WorldWideScience

Sample records for real-time rt-pcr analysis

  1. Table 1. Primer sequences used for real-time qRT-PCR analysis of ...

    Indian Academy of Sciences (India)

    User

    TGTCCCAGTAAACCGCTC. GAATCCAGCACGATACCAGT. Figure 1. Expression analysis of candidate CsActin and CsFbox genes by qRT-PCR in response to 4°C treatment. The y-axis indicates Cq values, and error bars represent standard deviations of the mean values of four replicates. Rt, roots; St, stems; Le, leaves; Fl ...

  2. Selection of Housekeeping Genes for Transgene Expression Analysis in Eucommia ulmoides Oliver Using Real-Time RT-PCR

    Directory of Open Access Journals (Sweden)

    Ren Chen

    2010-01-01

    Full Text Available In order to select appropriate housekeeping genes for accurate calibration of experimental variations in real-time (RT- PCR results in transgene expression analysis, particularly with respect to the influence of transgene on stability of endogenous housekeeping gene expression in transgenic plants, we outline a reliable strategy to identify the optimal housekeeping genes from a set of candidates by combining statistical analyses of their (RT- PCR amplification efficiency, gene expression stability, and transgene influences. We used the strategy to select two genes, ACTα and EF1α, from 10 candidate housekeeping genes, as the optimal housekeeping genes to evaluate transgenic Eucommia ulmoides Oliver root lines overexpressing IPPI or FPPS1 genes, which are involved in isoprenoid biosynthesis.

  3. Real-time RT-PCR high-resolution melting curve analysis and multiplex RT-PCR to detect and differentiate grapevine leafroll-associated associated virus 3 variant groups I, II, III and VI

    Directory of Open Access Journals (Sweden)

    Bester Rachelle

    2012-09-01

    Full Text Available Abstract Background Grapevine leafroll-associated virus 3 (GLRaV-3 is the main contributing agent of leafroll disease worldwide. Four of the six GLRaV-3 variant groups known have been found in South Africa, but their individual contribution to leafroll disease is unknown. In order to study the pathogenesis of leafroll disease, a sensitive and accurate diagnostic assay is required that can detect different variant groups of GLRaV-3. Methods In this study, a one-step real-time RT-PCR, followed by high-resolution melting (HRM curve analysis for the simultaneous detection and identification of GLRaV-3 variants of groups I, II, III and VI, was developed. A melting point confidence interval for each variant group was calculated to include at least 90% of all melting points observed. A multiplex RT-PCR protocol was developed to these four variant groups in order to assess the efficacy of the real-time RT-PCR HRM assay. Results A universal primer set for GLRaV-3 targeting the heat shock protein 70 homologue (Hsp70h gene of GLRaV-3 was designed that is able to detect GLRaV-3 variant groups I, II, III and VI and differentiate between them with high-resolution melting curve analysis. The real-time RT-PCR HRM and the multiplex RT-PCR were optimized using 121 GLRaV-3 positive samples. Due to a considerable variation in melting profile observed within each GLRaV-3 group, a confidence interval of above 90% was calculated for each variant group, based on the range and distribution of melting points. The intervals of groups I and II could not be distinguished and a 95% joint confidence interval was calculated for simultaneous detection of group I and II variants. An additional primer pair targeting GLRaV-3 ORF1a was developed that can be used in a subsequent real-time RT-PCR HRM to differentiate between variants of groups I and II. Additionally, the multiplex RT-PCR successfully validated 94.64% of the infections detected with the real-time RT-PCR HRM

  4. A novel method of multiple nucleic acid detection: Real-time RT-PCR coupled with probe-melting curve analysis.

    Science.gov (United States)

    Han, Yang; Hou, Shao-Yang; Ji, Shang-Zhi; Cheng, Juan; Zhang, Meng-Yue; He, Li-Juan; Ye, Xiang-Zhong; Li, Yi-Min; Zhang, Yi-Xuan

    2017-11-15

    A novel method, real-time reverse transcription PCR (real-time RT-PCR) coupled with probe-melting curve analysis, has been established to detect two kinds of samples within one fluorescence channel. Besides a conventional TaqMan probe, this method employs another specially designed melting-probe with a 5' terminus modification which meets the same label with the same fluorescent group. By using an asymmetric PCR method, the melting-probe is able to detect an extra sample in the melting stage effectively while it almost has little influence on the amplification detection. Thus, this method allows the availability of united employment of both amplification stage and melting stage for detecting samples in one reaction. The further demonstration by simultaneous detection of human immunodeficiency virus (HIV) and hepatitis C virus (HCV) in one channel as a model system is presented in this essay. The sensitivity of detection by real-time RT-PCR coupled with probe-melting analysis was proved to be equal to that detected by conventional real-time RT-PCR. Because real-time RT-PCR coupled with probe-melting analysis can double the detection throughputs within one fluorescence channel, it is expected to be a good solution for the problem of low-throughput in current real-time PCR. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Selection and validation of reference genes for gene expression analysis in switchgrass (Panicum virgatum using quantitative real-time RT-PCR.

    Directory of Open Access Journals (Sweden)

    Jacinta Gimeno

    Full Text Available Switchgrass (Panicum virgatum has received a lot of attention as a forage and bioenergy crop during the past few years. Gene expression studies are in progress to improve new traits and develop new cultivars. Quantitative real time PCR (qRT-PCR has emerged as an important technique to study gene expression analysis. For accurate and reliable results, normalization of data with reference genes is essential. In this work, we evaluate the stability of expression of genes to use as reference for qRT-PCR in the grass P. virgatum. Eleven candidate reference genes, including eEF-1α, UBQ6, ACT12, TUB6, eIF-4a, GAPDH, SAMDC, TUA6, CYP5, U2AF, and FTSH4, were validated for qRT-PCR normalization in different plant tissues and under different stress conditions. The expression stability of these genes was verified by the use of two distinct algorithms, geNorm and NormFinder. Differences were observed after comparison of the ranking of the candidate reference genes identified by both programs but eEF-1α, eIF-4a, CYP5 and U2AF are ranked as the most stable genes in the samples sets under study. Both programs discard the use of SAMDC and TUA6 for normalization. Validation of the reference genes proposed by geNorm and NormFinder were performed by normalization of transcript abundance of a group of target genes in different samples. Results show similar expression patterns when the best reference genes selected by both programs were used but differences were detected in the transcript abundance of the target genes. Based on the above research, we recommend the use of different statistical algorithms to identify the best reference genes for expression data normalization. The best genes selected in this study will help to improve the quality of gene expression data in a wide variety of samples in switchgrass.

  6. Validation of reference genes for quantitative expression analysis by real-time rt-PCR in four lepidopteran insects.

    Science.gov (United States)

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae), Chilo suppressalis Walker (Crambidae), and Spodoptera exigua Hübner (Noctuidae) to study their expression stability. The algorithms of geNorm, NormFinder, stability index, and ΔCt analysis were used to evaluate these HKGs. Across different developmental stages, actin A1 was the most stable in P. xylostella and C. suppressalis, but it was the least stable in B. mori and S. exigua. Rp49 and GAPDH were the most stable in B. mori and S. exigua, respectively. In different tissues, GAPDH, E2F, and Rp49 were the most stable in B. mori, S. exigua, and C. suppressalis, respectively. The relative abundances of Siwi genes estimated by 2(-ΔΔCt) method were tested with different HKGs as the reference gene, proving the importance of internal controls in qPCR data analysis. The results not only presented a list of suitable reference genes in four lepidopteran insects, but also proved that the expression stabilities of HKGs were different among evolutionarily close species. There was no single universal reference gene that could be used in all situations. It is indispensable to validate the expression of HKGs before using them as the internal control in qPCR.

  7. Validation of Reference Genes for Quantitative Expression Analysis by Real-Time RT-PCR in Four Lepidopteran Insects

    OpenAIRE

    Teng, Xiaolu; Zhang, Zan; He, Guiling; Yang, Liwen; Li, Fei

    2012-01-01

    Quantitative real-time polymerase chain reaction (qPCR) is an efficient and widely used technique to monitor gene expression. Housekeeping genes (HKGs) are often empirically selected as the reference genes for data normalization. However, the suitability of HKGs used as the reference genes has been seldom validated. Here, six HKGs were chosen (actin A3, actin A1, GAPDH, G3PDH, E2F, rp49) in four lepidopteran insects Bombyx mori L. (Lepidoptera: Bombycidae), Plutella xylostella L. (Plutellidae...

  8. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  9. Detection and characterization of Newcastle disease virus in clinical samples using real time RT-PCR and melting curve analysis based on matrix and fusion genes amplification

    Directory of Open Access Journals (Sweden)

    Saad Sharawi

    2013-10-01

    Full Text Available Aim: Newcastle disease is still one of the major threats for poultry industry allover the world. Therefore, attempt was made in this study to use the SYBR Green I real-time PCR with melting curves analysis as for detection and differentiation of NDV strains in suspected infected birds. Materials and Methods: Two sets of primers were used to amplify matrix and fusion genes in samples collected from suspectly infected birds (chickens and pigeons. Melting curve analysis in conjunction with real time PCR was conducted for identifying different pathotypes of the isolated NDVs. Clinical samples were propagated on specific pathogen free ECE and tested for MDT and ICIP. Results: The velogenic NDVs isolated from chickens and pigeons were distinguished with mean T 85.03±0.341 and m 83.78±0.237 respectively for M-gene amplification and for F-gene amplification the mean T were 84.04±0.037 and m 84.53±0.223. On the other hand the lentogenic NDV isolates including the vaccinal strains (HB1 and LaSota have a higher mean T (86.99±0.021 for M-gene amplification and 86.50±0.063 for F-gene amplification. The test showed no reaction with m unrelated RNA samples. In addition, the results were in good agreement with both virus isolation and biological pathotyping (MDT and ICIP. The assay offers an attractive alternative method for the diagnosis of NDV that can be easily applied in laboratory diagnosis as a screening test for the detection and differentiation of NDV infections. Conclusion: As was shown by the successful rapid detection and pathotyping of 15 NDV strains in clinical samples representing velogenic and lentogenic NDV strains, and the agreement with the results of virus isolation , biological pathotyping and pathogenicity indices. The results of this report suggests that the described SybrGreen I real-time RT-PCR assay in conjunction with Melting curve analysis used as a rapid, specific and simple diagnostic tools for detection and pathotyping of

  10. Gene expression analysis of the rat testis after treatment with di(2-ethylhexyl) phthalate using cDNA microarray and real-time RT-PCR

    International Nuclear Information System (INIS)

    Kijima, Kazuyasu; Toyosawa, Kaoru; Yasuba, Masashi; Matsuoka, Nobuo; Adachi, Tetsuya; Komiyama, Masatoshi; Mori, Chisato

    2004-01-01

    To investigate the effects of di(2-ethylhexyl) phthalate (DEHP) on gene expression in rat testis, 6-week-old male Sprague-Dawley rats were given a single oral dose of 20 or 2000 mg/kg and euthanized 3, 6, 24, or 72 h thereafter. Terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive cells were significantly increased in the testis at 24 and 72 h after the exposure to 2000 mg/kg of DEHP. On cDNA microarray analysis, in addition to apoptosis-related genes, genes associated with atrophy, APEX nuclease, MutS homologue (E. coli), testosterone-repressed-prostatic-message-2 (TRPM-2), connective tissue growth factor, collagen alpha 2 type V, and cell adhesion kinase were differentially expressed. To investigate the relationship between histopathological alteration and gene expression, we selected genes associated with apoptosis and analyzed their expression by real-time quantitative reverse transcription-polymerase chain reaction (RT-PCR). With 20 mg/kg of DEHP treatment, bcl-2, key gene related to apoptosis, was increased. Up-regulation of bcl-2, inhibitor of Apaf-1/caspase-9/caspase-2 cascade of apoptosis, may be related to the fact that no morphological apoptotic change was induced after dosing of 20 mg/kg DEHP. With 2000 mg/kg of DEHP treatment, the apoptotic activator cascade, Fas/FasL, FADD/caspase-8/caspase-3 cascade, and Apaf-1/caspase-9/caspase-2 cascade were increased and bcl-2 was decreased. Thus, these gene regulations might lead the cells into apoptosis in the case of high exposure to DEHP. In contrast, FADD/caspase-10/caspase-6 cascade and caspase-11/caspase-3 cascade were not increased. These results indicate that the cascades of FADD/caspase-10/caspase-6 and caspase-11/caspase-3 are not related to apoptosis with DEHP treatment

  11. Identification of normalization factors for quantitative real-time RT-PCR analysis of gene expression in Pacific abalone Haliotis discus hannai

    Science.gov (United States)

    Qiu, Reng; Sun, Boguang; Fang, Shasha; Sun, Li; Liu, Xiao

    2013-03-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is widely used in studies of gene expression. In most of these studies, housekeeping genes are used as internal references without validation. To identify appropriate reference genes for qRT-PCR in Pacific abalone Haliotis discus hannai, we examined the transcription stability of six housekeeping genes in abalone tissues in the presence and absence of bacterial infection. For this purpose, abalone were infected with the bacterial pathogen Vibrio anguillarum for 12 h and 48 h. The mRNA levels of the housekeeping genes in five tissues (digestive glands, foot muscle, gill, hemocyte, and mantle) were determined by qRT-PCR. The PCR data was subsequently analyzed with the geNorm and NormFinder algorithms. The results show that in the absence of bacterial infection, elongation factor-1-alpha and beta-actin were the most stably expressed genes in all tissues, and thus are suitable as cross-tissue type normalization factors. However, we did not identify any universal reference genes post infection because the most stable genes varied between tissue types. Furthermore, for most tissues, the optimal reference genes identified by both algorithms at 12 h and 48 h post-infection differed. These results indicate that bacterial infection induced significant changes in the expression of abalone housekeeping genes in a manner that is dependent on tissue type and duration of infection. As a result, different normalization factors must be used for different tissues at different infection points.

  12. Real-Time RT-PCR for the Detection of Lyssavirus Species

    Directory of Open Access Journals (Sweden)

    A. Deubelbeiss

    2014-01-01

    Full Text Available The causative agents of rabies are single-stranded, negative-sense RNA viruses in the genus Lyssavirus of Rhabdoviridae, consisting of twelve classified and three as yet unclassified species including classical rabies virus (RABV. Highly neurotropic RABV causes rapidly progressive encephalomyelitis with nearly invariable fatal outcome. Rapid and reliable diagnosis of rabies is highly relevant for public and veterinary health. Due to growing variety of the genus Lyssavirus observed, the development of suitable molecular assays for diagnosis and differentiation is challenging. This work focused on the establishment of a suitable real-time RT-PCR technique for rabies diagnosis as a complement to fluorescent antibody test and rabies tissue culture infection test as gold standard for diagnosis and confirmation. The real-time RT-PCR was adapted with the goal to detect the whole spectrum of lyssavirus species, for nine of which synthesized DNA fragments were used. For the detection of species, seven probes were developed. Serial dilutions of the rabies virus strain CVS-11 showed a 100-fold higher sensitivity of real-time PCR compared to heminested RT-PCR. Using a panel of thirty-one lyssaviruses representing four species, the suitability of the protocol could be shown. Phylogenetic analysis of the sequences obtained by heminested PCR allowed correct classification of all viruses used.

  13. Real-time RT-PCR, a necessary tool to support the diagnosis and surveillance of rotavirus in Mexico.

    Science.gov (United States)

    De La Cruz Hernández, Sergio Isaac; Anaya Molina, Yazmin; Gómez Santiago, Fabián; Terán Vega, Heidi Lizbeth; Monroy Leyva, Elda; Méndez Pérez, Héctor; García Lozano, Herlinda

    2018-04-01

    Rotavirus produces diarrhea in children under 5 years old. Most of those conventional methods such as polyacrylamide gel electrophoresis (PAGE) and reverse transcription-polymerase chain reaction (RT-PCR) have been used for rotavirus detection. However, these techniques need a multi-step process to get the results. In comparison with conventional methods, the real-time RT-PCR is a highly sensitive method, which allows getting the results in only one day. In this study a real-time RT-PCR assay was tested using a panel of 440 samples from patients with acute gastroenteritis, and characterized by PAGE and RT-PCR. The results show that the real-time RT-PCR detected rotavirus from 73% of rotavirus-negative samples analyzed by PAGE and RT-PCR; thus, the percentage of rotavirus-positive samples increased to 81%. The results indicate that this real-time RT-PCR should be part of a routine analysis, and as a support of the diagnosis of rotavirus in Mexico. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Quantitative real-time RT-PCR and chromogenic in situ hybridization

    DEFF Research Database (Denmark)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia G T

    2009-01-01

    . METHODS: To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. RESULTS: The concordance...

  15. Validation of reference genes for gene expression analysis in olive (Olea europaea) mesocarp tissue by quantitative real-time RT-PCR

    Science.gov (United States)

    2014-01-01

    Background Gene expression analysis using quantitative reverse transcription PCR (qRT-PCR) is a robust method wherein the expression levels of target genes are normalised using internal control genes, known as reference genes, to derive changes in gene expression levels. Although reference genes have recently been suggested for olive tissues, combined/independent analysis on different cultivars has not yet been tested. Therefore, an assessment of reference genes was required to validate the recent findings and select stably expressed genes across different olive cultivars. Results A total of eight candidate reference genes [glyceraldehyde 3-phosphate dehydrogenase (GAPDH), serine/threonine-protein phosphatase catalytic subunit (PP2A), elongation factor 1 alpha (EF1-alpha), polyubiquitin (OUB2), aquaporin tonoplast intrinsic protein (TIP2), tubulin alpha (TUBA), 60S ribosomal protein L18-3 (60S RBP L18-3) and polypyrimidine tract-binding protein homolog 3 (PTB)] were chosen based on their stability in olive tissues as well as in other plants. Expression stability was examined by qRT-PCR across 12 biological samples, representing mesocarp tissues at various developmental stages in three different olive cultivars, Barnea, Frantoio and Picual, independently and together during the 2009 season with two software programs, GeNorm and BestKeeper. Both software packages identified GAPDH, EF1-alpha and PP2A as the three most stable reference genes across the three cultivars and in the cultivar, Barnea. GAPDH, EF1-alpha and 60S RBP L18-3 were found to be most stable reference genes in the cultivar Frantoio while 60S RBP L18-3, OUB2 and PP2A were found to be most stable reference genes in the cultivar Picual. Conclusions The analyses of expression stability of reference genes using qRT-PCR revealed that GAPDH, EF1-alpha, PP2A, 60S RBP L18-3 and OUB2 are suitable reference genes for expression analysis in developing Olea europaea mesocarp tissues, displaying the highest level

  16. High-level expression of podoplanin in benign and malignant soft tissue tumors: immunohistochemical and quantitative real-time RT-PCR analysis.

    Science.gov (United States)

    Xu, Yongjun; Ogose, Akira; Kawashima, Hiroyuki; Hotta, Tetsuo; Ariizumi, Takashi; Li, Guidong; Umezu, Hajime; Endo, Naoto

    2011-03-01

    Podoplanin is a 38 kDa mucin-type transmembrane glycoprotein that was first identified in rat glomerular epithelial cells (podocytes). It is expressed in normal lymphatic endothelium, but is absent from vascular endothelial cells. D2-40 is a commercially available mouse monoclonal antibody which binds to an epitope on human podoplanin. D2-40 immunoreactivity is therefore highly sensitive and specific for lymphatic endothelium. Recent investigations have shown widespread applications of immunohistochemical staining with D2-40 in evaluating podoplanin expression as an immunohistochemical marker for diagnosis and prognosis in various tumors. To determine whether the podoplanin (D2-40) antibody may be useful for the diagnosis of soft tissue tumors, 125 cases, including 4 kinds of benign tumors, 15 kinds of malignant tumors and 3 kinds of tumor-like lesions were immunostained using the D2-40 antibody. Total RNA was extracted from frozen tumor tissue obtained from 41 corresponding soft tissue tumor patients and 12 kinds of soft tissue tumor cell lines. Quantitative real-time PCR reactions were performed. Immunohistochemical and quantitative real-time RT-PCR analyses demonstrated the expression of the podoplanin protein and mRNA in the majority of benign and malignant soft tissue tumors and tumor-like lesions examined, with the exception of alveolar soft part sarcoma, embryonal and alveolar rhabdomyosarcoma, extraskeletal Ewing's sarcoma/peripheral primitive neuro-ectodermal tumor and lipoma, which were completely negative for podoplanin. Since it is widely and highly expressed in nearly all kinds of soft tissue tumors, especially in spindle cell sarcoma, myxoid type soft tissue tumors and soft tissue tumors of the nervous system, podoplanin is considered to have little value in the differential diagnosis of soft tissue tumors.

  17. Improvement of a real-time RT-PCR assay for the detection of enterovirus RNA

    Directory of Open Access Journals (Sweden)

    Bruynseels Peggy

    2009-07-01

    Full Text Available Abstract We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5' exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.

  18. Detection of Tomato black ring virus by real-time one-step RT-PCR.

    Science.gov (United States)

    Harper, Scott J; Delmiglio, Catia; Ward, Lisa I; Clover, Gerard R G

    2011-01-01

    A TaqMan-based real-time one-step RT-PCR assay was developed for the rapid detection of Tomato black ring virus (TBRV), a significant plant pathogen which infects a wide range of economically important crops. Primers and a probe were designed against existing genomic sequences to amplify a 72 bp fragment from RNA-2. The assay amplified all isolates of TBRV tested, but no amplification was observed from the RNA of other nepovirus species or healthy host plants. The detection limit of the assay was estimated to be around nine copies of the TBRV target region in total RNA. A comparison with conventional RT-PCR and ELISA, indicated that ELISA, the current standard test method, lacked specificity and reacted to all nepovirus species tested, while conventional RT-PCR was approximately ten-fold less sensitive than the real-time RT-PCR assay. Finally, the real-time RT-PCR assay was tested using five different RT-PCR reagent kits and was found to be robust and reliable, with no significant differences in sensitivity being found. The development of this rapid assay should aid in quarantine and post-border surveys for regulatory agencies. Copyright © 2010 Elsevier B.V. All rights reserved.

  19. Gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of Japanese encephalitis virus

    International Nuclear Information System (INIS)

    Huang, S-H; Tsai, M-H; Lin, C-W; Yang, T-C; Chuang, P-H; Tsai, I-S; Lu, H-C; Wan Lei; Lin, Y-J; Lai, C-H

    2008-01-01

    Virus isolation and antibody detection are routinely used for diagnosis of Japanese encephalitis virus (JEV) infection, but the low level of transient viremia in some JE patients makes JEV isolation from clinical and surveillance samples very difficult. We describe the use of gold nanoparticle-based RT-PCR and real-time quantitative RT-PCR assays for detection of JEV from its RNA genome. We tested the effect of gold nanoparticles on four different PCR systems, including conventional PCR, reverse-transcription PCR (RT-PCR), and SYBR green real-time PCR and RT-PCR assays for diagnosis in the acute phase of JEV infection. Gold nanoparticles increased the amplification yield of the PCR product and shortened the PCR time compared to the conventional reaction. In addition, nanogold-based real-time RT-PCR showed a linear relationship between Ct and template amount using ten-fold dilutions of JEV. The nanogold-based RT-PCR and real-time quantitative RT-PCR assays were able to detect low levels (1-10 000 copies) of the JEV RNA genomes extracted from culture medium or whole blood, providing early diagnostic tools for the detection of low-level viremia in the acute-phase infection. The assays described here were simple, sensitive, and rapid approaches for detection and quantitation of JEV in tissue cultured samples as well as clinical samples

  20. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR) for detection of avian metapneumovirus subtype A

    OpenAIRE

    Ferreira, HL; Spilki, FR; dos Santos, MMAB; de Almeida, RS; Arns, CW

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  1. Detection of ROS1 Gene Rearrangement in Lung Adenocarcinoma: Comparison of IHC, FISH and Real-Time RT-PCR

    OpenAIRE

    Shan, Ling; Lian, Fang; Guo, Lei; Qiu, Tian; Ling, Yun; Ying, Jianming; Lin, Dongmei

    2015-01-01

    Aims To compare fluorescence in situ hybridization (FISH), immunohistochemistry (IHC) and quantitative real-time reverse transcription-PCR (qRT-PCR) assays for detection of ROS1 fusion in a large number of ROS1-positive lung adenocatcinoma (ADC) patients. Methods Using IHC analysis, sixty lung ADCs including 16 cases with ROS1 protein expression and 44 cases without ROS1 expression were selected for this study. The ROS1 fusion status was examined by FISH and qRT-PCR assay. Results Among 60 ca...

  2. Selection of housekeeping genes for normalization by real-time RT-PCR: analysis of Or-MYB1 gene expression in Orobanche ramosa development.

    Science.gov (United States)

    González-Verdejo, C I; Die, J V; Nadal, S; Jiménez-Marín, A; Moreno, M T; Román, B

    2008-08-15

    Real-time PCR has become the method of choice for accurate and in-depth expression studies of candidate genes. To avoid bias, real-time PCR is referred to one or several internal control genes that should not fluctuate among treatments. A need for reference genes in the parasitic plant Orobanche ramosa has emerged, and the studies in this area have not yet been evaluated. In this study, the genes 18S rRNA, Or-act1, Or-tub1, and Or-ubq1 were compared in terms of expression stability using the BestKeeper software program. Among the four common endogenous control genes, Or-act1 and Or-ubq1 were the most stable in O. ramosa samples. In parallel, a study was carried out studying the expression of the transcription factor Or-MYB1 that seemed to be implicated during preinfection stages. The normalization strategy presented here is a prerequisite to accurate real-time PCR expression profiling that, among other things, opens up the possibility of studying messenger RNA levels of low-copy-number-like transcription factors.

  3. Real time RT-PCR assay for detection of different serotypes of FMDV in Egypt

    Directory of Open Access Journals (Sweden)

    Laila El-Shehawy

    Full Text Available Aim: The present study indicated that rRT-PCR could be provided for the detection of FMDV in infected, contact and carrier cattle and also provide a rapid sensitive tool aiming to aid in rapid disease detection and control. Foot and Mouth disease virus serotypes O and A still existing in Egypt. In January 2012, sever outbreaks struck the animal population in most Egyptian 1 governorates. The causative virus was identified as FMDV SAT2. Material and Methods: Five samples of tongue epithelium (ET and five oesophageal-pharyngeal (OP fluid samples were collected from FMD suspected cattle in infected farm at El-Fayoum and 20 OP samples from in-contact cattle at the same farm in addition to 30 OP samples from apparently healthy cattle at three different localities in El-Fayoum governorate (12 from Fayoum; 9 from Sinoras and 9 from Edsa in order to detect carrier cattle. All of these samples were collected during November and December 2011 and January 2012. Results: All the ET and OP samples were inoculated on BHK cell culture and baby mice. The obtained results were identified using complement fixation test in addition to real-time reverse transcriptase polymerase chain reaction (rRT-PCR. In the infected farm at El-Fayoum FMDV type SAT2 was detected in cattle which are considered as the first introduction of this type while FMDV type O and SAT2 were detected in the in-contact cattle in the same farm. The sensitivity of rRT-PCR was cleared in the in-contact cattle as 13 out of 20 OP samples were positive to FMDV by rRT-PCR while 11 out of 20 OP samples were positive to FMDV by CFT. The OP samples collected from apparently healthy cattle from Fayoum, Sinoras and Edsa localities in Fayoum governorate demonstrate the circulation of the FMDV type A, O and the recent SAT2 in carrier cattle which threaten cattle population in Fayoum governorate. Also the sensitivity of real time RT-PCR over the CFT in detection of FMDV carrier cattle was clearly noticed in

  4. Ring trial 2016 for Bluetongue virus detection by real-time RT-PCR in France.

    Science.gov (United States)

    Sailleau, Corinne; Viarouge, Cyril; Breard, Emmanuel; Vitour, Damien; Zientara, Stephan

    2017-05-01

    Since the unexpected emergence of BTV-8 in Northern Europe and the incursion of BTV-8 and 1 in France in 2006-2007, molecular diagnosis has considerably evolved. Several real-time RT-PCR (rtRT-PCR) methods have been developed and published, and are currently being used in many countries across Europe for BTV detection and typing. In France, the national reference laboratory (NRL) for orbiviruses develops and validates 'ready-to-use' kits with private companies for viral RNA detection. The regional laboratories network that was set up to deal with a heavy demand for analyses has used these available kits. From 2007, ring tests were organized to monitor the performance of the French laboratories. This study presents the results of 63 regional laboratories in the ring trial organized in 2016. Blood samples were sent to the laboratories. Participants were asked to use the rtRT-PCR methods in place in their laboratory, for detection of all BTV serotypes and specifically BTV-8. The French regional laboratories are able to detect and genotype BTV in affected animals. Despite the use of several methods (i.e. RNA extraction and different commercial rtRT-PCRs), the network is homogeneous. The ring trial demonstrated that the French regional veterinary laboratories have reliable and robust BTV diagnostic tools for BTV genome detection.

  5. Detection panel for identification of twelve hemorrhagic viruses using real-time RT-PCR.

    Science.gov (United States)

    Fajfr, M; Neubauerová, V; Pajer, P; Kubíčková, P; Růžek, D

    2014-09-01

    Viral hemorrhagic fevers are caused by viruses from four viral families and develop diseases with high fatality rates. However, no commercial diagnostic assay for these pathogens is available. We developed real-time RT-PCR assays for viruses Ebola, Marburg, Lassa, Guanarito, Machupo, Junin, Sabiá, Seoul, Puumala, Hantaan, Crimean-Congo hemorrhagic fever virus and Rift Valley fever virus. The assays were optimized for identical reaction conditions and can be performed using several types of real-time PCR instruments, both capillary and plate, including a portable Ruggedized Advanced Pathogen Identification Device (R.A.P.I.D.) (Idaho Technology, Inc.). In combination with primers and probes from previously published studies, we present a simple system for rapid identification of hemorrhagic filoviruses, arenaviruses and bunyaviruses with sufficient sensitivity for first contact laboratory and diagnosis under field conditions.

  6. Real-time RT-PCR analysis of mRNA decay: half-life of Beta-actin mRNA in human leukemia CCRF-CEM and Nalm-6 cell lines

    Directory of Open Access Journals (Sweden)

    Barredo Julio C

    2002-03-01

    Full Text Available Abstract Background We describe an alternative method to determine mRNA half-life (t1/2 based on the Real-Time RT-PCR procedure. This approach was evaluated by using the β-actin gene as a reference molecule for measuring of mRNA stability. Results Human leukemia Nalm-6 and CCRF-CEM cells were treated with various concentrations of Actinomycin D to block transcription and aliquots were removed periodically. Total RNA was isolated and quantified using the RiboGreen® fluorescent dye with the VersaFluor Fluorometer System. One μg of total RNA was reverse transcribed and used as template for the amplification of a region of the β-actin gene (231 bp. To generate the standard curve, serial ten-fold dilutions of the pBactin-231 vector containing the cDNA amplified fragment were employed, β-actin mRNAs were quantified by Real-Time RT-PCR using the SYBR® Green I fluorogenic dye and data analyzed using the iCycle iQ system software. Using this method, the β-actin mRNA exhibited a half-life of 6.6 h and 13.5 h in Nalm-6 and CCRF-CEM cells, respectively. The t1/2 value obtained for Nalm-6 is comparable to those estimated from Northern blot studies, using normal human leukocytes (5.5 h. Conclusions We have developed a rapid, sensitive, and reliable method based on Real-Time RT-PCR for measuring mRNA half-life. Our results confirm that β-actin mRNA half-life can be affected by the cellular growth rate.

  7. Identification of genes for normalization of real-time RT-PCR data in breast carcinomas

    DEFF Research Database (Denmark)

    Lyng, Maria B; Laenkholm, Anne-Vibeke; Pallisgaard, Niels

    2008-01-01

    BACKGROUND: Quantitative real-time RT-PCR (RT-qPCR) has become a valuable molecular technique in basic and translational biomedical research, and is emerging as an equally valuable clinical tool. Correlation of inter-sample values requires data normalization, which can be accomplished by various...... means, the most common of which is normalization to internal, stably expressed, reference genes. Recently, such traditionally utilized reference genes as GAPDH and B2M have been found to be regulated in various circumstances in different tissues, emphasizing the need to identify genes independent...... of factors influencing the tissue, and that are stably expressed within the experimental milieu. In this study, we identified genes for normalization of RT-qPCR data for invasive breast cancer (IBC), with special emphasis on estrogen receptor positive (ER+) IBC, but also examined their applicability to ER...

  8. Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

    Directory of Open Access Journals (Sweden)

    Borges-Pérez Andrés

    2008-12-01

    Full Text Available Abstract Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC, SGN-U321250 (TIP41, SGN-U346908 ("Expressed" and SGN-U316474 (SAND genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real-time

  9. Single reaction, real time RT-PCR detection of all known avian and human metapneumoviruses.

    Science.gov (United States)

    Lemaitre, E; Allée, C; Vabret, A; Eterradossi, N; Brown, P A

    2018-01-01

    Current molecular methods for the detection of avian and human metapneumovirus (AMPV, HMPV) are specifically targeted towards each virus species or individual subgroups of these. Here a broad range SYBR Green I real time RT-PCR was developed which amplified a highly conserved fragment of sequence in the N open reading frame. This method was sufficiently efficient and specific in detecting all MPVs. Its validation according to the NF U47-600 norm for the four AMPV subgroups estimated low limits of detection between 1000 and 10copies/μL, similar with detection levels described previously for real time RT-PCRs targeting specific subgroups. RNA viruses present a challenge for the design of durable molecular diagnostic test due to the rate of change in their genome sequences which can vary substantially in different areas and over time. The fact that the regions of sequence for primer hybridization in the described method have remained sufficiently conserved since the AMPV and HMPV diverged, should give the best chance of continued detection of current subgroups and of potential unknown or future emerging MPV strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    Directory of Open Access Journals (Sweden)

    Qin E-de

    2010-06-01

    Full Text Available Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009 influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same as that of each single-target RT-PCR for pandemic H1N1 and even more sensitive for H5N1 with the same primers and probes. No cross reactivity of detecting other subtype influenza viruses or respiratory tract viruses was observed. Two hundred and thirty-six clinical specimens were tested by comparing with single real-time RT-PCR and result from the duplex assay was 100% consistent with the results of single real-time RT-PCR and sequence analysis.

  11. The development and application of the two real-time RT-PCR assays to detect the pathogen of HFMD.

    Directory of Open Access Journals (Sweden)

    Aili Cui

    Full Text Available Large-scale Hand, Foot, and Mouth Disease (HFMD outbreaks have frequently occurred in China since 2008, affecting more than one million children and causing several hundred children deaths every year. The pathogens of HFMD are mainly human enteroviruses (HEVs. Among them, human enterovirus 71 (HEV71 and coxsackievirus A16 (CVA16 are the most common pathogens of HFMD. However, other HEVs could also cause HFMD. To rapidly detect HEV71 and CVA16, and ensure detection of all HEVs causing HFMD, two real-time hybridization probe-based RT-PCR assays were developed in this study. One is a multiplex real-time RT-PCR assay, which was developed to detect and differentiate HEV71 specifically from CVA16 directly from clinical specimens within 1-2 h, and the other is a broad-spectrum real-time RT-PCR assay, which targeted almost all HEVs. The experiments confirmed that the two assays have high sensitivity and specificity, and the sensitivity was up to 0.1 TCID50/ml for detection of HEVs, HEV71, and CVA16, respectively. A total of 213 clinical specimens were simultaneously detected by three kinds of assays, including the two real-time RT-PCR assays, direct conventional RT-PCR assay, and virus isolation assay on human rhabdomyosarcoma cells (RD cells. The total positive rate of both HEV71 and CVA16 was 69.48% with real-time RT-PCR assay, 47.42% with RT-PCR assay, and 34.58% with virus isolation assay. One HFMD clinical specimen was positive for HEV, but negative for HEV71 or CVA16, which was identified as Echovirus 11 (Echo11 by virus isolation, RT-PCR, and sequencing for the VP1 gene. The two real-time RT-PCR assays had been applied in 31 provincial HFMD labs to detect the pathogens of HFMD, which has contributed to the rapid identification of the pathogens in the early stages of HFMD outbreaks, and helped to clarify the etiologic agents of HFMD in China.

  12. Comparative Evaluation Of Conventional Rt-pcr And Real-time Rt-pcr (rrt-pcr) For Detection Of Avian Metapneumovirus Subtype A [comparação Entre As Técnicas De Rt-pcr Convencional E Rt-pcr Em Tempo Real Para A Detecção Do Metapneumovírus Aviários Subtipo A

    OpenAIRE

    Ferreira H.L.; Spilki F.R.; dos Santos M.M.A.B.; de Almeida R.S.; Arns C.W.

    2009-01-01

    Avian metapneumovirus (AMPV) belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A) viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F) gene and nucleocapsid (N) gene were compared with an establis...

  13. Microdroplet sandwich real-time rt-PCR for detection of pandemic and seasonal influenza subtypes.

    Directory of Open Access Journals (Sweden)

    Stephanie L Angione

    Full Text Available As demonstrated by the recent 2012/2013 flu epidemic, the continual emergence of new viral strains highlights the need for accurate medical diagnostics in multiple community settings. If rapid, robust, and sensitive diagnostics for influenza subtyping were available, it would help identify epidemics, facilitate appropriate antiviral usage, decrease inappropriate antibiotic usage, and eliminate the extra cost of unnecessary laboratory testing and treatment. Here, we describe a droplet sandwich platform that can detect influenza subtypes using real-time reverse-transcription polymerase chain reaction (rtRT-PCR. Using clinical samples collected during the 2010/11 season, we effectively differentiate between H1N1p (swine pandemic, H1N1s (seasonal, and H3N2 with an overall assay sensitivity was 96%, with 100% specificity for each subtype. Additionally, we demonstrate the ability to detect viral loads as low as 10(4 copies/mL, which is two orders of magnitude lower than viral loads in typical infected patients. This platform performs diagnostics in a miniaturized format without sacrificing any sensitivity, and can thus be easily developed into devices which are ideal for small clinics and pharmacies.

  14. Real-time RT-PCR expression analysis of chitinase and endoglucanase genes in the three-way interaction between the biocontrol strain Clonostachys rosea IK726, Botrytis cinera and strawberry

    DEFF Research Database (Denmark)

    Mamarabadi, Mojtaba; Jensen, Birgit; Jensen, Søren Dan Funck

    2008-01-01

    Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two endoglucan......Clonostachys rosea is a well-known biocontrol agent against Botrytis cinerea, the causal agent of gray mold in strawberry. The activity of cell wall-degrading enzymes might play a significant role for successful biocontrol by C. rosea. The expression pattern of four chitinases, and two...... endoglucanase genes from C. rosea strain IK726 was analyzed using real-time RT-PCR in vitro and in strawberry leaves during interaction with B. cinerea. Specific primers were designed for ß-tubulin genes from C. rosea and B. cinerea, respectively, and a gene encoding a DNA-binding protein (DBP) from strawberry......, allowing in situ activity assessment of each fungus in vitro and during their interaction on strawberry leaves. Growth of B. cinerea was inhibited in all pathogen-antagonist interactions while the activity of IK726 was slightly increased. In all in vitro interactions, four of the six genes were upregulated...

