for synchronous voting. All the bounds assume that the computation phase is nonpreemptive and that there is no multitasking.

  16. Linear filters as a method of real-time prediction of geomagnetic activity

    International Nuclear Information System (INIS)

    McPherron, R.L.; Baker, D.N.; Bargatze, L.F.

    1985-01-01

    Important factors controlling geomagnetic activity include the solar wind velocity, the strength of the interplanetary magnetic field (IMF), and the field orientation. Because these quantities change so much in transit through the solar wind, real-time monitoring immediately upstream of the earth provides the best input for any technique of real-time prediction. One such technique is linear prediction filtering which utilizes past histories of the input and output of a linear system to create a time-invariant filter characterizing the system. Problems of nonlinearity or temporal changes of the system can be handled by appropriate choice of input parameters and piecewise approximation in various ranges of the input. We have created prediction filters for all the standard magnetic indices and tested their efficiency. The filters show that the initial response of the magnetosphere to a southward turning of the IMF peaks in 20 minutes and then again in 55 minutes. After a northward turning, auroral zone indices and the midlatitude ASYM index return to background within 2 hours, while Dst decays exponentially with a time constant of about 8 hours. This paper describes a simple, real-time system utilizing these filters which could predict a substantial fraction of the variation in magnetic activity indices 20 to 50 minutes in advance

  17. Evaluation of changes in periodontal bacteria in healthy dogs over 6 months using quantitative real-time PCR.

    Science.gov (United States)

    Maruyama, N; Mori, A; Shono, S; Oda, H; Sako, T

    2018-03-01

    Porphyromonas gulae, Tannerella forsythia and Campylobacter rectus are considered dominant periodontal pathogens in dogs. Recently, quantitative real-time PCR (qRT-PCR) methods have been used for absolute quantitative determination of oral bacterial counts. The purpose of the present study was to establish a standardized qRT-PCR procedure to quantify bacterial counts of the three target periodontal bacteria (P. gulae, T. forsythia and C. rectus). Copy numbers of the three target periodontal bacteria were evaluated in 26 healthy dogs. Then, changes in bacterial counts of the three target periodontal bacteria were evaluated for 24 weeks in 7 healthy dogs after periodontal scaling. Analytical evaluation of each self-designed primer indicated acceptable analytical imprecision. All 26 healthy dogs were found to be positive for P. gulae, T. forsythia and C. rectus. Median total bacterial counts (copies/ng) of each target genes were 385.612 for P. gulae, 25.109 for T. forsythia and 5.771 for C. rectus. Significant differences were observed between the copy numbers of the three target periodontal bacteria. Periodontal scaling reduced median copy numbers of the three target periodontal bacteria in 7 healthy dogs. However, after periodontal scaling, copy numbers of all three periodontal bacteria significantly increased over time (pperiodontal bacteria in dogs. Furthermore, the present study has revealed that qRT-PCR method can be considered as a new objective evaluation system for canine periodontal disease. Copyright© by the Polish Academy of Sciences.

  18. HRT-UML: a design method for hard real-time systems based on the UML notation

    Science.gov (United States)

    D'Alessandro, Massimo; Mazzini, Silvia; di Natale, Marco; Lipari, Giuseppe

    2002-07-01

    The Hard Real-Time-Unified Modelling Language (HRT-UML) method aims at providing a comprehensive solution to the modeling of Hard Real Time systems. The experience shows that the design of Hard Real-Time systems needs methodologies suitable for the modeling and analysis of aspects related to time, schedulability and performance. In the context of the European Aerospace community a reference method for design is Hierarchical Object Oriented Design (HOOD) and in particular its extension for the modeling of hard real time systems, Hard Real-Time-Hierarchical Object Oriented Design (HRT-HOOD), recommended by the European Space Agency (ESA) for the development of on-board systems. On the other hand in recent years the Unified Modelling Language (UML) has been gaining a very large acceptance in a wide range of domains, all over the world, becoming a de-facto international standard. Tool vendors are very active in this potentially big market. In the Aerospace domain the common opinion is that UML, as a general notation, is not suitable for Hard Real Time systems, even if its importance is recognized as a standard and as a technological trend in the near future. These considerations suggest the possibility of replacing the HRT-HOOD method with a customized version of UML, that incorporates the advantages of both standards and complements the weak points. This approach has the clear advantage of making HRT-HOOD converge on a more powerful and expressive modeling notation. The paper identifies a mapping of the HRT-HOOD semantics into the UML one, and proposes a UML extension profile, that we call HRT-UML, based on the UML standard extension mechanisms, to fully represent HRT-HOOD design concepts. Finally it discusses the relationships between our profile and the UML profile for schedulability, performance and time, adopted by OMG in November 2001.

  19. Comparison of the sensitivity and specificity of real-time PCR and in situ hybridization in HPV16 and 18 detection in archival cervical cancer specimens

    Directory of Open Access Journals (Sweden)

    Beata Biesaga

    2012-07-01

    Full Text Available The aim of this study was to analyze the correlation between real-time PCR (RT-PCR treated as a reference method and in situ hybridization with tyramide amplification system (ISH-TSA in the detection of HPV16 and 18 infection and the assessment of viral genome status. The study was performed on cervical cancer biopsies fixed in 10% neutral buffered formalin and embedded in paraffin obtained from 85 women. TaqMan-based 5’exonuclease RT-PCR with type-specific primers was used to assess HPV16 and 18 infections and genome status. Viral infection and genome status was also assessed by ISH-TSA. RT-PCR revealed 76 (89.4%, and ISH-TSA 81 (95.3% cancers with HPV16 and 18 infections. The ISH-TSA sensitivity and specificity were: 96.1% and 11.1% compared to RT-PCR. The difference between these techniques in HPV detection was significant (p = 0.000. Among 76 HPV16/18 positive cancers in RT-PCR, there were 30 (39.5% with integrated and 46 (60.5% with mixed viral genome form. According to ISH-TSA, there were 39 (51.3% samples with integrated and 37 with mixed form (48.7%. The sensitivity and specificity of ISH-TSA in genome status assessment were 70.0% and 60.9%, respectively. The difference between RT-PCR and ISH-TSA in genome state detection was not statistically significant (p = 0.391. These results suggest that ISH-TSA shows insufficient specificity in HPV detection for use in clinical practice. However, this assay could be applied for viral genome status assessment.

  20. Standardization and application of real-time polymerase chain reaction for rapid detection of bluetongue virus

    Directory of Open Access Journals (Sweden)

    I. Karthika Lakshmi

    2018-04-01

    Full Text Available Aim: The present study was designed to standardize real-time polymerase chain reaction (PCR for detecting the bluetongue virus from blood samples of sheep collected during outbreaks of bluetongue disease in the year 2014 in Andhra Pradesh and Telangana states of India. Materials and Methods: A 10-fold serial dilution of Plasmid PUC59 with bluetongue virus (BTV NS3 insert was used to plot the standard curve. BHK-21 and KC cells were used for in vitro propagation of virus BTV-9 at a TCID50/ml of 105 ml and RNA was isolated by the Trizol method. Both reverse transcription -PCR and real-time PCR using TaqMan probe were carried out with RNA extracted from virus-spiked culture medium and blood to compare the sensitivity by means of finding out the limit of detection (LoD. The results were verified by inoculating the detected and undetected dilutions onto cell cultures with further cytological (cytopathic effect and molecular confirmation (by BTV-NS1 group-specific PCR. The standardized technique was then applied to field samples (blood for detecting BTV. Results: The slope of the standard curve obtained was -3.23, and the efficiency was 103%. The LoD with RT-PCR was 8.269Ex103 number of copies of plasmid, whereas it was 13 with real-time PCR for plasmid dilutions. Similarly, LoD was determined for virus-spiked culture medium, and blood with both the types of PCR and the values were 103 TCID 50/ml and 104 TCID 50/ml with RT-PCR and 10° TCID 50/ml and 102 TCID 50/ml with real-time PCR, respectively. The standardized technique was applied to blood samples collected from BTV suspected animals; 10 among 20 samples were found positive with Cq values ranging from 27 to 39. The Cq value exhibiting samples were further processed in cell cultures and were confirmed to be BT positive. Likewise, Cq undetected samples on processing in cell cultures turned out to be BTV negative. Conclusion: Real-time PCR was found to be a very sensitive as well as reliable method

  1. GPU accelerated real-time confocal fluorescence lifetime imaging microscopy (FLIM) based on the analog mean-delay (AMD) method

    Science.gov (United States)

    Kim, Byungyeon; Park, Byungjun; Lee, Seungrag; Won, Youngjae

    2016-01-01

    We demonstrated GPU accelerated real-time confocal fluorescence lifetime imaging microscopy (FLIM) based on the analog mean-delay (AMD) method. Our algorithm was verified for various fluorescence lifetimes and photon numbers. The GPU processing time was faster than the physical scanning time for images up to 800 × 800, and more than 149 times faster than a single core CPU. The frame rate of our system was demonstrated to be 13 fps for a 200 × 200 pixel image when observing maize vascular tissue. This system can be utilized for observing dynamic biological reactions, medical diagnosis, and real-time industrial inspection. PMID:28018724

  2. Investigations for a multi-marker RT-PCR to improve sensitivity of disseminated tumor cell detection.

    NARCIS (Netherlands)

    Vlems, F.A.; Diepstra, J.H.S.; Cornelissen, I.M.; Ligtenberg, M.J.L.; Wobbes, Th.; Punt, C.J.A.; Krieken, J.H.J.M. van; Ruers, T.J.M.; Muijen, G.N.P. van

    2003-01-01

    BACKGROUND: In order to develop a multi-marker RT-PCR, which as such may be more sensitive than a single marker assay for the detection of disseminated tumor cells, we evaluated six RT-PCR markers: cytokeratin 20 (CK20), carcinoembryonic antigen (CEA), guanylyl cyclase C (GCC), epidermal growth

  3. Investigations for a multi-marker RT-PCR to improve sensitivity of disseminated tumor cell detection

    NARCIS (Netherlands)

    Vlems, F. A.; Diepstra, J. H. S.; Cornelissen, I. M. H. A.; Ligtenberg, M. J. L.; Wobbes, Th; Punt, C. J. A.; van Krieken, J. H. J. M.; Ruers, T. J. M.; van Muijen, G. N. P.

    2003-01-01

    In order to develop a multi-marker RT-PCR, which as such may be more sensitive than a single marker assay for the detection of disseminated tumor cells, we evaluated six RT-PCR markers: cytokeratin 20 (CK20), carcinoembryonic antigen (CEA), guanylyl cyclase C (GCC), epidermal growth factor receptor

  4. Formal methods and tools for the development of distributed and real time systems : Esprit Project 3096 (SPEC)

    NARCIS (Netherlands)

    Roever, de W.P.; Barringer, H.; Courcoubetis, C.; Gabbay, D.M.; Gerth, R.T.; Jonsson, B.; Pnueli, A.; Reed, M.; Sifakis, J.; Vytopil, J.; Wolper, P.

    1990-01-01

    The Basic Research Action No. 3096, Formal Methods snd Tools for the Development of Distributed and Real Time Systems, is funded in the Area of Computer Science, under the ESPRIT Programme of the European Community. The coordinating institution is the Department of Computing Science, Eindhoven

  5. Real-time contrast imaging: a new method to monitor capillary recruitment in human forearm skeletal muscle.

    NARCIS (Netherlands)

    Mulder, A.H.; Dijk, A.P.J. van; Smits, P.; Tack, C.J.J.

    2008-01-01

    OBJECTIVE: Muscle capillary perfusion can be measured by contrast-enhanced ultrasound. We examined whether a less time-consuming ultrasound technique, called "real-time imaging," could be used to measure capillary recruitment in human forearm skeletal muscle. METHODS: We measured microvascular blood

  6. Immunohistochemical detection of the BRAF V600E mutation in papillary thyroid carcinoma. Evaluation against real-time polymerase chain reaction.

    Science.gov (United States)

    Paja Fano, Miguel; Ugalde Olano, Aitziber; Fuertes Thomas, Elena; Oleaga Alday, Amelia

    2017-02-01

    The BRAF V600E mutation is the most common genetic change in papillary thyroid carcinoma and is associated with a poorer clinical course. Usual methods for its study (DNA sequencing or molecular test based on PCR) are expensive and time-consuming. Recently, immunohistochemistry (IHC) for BRAF mutation has been introduced. To compare the results of IHC and real time PCR (RT-PCR) in the detection of BRAF V600E mutation in papillary thyroid carcinoma. Analysis of clinical and pathological differences depending on RT-PCR results is included. A prospective study was performed in 82 consecutive samples, 54 of them taken through a core needle biopsy. IHC was performed on tissue fixed for 24hours with 10% neutral formalin using the anti-BRAF V600E (VE-1) mouse monoclonal primary antibody and was rated as positive or negative. DNA was extracted from formalin-fixed, paraffin-embedded tissues by manual microdissection, and BRAF mutation was detected by RT-PCR using the Cobas® 4800 BRAF V600 mutation test (Roche). Both techniques were concordant in 81 cases, and BRAF was positive in 49. Discordance appeared in a follicular variant showing positive IHC and negative RT-PCR, attributed to histological heterogeneity. Cost of materials for IHC was less than half of the cost for RT-PCR. IHC appears to be a reliable, economical and easily available alternative to molecular biology techniques for routine detection of the BRAF V600E mutation in papillary thyroid carcinoma patients, provided optimal fixation conditions are used. It may be a useful technique in hospitals with no access to molecular biology techniques. Copyright © 2017 SEEN. Publicado por Elsevier España, S.L.U. All rights reserved.

  7. Development of duplex RT-PCR-ELISA for the simultaneous detection of hepatitis A virus and hepatitis E virus.

    Science.gov (United States)

    Tahk, Hongmin; Lee, Min Hwa; Lee, Kang Bum; Cheon, Doo-Sung; Choi, Changsun

    2011-07-01

    This study aimed to develop a specific and sensitive duplex reverse transcription polymerase chain reaction enzyme-linked immunosorbent assay (duplex RT-PCR-ELISA) for hepatitis A virus (HAV) and hepatitis E virus (HEV). Duplex RT-PCR-ELISA could detect and differentiate HAV and HEV with specific probes. When ELISA technique was used to detect probe-bound RT-PCR products, duplex RT-PCR-ELISA could detect as little as 0.1 ng/μL HAV and HEV from clinical samples. Human norovirus, enterovirus, poliovirus, murine norovirus and feline calicivirus were used for the specificity test; all were negative. Therefore duplex RT-PCR-ELISA can be used for the simultaneous detection of HAV and HEV in contaminated fecal samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Real-time coloured visualization of phase flows by the schlieren method

    Science.gov (United States)

    Arbuzov, V. A.; Dubnistchev, Yu. N.

    1991-04-01

    A coloured real-time visualizer of optical inhomogeneities comprising a bichromatic schlieren system, video camera and colour monitor has been developed. The schlieren system represents a function Foucault-Hilbert transformation provided with an amplitude spatial frequency filter, or a quadrant Foucault knife edge. Two colour-coded complementary Toepler-grams are obtained in the exit plane of this schlieren system. Their summed image is then recorded by the video camera and displayed on the screen of the colour monitor. The schlieren photograph of internal gravity waves, generated by the cylindrical body motion in the reservoir filled with the stratified liquid, is presented.

  9. Method for Hot Real-Time Analysis of Pyrolysis Vapors at Pilot Scale

    Energy Technology Data Exchange (ETDEWEB)

    Pomeroy, Marc D [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2017-09-29

    Pyrolysis oils contain more than 400 compounds, up to 60% of which do not re-volatilize for subsequent chemical analysis. Vapor chemical composition is also complicated as additional condensation reactions occur during quenching and collection of the product. Due to the complexity of the pyrolysis oil, and a desire to catalytically upgrade the vapor composition before condensation, online real-time analytical techniques such as Molecular Beam Mass Spectrometry (MBMS) are of great use. However, in order to properly sample hot pyrolysis vapors at the pilot scale, many challenges must be overcome.

  10. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Science.gov (United States)

    McMillan, Mary; Pereg, Lily

    2014-01-01

    Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA) in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA) is sufficient for effective normalisation of qRT-PCR data.

  11. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Directory of Open Access Journals (Sweden)

    Mary McMillan

    Full Text Available Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA is sufficient for effective normalisation of qRT-PCR data.

  12. Detection of avian metapneumovirus subtypes in turkeys using RT-PCR.

    Science.gov (United States)

    Ongor, H; Karahan, M; Kalin, R; Bulut, H; Cetinkaya, B

    2010-03-20

    This study investigated the prevalence of avian metapneumovirus (aMPV) and the detection of molecular subtypes of field strains of the virus using RT-PCR in clinically healthy turkeys and those showing signs of respiratory disease. In the RT-PCR examination of 624 tracheal tissue samples collected from a local turkey abattoir, 2.9 per cent (18/624) of samples tested positive. In the examination of tracheal swab samples collected from flocks with respiratory problems, 18 of 20 samples tested positive. When the results were assessed at flock level, aMPV infection was detected in only one of the 23 clinically healthy turkey flocks, whereas all four flocks with respiratory problems were infected. Molecular typing using primers specific to the attachment glycoprotein (G) gene showed that all 36 positive samples belonged to subtype B. Partial sequence analysis of DNA samples showed 95 per cent homology between the field types and the reference strain aMPV subtype B. Whereas clinically healthy turkeys had been vaccinated with a subtype A virus vaccine, the flocks with respiratory problems had been vaccinated with a subtype B virus vaccine. Despite four blind passages of RT-PCR-positive samples on Vero and chicken embryo fibroblast cells, no cytopathic effect was detected by microscopic examination.

  13. Real-time systems

    OpenAIRE

    Badr, Salah M.; Bruztman, Donald P.; Nelson, Michael L.; Byrnes, Ronald Benton

    1992-01-01

    This paper presents an introduction to the basic issues involved in real-time systems. Both real-time operating sys and real-time programming languages are explored. Concurrent programming and process synchronization and communication are also discussed. The real-time requirements of the Naval Postgraduate School Autonomous Under Vehicle (AUV) are then examined. Autonomous underwater vehicle (AUV), hard real-time system, real-time operating system, real-time programming language, real-time sy...

  14. Airborne rhinovirus detection and effect of ultraviolet irradiation on detection by a semi-nested RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Rudnick Stephen

    2003-01-01

    Full Text Available Abstract Background Rhinovirus, the most common cause of upper respiratory tract infections, has been implicated in asthma exacerbations and possibly asthma deaths. Although the method of transmission of rhinoviruses is disputed, several studies have demonstrated that aerosol transmission is a likely method of transmission among adults. As a first step in studies of possible airborne rhinovirus transmission, we developed methods to detect aerosolized rhinovirus by extending existing technology for detecting infectious agents in nasal specimens. Methods We aerosolized rhinovirus in a small aerosol chamber. Experiments were conducted with decreasing concentrations of rhinovirus. To determine the effect of UV irradiation on detection of rhinoviral aerosols, we also conducted experiments in which we exposed aerosols to a UV dose of 684 mJ/m2. Aerosols were collected on Teflon filters and rhinovirus recovered in Qiagen AVL buffer using the Qiagen QIAamp Viral RNA Kit (Qiagen Corp., Valencia, California followed by semi-nested RT-PCR and detection by gel electrophoresis. Results We obtained positive results from filter samples that had collected at least 1.3 TCID50 of aerosolized rhinovirus. Ultraviolet irradiation of airborne virus at doses much greater than those used in upper-room UV germicidal irradiation applications did not inhibit subsequent detection with the RT-PCR assay. Conclusion The air sampling and extraction methodology developed in this study should be applicable to the detection of rhinovirus and other airborne viruses in the indoor air of offices and schools. This method, however, cannot distinguish UV inactivated virus from infectious viral particles.

  15. Application of F⁺RNA Coliphages as Source Tracking Enteric Viruses on Parsley and Leek Using RT-PCR.

    Science.gov (United States)

    Shahrampour, Dina; Yavarmanesh, Masoud; Najafi, Mohammad Bagher Habibi; Mohebbi, Mohebbat

    2015-12-01

    The objective of this study was to identify sources of fecal contamination in leek and parsley, by using four different F(+)RNA coliphage genogroups (IV, I indicate animal fecal contamination and II, III indicate human fecal contamination). Three different concentrations (10(2), 10(4), 10(6) pfu/ml) of MS2 coliphage were inoculated on the surface of parsley and leek samples for detection of phage recovery efficiency among two methods of elution concentration (PEG-precipitation and Ultracentrifugation) by performing double agar layer (DAL) assay in three replications. Highest recovery of MS2 was observed in PEG method and in 10(6) inoculation concentration. Accordingly, the PEG method was used for washing and isolation of potentially contaminated phages of 30 collected samples (15 samples from the market and 15 samples from the farm). The final solutions of PEG method were tested for the enumeration of plaques by DAL assay. Total RNA was then extracted from recovered phages, and RT-PCR was performed by using four primer sets I, II, III, and IV. Incidence of F(+)RNA coliphages was observed in 12/15 (80 %) and 10/15 (66/6 %) of samples were obtained from farm and market, respectively, using both DAL and RT-PCR test methods. Different genotypes (I, II, and IV) of F(+)RNA coliphages were found in farm samples, while only genotype I was detected in market samples by using the primer sets. Due to the higher frequency of genotype I and IV, the absence of genotype III, and also the low frequency of genotype II, it is concluded that the contamination of vegetable (parsley and leek) in Neyshabour, Iran is most likely originated from animal sources.

  16. Comparative analysis of fluorescence in situ hybridizationand real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

    International Nuclear Information System (INIS)

    Ali, J.; Khan, S.A.; Rauf, S.E.; Ayyub, M.; Ali, N.