  15. Absolute estimation of initial concentrations of amplicon in a real-time RT-PCR process

    Directory of Open Access Journals (Sweden)

    Kohn Michael

    2007-10-01

    Full Text Available Abstract Background Since real time PCR was first developed, several approaches to estimating the initial quantity of template in an RT-PCR reaction have been tried. While initially only the early thermal cycles corresponding to exponential duplication were used, lately there has been an effort to use all of the cycles in a PCR. The efforts have included both fitting empirical sigmoid curves and more elaborate mechanistic models that explore the chemical reactions taking place during each cycle. The more elaborate mechanistic models require many more parameters than can be fit from a single amplification, while the empirical models provide little insight and are difficult to tailor to specific reactants. Results We directly estimate the initial amount of amplicon using a simplified mechanistic model based on chemical reactions in the annealing step of the PCR. The basic model includes the duplication of DNA with the digestion of Taqman probe and the re-annealing between previously synthesized DNA strands of opposite orientation. By modelling the amount of Taqman probe digested and matching that with the observed fluorescence, the conversion factor between the number of fluorescing dye molecules and observed fluorescent emission can be estimated, along with the absolute initial amount of amplicon and the rate parameter for re-annealing. The model is applied to several PCR reactions with known amounts of amplicon and is shown to work reasonably well. An expanded version of the model allows duplication of amplicon without release of fluorescent dye, by adding 1 more parameter to the model. The additional process is helpful in most cases where the initial primer concentration exceeds the initial probe concentration. Software for applying the algorithm to data may be downloaded at http://www.niehs.nih.gov/research/resources/software/pcranalyzer/ Conclusion We present proof of the principle that a mechanistically based model can be fit to observations

  16. A novel and highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus.

    Science.gov (United States)

    Shen, Xin-Xin; Qiu, Fang-Zhou; Zhao, Huai-Long; Yang, Meng-Jie; Hong, Liu; Xu, Song-Tao; Zhou, Shuai-Feng; Li, Gui-Xia; Feng, Zhi-Shan; Ma, Xue-Jun

    2018-03-01

    The sensitivity of qRT-PCR assay is not adequate for the detection of the samples with lower viral load, particularly in the cerebrospinal fluid (CSF) of patients. Here, we present the development of a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of human enterovirus (HEV). The clinical performance of both RTN RT-PCR and qRT-PCR was also tested and compared using 140 CSF and fecal specimens. The sensitivities of RTN RT-PCR assay for EV71, Coxsackievirus A (CVA)16, CVA6 and CVA10 achieved 10 -8 dilution with a corresponding Ct value of 38.20, 36.45, 36.75, and 36.45, respectively, which is equal to traditional two-step nested RT-PCR assay and approximately 2-10-fold lower than that of qRT-PCR assay. The specificity of RTN RT-PCR assay was extensively analyzed insilico and subsequently verified using the reference isolates and clinical samples. Sixteen qRT-PCR-negative samples were detected by RTN RT-PCR and a variety of enterovirus serotypes was identified by sequencing of inner PCR products. We conclude RTN RT-PCR is more sensitive than qRT-PCR for the detection of HEV in clinical samples. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Development and implementation of the quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network in mainland China

    Directory of Open Access Journals (Sweden)

    Wang Wei

    2011-03-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR and real time RT-PCR (rRT-PCR have been indispensable methods for influenza surveillance, especially for determination of avian influenza. The movement of testing beyond reference lab introduced the need of quality control, including the implementation of an evaluation system for validating personal training and sample proficiency testing. Methods We developed a panel with lysates of seasonal influenza virus (H1N1, H3N2 and B, serials of diluted H5N1 virus lysates, and in-vitro transcribed H5 hemaglutinin (HA and an artificial gene RNAs for RT-PCR and rRT-PCR quality control assessment. The validations of stability and reproducibility were performed on the panel. Additionally, the panel was implemented to assess the detection capability of Chinese human avian influenza networks. Results The panel has relatively high stability and good reproducibility demonstrated by kappa's tests. In the implementation of panel on Chinese human avian influenza networks, the results suggested that there were a relatively low number of discrepancies for both concise and reproducibility in Chinese avian influenza virus net works. Conclusions A quality control panel of RT-PCR and real-time RT-PCR for avian influenza A (H5N1 surveillance network was developed. An availably statistical data, which are used to assess the detection capability of networks on avian influenza virus (H5N1, can be obtained relatively easily through implementation of the panel on networks.

  18. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil.

    Science.gov (United States)

    Fischer, Carlo; Torres, Maria C; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A; Charrel, Rémi N; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C; Rodrigues, Cintia D S; Kümmerer, Beate M; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-11-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  19. Lineage-Specific Real-Time RT-PCR for Yellow Fever Virus Outbreak Surveillance, Brazil

    OpenAIRE

    Fischer, Carlo; Torres, Maria C.; Patel, Pranav; Moreira-Soto, Andres; Gould, Ernest A.; Charrel, Rémi N.; de Lamballerie, Xavier; Nogueira, Rita Maria Ribeiro; Sequeira, Patricia C.; Rodrigues, Cintia D.S.; Kümmerer, Beate M.; Drosten, Christian; Landt, Olfert; Bispo de Filippis, Ana Maria; Drexler, Jan Felix

    2017-01-01

    The current yellow fever outbreak in Brazil prompted widespread yellow fever virus (YFV) vaccination campaigns, imposing a responsibility to distinguish between vaccine- and wild-type YFV-associated disease. We developed novel multiplex real-time reverse transcription PCRs that differentiate between vaccine and American wild-type YFV. We validated these highly specific and sensitive assays in an outbreak setting.

  20. Development of a duplex real-time RT-PCR for the simultaneous detection and differentiation of Theiler's murine encephalomyelitis virus and rat theilovirus.

    Science.gov (United States)

    Yuan, Wen; Wang, Jing; Xu, Fengjiao; Huang, Bihong; Lian, Yuexiao; Rao, Dan; Yin, Xueqin; Wu, Miaoli; Zhu, Yujun; Zhang, Yu; Huang, Ren; Guo, Pengju

    2016-10-01

    Theiler's murine encephalomyelitis virus (TMEV) and rat theilovirus (RTV), the member of the genus Cardiovirus, are widespread in laboratory mice and rats, and are potential contaminants of biological materials. Cardioviruses infection may cause serious complications in biomedical research. To improve the efficiency of routine screening for Cardioviruses infection, a duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was developed for simultaneous detection and differentiation of TMEV and RTV. The duplex assay was specific for reference strains of TMEV and RTV, and no cross-reaction was found with seven other rodent viruses. The limits of detection of both TMEV and RTV were 4×10(1) copies RNA/reaction. Reproducibility was estimated using standard dilutions, with coefficients of variation duplex real-time RT-PCR and conventional RT-PCR. For 439 clinical samples,95 samples were positive for TMEV and 72 samples were positive for RTV using duplex real-time RT-PCR approach, whereas only 77 samples were positive for TMEV and 66 samples were positive for RTV when conventional RT-PCR was applied. Mixed infections were found in 20 samples when analyzed by conventional RT-PCR whereas 30 samples were found to be mixed infection when duplex real-time RT-PCR was applied. This duplex assay provides a useful tool for routine health monitoring and screening of contaminated biological materials of these two viruses. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Development and validation of sensitive real-time RT-PCR assay for broad detection of rabies virus.

    Science.gov (United States)

    Faye, Martin; Dacheux, Laurent; Weidmann, Manfred; Diop, Sylvie Audrey; Loucoubar, Cheikh; Bourhy, Hervé; Sall, Amadou Alpha; Faye, Ousmane

    2017-05-01

    Rabies virus (RABV) remains one of the most important global zoonotic pathogens. RABV causes rabies, an acute encephalomyelitis associated with a high rate of mortality in humans and animals and affecting different parts of the world, particularly in Asia and Africa. Confirmation of rabies diagnosis relies on laboratory diagnosis, in which molecular techniques such as detection of viral RNA by reverse transcription polymerase chain reaction (RT-PCR) are increasingly being used. In this study, two real-time quantitative RT-PCR assays were developed for large-spectrum detection of RABV, with a focus on African isolates. The primer and probe sets were targeted highly conserved regions of the nucleoprotein (N) and polymerase (L) genes. The results indicated the absence of non-specific amplification and cross-reaction with a range of other viruses belonging to the same taxonomic family, i.e. Rhabdoviridae, as well as negative brain tissues from various host species. Analytical sensitivity ranged between 100 to 10 standard RNA copies detected per reaction for N-gene and L-gene assays, respectively. Effective detection and high sensitivity of these assays on African isolates showed that they can be successfully applied in general research and used in diagnostic process and epizootic surveillance in Africa using a double-check strategy. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Development of duplex real-time RT-PCR based on Taqman technology for detecting simultaneously the genome of pan-enterovirus and enterovirus 71.

    Science.gov (United States)

    Hwang, Seoyeon; Kang, Byunghak; Hong, Jiyoung; Kim, Ahyoun; Kim, Hyejin; Kim, Kisang; Cheon, Doo-Sung

    2013-07-01

    Human enterovirus (EV) 71 is the main etiological agent of hand, foot, and mouth disease (HFMD). It is associated with neurological complications, and caused fatalities during recent outbreaks in the Asia-Pacific region. Infections caused by EV71 could lead to many complications, ranging from brainstem encephalitis to pulmonary oedema, resulting in high mortality. In this study, a duplex real-time RT-PCR assay was developed in order to simultaneously detect pan-EV and EV71. EV71-specific primers and probes were designed based on the highly conserved VP1 region of EV71. Five EV71 strains were detected as positive, and no positive fluorescence signal was observed in the duplex real-time RT-PCR for other viral RNA, which showed 100% specificity for the selected panel, and no cross-reactions were observed in this duplex real-time RT-PCR. The EV71-specific duplex real-time RT-PCR was more sensitive than conventional RT-PCR, and detected viral titers that were 10-fold lower than those measured by the latter. Of the 381 HFMD clinical specimens, 196 (51.4%) cases were pan-EV-positive, of which 170 (86.7%) were EV71-positive when tested by pan-EV and EV71-specific duplex real-time RT-PCR. EV71-specific duplex real-time RT-PCR offers a rapid and sensitive method to detect EV71 from clinical specimens, and will allow quarantine measures to be taken more effectively during outbreaks. Copyright © 2013 Wiley Periodicals, Inc.

  3. Evaluation of candidate reference genes for gene expression normalization in Brassica juncea using real time quantitative RT-PCR.

    Directory of Open Access Journals (Sweden)

    Ruby Chandna

    Full Text Available The real time quantitative reverse transcription PCR (qRT-PCR is becoming increasingly important to gain insight into function of genes. Given the increased sensitivity, ease and reproducibility of qRT-PCR, the requirement of suitable reference genes for normalization has become important and stringent. It is now known that the expression of internal control genes in living organism vary considerably during developmental stages and under different experimental conditions. For economically important Brassica crops, only a couple of reference genes are reported till date. In this study, expression stability of 12 candidate reference genes including ACT2, ELFA, GAPDH, TUA, UBQ9 (traditional housekeeping genes, ACP, CAC, SNF, TIPS-41, TMD, TSB and ZNF (new candidate reference genes, in a diverse set of 49 tissue samples representing different developmental stages, stress and hormone treated conditions and cultivars of Brassica juncea has been validated. For the normalization of vegetative stages the ELFA, ACT2, CAC and TIPS-41 combination would be appropriate whereas TIPS-41 along with CAC would be suitable for normalization of reproductive stages. A combination of GAPDH, TUA, TIPS-41 and CAC were identified as the most suitable reference genes for total developmental stages. In various stress and hormone treated samples, UBQ9 and TIPS-41 had the most stable expression. Across five cultivars of B. juncea, the expression of CAC and TIPS-41 did not vary significantly and were identified as the most stably expressed reference genes. This study provides comprehensive information that the new reference genes selected herein performed better than the traditional housekeeping genes. The selection of most suitable reference genes depends on the experimental conditions, and is tissue and cultivar-specific. Further, to attain accuracy in the results more than one reference genes are necessary for normalization.

  4. Multiplex real-time RT-PCR assay for bovine viral diarrhea virus type 1, type 2 and HoBi-like pestivirus.

    Science.gov (United States)

    Mari, Viviana; Losurdo, Michele; Lucente, Maria Stella; Lorusso, Eleonora; Elia, Gabriella; Martella, Vito; Patruno, Giovanni; Buonavoglia, Domenico; Decaro, Nicola

    2016-03-01

    HoBi-like pestiviruses are emerging pestiviruses that infect cattle causing clinical forms overlapping to those induced by bovine viral diarrhea virus (BVDV) 1 and 2. As a consequence of their widespread distribution reported in recent years, molecular tools for rapid discrimination among pestiviruses infecting cattle are needed. The aim of the present study was to develop a multiplex real-time RT-PCR assay, based on the TaqMan technology, for the rapid and unambiguous characterisation of all bovine pestiviruses, including the emerging HoBi-like strains. The assay was found to be sensitive, specific and repeatable, ensuring detection of as few as 10(0)-10(1) viral RNA copies. No cross-reactions between different pestiviral species were observed even in samples artificially contaminated with more than one pestivirus. Analysis of field samples tested positive for BVDV-1, BVDV-2 or HoBi-like virus by a nested PCR protocol revealed that the developed TaqMan assay had equal or higher sensitivity and was able to discriminate correctly the viral species in all tested samples, whereas a real-time RT-PCR assay previously developed for HoBi-like pestivirus detection showed cross-reactivity with few high-titre BVDV-2 samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. A duplex real-time RT-PCR assay for detecting H5N1 avian influenza virus and pandemic H1N1 influenza virus

    OpenAIRE

    Kang, Xiao-ping; Jiang, Tao; Li, Yong-qiang; Lin, Fang; Liu, Hong; Chang, Guo-hui; Zhu, Qing-yu; Qin, E-de; Qin, Cheng-feng; Yang, Yin-hui

    2010-01-01

    Abstract A duplex real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay was improved for simultaneous detection of highly pathogenic H5N1 avian influenza virus and pandemic H1N1 (2009) influenza virus, which is suitable for early diagnosis of influenza-like patients and for epidemiological surveillance. The sensitivity of this duplex real-time RT-PCR assay was 0.02 TCID50 (50% tissue culture infective dose) for H5N1 and 0.2 TCID50 for the pandemic H1N1, which was the same a...

  6. A real time Taqman RT-PCR for the detection of rabbit hemorrhagic disease virus 2 (RHDV2).

    Science.gov (United States)

    Duarte, Margarida Dias; Carvalho, Carina L; Barros, Silvia C; Henriques, Ana M; Ramos, Fernanda; Fagulha, Teresa; Luís, Tiago; Duarte, Elsa L; Fevereiro, Miguel

    2015-07-01

    A specific real time RT-PCR for the detection of RHDV2 was developed and validated using RHDV and RHDV2 RNA preparations from positive field samples. The system was designed to amplify a 127 nucleotide-long RNA region located within the vp60 gene, based on the alignment of six sequences originated in Portugal, obtained in our laboratory, and 11 sequences from France and Italy. The primers and probe target sequences are highly conserved in the vast majority of the RHDV2 sequences presently known. In the sequences showing variability, only one mismatch is found per strain, usually outlying the 3' end of the primer or probe hybridization sequences. The specificity of the method was demonstrated in vitro with a panel of common rabbit pathogens. Standardization was performed with RNA transcripts obtained from a recombinant plasmid harboring the target sequence. The method was able to detected nine RNA molecules with an efficiency of 99.4% and a R(2) value of 1. Repeatability and reproducibility of the method were very high, with coefficients of variation lower than 2.40%. The assay was proven a valuable tool to diagnose most of RDVH2 circulating strains, and may be also useful to monitor viral loads, and consequently, disease progression and vaccination efficacy. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Identification of Dobrava, Hantaan, Seoul, and Puumala viruses by one-step real-time RT-PCR.

    Science.gov (United States)

    Aitichou, Mohamed; Saleh, Sharron S; McElroy, Anita K; Schmaljohn, C; Ibrahim, M Sofi

    2005-03-01

    We developed four assays for specifically identifying Dobrava (DOB), Hantaan (HTN), Puumala (PUU), and Seoul (SEO) viruses. The assays are based on the real-time one-step reverse transcriptase polymerase chain reaction (RT-PCR) with the small segment used as the target sequence. The detection limits of DOB, HTN, PUU, and SEO assays were 25, 25, 25, and 12.5 plaque-forming units, respectively. The assays were evaluated in blinded experiments, each with 100 samples that contained Andes, Black Creek Canal, Crimean-Congo hemorrhagic fever, Rift Valley fever and Sin Nombre viruses in addition to DOB, HTN, PUU and SEO viruses. The sensitivity levels of the DOB, HTN, PUU, and SEO assays were 98%, 96%, 92% and 94%, respectively. The specificity of DOB, HTN and SEO assays was 100% and the specificity of the PUU assay was 98%. Because of the high levels of sensitivity, specificity, and reproducibility, we believe that these assays can be useful for diagnosing and differentiating these four Old-World hantaviruses.

  8. Comparison of ELISA and dual stage real time RT-PCR to differentiate Sabin like and non-Sabin like poliovirus isolates.

    Science.gov (United States)

    Kaundal, Nirmal; Sarkate, Purva; Prakash, Charu; Rishi, Narayan

    2017-06-01

    Environmental surveillance of polioviruses has been used as an important tool in monitoring circulation of wild polioviruses and/or Vaccine derived polioviruses in sewage samples. It is important to distinguish Sabin like isolates from non-Sabin like; ELISA & dual stage real time RT-PCR have been used for the same. Current study was carried out on sewage isolates to compare ELISA & RT-PCR with sequencing to distinguish Sabin like from non-Sabin like. Out of 468 sewage specimens, 91 (19.44%) were non-polio enteroviruses positive and 377 (80.56%) were polio positive by virus isolation method. A total of 488 polio virus isolates were detected by L20B and RD route which were further subjected to ELISA and RT-PCR. The results were compared with sequencing. On comparison, the specificity of ELISA was only 66.67% in spite of very low sensitivity (3.43%). The sensitivity of RT-PCR was 97.71% which makes it a good primary screening test for detection of non-Sabin like viruses. However, the specificity was only 33.33%. RT-PCR appears to be a sensitive tool for detecting non-Sabin like viruses however; the isolates which are non-Sabin like by RT-PCR may not necessarily be mutated viruses. ELISA cannot be used for differentiation of Sabin likes from non-Sabin likes due to low sensitivity.

  9. Pandemic preparedness in Hawaii: a multicenter verification of real-time RT-PCR for the direct detection of influenza virus types A and B.

    Science.gov (United States)

    Whelen, A Christian; Bankowski, Matthew J; Furuya, Glenn; Honda, Stacey; Ueki, Robert; Chan, Amelia; Higa, Karen; Kumashiro, Diane; Moore, Nathaniel; Lee, Roland; Koyamatsu, Terrie; Effler, Paul V

    2010-01-01

    We integrated multicenter, real-time (RTi) reverse transcription polymerase chain reaction (RT-PCR) screening into a statewide laboratory algorithm for influenza surveillance and response. Each of three sites developed its own testing strategy and was challenged with one randomized and blinded panel of 50 specimens previously tested for respiratory viruses. Following testing, each participating laboratory reported its results to the Hawaii State Department of Health, State Laboratories Division for evaluation and possible discrepant analysis. Two of three laboratories reported a 100% sensitivity and specificity, resulting in a 100% positive predictive value and a 100% negative predictive value (NPV) for influenza type A. The third laboratory showed a 71% sensitivity for influenza type A (83% NPV) with 100% specificity. All three laboratories were 100% sensitive and specific for the detection of influenza type B. Discrepant analysis indicated that the lack of sensitivity experienced by the third laboratory may have been due to the analyte-specific reagent probe used by that laboratory. Use of a newer version of the product with a secondary panel of 20 specimens resulted in a sensitivity and specificity of 100%. All three laboratories successfully verified their ability to conduct clinical testing for influenza using diverse nucleic acid extraction and RTi RT-PCR platforms. Successful completion of the verification by all collaborating laboratories paved the way for the integration of those facilities into a statewide laboratory algorithm for influenza surveillance and response.

  10. Evaluation of RIDA®GENE norovirus GI/GII real time RT-PCR using stool specimens collected from children and adults with acute gastroenteritis.

    Science.gov (United States)

    Kanwar, N; Hassan, F; Barclay, L; Langley, C; Vinjé, J; Bryant, P W; George, K St; Mosher, L; Matthews-Greer, J M; Rocha, M A; Beenhouwer, D O; Harrison, C J; Moffatt, M; Shastri, N; Selvarangan, R

    2018-04-10

    Norovirus is the leading cause of epidemic and sporadic acute gastroenteritis (AGE) in the United States. Widespread prevalence necessitates implementation of accurate norovirus detection assays in clinical diagnostic laboratories. To evaluate RIDA ® GENE norovirus GI/GII real-time RT-PCR assay (RGN RT-PCR) using stool samples from patients with sporadic AGE. Patients between 14 days to 101 years of age with symptoms of AGE were enrolled prospectively at four sites across the United States during 2014-2015. Stool specimens were screened for the presence of norovirus RNA by the RGN RT-PCR assay. Results were compared with a reference method that included conventional RT-PCR and sequencing of a partial region of the 5'end of the norovirus ORF2 gene. A total of 259 (36.0%) of 719 specimens tested positive for norovirus by the reference method. The RGN RT-PCR assay detected norovirus in 244 (94%) of these 259 norovirus positive specimens. The sensitivity and specificity (95% confidence interval) of the RGN RT-PCR assay for detecting norovirus genogroup (G) I was 82.8% (63.5-93.5) and 99.1% (98.0-99.6) and for GII was 94.8% (90.8-97.2) and 98.6% (96.9-99.4), respectively. Seven specimens tested positive by the RGN-RT PCR that were negative by the reference method. The fifteen false negative samples were typed as GII.4 Sydney, GII.13, GI.3, GI.5, GI.2, GII.1, and GII.3 in the reference method. The RGN RT-PCR assay had a high sensitivity and specificity for the detection of norovirus in stool specimens from patients with sporadic AGE. Copyright © 2018. Published by Elsevier B.V.

  11. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    Directory of Open Access Journals (Sweden)

    Soares Fernando A

    2009-03-01

    Full Text Available Abstract Background HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC and fluorescence in situ hybridization (FISH. These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. Methods To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. Results The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4% and HER-2 transcript overexpression (20%. Moreover, 2+ immunostaining cases presented nonamplified status (50% by CISH and HER-2 downexpression (38.5% by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350. Conclusion Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene.

  12. Quantitative real-time RT-PCR and chromogenic in situ hybridization: precise methods to detect HER-2 status in breast carcinoma

    International Nuclear Information System (INIS)

    Rosa, Fabíola E; Silveira, Sara M; Silveira, Cássia GT; Bérgamo, Nádia A; Neto, Francisco A Moraes; Domingues, Maria AC; Soares, Fernando A; Caldeira, José RF; Rogatto, Silvia R

    2009-01-01

    HER-2 gene testing has become an integral part of breast cancer patient diagnosis. The most commonly used assay in the clinical setting for evaluating HER-2 status is immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH). These procedures permit correlation between HER-2 expression and morphological features. However, FISH signals are labile and fade over time, making post-revision of the tumor difficult. CISH (chromogenic in situ hybridization) is an alternative procedure, with certain advantages, although still limited as a diagnostic tool in breast carcinomas. To elucidate the molecular profile of HER-2 status, mRNA and protein expression in 75 invasive breast carcinomas were analyzed by real time quantitative RT-PCR (qRT-PCR) and IHC, respectively. Amplifications were evaluated in 43 of these cases by CISH and in 11 by FISH. The concordance rate between IHC and qRT-PCR results was 78.9%, and 94.6% for qRT-PCR and CISH. Intratumoral heterogeneity of HER-2 status was identified in three cases by CISH. The results of the three procedures were compared and showed a concordance rate of 83.8%; higher discordances were observed in 0 or 1+ immunostaining cases, which showed high-level amplification (15.4%) and HER-2 transcript overexpression (20%). Moreover, 2+ immunostaining cases presented nonamplified status (50%) by CISH and HER-2 downexpression (38.5%) by qRT-PCR. In general, concordance occurred between qRT-PCR and CISH results. A high concordance was observed between CISH/qRT-PCR and FISH. Comparisons with clinicopathological data revealed a significant association between HER-2 downexpression and the involvement of less than four lymph nodes (P = 0.0350). Based on these findings, qRT-PCR was more precise and reproducible than IHC. Furthermore, CISH was revealed as an alternative and useful procedure for investigating amplifications involving the HER-2 gene

  13. Real-time onestep RT-PCR for the detection and differentiation of European and North American types of PRRSV in boar semen

    DEFF Research Database (Denmark)

    Hjulsager, Charlotte Kristiane; Larsen, Lars Erik

    and safe diagnostic procedure, since cDNA synthesis and PCR is performed sequentially without inbetween opening of the PCR-tubes, thus eliminating a substantial contamination risk. The aim of the present study was to validate a real-time OneStep RT-PCR assay for the simultaneous detection...

  14. Development of a real-time RT-PCR assay based on primer-probe energy transfer for the detection of all serotypes of bluetongue virus

    DEFF Research Database (Denmark)

    Leblanc, N; Rasmussen, Thomas Bruun; Fernandez, J

    2010-01-01

    A real-time RT-PCR assay based on the primer–probe energy transfer (PriProET) was developed to detect all 24 serotypes of bluetongue virus (BTV). BTV causes serious disease, primarily in sheep, but in other ruminants as well. A distinguishing characteristic of the assay is its tolerance toward...

  15. Development of a novel quantitative real-time RT-PCR assay for the simultaneous detection of all serotypes of Foot-and-mouth disease virus

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Uttenthal, Åse; de Stricker, K.

    2003-01-01

    Foot-and-mouth disease virus (FMDV) spreads extremely fast and the need for rapid and robust diagnostic virus detection systems was obvious during the recent European epidemic. Using a novel real-time RT-PCR system based on primer-probe energy transfer (PriProET) we present here an assay targeting...

  16. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR

    Directory of Open Access Journals (Sweden)

    Nagorsen Dirk

    2003-12-01

    Full Text Available Abstract The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV and Influenza (Flu, were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ, Interleukin-2 (IL-2, Interleukin-4 (IL-4, and Interleukin-10 (IL-10. We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization.

  17. Ex vivo screening for immunodominant viral epitopes by quantitative real time polymerase chain reaction (qRT-PCR)

    Science.gov (United States)

    Provenzano, Maurizio; Mocellin, Simone; Bonginelli, Paola; Nagorsen, Dirk; Kwon, Seog-Woon; Stroncek, David

    2003-01-01

    The identification and characterization of viral epitopes across the Human Leukocyte Antigen (HLA) polymorphism is critical for the development of actives-specific or adoptive immunotherapy of virally-mediated diseases. This work investigates whether cytokine mRNA transcripts could be used to identify epitope-specific HLA-restricted memory T lymphocytes reactivity directly in fresh peripheral blood mononuclear cells (PBMCs) from viral-seropositive individuals in response to ex vivo antigen recall. PBMCs from HLA-A*0201 healthy donors, seropositive for Cytomegalovirus (CMV) and Influenza (Flu), were exposed for different periods and at different cell concentrations to the HLA-A*0201-restricted viral FluM158–66 and CMVpp65495–503 peptides. Quantitative real time PCR (qRT-PCR) was employed to evaluate memory T lymphocyte immune reactivation by measuring the production of mRNA encoding four cytokines: Interferon-γ (IFN-γ), Interleukin-2 (IL-2), Interleukin-4 (IL-4), and Interleukin-10 (IL-10). We could characterize cytokine expression kinetics that illustrated how cytokine mRNA levels could be used as ex vivo indicators of T cell reactivity. Particularly, IFN-γ mRNA transcripts could be consistently detected within 3 to 12 hours of short-term stimulation in levels sufficient to screen for HLA-restricted viral immune responses in seropositive subjects. This strategy will enhance the efficiency of the identification of viral epitopes independently of the individual HLA phenotype and could be used to follow the intensity of immune responses during disease progression or in response to in vivo antigen-specific immunization. PMID:14675481

  18. Detection and Analysis of Circular RNAs by RT-PCR.

    Science.gov (United States)

    Panda, Amaresh C; Gorospe, Myriam

    2018-03-20

    Gene expression in eukaryotic cells is tightly regulated at the transcriptional and posttranscriptional levels. Posttranscriptional processes, including pre-mRNA splicing, mRNA export, mRNA turnover, and mRNA translation, are controlled by RNA-binding proteins (RBPs) and noncoding (nc)RNAs. The vast family of ncRNAs comprises diverse regulatory RNAs, such as microRNAs and long noncoding (lnc)RNAs, but also the poorly explored class of circular (circ)RNAs. Although first discovered more than three decades ago by electron microscopy, only the advent of high-throughput RNA-sequencing (RNA-seq) and the development of innovative bioinformatic pipelines have begun to allow the systematic identification of circRNAs (Szabo and Salzman, 2016; Panda et al ., 2017b; Panda et al ., 2017c). However, the validation of true circRNAs identified by RNA sequencing requires other molecular biology techniques including reverse transcription (RT) followed by conventional or quantitative (q) polymerase chain reaction (PCR), and Northern blot analysis (Jeck and Sharpless, 2014). RT-qPCR analysis of circular RNAs using divergent primers has been widely used for the detection, validation, and sometimes quantification of circRNAs (Abdelmohsen et al ., 2015 and 2017; Panda et al ., 2017b). As detailed here, divergent primers designed to span the circRNA backsplice junction sequence can specifically amplify the circRNAs and not the counterpart linear RNA. In sum, RT-PCR analysis using divergent primers allows direct detection and quantification of circRNAs.

  19. Rapid detection of Enterovirus and Coxsackievirus A10 by a TaqMan based duplex one-step real time RT-PCR assay.

    Science.gov (United States)

    Chen, Jingfang; Zhang, Rusheng; Ou, Xinhua; Yao, Dong; Huang, Zheng; Li, Linzhi; Sun, Biancheng

    2017-06-01

    A TaqMan based duplex one-step real time RT-PCR (rRT-PCR) assay was developed for the rapid detection of Coxsackievirus A10 (CV-A10) and other enterovirus (EVs) in clinical samples. The assay was fully evaluated and found to be specific and sensitive. When applied in 115 clinical samples, a 100% diagnostic sensitivity in CV-A10 detection and 97.4% diagnostic sensitivity in other EVs were found. Copyright © 2017 Elsevier Ltd. All rights reserved.

  20. Selection of reference genes for quantitative real time RT-PCR during dimorphism in the zygomycete Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco I; Jácome-Galarza, Irvin E; Gutiérrez-Corona, Félix; Ramírez-Díaz, Martha I; Campos-García, Jesús; Meza-Carmen, Víctor

    2015-03-01

    Mucor circinelloides is a dimorphic fungal model for studying several biological processes including cell differentiation (yeast-mold transitions) as well as biodiesel and carotene production. The recent release of the first draft sequence of the M. circinelloides genome, combined with the availability of analytical methods to determine patterns of gene expression, such as quantitative Reverse transcription-Polymerase chain reaction (qRT-PCR), and the development of molecular genetic tools for the manipulation of the fungus, may help identify M. circinelloides gene products and analyze their relevance in different biological processes. However, no information is available on M. circinelloides genes of stable expression that could serve as internal references in qRT-PCR analyses. One approach to solve this problem consists in the use of housekeeping genes as internal references. However, validation of the usability of these reference genes is a fundamental step prior to initiating qRT-PCR assays. This work evaluates expression of several constitutive genes by qRT-PCR throughout the morphological differentiation stages of M. circinelloides; our results indicate that tfc-1 and ef-1 are the most stable genes for qRT-PCR assays during differentiation studies and they are proposed as reference genes to carry out gene expression studies in this fungus.

  1. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa

    DEFF Research Database (Denmark)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R.; Wadsworth, Jemma

    2016-01-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping...... methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within...... sequencing. Samples (n = 71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious...

  2. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Directory of Open Access Journals (Sweden)

    Gilberto A Santiago

    Full Text Available Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV. There are four genetically distinct DENVs (DENV-1-4 that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  3. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus.

    Science.gov (United States)

    Santiago, Gilberto A; Vergne, Edgardo; Quiles, Yashira; Cosme, Joan; Vazquez, Jesus; Medina, Juan F; Medina, Freddy; Colón, Candimar; Margolis, Harold; Muñoz-Jordán, Jorge L

    2013-01-01

    Dengue is an acute illness caused by the positive-strand RNA dengue virus (DENV). There are four genetically distinct DENVs (DENV-1-4) that cause disease in tropical and subtropical countries. Most patients are viremic when they present with symptoms; therefore, RT-PCR has been increasingly used in dengue diagnosis. The CDC DENV-1-4 RT-PCR Assay has been developed as an in-vitro diagnostic platform and was recently approved by the US Food and Drug Administration (FDA) for detection of dengue in patients with signs or symptoms of mild or severe dengue. The primers and probes of this test have been designed to detect currently circulating strains of DENV-1-4 from around the world at comparable sensitivity. In a retrospective study with 102 dengue cases confirmed by IgM anti-DENV seroconversion in the convalescent sample, the RT-PCR Assay detected DENV RNA in 98.04% of the paired acute samples. Using sequencing as a positive indicator, the RT-PCR Assay had a 97.92% positive agreement in 86 suspected dengue patients with a single acute serum sample. After extensive validations, the RT-PCR Assay performance was highly reproducible when evaluated across three independent testing sites, did not produce false positive results for etiologic agents of other febrile illnesses, and was not affected by pathological levels of potentially interfering biomolecules. These results indicate that the CDC DENV-1-4 RT-PCR Assay provides a reliable diagnostic platform capable for confirming dengue in suspected cases.

  4. A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

    Science.gov (United States)

    Wadhwa, Ashutosh; Wilkins, Kimberly; Gao, Jinxin; Condori Condori, Rene Edgar; Gigante, Crystal M; Zhao, Hui; Ma, Xiaoyue; Ellison, James A; Greenberg, Lauren; Velasco-Villa, Andres; Orciari, Lillian; Li, Yu

    2017-01-01

    Rabies, resulting from infection by Rabies virus (RABV) and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA) test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR) based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N) coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses, its high

  5. A Pan-Lyssavirus Taqman Real-Time RT-PCR Assay for the Detection of Highly Variable Rabies virus and Other Lyssaviruses.

    Directory of Open Access Journals (Sweden)

    Ashutosh Wadhwa

    2017-01-01

    Full Text Available Rabies, resulting from infection by Rabies virus (RABV and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses

  6. Intra-laboratory validation of chronic bee paralysis virus quantitation using an accredited standardised real-time quantitative RT-PCR method.

    Science.gov (United States)

    Blanchard, Philippe; Regnault, Julie; Schurr, Frank; Dubois, Eric; Ribière, Magali

    2012-03-01

    Chronic bee paralysis virus (CBPV) is responsible for chronic bee paralysis, an infectious and contagious disease in adult honey bees (Apis mellifera L.). A real-time RT-PCR assay to quantitate the CBPV load is now available. To propose this assay as a reference method, it was characterised further in an intra-laboratory study during which the reliability and the repeatability of results and the performance of the assay were confirmed. The qPCR assay alone and the whole quantitation method (from sample RNA extraction to analysis) were both assessed following the ISO/IEC 17025 standard and the recent XP U47-600 standard issued by the French Standards Institute. The performance of the qPCR assay and of the overall CBPV quantitation method were validated over a 6 log range from 10(2) to 10(8) with a detection limit of 50 and 100 CBPV RNA copies, respectively, and the protocol of the real-time RT-qPCR assay for CBPV quantitation was approved by the French Accreditation Committee. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Evaluation of FTA cards as a laboratory and field sampling device for the detection of foot-and-mouth disease virus and serotyping by RT-PCR and real-time RT-PCR.

    Science.gov (United States)

    Muthukrishnan, Madhanmohan; Singanallur, Nagendrakumar B; Ralla, Kumar; Villuppanoor, Srinivasan A

    2008-08-01

    Foot-and-mouth disease virus (FMDV) samples transported to the laboratory from far and inaccessible areas for serodiagnosis pose a major problem in a tropical country like India, where there is maximum temperature fluctuation. Inadequate storage methods lead to spoilage of FMDV samples collected from clinically positive animals in the field. Such samples are declared as non-typeable by the typing laboratories with the consequent loss of valuable epidemiological data. The present study evaluated the usefulness of FTA Classic Cards for the collection, shipment, storage and identification of the FMDV genome by RT-PCR and real-time RT-PCR. The stability of the viral RNA, the absence of infectivity and ease of processing the sample for molecular methods make the FTA cards a useful option for transport of FMDV genome for identification and serotyping. The method can be used routinely for FMDV research as it is economical and the cards can be transported easily in envelopes by regular document transport methods. Live virus cannot be isolated from samples collected in FTA cards, which is a limitation. This property can be viewed as an advantage as it limits the risk of transmission of live virus.

  8. Development of a novel real-time RT-PCR assay to detect Seneca Valley virus-1 associated with emerging cases of vesicular disease in pigs.

    Science.gov (United States)

    Fowler, Veronica L; Ransburgh, Russell H; Poulsen, Elizabeth G; Wadsworth, Jemma; King, Donald P; Mioulet, Valerie; Knowles, Nick J; Williamson, Susanna; Liu, Xuming; Anderson, Gary A; Fang, Ying; Bai, Jianfa

    2017-01-01

    Seneca Valley virus 1 (SVV-1) can cause vesicular disease that is clinically indistinguishable from foot-and-mouth disease, vesicular stomatitis and swine vesicular disease. SVV-1-associated disease has been identified in pigs in several countries, namely USA, Canada, Brazil and China. Diagnostic tests are required to reliably detect this emerging virus, and this report describes the development and evaluation of a novel real-time (r) reverse-transcription (RT) PCR assay (rRT-PCR), targeting the viral polymerase gene (3D) of SVV-1. This new assay detected all historical and contemporary SVV-1 isolates examined (n=8), while no cross-reactivity was observed with nucleic acid templates prepared from other vesicular disease viruses or common swine pathogens. The analytical sensitivity of the rRT-PCR was 0.79 TCID 50 /ml and the limit of detection was equivalent using two different rRT-PCR master-mixes. The performance of the test was further evaluated using pig nasal (n=25) and rectal swab samples (n=25), where concordant results compared to virus sequencing were generated for 43/50 samples. The availability of this assay, will enable laboratories to rapidly detect SVV-1 in cases of vesicular disease in pigs, negated for notifiable diseases, and could enable existing knowledge gaps to be investigated surrounding the natural epidemiology of SVV-1. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Selection of reference genes for quantitative real-time RT-PCR studies in tomato fruit of the genotype MT-Rg1

    Directory of Open Access Journals (Sweden)

    Karla L. González-Aguilera

    2016-09-01

    Full Text Available Quantitative real-time RT-PCR (qRT-PCR has become one of the most widely used methods for accurate quantification of gene expression. Since there are no universal reference genes for normalization, the optimal strategy to normalize raw qRT-PCR data is to perform an initial comparison of a set of independent reference genes to assess the most stable ones in each biological model. Normalization of a qRT-PCR experiment helps to ensure that the results are both statistically significant and biologically meaningful. Tomato is the model of choice to study fleshy fruit development. The miniature tomato (Solanum lycopersicum L. cultivar Micro-Tom (MT is considered a model system for tomato genetics and functional genomics. A new genotype, containing the Rg1 allele, improves tomato in vitro regeneration. In this work, we evaluated the expression stability of four tomato reference genes, namely CAC, SAND, Expressed and ACTIN2. We showed that the genes CAC and Exp are the best reference genes of the four we tested during fruit development in the MT-Rg1 genotype. Furthermore, we validated the reference genes by showing that the expression profiles of the transcription factors FRUITFULL1 (FUL1 and APETALA2c (AP2c during fruit development are comparable to previous reports using other tomato cultivars.

  10. Quantitative RT-PCR analysis of estrogen receptor gene expression in laser microdissected prostate cancer tissue.

    Science.gov (United States)

    Walton, Thomas J; Li, Geng; McCulloch, Thomas A; Seth, Rashmi; Powe, Desmond G; Bishop, Michael C; Rees, Robert C

    2009-06-01

    Real-time quantitative RT-PCR analysis of laser microdissected tissue is considered the most accurate technique for determining tissue gene expression. The discovery of estrogen receptor beta (ERbeta) has focussed renewed interest on the role of estrogen receptors in prostate cancer, yet few studies have utilized the technique to analyze estrogen receptor gene expression in prostate cancer. Fresh tissue was obtained from 11 radical prostatectomy specimens and from 6 patients with benign prostate hyperplasia. Pure populations of benign and malignant prostate epithelium were laser microdissected, followed by RNA isolation and electrophoresis. Quantitative RT-PCR was performed using primers for androgen receptor (AR), estrogen receptor beta (ERbeta), estrogen receptor alpha (ERalpha), progesterone receptor (PGR) and prostate specific antigen (PSA), with normalization to two housekeeping genes. Differences in gene expression were analyzed using the Mann-Whitney U-test. Correlation coefficients were analyzed using Spearman's test. Significant positive correlations were seen when AR and AR-dependent PSA, and ERalpha and ERalpha-dependent PGR were compared, indicating a representative population of RNA transcripts. ERbeta gene expression was significantly over-expressed in the cancer group compared with benign controls (P cancer group (P prostate cancer specimens. In concert with recent studies the findings suggest differential production of ERbeta splice variants, which may play important roles in the genesis of prostate cancer. (c) 2009 Wiley-Liss, Inc.

  11. Design and analysis of Q-RT-PCR assays for haematological malignancies using mixed effects models

    DEFF Research Database (Denmark)

    Bøgsted, Martin; Mandrup, Charlotte; Petersen, Anders

    2009-01-01

    research use and needs qualit control for accuracy and precision. Especially the identification of experimental variations and statistical analysis has recently created discussions. The standard analytical technique is to use the Delta-Delta-Ct method. Although this method accounts for sample specific...... developed based on a linear mixed effects model for factorial designs. The model consists of an analysis of variance where the variation of each fixed effect of interest and identified experimental and biological nuisance variations are split. Hereby it accounts for varying efficiency, inhomogeneous......The recent WHO classification of haematological malignancies includes detection of genetic abnormalities with rognostic significance. Consequently, an increasing number of specific real-time quantitative reverse transcription polymerase chain reaction (Q-RT-PCR) based assays are in clinical...

  12. Comparison of multiplex RT-PCR and real-time HybProbe assay for serotyping of dengue virus using reference strains and clinical samples from India

    Directory of Open Access Journals (Sweden)

    Anita Chakravarti

    2016-01-01

    Full Text Available Background: Dengue virus serotyping is crucial from clinical management and epidemiological point of view. Aims: To compare efficacy of two molecular detection and typing methods, namely, multiplex reverse transcription polymerase chain reaction (RT-PCR and real-time Hybprobe assay using a panel of known dilution of four reference Dengue virus strains and a panel of sera collected from clinically suspected dengue patients. Settings: This study was conducted at a tertiary-care teaching hospital in Delhi, India. Materials and Methods: Dengue serotype specific virus strains were used as prototypes for serotyping assays. Viral load was quantified by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR. Acute phase serum samples were collected from 79 patients with clinically suspected Dengue fever on their first day of presentation during September-October 2012. Viral RNA from serum and cell culture supernatant was extracted. Reverse transcription was carried out. Quantitative detection of DENV RNA from reference strain culture supernatants and each of the 79 patient samples by real-time PCR was performed using light cycler Taqman master mix kit. Serotyping was done by multiplex RT-PCR assay and Hybprobe assay. Results: The multiplex RT-PCR assay, though found to be 100% specific, couldn't serotype either patient or reference strains with viral load less than 1000 RNA copies/ml. The Hybprobe assay was found to have 100% specificity and had a lower limit of serotype detection of merely 3.54 RNA copies/ml. Conclusions: HybProbe assay has an important role especially in situations where serotyping is to be performed in clinical samples with low viral load.

  13. Detection, quantitation and identification of enteroviruses from surface waters and sponge tissue from the Florida Keys using real-time RT-PCR

    Science.gov (United States)

    Donaldson, K.A.; Griffin, Dale W.; Paul, J.H.

    2002-01-01

    A method was developed for the quantitative detection of pathogenic human enteroviruses from surface waters in the Florida Keys using Taqman (R) one-step Reverse transcription (RT)-PCR with the Model 7700 ABI Prism (R) Sequence Detection System. Viruses were directly extracted from unconcentrated grab samples of seawater, from seawater concentrated by vortex flow filtration using a 100kD filter and from sponge tissue. Total RNA was extracted from the samples, purified and concentrated using spin-column chromatography. A 192-196 base pair portion of the 5??? untranscribed region was amplified from these extracts. Enterovirus concentrations were estimated using real-time RT-PCR technology. Nine of 15 sample sites or 60% were positive for the presence of pathogenic human enteroviruses. Considering only near-shore sites, 69% were positive with viral concentrations ranging from 9.3viruses/ml to 83viruses/g of sponge tissue (uncorrected for extraction efficiency). Certain amplicons were selected for cloning and sequencing for identification. Three strains of waterborne enteroviruses were identified as Coxsackievirus A9, Coxsackievirus A16, and Poliovirus Sabin type 1. Time and cost efficiency of this one-step real-time RT-PCR methodology makes this an ideal technique to detect, quantitate and identify pathogenic enteroviruses in recreational waters. Copyright ?? 2002 Elsevier Science Ltd.

  14. Comparative evaluation of conventional RT-PCR and real-time RT-PCR (RRT-PCR for detection of avian metapneumovirus subtype A Comparação entre as técnicas de RT-PCR convencional e RT-PCR em tempo real para a detecção do metapneumovírus aviários subtipo A

    Directory of Open Access Journals (Sweden)

    Helena Lage Ferreira

    2009-08-01

    Full Text Available Avian metapneumovirus (AMPV belongs to Metapneumovirus genus of Paramyxoviridae family. Virus isolation, serology, and detection of genomic RNA are used as diagnostic methods for AMPV. The aim of the present study was to compare the detection of six subgroup A AMPV isolates (AMPV/A viral RNA by using different conventional and real time RT-PCR methods. Two new RT-PCR tests and two real time RT-PCR tests, both detecting fusion (F gene and nucleocapsid (N gene were compared with an established test for the attachment (G gene. All the RT-PCR tested assays were able to detect the AMPV/A. The lower detection limits were observed using the N-, F- based RRT-PCR and F-based conventional RT-PCR (10(0.3 to 10¹ TCID50 mL-1. The present study suggests that the conventional F-based RT-PCR presented similar detection limit when compared to N- and F-based RRT-PCR and they can be successfully used for AMPV/A detection.O metapneumovírus aviário (AMPV pertence ao gênero Metapneumovirus, família Paramyxoviridae. Isolamento viral, sorologia e detecção do RNA genômico são atualmente as técnicas utilizadas para o diagnóstico desse agente. O objetivo do presente estudo foi comparar a detecção de RNA viral de seis isolados de AMPV, subtipo A (AMPV/A, utilizando diferentes métodos de RT-PCR convencional e real time RT-PCR (RRT-PCR. Duas novas técnicas de RT-PCR convencional e duas técnicas de RRT-PCR, ambas para a detecção dos genes da nucleoproteína (N e da proteína de fusão (F, foram comparadas com um RT-PCR previamente estabelecido para a detecção do AMPV (gene da glicoproteína -G. Todos esses métodos foram capazes de detectar os isolados AMPV/A. As técnicas RRT-PCR (genes F e N mostraram os menores limites de detecção (10(0.3 to 10¹ TCID50 mL-1. Os resultados sugerem que as técnicas RT-PCR convencional (gene F e as técnicas de RRT-PCR (gene F e N desenvolvidas no presente estudo podem ser utilizadas com sucesso para a detecção do

  15. Conventional and real time RT-PCR assays for the detection and differentiation of variant rabbit hemorrhagic disease virus (RHDVb) and its recombinants.

    Science.gov (United States)

    Dalton, K P; Arnal, J L; Benito, A A; Chacón, G; Martín Alonso, J M; Parra, F

    2018-01-01

    Since its emergence, variant RHDV (RHDVb/RHDV2) has spread throughout the Iberian Peninsula aided by the apparent lack of cross protection provided by classic (genogroup 1; G1) strain derived vaccines. In addition to RHDVb, full-length genome sequencing of RHDV strains has recently revealed the circulation of recombinant viruses on the Iberian Peninsula. These recombinant viruses contain the RHDVb structural protein encoding sequences and the non-structural coding regions of either pathogenic RHDV-G1 strains or non-pathogenic (np) rabbit caliciviruses. The aim of the work was twofold: firstly to validate a diagnostic real time RT-PCR developed in 2012 for the detection of RHDVb strains and secondly, to design a conventional RT-PCR for the differentiation of RHDVb strains from RHDVb recombinants by subsequent sequencing of the amplicon. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Development and evaluation of tailored specific real-time RT-PCR assays for detection of foot-and-mouth disease virus serotypes circulating in East Africa.

    Science.gov (United States)

    Bachanek-Bankowska, Katarzyna; Mero, Herieth R; Wadsworth, Jemma; Mioulet, Valerie; Sallu, Raphael; Belsham, Graham J; Kasanga, Christopher J; Knowles, Nick J; King, Donald P

    2016-11-01

    Rapid, reliable and accurate diagnostic methods provide essential support to programmes that monitor and control foot-and-mouth disease (FMD). While pan-specific molecular tests for FMD virus (FMDV) detection are well established and widely used in endemic and FMD-free countries, current serotyping methods mainly rely either on antigen detection ELISAs or nucleotide sequencing approaches. This report describes the development of a panel of serotype-specific real-time RT-PCR assays (rRT-PCR) tailored to detect FMDV lineages currently circulating in East Africa. These assays target sequences within the VP1-coding region that share high intra-lineage identity, but do not cross-react with FMD viruses from other serotypes that circulate in the region. These serotype-specific assays operate with the same thermal profile as the pan-diagnostic tests making it possible to run them in parallel to produce C T values comparable to the pan-diagnostic test detecting the 3D-coding region. These assays were evaluated alongside the established pan-specific molecular test using field samples and virus isolates collected from Tanzania, Kenya and Ethiopia that had been previously characterised by nucleotide sequencing. Samples (n=71) representing serotype A (topotype AFRICA, lineage G-I), serotype O (topotypes EA-2 and EA-4), serotype SAT 1 (topotype I (NWZ)) and serotype SAT2 (topotype IV) were correctly identified with these rRT-PCR assays. Furthermore, FMDV RNA from samples that did not contain infectious virus could still be serotyped using these assays. These serotype-specific real-time RT-PCR assays can detect and characterise FMDVs currently circulating in East Africa and hence improve disease control in this region. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  17. Quantitation of O6-methylguanine-DNA methyltransferase gene messenger RNA in gliomas by means of real-time RT-PCR and clinical response to nitrosoureas.

    Science.gov (United States)

    Tanaka, Satoshi; Oka, Hidehiro; Fujii, Kiyotaka; Watanabe, Kaoru; Nagao, Kumi; Kakimoto, Atsushi

    2005-09-01

    1. O6-methylguanine-DNA methyltransferase (MGMT) mRNA was measured in 50 malignant gliomas that had received 1-(4-amino-2-methyl-5-pyrimidynyl) methyl-3-(2-chloroethyl)-3-nitrosourea hydrochloride (ACNU) after the resection of the tumor by real-time reverse transcription-polymerase chain reaction (RT-PCR) using TaqMan probe. 2. The mean absolute value of MGMTmRNA normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) for 50 tumors was 1.29 x 10(4)+/- 1.28 x 10(4) copy/microg RNA (mean +/- SD). The amount of MGMTmRNA less than 6 x 10(3) copy/microg RNA was the most significant factor in predicting the initial effect of treatment with ACNU by multi-variant regression analysis (p = 0.0157). 3. These results suggest that quantitation of MGMTmRNA is the excellent method for predicting for the effect of ACNU in glioma therapy.

  18. Correlation of immune activation with HIV-1 RNA levels assayed by real-time RT-PCR in HIV-1 Subtype C infected patients in Northern India

    Science.gov (United States)

    Agarwal, Atima; Sankaran, Sumathi; Vajpayee, Madhu; Sreenivas, V; Seth, Pradeep; Dandekar, Satya

    2014-01-01

    Background Assays with specificity and cost effectiveness are needed for the measurement of HIV-1 burden to monitor disease progression or response to anti-retroviral therapy (ART) in HIV-1 subtype C infected patients. Objectives The objective of this study was to develop and validate an affordable; one step Real-Time RT-PCR assay with high specificity and sensitivity to measure plasma HIV-1 loads in HIV-1 subtype C infected patients. Results We developed an RT-PCR assay to detect and quantitate plasma HIV-1 levels in HIV-1 subtype C infected patients. An inverse correlation between plasma viral loads (PVL) and CD4+ T-cell numbers was detected at all CDC stages. Significant correlations were found between CD8+ T-cell activation and PVL, as well as with the clinical and immunological status of the patients. Conclusions The RT-PCR assay provides a sensitive method to measure PVL in HIV-1 subtype C infected patients. Viral loads correlated with immune activation and can be used to monitor HIV care in India. PMID:17962068

  19. Early diagnosis of dengue in travelers: comparison of a novel real-time RT-PCR, NS1 antigen detection and serology.

    Science.gov (United States)

    Huhtamo, Eili; Hasu, Essi; Uzcátegui, Nathalie Y; Erra, Elina; Nikkari, Simo; Kantele, Anu; Vapalahti, Olli; Piiparinen, Heli

    2010-01-01

    The increased traveling to dengue endemic regions and the numerous epidemics have led to a rise in imported dengue. The laboratory diagnosis of acute dengue requires several types of tests and often paired samples are needed for obtaining reliable results. Although several diagnostic methods are available, proper comparative data on their performance are lacking. To compare the performance of novel methods including a novel pan-DENV real-time RT-PCR and a commercially available NS1 capture-EIA in regard to IgM detection for optimizing the early diagnosis of DENV in travelers. A panel of 99 selected early phase serum samples of dengue patients was studied by real-time RT-PCR, NS1 antigen ELISA, IgM-EIA, IgG-IFA and cell culture virus isolation. The novel real-time RT-PCR was shown specific and sensitive for detection of DENV-1-4 RNA and suitable for diagnostic use. The diagnostic rate using combination of RNA and IgM detection was 99% and using NS1 and IgM detection 95.9%. The results of RNA and NS1 antigen detection disagreed in 15.5% of samples that had only RNA or NS1 antigen detected. The diagnostic rates of early samples are higher when either RNA or NS1 antigen detection is combined with IgM detection. Besides the differences in the RNA and NS1 detection assays, the observed discrepancy of results could suggest individual variation or differences in timing of these markers in patient serum. Copyright (c) 2009 Elsevier B.V. All rights reserved.

  20. Development of a real-time RT-PCR and Reverse Line probe Hybridisation assay for the routine detection and genotyping of Noroviruses in Ireland.

    LENUS (Irish Health Repository)

    Menton, John F

    2007-01-01

    BACKGROUND: Noroviruses are the most common cause of non-bacterial gastroenteritis. Improved detection methods have seen a large increase in the number of human NoV genotypes in the last ten years. The objective of this study was to develop a fast method to detect, quantify and genotype positive NoV samples from Irish hospitals. RESULTS: A real-time RT-PCR assay and a Reverse Line Blot Hybridisation assay were developed based on the ORF1-ORF2 region. The sensitivity and reactivity of the two assays used was validated using a reference stool panel containing 14 NoV genotypes. The assays were then used to investigate two outbreaks of gastroenteritis in two Irish hospitals. 56 samples were screened for NoV using a real-time RT-PCR assay and 26 samples were found to be positive. Genotyping of these positive samples found that all positives belonged to the GII\\/4 variant of NoV. CONCLUSION: The combination of the Real-time assay and the reverse line blot hybridisation assay provided a fast and accurate method to investigate a NoV associated outbreak. It was concluded that the predominant genotype circulating in these Irish hospitals was GII\\/4 which has been associated with the majority of NoV outbreaks worldwide. The assays developed in this study are useful tools for investigating NoV infection.

  1. Novel Molecular Beacon Probe-Based Real-Time RT-PCR Assay for Diagnosis of Crimean-Congo Hemorrhagic Fever Encountered in India

    Directory of Open Access Journals (Sweden)

    Aman Kamboj

    2014-01-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is an emerging zoonotic disease in India and requires immediate detection of infection both for preventing further transmission and for controlling the infection. The present study describes development, optimization, and evaluation of a novel molecular beacon-based real-time RT-PCR assay for rapid, sensitive, and specific diagnosis of Crimean-Congo hemorrhagic fever virus (CCHFV. The developed assay was found to be a better alternative to the reported TaqMan assay for routine diagnosis of CCHF.

  2. Evaluation of 793/B-like and Mass-like vaccine strain kinetics in experimental and field conditions by real-time RT-PCR quantification.

    Science.gov (United States)

    Tucciarone, C M; Franzo, G; Berto, G; Drigo, M; Ramon, G; Koutoulis, K C; Catelli, E; Cecchinato, M

    2018-01-01

    Infectious bronchitis virus (IBV) is a great economic burden both for productive losses and costs of the control strategies. Many different vaccination protocols are applied in the same region and even in consecutive cycles on the same farm in order to find the perfect balance between costs and benefits. In Northern Italy, the usual second vaccination is more and more often moved up to the chick's first d of life. The second strain administration together with the common Mass priming by spray at the hatchery allows saving money and time and reducing animal stress. The present work compared the different vaccine strains (Mass-like or B48, and 1/96) kinetics both in field conditions and in a 21-day-long experimental trial in broilers, monitoring the viral replication by upper respiratory tract swabbing and vaccine specific real time reverse transcription PCR (RT-PCR) quantification. In both field and experimental conditions, titers for all the vaccines showed an increasing trend in the first 2 wk and then a decrease, though still remaining detectable during the whole monitored period. IBV field strain and avian Metapneumovirus (aMPV) presence also was also investigated by RT-PCR and sequencing, and by multiplex real-time RT-PCR, respectively, revealing a consistency in the pathogen introduction timing at around 30 d, in correspondence with the vaccine titer's main decrease. These findings suggest the need for an accurate knowledge of live vaccine kinetics, whose replication can compete with the other pathogen one, providing additional protection to be added to what is conferred by the adaptive immune response. © 2017 Poultry Science Association Inc.

  3. Cross-platform evaluation of commercial real-time SYBR green RT-PCR kits for sensitive and rapid detection of European bat Lyssavirus type 1.

    Science.gov (United States)

    Picard-Meyer, Evelyne; Peytavin de Garam, Carine; Schereffer, Jean Luc; Marchal, Clotilde; Robardet, Emmanuelle; Cliquet, Florence

    2015-01-01

    This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R (2) values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  4. Cross-Platform Evaluation of Commercial Real-Time SYBR Green RT-PCR Kits for Sensitive and Rapid Detection of European Bat Lyssavirus Type 1

    Directory of Open Access Journals (Sweden)

    Evelyne Picard-Meyer

    2015-01-01

    Full Text Available This study evaluates the performance of five two-step SYBR Green RT-qPCR kits and five one-step SYBR Green qRT-PCR kits using real-time PCR assays. Two real-time thermocyclers showing different throughput capacities were used. The analysed performance evaluation criteria included the generation of standard curve, reaction efficiency, analytical sensitivity, intra- and interassay repeatability as well as the costs and the practicability of kits, and thermocycling times. We found that the optimised one-step PCR assays had a higher detection sensitivity than the optimised two-step assays regardless of the machine used, while no difference was detected in reaction efficiency, R2 values, and intra- and interreproducibility between the two methods. The limit of detection at the 95% confidence level varied between 15 to 981 copies/µL and 41 to 171 for one-step kits and two-step kits, respectively. Of the ten kits tested, the most efficient kit was the Quantitect SYBR Green qRT-PCR with a limit of detection at 95% of confidence of 20 and 22 copies/µL on the thermocyclers Rotor gene Q MDx and MX3005P, respectively. The study demonstrated the pivotal influence of the thermocycler on PCR performance for the detection of rabies RNA, as well as that of the master mixes.

  5. Diagnosis of Barmah Forest Virus Infection by a Nested Real-Time SYBR Green RT-PCR Assay

    OpenAIRE

    Hueston, Linda; Toi, Cheryl S.; Jeoffreys, Neisha; Sorrell, Tania; Gilbert, Gwendolyn

    2013-01-01

    Barmah Forest virus (BFV) is a mosquito borne (+) ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR ne...

  6. Development of a highly sensitive real-time nested RT-PCR assay in a single closed tube for detection of enterovirus 71 in hand, foot, and mouth disease.

    Science.gov (United States)

    Niu, Peihua; Qi, Shunxiang; Yu, Benzhang; Zhang, Chen; Wang, Ji; Li, Qi; Ma, Xuejun

    2016-11-01

    Enterovirus 71 (EV71) is one of the major causative agents of outbreaks of hand, foot, and mouth disease (HFMD). A commercial TaqMan probe-based real-time PCR assay has been widely used for the differential detection of EV71 despite its relatively high cost and failure to detect samples with a low viral load (Ct value > 35). In this study, a highly sensitive real-time nested RT-PCR (RTN RT-PCR) assay in a single closed tube for detection of EV71 in HFMD was developed. The sensitivity and specificity of this assay were evaluated using a reference EV71 stock and a panel of controls consisting of coxsackievirus A16 (CVA16) and common respiratory viruses, respectively. The clinical performance of this assay was evaluated and compared with those of a commercial TaqMan probe-based real-time PCR (qRT-PCR) assay and a traditional two-step nested RT-PCR assay. The limit of detection for the RTN RT-PCR assay was 0.01 TCID50/ml, with a Ct value of 38.3, which was the same as that of the traditional two-step nested RT-PCR assay and approximately tenfold lower than that of the qRT-PCR assay. When testing the reference strain EV71, this assay showed favorable detection reproducibility and no obvious cross-reactivity. The testing results of 100 clinical throat swabs from HFMD-suspected patients revealed that 41 samples were positive for EV71 by both RTN RT-PCR and traditional two-step nested RT-PCR assays, whereas only 29 were EV71 positive by qRT-PCR assay.

  7. Diagnosis of Barmah Forest virus infection by a nested real-time SYBR green RT-PCR assay.

    Directory of Open Access Journals (Sweden)

    Linda Hueston

    Full Text Available Barmah Forest virus (BFV is a mosquito borne (+ ssRNA alphavirus found only in Australia. It causes rash, myalgia and arthralgia in humans and is usually diagnosed serologically. We developed a real-time PCR assay to detect BFV in an effort to improve diagnosis early in the course of infection. The limit of detection was 16 genome equivalents with a specificity of 100%. Fifty five serum samples from BFV-infected patients were tested by the PCR. 52 of 53 antibody-positive samples were PCR negative. Two culture-positive (neutralizing antibody negative samples were positive on first round PCR, while one sample (IgM and neutralizing antibody strongly positive, IgG negative was positive on second round PCR, suggesting that viral RNA is detectable and transiently present in early infection. PCR can provide results faster than culture, is capable of high throughput and by sequencing the PCR product strain variants can be characterized.

  8. Detection and typing of highly pathogenic porcine reproductive and respiratory syndrome virus by multiplex real-time rt-PCR.

    Directory of Open Access Journals (Sweden)

    Kerstin Wernike

    Full Text Available Porcine reproductive and respiratory syndrome (PRRS causes economic losses in the pig industry worldwide, and PRRS viruses (PRRSV are classified into the two distinct genotypes "North American (NA, type 2" and "European (EU, type 1". In 2006, a highly pathogenic NA strain of PRRSV (HP-PRRSV, characterized by high fever as well as high morbidity and mortality, emerged in swine farms in China. Therefore, a real-time reverse transcription polymerase chain reaction (RT-qPCR assay specific for HP-PRRSV was developed and combined with type 1- and type 2-specific RT-qPCR systems. Furthermore, an internal control, based on a heterologous RNA, was successfully introduced. This final multiplex PRRSV RT-qPCR, detecting and typing PRRSV, had an analytical sensitivity of less than 200 copies per µl for the type 1-assay and 20 copies per µl for the type 2- and HP assays and a high diagnostic sensitivity. A panel of reference strains and field isolates was reliably detected and samples from an animal trial with a Chinese HP-PRRS strain were used for test validation. The new multiplex PRRSV RT-qPCR system allows for the first time the highly sensitive detection and rapid differentiation of PRRSV of both genotypes as well as the direct detection of HP-PRRSV.

  9. Simultaneous detection of Zika, Chikungunya and Dengue viruses by a multiplex real-time RT-PCR assay.

    Science.gov (United States)

    Pabbaraju, Kanti; Wong, Sallene; Gill, Kara; Fonseca, Kevin; Tipples, Graham A; Tellier, Raymond

    2016-10-01

    In the recent past, arboviruses such as Chikungunya (CHIKV) and Zika (ZIKV) have increased their area of endemicity and presented as an emerging global public health threat. To design an assay for the simultaneous detection of ZIKV, CHIKV and Dengue (DENV) 1-4 from patients with symptoms of arboviral infection. This would be advantageous because of the similar clinical presentation typically encountered with these viruses and their co-circulation in endemic areas. In this study we have developed and validated a triplex real time reverse transcription PCR assay using hydrolysis probes targeting the non-structural 5 (NS5) region of ZIKV, non-structural protein 4 (nsP4) from CHIKV and 3' untranslated region (3'UTR) of DENV 1-4. The 95% LOD by the triplex assay was 15 copies/reaction for DENV-1 and less than 10 copies/reaction for all other viruses. The triplex assay was 100% specific and did not amplify any of the other viruses tested. The assay was reproducible and adaptable to testing different specimen types including serum, plasma, urine, placental tissue, brain tissue and amniotic fluid. This assay can be easily implemented for diagnostic testing of patient samples, even in a high throughput laboratory. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Development of a real-time RT-PCR assay for the simultaneous identification, quantitation and differentiation of avian metapneumovirus subtypes A and B.

    Science.gov (United States)

    Cecchinato, Mattia; Lupini, Caterina; Munoz Pogoreltseva, Olga Svetlana; Listorti, Valeria; Mondin, Alessandra; Drigo, Michele; Catelli, Elena

    2013-01-01

    In recent years, special attention has been paid to real-time polymerase chain reaction (PCR) for avian metapneumovirus (AMPV) diagnosis, due to its numerous advantages over classical PCR. A new multiplex quantitative real-time reverse transcription-PCR (qRT-PCR) with molecular beacon probe assay, designed to target the SH gene, was developed. The test was evaluated in terms of specificity, sensitivity and repeatability, and compared with conventional RT nested-PCR based on the G gene. All of the AMPV subtype A and B strains tested were amplified and specifically detected while no amplification occurred with other non-target bird respiratory pathogens. The detection limit of the assay was 10(-0.41) median infectious dose/ml and 10(1.15) median infectious dose/ml when the AMPV-B strain IT/Ty/B/Vr240/87 and the AMPV-A strain IT/Ty/A/259-01/03 were used, respectively, as templates. In all cases, the amplification efficiency was approximately 2 and the error values were 0.9375) between crossing point values and virus quantities, making the assay herein designed reliable for quantification. When the newly developed qRT-PCR was compared with a conventional RT nested-PCR, it showed greater sensitivity with RNA extracted from both positive controls and from experimentally infected birds. This assay can be effectively used for the detection, identification, differentiation and quantitation of AMPV subtype A or subtype B to assist in disease diagnosis and to carry out rapid surveillance with high levels of sensitivity and specificity.

  11. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples.

    Science.gov (United States)

    Mehta, Rohini; Birerdinc, Aybike; Hossain, Noreen; Afendy, Arian; Chandhoke, Vikas; Younossi, Zobair; Baranova, Ancha

    2010-05-21

    Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR) is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  12. Validation of endogenous reference genes for qRT-PCR analysis of human visceral adipose samples

    Directory of Open Access Journals (Sweden)

    Afendy Arian

    2010-05-01

    Full Text Available Abstract Background Given the epidemic proportions of obesity worldwide and the concurrent prevalence of metabolic syndrome, there is an urgent need for better understanding the underlying mechanisms of metabolic syndrome, in particular, the gene expression differences which may participate in obesity, insulin resistance and the associated series of chronic liver conditions. Real-time PCR (qRT-PCR is the standard method for studying changes in relative gene expression in different tissues and experimental conditions. However, variations in amount of starting material, enzymatic efficiency and presence of inhibitors can lead to quantification errors. Hence the need for accurate data normalization is vital. Among several known strategies for data normalization, the use of reference genes as an internal control is the most common approach. Recent studies have shown that both obesity and presence of insulin resistance influence an expression of commonly used reference genes in omental fat. In this study we validated candidate reference genes suitable for qRT-PCR profiling experiments using visceral adipose samples from obese and lean individuals. Results Cross-validation of expression stability of eight selected reference genes using three popular algorithms, GeNorm, NormFinder and BestKeeper found ACTB and RPII as most stable reference genes. Conclusions We recommend ACTB and RPII as stable reference genes most suitable for gene expression studies of human visceral adipose tissue. The use of these genes as a reference pair may further enhance the robustness of qRT-PCR in this model system.

  13. The effect of various disinfectants on detection of avian influenza virus by real time RT-PCR.

    Science.gov (United States)

    Suarez, D L; Spackman, E; Senne, D A; Bulaga, L; Welsch, A C; Froberg, K

    2003-01-01

    An avian influenza (AI) real time reverse transcriptase-polymerase chain reaction (RRT-PCR) test was previously shown to be a rapid and sensitive method to identify AI virus-infected birds in live-bird markets (LBMs). The test can also be used to identify avian influenza virus (AIV) from environmental samples. Consequently, the use of RRT-PCR was being considered as a component of the influenza eradication program in the LBMs to assure that each market was properly cleaned and disinfected before allowing the markets to be restocked. However, the RRT-PCR test cannot differentiate between live and inactivated virus, particularly in environmental samples where the RRT-PCR test potentially could amplify virus that had been inactivated by commonly used disinfectants, resulting in a false positive test result. To determine whether this is a valid concern, a study was conducted in three New Jersey LBMs that were previously shown to be positive for the H7N2 AIV. Environmental samples were collected from all three markets following thorough cleaning and disinfection with a phenolic disinfectant. Influenza virus RNA was detected in at least one environmental sample from two of the three markets when tested by RRT-PCR; however, all samples were negative by virus isolation using the standard egg inoculation procedure. As a result of these findings, laboratory experiments were designed to evaluate several commonly used disinfectants for their ability to inactivate influenza as well as disrupt the RNA so that it could not be detected by the RRT-PCR test. Five disinfectants were tested: phenolic disinfectants (Tek-trol and one-stroke environ), a quaternary ammonia compound (Lysol no-rinse sanitizer), a peroxygen compound (Virkon-S), and sodium hypochlorite (household bleach). All five disinfectants were effective at inactivating AIV at the recommended concentrations, but AIV RNA in samples inactivated with phenolic and quaternary ammonia compounds could still be detected by RRT

  14. Estudio comparativo entre una prueba rápida y RT-PCR tiempo real en el diagnóstico de influenza AH1N1 2009 Comparative study of a rapid testing with real time RT-PCR for diagnosis of influenza AH1N1 2009

    Directory of Open Access Journals (Sweden)

    Luz Araceli Castro-Cárdenas

    2011-08-01

    Full Text Available OBJETIVO: Comparar la prueba QuickVue Influenza A+B empleando como estándar la RT-PCR tiempo real para influenza AH1N1 2009. MATERIAL Y MÉTODOS: Estudio retrospectivo-comparativo de 135 muestras de vías respiratorias de individuos sintomáticos para influenza procesadas de mayo 2009 a octubre 2010.Las pruebas citadas se realizaron simultáneamente. Se utilizó el software Confidence Interval Analysis 2000. RESULTADOS: Sensibilidad 62.96; especificidad 94.44; valor predictivo negativo 62.9; valor predictivo positivo 94.44; razón de probabilidad positiva 11.33 y razón de probabilidad negativa 0.39. Se calcularon intervalos de confianza a 95. DISCUSIÓN: Los valores obtenidos concuerdan con otros estudios donde la sensibilidad fluctúa de 50 a 70 y especificidad entre 90 y 95 por ciento. La prueba QuickVue Influenza A+B es rápida, simple y de menor costo que el RT-PCR tiempo real, útil para identificar el tipo de virus en brotes de influenza de una población determinadaOBJECTIVE: Compare QuickVue Influenza A+B test with real-time RT-PCR for the diagnosis of influenza AH1N1 2009. MATERIAL AND METHODS: Retrospective-comparative study of 135 respiratory specimens from individuals with symptoms of influenza processed from May 2009 to October 2010.The above mentioned tests were performed simultaneously. For statistic analysisthe softwareof Confidence IntervalAnalysis 2000 was used. RESULTS: The parameters obtained were: sensitivity 62.96; specificity 94.44; negative predictive value 62.9; positive predictive value 94.44; positive likelihood ratio 11.33; negative likelihood ratio 0.39. Confidence intervals to 95,were calculated to all of the above data. DISCUSSION: The test QuickVue InfluenzaA+B is a rapid,simple test,with lower cost than real-time RT-PCR useful for identifying the type of virus outbreaks of influenza in a given population.It correlates well with more specific test and similar reports.

  15. Sequence Optimized Real-Time RT-PCR Assay for Detection of Crimean-Congo Hemorrhagic Fever Virus

    Science.gov (United States)

    2017-03-21

    on the linear range of the curve 129 using a nonlinear regression analysis. A two-way ANOVA with Sidak’s multiple comparisons test was 130 done to...currently fielded CCHFV assay. 31 TR-17-094 DISTRIBUTION STATEMENT A: Approved for public release; distribution is unlimited. 2 Introduction 32...analyses were performed using GraphPrism 6 (GraphPad Software, San Diego, CA). 128 Assay linearity based on the preliminary LOD was determined based

  16. Comparison of real-time SYBR green dengue assay with real-time taqman RT-PCR dengue assay and the conventional nested PCR for diagnosis of primary and secondary dengue infection

    Science.gov (United States)

    Paudel, Damodar; Jarman, Richard; Limkittikul, Kriengsak; Klungthong, Chonticha; Chamnanchanunt, Supat; Nisalak, Ananda; Gibbons, Robert; Chokejindachai, Watcharee

    2011-01-01

    Background: Dengue fever and dengue hemorrhagic fever are caused by dengue virus. Dengue infection remains a burning problem of many countries. To diagnose acute dengue in the early phase we improve the low cost, rapid SYBR green real time assay and compared the sensitivity and specificity with real time Taqman® assay and conventional nested PCR assay. Aims: To develop low cost, rapid and reliable real time SYBR green diagnostic dengue assay and compare with Taqman real-time assay and conventional nested PCR (modified Lanciotti). Materials and Methods: Eight cultured virus strains were diluted in tenth dilution down to undetectable level by the PCR to optimize the primer, temperature (annealing, and extension and to detect the limit of detection of the assay. Hundred and ninety three ELISA and PCR proved dengue clinical samples were tested with real time SYBR® Green assay, real time Taqman® assay to compare the sensitivity and specificity. Results: Sensitivity and specificity of real time SYBR® green dengue assay (84% and 66%, respectively) was almost comparable to those (81% and 74%) of Taqman real time PCR dengue assay. Real time SYBR® green RT-PCR was equally sensitive in primary and secondary infection while real time Taqman was less sensitive in the secondary infection. Sensitivity of real time Taqman on DENV3 (87%) was equal to SYBR green real time PCR dengue assay. Conclusion: We developed low cost rapid diagnostic SYBR green dengue assay. Further study is needed to make duplex primer assay for the serotyping of dengue virus. PMID:22363089

  17. Characterization of human coronavirus etiology in Chinese adults with acute upper respiratory tract infection by real-time RT-PCR assays.

    Directory of Open Access Journals (Sweden)

    Roujian Lu

    Full Text Available BACKGROUND: In addition to SARS associated coronaviruses, 4 non-SARS related human coronaviruses (HCoVs are recognized as common respiratory pathogens. The etiology and clinical impact of HCoVs in Chinese adults with acute upper respiratory tract infection (URTI needs to be characterized systematically by molecular detection with excellent sensitivity. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we detected 4 non-SARS related HCoV species by real-time RT-PCR in 981 nasopharyngeal swabs collected from March 2009 to February 2011. All specimens were also tested for the presence of other common respiratory viruses and newly identified viruses, human metapneumovirus (hMPV and human bocavirus (HBoV. 157 of the 981 (16.0% nasopharyngeal swabs were positive for HCoVs. The species detected were 229E (96 cases, 9.8%, OC43 (42 cases, 4.3%, HKU1 (16 cases, 1.6% and NL63 (11 cases, 1.1%. HCoV-229E was circulated in 21 of the 24 months of surveillance. The detection rates for both OC43 and NL63 were showed significantly year-to-year variation between 2009/10 and 2010/11, respectively (P<0.001 and P = 0.003, and there was a higher detection frequency of HKU1 in patients aged over 60 years (P = 0.03. 48 of 157(30.57% HCoV positive patients were co-infected. Undifferentiated human rhinoviruses and influenza (Flu A were the most common viruses detected (more than 35% in HCoV co-infections. Respiratory syncytial virus (RSV, human parainfluenza virus (PIV and HBoV were detected in very low rate (less than 1% among adult patients with URTI. CONCLUSIONS/SIGNIFICANCE: All 4 non-SARS-associated HCoVs were more frequently detected by real-time RT-PCR assay in adults with URTI in Beijing and HCoV-229E led to the most prevalent infection. Our study also suggested that all non-SARS-associated HCoVs contribute significantly to URTI in adult patients in China.

  18. [Detecting HB-1 Expression Level in Bone Marrow of Acute Leukemia Patients by Real-Time Fluorescence Quantitative RT-PCR].