    2017-01-01

    To compare the sensitivity and specificity of fluorescence in situ hybridization (FISH) with real time polymerase chain reaction (RT-PCR) in the diagnosis of Chronic Myeloid Leukemia (CML). Study Design: A cross-sectional, analytical study. Place and Duration of Study: Haematology Department, Armed Forces Institute of Pathology, Rawalpindi, from January 2012 to February 2014. Methodology:A total number of 87 patients of CML were studied. The diagnosis was made on the basis of clinical history, peripheral blood and bone marrow aspiration. These patients were tested for the presence of BCR-ABL1 fusion gene by RT-PCR and FISH. About 5 ml of venous blood was collected, half was taken in heparin for FISH and half in ethylenediamine tetra-acetic acid (EDTA) for CBC and PCR. For FISH, cells were cultured for 24 hours in RPMI 1640 medium and evaluated using BX51 fluorescence microscope for dual fusion signal of yellow colour. Samples having 20 or more interphases positive for dual fusion signals were taken as positive. For PCR, RNA extraction was done by Tri-Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT-PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of RT-PCR and FISH were compared. Results: Out of the 87 patients, 85 (97.7%) were PCR positive and 2 (2.3%) were PCR negative, whereas in FISH 83 (95.4%) were positive and 4 (4.5%) were negative. Sensitivity and specificity of FISH was 97.6% and 100%, respectively. Conclusion: FISH is a reliable supplementary method to PCR for detection of BCR-ABL1 fusion gene in the diagnosis of CML. (author)

  17. Quantitative Real-time Polymerase Chain Reaction for Enteropathogenic Escherichia coli: A Tool for Investigation of Asymptomatic Versus Symptomatic Infections

    Science.gov (United States)

    Barletta, Francesca; Mercado, Erik; Ruiz, Joaquim; Ecker, Lucie; Lopez, Giovanni; Mispireta, Monica; Gil, Ana I.; Lanata, Claudio F.; Cleary, Thomas G.

    2011-01-01

    Background. Enteropathogenic Escherichia coli (EPEC) strains are pediatric pathogens commonly isolated from both healthy and sick children with diarrhea in areas of endemicity. The aim of this study was to compare the bacterial load of EPEC isolated from stool samples from children with and without diarrhea to determine whether bacterial load might be a useful tool for further study of this phenomenon. Methods. EPEC was detected by polymerase chain reaction (PCR) of colonies isolated on MacConkey plates from 53 diarrheal and 90 healthy children aged <2 years. DNA was isolated from stool samples by cetyltrimethylammonium bromide extraction. To standardize quantification by quantitative real-time PCR (qRT-PCR), the correlation between fluorescence threshold cycle and copy number of the intimin gene of EPEC E2348/69 was determined. Results. The detection limit of qRT-PCR was 5 bacteria/mg stool. The geometric mean load in diarrhea was 299 bacteria/mg (95% confidence interval [CI], 77–1164 bacteria/mg), compared with 29 bacteria/mg (95% CI, 10–87 bacteria/mg) in control subjects (P = .016). Bacterial load was significantly higher in children with diarrhea than in control subjects among children <12 months of age (178 vs 5 bacteria/mg; P = .006) and among children with EPEC as the sole pathogen (463 vs 24 bacteria/mg; P = .006). Conclusions. EPEC load measured by qRT-PCR is higher in diarrheal than in healthy children. qRT-PCR may be useful to study the relationship between disease and colonization in settings of endemicity. PMID:22028433

  18. Near real-time characterization of radio-contaminated soils in France: challenges and methods

    International Nuclear Information System (INIS)

    Desnoyers, Y.; Dubot, D.

    2011-01-01

    Over the last 10 years, the French Atomic Energy Commission (CEA, Commissariat a l'Energie Atomique) has set up an innovative methodology aiming at characterizing radiological contaminations. The application of the latter relies on various tools such as expertise vehicles with embedded measurement devices and a recently developed software platform called Kartotrak. A Geographic Information System tailored to radiological needs constitutes the heart of the platform; it is surrounded by several modules aiming at (i) sampling preparation, (ii) data analysis and geostatistical modeling and (iii) real-time monitoring and data acquisition. This paper presents a methodological framework for the follow-up of decontamination projects, from doubt removal to the verification of the decontamination process. The use of the radiological characterization methodology and its related developments leads to a better appreciation of the contamination and, most importantly, to the optimization of the waste volumes and the reduction of the global cost of the remediation process. (author)

  19. Near real-time characterization of radio-contaminated soils in France: challenges and methods

    Energy Technology Data Exchange (ETDEWEB)

    Desnoyers, Y. [Geovariances, Avon (France); Dubot, D. [Commissariat a l' Energie Atomique (CEA), Fontenay-aux-Roses (France)

    2011-07-01

    Over the last 10 years, the French Atomic Energy Commission (CEA, Commissariat a l'Energie Atomique) has set up an innovative methodology aiming at characterizing radiological contaminations. The application of the latter relies on various tools such as expertise vehicles with embedded measurement devices and a recently developed software platform called Kartotrak. A Geographic Information System tailored to radiological needs constitutes the heart of the platform; it is surrounded by several modules aiming at (i) sampling preparation, (ii) data analysis and geostatistical modeling and (iii) real-time monitoring and data acquisition. This paper presents a methodological framework for the follow-up of decontamination projects, from doubt removal to the verification of the decontamination process. The use of the radiological characterization methodology and its related developments leads to a better appreciation of the contamination and, most importantly, to the optimization of the waste volumes and the reduction of the global cost of the remediation process. (author)

  20. An Energy Efficient Neuromorphic Computing System Using Real Time Sensing Method

    DEFF Research Database (Denmark)

    Farkhani, Hooman; Tohidi, Mohammad; Farkhani, Sadaf

    2017-01-01

    In spintronic-based neuromorphic computing systems (NCS), the switching of magnetic moment in a magnetic tunnel junction (MTJ) is used to mimic neuron firing. However, the stochastic switching behavior of the MTJ and process variations effect leads to extra stimulation time. This leads to extra...... energy consumption and delay of such NCSs. In this paper, a new real-time sensing (RTS) circuit is proposed to track the MTJ state and terminate stimulation phase immediately after MTJ switching. This leads to significant degradation in energy consumption and delay of NCS. The simulation results using...... a 65-nm CMOS technology and a 40-nm MTJ technology confirm that the energy consumption of a RTS-based NCS is improved by 50% in comparison with a typical NCS. Moreover, utilizing RTS circuit improves the overall speed of an NCS by 2.75x....

  1. Construction of an adult barnacle (Balanus amphitrite cDNA library and selection of reference genes for quantitative RT-PCR studies

    Directory of Open Access Journals (Sweden)

    Burgess J Grant

    2009-06-01

    Full Text Available Abstract Background Balanus amphitrite is a barnacle commonly used in biofouling research. Although many aspects of its biology have been elucidated, the lack of genetic information is impeding a molecular understanding of its life cycle. As part of a wider multidisciplinary approach to reveal the biogenic cues influencing barnacle settlement and metamorphosis, we have sequenced and annotated the first cDNA library for B. amphitrite. We also present a systematic validation of potential reference genes for normalization of quantitative real-time PCR (qRT-PCR data obtained from different developmental stages of this animal. Results We generated a cDNA library containing expressed sequence tags (ESTs from adult B. amphitrite. A total of 609 unique sequences (comprising 79 assembled clusters and 530 singlets were derived from 905 reliable unidirectionally sequenced ESTs. Bioinformatics tools such as BLAST, HMMer and InterPro were employed to allow functional annotation of the ESTs. Based on these analyses, we selected 11 genes to study their ability to normalize qRT-PCR data. Total RNA extracted from 7 developmental stages was reverse transcribed and the expression stability of the selected genes was compared using geNorm, BestKeeper and NormFinder. These software programs produced highly comparable results, with the most stable gene being mt-cyb, while tuba, tubb and cp1 were clearly unsuitable for data normalization. Conclusion The collection of B. amphitrite ESTs and their annotation has been made publically available representing an important resource for both basic and applied research on this species. We developed a qRT-PCR assay to determine the most reliable reference genes. Transcripts encoding cytochrome b and NADH dehydrogenase subunit 1 were expressed most stably, although other genes also performed well and could prove useful to normalize gene expression studies.

  2. Result Variation and Efficiency Kinetics in Real-Time PCR

    Directory of Open Access Journals (Sweden)

    Reza Shahsiah

    2010-10-01

    Full Text Available Fluorescent monitoring of DNA amplification is the basis of real-time PCR. Absolute quantification can be achieved using a standard curve method. The standard curve is constructed by amplifying known amounts of standards under identical conditions to that of the samples.The objective of the current study is to propose a mathematical model to assess the acceptability of PCR resulys.Four commercial standards for HCV-RNA (hepatitis C virus RNA along with 6 patient samples were measured by real-time PCR, using two different RT-PCR reagents. The standard deviation of regression (Sy,x was calculated for each group of standard and compared by F-Test. The efficiency kinetics was computed by logistic regression, c2 goodness of fit test was preformed to assess the appropriateness of the efficiency curves.Calculated efficiencies were not significantly different from the value predicted by logistic regression model. Reactions with more variation showed less stable efficiency curves, with wider range of amplification efficiencies.Amplification efficiency kinetics can be computed by fitting a logistic regression curve to the gathered fluorescent data of each reaction. This model can be employed to assess the acceptability of PCR results calculated by standard curve method.

  3. High-efficient method for spectrometric data real time processing with increased resolution of a measuring channel

    International Nuclear Information System (INIS)

    Ashkinaze, S.I.; Voronov, V.A.; Nechaev, Yu.I.

    1988-01-01

    Solution of reduction problem as a mean to increase spectrometric tract resolution when it is realized using the digit-by-digit modified method and special strategy, significantly reducing the time of processing, is considered. The results presented confirm that the complex measurement tract plus microcomputer is equivalent to the use of the tract with a higher resolution, and the use of the digit-by-digit modified method permits to process spectrometric information in real time scale

  4. An Evidence-Based Approach to Plum Pox Virus Detection by DASI-ELISA and RT-PCR in Dormant Period

    Directory of Open Access Journals (Sweden)

    Antonio Olmos

    2008-01-01

    Full Text Available An evidence-based approach, such as those developed in clinical and veterinary medicine, was applied to the detection of Plum pox virus (PPV during the dormant period. A standardized methodology was used for the calculation of parameters of the operational capacity of DASI-ELISA and RT-PCR in wintertime. These methods are routinely handled to test the sanitary status of plants in national or international trading and in those cases concerning export-import of plant materials. Diagnosis often has to be performed during the dormant period, when plant material is commercialized. Some guidelines to interpret diagnostic results of wintertime are provided in an attempt to minimize risks associated with the methods and over-reliance on the binary outcome of a single assay. In order to evaluate if a complementary test increased the confidence of PPV diagnosis when discordant results between DASI-ELISA and RT-PCR are obtained, NASBA-FH also was included. Likelihood ratios of each method were estimated based on the sensitivity and specificity obtained in wintertime. Subsequently, a Bayesian approach was performed to calculate post-test probability of PPV infection in spring. Results of evidence-based approach show that different PPV prevalences require different screening tests. Thus, at very low PPV prevalence levels DASI-ELISA should be used as the election method, whilst at the highest PPV prevalence levels RT-PCR should be performed. NASBA-FH could be used at medium prevalences to clarify discordances between DASIELISA and RT-PCR.

  5. Real-time ed end-point Polymerase Chain Reaction per la quantizzazione del DNA di Citomegalovirus: confronto tra metodi e con il test per l’antigene pp65

    Directory of Open Access Journals (Sweden)

    Tiziano Allice

    2006-03-01

    Full Text Available Quantitave Polymerase Chain Reaction (PCR for Cytomegalovirus (CMV DNA provides highly sensitive and specific data for detecting CMV as well as monitoring the infection and determining the appropriate antiviral strategy.To determine the clinical application of a recently introduced real-time (RT PCR assay for CMV DNA quantitation in peripheral blood leukocytes (PBLs and defining its correlation with the commercial quantitative end-point (EP PCR method COBAS AMPLICOR CMV Monitor and pp65 antigen test. Sequential PBL samples (n=158 from 32 liver transplanted patients with CMV asymptomatic infection and positive for CMV DNA by EP-PCR were retrospectively analysed with RT-PCR and studied according to pp65 antigen levels. A good correlation was found between RT-PCR and pp65 antigen test (r=0.691 and between the two PCR assays (r=0.761. RT-PCR data were significantly higher in pre-emptive treated patients (those with >20 pp65+positive cells, median value: 3.8 log10 copies/500,000 PBLs than in not-treated ones (2.9 logs.According to pp65 levels of 0, 1-10, 11-20, 21-50, 51-100 and >100 positive cells/200,000 PBLs, median CMV DNA load by RT-PCR was 2.6, 3.0, 3.6, 4.0. 4.2 and 4.8, log10 copies/ 500,000 PBLs, respectively (EP-PCR CMV DNA levels: 2. 8, 2.9, 3.8, 3.7, 3.9 and 4.0 logs. For samples with >20 pp65+cells, that is above the level at which pre-emptive therapy was started, RT-PCR values were significantly higher than in groups with less than 20 pp65+cells, whereas EP-PCR values did not significantly differ and showed a slower progression rate. Dilutions of DNA from CMV AD169 strain were used to probe RT-PCR reproducibility (between and intra-assay variability < 2% and sensitivity (100% detection rate at 10 copies/reaction, 28.5% with EP-PCR. A significant improvement is coming from the introduction of RT-PCR to the study of CMV DNA dynamics in differently CMV infected patients due to a more reliable quantitation of CMV DNA for moderate and high

  6. Localisation of Abundant and Organ-Specific Genes Expressed in Rosa hybrida Leaves and Flower Buds by Direct In Situ RT-PCR

    Directory of Open Access Journals (Sweden)

    Agata Jedrzejuk

    2012-01-01

    Full Text Available In situ PCR is a technique that allows specific nucleic acid sequences to be detected in individual cells and tissues. In situ PCR and IS-RT-PCR are elegant techniques that can increase both sensitivity and throughput, but they are, at best, only semiquantitative; therefore, it is desirable first to ascertain the expression pattern by conventional means to establish the suitable conditions for each probe. In plants, in situ RT-PCR is widely used in the expression localisation of specific genes, including MADS-box and other function-specific genes or housekeeping genes in floral buds and other organs. This method is especially useful in small organs or during early developmental stages when the separation of particular parts is impossible. In this paper, we compared three different labelling and immunodetection methods by using in situ RT-PCR in Rosa hybrida flower buds and leaves. As target genes, we used the abundant β-actin and RhFUL gene, which is expressed only in the leaves and petals/sepals of flower buds. We used digoxygenin-11-dUTP, biotin-11-dUTP, and fluorescein-12-dUTP-labelled nucleotides and antidig-AP/ streptavidin-fluorescein-labelled antibodies. All of the used methods gave strong, specific signal and all of them may be used in localization of gene expression on tissue level in rose organs.

  7. Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

    Science.gov (United States)

    Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

    2018-04-23

    Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

  8. Simultaneous detection and identification of four cherry viruses by two step multiplex RT-PCR with an internal control of plant nad5 mRNA.

    Science.gov (United States)

    Noorani, Md Salik; Awasthi, Prachi; Sharma, Maheshwar Prasad; Ram, Raja; Zaidi, Aijaz Asgar; Hallan, Vipin

    2013-10-01

    A multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed and standardized for the simultaneous detection of four cherry viruses: Cherry virus A (CVA, Genus; Capillovirus), Cherry necrotic rusty mottle virus (CNRMV, unassigned species of the Betaflexiviridae), Little cherry virus 1 (LChV-1, Genus; Closterovirus) and Prunus necrotic ringspot virus (PNRSV, Genus; Ilarvirus) with nad5 as plant internal control. A reliable and quick method for total plant RNA extraction from pome and stone fruit trees was also developed. To minimize primer dimer formation, a single antisense primer for CVA and CNRMV was used. A mixture of random hexamer and oligo (dT) primer was used for cDNA synthesis, which was highly suited and economic for multiplexing. All four viruses were detected successfully by mRT-PCR in artificially created viral RNA mixture and field samples of sweet cherry. The identity of the viruses was confirmed by sequencing. The assay could detect above viruses in diluted cDNA (10(-4)) and RNA (10(-3), except PNRSV which was detected only till ten times lesser dilution). The developed mRT-PCR will not only be useful for the detection of viruses from single or multiple infections of sweet cherry plants but also for other stone and pome fruits. The developed method will be therefore quite helpful for virus indexing, plant quarantine and certification programs. This is the first report for the simultaneous detection of four cherry viruses by mRT-PCR. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Identification and differentiation of the twenty six bluetongue virus serotypes by RT-PCR amplification of the serotype-specific genome segment 2.

    Directory of Open Access Journals (Sweden)

    Narender S Maan

    Full Text Available Bluetongue (BT is an arthropod-borne viral disease, which primarily affects ruminants in tropical and temperate regions of the world. Twenty six bluetongue virus (BTV serotypes have been recognised worldwide, including nine from Europe and fifteen in the United States. Identification of BTV serotype is important for vaccination programmes and for BTV epidemiology studies. Traditional typing methods (virus isolation and serum or virus neutralisation tests (SNT or VNT are slow (taking weeks, depend on availability of reference virus-strains or antisera and can be inconclusive. Nucleotide sequence analyses and phylogenetic comparisons of genome segment 2 (Seg-2 encoding BTV outer-capsid protein VP2 (the primary determinant of virus serotype were completed for reference strains of BTV-1 to 26, as well as multiple additional isolates from different geographic and temporal origins. The resulting Seg-2 database has been used to develop rapid (within 24 h and reliable RT-PCR-based typing assays for each BTV type. Multiple primer-pairs (at least three designed for each serotype were widely tested, providing an initial identification of serotype by amplification of a cDNA product of the expected size. Serotype was confirmed by sequencing of the cDNA amplicons and phylogenetic comparisons to previously characterised reference strains. The results from RT-PCR and sequencing were in perfect agreement with VNT for reference strains of all 26 BTV serotypes, as well as the field isolates tested. The serotype-specific primers showed no cross-amplification with reference strains of the remaining 25 serotypes, or multiple other isolates of the more closely related heterologous BTV types. The primers and RT-PCR assays developed in this study provide a rapid, sensitive and reliable method for the identification and differentiation of the twenty-six BTV serotypes, and will be updated periodically to maintain their relevance to current BTV distribution and

  10. A Verification Method of Inter-Task Cooperation in Embedded Real-time Systems and its Evaluation

    Science.gov (United States)

    Yoshida, Toshio

    In software development process of embedded real-time systems, the design of the task cooperation process is very important. The cooperating process of such tasks is specified by task cooperation patterns. Adoption of unsuitable task cooperation patterns has fatal influence on system performance, quality, and extendibility. In order to prevent repetitive work caused by the shortage of task cooperation performance, it is necessary to verify task cooperation patterns in an early software development stage. However, it is very difficult to verify task cooperation patterns in an early software developing stage where task program codes are not completed yet. Therefore, we propose a verification method using task skeleton program codes and a real-time kernel that has a function of recording all events during software execution such as system calls issued by task program codes, external interrupts, and timer interrupt. In order to evaluate the proposed verification method, we applied it to the software development process of a mechatronics control system.

  11. Optimization of a Real Time PCR based method for the detection of Listeria monocytogenes in pork meat.

    Science.gov (United States)

    Gattuso, Antonietta; Gianfranceschi, Monica Virginia; Sonnessa, Michele; Delibato, Elisabetta; Marchesan, Massimo; Hernandez, Marta; De Medici, Dario; Rodriguez-Lazaro, David

    2014-08-01

    The aim of this study was to optimize a Real-Time PCR protocol for a rapid detection of Listeria monocytogenes in pork meat, using reduced volumes of primary selective enrichment broth and times of incubation to decrease the cost and time for analysis. Forty-five samples of pork meat were artificially contaminated with two different levels of L. monocytogenes (1-10 CFU per sample and 10-100 CFU per sample), homogenized in three different volumes of Half Fraser Broth (1:3; 1:5 and 1:10) and incubated at 30°C ± 1°C for 5h, 8h and 24h. The detection was conducted in parallel by Real-Time PCR and the ISO standard 11290-1 methods. L. monocytogenes was detected in all the samples after 24h by Real-Time PCR method, also using reduced volumes of Half Fraser Broth. This represents a clear advantage as the time to final detection and the inherent costs were significantly reduced compared to the ISO reference method. All samples artificially contaminated were correctly detected also after 8 of incubation at 30°C ± 1°C in Half Fraser Broth and 24h in Fraser Broth at 37°C ± 1°C using cultural method. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Dynamic Value Engineering Method Optimizing the Risk on Real Time Operating System

    Directory of Open Access Journals (Sweden)

    Prashant Kumar Patra

    2014-04-01

    Full Text Available The value engineering is the umbrella of the many more sub-system like quality assurance, quality control, quality function design and development for manufacturability. The system engineering & value engineering is two part of the coin. The value engineering is the high level of technology management for every aspect of engineering fields. The value engineering is the high utilization of System Product (i.e. Processor, Memory & Encryption key, Services, Business and Resources at minimal cost. The high end operating system providing highest services at optimal cost & time. The value engineering provides the maximum performance, accountability, reliability, integrity and availability of processor, memory, encryption key and other inter dependency sub-components. The value engineering is the ratio of the maximum functionality of individual components to the optimal cost. VE=k [(P, M, E, C, A]/optimal cost. Where k is the proportionality constant. The VE is directly proportional to performance of individual components and inversely proportional to the minimal cost. The VE is directly proportional to the risk assessment. The VE maximize the business throughput & decision process mean while minimize the risk and down time. We have to develop the dynamic value engineering model & mechanism for risk optimization over a complex real time operating system This proposed composition model definite will be resolve our objective at top high level. Product

  13. Automated methods for real-time analysis of spent-fuel measurement data

    International Nuclear Information System (INIS)

    Bosler, G.E.; Rinard, P.M.; Klosterbuer, S.F.; Painter, J.