    Science.gov (United States)

    Wang, Qing-Yun; Li, Yuan; Ji, Li; Liang, Ze-Yin; Liu, Wei; Ren, Han-Yun; Qiu, Zhi-Xiang

    2018-02-01

    To investigate the expression level of HB-1 gene in patients with acute lymphoblastic leukemia (ALL) and the significance of HB-1 gene in monitoring of minimal residual disease (MRD). The method of real-time fluorescence quantitative RT-PCR (Taqman probe) was established to detect the expression levels of HB-1 gene; then the sensitivity, specificity and repeatability of this assay were evaluated and verified. The HB-1 gene expression levels in bone marrow of 183 cases of ALL, 70 cases of acute myeloid leukemias (AML), 52 cases of non-malignant hematologic diseases and 24 healthy hematopoietic stem cell donors were detected. The correlation of HB-1 level with diagnosis and relapse was analyzed by detecting bone marrow samples of 33 B-ALL. The sensitivity of this assay reached the 10 -4 level. The coefficient of variation for inter-batch and inter-tube of HB-1 were 6.79% and 4.80%, respectively. It was found that HB-1 gene specifically expressed in acute B lymphoblastic leukemia. The median expression levels of HB-1 gene in newly diagnosed and relapsed B-ALL patients were statistically significantly higher than those in ALL in complete remission(CR), newly diagnosed T-ALL, newly diagnosed AML, non-malignant hematologic diseases, and healthy hematopoietic stem cell donors(33.0% vs 0.68%, 0.07%, 0.02%, 0.58% and 0, respectively) (P0.05). The expression level of HB-1 gene declined sharply when B-ALL patients reached complete remission (0-7.99%, with median level 0.68%), but increased when relapsed (7.69%, 8.08% and 484.0% in 3 relapsed samples), which was in accordance with results of flow cytometry. HB-1 gene specifically expressed in acute B lymphoblastic leukemia cells. The established real-time fluorescence quantitative RT-PCR assay shows good sensitivity, specificity and repeatability, thus, can be used as a biological marker in the clinical detection, monitoring MRD and predicting of early relapse for B-ALL patients.

  19. Use of quantitative real-time RT-PCR to investigate the correlation between viremia and viral shedding of canine distemper virus, and infection outcomes in experimentally infected dogs.

    Science.gov (United States)

    Sehata, Go; Sato, Hiroaki; Ito, Toshihiro; Imaizumi, Yoshitaka; Noro, Taichi; Oishi, Eiji

    2015-07-01

    We used real-time RT-PCR and virus titration to examine canine distemper virus (CDV) kinetics in peripheral blood and rectal and nasal secretions from 12 experimentally infected dogs. Real-time RT-PCR proved extremely sensitive, and the correlation between the two methods for rectal and nasal (r=0.78, 0.80) samples on the peak day of viral RNA was good. Although the dogs showed diverse symptoms, viral RNA kinetics were similar; the peak of viral RNA in the symptomatic dogs was consistent with the onset of symptoms. These results indicate that real-time RT-PCR is sufficiently sensitive to monitor CDV replication in experimentally infected dogs regardless of the degree of clinical manifestation and suggest that the peak of viral RNA reflects active CDV replication.

  20. Laboratory validation of two real-time RT-PCR methods with 5'-tailed primers for an enhanced detection of foot-and-mouth disease virus.

    Science.gov (United States)

    Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris

    2017-08-01

    The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Selection of Reference Genes for qRT-PCR Analysis of Gene Expression in Stipa grandis during Environmental Stresses.

    Directory of Open Access Journals (Sweden)

    Dongli Wan

    Full Text Available Stipa grandis P. Smirn. is a dominant plant species in the typical steppe of the Xilingole Plateau of Inner Mongolia. Selection of suitable reference genes for the quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR is important for gene expression analysis and research into the molecular mechanisms underlying the stress responses of S. grandis. In the present study, 15 candidate reference genes (EF1 beta, ACT, GAPDH, SamDC, CUL4, CAP, SNF2, SKIP1, SKIP5, SKIP11, UBC2, UBC15, UBC17, UCH, and HERC2 were evaluated for their stability as potential reference genes for qRT-PCR under different stresses. Four algorithms were used: GeNorm, NormFinder, BestKeeper, and RefFinder. The results showed that the most stable reference genes were different under different stress conditions: EF1beta and UBC15 during drought and salt stresses; ACT and GAPDH under heat stress; SKIP5 and UBC17 under cold stress; UBC15 and HERC2 under high pH stress; UBC2 and UBC15 under wounding stress; EF1beta and UBC17 under jasmonic acid treatment; UBC15 and CUL4 under abscisic acid treatment; and HERC2 and UBC17 under salicylic acid treatment. EF1beta and HERC2 were the most suitable genes for the global analysis of all samples. Furthermore, six target genes, SgPOD, SgPAL, SgLEA, SgLOX, SgHSP90 and SgPR1, were selected to validate the most and least stable reference genes under different treatments. Our results provide guidelines for reference gene selection for more accurate qRT-PCR quantification and will promote studies of gene expression in S. grandis subjected to environmental stress.

  2. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Science.gov (United States)

    McMillan, Mary; Pereg, Lily

    2014-01-01

    Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA) in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA) is sufficient for effective normalisation of qRT-PCR data.

  3. Evaluation of reference genes for gene expression analysis using quantitative RT-PCR in Azospirillum brasilense.

    Directory of Open Access Journals (Sweden)

    Mary McMillan

    Full Text Available Azospirillum brasilense is a nitrogen fixing bacterium that has been shown to have various beneficial effects on plant growth and yield. Under normal conditions A. brasilense exists in a motile flagellated form, which, under starvation or stress conditions, can undergo differentiation into an encapsulated, cyst-like form. Quantitative RT-PCR can be used to analyse changes in gene expression during this differentiation process. The accuracy of quantification of mRNA levels by qRT-PCR relies on the normalisation of data against stably expressed reference genes. No suitable set of reference genes has yet been described for A. brasilense. Here we evaluated the expression of ten candidate reference genes (16S rRNA, gapB, glyA, gyrA, proC, pykA, recA, recF, rpoD, and tpiA in wild-type and mutant A. brasilense strains under different culture conditions, including conditions that induce differentiation. Analysis with the software programs BestKeeper, NormFinder and GeNorm indicated that gyrA, glyA and recA are the most stably expressed reference genes in A. brasilense. The results also suggested that the use of two reference genes (gyrA and glyA is sufficient for effective normalisation of qRT-PCR data.

  4. Selection of reference genes for qRT-PCR analysis of gene expression in sea cucumber Apostichopus japonicus during aestivation

    Science.gov (United States)

    Zhao, Ye; Chen, Muyan; Wang, Tianming; Sun, Lina; Xu, Dongxue; Yang, Hongsheng

    2014-11-01

    Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is a technique that is widely used for gene expression analysis, and its accuracy depends on the expression stability of the internal reference genes used as normalization factors. However, many applications of qRT-PCR used housekeeping genes as internal controls without validation. In this study, the expression stability of eight candidate reference genes in three tissues (intestine, respiratory tree, and muscle) of the sea cucumber Apostichopus japonicus was assessed during normal growth and aestivation using the geNorm, NormFinder, delta CT, and RefFinder algorithms. The results indicate that the reference genes exhibited significantly different expression patterns among the three tissues during aestivation. In general, the β-tubulin (TUBB) gene was relatively stable in the intestine and respiratory tree tissues. The optimal reference gene combination for intestine was 40S ribosomal protein S18 (RPS18), TUBB, and NADH dehydrogenase (NADH); for respiratory tree, it was β-actin (ACTB), TUBB, and succinate dehydrogenase cytochrome B small subunit (SDHC); and for muscle it was α-tubulin (TUBA) and NADH dehydrogenase [ubiquinone] 1 α subcomplex subunit 13 (NDUFA13). These combinations of internal control genes should be considered for use in further studies of gene expression in A. japonicus during aestivation.

  5. Selection and Validation of Reference Genes for qRT-PCR Expression Analysis of Candidate Genes Involved in Olfactory Communication in the Butterfly Bicyclus anynana

    OpenAIRE

    Arun, Alok; Bauml?, V?ronique; Amelot, Ga?l; Nieberding, Caroline M.

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at ident...

  6. Selection and validation of endogenous reference genes for qRT-PCR analysis in leafy spurge (Euphorbia esula.

    Directory of Open Access Journals (Sweden)

    Wun S Chao

    Full Text Available Quantitative real-time polymerase chain reaction (qRT-PCR is the most important tool in measuring levels of gene expression due to its accuracy, specificity, and sensitivity. However, the accuracy of qRT-PCR analysis strongly depends on transcript normalization using stably expressed reference genes. The aim of this study was to find internal reference genes for qRT-PCR analysis in various experimental conditions for seed, adventitious underground bud, and other organs of leafy spurge. Eleven candidate reference genes (BAM4, PU1, TRP-like, FRO1, ORE9, BAM1, SEU, ARF2, KAPP, ZTL, and MPK4 were selected from among 171 genes based on expression stabilities during seed germination and bud growth. The other ten candidate reference genes were selected from three different sources: (1 3 stably expressed leafy spurge genes (60S, bZIP21, and MD-100 identified from the analyses of leafy spurge microarray data; (2 3 orthologs of Arabidopsis "general purpose" traditional reference genes (GAPDH_1, GAPDH_2, and UBC; and (3 4 orthologs of Arabidopsis stably expressed genes (UBC9, SAND, PTB, and F-box identified from Affymetrix ATH1 whole-genome GeneChip studies. The expression stabilities of these 21 genes were ranked based on the C(T values of 72 samples using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ΔC(T method. Our analyses revealed SAND, PTB, ORE9, and ARF2 to be the most appropriate reference genes for accurate normalization of gene expression data. Since SAND and PTB were obtained from 4 orthologs of Arabidopsis, while ORE9 and ARF2 were selected from 171 leafy spurge genes, it was more efficient to identify good reference genes from the orthologs of other plant species that were known to be stably expressed than that of randomly testing endogenous genes. Nevertheless, the two newly identified leafy spurge genes, ORE9 and ARF2, can serve as orthologous candidates in the search for reference genes

  7. No control genes required: Bayesian analysis of qRT-PCR data.

    Directory of Open Access Journals (Sweden)

    Mikhail V Matz

    Full Text Available Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process.In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts. Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests.Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  8. No control genes required: Bayesian analysis of qRT-PCR data.

    Science.gov (United States)

    Matz, Mikhail V; Wright, Rachel M; Scott, James G

    2013-01-01

    Model-based analysis of data from quantitative reverse-transcription PCR (qRT-PCR) is potentially more powerful and versatile than traditional methods. Yet existing model-based approaches cannot properly deal with the higher sampling variances associated with low-abundant targets, nor do they provide a natural way to incorporate assumptions about the stability of control genes directly into the model-fitting process. In our method, raw qPCR data are represented as molecule counts, and described using generalized linear mixed models under Poisson-lognormal error. A Markov Chain Monte Carlo (MCMC) algorithm is used to sample from the joint posterior distribution over all model parameters, thereby estimating the effects of all experimental factors on the expression of every gene. The Poisson-based model allows for the correct specification of the mean-variance relationship of the PCR amplification process, and can also glean information from instances of no amplification (zero counts). Our method is very flexible with respect to control genes: any prior knowledge about the expected degree of their stability can be directly incorporated into the model. Yet the method provides sensible answers without such assumptions, or even in the complete absence of control genes. We also present a natural Bayesian analogue of the "classic" analysis, which uses standard data pre-processing steps (logarithmic transformation and multi-gene normalization) but estimates all gene expression changes jointly within a single model. The new methods are considerably more flexible and powerful than the standard delta-delta Ct analysis based on pairwise t-tests. Our methodology expands the applicability of the relative-quantification analysis protocol all the way to the lowest-abundance targets, and provides a novel opportunity to analyze qRT-PCR data without making any assumptions concerning target stability. These procedures have been implemented as the MCMC.qpcr package in R.

  9. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    International Nuclear Information System (INIS)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues or cells under investigation

  10. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Directory of Open Access Journals (Sweden)

    Radtke Arnold

    2008-11-01

    Full Text Available Abstract Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR. The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC is presented. Methods Six genes, beta-2-microglobulin (B2M, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, hydroxymethyl-bilane synthase (HMBS, hypoxanthine phosphoribosyl-transferase 1 (HPRT1, succinate dehydrogenase complex, subunit A (SDHA and ubiquitin C (UBC, with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the

  11. Validation of putative reference genes for gene expression studies in human hepatocellular carcinoma using real-time quantitative RT-PCR

    Science.gov (United States)

    Cicinnati, Vito R; Shen, Qingli; Sotiropoulos, Georgios C; Radtke, Arnold; Gerken, Guido; Beckebaum, Susanne

    2008-01-01

    Background Reference genes, which are often referred to as housekeeping genes are frequently used to normalize mRNA levels between different samples in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The selection of reference genes is critical for gene expression studies because the expression of these genes may vary among tissues or cells and may change under certain circumstances. Here, a systematic evaluation of six putative reference genes for gene expression studies in human hepatocellular carcinoma (HCC) is presented. Methods Six genes, beta-2-microglobulin (B2M), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), hydroxymethyl-bilane synthase (HMBS), hypoxanthine phosphoribosyl-transferase 1 (HPRT1), succinate dehydrogenase complex, subunit A (SDHA) and ubiquitin C (UBC), with distinct functional characteristics and expression patterns were evaluated by qRT-PCR. Inhibitory substances in RNA samples were quantitatively assessed and controlled using an external RNA control. The stability of selected reference genes was analyzed using both geNorm and NormFinder software. Results HMBS and GAPDH were identified as the optimal reference genes for normalizing gene expression data between paired tumoral and adjacent non-tumoral tissues derived from patients with HCC. HMBS, GAPDH and UBC were identified to be suitable for the normalization of gene expression data among tumor tissues; whereas the combination of HMBS, B2M, SDHA and GAPDH was suitable for normalizing gene expression data among five liver cancer cell lines, namely Hep3B, HepG2, HuH7, SK-HEP-1 and SNU-182. The determined gene stability was increased after exclusion of RNA samples containing relatively higher inhibitory substances. Conclusion Of six genes studied, HMBS was found to be the single best reference gene for gene expression studies in HCC. The appropriate choice of combination of more than one reference gene to improve qRT-PCR accuracy depends on the kind of liver tissues

  12. Development of single-step multiplex real-time RT-PCR assays for rapid diagnosis of enterovirus 71, coxsackievirus A6, and A16 in patients with hand, foot, and mouth disease.

    Science.gov (United States)

    Puenpa, Jiratchaya; Suwannakarn, Kamol; Chansaenroj, Jira; Vongpunsawad, Sompong; Poovorawan, Yong

    2017-10-01

    Real-time reverse-transcription polymerase chain reaction (rRT-PCR) to detect enterovirus 71 (EV-A71) and coxsackievirus A16 (CV-A16) has facilitated the rapid and accurate identification of the two most common etiological agents underlying hand, foot, and mouth disease (HFMD). However, the worldwide emergence of CV-A6 infection in HFMD necessitates development of an improved multiplex rRT-PCR method. To rapidly determine the etiology of HFMD, two rRT-PCR assays using TaqMan probes were developed to differentiate among three selected common enteroviruses (EV-A71, CV-A16 and CV-A6) and to enable broad detection of enteroviruses (pan-enterovirus assay). No cross-reactions were observed with other RNA viruses examined. The detection limits of both assays were 10 copies per microliter for EV-A71, CV-A6 and CV-A16, and pan-enterovirus. The methods showed high accuracy (EV-A71, 90.6%; CV-A6, 92.0%; CV-A16, 100%), sensitivity (EV-A71, 96.5%; CV-A6, 95.8%; CV-A16, 99.0%), and specificity (EV-A71, 100%; CV-A6, 99.9%; CV-A16, 99.9%) in testing clinical specimens (n=1049) during 2014-2016, superior to those of conventional RT-PCR. Overall, the multiplex rRT-PCR assays enabled highly sensitive detection and rapid simultaneous typing of EV-A71, CV-A6 and CV-A16, and enteroviruses, rendering them feasible and attractive methods for large-scale surveillance of enteroviruses associated with HFMD outbreaks. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Comparison of the genexpert enterovirus assay (GXEA) with real-time one step RT-PCR for the detection of enteroviral RNA in the cerebrospinal fluid of patients with meningitis.

    Science.gov (United States)

    Hong, JiYoung; Kim, Ahyoun; Hwang, Seoyeon; Cheon, Doo-Sung; Kim, Jong-Hyen; Lee, June-Woo; Park, Jae-Hak; Kang, Byunghak

    2015-02-13

    Enteroviruses (EVs) are the leading cause of aseptic meningitis worldwide. Detection of enteroviral RNA in clinical specimens has been demonstrated to improve the management of patient care, especially that of neonates and young children. To establish a sensitive and reliable assay for routine laboratory diagnosis, we compared the sensitivity and specificity of the GeneXpert Enterovirus Assay (GXEA) with that of the reverse transcription polymerase chain reaction (RT-PCR) based assay referred to as real-time one step RT-PCR (RTo-PCR). The sensitivity/specificity produced by GXEA and RTo-PCR were 100%/100% and 65%/100%, respectively. Both methods evaluated in this article can be used for detection of enterovirus in clinical specimens and these nucleic acid amplification methods are useful assays for the diagnosis of enteroviral infection.

  14. Molecular analysis of dolphin morbillivirus: A new sensitive detection method based on nested RT-PCR.

    Science.gov (United States)

    Centelleghe, Cinzia; Beffagna, Giorgia; Zanetti, Rossella; Zappulli, Valentina; Di Guardo, Giovanni; Mazzariol, Sandro

    2016-09-01

    Cetacean Morbillivirus (CeMV) has been identified as the most pathogenic virus for cetaceans. Over the past three decades, this RNA virus has caused several outbreaks of lethal disease in odontocetes and mysticetes worldwide. Isolation and identification of CeMV RNA is very challenging in whales because of the poor preservation status frequently shown by tissues from stranded animals. Nested reverse transcription polymerase chain reaction (nested RT-PCR) is used instead of conventional RT-PCR when it is necessary to increase the sensitivity and the specificity of the reaction. This study describes a new nested RT-PCR technique useful to amplify small amounts of the cDNA copy of Cetacean morbillivirus (CeMV) when it is present in scant quantity in whales' biological specimens. This technique was used to analyze different tissues (lung, brain, spleen and other lymphoid tissues) from one under human care seal and seven cetaceans stranded along the Italian coastline between October 2011 and September 2015. A well-characterized, 200 base pair (bp) fragment of the dolphin Morbillivirus (DMV) haemagglutinin (H) gene, obtained by nested RT-PCR, was sequenced and used to confirm DMV positivity in all the eight marine mammals under study. In conclusion, this nested RT-PCR protocol can represent a sensitive detection method to identify CeMV-positive, poorly preserved tissue samples. Furthermore, this is also a rather inexpensive molecular technique, relatively easy to apply. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Performance of a commercial assay for the diagnosis of influenza A (H1N1 infection in comparison to the Centers for Disease Control and Prevention protocol of real time RT-PCR

    Directory of Open Access Journals (Sweden)

    María G Barbás

    2012-03-01

    Full Text Available At the time of influenza A (H1N1 emergency, the WHO responded with remarkable speed by releasing guidelines and a protocol for a real-time RT-PCR assay (rRT-PCR. The aim of the present study was to evalúate the performance of the "Real Time Ready Influenza A/H1N1 Detection Set" (June 2009-Roche kit in comparison to the CDC reference rRT-PCR protocol. The overall sensitivity of the Roche assay for detection of the Inf A gene in the presence or absence of the H1 gene was 74.5 %. The sensitivity for detecting samples that were only positive for the Inf A gene (absence of the H1 gene was 53.3 % whereas the sensitivity for H1N1-positive samples (presence of the Inf A gene and any other swine gene was 76.4 %. The specificity of the assay was 97.1 %. A new version of the kit (November 2009 is now available, and a recent evaluation of its performance showed good sensitivity to detect pandemic H1N1 compared to other molecular assays.Durante la pandemia de influenza A (H1N1, la OMS recomendó algoritmos y protocolos de detección del virus mediante RT-PCR en tiempo real. El objetivo del presente estudio fue evaluar el desempeño del equipo que comercializa la empresa Roche, Real Time Ready Influenza A/H1N1 Detection Set (junio de 2009, en comparación con el protocolo de RT-PCR en tiempo real de los CDC. La sensibilidad global del ensayo de Roche para la detección del gen Inf A en presencia o ausencia del gen H1 fue 74,5 %. La sensibilidad para la detección de muestras positivas solo para el gen Inf A (ausencia del gen H1 fue 53,3 % y la sensibilidad para la detección de muestras positivas para H1N1 (presencia del gen Inf A y cualquier otro gen porcino fue 76,4 %. La especificidad fue 97,1 %. Existe una nueva versión del equipo (noviembre 2009 que, según se ha descrito, presenta buena sensibilidad en comparación con otros ensayos moleculares para detectar H1N1 pandémica.

  16. Real Time Text Analysis

    Science.gov (United States)

    Senthilkumar, K.; Ruchika Mehra Vijayan, E.

    2017-11-01

    This paper aims to illustrate real time analysis of large scale data. For practical implementation we are performing sentiment analysis on live Twitter feeds for each individual tweet. To analyze sentiments we will train our data model on sentiWordNet, a polarity assigned wordNet sample by Princeton University. Our main objective will be to efficiency analyze large scale data on the fly using distributed computation. Apache Spark and Apache Hadoop eco system is used as distributed computation platform with Java as development language

  17. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East.

    Science.gov (United States)

    Reid, Scott M; Mioulet, Valerie; Knowles, Nick J; Shirazi, Nazeem; Belsham, Graham J; King, Donald P

    2014-10-01

    Rapid and accurate diagnosis is essential for effective control of foot-and-mouth disease (FMD). In countries where FMD is endemic, identification of the serotypes of the causative virus strains is important for vaccine selection and tracing the source of outbreaks. In this study, real-time reverse transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative field samples of serotype O strains belonging exclusively to the PanAsia-2 lineage, serotype A strains of the Iran-05 lineage and serotype Asia-1 viruses from three relevant sub-groups. When RNA extracted from archival and contemporary field strains was tested using one- or two-step rRT-PCR assays, all three primer/probe sets detected the RNA from homotypic viruses and no cross-reactivity was observed with heterotypic viruses. Similar results were obtained using both single- and multiplex assay formats. Using plasmid standards, the minimum detection level of these tests was found to be lower than two copies. The results illustrate the potential of tailored rRT-PCR tools for the detection and categorization of viruses circulating in the Middle East belonging to distinct subgroups of serotypes O, A and Asia-1. These assays can also overcome the problem of serotyping samples which are found positive by the generic rRT-PCR diagnostic assays but negative by virus isolation and antigen-detection ELISA which would otherwise have to be serotyped by nucleotide sequencing. A similar approach could be used to develop serotyping assays for FMDV strains circulating in other regions of the world. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Real Time RT-PCR with a Newly Designed Set of Promers Confirmed the Presence of 2b and 2x/d Myosim Heavy Chain mRNAs in the Rat Slow Soleus Muscle

    Czech Academy of Sciences Publication Activity Database

    Žurmanová, Jitka; Půta, F.; Stopková, R.; Soukup, Tomáš

    2008-01-01

    Roč. 57, č. 6 (2008), s. 973-978 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LC554; GA ČR(CZ) GA305/06/1115; GA ČR(CZ) GA304/08/0256 Grant - others:EC(XE) LSH-CT-2004-511978 Institutional research plan: CEZ:AV0Z50110509 Keywords : rat slow soleus muscle * myosin heavy chain isoforms * real time RT-PCR Subject RIV: ED - Physiology Impact factor: 1.653, year: 2008

  19. Analysis of gene expression in small numbers of purified hemopoietic progenitor cells by RT-PCR.

    Science.gov (United States)

    Ziegler, B L; Lamping, C P; Thoma, S J; Fliedner, T M

    1995-05-01

    Primitive hemopoietic stem cells represent the most probable targets for genetic alterations due to exposure to ionizing irradiation or chemical carcinogens. We have applied a two-step protocol for the purification of CD34+HLA-DR-/low hemopoietic progenitor cells from cord blood (CB). CD34+ cells were isolated by monoclonal antibody (mAb) against CD34 (My10) and immunomagnetic beads. Beads were cleaved off the CD34+ cells by enzymatic treatment with chymopapain. Due to chymopapain-resistance of epitopes recognized by the used mAbs purity control of CD34+ cells and separation into CD34+HLA-DR-/low and CD34+HLA-DR+ subsets could be performed by using flow cytometry. Two miniaturized procedures were applied to isolate poly(A)+ mRNA for the reverse transcription polymerase chain reaction (RT-PCR) from small numbers of CD34+HLA-DR-/low cells. In five experiments, the mean purity of immunomagnetically isolated CD34+ cells was 93.8% +/- 3.9. Flow cytometry sorting of CD34+ cells resulted in pure CD34+HLA-DR-/low populations (purity > 98.8%; range 98.8% to 99.9%; viability > 96%) with an average yield of 2600 +/- 800 cells/5 x 10(7) low density CB cells. By RT-PCR using both poly(A)+ mRNA isolation procedures, sequences corresponding to CD34 and beta 2-microglobulin were amplified from as few as 20 cells. Furthermore, a sequence-independent RT-PCR (SIP-RT-PCR) was applied to amplify the cDNA derived from five erythroblasts isolated from a burst-forming unit-erythroid (BFU-E). Upon hybridization, full-length c-fos message was detected in the SIP-RT-PCR amplified material. Our data demonstrate that gene expression can be detected at the transcriptional level in small numbers of hemopoietic progenitor cells. In addition, the SIP-RT-PCR may allow the amplification of unique mRNA species when subtractive hybridization procedures are performed. The presented data should be useful to analyze gene expression in rare subsets of radiation-exposed immature hemopoietic stem

  20. Selection of reference genes for normalisation of real-time RT-PCR in brain-stem death injury in Ovis aries

    Directory of Open Access Journals (Sweden)

    Fraser John F

    2009-07-01

    Full Text Available Abstract Background Heart and lung transplantation is frequently the only therapeutic option for patients with end stage cardio respiratory disease. Organ donation post brain stem death (BSD is a pre-requisite, yet BSD itself causes such severe damage that many organs offered for donation are unusable, with lung being the organ most affected by BSD. In Australia and New Zealand, less than 50% of lungs offered for donation post BSD are suitable for transplantation, as compared with over 90% of kidneys, resulting in patients dying for lack of suitable lungs. Our group has developed a novel 24 h sheep BSD model to mimic the physiological milieu of the typical human organ donor. Characterisation of the gene expression changes associated with BSD is critical and will assist in determining the aetiology of lung damage post BSD. Real-time PCR is a highly sensitive method involving multiple steps from extraction to processing RNA so the choice of housekeeping genes is important in obtaining reliable results. Little information however, is available on the expression stability of reference genes in the sheep pulmonary artery and lung. We aimed to establish a set of stably expressed reference genes for use as a standard for analysis of gene expression changes in BSD. Results We evaluated the expression stability of 6 candidate normalisation genes (ACTB, GAPDH, HGPRT, PGK1, PPIA and RPLP0 using real time quantitative PCR. There was a wide range of Ct-values within each tissue for pulmonary artery (15–24 and lung (16–25 but the expression pattern for each gene was similar across the two tissues. After geNorm analysis, ACTB and PPIA were shown to be the most stably expressed in the pulmonary artery and ACTB and PGK1 in the lung tissue of BSD sheep. Conclusion Accurate normalisation is critical in obtaining reliable and reproducible results in gene expression studies. This study demonstrates tissue associated variability in the selection of these

  1. Validation of a norovirus multiplex real-time RT-PCR assay for the detection of norovirus GI and GII from faeces samples.

    LENUS (Irish Health Repository)

    Jones, S

    2011-01-01

    Norovirus is a leading cause of infectious non-bacterial gastroenteritis. The virus is highly contagious and has multiple modes of transmission, presenting a growing challenge to hospital-based healthcare. In this study, a total of 120 stool samples are tested for the presence of norovirus GI and GII by the Roche two-step Lightcycler 2.0 assay incorporating primers and probes produced by TIB Molbiol, and the results are compared with results from the National Virus Reference Laboratory. The Roche\\/TIB Molbiol assay produced 51 positive results and 69 negative results. Discrepancy analysis was performed for six conflicting results using a second real-time polymerase chain reaction (PCR) assay (Roche\\/TIB Molbiol) and this confirmed that four of the five discrepant positive results were true positives. A single discrepant negative result generated by the Roche assay remained negative using the second assay. Sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) were calculated to be 98%, 98.6%, 98.0% and 98.6%, respectively. Melting curve analysis was used to differentiate genogroups I and II and this showed that 92% of strains belonged to genogroup II.

  2. One-step multiplex real-time RT-PCR assay for detecting and genotyping wild-type group A rotavirus strains and vaccine strains (Rotarix® and RotaTeq®) in stool samples

    Science.gov (United States)

    Mijatovic-Rustempasic, Slavica; Esona, Mathew D.; Tam, Ka Ian; Quaye, Osbourne; Bowen, Michael D.

    2016-01-01

    Background. Group A rotavirus (RVA) infection is the major cause of acute gastroenteritis (AGE) in young children worldwide. Introduction of two live-attenuated rotavirus vaccines, RotaTeq® and Rotarix®, has dramatically reduced RVA associated AGE and mortality in developed as well as in many developing countries. High-throughput methods are needed to genotype rotavirus wild-type strains and to identify vaccine strains in stool samples. Quantitative RT-PCR assays (qRT-PCR) offer several advantages including increased sensitivity, higher throughput, and faster turnaround time. Methods. In this study, a one-step multiplex qRT-PCR assay was developed to detect and genotype wild-type strains and vaccine (Rotarix® and RotaTeq®) rotavirus strains along with an internal processing control (Xeno or MS2 RNA). Real-time RT-PCR assays were designed for VP7 (G1, G2, G3, G4, G9, G12) and VP4 (P[4], P[6] and P[8]) genotypes. The multiplex qRT-PCR assay also included previously published NSP3 qRT-PCR for rotavirus detection and Rotarix® NSP2 and RotaTeq® VP6 qRT-PCRs for detection of Rotarix® and RotaTeq® vaccine strains respectively. The multiplex qRT-PCR assay was validated using 853 sequence confirmed stool samples and 24 lab cultured strains of different rotavirus genotypes. By using thermostable rTth polymerase enzyme, dsRNA denaturation, reverse transcription (RT) and amplification (PCR) steps were performed in single tube by uninterrupted thermocycling profile to reduce chances of sample cross contamination and for rapid generation of results. For quantification, standard curves were generated using dsRNA transcripts derived from RVA gene segments. Results. The VP7 qRT-PCRs exhibited 98.8–100% sensitivity, 99.7–100% specificity, 85–95% efficiency and a limit of detection of 4–60 copies per singleplex reaction. The VP7 qRT-PCRs exhibited 81–92% efficiency and limit of detection of 150–600 copies in multiplex reactions. The VP4 qRT-PCRs exhibited 98.8

  3. Real time spectrum analysis

    International Nuclear Information System (INIS)

    Blunden, A.; O'Prey, D.G.; Tait, W.H.

    1983-01-01

    A method is described for the separation of a composite pulse-height spectrum into its unresolved component parts, which belong to a set of measured library spectra. The method allows real-time estimation giving running estimates during acquisition of the spectrum, minimises computation space, especially for a number of parallel calculations, estimates in advance the rms errors, and produces a significance measure for the hypothesis that the composite contains only the library spectra. Least squares curve-fitting, and other methods, can be compared, with the formalism developed, allowing analytical comparison of the effect of detector energy resolution and detection efficiency. A rational basis for the choice between the various methods of spectrum analysis follows from the theory, minimising rms estimation errors. The method described is applicable for very low numbers of counts and poor resolution. (orig.)

  4. A community resource for high-throughput quantitative RT-PCR analysis of transcription factor gene expression in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Redman Julia C

    2008-07-01

    Full Text Available Abstract Background Medicago truncatula is a model legume species that is currently the focus of an international genome sequencing effort. Although several different oligonucleotide and cDNA arrays have been produced for genome-wide transcript analysis of this species, intrinsic limitations in the sensitivity of hybridization-based technologies mean that transcripts of genes expressed at low-levels cannot be measured accurately with these tools. Amongst such genes are many encoding transcription factors (TFs, which are arguably the most important class of regulatory proteins. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR is the most sensitive method currently available for transcript quantification, and one that can be scaled up to analyze transcripts of thousands of genes in parallel. Thus, qRT-PCR is an ideal method to tackle the problem of TF transcript quantification in Medicago and other plants. Results We established a bioinformatics pipeline to identify putative TF genes in Medicago truncatula and to design gene-specific oligonucleotide primers for qRT-PCR analysis of TF transcripts. We validated the efficacy and gene-specificity of over 1000 TF primer pairs and utilized these to identify sets of organ-enhanced TF genes that may play important roles in organ development or differentiation in this species. This community resource will be developed further as more genome sequence becomes available, with the ultimate goal of producing validated, gene-specific primers for all Medicago TF genes. Conclusion High-throughput qRT-PCR using a 384-well plate format enables rapid, flexible, and sensitive quantification of all predicted Medicago transcription factor mRNAs. This resource has been utilized recently by several groups in Europe, Australia, and the USA, and we expect that it will become the 'gold-standard' for TF transcript profiling in Medicago truncatula.

  5. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data

    Directory of Open Access Journals (Sweden)

    Alves-Ferreira Marcio

    2010-03-01

    Full Text Available Abstract Background Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR. Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. Results By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1α5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhβTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. Conclusion We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references

  6. Identification and evaluation of new reference genes in Gossypium hirsutum for accurate normalization of real-time quantitative RT-PCR data.

    Science.gov (United States)

    Artico, Sinara; Nardeli, Sarah M; Brilhante, Osmundo; Grossi-de-Sa, Maria Fátima; Alves-Ferreira, Marcio

    2010-03-21

    Normalizing through reference genes, or housekeeping genes, can make more accurate and reliable results from reverse transcription real-time quantitative polymerase chain reaction (qPCR). Recent studies have shown that no single housekeeping gene is universal for all experiments. Thus, suitable reference genes should be the first step of any qPCR analysis. Only a few studies on the identification of housekeeping gene have been carried on plants. Therefore qPCR studies on important crops such as cotton has been hampered by the lack of suitable reference genes. By the use of two distinct algorithms, implemented by geNorm and NormFinder, we have assessed the gene expression of nine candidate reference genes in cotton: GhACT4, GhEF1alpha5, GhFBX6, GhPP2A1, GhMZA, GhPTB, GhGAPC2, GhbetaTUB3 and GhUBQ14. The candidate reference genes were evaluated in 23 experimental samples consisting of six distinct plant organs, eight stages of flower development, four stages of fruit development and in flower verticils. The expression of GhPP2A1 and GhUBQ14 genes were the most stable across all samples and also when distinct plants organs are examined. GhACT4 and GhUBQ14 present more stable expression during flower development, GhACT4 and GhFBX6 in the floral verticils and GhMZA and GhPTB during fruit development. Our analysis provided the most suitable combination of reference genes for each experimental set tested as internal control for reliable qPCR data normalization. In addition, to illustrate the use of cotton reference genes we checked the expression of two cotton MADS-box genes in distinct plant and floral organs and also during flower development. We have tested the expression stabilities of nine candidate genes in a set of 23 tissue samples from cotton plants divided into five different experimental sets. As a result of this evaluation, we recommend the use of GhUBQ14 and GhPP2A1 housekeeping genes as superior references for normalization of gene expression measures in

  7. Real-time RT-PCR systems for CTC detection from blood samples of breast cancer and gynaecological tumour patients (Review).

    Science.gov (United States)

    Andergassen, Ulrich; Kölbl, Alexandra C; Mahner, Sven; Jeschke, Udo

    2016-04-01

    Cells, which detach from a primary epithelial tumour and migrate through lymphatic vessels and blood stream are called 'circulating tumour cells'. These cells are considered to be the main root of remote metastasis and are correlated to a worse prognosis concerning progression-free and overall survival of the patients. Therefore, the detection of the minimal residual disease is of great importance regarding therapeutic decisions. Many different detection strategies are already available, but only one method, the CellSearch® system, reached FDA approval. The present review focusses on the detection of circulating tumour cells by means of real-time PCR, a highly sensitive method based on differences in gene expression between normal and malignant cells. Strategies for an enrichment of tumour cells are mentioned, as well as a large panel of potential marker genes. Drawbacks and advantages of the technique are elucidated, whereas, the greatest advantage might be, that by selection of appropriate marker genes, also tumour cells, which have already undergone epithelial to mesenchymal transition can be detected. Finally, the application of real-time PCR in different gynaecological malignancies is described, with breast cancer being the most studied cancer entity.

  8. Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

    Science.gov (United States)

    Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

    2005-01-01

    Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific

  9. Evaluation of the Xpert Flu test and comparison with in-house real-time RT-PCR assays for detection of influenza virus from 2008 to 2011 in Marseille, France.

    Science.gov (United States)

    Salez, N; Ninove, L; Thirion, L; Gazin, C; Zandotti, C; de Lamballerie, X; Charrel, R N

    2012-04-01

    Rapid documentation of respiratory specimens can have an impact on the management of patients and their relatives in terms of preventive and curative measures. We compared the results of the Xpert(®) Flu assay (Cepheid) with three real-time RT-PCR assays using 127 nasopharyngeal samples, of which 75 were positive for influenza A (with 52 identified as A/H1N1-2009) and 52 were positive for influenza B. The Xpert(®) Flu assay presented a quasi-absence of non-interpretable tests, and showed sensitivity and specificity of 100% and 100% for Flu A, 98.4% and 100% for A/H1N1-2009, and 80.7% and 100% for Flu B. © 2012 The Authors. Clinical Microbiology and Infection © 2012 European Society of Clinical Microbiology and Infectious Diseases.

  10. [Validation of a real time RT-PCR assay to detect foot-and-mouth disease virus and assessment of its performance in acute infection].

    Science.gov (United States)

    Fondevila, Norberto; Compaired, Diego; Maradei, Eduardo; Duffy, Sergio

    2014-01-01

    A specific real time reverse transcription polymerase chain reaction (RT-PCRrt) for the detection of foot-and-mouth disease virus was validated using the LightCycler thermocycler 2.0 and its reagents as recommended by the World Organization for Animal Health and was assessed for the detection of the virus in acute infection of cattle experimentally vaccinated and challenged with virus A Argentina/2001 or A24 Cruzeiro. The technique proved to be robust, showing coefficients of variation lower than 4% for different ARN extractions, days or repetitions and was able to detect up to 0,4 TCID 50%, and/or up to 100 RNA molecules. In probang samples, diagnostic sensitivity was 93.1 (95% CI 86.5-96.6) and diagnostic specificity 100 (95% CI 96.3-100). The results of the challenge in vaccinated or multivaccinated bovines showed that although there were high levels of clinical protection in the vaccinated group, FMDV could be detected in all challenged groups. However, detection was 100 times lower in immunized animals. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

  11. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Directory of Open Access Journals (Sweden)

    Shiyin Zhang

    Full Text Available The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD, which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71 and coxsackie A16 (CA16 are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  12. A one-step, triplex, real-time RT-PCR assay for the simultaneous detection of enterovirus 71, coxsackie A16 and pan-enterovirus in a single tube.

    Science.gov (United States)

    Zhang, Shiyin; Wang, Jin; Yan, Qiang; He, Shuizhen; Zhou, Wenbin; Ge, Shengxiang; Xia, Ningshao

    2014-01-01

    The recent, ongoing epidemic of hand, foot, and mouth disease (HFMD), which is caused by enterovirus infection, has affected millions of children and resulted in thousands of deaths in China. Enterovirus 71 (EV71) and coxsackie A16 (CA16) are the two major distinct pathogens for HFMD. However, EV71 is more commonly associated with neurologic complications and even fatalities. Therefore, simultaneously detecting and differentiating EV71 and CA16 specifically from other enteroviruses for diagnosing HFMD is important. Here, we developed a one-step, triplex, real-time RT-PCR assay for the simultaneous detection of EV71, CA16, and pan-enterovirus (EVs) in a single tube with an internal amplification control. The detection results for the serially diluted viruses indicate that the lower limit of detection for this assay is 0.001-0.04 TCID50/ml, 0.02 TCID50/ml, and 0.001 TCID50/ml for EVs, EV71, and CA16, respectively. After evaluating known HFMD virus stocks of 17 strains of 16 different serotypes, this assay showed a favorable detection spectrum and no obvious cross-reactivity. The results for 141 clinical throat swabs from HFMD-suspected patients demonstrated sensitivities of 98.4%, 98.7%, and 100% for EVs, EV71, and CA16, respectively, and 100% specificity for each virus. The application of this one-step, triplex, real-time RT-PCR assay in clinical units will contribute to HFMD surveillance and help to identify causative pathogen in patients with suspected HFMD.

  13. Accuracy of rapid influenza diagnostic test and immunofluorescence assay compared to real time RT-PCR in children with influenza A(H1N1pdm09 infection 

    Directory of Open Access Journals (Sweden)

    Aneta Nitsch-Osuch

    2012-10-01

    Full Text Available  Introduction:The influenza burden among children is underestimated. The aim of our study was to estimate the accuracy of the rapid influenza detection test (RIDT BD Directigen™ EZ Flu A B® and direct immunofluorescence assay (DFA used among children with influenza-like illness (ILI consulted in the ambulatory care clinic.Material/Methods:A total of 150 patients were enrolled in the study. Inclusion criteria were: age less than 59 months, presentation of ILI according to the CDC (Centers for Disease Control and Prevention definition (fever >37.8°C, cough and/or sore throat in the absence of another known cause of illness, duration of symptoms shorter than 96 hours. Two nasal swabs and one pharyngeal swab were obtained from patients and tested by RIDT, DFA and real time RT-PCR as the reference method.Results:For influenza A (H1N1pdm09 virus sensitivity of RIDT was 62.2�0(95�0CI 46.5–76.2� specificity 97.1�0(95�0CI 91.8–99.4� PPV 90.3�0(95�0CI 74.3–98� NPV 85.7�0(95�0CI 78.1–91.5� for DFA sensitivity was 60�0(95�0CI 51.9–63.2� specificity 96�0(95�0CI 88.7–98.8� PPV 93.1�0(95�0CI 80.5–98� NPV 72.7�0(95�0CI 67.2–74.9� Analysis of logistic regression revealed that the chance of receiving a true positive result of RIDT was twice as high when the test was conducted during the first 48 hours of symptoms (OR 0.40 vs OR 0.22.Conclusions:The accuracy of RIDT is comparable with DFA and both methods are very specific but moderately sensitive in diagnosis of influenza in young children. Both methods may be recommended for screening for influenza among children.

  14. RT-PCR analysis of dystrophin mRNA in DND/BMD patients

    Energy Technology Data Exchange (ETDEWEB)

    Ciafaloni, E.; Silva, H.A.R. de; Roses, A.D. [Duke Univ. Medical Center, Durham, NC (United States)

    1994-09-01

    Duchenne and Becker muscular dystrophies (DMD, BMD) are X-linked recessive disorders caused by mutations in the dystrophin (dys) gene. The majority of these mutations are intragenic deletions of duplications routinely detected by Southern biots and multiplex PCR. The remainder are very likely, smaller mutations, mostly point-mutations. Detection of these mutations is very difficult due to the size and complexity of the dys gene. We applied RT-PCR to analyse the entire dys mRNA of three DMD patients with no detectable genomic defect. In two unrelated patients, a duplication of the 62 bp exon 2 was identified. This causes a frameshift sufficient to explain the DMD phenotype. In the third patient, who had congenital DMD and severe mental retardation, a complex pattern of aberrant splicing at the 3-prime exons 67-79 was observed. Sural nerve biopsy in this patient showed the complete absence of Dp116. PCR-SSCP studies are presently in progress to identify the mutations responsible for the aberrant splicing patterns.

  15. Identification of suitable reference genes for gene expression normalization in qRT-PCR analysis in watermelon.

    Directory of Open Access Journals (Sweden)

    Qiusheng Kong

    Full Text Available Watermelon is one of the major Cucurbitaceae crops and the recent availability of genome sequence greatly facilitates the fundamental researches on it. Quantitative real-time reverse transcriptase PCR (qRT-PCR is the preferred method for gene expression analyses, and using validated reference genes for normalization is crucial to ensure the accuracy of this method. However, a systematic validation of reference genes has not been conducted on watermelon. In this study, transcripts of 15 candidate reference genes were quantified in watermelon using qRT-PCR, and the stability of these genes was compared using geNorm and NormFinder. geNorm identified ClTUA and ClACT, ClEF1α and ClACT, and ClCAC and ClTUA as the best pairs of reference genes in watermelon organs and tissues under normal growth conditions, abiotic stress, and biotic stress, respectively. NormFinder identified ClYLS8, ClUBCP, and ClCAC as the best single reference genes under the above experimental conditions, respectively. ClYLS8 and ClPP2A were identified as the best reference genes across all samples. Two to nine reference genes were required for more reliable normalization depending on the experimental conditions. The widely used watermelon reference gene 18SrRNA was less stable than the other reference genes under the experimental conditions. Catalase family genes were identified in watermelon genome, and used to validate the reliability of the identified reference genes. ClCAT1and ClCAT2 were induced and upregulated in the first 24 h, whereas ClCAT3 was downregulated in the leaves under low temperature stress. However, the expression levels of these genes were significantly overestimated and misinterpreted when 18SrRNA was used as a reference gene. These results provide a good starting point for reference gene selection in qRT-PCR analyses involving watermelon.

  16. Proteomic analysis and qRT-PCR verification of temperature response to Arthrospira (Spirulina platensis.

    Directory of Open Access Journals (Sweden)

    Wang Huili

    Full Text Available Arthrospira (Spirulina platensis (ASP is a representative filamentous, non-N2-fixing cyanobacterium that has great potential to enhance the food supply and possesses several valuable physiological features. ASP tolerates high and low temperatures along with highly alkaline and salty environments, and can strongly resist oxidation and irradiation. Based on genomic sequencing of ASP, we compared the protein expression profiles of this organism under different temperature conditions (15°C, 35°Cand 45°C using 2-DE and peptide mass fingerprinting techniques. A total of 122 proteins having a significant differential expression response to temperature were retrieved. Of the positively expressed proteins, the homologies of 116 ASP proteins were found in Arthrospira (81 proteins in Arthrospira platensis str. Paraca and 35 in Arthrospira maxima CS-328. The other 6 proteins have high homology with other microorganisms. We classified the 122 differentially expressed positive proteins into 14 functions using the COG database, and characterized their respective KEGG metabolism pathways. The results demonstrated that these differentially expressed proteins are mainly involved in post-translational modification (protein turnover, chaperones, energy metabolism (photosynthesis, respiratory electron transport, translation (ribosomal structure and biogenesis and carbohydrate transport and metabolism. Others proteins were related to amino acid transport and metabolism, cell envelope biogenesis, coenzyme metabolism and signal transduction mechanisms. Results implied that these proteins can perform predictable roles in rendering ASP resistance against low and high temperatures. Subsequently, we determined the transcription level of 38 genes in vivo in response to temperature and identified them by qRT-PCR. We found that the 26 differentially expressed proteins, representing 68.4% of the total target genes, maintained consistency between transcription and

  17. Comparative evaluation of the CerTest VIASURE flu A, B & RSV real time RT-PCR detection kit on the BD MAX system versus a routine in-house assay for detection of influenza A and B virus during the 2016/17 influenza season

    DEFF Research Database (Denmark)

    Sydenham, Thomas Vognbjerg; Bek-Thomsen, Malene; Andersen, Signe Dalsgaard

    2018-01-01

    laboratory technician "hands on" time but also the laboratory turnaround time is of interest. OBJECTIVES: We evaluated the performance of the VIASURE Flu A, B & RSV Real Time RT-PCR Detection Kit (CerTest Biotec) for detecting Influenza A and B viruses. STUDY DESIGN: During the 2016/17 influenza season 532...

  18. Circadian transitions in radiation dose-dependent augmentation of mRNA levels for DNA damage-induced genes elicited by accurate real-time RT-PCR quantification

    International Nuclear Information System (INIS)

    Ishihara, Hiroshi; Tanaka, Izumi; Yakumaru, Haruko

    2010-01-01

    Molecular mechanisms of intracellular response after DNA-damage by exposure to ionizing radiation have been studied. In the case of cells isolated from living body of human and experimental animals, alteration of the responsiveness by physiological oscillation such as circadian rhythm must be considered. To examine the circadian variation in the response of p53-responsible genes p21, mdm2, bax, and puma, we established a method to quantitate their mRNA levels with high reproducibility and accuracy based on real-time reverse transcription polymerase chain reaction (RT-PCR) and compared the levels of responsiveness in mouse hemocytes after diurnal irradiation to that after nocturnal irradiation. Augmentations of p21 and mdm2 mRNA levels with growth-arrest and of puma mRNA before apoptosis were confirmed by time-course experiment in RAW264.7, and dose-dependent increases in the peak levels of all the RNA were shown. Similarly, the relative RNA levels of p21, mdm2, bax, and puma per glyceraldehyde-3-phosphate dehydrogenase (GAPDH) also increased dose-dependently in peripheral blood and bone marrow cells isolated from whole-body-irradiated mice. Induction levels of all messages reduced by half after nighttime irradiation as compared with daytime irradiation in blood cells. In marrow cells, nighttime irradiation enhanced the p21 and mdm2 mRNA levels than daytime irradiation. No significant difference in bax or puma mRNA levels was observed between nighttime and daytime irradiation in marrow cells. This suggests that early-stage cellular responsiveness in DNA damage-induced genes is modulated between diurnal and nocturnal irradiation. (author)

  19. RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs.

    Science.gov (United States)

    Romanutti, Carina; Gallo Calderón, Marina; Keller, Leticia; Mattion, Nora; La Torre, José

    2016-02-01

    During 2007-2014, 84 out of 236 (35.6%) samples from domestic dogs submitted to our laboratory for diagnostic purposes were positive for Canine Distemper Virus (CDV), as analyzed by RT-PCR amplification of a fragment of the nucleoprotein gene. Fifty-nine of them (70.2%) were from dogs that had been vaccinated against CDV. The full-length gene encoding the Fusion (F) protein of fifteen isolates was sequenced and compared with that of those of other CDVs, including wild-type and vaccine strains. Phylogenetic analysis using the F gene full-length sequences grouped all the Argentinean CDV strains in the SA2 clade. Sequence identity with the Onderstepoort vaccine strain was 89.0-90.6%, and the highest divergence was found in the 135 amino acids corresponding to the F protein signal-peptide, Fsp (64.4-66.7% identity). In contrast, this region was highly conserved among the local strains (94.1-100% identity). One extra putative N-glycosylation site was identified in the F gene of CDV Argentinean strains with respect to the vaccine strain. The present report is the first to analyze full-length F protein sequences of CDV strains circulating in Argentina, and contributes to the knowledge of molecular epidemiology of CDV, which may help in understanding future disease outbreaks. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Monitoring and improving the sensitivity of dengue nested RT-PCR used in longitudinal surveillance in Thailand.

    Science.gov (United States)

    Klungthong, Chonticha; Manasatienkij, Wudtichai; Phonpakobsin, Thipwipha; Chinnawirotpisan, Piyawan; Rodpradit, Prinyada; Hussem, Kittinun; Thaisomboonsuk, Butsaya; Ong-ajchaowlerd, Prapapun; Nisalak, Ananda; Kalayanarooj, Siripen; Buddhari, Darunee; Gibbons, Robert V; Jarman, Richard G; Yoon, In-Kyu; Fernandez, Stefan

    2015-02-01

    AFRIMS longitudinal dengue surveillance in Thailand depends on the nested RT-PCR and the dengue IgM/IgG ELISA. To examine and improve the sensitivity of the nested RT-PCR using a panel of archived samples collected during dengue surveillance. A retrospective analysis of 16,454 dengue IgM/IgG ELISA positive cases collected between 2000 and 2013 was done to investigate the sensitivity of the nested RT-PCR. From these cases, 318 acute serum specimens or extracted RNA, previously found to be negative by the nested RT-PCR, were tested using TaqMan real-time RT-PCR (TaqMan rRT-PCR). To improve the sensitivity of nested RT-PCR, we designed a new primer based on nucleotide sequences from contemporary strains found to be positive by the TaqMan rRT-PCR. Sensitivity of the new nested PCR was calculated using a panel of 87 samples collected during 2011-2013. The percentage of dengue IgM/IgG ELISA positive cases that were negative by the nested RT-PCR varied from 17% to 42% for all serotypes depending on the year. Using TaqMan rRT-PCR, dengue RNA was detected in 194 (61%) of the 318 acute sera or extracted RNA previously found to be negative by the nested RT-PCR. The newly designed DENV-1 specific primer increased the sensitivity of DENV-1 detection by the nested RT-PCR from 48% to 88%, and of all 4 serotypes from 73% to 87%. These findings demonstrate the impact of genetic diversity and signal erosion on the sensitivity of PCR-based methods. Published by Elsevier B.V.

  1. Development of tailored real-time RT-PCR assays for the detection and differentiation of serotype O, A and Asia-1 foot-and-mouth disease virus lineages circulating in the Middle East

    DEFF Research Database (Denmark)

    Reid, Scott M.; Mioulet, Valerie; Knowles, Nick J.

    2014-01-01

    transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative...... by the generic rRT-PCR diagnostic assays but negative by virus isolation and antigen-detection ELISA which would otherwise have to be serotyped by nucleotide sequencing. A similar approach could be used to develop serotyping assays for FMDV strains circulating in other regions of the world....

  2. Exploring Valid Reference Genes for Quantitative Real-Time PCR Analysis in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study...

  3. Real time analysis under EDS

    International Nuclear Information System (INIS)

    Schneberk, D.

    1985-07-01

    This paper describes the analysis component of the Enrichment Diagnostic System (EDS) developed for the Atomic Vapor Laser Isotope Separation Program (AVLIS) at Lawrence Livermore National Laboratory (LLNL). Four different types of analysis are performed on data acquired through EDS: (1) absorption spectroscopy on laser-generated spectral lines, (2) mass spectrometer analysis, (3) general purpose waveform analysis, and (4) separation performance calculations. The information produced from this data includes: measures of particle density and velocity, partial pressures of residual gases, and overall measures of isotope enrichment. The analysis component supports a variety of real-time modeling tasks, a means for broadcasting data to other nodes, and a great degree of flexibility for tailoring computations to the exact needs of the process. A particular data base structure and program flow is common to all types of analysis. Key elements of the analysis component are: (1) a fast access data base which can configure all types of analysis, (2) a selected set of analysis routines, (3) a general purpose data manipulation and graphics package for the results of real time analysis. Each of these components are described with an emphasis upon how each contributes to overall system capability. 3 figs

  4. Metabolic regulation analysis of an ethanologenic Escherichia coli strain based on RT-PCR and enzymatic activities

    Directory of Open Access Journals (Sweden)

    Martinez Alfredo

    2008-05-01

    Full Text Available Abstract Background A metabolic regulation study was performed, based upon measurements of enzymatic activities, fermentation performance, and RT-PCR analysis of pathways related to central carbon metabolism, in an ethanologenic Escherichia coli strain (CCE14 derived from lineage C. In comparison with previous engineered strains, this E coli derivative has a higher ethanol production rate in mineral medium, as a result of the elevated heterologous expression of the chromosomally integrated genes encoding PDCZm and ADHZm (pyruvate decarboxylase and alcohol dehydrogenase from Zymomonas mobilis. It is suggested that this behavior might be due to lineage differences between E. coli W and C. Results This study demonstrated that the glycolytic flux is controlled, in this case, by reactions outside glycolysis, i.e., the fermentative pathways. Changes in ethanol production rate in this ethanologenic strain result in low organic acid production rates, and high glycolytic and ethanologenic fluxes, that correlate with enhanced transcription and enzymatic activity levels of PDCZm and ADHZm. Furthermore, a higher ethanol yield (90% of the theoretical in glucose-mineral media was obtained with CCE14 in comparison with previous engineered E. coli strains, such as KO11, that produces a 70% yield under the same conditions. Conclusion Results suggest that a higher ethanol formation rate, caused by ahigher PDCZm and ADHZm activities induces a metabolic state that cells compensate through enhanced glucose transport, ATP synthesis, and NAD-NADH+H turnover rates. These results show that glycolytic enzymatic activities, present in E. coli W and C under fermentative conditions, are sufficient to contend with increases in glucose consumption and product formation rates.

  5. Field evaluation of an open and polyvalent universal HIV-1/SIVcpz/SIVgor quantitative RT-PCR assay for HIV-1 viral load monitoring in comparison to Abbott RealTime HIV-1 in Cameroon.

    Science.gov (United States)

    Guichet, Emilande; Aghokeng, Avelin; Eymard-Duvernay, Sabrina; Vidal, Nicole; Ayouba, Ahidjo; Mpoudi Ngole, Eitel; Delaporte, Eric; Ciaffi, Laura; Peeters, Martine

    2016-11-01

    With the increasing demand of HIV viral load (VL) tests in resource-limited countries (RLCs) there is a need for assays at affordable cost and able to quantify all known HIV-1 variants. VLs obtained with a recently developed open and polyvalent universal HIV-1/SIVcpz/SIVgor RT-qPCR were compared to Abbott RealTime HIV-1 assay in Cameroon. On 474 plasma samples, characterized by a wide range of VLs and a broad HIV-1 group M genetic diversity, 97.5% concordance was observed when using the lower detection limit of each assay. When using the threshold of 3.00 log 10 copies/mL, according to WHO guidelines to define virological failure (VF) in RLCs, the concordance was 94.7%, 360/474 versus 339/474 patients were identified with VF with the new assay and Abbott RealTime HIV-1, respectively. Higher VLs were measured with the new assay, +0.47 log 10 copies/mL (95% CI; 0.42-0.52) as shown with Bland-Altman analysis. Eleven samples from patients on VF with drug resistance were not detected by Abbott RealTime HIV-1 versus two only with the new assay. Overall, our study showed that the new assay can be easily implemented in a laboratory in RLCs with VL experience and showed good performance on a wide diversity of HIV-1 group M variants. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1 ...

    Indian Academy of Sciences (India)

    Department of Molecular Oncology, Cancer Institute (WIA) 38, Sardar Patel Road, Chennai 600 036, India; Department of Biotechnology, Dr M. G. R. Educational and Research Institute, Dr M. G. R. University, Maduravoyal, Chennai 600 095, India; Department of Hemato Immunology, Cancer Institute (WIA) 38, Sardar Patel ...

  7. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  8. RT-PCR and real-time PCR analysis of E2A-PBX1, TEL-AML1 ...

    Indian Academy of Sciences (India)

    2011-08-19

    Aug 19, 2011 ... group of 1–25 years (50 pediatric and 14 young adults). Diagnosis of ... 3% agarose gel to visualize the amplified products of fusion gene transcripts. .... translocation in 13.4% (177/1321, range 9–23%) of child- hood ALL in Far ... to apoptosis, growth factor interactions and alters cell–cell and cell–matrix ...

  9. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Directory of Open Access Journals (Sweden)

    Alok Arun

    Full Text Available Real-time quantitative reverse transcription PCR (qRT-PCR is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae, two developmental stages (pupal and adult and two sexes (male and female, all of which were subjected to two food treatments (food stress and control feeding ad libitum. The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the

  10. Selection and validation of reference genes for qRT-PCR expression analysis of candidate genes involved in olfactory communication in the butterfly Bicyclus anynana.

    Science.gov (United States)

    Arun, Alok; Baumlé, Véronique; Amelot, Gaël; Nieberding, Caroline M

    2015-01-01

    Real-time quantitative reverse transcription PCR (qRT-PCR) is a technique widely used to quantify the transcriptional expression level of candidate genes. qRT-PCR requires the selection of one or several suitable reference genes, whose expression profiles remain stable across conditions, to normalize the qRT-PCR expression profiles of candidate genes. Although several butterfly species (Lepidoptera) have become important models in molecular evolutionary ecology, so far no study aimed at identifying reference genes for accurate data normalization for any butterfly is available. The African bush brown butterfly Bicyclus anynana has drawn considerable attention owing to its suitability as a model for evolutionary ecology, and we here provide a maiden extensive study to identify suitable reference gene in this species. We monitored the expression profile of twelve reference genes: eEF-1α, FK506, UBQL40, RpS8, RpS18, HSP, GAPDH, VATPase, ACT3, TBP, eIF2 and G6PD. We tested the stability of their expression profiles in three different tissues (wings, brains, antennae), two developmental stages (pupal and adult) and two sexes (male and female), all of which were subjected to two food treatments (food stress and control feeding ad libitum). The expression stability and ranking of twelve reference genes was assessed using two algorithm-based methods, NormFinder and geNorm. Both methods identified RpS8 as the best suitable reference gene for expression data normalization. We also showed that the use of two reference genes is sufficient to effectively normalize the qRT-PCR data under varying tissues and experimental conditions that we used in B. anynana. Finally, we tested the effect of choosing reference genes with different stability on the normalization of the transcript abundance of a candidate gene involved in olfactory communication in B. anynana, the Fatty Acyl Reductase 2, and we confirmed that using an unstable reference gene can drastically alter the expression

  11. Identification of Suitable Endogenous Normalizers for qRT- PCR Analysis of Plasma microRNA Expression in Essential Hypertension

    Science.gov (United States)

    Solayman, Mohamed Hassan M.; Langaee, Taimour; Patel, Archanakumari; El-Wakeel, Lamia; El-Hamamsy, Manal; Badary, Osama; Johnson, Julie A.

    2016-01-01

    Circulating microRNAs (miRNAs) are promising biomarkers for many diseases. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is a gold standard for miRNA expression profiling that requires proper data normalization. Since there is no universal normalizer, it is recommended to evaluate normalizers under every experimental condition. This study describes the identification of suitable endogenous normalizer(s) (ENs) for plasma miRNA expression in essential hypertension. Expression levels of 5 candidate ENs and 2 plasma quality markers were determined by qRT-PCR in plasma samples from 18 hypertensive patients and 10 healthy controls. NormFinder, GeNorm, and DataAssist software programs were used to select the best EN(s). Expression levels of the 5 candidate ENs were also analyzed in urine samples from hypertensive patients and compared to the plasma samples of the hypertensive patients. Among the analyzed candidates, hsa-miR-92a-3p was identified as the best EN, and hsa-miR-21-5p and hsa-miR-16-5p as next best. Moreover, hsa-miR-92a-3p showed the most consistent expression between plasma and urine In conclusion, this study showed that hsa-miR-92a-3p, hsa-miR-21-5p, and hsa-miR-16-5p may be used as normalizers for plasma miRNA expression data in essential hypertension studies. PMID:26798072

  12. Establishment and in-house validation of stem-loop RT PCR method for MicroRNA398 expression analysis

    Directory of Open Access Journals (Sweden)

    Timotijević Gordana S.

    2015-01-01

    Full Text Available MicroRNAs (miRNAs belong to the class of small non-coding RNAs which have important roles throughout development as well as in plant response to diverse environmental stresses. Some of plant miRNAs are essential for regulation and maintenance of nutritive homeostasis when nutrients are in excess or shortage comparing to optimal concentration for certain plant species. Better understanding of miRNAs functions implies development of efficient technology for profiling their gene expression. We set out to establish validate the methodology for miRNA gene expression analysis in cucumber grown under suboptimal mineral nutrient regimes, including iron deficiency. Reverse transcription by “stem-loop” primers in combination with Real time PCR method is one of potential approaches for quantification of miRNA gene expression. In this paper we presented a method for “stem loop” primer design specific for miR398, as well as reaction optimization and determination of Real time PCR efficiency. Proving the accuracy of this method was imperative as “stem loop” RT which consider separate transcription of target and endogenous control. The method was verified by comparison of the obtained data with results of miR398 expression achieved using a commercial kit based on simultaneous conversion of all RNAs in cDNAs. [Projekat Ministarstva nauke Republike Srbije, br. 173005 i br. ON-173028

  13. Selection of reference genes for quantitative RT-PCR (RT-qPCR) analysis of rat tissues under physiological and toxicological conditions

    DEFF Research Database (Denmark)

    Svingen, Terje; Letting, Heidi; Hadrup, Niels

    2015-01-01

    In biological research the analysis of gene expression levels in cells and tissues can be a powerful tool to gain insights into biological processes. For this, quantitative RT-PCR (RT-qPCR) is a popular method that often involve the use of constitutively expressed endogenous reference (or...... ‘housekeeping’) gene for normalization of data. Thus, it is essential to use reference genes that have been verified to be stably expressed within the specific experimental setting. Here, we have analysed the expression stability of 12 commonly used reference genes (Actb, B2m, Gapdh, Hprt, Pgk1, Rn18s, Rpl13a...

  14. Genome-Wide Identification and Evaluation of Reference Genes for Quantitative RT-PCR Analysis during Tomato Fruit Development.

    Science.gov (United States)

    Cheng, Yuan; Bian, Wuying; Pang, Xin; Yu, Jiahong; Ahammed, Golam J; Zhou, Guozhi; Wang, Rongqing; Ruan, Meiying; Li, Zhimiao; Ye, Qingjing; Yao, Zhuping; Yang, Yuejian; Wan, Hongjian

    2017-01-01

    Gene expression analysis in tomato fruit has drawn increasing attention nowadays. Quantitative real-time PCR (qPCR) is a routine technique for gene expression analysis. In qPCR operation, reliability of results largely depends on the choice of appropriate reference genes (RGs). Although tomato is a model for fruit biology study, few RGs for qPCR analysis in tomato fruit had yet been developed. In this study, we initially identified 38 most stably expressed genes based on tomato transcriptome data set, and their expression stabilities were further determined in a set of tomato fruit samples of four different fruit developmental stages (Immature, mature green, breaker, mature red) using qPCR analysis. Two statistical algorithms, geNorm and Normfinder, concordantly determined the superiority of these identified putative RGs. Notably, SlFRG05 (Solyc01g104170), SlFRG12 (Solyc04g009770), SlFRG16 (Solyc10g081190), SlFRG27 (Solyc06g007510), and SlFRG37 (Solyc11g005330) were proved to be suitable RGs for tomato fruit development study. Further analysis using geNorm indicate that the combined use of SlFRG03 (Solyc02g063070) and SlFRG27 would provide more reliable normalization results in qPCR experiments. The identified RGs in this study will be beneficial for future qPCR analysis of tomato fruit developmental study, as well as for the potential identification of optimal normalization controls in other plant species.

  15. Genome-Wide Identification and Evaluation of Reference Genes for Quantitative RT-PCR Analysis during Tomato Fruit Development

    Directory of Open Access Journals (Sweden)

    Yuan Cheng

    2017-08-01

    Full Text Available Gene expression analysis in tomato fruit has drawn increasing attention nowadays. Quantitative real-time PCR (qPCR is a routine technique for gene expression analysis. In qPCR operation, reliability of results largely depends on the choice of appropriate reference genes (RGs. Although tomato is a model for fruit biology study, few RGs for qPCR analysis in tomato fruit had yet been developed. In this study, we initially identified 38 most stably expressed genes based on tomato transcriptome data set, and their expression stabilities were further determined in a set of tomato fruit samples of four different fruit developmental stages (Immature, mature green, breaker, mature red using qPCR analysis. Two statistical algorithms, geNorm and Normfinder, concordantly determined the superiority of these identified putative RGs. Notably, SlFRG05 (Solyc01g104170, SlFRG12 (Solyc04g009770, SlFRG16 (Solyc10g081190, SlFRG27 (Solyc06g007510, and SlFRG37 (Solyc11g005330 were proved to be suitable RGs for tomato fruit development study. Further analysis using geNorm indicate that the combined use of SlFRG03 (Solyc02g063070 and SlFRG27 would provide more reliable normalization results in qPCR experiments. The identified RGs in this study will be beneficial for future qPCR analysis of tomato fruit developmental study, as well as for the potential identification of optimal normalization controls in other plant species.

  16. Evaluation of the suitability of six host genes as internal control in real-time RT-PCR assays in chicken embryo cell cultures infected with infectious bursal disease virus

    DEFF Research Database (Denmark)

    Li, Yiping; Bang, Dang Duong; Handberg, Kurt

    2005-01-01

    following a 7-day IBDV infection. The CE cells were inoculated with various multiplicity of infection (MOI) of IBDV vaccine strain Bursine-2, the expression of genes was measured by quantitative real-time PCR-based on cDNA synthesized from either normalized (100 ng) or non-normalized (10 mu l) total RNA...

  17. Reference Gene Selection for qRT-PCR Normalization Analysis in kenaf (Hibiscus cannabinus L. under Abiotic Stress and Hormonal Stimuli

    Directory of Open Access Journals (Sweden)

    Xiaoping Niu

    2017-05-01

    Full Text Available Kenaf (Hibiscus cannabinus L., an environmental friendly and economic fiber crop, has a certain tolerance to abiotic stresses. Identification of reliable reference genes for transcript normalization of stress responsive genes expression by quantitative real-time PCR (qRT-PCR is important for exploring the molecular mechanisms of plants response to abiotic stresses. In this study, nine candidate reference genes were cloned, and their expression stabilities were assessed in 132 abiotic stress and hormonal stimuli samples of kenaf using geNorm, NormFinder, and BestKeeper algorithms. Results revealed that HcPP2A (Protein phosphatase 2A and HcACT7 (Actin 7 were the optimum reference genes across all samples; HcUBC (Ubiquitin-conjugating enzyme like protein was the worst reference gene for transcript normalization. The reliability of the selected reference genes was further confirmed by evaluating the expression profile of HcWRKY28 gene at different stress durations. This work will benefit future studies on discovery of stress-tolerance genes and stress-signaling pathways in this important fiber crop.

  18. Pathway and network-based analysis of genome-wide association studies and RT-PCR validation in polycystic ovary syndrome.

    Science.gov (United States)

    Shen, Haoran; Liang, Zhou; Zheng, Saihua; Li, Xuelian

    2017-11-01

    The purpose of this study was to identify promising candidate genes and pathways in polycystic ovary syndrome (PCOS). Microarray dataset GSE345269 obtained from the Gene Expression Omnibus database includes 7 granulosa cell samples from PCOS patients, and 3 normal granulosa cell samples. Differentially expressed genes (DEGs) were screened between PCOS and normal samples. Pathway enrichment analysis was conducted for DEGs using ClueGO and CluePedia plugin of Cytoscape. A Reactome functional interaction (FI) network of the DEGs was built using ReactomeFIViz, and then network modules were extracted, followed by pathway enrichment analysis for the modules. Expression of DEGs in granulosa cell samples was measured using quantitative RT-PCR. A total of 674 DEGs were retained, which were significantly enriched with inflammation and immune-related pathways. Eight modules were extracted from the Reactome FI network. Pathway enrichment analysis revealed significant pathways of each module: module 0, Regulation of RhoA activity and Signaling by Rho GTPases pathways shared ARHGAP4 and ARHGAP9; module 2, GlycoProtein VI-mediated activation cascade pathway was enriched with RHOG; module 3, Thromboxane A2 receptor signaling, Chemokine signaling pathway, CXCR4-mediated signaling events pathways were enriched with LYN, the hub gene of module 3. Results of RT-PCR confirmed the finding of the bioinformatic analysis that ARHGAP4, ARHGAP9, RHOG and LYN were significantly upregulated in PCOS. RhoA-related pathways, GlycoProtein VI-mediated activation cascade pathway, ARHGAP4, ARHGAP9, RHOG and LYN may be involved in the pathogenesis of PCOS.

  19. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia

    DEFF Research Database (Denmark)

    Jamal, Syed M.; Belsham, Graham

    2015-01-01

    Asia,A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08)). In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 subline-agewere also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV....... Due to the heterogeneity of FMD viruses (FMDVs) in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysableprobe-based real time reverse transcription quantitative polymerase chain reaction (RTqPCR) assays were developed for specific detection...... and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnosticassays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of OPan...

  20. Development and evaluation of a real-time RT-PCR assay for the detection of Ebola virus (Zaire) during an Ebola outbreak in Guinea in 2014-2015.

    Science.gov (United States)

    Dedkov, V G; Magassouba, N' F; Safonova, M V; Deviatkin, A A; Dolgova, A S; Pyankov, O V; Sergeev, A A; Utkin, D V; Odinokov, G N; Safronov, V A; Agafonov, A P; Maleev, V V; Shipulin, G A

    2016-02-01

    In early February 2014, an outbreak of the Ebola virus disease caused by Zaire ebolavirus (EBOV) occurred in Guinea; cases were also recorded in other West African countries with a combined population of approximately 25 million. A rapid, sensitive and inexpensive method for detecting EBOV is needed to effectively control such outbreak. Here, we report a real-time reverse-transcription PCR assay for Z. ebolavirus detection used by the Specialized Anti-epidemic Team of the Russian Federation during the Ebola virus disease prevention mission in the Republic of Guinea. The analytical sensitivity of the assay is 5 × 10(2) viral particles per ml, and high specificity is demonstrated using representative sampling of viral, bacterial and human nucleic acids. This assay can be applied successfully for detecting the West African strains of Z. ebolavirus as well as on strains isolated in the Democratic Republic of the Congo in 2014. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Relative quantification of PIK3CA gene expression level in fine-needle aspiration biopsy thyroid specimens collected from patients with papillary thyroid carcinoma and non-toxic goitre by real-time RT-PCR

    Directory of Open Access Journals (Sweden)

    Wojciechowska-Durczyńska Katarzyna

    2010-08-01

    Full Text Available Abstract Background Recent studies have shown that the phosphatidylinositol 3-kinase (PI3K signaling pathway is important regulator of many cellular events, including apoptosis, proliferation and motility. PI3K pathway alterations (PIK3CA gene mutations and/or amplification have been observed in various human tumours. In the majority of diagnosed cases, mutations are localized in one of the three "hot spots" in the gene, responsible for coding catalytic subunit α of class I PI3K (PIK3CA. Mutations and amplification of PIK3CA gene are characteristic for thyroid cancer, as well. Methods The aim of our study was to examine a gene expression level of PIK3CA in fine-needle aspiration biopsy (FNAB thyroid specimens in two types of thyroid lesions, papillary thyroid carcinoma (PTC and non-toxic goitre (NTG. Following conventional cytological examination, 42 thyroid FNAB specimens, received from patients with PTC (n = 20 and NTG (n = 22, were quantitatively evaluated regarding PIK3CA expression level by real-time PCR in the ABI PRISM® 7500 Sequence Detection System. Results Significantly higher expression level (RQ of PIK3CA in PTC group has been noted in comparison with NTG group (p Conclusion These observations may suggest role of PIK3CA alterations in PTC carcinogenesis.

  2. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia.

    Science.gov (United States)

    Jamal, Syed M; Belsham, Graham J

    2015-01-01

    Rapid and accurate diagnosis of foot-and-mouth disease (FMD) and virus serotyping are of paramount importance for control of this disease in endemic areas where vaccination is practiced. Ideally this virus characterization should be achieved without the need for virus amplification in cell culture. Due to the heterogeneity of FMD viruses (FMDVs) in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysable probe-based real time reverse transcription quantitative polymerase chain reaction (RT-qPCR) assays were developed for specific detection and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnostic assays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of O-PanAsia, A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08)). In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 sublineage were also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV and detected the RNA from the target viruses with cycle threshold (CT) values comparable with those obtained with the serotype-independent pan-FMDV diagnostic assays. No cross-reactivity was observed in these assays between the heterotypic viruses circulating in the region. The assays reported here have higher diagnostic sensitivity (100% each for serotypes O and Asia-1, and 92% [95% CI = 81.4-100%] for serotype A positive samples) and specificity (100% each for serotypes O, A and Asia-1 positive samples) for the viruses currently circulating in West Eurasia compared to the serotyping assays reported earlier. Comparisons of the sequences of the primers and probes used in these assays and the corresponding regions of the circulating viruses provided explanations for the poor

  3. Development and Characterization of Probe-Based Real Time Quantitative RT-PCR Assays for Detection and Serotyping of Foot-And-Mouth Disease Viruses Circulating in West Eurasia.

    Directory of Open Access Journals (Sweden)

    Syed M Jamal

    Full Text Available Rapid and accurate diagnosis of foot-and-mouth disease (FMD and virus serotyping are of paramount importance for control of this disease in endemic areas where vaccination is practiced. Ideally this virus characterization should be achieved without the need for virus amplification in cell culture. Due to the heterogeneity of FMD viruses (FMDVs in different parts of the world, region specific diagnostic tests are required. In this study, hydrolysable probe-based real time reverse transcription quantitative polymerase chain reaction (RT-qPCR assays were developed for specific detection and serotyping of the FMDVs currently circulating in West Eurasia. These assays were evaluated, in parallel with pan-FMDV diagnostic assays and earlier serotype-specific assays, using field samples originating from Pakistan and Afghanistan containing FMD viruses belonging to different sublineages of O-PanAsia, A-Iran05 and Asia-1 (Group-II and Group-VII (Sindh-08. In addition, field samples from Iran and Bulgaria, containing FMDVs belonging to the O-PanAsiaANT-10 sublineage were also tested. Each of the three primer/probe sets was designed to be specific for just one of the serotypes O, A and Asia-1 of FMDV and detected the RNA from the target viruses with cycle threshold (CT values comparable with those obtained with the serotype-independent pan-FMDV diagnostic assays. No cross-reactivity was observed in these assays between the heterotypic viruses circulating in the region. The assays reported here have higher diagnostic sensitivity (100% each for serotypes O and Asia-1, and 92% [95% CI = 81.4-100%] for serotype A positive samples and specificity (100% each for serotypes O, A and Asia-1 positive samples for the viruses currently circulating in West Eurasia compared to the serotyping assays reported earlier. Comparisons of the sequences of the primers and probes used in these assays and the corresponding regions of the circulating viruses provided explanations for

  4. Development of single step RT-PCR for detection of Kyasanur forest disease virus from clinical samples

    Directory of Open Access Journals (Sweden)

    Gouri Chaubal

    2018-02-01

    Discussion and conclusion: The previously published sensitive real time RT-PCR assay requires higher cost in terms of reagents and machine setup and technical expertise has been the primary reason for development of this assay. A single step RT-PCR is relatively easy to perform and more cost effective than real time RT-PCR in smaller setups in the absence of Biosafety Level-3 facility. This study reports the development and optimization of single step RT-PCR assay which is more sensitive and less time-consuming than nested RT-PCR and cost effective for rapid diagnosis of KFD viral RNA.