    1988-01-01

    Software has been developed for ''real-time'' analysis of neutron and gamma data from GRAND-1/fork measurements on spent-fuel assemblies. Three modules compose the software package. The modules are linked through a database system of files. The first module is part of a general data-base processing code. This module prepares input data files with inventory and correction-factor information for the second module. The second module, called OLAF, operates on a computer attached to the GRAND-1 electronics unit. In this second module, neutron and gamma data from spent-fuel assemblies are analyzed to verify consistency in the facility operator declarations for exposure (burnup) and cooling time. From the analysis, potential discrepancies in the measurement data are questioned while equipment is still installed at the facility and is available for additional measurements. During the measurements, data are written to an output file, called a results file, which can be processed by the third module of the software package. In the third module, printed reports summarizing the data and results are prepared, and neutron and gamma data are written to files that are process by the Deming curve-fitting code

  14. Detection of poliovirus type 2 in oysters by using cell culture and RT-PCR Detecção de poliovírus tipo 2 em ostras através de cultura celular e RT-PCR

    Directory of Open Access Journals (Sweden)

    Cecília E.B. Vinatea

    2006-03-01

    Full Text Available Shellfish are readily contaminated with viruses present in water containing sewage due to the concentrating effect of filter feeding. Enteroviruses are generally used as a model for the detection of viruses from shellfish due to their public health significance. In the present work, oysters were placed in glass aquaria containing seawater plus unicellular algae. Two experiments were performed: 1 oysters bioaccumulating four different poliovirus type 2 concentrations: 5 x 10(4, 2.5 x 10(4, 5 x 10³ and 5 x 10² PFU/mL during 20h; 2 oyster tissues directly inoculated with 6.0 x 10(5 and 1.0 x 10(5 PFU/mL. After viruses seeding, tissue samples were processed by an adsorption-elution-precipitation method. Positive controls were performed by seeding 6.0 x 10(5 PFU/mL of poliovirus type 2 directly on the final oyster tissue extracts. Oyster extracts were assayed for viruses recovery by plaque assay, RT-PCR and integrated cell culture-PCR methodologies (ICC/PCR. The last one was based on the inoculation of the samples onto VERO cell monolayer followed by RT-PCR analysis of the infected cell fluid. In the first experiment (20h bioaccumulation until 5 x 10³ PFU were detected after 24 and 48h growth on VERO cells. Direct RT-PCR and ICC/PCR were able to detect 3 and 0.04 PFU of poliovirus, respectively, when bioaccumulation assay was used. When direct tissue virus seeding was performed, the plaque assays showed that polioviruses were recovered in all tested concentrations. Based on these results, it is possible to conclude that viable polioviruses can be detected in oysters after bioaccumulation and these techniques can be directly applied for monitoring virus contamination in environmental samples.Devido ao hábito alimentar filtrante, os moluscos bivalves são contaminados por vírus presentes em águas contaminadas por esgoto. Os enterovírus são geralmente usados como modelos para a detecção de vírus em moluscos bivalves devido a sua import

  15. Evaluation of a rapid method for recovery of norovirus and hepatitis A virus from oysters and blue mussels

    DEFF Research Database (Denmark)

    Uhrbrand, Katrine; Myrmel, Mette; Maunula, Leena

    2010-01-01

    Foodborne outbreaks caused by noroviruses (NoVs) and hepatitis A virus (HAV) are often linked to consumption of contaminated shellfish. The objective of this study was to identify an appropriate virus recovery method for real-time reverse transcriptase (RT)-PCR detection and subsequently to evalu......Foodborne outbreaks caused by noroviruses (NoVs) and hepatitis A virus (HAV) are often linked to consumption of contaminated shellfish. The objective of this study was to identify an appropriate virus recovery method for real-time reverse transcriptase (RT)-PCR detection and subsequently...

  16. Methods of using real-time social media technologies for detection and remote monitoring of HIV outcomes.

    Science.gov (United States)

    Young, Sean D; Rivers, Caitlin; Lewis, Bryan

    2014-06-01

    Recent availability of "big data" might be used to study whether and how sexual risk behaviors are communicated on real-time social networking sites and how data might inform HIV prevention and detection. This study seeks to establish methods of using real-time social networking data for HIV prevention by assessing 1) whether geolocated conversations about HIV risk behaviors can be extracted from social networking data, 2) the prevalence and content of these conversations, and 3) the feasibility of using HIV risk-related real-time social media conversations as a method to detect HIV outcomes. In 2012, tweets (N=553,186,061) were collected online and filtered to include those with HIV risk-related keywords (e.g., sexual behaviors and drug use). Data were merged with AIDSVU data on HIV cases. Negative binomial regressions assessed the relationship between HIV risk tweeting and prevalence by county, controlling for socioeconomic status measures. Over 9800 geolocated tweets were extracted and used to create a map displaying the geographical location of HIV-related tweets. There was a significant positive relationship (psocial networking data as a method for evaluating and detecting Human immunodeficiency virus (HIV) risk behaviors and outcomes. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Development and evaluation of a real-time method for testing human enteroviruses and coxsackievirus A16.

    Science.gov (United States)

    Chen, Qian; Hu, Zheng; Zhang, Qihua; Yu, Minghui

    2016-05-01

    Hand, foot, and mouth disease (HFMD) is a common infectious disease caused by a group of the human enteroviruses (HEV), including coxsackievirus A16 (CA16) and enterovirus 71 (EV71). In recent years, another HEV-A serotype, CA6 or CA10, has emerged to be one of the major etiologic agents that can induce HFMD worldwide. The objective of this study is to develop specific, sensitive, and rapid methods to help diagnose HEV and CA16 specifically by using simultaneous amplification testing (SAT) based on isothermal amplification of RNA and real-time detection of fluorescence technique, which were named as SAT-HEV and SAT-CA16, respectively (SAT-HEV/SAT-CA16). The specificity and sensitivity of SAT were tested here. SAT-HEV/SAT-CA16 could measure viral titers that were at least 10-fold lower than those measured by real-time PCR. Non-false cross-reactive amplification indicated that SAT-HEV/SAT-CA16 were highly specific with the addition of internal control (IC) RNA (5000 copies/reaction). A total of 198 clinical specimens were assayed by SAT comparing with real-time PCR. The statistically robust assessment of SAT-HEV and HEV-specific real-time PCR plus sequencing reached 99.0% (196/198), with a kappa value of 0.97, and 99.5% (197/198) and a kappa value of 0.99 for CA16, respectively. Additionally, IC prevented false-negative readings and assured the SAT-HEV/SAT-CA16 method's accuracy. Overall, SAT-HEV/SAT-CA16 method may serve as a platform for the simple and rapid detection of HEV/CA16 in time of HFMD outbreak. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. RT-PCR for confirmation of echovirus 30 isolated in Belém, Brazil

    Directory of Open Access Journals (Sweden)

    Maria de Lourdes C. Gomes

    Full Text Available Echovirus (Echo 30 or human enterovirus B is the most frequent enterovirus associated with meningitis cases. Epidemics and outbreaks of this disease caused by Echo 30 have occurred in several countries. In Brazil, Echo 30 has been isolated from sporadic cases and outbreaks that occurred mainly in the south and southeast regions. We used RT-PCR to examine Echo 30 isolates from meningitis cases detected from March 2002 to December 2003 in Belém, state of Pará, in northern Brazil. The patients were attended in a Basic Health Unit (State Health Secretary of Pará, where cerebrospinal fluid (CSF was collected and stored in liquid nitrogen. Weekly visits were made by technicians from Evandro Chagas Institute to the health unit and samples were stored at -70ºC in the laboratory until use. HEp-2 and RD cell lines were used for viral isolation and neutralization with specific antisera for viral identification. RNA extraction was made using Trizol reagent. The RT-PCR was made in one step, and the total mixture (50 µL was composed of: RNA, reaction buffer, dNTP, primers, Rnase inhibitor, reverse transcriptase, Taq polymerase and water. The products were visualized in agarose gel stained with ethidium bromide, visualized under UV light. Among the 279 CSF samples examined, 30 (10.7% were EV positive, 29 being Echo 30 and one was Cox B. Nineteen Echo 30 were examined with RT-PCR; 18 tested positive (762 and 494 base pairs. The use of this technique permitted viral identification in less time than usual, which benefits the patient and is of importance for public-health interventions.

  19. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets.

    Science.gov (United States)

    Liu, Xin; Guan, Huirui; Song, Min; Fu, Yanping; Han, Xiaomin; Lei, Meng; Ren, Jingyu; Guo, Bin; He, Wei; Wei, Yahui

    2018-01-01

    Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR) is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs) as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported. In this study, 10 candidate RGs namely, 18S , 60S , CYP , GAPCP1 , GAPDH2 , EF1B , MDH , SAND , TUA1 , and TUA6 , were singled out from the transcriptome database of S. chamaejasme , and their expression stability under three abiotic stresses (drought, cold, and salt) and three hormone treatments (abscisic acid, ABA; gibberellin, GA; ethephon, ETH) were estimated with the programs geNorm, NormFinder, and BestKeeper. Our results showed that GAPCP1 and EF1B were the best combination for the three abiotic stresses, whereas TUA6 and SAND , TUA1 and CYP , GAPDH2 and 60S were the best choices for ABA, GA, and ETH treatment, respectively. Moreover, GAPCP1 and 60S were assessed to be the best combination for all samples, and 18S was the least stable RG for use as an internal control in all of the experimental subsets. The expression patterns of two target genes ( P5CS2 and GI ) further verified that the RGs that we selected were suitable for gene expression normalization. This work is the first attempt to

  20. The current incidence of viral disease in korean sweet potatoes and development of multiplex rt-PCR assays for simultaneous detection of eight sweet potato viruses.

    Science.gov (United States)

    Kwak, Hae-Ryun; Kim, Mi-Kyeong; Shin, Jun-Chul; Lee, Ye-Ji; Seo, Jang-Kyun; Lee, Hyeong-Un; Jung, Mi-Nam; Kim, Sun-Hyung; Choi, Hong-Soo

    2014-12-01

    Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV) and sweet potato virus C (SPVC) were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1), Sweet potato virus G (SPVG), Sweet potato leaf curl virus (SPLCV), Sweet potato virus 2 ( SPV2), Sweet potato chlorotic fleck virus (SPCFV), and Sweet potato latent virus (SPLV) were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1) in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  1. The Current Incidence of Viral Disease in Korean Sweet Potatoes and Development of Multiplex RT-PCR Assays for Simultaneous Detection of Eight Sweet Potato Viruses

    Directory of Open Access Journals (Sweden)

    Hae-Ryun Kwak

    2014-12-01

    Full Text Available Sweet potato is grown extensively from tropical to temperate regions and is an important food crop worldwide. In this study, we established detection methods for 17 major sweet potato viruses using single and multiplex RT-PCR assays. To investigate the current incidence of viral diseases, we collected 154 samples of various sweet potato cultivars showing virus-like symptoms from 40 fields in 10 Korean regions, and analyzed them by RT-PCR using specific primers for each of the 17 viruses. Of the 17 possible viruses, we detected eight in our samples. Sweet potato feathery mottle virus (SPFMV and sweet potato virus C (SPVC were most commonly detected, infecting approximately 87% and 85% of samples, respectively. Furthermore, Sweet potato symptomless virus 1 (SPSMV-1, Sweet potato virus G (SPVG, Sweet potato leaf curl virus (SPLCV, Sweet potato virus 2 ( SPV2, Sweet potato chlorotic fleck virus (SPCFV, and Sweet potato latent virus (SPLV were detected in 67%, 58%, 47%, 41%, 31%, and 20% of samples, respectively. This study presents the first documented occurrence of four viruses (SPVC, SPV2, SPCFV, and SPSMV-1 in Korea. Based on the results of our survey, we developed multiplex RT-PCR assays for simple and simultaneous detection of the eight sweet potato viruses we recorded.