  5. Failure analysis of real-time systems

    International Nuclear Information System (INIS)

    Jalashgar, A.; Stoelen, K.

    1998-01-01

    This paper highlights essential aspects of real-time software systems that are strongly related to the failures and their course of propagation. The significant influence of means-oriented and goal-oriented system views in the description, understanding and analysing of those aspects is elaborated. The importance of performing failure analysis prior to reliability analysis of real-time systems is equally addressed. Problems of software reliability growth models taking the properties of such systems into account are discussed. Finally, the paper presents a preliminary study of a goal-oriented approach to model the static and dynamic characteristics of real-time systems, so that the corresponding analysis can be based on a more descriptive and informative picture of failures, their effects and the possibility of their occurrence. (author)

  6. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism a...

  7. Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

    Science.gov (United States)

    Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

    2017-07-25

    Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

  8. APPLICATION OF CDNA MICROARRAY TECHNOLOGY TO IN VITRO TOXICOLOGY AND THE SELECTION OF GENES FOR A REAL TIME RT-PCR-BASED SCREEN FOR OXIDATIVE STRESS IN HEP-G2 CELLS

    Science.gov (United States)

    Large-scale analysis of gene expression using cDNA microarrays promises therapid detection of the mode of toxicity for drugs and other chemicals. cDNAmicroarrays were used to examine chemically-induced alterations of geneexpression in HepG2 cells exposed to oxidative ...

  9. Characterization of bovine ruminal epithelial bacterial communities using 16S rRNA sequencing, PCR-DGGE, and qRT-PCR analysis.

    Science.gov (United States)

    Li, Meiju; Zhou, Mi; Adamowicz, Elizabeth; Basarab, John A; Guan, Le Luo

    2012-02-24

    Currently, knowledge regarding the ecology and function of bacteria attached to the epithelial tissue of the rumen wall is limited. In this study, the diversity of the bacterial community attached to the rumen epithelial tissue was compared to the rumen content bacterial community using 16S rRNA gene sequencing, PCR-DGGE, and qRT-PCR analysis. Sequence analysis of 2785 randomly selected clones from six 16S rDNA (∼1.4kb) libraries showed that the community structures of three rumen content libraries clustered together and were separated from the rumen tissue libraries. The diversity index of each library revealed that ruminal content bacterial communities (4.12/4.42/4.88) were higher than ruminal tissue communities (2.90/2.73/3.23), based on 97% similarity. The phylum Firmicutes was predominant in the ruminal tissue communities, while the phylum Bacteroidetes was predominant in the ruminal content communities. The phyla Fibrobacteres, Planctomycetes, and Verrucomicrobia were only detected in the ruminal content communities. PCR-DGGE analysis of the bacterial profiles of the rumen content and ruminal epithelial tissue samples from 22 steers further confirmed that there is a distinct bacterial community that inhibits the rumen epithelium. The distinctive epimural bacterial communities suggest that Firmicutes, together with other epithelial-specific species, may have additional functions other than food digestion. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Real-time systems design and analysis

    CERN Document Server

    Laplante, Phillip A

    2004-01-01

    "Real-Time Systems Design and Analysis, Third Edition is essential for students and practicing software engineers who want improved designs, faster computation, and ultimate cost savings. Chapters discuss hardware considerations and software requirements, software systems design, the software production process, performance estimation and optimization, and engineering considerations."--Jacket.

  11. Mathematical analysis of the real time array PCR (RTA PCR) process

    NARCIS (Netherlands)

    Dijksman, Johan Frederik; Pierik, A.

    2012-01-01

    Real time array PCR (RTA PCR) is a recently developed biochemical technique that measures amplification curves (like with quantitative real time Polymerase Chain Reaction (qRT PCR)) of a multitude of different templates in a sample. It combines two different methods in order to profit from the

  12. On-Orbit Quantitative Real-Time Gene Expression Analysis Using the Wetlab-2 System

    Science.gov (United States)

    Parra, Macarena; Jung, Jimmy; Almeida, Eduardo; Boone, Travis; Tran, Luan; Schonfeld, Julie

    2015-01-01

    NASA Ames Research Center's WetLab-2 Project enables on-orbit quantitative Reverse Transcriptase PCR (qRT-PCR) analysis without the need for sample return. The WetLab-2 system is capable of processing sample types ranging from microbial cultures to animal tissues dissected on-orbit. The project developed a RNA preparation module that can lyse cells and extract RNA of sufficient quality and quantity for use as templates in qRT-PCR reactions. Our protocol has the advantage of using non-toxic chemicals and does not require alcohols or other organics. The resulting RNA is dispensed into reaction tubes that contain all lyophilized reagents needed to perform qRT-PCR reactions. System operations require simple and limited crew actions including syringe pushes, valve turns and pipette dispenses. The project selected the Cepheid SmartCycler (TradeMark), a Commercial-Off-The-Shelf (COTS) qRT-PCR unit, because of its advantages including rugged modular design, low power consumption, rapid thermal ramp times and four-color multiplex detection. Single tube multiplex assays can be used to normalize for RNA concentration and integrity, and to study multiple genes of interest in each module. The WetLab-2 system can downlink data from the ISS to the ground after a completed run and uplink new thermal cycling programs. The ability to conduct qRT-PCR and generate results on-orbit is an important step towards utilizing the ISS as a National Laboratory facility. Specifically, the ability to get on-orbit data will provide investigators with the opportunity to adjust experimental parameters in real time without the need for sample return and re-flight. On orbit gene expression analysis can also eliminate the confounding effects on gene expression of reentry stresses and shock acting on live cells and organisms or the concern of RNA degradation of fixed samples and provide on-orbit gene expression benchmarking prior to sample return. Finally, the system can also be used for analysis of

  13. Exploring Valid Reference Genes for Quantitative Real-time PCR Analysis in Plutella xylostella (Lepidoptera: Plutellidae)

    Science.gov (United States)

    Fu, Wei; Xie, Wen; Zhang, Zhuo; Wang, Shaoli; Wu, Qingjun; Liu, Yong; Zhou, Xiaomao; Zhou, Xuguo; Zhang, Youjun

    2013-01-01

    Abstract: Quantitative real-time PCR (qRT-PCR), a primary tool in gene expression analysis, requires an appropriate normalization strategy to control for variation among samples. The best option is to compare the mRNA level of a target gene with that of reference gene(s) whose expression level is stable across various experimental conditions. In this study, expression profiles of eight candidate reference genes from the diamondback moth, Plutella xylostella, were evaluated under diverse experimental conditions. RefFinder, a web-based analysis tool, integrates four major computational programs including geNorm, Normfinder, BestKeeper, and the comparative ΔCt method to comprehensively rank the tested candidate genes. Elongation factor 1 (EF1) was the most suited reference gene for the biotic factors (development stage, tissue, and strain). In contrast, although appropriate reference gene(s) do exist for several abiotic factors (temperature, photoperiod, insecticide, and mechanical injury), we were not able to identify a single universal reference gene. Nevertheless, a suite of candidate reference genes were specifically recommended for selected experimental conditions. Our finding is the first step toward establishing a standardized qRT-PCR analysis of this agriculturally important insect pest. PMID:23983612

  14. Trends and advances in food analysis by real-time polymerase chain reaction.

    Science.gov (United States)

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  15. Evaluation of Housekeeping Genes for Quantitative Real-Time PCR Analysis of Bradysia odoriphaga (Diptera: Sciaridae

    Directory of Open Access Journals (Sweden)

    Caihua Shi

    2016-07-01

    Full Text Available The soil insect Bradysia odoriphaga (Diptera: Sciaridae causes substantial damage to Chinese chive. Suitable reference genes in B. odoriphaga (Bradysia odoriphaga have yet to be identified for normalizing target gene expression among samples by quantitative real-time PCR (qRT-PCR. This study was focused on identifying the expression stability of 12 candidate housekeeping genes in B. odoriphaga under various experiment conditions. The final stability ranking of 12 housekeeping genes was obtained with RefFinder, and the most suitable number of reference genes was analyzed by GeNorm. The results revealed that the most appropriate sets of internal controls were RPS15, RPL18, and RPS18 across developmental phases; RPS15, RPL28, and GAPDH across temperatures; RPS15 and RPL18 across pesticide treatments; RSP5, RPS18, and SDHA across photoperiods; ACTb, RPS18, and RPS15 across diets; RPS13 and RPL28 across populations; and RPS15, ACTb, and RPS18 across all samples. The use of the most suitable reference genes versus an arbitrarily selected reference gene resulted in significant differences in the analysis of a target gene expression. HSP23 in B. odoriphaga was found to be up-regulated under low temperatures. These results will contribute to the standardization of qRT-PCR and will also be valuable for further research on gene function in B. odoriphaga.

  16. Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

    Science.gov (United States)

    Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

    2012-10-01

    A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Real-time Forensic Disaster Analysis

    Science.gov (United States)

    Wenzel, F.; Daniell, J.; Khazai, B.; Mühr, B.; Kunz-Plapp, T.; Markus, M.; Vervaeck, A.

    2012-04-01

    The Center for Disaster Management and Risk Reduction Technology (CEDIM, www.cedim.de) - an interdisciplinary research center founded by the German Research Centre for Geoscience (GFZ) and Karlsruhe Institute of Technology (KIT) - has embarked on a new style of disaster research known as Forensic Disaster Analysis. The notion has been coined by the Integrated Research on Disaster Risk initiative (IRDR, www.irdrinternational.org) launched by ICSU in 2010. It has been defined as an approach to studying natural disasters that aims at uncovering the root causes of disasters through in-depth investigations that go beyond the reconnaissance reports and case studies typically conducted after disasters. In adopting this comprehensive understanding of disasters CEDIM adds a real-time component to the assessment and evaluation process. By comprehensive we mean that most if not all relevant aspects of disasters are considered and jointly analysed. This includes the impact (human, economy, and infrastructure), comparisons with recent historic events, social vulnerability, reconstruction and long-term impacts on livelihood issues. The forensic disaster analysis research mode is thus best characterized as "event-based research" through systematic investigation of critical issues arising after a disaster across various inter-related areas. The forensic approach requires (a) availability of global data bases regarding previous earthquake losses, socio-economic parameters, building stock information, etc.; (b) leveraging platforms such as the EERI clearing house, relief-web, and the many sources of local and international sources where information is organized; and (c) rapid access to critical information (e.g., crowd sourcing techniques) to improve our understanding of the complex dynamics of disasters. The main scientific questions being addressed are: What are critical factors that control loss of life, of infrastructure, and for economy? What are the critical interactions

  18. Outbreak of hepatitis E virus infection in Darfur, Sudan: effectiveness of real-time reverse transcription-PCR analysis of dried blood spots.

    Science.gov (United States)

    Mérens, Audrey; Guérin, Philippe Jean; Guthmann, Jean-Paul; Nicand, Elisabeth

    2009-06-01

    Biological samples collected in refugee camps during an outbreak of hepatitis E were used to compare the accuracy of hepatitis E virus RNA amplification by real-time reverse transcription-PCR (RT-PCR) for sera and dried blood spots (concordance of 90.6%). Biological profiles (RT-PCR and serology) of asymptomatic individuals were also analyzed.

  19. Male DNA under female fingernails after scratching: transfer and persistence evaluation by RT-PCR analysis and Y-STR typing.

    Science.gov (United States)

    Iuvaro, Alessandra; Bini, Carla; Dilloo, Silvia; Sarno, Stefania; Pelotti, Susi

    2018-04-17

    The collection of biological debris beneath fingernails can be useful in forensic casework when a struggle between the victim and the offender is suspected. In the present study, we set up a controlled scratching experiment in which female volunteers scratched the male volunteers' forearms, simulating a defensive action during an assault. A total of 160 fingernail samples were collected: 80 "control samples" before the scratching, 40 samples immediately after the scratching (t = 0 h), and 40 samples 5 h after the scratching (t = 5 h). The aim was to evaluate, using a real-time PCR approach and Y-STR profiling, the transfer and the persistence of male DNA under female fingernails after scratching. A significant reduction in DNA yield was observed between fingernail samples collected immediately and those collected 5 h after scratching, with a corresponding decrease in Y-STR profile quality. Overall, 38/40 (95%) of the fingernail samples collected immediately (t = 0 h) and 24/40 (60%) of those collected 5 h later (t = 5 h) were suitable for comparison and the scratched male volunteers could not be excluded as donors of the foreign DNA from 37 (92.5%) of the t = 0 h and from 10 (25%) of the t = 5 h profiles. The analysis of male DNA under female fingernails showed that Y-chromosome STR typing may provide extremely valuable genetic information of the male contributor(s), although 5 h after scratching the profile of the scratched male was lost in three-quarters of samples.

  20. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae.

    Directory of Open Access Journals (Sweden)

    Meng Sun

    Full Text Available The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA, elongation factor 1 (EF1, glyceraldehyde-3-phosphate dehydrogenase (GAPDH, ribosomal protein S13 (RPS13, ribosomal protein S20 (RPS20, tubulin (TUB, and β-actin (ACTB were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1 were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands. 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults. 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C. To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83 was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

  1. Exploring valid reference genes for quantitative real-time PCR analysis in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2015-01-01

    The pink stem borer, Sesamia inferens, which is endemic in China and other parts of Asia, is a major pest of rice and causes significant yield loss in this host plant. Very few studies have addressed gene expression in S. inferens. Quantitative real-time PCR (qRT-PCR) is currently the most accurate and sensitive method for gene expression analysis. In qRT-PCR, data are normalized using reference genes, which help control for internal differences and reduce error between samples. In this study, seven candidate reference genes, 18S ribosomal RNA (18S rRNA), elongation factor 1 (EF1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), ribosomal protein S13 (RPS13), ribosomal protein S20 (RPS20), tubulin (TUB), and β-actin (ACTB) were evaluated for their suitability in normalizing gene expression under different experimental conditions. The results indicated that three genes (RPS13, RPS20, and EF1) were optimal for normalizing gene expression in different insect tissues (head, epidermis, fat body, foregut, midgut, hindgut, Malpighian tubules, haemocytes, and salivary glands). 18S rRNA, EF1, and GAPDH were best for normalizing expression with respect to developmental stages and sex (egg masses; first, second, third, fourth, fifth, and sixth instar larvae; male and female pupae; and one-day-old male and female adults). 18S rRNA, RPS20, and TUB were optimal for fifth instars exposed to different temperatures (-8, -6, -4, -2, 0, and 27°C). To validate this recommendation, the expression profile of a target gene heat shock protein 83 gene (hsp83) was investigated, and results showed the selection was necessary and effective. In conclusion, this study describes reference gene sets that can be used to accurately measure gene expression in S. inferens.

  2. RT-PCR Analysis of ED-A,ED-B, and IIICS Fibronectin Domains: A New Screening Marker For Bladder Cancer

    Directory of Open Access Journals (Sweden)

    M Ahmadi Javid

    2004-12-01

    Full Text Available Background: Fibronectin seems to play a very important role in the progression and invasion of bladder cancer. EDA, EDB, and IIICS domains of fibronectin are not expressed in the adult persons but they’re expressed in different cancers. The aim of this study is to investigate the mRNA of fibronectin in transitional carcinoma cells (TCC of bladder to study these domains. Methods: A total of 20 patients with known bladder cancer were studied. Two of them excluded since their excised tissues were not enough for both the pathological examination and RNA study. Another 20 (control group were normal volunteers who needed bladder operations. The excised tissue was immediately transferred to RNAlater (Ambion,TX. RNA was extracted via RNAWIZ (Ambion, TX. cDNA was made via RevertAid First Strand cDNA Synthesis Kit (Fermentas. PCR of the cDNAs was performed using primers for EDA, EDB, and IIICS (Eurogentec,Belgium. Results: For the first time, we present the expression of the oncofetal fibronectin mRNA in the transitional cell carcinoma of bladder. The high grade muscle invasive (G3T2 tumor, expressed ED-A, ED-B, and IIICS. Expression of ED-A, ED-B, and IIICS was confirmed in the two patients with G3T1 TCC. The four patients with G2Ta and G3Ta expressed both ED-A and ED-B. The four patients with G1T1 tumor expressed ED-A only, similar to the nine patients with G1Ta tumor. None of the normal volunteers expressed the oncofetal extra domains. The sensitivity of ED-A positive fibronectin RNA for detecting TCC of any kind is 100%, and of ED-B was only 35%. The specificity of ED-B positive fibronectin RNA for the high grade TCC is 100%. Conclusion: ED-A, ED-B, and IIICS could be used as useful markers for the diagnosis and following up of bladder carcinoma. Keywords: Transitional Cell Carcinoma, bladder cancer, fibronectin, RT-PCR, oncofetal.

  3. WetLab-2: Tools for Conducting On-Orbit Quantitative Real-Time Gene Expression Analysis on ISS

    Science.gov (United States)

    Parra, Macarena; Almeida, Eduardo; Boone, Travis; Jung, Jimmy; Schonfeld, Julie

    2014-01-01

    The objective of NASA Ames Research Centers WetLab-2 Project is to place on the ISS a research platform capable of conducting gene expression analysis via quantitative real-time PCR (qRT-PCR) of biological specimens sampled or cultured on orbit. The project has selected a Commercial-Off-The-Shelf (COTS) qRT-PCR system, the Cepheid SmartCycler and will fly it in its COTS configuration. The SmartCycler has a number of advantages including modular design (16 independent PCR modules), low power consumption, rapid ramp times and the ability to detect up to four separate fluorescent channels at one time enabling multiplex assays that can be used for normalization and to study multiple genes of interest in each module. The team is currently working with Cepheid to enable the downlink of data from the ISS to the ground and provide uplink capabilities for programming, commanding, monitoring, and instrument maintenance. The project has adapted commercial technology to design a module that can lyse cells and extract RNA of sufficient quality and quantity for use in qRT-PCR reactions while using a housekeeping gene to normalize RNA concentration and integrity. The WetLab-2 system is capable of processing multiple sample types ranging from microbial cultures to animal tissues dissected on-orbit. The ability to conduct qRT-PCR on-orbit eliminates the confounding effects on gene expression of reentry stresses and shock acting on live cells and organisms or the concern of RNA degradation of fixed samples. The system can be used to validate terrestrial analyses of samples returned from ISS by providing on-orbit gene expression benchmarking prior to sample return. The ability to get on orbit data will provide investigators with the opportunity to adjust experiment parameters for subsequent trials based on the real-time data analysis without need for sample return and re-flight. Researchers will also be able to sample multigenerational changes in organisms. Finally, the system can be

  4. Sequence and RT-PCR expression analysis of two peroxidases from Arabidopsis thaliana belonging to a novel evolutionary branch of plant peroxidases.

    Science.gov (United States)

    Kjaersgård, I V; Jespersen, H M; Rasmussen, S K; Welinder, K G

    1997-03-01

    ; (2) an N-glycosylation site is located right at the entrance to the heme channel. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to identify mRNAs coding for ATP 1a/b and ATP 2a/b in germinating seeds, seedlings, roots, leaves, stems, flowers and cell suspension culture using elongation factor 1alpha (EF-1alpha) for the first time as a positive control. Both mRNAs were transcribed at levels comparable to EF-1alpha in all plant tissues investigated which were more than two days old, and in cell suspension culture. In addition, the mRNA coding for ATP 1a/b was found in two day old germinating seeds. The abundant transcription of ATP 1a/b and ATP 2a/b is in line with their many entries in dbEST, and indicates essential roles for these novel peroxidases.

  5. Selection of reference genes for quantitative RT-PCR studies in striped dolphin (Stenella coeruleoalba skin biopsies

    Directory of Open Access Journals (Sweden)

    Casini Silvia

    2006-09-01

    Full Text Available Abstract Background Odontocete cetaceans occupy the top position of the marine food-web and are particularly sensitive to the bioaccumulation of lipophilic contaminants. The effects of environmental pollution on these species are highly debated and various ecotoxicological studies have addressed the impact of xenobiotic compounds on marine mammals, raising conservational concerns. Despite its sensitivity, quantitative real-time PCR (qRT-PCR has never been used to quantify gene induction caused by exposure of cetaceans to contaminants. A limitation for the application of qRT-PCR is the need for appropriate reference genes which allow the correct quantification of gene expression. A systematic evaluation of potential reference genes in cetacean skin biopsies is presented, in order to validate future qRT-PCR studies aiming at using the expression of selected genes as non-lethal biomarkers. Results Ten commonly used housekeeping genes (HKGs were partially sequenced in the striped dolphin (Stenella coeruleoalba and, for each gene, PCR primer pairs were specifically designed and tested in qRT-PCR assays. The expression of these potential control genes was examined in 30 striped dolphin skin biopsy samples, obtained from specimens sampled in the north-western Mediterranean Sea. The stability of selected control genes was determined using three different specific VBA applets (geNorm, NormFinder and BestKeeper which produce highly comparable results. Glyceraldehyde-3P-dehydrogenase (GAPDH and tyrosine 3-monooxygenase (YWHAZ always rank as the two most stably expressed HKGs according to the analysis with geNorm and Normfinder, and are defined as optimal control genes by BestKepeer. Ribosomal protein L4 (RPL4 and S18 (RPS18 also exhibit a remarkable stability of their expression levels. On the other hand, transferrin receptor (TFRC, phosphoglycerate kinase 1 (PGK1, hypoxanthine ribosyltransferase (HPRT1 and β-2-microglobin (B2M show variable expression

  6. Enabling Real-Time Analysis at LHCb

    CERN Multimedia

    Govorkova, Katya

    2017-01-01

    A new streaming strategy of the LHCb experiment includes the possibility to perform the physics analysis with candidates reconstructed in the trigger, thus bypassing the offline reconstruction. In the Turbo stream the trigger writes out a compact summary of physics objects containing all information necessary for analyses. This allows an increased output rate and thus higher average efficiencies. The Turbo stream was introduced in 2015 and has allowed for and expanded physics program in Run 2 of the LHC.

  7. Application of reverse transcription-PCR and real-time PCR in nanotoxicity research.

    Science.gov (United States)

    Mo, Yiqun; Wan, Rong; Zhang, Qunwei

    2012-01-01

    Reverse transcription-polymerase chain reaction (RT-PCR) is a relatively simple and inexpensive technique to determine the expression level of target genes and is widely used in biomedical science research including nanotoxicology studies for semiquantitative analysis. Real-time PCR allows for the detection of PCR amplification in the exponential growth phase of the reaction and is much more quantitative than traditional RT-PCR. Although a number of kits and reagents for RT-PCR and real-time PCR are commercially available, the basic principles are the same. Here, we describe the procedures for total RNA isolation by using TRI Reagent, for reverse transcription (RT) by M-MLV reverse transcriptase, and for PCR by GoTaq(®) DNA Polymerase. And real-time PCR will be performed on an iQ5 multicolor real-time PCR detection system by using iQ™ SYBR Green Supermix.

  8. Analysis and Synthesis of Distributed Real-Time Embedded Systems

    DEFF Research Database (Denmark)

    Pop, Paul; Eles, Petru; Peng, Zebo

    like automotive electronics, real-time multimedia, avionics, medical equipment, and factory systems. The proposed analysis and synthesis techniques derive optimized implementations that fulfill the imposed design constraints. An important part of the implementation process is the synthesis...

  9. Real-time PCR analysis of carbon catabolite repression of cellobiose gene transcription in Trametes versicolor

    Energy Technology Data Exchange (ETDEWEB)

    Stapleton, P. C.; O' Mahoney, J.; Dobson, A. D. W. [National University of Ireland, Microbiology Department, Cork (Ireland)

    2004-02-01

    Previous reports indicate that in white rot fungi such as Trametes versicolor, the production of cellobiose dehydrogenase (CDH), an extracellular haemo-flavo-enzyme, is subject to carbon catabolite repression by both glucose and maltose, and that the repression is mediated at the transcriptional level. This paper describes the results of an investigation of CDH gene transcription in cellulolytic cultures of T. versicolor, in the presence of other additional carbon sources such as glucose, arabinose, and xylose. Using real time polymerase chain reaction (RT-PCR) assay methods in the presence of these other additional carbon sources, the levels of repression observed are quantitatively determined in an effort to obtain more accurate measurements of carbon catabolite repression of CDH production in this ligninolytic fungus. Ninety-six hours after addition, results of the analysis showed reduction in CDH transcript levels of 19-fold for galactose, 92-fold for arabinose and 114-fold for xylose. The greatest repressive effect was exhibited by glucose. In this case the reduction in CDH transcript levels was 3400-fold. CDH plays an important role in lignin degradation, and there is also substantial interest in the biotechnological applications of CDH, most particularly in the pulp and paper industry. 24 refs., 4 figs.

  10. GNSS global real-time augmentation positioning: Real-time precise satellite clock estimation, prototype system construction and performance analysis

    Science.gov (United States)

    Chen, Liang; Zhao, Qile; Hu, Zhigang; Jiang, Xinyuan; Geng, Changjiang; Ge, Maorong; Shi, Chuang

    2018-01-01

    Lots of ambiguities in un-differenced (UD) model lead to lower calculation efficiency, which isn't appropriate for the high-frequency real-time GNSS clock estimation, like 1 Hz. Mixed differenced model fusing UD pseudo-range and epoch-differenced (ED) phase observations has been introduced into real-time clock estimation. In this contribution, we extend the mixed differenced model for realizing multi-GNSS real-time clock high-frequency updating and a rigorous comparison and analysis on same conditions are performed to achieve the best real-time clock estimation performance taking the efficiency, accuracy, consistency and reliability into consideration. Based on the multi-GNSS real-time data streams provided by multi-GNSS Experiment (MGEX) and Wuhan University, GPS + BeiDou + Galileo global real-time augmentation positioning prototype system is designed and constructed, including real-time precise orbit determination, real-time precise clock estimation, real-time Precise Point Positioning (RT-PPP) and real-time Standard Point Positioning (RT-SPP). The statistical analysis of the 6 h-predicted real-time orbits shows that the root mean square (RMS) in radial direction is about 1-5 cm for GPS, Beidou MEO and Galileo satellites and about 10 cm for Beidou GEO and IGSO satellites. Using the mixed differenced estimation model, the prototype system can realize high-efficient real-time satellite absolute clock estimation with no constant clock-bias and can be used for high-frequency augmentation message updating (such as 1 Hz). The real-time augmentation message signal-in-space ranging error (SISRE), a comprehensive accuracy of orbit and clock and effecting the users' actual positioning performance, is introduced to evaluate and analyze the performance of GPS + BeiDou + Galileo global real-time augmentation positioning system. The statistical analysis of real-time augmentation message SISRE is about 4-7 cm for GPS, whlile 10 cm for Beidou IGSO/MEO, Galileo and about 30 cm

  11. Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells

    International Nuclear Information System (INIS)

    Raynor, Michael; Stephenson, Sally-Anne; Walsh, David CA; Pittman, Kenneth B; Dobrovic, Alexander

    2002-01-01

    Immunomagnetic enrichment followed by RT-PCR (immunobead RT-PCR) is an efficient methodology to identify disseminated carcinoma cells in the blood and bone marrow. The RT-PCR assays must be both specific for the tumor cells and sufficiently sensitive to enable detection of single tumor cells. We have developed a method to test RT-PCR assays for any cancer. This has been investigated using a panel of RT-PCR markers suitable for the detection of breast cancer cells. In the assay, a single cell line-derived tumor cell is added to 100 peripheral blood mononuclear cells (PBMNCs) after which mRNA is isolated and reverse transcribed for RT-PCR analysis. PBMNCs without added tumor cells are used as specificity controls. The previously studied markers epidermal growth factor receptor (EGFR), mammaglobin 1 (MGB1), epithelial cell adhesion molecule (EpCAM/TACSTD1), mucin 1 (MUC1), carcinoembryonic antigen (CEA) were tested. Two new epithelial-specific markers ELF3 and EphB4 were also tested. MUC1 was unsuitable as strong amplification was detected in 100 cell PBMNC controls. Expression of ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 was found to be both specific for the tumor cell, as demonstrated by the absence of a signal in most 100 cell PBMNC controls, and sensitive enough to detect a single tumor cell in 100 PBMNCs using a single round of RT-PCR. ELF3, EphB4, EpCAM, EGFR, CEA and MGB1 are appropriate RT-PCR markers for use in a marker panel to detect disseminated breast cancer cells after immunomagnetic enrichment

  12. Real Time Engineering Analysis Based on a Generative Component Implementation

    DEFF Research Database (Denmark)

    Kirkegaard, Poul Henning; Klitgaard, Jens

    2007-01-01

    The present paper outlines the idea of a conceptual design tool with real time engineering analysis which can be used in the early conceptual design phase. The tool is based on a parametric approach using Generative Components with embedded structural analysis. Each of these components uses the g...

  13. Outcome on EPIZONE Extension on VER/ VNN: Diagnostics, proficiency test and qRT-PCR validation

    DEFF Research Database (Denmark)

    Bigarré, Laurent; Panzarin, Valentina; Baud, Marine

    2012-01-01

    1 is to bring valuable genetic information on the second genome component of a given isolate. ANSES has developed new DNA probes targeting RNA1 with the goal of detecting all genotypes of nodaviruses. The aim of the project is thus: - To organize, conduct and report an inter-laboratory proficiency...... test for detection of aquatic nodaviruses by real time RT-PCR targeting RNA1 and RNA2, respectively. - To test a newly developed real-time RT-PCR targeting RNA1: sensitivity, specificity, range of detection and genetic information provided by sequencing the PCR product. Materials & methods Primers...... to be extracted by each partner. In the meantime, ANSES produced and distributed RNA extracted from healthy or infected fish (2 genogroups), or cell culture; one sample from cell culture had to be serially diluted to test the sensitivity of each method in partners’ hands. Samples were tested in duplicates...

  14. Modelling and analysis of real-time and hybrid systems

    Energy Technology Data Exchange (ETDEWEB)

    Olivero, A

    1994-09-29

    This work deals with the modelling and analysis of real-time and hybrid systems. We first present the timed-graphs as model for the real-time systems and we recall the basic notions of the analysis of real-time systems. We describe the temporal properties on the timed-graphs using TCTL formulas. We consider two methods for property verification: in one hand we study the symbolic model-checking (based on backward analysis) and in the other hand we propose a verification method derived of the construction of the simulation graph (based on forward analysis). Both methods have been implemented within the KRONOS verification tool. Their application for the automatic verification on several real-time systems confirms the practical interest of our approach. In a second part we study the hybrid systems, systems combining discrete components with continuous ones. As in the general case the analysis of this king of systems is not decidable, we identify two sub-classes of hybrid systems and we give a construction based method for the generation of a timed-graph from an element into the sub-classes. We prove that in one case the timed-graph obtained is bi-similar with the considered system and that there exists a simulation in the other case. These relationships allow the application of the described technics on the hybrid systems into the defined sub-classes. (authors). 60 refs., 43 figs., 8 tabs., 2 annexes.

  15. Resource-Parameterized Timing Analysis of Real-Time Systems

    DEFF Research Database (Denmark)

    Kim, Jin Hyun; Legay, Axel; Larsen, Kim Guldstrand

    2015-01-01

    on a specic platform. For the same reason, a configuration of platforms cannot be independent from applications in most cases. This paper proposes a new analysis framework of real-time systems where an application and a platform can be analyzed in a fully independent way such that not only the application...

  16. Real-time regression analysis with deep convolutional neural networks

    OpenAIRE

    Huerta, E. A.; George, Daniel; Zhao, Zhizhen; Allen, Gabrielle

    2018-01-01

    We discuss the development of novel deep learning algorithms to enable real-time regression analysis for time series data. We showcase the application of this new method with a timely case study, and then discuss the applicability of this approach to tackle similar challenges across science domains.

  17. Analysis and optimisation of heterogeneous real-time embedded systems

    DEFF Research Database (Denmark)

    Pop, Paul; Eles, Petru; Peng, Zebo

    2005-01-01

    . The success of such new design methods depends on the availability of analysis and optimisation techniques. Analysis and optimisation techniques for heterogeneous real-time embedded systems are presented in the paper. The authors address in more detail a particular class of such systems called multi...... of application messages to frames. Optimisation heuristics for frame packing aimed at producing a schedulable system are presented. Extensive experiments and a real-life example show the efficiency of the frame-packing approach....

  18. Analysis and optimisation of heterogeneous real-time embedded systems

    DEFF Research Database (Denmark)

    Pop, Paul; Eles, Petru; Peng, Zebo

    2006-01-01

    . The success of such new design methods depends on the availability of analysis and optimisation techniques. Analysis and optimisation techniques for heterogeneous real-time embedded systems are presented in the paper. The authors address in more detail a particular class of such systems called multi...... of application messages to frames. Optimisation heuristics for frame packing aimed at producing a schedulable system are presented. Extensive experiments and a real-life example show the efficiency of the frame-packing approach....

  19. Analysis and Optimization of Heterogeneous Real-Time Embedded Systems

    DEFF Research Database (Denmark)

    Pop, Paul; Eles, Petru; Peng, Zebo

    2005-01-01

    . The success of such new design methods depends on the availability of analysis and optimization techniques. In this paper, we present analysis and optimization techniques for heterogeneous real-time embedded systems. We address in more detail a particular class of such systems called multi-clusters, composed...... to frames. Optimization heuristics for frame packing aiming at producing a schedulable system are presented. Extensive experiments and a real-life example show the efficiency of the frame-packing approach....

  20. Performance of nested RT-PCR on CSF for tuberculous meningitis diagnosis in HIV-infected patients.

    Science.gov (United States)

    Gualberto, F A S; Gonçalves, M G; Fukasawa, L O; Santos, A M Ramos Dos; Sacchi, C T; Harrison, L H; Boulware, D R; Vidal, J E

    2017-10-01

    Timely diagnosis of tuberculous meningitis (TBM) in patients with human immunodeficiency virus (HIV) infection remains a challenge. Despite the current scale-up of the Xpert® MTB/RIF assay, other molecular diagnostic tools are necessary, particularly in referral centres in low- and middle-income countries without Xpert testing. To determine the diagnostic performance of nested real-time polymerase chain reaction (nRT-PCR) in HIV-infected TBM patients categorised according to standardised clinical case definitions. Based on clinical, laboratory and imaging data, HIV-infected patients with suspected TBM were prospectively categorised as 'definite TBM', 'probable TBM', 'possible TBM' or 'not TBM'. We evaluated nRT-PCR sensitivity and specificity in diagnosing TBM among definite TBM cases, and among definite + probable TBM cases. Ninety-two participants were enrolled in the study. nRT-PCR sensitivity for definite TBM (n = 8) was 100% (95%CI 67-100) and 86% (95%CI 60-96) for both definite and probable TBM (n = 6). Assuming that 'not TBM' patients (n = 74) were true-negatives, nRT-PCR specificity was 100% (95%CI 95-100). The possible TBM group (n = 4) had no nRT-PCR positives. The nRT-PCR is a useful rule-in test for HIV-infected patients with TBM according to international consensus case definitions. As nRT-PCR cannot exclude TBM, studies comparing and combining nRT-PCR with other assays are necessary for a rule-out test.

  1. Low-level processing for real-time image analysis

    Science.gov (United States)

    Eskenazi, R.; Wilf, J. M.

    1979-01-01

    A system that detects object outlines in television images in real time is described. A high-speed pipeline processor transforms the raw image into an edge map and a microprocessor, which is integrated into the system, clusters the edges, and represents them as chain codes. Image statistics, useful for higher level tasks such as pattern recognition, are computed by the microprocessor. Peak intensity and peak gradient values are extracted within a programmable window and are used for iris and focus control. The algorithms implemented in hardware and the pipeline processor architecture are described. The strategy for partitioning functions in the pipeline was chosen to make the implementation modular. The microprocessor interface allows flexible and adaptive control of the feature extraction process. The software algorithms for clustering edge segments, creating chain codes, and computing image statistics are also discussed. A strategy for real time image analysis that uses this system is given.

  2. Real-time analysis of water movement in plant sample

    International Nuclear Information System (INIS)

    Yokota, Harumi; Furukawa, Jun; Tanoi, Keitaro

    2000-01-01

    To know the effect of drought stress on two cultivars of cowpea, drought tolerant (DT) and drought sensitive (DS), and to estimate vanadium treatment on plant activity, we performed real time 18 F labeled water uptake measurement by PETIS. Fluoride-18 was produced by bombarding a cubic ice target with 50 MeV protons using TIARA AVF cyclotron. Then 18 F labeled water was applied to investigate water movement in a cowpea plant. Real time water uptake manner could be monitored by PETIS. After the analysis by PETIS, we also measured the distribution of 18 F in a whole plant by BAS. When a cowpea plant was treated with drought stress, there was a difference in water uptake manner between DT and DS cultivar. When a cowpea plant was treated with V for 20 hours before the water uptake experiment, the total amount of 18 F labeled water absorption was found to be drastically decreased. (author)

  3. Real-time analysis of water movement in plant sample

    Energy Technology Data Exchange (ETDEWEB)

    Yokota, Harumi; Furukawa, Jun; Tanoi, Keitaro [Graduate School, Tokyo Univ. (Japan)

    2000-07-01

    To know the effect of drought stress on two cultivars of cowpea, drought tolerant (DT) and drought sensitive (DS), and to estimate vanadium treatment on plant activity, we performed real time{sup 18}F labeled water uptake measurement by PETIS. Fluoride-18 was produced by bombarding a cubic ice target with 50 MeV protons using TIARA AVF cyclotron. Then {sup 18}F labeled water was applied to investigate water movement in a cowpea plant. Real time water uptake manner could be monitored by PETIS. After the analysis by PETIS, we also measured the distribution of {sup 18}F in a whole plant by BAS. When a cowpea plant was treated with drought stress, there was a difference in water uptake manner between DT and DS cultivar. When a cowpea plant was treated with V for 20 hours before the water uptake experiment, the total amount of {sup 18}F labeled water absorption was found to be drastically decreased. (author)

  4. Diagnosis of intestinal parasites in a rural community of Venezuela : Advantages and disadvantages of using microscopy or RT-PCR

    NARCIS (Netherlands)

    Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia M.; Pinelli, Elena

    2017-01-01

    A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular

  5. Reference gene selection for real-time quantitative PCR analysis of the mouse uterus in the peri-implantation period.

    Directory of Open Access Journals (Sweden)

    Pengfei Lin

    Full Text Available The study of uterine gene expression patterns is valuable for understanding the biological and molecular mechanisms that occur during embryo implantation. Real-time quantitative RT-PCR (qRT-PCR is an extremely sensitive technique that allows for the precise quantification of mRNA abundance; however, selecting stable reference genes suitable for the normalization of qRT-PCR data is required to avoid the misinterpretation of experimental results and erroneous analyses. This study employs several mouse models, including an early pregnancy, a pseudopregnancy, a delayed implantation and activation, an artificial decidualization and a hormonal treatment model; ten candidate reference genes (PPIA, RPLP0, HPRT1, GAPDH, ACTB, TBP, B2M, 18S, UBC and TUBA that are found in uterine tissues were assessed for their suitability as internal controls for relative qRT-PCR quantification. GeNorm(PLUS, NormFinder, and BestKeeper were used to evaluate these candidate reference genes, and all of these methods identified RPLP0 and GAPDH as the most stable candidates and B2M and 18S as the least stable candidates. However, when the different models were analyzed separately, the reference genes exhibited some variation in their expression levels.