  2. [Disappearance of residual disease confirmed by RT-PCR following induction chemotherapy in two hypoplastic leukemia patients with t(8;21)].

    Science.gov (United States)

    Sawada, M; Tsurumi, H; Yamada, T; Hara, T; Oyama, M; Moriwaki, H

    1999-04-01

    Reverse transcriptase-polymerase chain reaction (RT-PCR) methods often detect the AML1/MTG8 fusion transcript even in acute myelogenous leukemia (AML) patients with t(8;21) who have been in long-term remission. We encountered 2 hypoplastic leukemia patients with t(8;21) who achieved cytogenetic remission with short-term conventional chemotherapy. Patient 1 was a 42-year-old woman. Chromosomal analysis detected t(8;21) (q22;q22) and PCR analysis (35 cycles PCR amplification; detection limit 1 x 10(-5) cells) detected the AML1/MTG8 fusion transcript. Complete remission was obtained with 1 course of chemotherapy consisting of low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days). After 2 courses of consolidation chemotherapy consisting of conventional-dose cytarabine and mitoxantrone, the RT-PCR findings were negative for the AML1/MTG8 fusion transcript. Patient 2 was a 67-year-old man. Cytogenetic analysis detected t(8;21) (q22;q22), and was positive for the AML1/MTG8 fusion transcript. After 2 courses of induction chemotherapy comprising low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days), and 3 courses of conventional consolidation chemotherapy, RT-PCR analysis confirmed the disappearance of the AML1/MTG8 fusion transcript.

  3. Visual simultaneous localization and mapping (VSLAM) methods applied to indoor 3D topographical and radiological mapping in real-time

    International Nuclear Information System (INIS)

    Hautot, F.; Dubart, P.; Chagneau, B.; Bacri, C.O.; Abou-Khalil, R.

    2017-01-01

    New developments in the field of robotics and computer vision enable to merge sensors to allow fast real-time localization of radiological measurements in the space/volume with near real-time radioactive sources identification and characterization. These capabilities lead nuclear investigations to a more efficient way for operators' dosimetry evaluation, intervention scenarios and risks mitigation and simulations, such as accidents in unknown potentially contaminated areas or during dismantling operations. This paper will present new progresses in merging RGB-D camera based on SLAM (Simultaneous Localization and Mapping) systems and nuclear measurement in motion methods in order to detect, locate, and evaluate the activity of radioactive sources in 3-dimensions

  4. DETECTION OF CLASSICAL SWINE FEVER VIRUS BY RT-PCR IN WEST BENGAL, INDIA

    Directory of Open Access Journals (Sweden)

    Sumit Chowdhury

    2016-12-01

    Full Text Available Classical swine fever is a deadly disease of swine, caused by a RNA virus. The present study has identified presence of the classical swine fever virus (CSFV in pigs of West Bengal by one step reverse transcriptase PCR (RT-PCR performed using 5’ NTR specific primers. Internal organs from clinically affected pigs were examined from three districts of West Bengal. RT-PCT has identified presence of CSFV in all the tissues examined confirming presence of CSFV in different parts of the state.

  5. Method and system for detecting, in real time, the imbalance of the head in a high-precision rotary mechanism

    OpenAIRE

    Toro Matamoros, Raúl Mario del; Schmittdiel, Michael Charles; Haber Guerra, Rodolfo E.

    2008-01-01

    [EN] The invention relates to a method for detecting, in real time, an imbalance of the head in a high-precision rotary mechanism, and to the system for carrying out said method. The method comprises the following steps: a) the signal X(t) corresponding to the acceleration of the vibrations of the head is acquired by means of an acquisition means at a sampling rate FS; and b) it is determined, from the signal X(t) obtained, whether the head is imbalanced.

  6. POD for Real-Time Simulation of Hyperelastic Soft Biological Tissue Using the Point Collocation Method of Finite Spheres

    Directory of Open Access Journals (Sweden)

    Suleiman Banihani

    2013-01-01

    Full Text Available The point collocation method of finite spheres (PCMFS is used to model the hyperelastic response of soft biological tissue in real time within the framework of virtual surgery simulation. The proper orthogonal decomposition (POD model order reduction (MOR technique was used to achieve reduced-order model of the problem, minimizing computational cost. The PCMFS is a physics-based meshfree numerical technique for real-time simulation of surgical procedures where the approximation functions are applied directly on the strong form of the boundary value problem without the need for integration, increasing computational efficiency. Since computational speed has a significant role in simulation of surgical procedures, the proposed technique was able to model realistic nonlinear behavior of organs in real time. Numerical results are shown to demonstrate the effectiveness of the new methodology through a comparison between full and reduced analyses for several nonlinear problems. It is shown that the proposed technique was able to achieve good agreement with the full model; moreover, the computational and data storage costs were significantly reduced.

  7. Real-time PCR-based method for rapid detection of Aspergillus niger and Aspergillus welwitschiae isolated from coffee.

    Science.gov (United States)

    von Hertwig, Aline Morgan; Sant'Ana, Anderson S; Sartori, Daniele; da Silva, Josué José; Nascimento, Maristela S; Iamanaka, Beatriz Thie; Pelegrinelli Fungaro, Maria Helena; Taniwaki, Marta Hiromi

    2018-05-01

    Some species from Aspergillus section Nigri are morphologically very similar and altogether have been called A. niger aggregate. Although the species included in this group are morphologically very similar, they differ in their ability to produce mycotoxins and other metabolites and their taxonomical status has evolved continuously. Among them, A. niger and A. welwitschiae are ochratoxin A and fumonisin B 2 producers and their detection and/or identification is of crucial importance for food safety. The aim of this study was the development of a real-time PCR-based method for simultaneous discrimination of A. niger and A. welwitschiae from other species of the A. niger aggregate isolated from coffee beans. One primer pair and a hybridization probe specific for detection of A. niger and A. welwitschiae strains were designed based on the BenA gene sequences, and used in a Real-time PCR assay for the rapid discrimination between both these species from all others of the A. niger aggregate. The Real-time PCR assay was shown to be 100% efficient in discriminating the 73 isolates of A. niger/A. welwitschiae from the other A. niger aggregate species analyzed as a negative control. This result testifies to the use of this technique as a good tool in the rapid detection of these important toxigenic species. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Validation of putative reference genes for normalization of Q-RT-PCR data from paraffin-embedded lymphoid tissue

    DEFF Research Database (Denmark)

    Green, Tina Marie; de Stricker, Karin; Møller, Michael Boe

    2009-01-01

    Normalization of quantitative reverse transcription-PCR (Q-RT-PCR) data to appropriate tissue-specific reference genes is an essential part of interpreting the results. This study aimed to determine the most appropriate reference genes for normalizing gene expressions in lymphatic tissue...... was 0.93 (Pnormalization with the appropriate reference genes. Thus, we show that formalin-fixed, paraffin-embedded lymphoid samples are suitable for Q-RT-PCR when using thoroughly validated reference genes....

  9. Identification of circulating miRNA biomarkers based on global quantitative real-time PCR profiling

    Directory of Open Access Journals (Sweden)

    Kang Kang

    2012-02-01

    Full Text Available Abstract MicroRNAs (miRNAs are small noncoding RNAs (18-25 nucleotides that regulate gene expression at the post-transcriptional level. Recent studies have demonstrated the presence of miRNAs in the blood circulation. Deregulation of miRNAs in serum or plasma has been associated with many diseases including cancers and cardiovascular diseases, suggesting the possible use of miRNAs as diagnostic biomarkers. However, the detection of the small amount of miRNAs found in serum or plasma requires a method with high sensitivity and accuracy. Therefore, the current study describes polymerase chain reaction (PCR-based methods for measuring circulating miRNAs. Briefly, the procedure involves four major steps: (1 sample collection and preparation; (2 global miRNAs profiling using quantitative real-time PCR (qRT-PCR; (3 data normalization and analysis; and (4 selection and validation of miRNA biomarkers. In conclusion, qRT-PCR is a promising method for profiling of circulating miRNAs as biomarkers.

  10. Strategy for the maximization of clinically relevant information from hepatitis C virus, RT-PCR quantification.

    LENUS (Irish Health Repository)

    Levis, J

    2012-02-03

    BACKGROUND: The increasing clinical application of viral load assays for monitoring viral infections has been an incentive for the development of standardized tests for the hepatitis C virus. OBJECTIVE: To develop a simple model for the prediction of baseline viral load in individuals infected with the hepatitis C virus. METHODOLOGY: Viral load quantification of each patient\\'s first sample was assessed by RT-PCR-ELISA using the Roche MONITOR assay in triplicate. Genotype of the infecting virus was identified by reverse line probe hybridization, using amplicons resulting from the qualitative HCV Roche AMPLICOR assay. RESULTS: Retrospective evaluation of first quantitative values suggested that 82.4% (n=168\\/204) of individuals had a viral load between 4.3 and 6.7 log(10) viral copies per ml. A few patients (3.4%; n=7\\/204) have a serum viremia less than the lower limit of the linear range of the RT-PCR assay. Subsequent, prospective evaluation of hepatitis C viral load of all new patients using a model based on the dynamic range of viral load in the retrospective group correctly predicted the dynamic range in 75.9% (n=33\\/54). CONCLUSION: The dynamic range of hepatitis C viremia extends beyond the linear range of the Roche MONITOR assay. Accurate determination of serum viremia is substantially improved by dilution of specimens prior to quantification.

  11. Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR

    Directory of Open Access Journals (Sweden)

    Hoseong Choi

    2013-03-01

    Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

  12. Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    International Nuclear Information System (INIS)

    Gebara, C.M.S.; Wosiachi, S.R.; Negrao, F.J.; Oliveira, D.B. de; Beloni, S.N.E.; Alfieri, A.A.; Alfieri, A.F.

    2004-01-01

    The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV) nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control) included 20 assymptomatic dogs. A c2 was used to test RT-PCR results according to clinical form and hematological characteristics. The RT-PCR was positive for CDV in 47% (41/87) of the urine samples from dogs with clinical signs. All samples from assymptomatic dogs were RT-PCR negatives. Positive samples were found in all groups of dogs with distemper symptoms according to the following propositions: 51.2% (21/41), 29% (11/37) and 100% (9/9) for groups A, B and C, respectively. In all clinical forms (groups A, B and C) leucocytosis was the most frequent observed hematological alteration. No relationship between RT-PCR results and hematological changes was observed. The results showed that independently of the clinical stage of the illness the RT-PCR based on urine sample can be applied for ante mortem diagnosis of CDV

  13. Unequal distribution of RT-PCR artifacts along the E1-E2 region of Hepatitis C virus.

    Science.gov (United States)

    Domingo-Calap, Pilar; Sentandreu, Vicente; Bracho, Maria Alma; González-Candelas, Fernando; Moya, Andrés; Sanjuán, Rafael

    2009-10-01

    Although viral variability studies have focused traditionally on consensus sequences, the relevance of molecular clone sequences for studying viral evolution at the intra-host level is being increasingly recognized. However, for this approach to be reliable, RT-PCR artifacts do not have to contribute excessively to the observed variability. Molecular clone sequences were obtained from an in vitro transcript to estimate the maximum error rate associated to RT-PCR for the Hepatitis C virus (HCV) E1-E2 region. On average, the frequency of RT-PCR errors was one order of magnitude lower than the level of intra-host genetic variability observed in samples from an HCV outbreak. However, RT-PCR errors were not distributed evenly along the E1-E2 region and were concentrated heavily in the hypervariable region 2 (HVR 2). Although it is concluded that RT-PCR molecular clone sequences are reliable, these results warn against extrapolation of RT-PCR error rates to different genome regions. The data suggest that the RNA sequence context or secondary structure can determine the fidelity of in vitro transcription or reverse transcription. Potentially, these factors might also modify the fidelity of the viral polymerase.

  14. Epidemiological, clinical and laboratory profile of scrub typhus cases detected by serology and RT-PCR in Kumaon, Uttarakhand: a hospital-based study.

    Science.gov (United States)

    Rawat, Vinita; Singh, Rajesh Kumar; Kumar, Ashok; Saxena, Sandip R; Varshney, Umesh; Kumar, Mukesh

    2018-04-01

    We analysed the epidemiology, clinical and laboratory data of the 168 scrub typhus cases confirmed by a combination of any one of the following: real time polymerase chain reaction (RT-PCR) and/or immunofluorescence assay (IFA) (IgM and/or IgG). The peak season for scrub typhus was from July to October. By multivariate binary logistic regression analysis, the risk of scrub typhus was about four times in those working in occupation related to forest work. Major clinical manifestations were fever (100%), myalgia (65%), cough (51%) and vomiting (46%); major complications were meningitis/meningoencephatilitis (12.5%) and multi-organ failure (MOF) and pneumonia (5.3% each). Laboratory investigations revealed raised aminotranferase levels and thrombocytopenia in most confirmed cases. We conclude that scrub typhus is an important cause of febrile illness in the Kumaon hills of Uttarakhand where this disease had not previously been considered to exist.

  15. Evaluation of the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction assay and the INFINITI® Respiratory Viral Panel Plus assay for the detection of human metapneumovirus in Kuwait.

    Science.gov (United States)

    Al-Turab, Mariam; Chehadeh, Wassim; Al-Mulla, Fahd; Al-Nakib, Widad

    2012-04-01

    Human metapneumovirus (hMPV) is a respiratory pathogen that was discovered in 2001 and is considered a major cause of both upper and lower respiratory tract infections. A sensitive, fast, and high-throughput diagnostic test is needed for the detection of hMPV that may assist in the clinical management as well as in the reduction of inappropriate therapy. Therefore, a comparison assessment was performed in this study between the PrimerDesign™ genesig real-time reverse transcription-polymerase chain reaction (RT-PCR) Assay and the INFINITI(®) Respiratory Viral Panel Plus Assay (RVP-Plus) for the detection of hMPV infection in patients with respiratory tract infections. A total of 200 respiratory samples were collected from 185 hospitalized patients, during the winter season in Kuwait. Of 185 patients, 10 (5.4%) were positive for hMPV RNA by the in-house RT-PCR assay, while 7 (4%) were positive for hMPV RNA by the real-time RT-PCR assay and 9 (5%) were positive for hMPV RNA by the INFINITI(®) RVP-Plus assay. The high incidence rate (60%) of hMPV infection was in January 2011. The sensitivity of the real-time RT-PCR and INFINITI(®) RVP-Plus assays was 70% and 90%, respectively, with specificity of 100% for both assays. hMPV types A and B could be identified in this study; however, discordant genotyping results were found between the direct sequencing method and the INFINITI(®) RVP-Plus assay in 33% of hMPV-positive patients. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Real time alpha value measurement with Feynman-α method utilizing time series data acquisition on low enriched uranium system

    International Nuclear Information System (INIS)

    Tonoike, Kotaro; Yamamoto, Toshihiro; Watanabe, Shoichi; Miyoshi, Yoshinori

    2003-01-01

    As a part of the development of a subcriticality monitoring system, a system which has a time series data acquisition function of detector signals and a real time evaluation function of alpha value with the Feynman-alpha method was established, with which the kinetic parameter (alpha value) was measured at the STACY heterogeneous core. The Hashimoto's difference filter was implemented in the system, which enables the measurement at a critical condition. The measurement result of the new system agreed with the pulsed neutron method. (author)

  17. Rapid detection of Salmonella in pet food: design and evaluation of integrated methods based on real-time PCR detection.

    Science.gov (United States)

    Balachandran, Priya; Friberg, Maria; Vanlandingham, V; Kozak, K; Manolis, Amanda; Brevnov, Maxim; Crowley, Erin; Bird, Patrick; Goins, David; Furtado, Manohar R; Petrauskene, Olga V; Tebbs, Robert S; Charbonneau, Duane

    2012-02-01

    Reducing the risk of Salmonella contamination in pet food is critical for both companion animals and humans, and its importance is reflected by the substantial increase in the demand for pathogen testing. Accurate and rapid detection of foodborne pathogens improves food safety, protects the public health, and benefits food producers by assuring product quality while facilitating product release in a timely manner. Traditional culture-based methods for Salmonella screening are laborious and can take 5 to 7 days to obtain definitive results. In this study, we developed two methods for the detection of low levels of Salmonella in pet food using real-time PCR: (i) detection of Salmonella in 25 g of dried pet food in less than 14 h with an automated magnetic bead-based nucleic acid extraction method and (ii) detection of Salmonella in 375 g of composite dry pet food matrix in less than 24 h with a manual centrifugation-based nucleic acid preparation method. Both methods included a preclarification step using a novel protocol that removes food matrix-associated debris and PCR inhibitors and improves the sensitivity of detection. Validation studies revealed no significant differences between the two real-time PCR methods and the standard U.S. Food and Drug Administration Bacteriological Analytical Manual (chapter 5) culture confirmation method.

  18. Clinical utility of an optimised multiplex real-time PCR assay for the identification of pathogens causing sepsis in Vietnamese patients.

    Science.gov (United States)

    Tat Trung, Ngo; Van Tong, Hoang; Lien, Tran Thi; Van Son, Trinh; Thanh Huyen, Tran Thi; Quyen, Dao Thanh; Hoan, Phan Quoc; Meyer, Christian G; Song, Le Huu

    2018-02-01

    For the identification of bacterial pathogens, blood culture is still the gold standard diagnostic method. However, several disadvantages apply to blood cultures, such as time and rather large volumes of blood sample required. We have previously established an optimised multiplex real-time PCR method in order to diagnose bloodstream infections. In the present study, we evaluated the diagnostic performance of this optimised multiplex RT-PCR in blood samples collected from 110 septicaemia patients enrolled at the 108 Military Central Hospital, Hanoi, Vietnam. Positive results were obtained by blood culture, the Light Cylcler-based SeptiFast ® assay and our multiplex RT-PCR in 35 (32%), 31 (28%), and 31 (28%) samples, respectively. Combined use of the three methods confirmed 50 (45.5%) positive cases of bloodstream infection, a rate significantly higher compared to the exclusive use of one of the three methods (P=0.052, 0.012 and 0.012, respectively). The sensitivity, specificity and area under the curve (AUC) of our assay were higher compared to that of the SeptiFast ® assay (77.4%, 86.1% and 0.8 vs. 67.7%, 82.3% and 0.73, respectively). Combined use of blood culture and multiplex RT-PCR assay showed a superior diagnostic performance, as the sensitivity, specificity, and AUC reached 83.3%, 100%, and 0.95, respectively. The concordance between blood culture and the multiplex RT-PCR assay was highest for Klebsiella pneumonia (100%), followed by Streptococcus spp. (77.8%), Escherichia coli (66.7%), Staphylococcus spp. (50%) and Salmonella spp. (50%). In addition, the use of the newly established multiplex RT-PCR assay increased the spectrum of identifiable agents (Acintobacter baumannii, 1/32; Proteus mirabilis, 1/32). The combination of culture and the multiplex RT-PCR assay provided an excellent diagnostic accomplishment and significantly supported the identification of causative pathogens in clinical samples obtained from septic patients. Copyright © 2017 The

  19. A comparison of EGFR mutation testing methods in lung carcinoma: direct sequencing, real-time PCR and immunohistochemistry.

    Directory of Open Access Journals (Sweden)

    Bárbara Angulo

    Full Text Available The objective of this study is to compare two EGFR testing methodologies (a commercial real-time PCR kit and a specific EGFR mutant immunohistochemistry, with direct sequencing and to investigate the limit of detection (LOD of both PCR-based methods. We identified EGFR mutations in 21 (16% of the 136 tumours analyzed by direct sequencing. Interestingly, the Therascreen EGFR Mutation Test kit was able to characterize as wild-type one tumour that could not be analyzed by direct sequencing of the PCR product. We then compared the LOD of the kit and that of direct sequencing using the available mutant tumours. The kit was able to detect the presence of a mutation in a 1% dilution of the total DNA in nine of the 18 tumours (50%, which tested positive with the real-time quantitative PCR method. In all cases, EGFR mutation was identified at a dilution of 5%. Where the mutant DNA represented 30% of the total DNA, sequencing was able to detect mutations in 12 out of 19 cases (63%. Additional experiments with genetically defined standards (EGFR ΔE746-A750/+ and EGFR L858R/+ yielded similar results. Immunohistochemistry (IHC staining with exon 19-specific antibody was seen in eight out of nine cases with E746-A750del detected by direct sequencing. Neither of the two tumours with complex deletions were positive. Of the five L858R-mutated tumours detected by the PCR methods, only two were positive for the exon 21-specific antibody. The specificity was 100% for both antibodies. The LOD of the real-time PCR method was lower than that of direct sequencing. The mutation specific IHC produced excellent specificity.

  20. Comparison of gating methods for the real-time analysis of left ventricular function in nonimaging blood pool studies.