  6. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    Energy Technology Data Exchange (ETDEWEB)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  7. ClockWork: a Real-Time Feasibility Analysis Tool

    NARCIS (Netherlands)

    Jansen, P.G.; Hanssen, F.T.Y.; Mullender, Sape J.

    ClockWork shows that we can improve the flexibility and efficiency of real-time kernels. We do this by proposing methods for scheduling based on so-called Real-Time Transactions. ClockWork uses Real-Time Transactions which allow scheduling decisions to be taken by the system. A programmer does not

  8. Evaluation of different enrichment methods for pathogenic Yersinia species detection by real time PCR

    Science.gov (United States)

    2014-01-01

    Background Yersiniosis is a zoonotic disease reported worldwide. Culture and PCR based protocols are the most common used methods for detection of pathogenic Yersinia species in animal samples. PCR sensitivity could be increased by an initial enrichment step. This step is particularly useful in surveillance programs, where PCR is applied to samples from asymptomatic animals. The aim of this study was to evaluate the improvement in pathogenic Yersinia species detection using a suitable enrichment method prior to the real time PCR (rtPCR). Nine different enrichment protocols were evaluated including six different broth mediums (CASO, ITC, PSB, PBS, PBSMSB and PBSSSB). Results The analysis of variance showed significant differences in Yersinia detection by rtPCR according to the enrichment protocol used. These differences were higher for Y. pseudotuberculosis than for Y. enterocolitica. In general, samples incubated at lower temperatures yielded the highest detection rates. The best results were obtained with PBSMSB and PBS2. Application of PBSMSB protocol to free-ranging wild board samples improved the detection of Y. enterocolitica by 21.2% when compared with direct rtPCR. Y. pseudotuberculosis detection was improved by 10.6% when results obtained by direct rtPCR and by PBSMSB enrichment before rtPCR were analyzed in combination. Conclusions The data obtained in the present study indicate a difference in Yersinia detection by rtPCR related to the enrichment protocol used, being PBSMSB enrichment during 15 days at 4°C and PBS during 7 days at 4°C the most efficient. The use of direct rtPCR in combination with PBSMSB enrichment prior to rtPCR resulted in an improvement in the detection rates of pathogenic Yersinia in wild boar and could be useful for application in other animal samples. PMID:25168886

  9. Implementation and Analysis of Real-Time Streaming Protocols.

    Science.gov (United States)

    Santos-González, Iván; Rivero-García, Alexandra; Molina-Gil, Jezabel; Caballero-Gil, Pino

    2017-04-12

    Communication media have become the primary way of interaction thanks to the discovery and innovation of many new technologies. One of the most widely used communication systems today is video streaming, which is constantly evolving. Such communications are a good alternative to face-to-face meetings, and are therefore very useful for coping with many problems caused by distance. However, they suffer from different issues such as bandwidth limitation, network congestion, energy efficiency, cost, reliability and connectivity. Hence, the quality of service and the quality of experience are considered the two most important issues for this type of communication. This work presents a complete comparative study of two of the most used protocols of video streaming, Real Time Streaming Protocol (RTSP) and the Web Real-Time Communication (WebRTC). In addition, this paper proposes two new mobile applications that implement those protocols in Android whose objective is to know how they are influenced by the aspects that most affect the streaming quality of service, which are the connection establishment time and the stream reception time. The new video streaming applications are also compared with the most popular video streaming applications for Android, and the experimental results of the analysis show that the developed WebRTC implementation improves the performance of the most popular video streaming applications with respect to the stream packet delay.

  10. Portable real time analysis system for regional cerebral blood flow

    International Nuclear Information System (INIS)

    Tiernan, T.; Entine, G.; Stump, D.A.; Prough, D.S.

    1988-01-01

    A very portable, regional cerebral blood flow (rCBF) analysis instrument system suitable for use in the operating theater during surgery is under development. Cadmium telluride (CdTe) solid state radiation detectors, an 8086 based data acquisition and communications module and a DEC Microvax computer are used so that the instrument is very compact, yet has the computational power to provide real time data analysis in the clinical environment. The instrument is currently being used at Bowman Gray School of Medicine to study rCBF during cardiopulmonary bypass surgery (CPB). Preliminary studies indicate that monitoring rCBF during this surgical procedure may provide insights into the mechanism that causes a significant fraction of these patients to suffer post operative neuropsychological deficit

  11. Real-time analysis of nitrogen translocation in plants

    International Nuclear Information System (INIS)

    Hayashi, Hiroaki

    2000-01-01

    Nitrogen absorbed by roots is transported to the leaves through xylem vessels and then retranslocated to the new leaves, such as root and storage organs through sieve tubes. It is very important to know how this nitrogen movement occurs in the plants and what mechanisms are involved in controlling this movement in order to increase the efficiency of fertilizer. In this experiments, 13 N and 15 N was used to detect the nitrogen circulation in plants, in combination with the technique for positron detection in real time and for collection of sap in sieve tubes and analysis of 15 N in it. By using 13 N, nitrogen movement from root to shoot was analyzed within 10 min after 13 N was applied to the roots. On the other hand, nitrogen retranslocation through sieve tubes was detected by the analysis of 15 N in the phloem sap over 6 hrs. All data suggest the dynamic translocation of nitrogen in rice plants. (author)

  12. RT-PCR Detection of HIV in Republic of Macedonia

    Directory of Open Access Journals (Sweden)

    Golubinka Bosevska

    2008-11-01

    Full Text Available The aim of the study was to detect HIV RNA in seropositive patients using RT-PCR method and thus, to establish PCR methodology in the routine laboratory works.The total of 33 examined persons were divided in two groups: 1 13 persons seropositive for HIV; and 2 20 healthy persons - randomly selected blood donors that made the case control group. The subjects age was between 25 and 52 years (average 38,5.ELFA test for combined detection of HIV p24 antigen and anti HIV-1 + 2 IgG and ELISA test for detection of antibodies against HIV-1 and HIV-2, were performed for each examined person. RNA from the whole blood was extracted using a commercial kit based on salt precipitation. Detection of HIV RNA was performed using RT-PCR kit. Following nested PCR, the product was separated by electrophoresis in 1,5 % agarose gel. The result was scored positive if the band of 210bp was visible regardless of intensity Measures of precaution were taken during all the steps of the work and HIV infected materials were disposed of accordingly.In the group of blood donors ELFA, ELISA and RT-PCR were negative. Assuming that prevalence of HIV infection is zero, the clinical specificity of RT-PCR is 100 %. The analytical specificity of RT-PCR method was tested against Hepatitis C and B, Human Papiloma Virus, Cytomegalovirus, Herpes Simplex Virus, Rubella Virus, Mycobacterium tuberculosis, Chlamydia trachomatis. None of these templates yielded amplicon. In the group of 13 seropositive persons, 33 samples were analyzed. HIV RNA was detected in 15 samples. ELISA and ELFA test were positive in all samples. Different aliquots of the samples were tested independently and showed the same results. After different periods of storing the RNA samples at -70°C, RT-PCR reaction was identical to the one performed initially. The obtained amplicons were maintained frozen at -20°C for a week and the subsequently performed electrophoresis was identical to the previous one. The reaction is

  13. Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)

    Science.gov (United States)

    Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...

  14. RT-PCR Protocols - Methods in Molecular Biology

    Directory of Open Access Journals (Sweden)

    Manuela Monti

    2011-03-01

    Full Text Available “The first record I have of it, is when I made a computer file which I usually did whenever I had an idea, that would have been on the Monday when I got back, and I called it Chain Reaction.POL, meaning polymerase. That was the identifier for it and later I called the thing the Polymerase Chain Reaction, which a lot of people thought was a dumb name for it, but it stuck, and it became PCR”. With these words the Nobel prize winner, Kary Mullis, explains how he named the PCR: one of the most important techniques ever invented and currently used in molecular biology. This book “RT-PCR Protocols” covers a wide range of aspects important for the setting of a PCR experiment for both beginners and advanced users. In my opinion the book is very well structured in three different sections. The first one describes the different technologies now available, like competitive RT-PCR, nested RT-PCR or RT-PCR for cloning. An important part regards the usage of PCR in single cell mouse embryos, stressing how important...........

  15. Petroleomics by Direct Analysis in Real Time-Mass Spectrometry.

    Science.gov (United States)

    Romão, Wanderson; Tose, Lilian V; Vaz, Boniek G; Sama, Sara G; Lobinski, Ryszard; Giusti, Pierre; Carrier, Hervé; Bouyssiere, Brice

    2016-01-01

    The analysis of crude oil and its fractions by applying ambient ionization techniques remains underexplored in mass spectrometry (MS). Direct analysis in real time (DART) in the positive-ion mode was coupled to a linear quadrupole ion trap Orbitrap mass spectrometer (LTQ Orbitrap) to analyze crude oil, paraffin samples, and porphyrin standard compounds. The ionization parameters of DART-MS were optimized for crude oil analysis. DART-MS rendered the optimum conditions of the operation using paper as the substrate, T = 400°C, helium as the carrier gas, and a sample concentration ≥6 mg mL(-1). In the crude oils analysis, the DART(+)-Orbitrap mass spectra detected the typical N, NO, and O-containing compounds. In the paraffin samples, oxidized hydrocarbon species (Ox classes, where x = 1-4) with double-bond equivalent of 1-4 were detected, and their structures and connectivity were confirmed by collision-induced dissociation (CID) experiments. DART(+)-MS has identified the porphyrin standard compounds as [M + H](+) ions of m/z 615.2502 and 680.1763, where M = C44H30N4 and C44H28N4OV, respectively, based on the formula assignment and by phenyl losses observed on CID experiments.

  16. Effectiveness of real-time polymerase chain reaction assay for the detection of Mycobacterium tuberculosis in pathological samples: a systematic review and meta-analysis.

    Science.gov (United States)

    Babafemi, Emmanuel O; Cherian, Benny P; Banting, Lee; Mills, Graham A; Ngianga, Kandala

    2017-10-25

    Rapid and accurate diagnosis of tuberculosis (TB) is key to manage the disease and to control and prevent its transmission. Many established diagnostic methods suffer from low sensitivity or delay of timely results and are inadequate for rapid detection of Mycobacterium tuberculosis (MTB) in pulmonary and extra-pulmonary clinical samples. This study examined whether a real-time polymerase chain reaction (RT-PCR) assay, with a turn-a-round time of 2 h, would prove effective for routine detection of MTB by clinical microbiology laboratories. A systematic literature search was performed for publications in any language on the detection of MTB in pathological samples by RT-PCR assay. The following sources were used MEDLINE via PubMed, EMBASE, BIOSIS Citation Index, Web of Science, SCOPUS, ISI Web of Knowledge and Cochrane Infectious Diseases Group Specialised Register, grey literature, World Health Organization and Centres for Disease Control and Prevention websites. Forty-six studies met set inclusion criteria. Generated pooled summary estimates (95% CIs) were calculated for overall accuracy and bivariate meta-regression model was used for meta-analysis. Summary estimates for pulmonary TB (31 studies) were as follows: sensitivity 0.82 (95% CI 0.81-0.83), specificity 0.99 (95% CI 0.99-0.99), positive likelihood ratio 43.00 (28.23-64.81), negative likelihood ratio 0.16 (0.12-0.20), diagnostic odds ratio 324.26 (95% CI 189.08-556.09) and area under curve 0.99. Summary estimates for extra-pulmonary TB (25 studies) were as follows: sensitivity 0.70 (95% CI 0.67-0.72), specificity 0.99 (95% CI 0.99-0.99), positive likelihood ratio 29.82 (17.86-49.78), negative likelihood ratio 0.33 (0.26-0.42), diagnostic odds ratio 125.20 (95% CI 65.75-238.36) and area under curve 0.96. RT-PCR assay demonstrated a high degree of sensitivity for pulmonary TB and good sensitivity for extra-pulmonary TB. It indicated a high degree of specificity for ruling in TB infection from sampling

  17. Table 1. Real-time qRT-PCR verification of eight DEGs. Gene ...

    Indian Academy of Sciences (India)

    (TCA)8. GGGTCCGAGTGCCTTAATTT. TGTGGGATGTGTTGTGTGTG 60.32 59.88. HAAS VR 415 BMK.5319. (T)13. GATTCACGTGTGCCATCATC TGGACAATTCATTCAAAAAGAAAA 59.93 59.87 372. HAAS_VR_417 BMK.5329. (AG)6. ATCCCGGGGTGAAAAATAAA AGAAATGGTGCAATGGGTTC 60.36 59.80 157. (GAC)5 ...

  18. Real time physics analysis with the ATLAS tau trigger system

    International Nuclear Information System (INIS)

    Casado Lechuga, M. P.

    2009-01-01

    The scope of the ATLAS tau trigger system at the LHC is most ambitious. It aims at reconstructing in real time, a matter of seconds, a detailed picture of the high energy proton proton collisions at the LHC. Such system is mandatory in order to select efficiently data needed for discovery of new physics in a proton proton collision environment where the rates of jets observed in the detector are high and the tau identification is difficult. New physics scenarios targeted specifically by the the ATLAS tau trigger system are Standard Model or Supersymmetric Higgs production, and production of new exotic resonances. This contribution will detail how the analysis techniques developed offline for efficient data analysis have been implemented in the algorithms which run online at the trigger. In particular, the focus will be on how to satisfy the requirements imposed by the physics goals while addressing the limitations from the overall event rate and latency allowed. The prospects for early running during the first LHC collisions and trigger evolution from first collisions to stable running will be also summarized, following change of trigger goals from commissioning of detector to measurement of Standard Model physics and discoveries. (author)

  19. Cluster Computing For Real Time Seismic Array Analysis.

    Science.gov (United States)

    Martini, M.; Giudicepietro, F.

    A seismic array is an instrument composed by a dense distribution of seismic sen- sors that allow to measure the directional properties of the wavefield (slowness or wavenumber vector) radiated by a seismic source. Over the last years arrays have been widely used in different fields of seismological researches. In particular they are applied in the investigation of seismic sources on volcanoes where they can be suc- cessfully used for studying the volcanic microtremor and long period events which are critical for getting information on the volcanic systems evolution. For this reason arrays could be usefully employed for the volcanoes monitoring, however the huge amount of data produced by this type of instruments and the processing techniques which are quite time consuming limited their potentiality for this application. In order to favor a direct application of arrays techniques to continuous volcano monitoring we designed and built a small PC cluster able to near real time computing the kinematics properties of the wavefield (slowness or wavenumber vector) produced by local seis- mic source. The cluster is composed of 8 Intel Pentium-III bi-processors PC working at 550 MHz, and has 4 Gigabytes of RAM memory. It runs under Linux operating system. The developed analysis software package is based on the Multiple SIgnal Classification (MUSIC) algorithm and is written in Fortran. The message-passing part is based upon the LAM programming environment package, an open-source imple- mentation of the Message Passing Interface (MPI). The developed software system includes modules devote to receiving date by internet and graphical applications for the continuous displaying of the processing results. The system has been tested with a data set collected during a seismic experiment conducted on Etna in 1999 when two dense seismic arrays have been deployed on the northeast and the southeast flanks of this volcano. A real time continuous acquisition system has been simulated by

  20. Noncontact optical motion sensing for real-time analysis

    Science.gov (United States)

    Fetzer, Bradley R.; Imai, Hiromichi

    1990-08-01

    The adaptation of an image dissector tube (IDT) within the OPTFOLLOW system provides high resolution displacement measurement of a light discontinuity. Due to the high speed response of the IDT and the advanced servo loop circuitry, the system is capable of real time analysis of the object under test. The image of the discontinuity may be contoured by direct or reflected light and ranges spectrally within the field of visible light. The image is monitored to 500 kHz through a lens configuration which transposes the optical image upon the photocathode of the IDT. The photoelectric effect accelerates the resultant electrons through a photomultiplier and an enhanced current is emitted from the anode. A servo loop controls the electron beam, continually centering it within the IDT using magnetic focusing of deflection coils. The output analog voltage from the servo amplifier is thereby proportional to the displacement of the target. The system is controlled by a microprocessor with a 32kbyte memory and provides a digital display as well as instructional readout on a color monitor allowing for offset image tracking and automatic system calibration.

  1. Resistive MHD Stability Analysis in Near Real-time

    Science.gov (United States)

    Glasser, Alexander; Kolemen, Egemen

    2017-10-01

    We discuss the feasibility of a near real-time calculation of the tokamak Δ' matrix, which summarizes MHD stability to resistive modes, such as tearing and interchange modes. As the operational phase of ITER approaches, solutions for active feedback tokamak stability control are needed. It has been previously demonstrated that an ideal MHD stability analysis is achievable on a sub- O (1 s) timescale, as is required to control phenomena comparable with the MHD-evolution timescale of ITER. In the present work, we broaden this result to incorporate the effects of resistive MHD modes. Such modes satisfy ideal MHD equations in regions outside narrow resistive layers that form at singular surfaces. We demonstrate that the use of asymptotic expansions at the singular surfaces, as well as the application of state transition matrices, enable a fast, parallelized solution to the singular outer layer boundary value problem, and thereby rapidly compute Δ'. Sponsored by US DOE under DE-SC0015878 and DE-FC02-04ER54698.

  2. Validation of tumor markers in central nervous system germ cell tumors by real-time reverse transcriptase polymerase chain reaction using formalin-fixed paraffin-embedded tissues.

    Science.gov (United States)

    Kim, Dowhan; Lee, Da Hye; Choi, Junjeong; Shim, Kyu Won; Kim, Se Hoon

    2013-01-01

    The therapeutic protocols for treatment of germinomas and non-germinomatous germ cell tumors (NGGCTs) are completely different, so it is important to distinguish pure germinomas from NGGCTs. As it can be difficult to diagnose by morphology alone, immunohisto-chemistry (IHC) has been widely used as an ancillary test to improve diagnostic accuracy. However, IHC has limitations due to the misinterpretation of results or the aberrant loss of immunoreactivity. However, real-time RT-PCR has certain advantages over IHC, including its quantitative nature. The aim of our study was to evaluate the usefulness of real-time RT-PCR on formalin-fixed paraffin-embedded (FFPE) tissue blocks for the diagnosis of germ cell tumors of the central nervous system. We selected eight markers of germ cell tumors using a literature search, and validated them using real-time RT-PCR. Among them, POU5F1, NANOG and TGFB2 were statistically significant (P=0.05) in multiple comparisons (MANOVA) of three groups (pure germinomas, mature teratomas and malignant germ cell tumors). Two-group (pure germinomas and NGGCTs) discriminant analysis achieved a 70.0% success rate in cross-validation. We concluded that real-time RT-PCR using FFPE tissue has adequate validating power comparable to IHC in the diagnosis of central nervous system germ cell tumors; therefore, when IHC is not available, not conclusive or not informative, RT-PCR is a potential alternative to a repeat biopsy.

  3. Modelling and analysis of real-time coordination patterns

    NARCIS (Netherlands)

    Kemper, Stephanie

    2011-01-01

    Present-day embedded software systems need to support an increasing number of features and formalisms; the two most important ones being handling of real-time, and the possibility to develop the system in a modular, component-based way. To ensure that the behaviour of the final system is correct

  4. ANALYSIS OF REAL-TIME VEHICLE HYDROCARBON EMISSIONS DATA

    Science.gov (United States)

    The report gives results of analyses using real-time dynamometer test emissions data from 13 passenger cars to examine variations in emissions during different speeds or modes of travel. The resulting data provided a way to separately identify idle, cruise, acceleration, and dece...

  5. Comparative analysis of fluorescence in situ hybridizationand real time polymerase chain reaction in diagnosis of chronic myeloid leukemia

    International Nuclear Information System (INIS)

    Ali, J.; Khan, S.A.; Rauf, S.E.; Ayyub, M.; Ali, N.

    2017-01-01

    To compare the sensitivity and specificity of fluorescence in situ hybridization (FISH) with real time polymerase chain reaction (RT-PCR) in the diagnosis of Chronic Myeloid Leukemia (CML). Study Design: A cross-sectional, analytical study. Place and Duration of Study: Haematology Department, Armed Forces Institute of Pathology, Rawalpindi, from January 2012 to February 2014. Methodology:A total number of 87 patients of CML were studied. The diagnosis was made on the basis of clinical history, peripheral blood and bone marrow aspiration. These patients were tested for the presence of BCR-ABL1 fusion gene by RT-PCR and FISH. About 5 ml of venous blood was collected, half was taken in heparin for FISH and half in ethylenediamine tetra-acetic acid (EDTA) for CBC and PCR. For FISH, cells were cultured for 24 hours in RPMI 1640 medium and evaluated using BX51 fluorescence microscope for dual fusion signal of yellow colour. Samples having 20 or more interphases positive for dual fusion signals were taken as positive. For PCR, RNA extraction was done by Tri-Reagent LS (MRC, USA) and cDNA was synthesized using reverse transcriptase and gene specific primer. RT-PCR was done on ABI-7500. The positive samples were identified when fluorescence exceeded threshold limit. Results of RT-PCR and FISH were compared. Results: Out of the 87 patients, 85 (97.7%) were PCR positive and 2 (2.3%) were PCR negative, whereas in FISH 83 (95.4%) were positive and 4 (4.5%) were negative. Sensitivity and specificity of FISH was 97.6% and 100%, respectively. Conclusion: FISH is a reliable supplementary method to PCR for detection of BCR-ABL1 fusion gene in the diagnosis of CML. (author)

  6. Real-Time Polymerase Chain Reaction: Applications in Diagnostic Microbiology

    Directory of Open Access Journals (Sweden)

    Kordo B. A. Saeed

    2013-11-01

    Full Text Available The polymerase chain reaction (PCR has revolutionized the detection of DNA and RNA. Real-Time PCR (RT-PCR is becoming the gold standard test for accurate, sensitive and fast diagnosis for a large range of infectious agents. Benefits of this procedure over conventional methods for measuring RNA include its sensitivity, high throughout and quantification. RT-PCR assays have advanced the diagnostic abilities of clinical laboratories particularly microbiology and infectious diseases. In this review we would like to briefly discuss RT-PCR in diagnostic microbiology laboratory, beginning with a general introduction to RT-PCR and its principles, setting up an RT PCR, including multiplex systems and the avoidance and remediation of contamination issues. A segment of the review would be devoted to the application of RT-PCR in clinical practice concentrating on its role in the diagnosis and treatment of infectious diseases.

  7. Analysis of real-time reservoir monitoring : reservoirs, strategies, & modeling.

    Energy Technology Data Exchange (ETDEWEB)

    Mani, Seethambal S.; van Bloemen Waanders, Bart Gustaaf; Cooper, Scott Patrick; Jakaboski, Blake Elaine; Normann, Randy Allen; Jennings, Jim (University of Texas at Austin, Austin, TX); Gilbert, Bob (University of Texas at Austin, Austin, TX); Lake, Larry W. (University of Texas at Austin, Austin, TX); Weiss, Chester Joseph; Lorenz, John Clay; Elbring, Gregory Jay; Wheeler, Mary Fanett (University of Texas at Austin, Austin, TX); Thomas, Sunil G. (University of Texas at Austin, Austin, TX); Rightley, Michael J.; Rodriguez, Adolfo (University of Texas at Austin, Austin, TX); Klie, Hector (University of Texas at Austin, Austin, TX); Banchs, Rafael (University of Texas at Austin, Austin, TX); Nunez, Emilio J. (University of Texas at Austin, Austin, TX); Jablonowski, Chris (University of Texas at Austin, Austin, TX)

    2006-11-01

    The project objective was to detail better ways to assess and exploit intelligent oil and gas field information through improved modeling, sensor technology, and process control to increase ultimate recovery of domestic hydrocarbons. To meet this objective we investigated the use of permanent downhole sensors systems (Smart Wells) whose data is fed real-time into computational reservoir models that are integrated with optimized production control systems. The project utilized a three-pronged approach (1) a value of information analysis to address the economic advantages, (2) reservoir simulation modeling and control optimization to prove the capability, and (3) evaluation of new generation sensor packaging to survive the borehole environment for long periods of time. The Value of Information (VOI) decision tree method was developed and used to assess the economic advantage of using the proposed technology; the VOI demonstrated the increased subsurface resolution through additional sensor data. Our findings show that the VOI studies are a practical means of ascertaining the value associated with a technology, in this case application of sensors to production. The procedure acknowledges the uncertainty in predictions but nevertheless assigns monetary value to the predictions. The best aspect of the procedure is that it builds consensus within interdisciplinary teams The reservoir simulation and modeling aspect of the project was developed to show the capability of exploiting sensor information both for reservoir characterization and to optimize control of the production system. Our findings indicate history matching is improved as more information is added to the objective function, clearly indicating that sensor information can help in reducing the uncertainty associated with reservoir characterization. Additional findings and approaches used are described in detail within the report. The next generation sensors aspect of the project evaluated sensors and packaging

  8. Quantitative analysis of real-time radiographic systems

    International Nuclear Information System (INIS)

    Barker, M.D.; Condon, P.E.; Barry, R.C.; Betz, R.A.; Klynn, L.M.

    1988-01-01

    A method was developed which yields quantitative information on the spatial resolution, contrast sensitivity, image noise, and focal spot size from real time radiographic images. The method uses simple image quality indicators and computer programs which make it possible to readily obtain quantitative performance measurements of single or multiple radiographic systems. It was used for x-ray and optical images to determine which component of the system was not operating up to standard. Focal spot size was monitored by imaging a bar pattern. This paper constitutes the second progress report on the development of the camera and radiation image quality indicators

  9. Performance of a RT-PCR Assay in Comparison to FISH and Immunohistochemistry for the Detection of ALK in Non-Small Cell Lung Cancer.

    Science.gov (United States)

    Hout, David R; Schweitzer, Brock L; Lawrence, Kasey; Morris, Stephan W; Tucker, Tracy; Mazzola, Rosetta; Skelton, Rachel; McMahon, Frank; Handshoe, John; Lesperance, Mary; Karsan, Aly; Saltman, David L

    2017-08-01

    Patients with lung cancers harboring an activating anaplastic lymphoma kinase ( ALK ) rearrangement respond favorably to ALK inhibitor therapy. Fluorescence in situ hybridization (FISH) and immunohistochemistry (IHC) are validated and widely used screening tests for ALK rearrangements but both methods have limitations. The ALK RGQ RT-PCR Kit (RT-PCR) is a single tube quantitative real-time PCR assay for high throughput and automated interpretation of ALK expression. In this study, we performed a direct comparison of formalin-fixed paraffin-embedded (FFPE) lung cancer specimens using all three ALK detection methods. The RT-PCR test (diagnostic cut-off Δ C t of ≤8) was shown to be highly sensitive (100%) when compared to FISH and IHC. Sequencing of RNA detected full-length ALK transcripts or EML4-ALK and KIF5B-ALK fusion variants in discordant cases in which ALK expression was detected by the ALK RT-PCR test but negative by FISH and IHC. The overall specificity of the RT-PCR test for the detection of ALK in cases without full-length ALK expression was 94% in comparison to FISH and sequencing. These data support the ALK RT-PCR test as a highly efficient and reliable diagnostic screening approach to identify patients with non-small cell lung cancer whose tumors are driven by oncogenic ALK.

  10. Combination of RT-PCR and proteomics for the identification of Crimean-Congo hemorrhagic fever virus in ticks

    Directory of Open Access Journals (Sweden)

    Isabel G. Fernández de Mera

    2017-07-01

    Full Text Available Crimean-Congo hemorrhagic fever (CCHF is an emerging tick-borne zoonotic disease caused by the CCHF virus (CCHFV. In this study, an experimental approach combining RT-PCR and proteomics was used for the identification and characterization of CCHFV in 106 ticks from 7 species that were collected from small ruminants in Greece. The methodological approach included an initial screening for CCHFV by RT-PCR followed by proteomics analysis of positive and control negative tick samples. This novel approach allowed the identification of CCHFV-positive ticks and provided additional information to corroborate the RT-PCR findings using a different approach. Two ticks, Dermacentor marginatus and Haemaphysalis parva collected from a goat and a sheep, respectively were positive for CCHFV. The sequences for CCHFV RNA segments S and L were characterized by RT-PCR and proteomics analysis of tick samples, respectively. These results showed the possibility of combining analyses at the RNA and protein levels using RT-PCR and proteomics for the characterization of CCHFV in ticks. The results supported that the CCHFV identified in ticks are genetic variants of the AP92 strain. Although the AP92-like strains probably do not represent a high risk of CCHF to the population, the circulation of genetically diverse CCHFV strains could potentially result in the appearance of novel viral genotypes with increased pathogenicity and fitness.

  11. Differential expression analysis of boron transporters and some stress-related genes in response to 24-epibrassinolide and boron by semi-quantitative RT-PCR in Arabidopsis thaliana (L. Heynh

    Directory of Open Access Journals (Sweden)

    Surgun Yonca

    2016-01-01

    Full Text Available Plant steroidal hormones, brassinosteroids (BRs, promote plant developmental processes and enhance tolerance to several abiotic stresses including high boron (B stress. To examine the possible role of BR in high B-induced stress at the transcriptional level, we investigated the response of B transporter genes (BOR1-4, high B-induced genes (MATE, Hsp-like, BR-induced genes (Hsp70-4, Hsp90-1 and other stress-related genes (LTI/COR78, LEA4-5 upon exogenous treatments of 24-epibrassinolide (EBL on Arabidopsis thaliana (L. Heynh exposed to high concentrations of boric acid (BA using semi-quantitative RT-PCR. BA treatments led to down regulation of BOR1 and BOR3 genes in leaf and root tissues and higher concentration of EBL further decreased expression of these genes in roots. The expression of high B-induced genes was observed to be upregulated by 1 μM EBL treatment under high B stress in both tissues of the seedlings. The upregulation of BR-induced genes were clearly evident in root tissues co-treated with 1 μM EBL and BA as compared to BA alone. Higher concentration of EBL was found to be more effective in increasing expression of LTI/COR78 gene in root and LEA4-5 gene in shoot tissues. To our knowledge, this is the first report how exogenous application of EBL modulates high B stress responses at molecular level in model plant Arabidopsis thaliana.

  12. Detection of avian metapneumovirus subtypes in turkeys using RT-PCR.

    Science.gov (United States)

    Ongor, H; Karahan, M; Kalin, R; Bulut, H; Cetinkaya, B

    2010-03-20

    This study investigated the prevalence of avian metapneumovirus (aMPV) and the detection of molecular subtypes of field strains of the virus using RT-PCR in clinically healthy turkeys and those showing signs of respiratory disease. In the RT-PCR examination of 624 tracheal tissue samples collected from a local turkey abattoir, 2.9 per cent (18/624) of samples tested positive. In the examination of tracheal swab samples collected from flocks with respiratory problems, 18 of 20 samples tested positive. When the results were assessed at flock level, aMPV infection was detected in only one of the 23 clinically healthy turkey flocks, whereas all four flocks with respiratory problems were infected. Molecular typing using primers specific to the attachment glycoprotein (G) gene showed that all 36 positive samples belonged to subtype B. Partial sequence analysis of DNA samples showed 95 per cent homology between the field types and the reference strain aMPV subtype B. Whereas clinically healthy turkeys had been vaccinated with a subtype A virus vaccine, the flocks with respiratory problems had been vaccinated with a subtype B virus vaccine. Despite four blind passages of RT-PCR-positive samples on Vero and chicken embryo fibroblast cells, no cytopathic effect was detected by microscopic examination.

  13. A Multiplex RT-PCR Assay for S. aureus, L. monocytogenes, and Salmonella spp. Detection in Raw Milk with Pre-enrichment

    Directory of Open Access Journals (Sweden)

    Tian Ding

    2017-05-01

    Full Text Available This study firstly developed a multiplex real-time PCR (RT-PCR technique combined with a pre-enrichment step to simultaneously detect Staphylococcus aureus (S. aureus, Listeria monocytogenes (L. monocytogenes and Salmonella spp. in raw milk and the dairy farm environment (feces, soil, feed, water in one reaction. Brain heart infusion (BHI broth was selected for the enrichment step to increase the density of the target bacteria by using an incubation of 4 h before multiplex RT-PCR. The results showed that the detection limit of the multiplex real-time assay was approximately 102 CFU/mL for pure cultures and artificially contaminated milk without enrichment, while 12, 14, and 10 CFU/25 mL, respectively, for S. aureus, L. monocytogenes, and Salmonella spp. after pre-enrichment. The newly developed multiplex RT-PCR assay was applied to 46 dairy farm environmental samples and raw milk samples covering a wide variety of sample types. The results demonstrated that the multiplex RT-PCR assay coupled with the BHI enrichment broth was suitable for the simultaneous screening of S. aureus, L. monocytogenes, and Salmonella spp. in the pasture environment and in raw milk. The multiplex RT-PCR assay clearly and successfully shortened the total detection time and reduced labor compared to conventional culture-based methods for testing natural samples.

  14. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets.

    Science.gov (United States)

    Liu, Xin; Guan, Huirui; Song, Min; Fu, Yanping; Han, Xiaomin; Lei, Meng; Ren, Jingyu; Guo, Bin; He, Wei; Wei, Yahui

    2018-01-01

    Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR) is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs) as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported. In this study, 10 candidate RGs namely, 18S , 60S , CYP , GAPCP1 , GAPDH2 , EF1B , MDH , SAND , TUA1 , and TUA6 , were singled out from the transcriptome database of S. chamaejasme , and their expression stability under three abiotic stresses (drought, cold, and salt) and three hormone treatments (abscisic acid, ABA; gibberellin, GA; ethephon, ETH) were estimated with the programs geNorm, NormFinder, and BestKeeper. Our results showed that GAPCP1 and EF1B were the best combination for the three abiotic stresses, whereas TUA6 and SAND , TUA1 and CYP , GAPDH2 and 60S were the best choices for ABA, GA, and ETH treatment, respectively. Moreover, GAPCP1 and 60S were assessed to be the best combination for all samples, and 18S was the least stable RG for use as an internal control in all of the experimental subsets. The expression patterns of two target genes ( P5CS2 and GI ) further verified that the RGs that we selected were suitable for gene expression normalization. This work is the first attempt to

  15. Reference gene selection for qRT-PCR assays in Stellera chamaejasme subjected to abiotic stresses and hormone treatments based on transcriptome datasets

    Directory of Open Access Journals (Sweden)

    Xin Liu

    2018-04-01

    Full Text Available Background Stellera chamaejasme Linn, an important poisonous plant of the China grassland, is toxic to humans and livestock. The rapid expansion of S. chamaejasme has greatly damaged the grassland ecology and, consequently, seriously endangered the development of animal husbandry. To draft efficient prevention and control measures, it has become more urgent to carry out research on its adaptive and expansion mechanisms in different unfavorable habitats at the genetic level. Quantitative real-time polymerase chain reaction (qRT-PCR is a widely used technique for studying gene expression at the transcript level; however, qRT-PCR requires reference genes (RGs as endogenous controls for data normalization and only through appropriate RG selection and qRT-PCR can we guarantee the reliability and robustness of expression studies and RNA-seq data analysis. Unfortunately, little research on the selection of RGs for gene expression data normalization in S. chamaejasme has been reported. Method In this study, 10 candidate RGs namely, 18S, 60S, CYP, GAPCP1, GAPDH2, EF1B, MDH, SAND, TUA1, and TUA6, were singled out from the transcriptome database of S. chamaejasme, and their expression stability under three abiotic stresses (drought, cold, and salt and three hormone treatments (abscisic acid, ABA; gibberellin, GA; ethephon, ETH were estimated with the programs geNorm, NormFinder, and BestKeeper. Result Our results showed that GAPCP1 and EF1B were the best combination for the three abiotic stresses, whereas TUA6 and SAND, TUA1 and CYP, GAPDH2 and 60S were the best choices for ABA, GA, and ETH treatment, respectively. Moreover, GAPCP1 and 60S were assessed to be the best combination for all samples, and 18S was the least stable RG for use as an internal control in all of the experimental subsets. The expression patterns of two target genes (P5CS2 and GI further verified that the RGs that we selected were suitable for gene expression normalization. Discussion

  16. Selection and validation of appropriate reference genes for quantitative real-time PCR analysis in Salvia hispanica.

    Directory of Open Access Journals (Sweden)

    Rahul Gopalam

    Full Text Available Quantitative real-time polymerase chain reaction (qRT-PCR has become the most popular choice for gene expression studies. For accurate expression analysis, it is pertinent to select a stable reference gene to normalize the data. It is now known that the expression of internal reference genes varies considerably during developmental stages and under different experimental conditions. For Salvia hispanica, an economically important oilseed crop, there are no reports of stable reference genes till date. In this study, we chose 13 candidate reference genes viz. Actin11 (ACT, Elongation factor 1-alpha (EF1-α, Eukaryotic translation initiation factor 3E (ETIF3E, alpha tubulin (α-TUB, beta tubulin (β-TUB, Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, Cyclophilin (CYP, Clathrin adaptor complex (CAC, Serine/threonine-protein phosphatase 2A (PP2A, FtsH protease (FtsH, 18S ribosomal RNA (18S rRNA, S-adenosyl methionine decarboxylase (SAMDC and Rubisco activase (RCA and the expression levels of these genes were assessed in a diverse set of tissue samples representing vegetative stages, reproductive stages and various abiotic stress treatments. Two of the widely used softwares, geNorm and Normfinder were used to evaluate the expression stabilities of these 13 candidate reference genes under different conditions. Results showed that GAPDH and CYP expression remain stable throughout in the different abiotic stress treatments, CAC and PP2A expression were relatively stable under reproductive stages and α-TUB, PP2A and ETIF3E were found to be stably expressed in vegetative stages. Further, the expression levels of Diacylglycerol acyltransferase (DGAT1, a key enzyme in triacylglycerol synthesis was analyzed to confirm the validity of reference genes identified in the study. This is the first systematic study of selection of reference genes in S. hispanica, and will benefit future expression studies in this crop.

  17. On-line real time gamma analysis of primary coolant

    International Nuclear Information System (INIS)

    Kalechstein, W.; Kupca, S.; Lipsett, J.J.