    Science.gov (United States)

    Beard, B B; Stewart, J R; Shiavi, R G; Lorenz, C H

    1995-01-01

    Gating methods developed for electrocardiographic-triggered radionuclide ventriculography are being used with nonimaging detectors. These methods have not been compared on the basis of their real-time performance or suitability for determination of load-independent indexes of left ventricular function. This work evaluated the relative merits of different gating methods for nonimaging radionuclude ventriculographic studies, with particular emphasis on their suitability for real-time measurements and the determination of pressure-volume loops. A computer model was used to investigate the relative accuracy of forward gating, backward gating, and phase-mode gating. The durations of simulated left ventricular time-activity curves were randomly varied. Three acquisition parameters were considered: frame rate, acceptance window, and sample size. Twenty-five studies were performed for each combination of acquisition parameters. Hemodynamic and shape parameters from each study were compared with reference parameters derived directly from the random time-activity curves. Backward gating produced the largest errors under all conditions. For both forward gating and phase-mode gating, ejection fraction was underestimated and time to end systole and normalized peak ejection rate were overestimated. For the hemodynamic parameters, forward gating was marginally superior to phase-mode gating. The mean difference in errors between forward and phase-mode gating was 1.47% (SD 2.78%). However, for root mean square shape error, forward gating was several times worse in every case and seven times worse than phase-mode gating on average. Both forward and phase-mode gating are suitable for real-time hemodynamic measurements by nonimaging techniques. The small statistical difference between the methods is not clinically significant. The true shape of the time-activity curve is maintained most accurately by phase-mode gating.

  1. Real-time method of powder diffraction for non-periodic and nearly periodic materials

    International Nuclear Information System (INIS)

    Egami, T.; Toby, B.H.; Dmowski, T.W.; Jorgensen, J.D.

    1989-12-01

    The use of high-energy neutrons from pulsed or hot sources allows the method of atomic pair distribution analysis to be applied to the structural determination of crystalline as well as amorphous solids. This method complements the standard crystallographic methods in studying non-periodic aspects of solids with or without long range order. 14 refs., 3 figs

  2. An introduction to compositional methods for concurrency and their application to real-time

    NARCIS (Netherlands)

    Hooman, J.J.M.; Roever, de W.P.

    1992-01-01

    Formal methods to specify and verify concurrent programs with synchronous message passing are discussed. We stress the development towards compositional methods, i.e. methods in which the specification of a compound program can be inferred from specifications of its constituents without reference to

  3. A Robust Real Time Direction-of-Arrival Estimation Method for Sequential Movement Events of Vehicles.

    Science.gov (United States)

    Liu, Huawei; Li, Baoqing; Yuan, Xiaobing; Zhou, Qianwei; Huang, Jingchang

    2018-03-27

    Parameters estimation of sequential movement events of vehicles is facing the challenges of noise interferences and the demands of portable implementation. In this paper, we propose a robust direction-of-arrival (DOA) estimation method for the sequential movement events of vehicles based on a small Micro-Electro-Mechanical System (MEMS) microphone array system. Inspired by the incoherent signal-subspace method (ISM), the method that is proposed in this work employs multiple sub-bands, which are selected from the wideband signals with high magnitude-squared coherence to track moving vehicles in the presence of wind noise. The field test results demonstrate that the proposed method has a better performance in emulating the DOA of a moving vehicle even in the case of severe wind interference than the narrowband multiple signal classification (MUSIC) method, the sub-band DOA estimation method, and the classical two-sided correlation transformation (TCT) method.

  4. Finite Element Methods for real-time Haptic Feedback of Soft-Tissue Models in Virtual Reality Simulators

    Science.gov (United States)

    Frank, Andreas O.; Twombly, I. Alexander; Barth, Timothy J.; Smith, Jeffrey D.; Dalton, Bonnie P. (Technical Monitor)

    2001-01-01

    We have applied the linear elastic finite element method to compute haptic force feedback and domain deformations of soft tissue models for use in virtual reality simulators. Our results show that, for virtual object models of high-resolution 3D data (>10,000 nodes), haptic real time computations (>500 Hz) are not currently possible using traditional methods. Current research efforts are focused in the following areas: 1) efficient implementation of fully adaptive multi-resolution methods and 2) multi-resolution methods with specialized basis functions to capture the singularity at the haptic interface (point loading). To achieve real time computations, we propose parallel processing of a Jacobi preconditioned conjugate gradient method applied to a reduced system of equations resulting from surface domain decomposition. This can effectively be achieved using reconfigurable computing systems such as field programmable gate arrays (FPGA), thereby providing a flexible solution that allows for new FPGA implementations as improved algorithms become available. The resulting soft tissue simulation system would meet NASA Virtual Glovebox requirements and, at the same time, provide a generalized simulation engine for any immersive environment application, such as biomedical/surgical procedures or interactive scientific applications.

  5. A Real-Time Thermal Self-Elimination Method for Static Mode Operated Freestanding Piezoresistive Microcantilever-Based Biosensors.

    Science.gov (United States)

    Ku, Yu-Fu; Huang, Long-Sun; Yen, Yi-Kuang

    2018-02-28

    Here, we provide a method and apparatus for real-time compensation of the thermal effect of single free-standing piezoresistive microcantilever-based biosensors. The sensor chip contained an on-chip fixed piezoresistor that served as a temperature sensor, and a multilayer microcantilever with an embedded piezoresistor served as a biomolecular sensor. This method employed the calibrated relationship between the resistance and the temperature of piezoresistors to eliminate the thermal effect on the sensor, including the temperature coefficient of resistance (TCR) and bimorph effect. From experimental results, the method was verified to reduce the signal of thermal effect from 25.6 μV/°C to 0.3 μV/°C, which was approximately two orders of magnitude less than that before the processing of the thermal elimination method. Furthermore, the proposed approach and system successfully demonstrated its effective real-time thermal self-elimination on biomolecular detection without any thermostat device to control the environmental temperature. This method realizes the miniaturization of an overall measurement system of the sensor, which can be used to develop portable medical devices and microarray analysis platforms.

  6. A Real-Time Thermal Self-Elimination Method for Static Mode Operated Freestanding Piezoresistive Microcantilever-Based Biosensors

    Directory of Open Access Journals (Sweden)

    Yu-Fu Ku

    2018-02-01

    Full Text Available Here, we provide a method and apparatus for real-time compensation of the thermal effect of single free-standing piezoresistive microcantilever-based biosensors. The sensor chip contained an on-chip fixed piezoresistor that served as a temperature sensor, and a multilayer microcantilever with an embedded piezoresistor served as a biomolecular sensor. This method employed the calibrated relationship between the resistance and the temperature of piezoresistors to eliminate the thermal effect on the sensor, including the temperature coefficient of resistance (TCR and bimorph effect. From experimental results, the method was verified to reduce the signal of thermal effect from 25.6 μV/°C to 0.3 μV/°C, which was approximately two orders of magnitude less than that before the processing of the thermal elimination method. Furthermore, the proposed approach and system successfully demonstrated its effective real-time thermal self-elimination on biomolecular detection without any thermostat device to control the environmental temperature. This method realizes the miniaturization of an overall measurement system of the sensor, which can be used to develop portable medical devices and microarray analysis platforms.

  7. Gauss-Seidel Iterative Method as a Real-Time Pile-Up Solver of Scintillation Pulses

    Science.gov (United States)

    Novak, Roman; Vencelj, Matja¿

    2009-12-01

    The pile-up rejection in nuclear spectroscopy has been confronted recently by several pile-up correction schemes that compensate for distortions of the signal and subsequent energy spectra artifacts as the counting rate increases. We study here a real-time capability of the event-by-event correction method, which at the core translates to solving many sets of linear equations. Tight time limits and constrained front-end electronics resources make well-known direct solvers inappropriate. We propose a novel approach based on the Gauss-Seidel iterative method, which turns out to be a stable and cost-efficient solution to improve spectroscopic resolution in the front-end electronics. We show the method convergence properties for a class of matrices that emerge in calorimetric processing of scintillation detector signals and demonstrate the ability of the method to support the relevant resolutions. The sole iteration-based error component can be brought below the sliding window induced errors in a reasonable number of iteration steps, thus allowing real-time operation. An area-efficient hardware implementation is proposed that fully utilizes the method's inherent parallelism.

  8. Analysis of potential errors in real-time streamflow data and methods of data verification by digital computer

    Science.gov (United States)

    Lystrom, David J.

    1972-01-01

    The magnitude, frequency, and types of errors inherent in real-time streamflow data are presented in part I. It was found that real-time data are generally less accurate than are historical data, primarily because real-time data are often used before errors can be detected and corrections applied.

  9. CyNC - a method for Real Time Analysis of Systems with Cyclic Data Flows

    DEFF Research Database (Denmark)

    Schiøler, Henrik; Nielsen, Jens F. Dalsgaard; Larsen, Kim Guldstrand

    2005-01-01

    The paper addresses a novel method for realtime analysis of systems with cyclic data flows. The presented method is based on Network Calculus principles, where upper and lower flow and service constraint are used to bound data flows and processing resources. In acyclic systems flow constraints ma...... in a prototype tool also denoted CyNC providing a graphical user interface for model specification based on the MATLAB/SimuLink framework....... in a space of constraint functions. In this paper a method denoted CyNC for obtaining a well defined solution to that problem is presented along with a theoretical justification of the method as well as comparative results for CyNC and alternative methods on a relevant example. The method is implemented...

  10. Validation of a same-day real-time PCR method for screening of meat and carcass swabs for Salmonella

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Krause, Michael; Josefsen, Mathilde Hartmann

    2009-01-01

    of the published PCR methods for Salmonella have been validated in collaborative studies. This study describes a validation including comparative and collaborative trials, based on the recommendations from the Nordic organization for validation of alternative microbiological methods (NordVal) of a same-day, non....... Partly based on results obtained in this study, the method has obtained NordVal approval for analysis of Salmonella in meat and carcass swabs. The PCR method was transferred to a production laboratory and the performance was compared with the BAX Salmonella test on 39 pork samples artificially...... contaminated with Salmonella. There was no significant difference in the results obtained by the two methods. Conclusion: The real-time PCR method for detection of Salmonella in meat and carcass swabs was validated in comparative and collaborative trials according to NordVal recommendations. The PCR method...

  11. Comparison of nine DNA extraction methods for the diagnosis of bovine tuberculosis by real time PCR

    OpenAIRE

    Moura, André; Hodon, Mikael Arrais; Soares Filho, Paulo Martins; Issa, Marina de Azevedo; Oliveira, Ana Paula Ferreira de; Fonseca Júnior, Antônio Augusto

    2016-01-01

    ABSTRACT: Bovine tuberculosis is an infectious disease with a high impact on the cattle industry, particularly in developing countries. PCR is a very sensitive method for detection of infectious agents, but the sensitivity of molecular diagnosis is largely dependent on the efficiency of the DNA extraction methods. The objective of this study was to evaluate DNA extraction methods for direct detection of Mycobacterium bovis in bovine tissue. Nine commercial kits for DNA extraction were evalua...

  12. Method for near-real-time continuous air monitoring of phosgene, hydrogen cyanide, and cyanogen chloride

    Science.gov (United States)

    Lattin, Frank G.; Paul, Donald G.

    1996-11-01

    A sorbent-based gas chromatographic method provides continuous quantitative measurement of phosgene, hydrogen cyanide, and cyanogen chloride in ambient air. These co