    1985-10-01

    The evolution of failed fuel monitoring at CANDU power stations is briefly summarized and the design of the latest system for failed fuel detection at a multi-unit power station is described. At each reactor, the system employs a germanium spectrometer combined with a novel spectrum analyzer that simultaneously accumulates the gamma-ray spectrum of the coolant and provides the control room with the concentration of radioisotope activity in the coolant for the gaseous fission products Xe-133, Xe-135, Kr-88 and I-131 in real time and with statistical precision independent of count rate. A gross gamma monitor is included to provide independent information on the level of radioactivity in the coolant and extend the measurement range at very high count rates. A central computer system archives spectra received from all four spectrum analyzers and provides both the activity concentrations and the release rates of specified isotopes. Compared with previous systems the current design offers improvements in that the activity concentrations are updated much more frequently, improved tools are provided for long term surveillance of the heat transport system and the monitor is more reliable and less costly

  18. REAL TIME ANALYSIS OF WIRELESS CONTROLLER AREA NETWORK

    Directory of Open Access Journals (Sweden)

    Gerardine Immaculate Mary

    2014-09-01

    Full Text Available It is widely known that Control Area Networks (CAN are used in real-time, distributed and parallel processing which cover manufacture plants, humanoid robots, networking fields, etc., In applications where wireless conditions are encountered it is convenient to continue the exchange of CAN frames within the Wireless CAN (WCAN. The WCAN considered in this research is based on wireless token ring protocol (WTRP; a MAC protocol for wireless networks to reduce the number of retransmissions due to collision and the wired counterpart CAN attribute on message based communication. WCAN uses token frame method to provide channel access to the nodes in the system. This method allow all the nodes to share common broadcast channel by taken turns in transmitting upon receiving the token frame which is circulating within the network for specified amount of time. This method provides high throughput in bounded latency environment, consistent and predictable delays and good packet delivery ratio. The most important factor to consider when evaluating a control network is the end-to-end time delay between sensors, controllers, and actuators. The correct operation of a control system depends on the timeliness of the data coming over the network, and thus, a control network should be able to guarantee message delivery within a bounded transmission time. The proposed WCAN is modeled and simulated using QualNet, and its average end to end delay and packet delivery ratio (PDR are calculated. The parameters boundaries of WCAN are evaluated to guarantee a maximum throughput and a minimum latency time, in the case of wireless communications, precisely WCAN.

  19. Evaluation of ALK gene rearrangement in central nervous system metastases of non-small-cell lung cancer using two-step RT-PCR technique.

    Science.gov (United States)

    Nicoś, M; Krawczyk, P; Wojas-Krawczyk, K; Bożyk, A; Jarosz, B; Sawicki, M; Trojanowski, T; Milanowski, J

    2017-12-01

    RT-PCR technique has showed a promising value as pre-screening method for detection of mRNA containing abnormal ALK sequences, but its sensitivity and specificity is still discussable. Previously, we determined the incidence of ALK rearrangement in CNS metastases of NSCLC using IHC and FISH methods. We evaluated ALK gene rearrangement using two-step RT-PCR method with EML4-ALK Fusion Gene Detection Kit (Entrogen, USA). The studied group included 145 patients (45 females, 100 males) with CNS metastases of NSCLC and was heterogeneous in terms of histology and smoking status. 21% of CNS metastases of NSCLC (30/145) showed presence of mRNA containing abnormal ALK sequences. FISH and IHC tests confirmed the presence of ALK gene rearrangement and expression of ALK abnormal protein in seven patients with positive result of RT-PCR analysis (4.8% of all patients, 20% of RT-PCR positive patients). RT-PCR method compared to FISH analysis achieved 100% of sensitivity and only 82.7% of specificity. IHC method compared to FISH method indicated 100% of sensitivity and 97.8% of specificity. In comparison to IHC, RT-PCR showed identical sensitivity with high number of false positive results. Utility of RT-PCR technique in screening of ALK abnormalities and in qualification patients for molecularly targeted therapies needs further validation.

  20. Epidemiological, clinical and laboratory profile of scrub typhus cases detected by serology and RT-PCR in Kumaon, Uttarakhand: a hospital-based study.

    Science.gov (United States)

    Rawat, Vinita; Singh, Rajesh Kumar; Kumar, Ashok; Saxena, Sandip R; Varshney, Umesh; Kumar, Mukesh

    2018-04-01

    We analysed the epidemiology, clinical and laboratory data of the 168 scrub typhus cases confirmed by a combination of any one of the following: real time polymerase chain reaction (RT-PCR) and/or immunofluorescence assay (IFA) (IgM and/or IgG). The peak season for scrub typhus was from July to October. By multivariate binary logistic regression analysis, the risk of scrub typhus was about four times in those working in occupation related to forest work. Major clinical manifestations were fever (100%), myalgia (65%), cough (51%) and vomiting (46%); major complications were meningitis/meningoencephatilitis (12.5%) and multi-organ failure (MOF) and pneumonia (5.3% each). Laboratory investigations revealed raised aminotranferase levels and thrombocytopenia in most confirmed cases. We conclude that scrub typhus is an important cause of febrile illness in the Kumaon hills of Uttarakhand where this disease had not previously been considered to exist.

  1. A novel RT-PCR for the detection of Helicobacter pylori and identification of clarithromycin resistance mediated by mutations in the 23S rRNA gene.

    Science.gov (United States)

    Redondo, Javier Jareño; Keller, Peter M; Zbinden, Reinhard; Wagner, Karoline

    2018-01-01

    In this study we evaluated the commercially available LightMix® RT-PCR assay for Helicobacter pylori detection and identification of clarithromycin (CLR) resistance in culture and clinical specimens (gastric biopsies and stool). The H. pylori LightMix® RT-PCR detects a 97bp long fragment of the 23S rRNA gene and allows the identification of 3 distinct point mutations conferring CLR resistance via melting curve analysis. The performance of the H. pylori LightMix® RT-PCR was evaluated using a set of 60 H. pylori strains showing phenotypical CLR susceptibility or CLR resistance (Minimum inhibitory concentrations from 0.016 to 256mg/L). We found high concordance (95%) between phenotypical CLR resistance screening by E-Test® and the Lightmix® RT-PCR. Discrepant results were verified by sequencing of the 23S rRNA gene that always confirmed the results obtained by Lightmix® RT-PCR. Furthermore, H. pylori was detected in clinical biopsy and stool specimens by Lightmix® RT-PCR that identified the correct H. pylori genotype. The LightMix® RT-PCR is an accurate, sensitive and easy to use test for H. pylori and CLR resistance detection and can therefore be readily implemented in any diagnostic laboratory. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Comparison of real-time and quantitative polymerase chain reaction assays in detection of cytomegalovirus DNA in clinical specimens

    International Nuclear Information System (INIS)

    Gokahmetoglu, S.; Deniz, E.

    2007-01-01

    To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)

  3. Simultaneous VENTANA IHC and RT-PCR testing of ALK status in Chinese non-small cell lung cancer patients and response to crizotinib.

    Science.gov (United States)

    Xu, Chun-Wei; Wang, Wen-Xian; Chen, Yan-Ping; Chen, Yu; Liu, Wei; Zhong, Li-Hua; Chen, Fang-Fang; Zhuang, Wu; Song, Zheng-Bo; Chen, Xiao-Hui; Huang, Yun-Jian; Guan, Yan-Fang; Yi, Xin; Lv, Tang-Feng; Zhu, Wei-Feng; Lu, Jian-Ping; Wang, Xiao-Jiang; Shi, Yi; Lin, Xian-Dong; Chen, Gang; Song, Yong

    2018-04-11

    ALK rearrangement-advanced NSCLC patients respond to crizotinib. ALK rearrangement is currently determined with RT-PCR. VENTANA IHC is a standard method to identify ALK protein overexpression in NSCLC; however, VENTANA IHC has rarely been used to determine the response to crizotinib in Chinese patients with NSCLC and ALK overexpression. To better clarify the clinical implication of VENTANA IHC to detect ALK rearrangements, we conducted this study to analyze VENTANA IHC and RT-PCR in a large cohort of Chinese patients with NSCLC undergoing screening for ALK rearrangements. A total of 1720 patients with NSCLC who had ALK rearrangements detected by VENTANA IHC and/or RT-PCR were included in this analysis. We compared the efficacy and survival of ALK-positive patients detected by VENTANA IHC and RT-PCR. We used NGS to identify patients in whom the two methods were inconsistent. Among 1720 patients, 187 (10.87%) were shown to be ALK-positive by VENTANA IHC and/or RT-PCR, and 66 received crizotinib treatment. We identified 10.27% (172/1674) of patients as ALK-positive by the VENTANA IHC method, and 12.73% (41/322) of patients had ALK rearrangements by the RT-PCR method. Twenty-nine of 276 (10.51%) ALK-positive patients were simultaneously analyzed using VENTANA IHC and RT-PCR. The overall response rates were 65.90% (29/44) by VENTANA IHC and 55.88% (19/34) by RT-PCR. The disease control rates were 86.36% (38/44) by VENTANA IHC and 76.47% (26/34) by RT-PCR. In contrast, the median progression-free survival for VENTANA IHC and RT-PCR was 8.5 and 9.2 months, respectively. The VENTANA IHC and RT-PCR results obtained for 6 of 17 ALK-positive patients were inconsistent based on NGS; specifically, 4 patients had EML4-ALK fusions, 2 patients had non EML4-ALK fusions, 1 patient had a KCL1-ALK fusion, and one patient had a FBXO36-ALK fusion. VENTANA IHC is a reliable and rapid screening tool used in routine pathologic laboratories for the identification of suitable candidates for

  4. Clinical utility of RT-PCR in assessing HER 2 gene expression versus traditional IHC and FISH in breast cancer patients.

    Science.gov (United States)

    Suryavanshi, Moushumi; Mehta, Anurag; Jaipuria, Jiten; Kumar, Dushyant; Vishwakarma, Gayatri; Panigrahi, Manoj Kumar; Verma, Haristuti; Saifi, Mumtaz; Sharma, Sanjeev; Tandon, Simran; Doval, D C; Das, Bhudev C

    2018-02-09

    IHC and FISH are used for categorizing HER 2 status in breast cancer at the protein and DNA level, respectively. HER 2 expression at the RNA level is quantitative, cheaper, easier to standardize and free from interobserver variation. 115 consecutive patients were tested by IHC, FISH and RT-PCR (test cohort). Assuming FISH result to be the response variable, ROC curves for RT-PCR ratio were analyzed to label HER 2 negative, equivocal and positive cases as RT-PCR score 1, 2 and 3, respectively. Inter-relationships between RT-PCR, IHC and FISH were defined. 'Clinical benefit' of a test was defined as proportion of patients labeled unequivocally as HER 2 positive or negative. Population for 1 year was simulated constraint to previous reports of HER 2 positivity and IHC category distribution by a meta-analysis of previous studies that evaluated concordance between IHC and FISH to determine HER 2 status (simulation cohort). Four diagnostic pathways in the simulation cohort were defined-(1) initial IHC, followed by FISH (conventional pathway); (2) initial RT-PCR, followed by FISH; (3) initial IHC, followed by RT-PCR and then by FISH; (4) initial RT-PCR, followed by IHC and then by FISH. The clinical benefit of IHC and RT-PCR in the four pathways was analyzed and sensitivity analysis for incremental cost-effectiveness ratio and cost-benefit comapring RT-PCR against IHC, both as first-line tests and among those with IHC score 2 as a reflex second-line test was performed by the Monte Carlo technique. 115 patients comprised the study population. While none with IHC score of 0 or 1 was FISH positive for HER 2, all cases with IHC score of 3 were FISH positive. 43 cases were assigned IHC score of 2. Thus, 72 patients benefited from the initial IHC testing [clinical benefit 62.6%], with the overall concordance between IHC and FISH being 100% for those with IHC score of 0, 1 and 3 (conclusive IHC categories). For RT-PCR with 100% concordance, 15.7% (115-97 = 18) patients

  5. Image analysis of multiple moving wood pieces in real time

    Science.gov (United States)

    Wang, Weixing

    2006-02-01

    This paper presents algorithms for image processing and image analysis of wood piece materials. The algorithms were designed for auto-detection of wood piece materials on a moving conveyor belt or a truck. When wood objects on moving, the hard task is to trace the contours of the objects in n optimal way. To make the algorithms work efficiently in the plant, a flexible online system was designed and developed, which mainly consists of image acquisition, image processing, object delineation and analysis. A number of newly-developed algorithms can delineate wood objects with high accuracy and high speed, and in the wood piece analysis part, each wood piece can be characterized by a number of visual parameters which can also be used for constructing experimental models directly in the system.

  6. Analysis and Optimization of Distributed Real-Time Embedded Systems

    DEFF Research Database (Denmark)

    Pop, Paul; Eles, Petru; Peng, Zebo

    2006-01-01

    and scheduling policies. In this context, the task of designing such systems is becoming increasingly difficult. The success of new adequate design methods depends on the availability of efficient analysis as well as optimization techniques. In this paper, we present both analysis and optimization approaches...... characteristic to this class of systems: mapping of functionality, the optimization of the access to the communication channel, and the assignment of scheduling policies to processes. Optimization heuristics aiming at producing a schedulable system, with a given amount of resources, are presented....

  7. Real Time Analysis: Does Navy Have a Plan?

    Science.gov (United States)

    2015-06-12

    our militaries face. Peter Tran, senior director of the worldwide advanced cyber defense practice at RSA , commented that “Historically, the...should look like for analysis on the data Navy needs to analyze when he stated: Computers, communications links, encryption devices, and other IT allow

  8. Mass spectrometry for real-time quantitative breath analysis

    Czech Academy of Sciences Publication Activity Database

    Smith, D.; Španěl, Patrik; Herbig, J.; Beauchamp, J.

    2014-01-01

    Roč. 8, č. 2 (2014), 027101 ISSN 1752-7155 Institutional support: RVO:61388955 Keywords : breath analysis * proton transfer reaction mass spectrometry * selected ion flow tube mass spectrometry Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.631, year: 2014

  9. Interactive Construction Digital Tools With Real Time Analysis

    DEFF Research Database (Denmark)

    Klitgaard, Jens; Kirkegaard, Poul Henning

    2007-01-01

    . The aim of this research is to look into integrated digital design and analysis tools in order to find out if it is suited for use by architects and designers or only by specialists and technicians - and if not, then to look at what can be done to make them more available to architects and designers...... an architect-engineer or hybrid practitioner works simultaneously with both aesthetic and technical design requirements. In this paper the problem of a vague or not existing link between digital design tools, used by architects and designers, and the analysis tools developed by and for engineers is considered......The recent developments in computational design tools have evolved into a sometimes purely digital process which opens up for new perspectives and problems in the sketching process. One of the interesting possibilities lay within the hybrid practitioner- or architect-engineer approach, where...

  10. The economic analysis of power market architectures: application to real-time market design

    International Nuclear Information System (INIS)

    Saguan, M.

    2007-04-01

    This work contributes to the economic analysis of power market architectures. A modular framework is used to separate problems of market design in different modules. The work's goal is to study real-time market design. A two-stage market equilibrium model is used to analyse the two main real-time designs: the 'market' and the 'mechanism' (with penalty). Numerical simulations show that design applied in real-time is not neutral vis-a-vis of energy markets sequence and the competition dynamic. Designs using penalty (mechanisms) cause distortions, inefficiencies and can create barriers to entry. The size of distortions is given by the temporal position of the gate that closure the forward markets. This model has also allowed us to show the key role of real-time integration between zones and the importance of good harmonization between real-time designs of each zone. (author)

  11. Effectiveness of real-time polymerase chain reaction assay for the detection of Mycobacterium tuberculosis in pathological samples: a systematic review and meta-analysis

    Directory of Open Access Journals (Sweden)

    Emmanuel O. Babafemi

    2017-10-01

    Full Text Available Abstract Background Rapid and accurate diagnosis of tuberculosis (TB is key to manage the disease and to control and prevent its transmission. Many established diagnostic methods suffer from low sensitivity or delay of timely results and are inadequate for rapid detection of Mycobacterium tuberculosis (MTB in pulmonary and extra-pulmonary clinical samples. This study examined whether a real-time polymerase chain reaction (RT-PCR assay, with a turn-a-round time of 2 h, would prove effective for routine detection of MTB by clinical microbiology laboratories. Methods A systematic literature search was performed for publications in any language on the detection of MTB in pathological samples by RT-PCR assay. The following sources were used MEDLINE via PubMed, EMBASE, BIOSIS Citation Index, Web of Science, SCOPUS, ISI Web of Knowledge and Cochrane Infectious Diseases Group Specialised Register, grey literature, World Health Organization and Centres for Disease Control and Prevention websites. Forty-six studies met set inclusion criteria. Generated pooled summary estimates (95% CIs were calculated for overall accuracy and bivariate meta-regression model was used for meta-analysis. Results Summary estimates for pulmonary TB (31 studies were as follows: sensitivity 0.82 (95% CI 0.81–0.83, specificity 0.99 (95% CI 0.99–0.99, positive likelihood ratio 43.00 (28.23–64.81, negative likelihood ratio 0.16 (0.12–0.20, diagnostic odds ratio 324.26 (95% CI 189.08–556.09 and area under curve 0.99. Summary estimates for extra-pulmonary TB (25 studies were as follows: sensitivity 0.70 (95% CI 0.67–0.72, specificity 0.99 (95% CI 0.99–0.99, positive likelihood ratio 29.82 (17.86–49.78, negative likelihood ratio 0.33 (0.26–0.42, diagnostic odds ratio 125.20 (95% CI 65.75–238.36 and area under curve 0.96. Conclusions RT-PCR assay demonstrated a high degree of sensitivity for pulmonary TB and good sensitivity for extra-pulmonary TB. It indicated a

  12. A quantitative method to evaluate mesenchymal stem cell lipofection using real-time PCR.

    Science.gov (United States)

    Ribeiro, S C; Mendes, R; Madeira, C; Monteiro, G A; da Silva, C L; Cabral, J M S

    2010-01-01

    Genetic modification of human mesenchymal stem cells (MSC) is a powerful tool to improve the therapeutic utility of these cells and to increase the knowledge on their regulation mechanisms. In this context, strong efforts have been made recently to develop efficient nonviral gene delivery systems. Although several studies addressed this question most of them use the end product of a reporter gene instead of the DNA uptake quantification to test the transfection efficiency. In this study, we established a method based on quantitative real-time PCR (RT-PCR) to determine the intracellular plasmid DNA copy number in human MSC after lipofection. The procedure requires neither specific cell lysis nor DNA purification. The influence of cell number on the RT-PCR sensitivity was evaluated. The method showed good reproducibility, high sensitivity, and a wide linear range of 75-2.5 x 10⁶ plasmid DNA copies per cell. RT-PCR results were then compared with the percentage of transfected cells assessed by flow cytometry analysis, which showed that flow cytometry-based results are not always proportional to plasmid cellular uptake determined by RT-PCR. This work contributed for the establishment of a rapid quantitative assay to determine intracellular plasmid DNA in stem cells, which will be extremely beneficial for the optimization of gene delivery strategies. © 2010 American Institute of Chemical Engineers

  13. Identification and validation of quantitative real-time reverse transcription PCR reference genes for gene expression analysis in teak (Tectona grandis L.f.).

    Science.gov (United States)

    Galeano, Esteban; Vasconcelos, Tarcísio Sales; Ramiro, Daniel Alves; De Martin, Valentina de Fátima; Carrer, Helaine

    2014-07-22

    Teak (Tectona grandis L.f.) is currently the preferred choice of the timber trade for fabrication of woody products due to its extraordinary qualities and is widely grown around the world. Gene expression studies are essential to explore wood formation of vascular plants, and quantitative real-time reverse transcription PCR (qRT-PCR) is a sensitive technique employed for quantifying gene expression levels. One or more appropriate reference genes are crucial to accurately compare mRNA transcripts through different tissues/organs and experimental conditions. Despite being the focus of some genetic studies, a lack of molecular information has hindered genetic exploration of teak. To date, qRT-PCR reference genes have not been identified and validated for teak. Identification and cloning of nine commonly used qRT-PCR reference genes from teak, including ribosomal protein 60s (rp60s), clathrin adaptor complexes medium subunit family (Cac), actin (Act), histone 3 (His3), sand family (Sand), β-Tubulin (Β-Tub), ubiquitin (Ubq), elongation factor 1-α (Ef-1α), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Expression profiles of these genes were evaluated by qRT-PCR in six tissue and organ samples (leaf, flower, seedling, root, stem and branch secondary xylem) of teak. Appropriate gene cloning and sequencing, primer specificity and amplification efficiency was verified for each gene. Their stability as reference genes was validated by NormFinder, BestKeeper, geNorm and Delta Ct programs. Results obtained from all programs showed that TgUbq and TgEf-1α are the most stable genes to use as qRT-PCR reference genes and TgAct is the most unstable gene in teak. The relative expression of the teak cinnamyl alcohol dehydrogenase (TgCAD) gene in lignified tissues at different ages was assessed by qRT-PCR, using TgUbq and TgEf-1α as internal controls. These analyses exposed a consistent expression pattern with both reference genes. This study proposes a first broad

  14. Quantitation of TGF-beta1 mRNA in porcine mesangial cells by comparative kinetic RT/PCR: comparison with ribonuclease protection assay and in situ hybridization.

    Science.gov (United States)

    Ceol, M; Forino, M; Gambaro, G; Sauer, U; Schleicher, E D; D'Angelo, A; Anglani, F

    2001-01-01

    Gene expression can be examined with different techniques including ribonuclease protection assay (RPA), in situ hybridisation (ISH), and quantitative reverse transcription-polymerase chain reaction (RT/PCR). These methods differ considerably in their sensitivity and precision in detecting and quantifying low abundance mRNA. Although there is evidence that RT/PCR can be performed in a quantitative manner, the quantitative capacity of this method is generally underestimated. To demonstrate that the comparative kinetic RT/PCR strategy-which uses a housekeeping gene as internal standard-is a quantitative method to detect significant differences in mRNA levels between different samples, the inhibitory effect of heparin on phorbol 12-myristate 13-acetate (PMA)-induced-TGF-beta1 mRNA expression was evaluated by RT/PCR and RPA, the standard method of mRNA quantification, and the results were compared. The reproducibility of RT/PCR amplification was calculated by comparing the quantity of G3PDH and TGF-beta1 PCR products, generated during the exponential phases, estimated from two different RT/PCR (G3PDH, r = 0.968, P = 0.0000; TGF-beta1, r = 0.966, P = 0.0000). The quantitative capacity of comparative kinetic RT/PCR was demonstrated by comparing the results obtained from RPA and RT/PCR using linear regression analysis. Starting from the same RNA extraction, but using only 1% of the RNA for the RT/PCR compared to RPA, significant correlation was observed (r = 0.984, P = 0.0004). Moreover the morphometric analysis of ISH signal was applied for the semi-quantitative evaluation of the expression and localisation of TGF-beta1 mRNA in the entire cell population. Our results demonstrate the close similarity of the RT/PCR and RPA methods in giving quantitative information on mRNA expression and indicate the possibility to adopt the comparative kinetic RT/PCR as reliable quantitative method of mRNA analysis. Copyright 2001 Wiley-Liss, Inc.

  15. Real time computer control of a nonlinear Multivariable System via Linearization and Stability Analysis

    International Nuclear Information System (INIS)

    Raza, K.S.M.

    2004-01-01

    This paper demonstrates that if a complicated nonlinear, non-square, state-coupled multi variable system is smartly linearized and subjected to a thorough stability analysis then we can achieve our design objectives via a controller which will be quite simple (in term of resource usage and execution time) and very efficient (in terms of robustness). Further the aim is to implement this controller via computer in a real time environment. Therefore first a nonlinear mathematical model of the system is achieved. An intelligent work is done to decouple the multivariable system. Linearization and stability analysis techniques are employed for the development of a linearized and mathematically sound control law. Nonlinearities like the saturation in actuators are also been catered. The controller is then discretized using Runge-Kutta integration. Finally the discretized control law is programmed in a computer in a real time environment. The programme is done in RT -Linux using GNU C for the real time realization of the control scheme. The real time processes, like sampling and controlled actuation, and the non real time processes, like graphical user interface and display, are programmed as different tasks. The issue of inter process communication, between real time and non real time task is addressed quite carefully. The results of this research pursuit are presented graphically. (author)

  16. Establishment of realtime RT-PCR assay to detect polio virus in the Acute Flaccid Paralysis laboratory surveillance

    Directory of Open Access Journals (Sweden)

    Nike Susanti

    2016-07-01

    Full Text Available AbstrakLatar belakang: Virus polio indigenous terakhir ditemukan di Indonesia tahun 1995 tetapi ancaman viruspolio impor dan mutasi virus dari Oral Polio Vaccine (OPV menjadi Vaccine Derived Poliovirus (VDPVmasih berlanjut. Tahun 1991 WHO mengembangkan Surveilans Acute Flaccid Paralysis (AFP dan tahun2014, identifikasi virus polio dengan real-time reverse transcriptase Polymerase Chain Reaction (rRTPCRmulai digunakan di Laboratorium Nasional Polio Pusat Biomedis dan Teknologi Dasar Kesehatan.Tujuan dari penggunaan rRT-PCR untuk mendapatkan metode yang cepat dan lebih baik dalam memantausirkulasi dan mutasi virus polio.Metode: Isolat polio positif diidentifikasi menggunakanan rRT PCR dengan kombinasi primer dan probeyang ditetapkan WHO. RNA virus di konversi ke cDNA menggunakan reverse transcriptase lalu diamplifikasimenggunakan taq polymerase. Produk PCR di deteksi dan diidentifikasi dengan hibridisasi menggunakanprobe spesifik. Sintesis cDNA dan reaksi PCR menggunakan primer yang dilekatkan di probe. Kombinasiprimer dan probe menghasilkan identifikasi serotipe dan intratypic differentiation (ITD dari isolat virus.Hasil: Selama tahun 2014, NPL Jakarta menerima 604 kasus AFP dari surveilans dan lima kasusterdeteksi positif mengandung virus polio. Semua spesimen positif mengandung virus polio yang berasaldari vaksin. Dua kasus positif virus polio tipe P2 (40%, satu kasus jenis virus polio P1 (20%, 1 kasusjenis virus polio P3 (20% dan satu kasus virus polio campuran jenis P1 + P2 (20%.Kesimpulan: Real-time PCR dapat digunakan di Laboratorium Polio Jakarta untuk membantu identifikasivirus Polio secara cepat. Tes ini dapat digunakan untuk memantau sirkulasi virus polio pada populasiyang rutin diimunisasi dengan OPV. (Health Science Journal of Indonesia 2016;7:27-31Kata kunci: ITD, Poliovirus, Identification, rRT-PCR AbstractBackground: The last indigenous polio was detected in 1995 but the threat of wild type polio viruses and themutation of Oral

  17. Detection of bacterial species involved in perimplantitis concerned with cultural and RT-PCR

    Directory of Open Access Journals (Sweden)

    Marcello Gatti

    2010-06-01

    Full Text Available Dental implants offer new treatment options for edentulous either partially or completely, now represent a viable alternative to conventional fixed protheses. Dental implants are colonized by a flora dominated by Gram-positive facultative aerobic, while in patients with bone loss and formation of pockets peri-implant diseases was found a significant difference in the composition of microflora, bacteria, Gram-negative anaerobes in particular Fusobacterium spp., Treponema denticola (Spirochetes, Tannerella forsythensis, Aggregatibacter actinomycetemcomitans, Prevotella intermedia as interim black-pigmented bacteria, Porphyromonas gingivalis, often in high concentrations. Aims. The purpose of this study was to identify those at risk of perimplantitis using 2 techniques: RT-PCR examination of trade and culture. The results were compared taking into consideration the advantages and disadvantages of both methods. Materials and methods.We studied 24 patients (14 women and 10 men, aged, women between 43 and 76 years, with an average of 63.8 + / - 10.9 years, men between 45 and 88 years with a average of 64.3 years + / - 12.5 years. Was performed a double levy of sub-gingival plaque at multiple sites that had an implant CAL (clinical attachment level> 4mm in order to assess the microbiological identification with the two techniques: Examining culture and Real-Time PCR of Commerce ( Gum-Sunstar that identifies 4 bacterial species: A. actinomycetemcomitans (A.a., P.gingivalis (P.g., T.forsythensis (T.f., and T.denticola (T.d.. Results. All patients studied were positive to both tests with charger high: the consideration of tenure, with CFU / ml > 105, was positive in 66.6% of samples by:T.f., and P.g., in 12.5% for A.a., while T.d. not been sought by examining culture, the RT-PCR was positive, with high loads, in 95.8% of samples for T.f., in 79.1% for P.g., in 12.5% for A.a. and 20.8% for T.d.The test crop showed the presence of even P.intermedia in 91

  18. Comparison of RT-PCR-Dot blot hybridization based on radioisotope 32P with conventional RT-PCR and commercial ELISA Assays for blood screening of HIV-1

    International Nuclear Information System (INIS)

    Maria Lina R; Andi Yasmon

    2011-01-01

    There are many commercial ELISA and rapid test kits that have been used for blood screening; however, the kits can give false positive and negative results. Therefore, RT-PCR (Reverse Transcription Polymerase Chain Reaction) - Dot Blot Hybridization based on radioisotope 32 P (RDBR) method was developed in this research, to compare the method with the conventional RT-PCR and commercial ELISA Enzyme-Linked lmmunosorbent Assay) kit. This method is efficient for screening of large blood specimens and surveillance study. Eighty seven samples were used and serum of the samples were tested by ELISA to detect HIV-1. The HIV-l RNA genome was extracted from plasma samples and tested using the RT-PCR and RDBR methods. Of 87 samples that were tested, the rates of positive testing of the RT-PCR, the RDBR, and the ELISA were 71.26%, 74.71%, and 80.46%, respectively. The RDBR (a combination of RTPCR and dot blot hybridization) was more sensitive than conventional RT-PCR by showing 3.45% in increase number of positive specimens. The results showed that of 9 samples (10.34%) were negative RDBR and positive ELISA, while 4 samples (4.60%) were negative ELISA and positive RDBR. The two methods showed slightly difference in the results but further validation is still needed. However, RDBR has high potential as an alternative method for screening of blood in large quantities when compared to method of conventional RT-PCR and ELISA. (author)

  19. Cost Analysis for Real-time Java Scoped-memory Areas

    Directory of Open Access Journals (Sweden)

    Delvin Defoe

    2007-08-01

    Full Text Available Java has recently joined C and C++ as a development platform for real-time and embedded applications. Java's garbage collection, while generally a useful feature, can be problematic for these applications: garbage collection occurs at unpredictable times and its latency is typically unbounded. This can compromise necessary real-time guarantees. To overcome these limitations, the Real-Time for Java Expert Group (RTJEG proposed the Real-Time Specification for Java (RTSJ, which introduced new memory models and new threads to utilize those models. One such memory model uses scoped-memory areas, which work best in the context of a NoHeapRealtimeThread (NHRT. Although much work has been done with scoped-memory areas and NHRTs, there is no system-independent analysis of their costs. In this article we present an asymptotic analysis for RTSJ scoped-memory areas and NHRTs.

  20. Development of Transient-Reactor Analysis Code (TRAC) for real-time applications

    International Nuclear Information System (INIS)

    Niederauer, G.F.; Giguere, P.T.; Lime, J.F.; Knight, T.D.; Ashy, O.; Fakory, R.

    1997-01-01

    This is the final report of a six-month, Laboratory-Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). Nuclear-plant training simulators employ simplified one-dimensional thermal-hydraulics codes because of the demands to run in real time and with limited computing power. The objective of this project was to investigate the feasibility of using the advanced Transient-Reactor Analysis Code (TRAC) in a simulator to increase the fidelity of a simulator. Many issues need to be addressed to take such a complex code from a batch engineering environment to a real-time environment. Working with simulator vendor, GSE, the authors investigated the technical issues relating to integrating TRAC into a real-time environment. They also modified a nuclear power plant model for simulator purposes and investigated its performance in real time

  1. Phase-shifting Real-time Holographic Microscopy applied in micro-structures surface analysis

    International Nuclear Information System (INIS)

    Brito, I V; Gesualdi, M R R; Muramatsu, M; Ricardo, J

    2011-01-01

    The microscopic real-time analysis of micro structured materials is of great importance in various domains of science and technology. For other hand, the holographic interferometry comprises a group of powerful optical methods for non-destructive testing in surface analysis. The holographic microscopy uses the holographic interferometric techniques to obtain quantitative intensity and phase information of the optical waves by microscopic systems. With the development of CCD cameras, computers (hardware and software), and new materials for holographic recording, these techniques can be used to replace the classical form of registration and became promising tools in surface analysis. In this work, we developed a prototype of Photorefractive and Digital Holographic Microscope for real-time analysis of micro-structured systems based on the phase-shifting real-time holographic interferometry techniques. Using this apparatus, we are made analysis of shapes and surfaces to obtain the phase maps and the 3D profiles of some samples.

  2. The hsp 16 Gene of the Probiotic Lactobacillus acidophilus Is Differently Regulated by Salt, High Temperature and Acidic Stresses, as Revealed by Reverse Transcription Quantitative PCR (qRT-PCR Analysis

    Directory of Open Access Journals (Sweden)

    Daniela Fiocco

    2011-08-01

    Full Text Available Small heat shock proteins (sHsps are ubiquitous conserved chaperone-like proteins involved in cellular proteins protection under stressful conditions. In this study, a reverse transcription quantitative PCR (RT-qPCR procedure was developed and used to quantify the transcript level of a small heat shock gene (shs in the probiotic bacterium Lactobacillus acidophilus NCFM, under stress conditions such as heat (45 °C and 53 °C, bile (0.3% w/v, hyperosmosis (1 M and 2.5 M NaCl, and low pH value (pH 4. The shs gene of L. acidophilus NCFM was induced by salt, high temperature and acidic stress, while repression was observed upon bile stress. Analysis of the 5' noncoding region of the hsp16 gene reveals the presence of an inverted repeat (IR sequence (TTAGCACTC-N9-GAGTGCTAA homologue to the controlling IR of chaperone expression (CIRCE elements found in the upstream regulatory region of Gram-positive heat shock operons, suggesting that the hsp16 gene of L. acidophilus might be transcriptionally controlled by HrcA. In addition, the alignment of several small heat shock proteins identified so far in lactic acid bacteria, reveals that the Hsp16 of L. acidophilus exhibits a strong evolutionary relationship with members of the Lactobacillus acidophilus group.

  3. The Real-time Frequency Spectrum Analysis of Neutron Pulse Signal Series

    International Nuclear Information System (INIS)

    Tang Yuelin; Ren Yong; Wei Biao; Feng Peng; Mi Deling; Pan Yingjun; Li Jiansheng; Ye Cenming

    2009-01-01

    The frequency spectrum analysis of neutron pulse signal is a very important method in nuclear stochastic signal processing Focused on the special '0' and '1' of neutron pulse signal series, this paper proposes new rotation-table and realizes a real-time frequency spectrum algorithm under 1G Hz sample rate based on PC with add, address and SSE. The numerical experimental results show that under the count rate of 3X10 6 s -1 , this algorithm is superior to FFTW in time-consumption and can meet the real-time requirement of frequency spectrum analysis. (authors)

  4. Flipping the analytical coin : closing the information flow loop in high speed (real time) analysis

    NARCIS (Netherlands)

    K.E. Shahroudi

    1997-01-01

    textabstractAnalysis modules tend to be set up as one way flow of information, i.e a clear distinction between cause and effect or input and output. However, as the speed of analysis approaches real time (or faster than movie rate), it becomes increasingly difficult for an external user to

  5. Validation of an intermediate heat exchanger model for real time analysis

    International Nuclear Information System (INIS)

    Tzanos, C.P.

    1986-11-01

    A new method was presented for LMFBR intermediate heat exchanger (IHX) analysis in real time for purposes of continuous on-line data validation, plant state verification and fault identification. For the validation of this methodology the EBR-II IHX transient during Test 8A was analyzed. This paper presents the results of this analysis

  6. Noninvasive Strategy Based on Real-Time in Vivo Cataluminescence Monitoring for Clinical Breath Analysis.

    Science.gov (United States)

    Zhang, Runkun; Huang, Wanting; Li, Gongke; Hu, Yufei

    2017-03-21

    The development of noninvasive methods for real-time in vivo analysis is of great significant, which provides powerful tools for medical research and clinical diagnosis. In the present work, we described a new strategy based on cataluminescence (CTL) for real-time in vivo clinical breath analysis. To illustrate such strategy, a homemade real-time CTL monitoring system characterized by coupling an online sampling device with a CTL sensor for sevoflurane (SVF) was designed, and a real-time in vivo method for the monitoring of SVF in exhaled breath was proposed. The accuracy of the method was evaluated by analyzing the real exhaled breath samples, and the results were compared with those obtained by GC/MS. The measured data obtained by the two methods were in good agreement. Subsequently, the method was applied to real-time monitoring of SVF in exhaled breath from rat models of the control group to investigate elimination pharmacokinetics. In order to further probe the potential of the method for clinical application, the elimination pharmacokinetics of SVF from rat models of control group, liver fibrosis group alcohol liver group, and nonalcoholic fatty liver group were monitored by the method. The raw data of pharmacokinetics of different groups were normalized and subsequently subjected to linear discriminant analysis (LDA). These data were transformed to canonical scores which were visualized as well-clustered with the classification accuracy of 100%, and the overall accuracy of leave-one-out cross-validation procedure is 88%, thereby indicating the utility of the potential of the method for liver disease diagnosis. Our strategy undoubtedly opens up a new door for real-time clinical analysis in a pain-free and noninvasive way and also guides a promising development direction for CTL.

  7. Real-Time Shop-Floor Production Performance Analysis Method for the Internet of Manufacturing Things

    Directory of Open Access Journals (Sweden)

    Yingfeng Zhang

    2014-04-01

    Full Text Available Typical challenges that manufacturing enterprises are facing now are compounded by lack of timely, accurate, and consistent information of manufacturing resources. As a result, it is difficult to analyze the real-time production performance for the shop-floor. In this paper, the definition and overall architecture of the internet of manufacturing things is presented to provide a new paradigm by extending the techniques of internet of things (IoT to manufacturing field. Under this architecture, the real-time primitive events which occurred at different manufacturing things such as operators, machines, pallets, key materials, and so forth can be easily sensed. Based on these distributed primitive events, a critical event model is established to automatically analyze the real-time production performance. Here, the up-level production performance analysis is regarded as a series of critical events, and the real-time value of each critical event can be easily calculated according to the logical and sequence relationships among these multilevel events. Finally, a case study is used to illustrate how to apply the designed methods to analyze the real-time production performance.

  8. Simultaneous detection of three lily viruses using Triplex IC-RT-PCR.

    Science.gov (United States)

    Zhang, Yubao; Wang, Yajun; Xie, Zhongkui; Yang, Guo; Guo, Zhihong; Wang, Le

    2017-11-01

    Viruses commonly infecting lily (Lilium spp.) include: Lily symptomless virus (LSV), Cucumber mosaic virus (CMV) and Lily mottle virus (LMoV). These viruses usually co-infect lilies causing severe economic losses in terms of quantity and quality of flower and bulb production around the world. Reliable and precise detection systems need to be developed for virus identification. We describe the development of a triplex immunocapture (IC) reverse transcription (RT) polymerase chain reaction (PCR) assay for the simultaneous detection of LSV, CMV and LMoV. The triplex IC-RT-PCR was compared with a quadruplex RT-PCR assay. Relative to the quadruplex RT-PCR, the specificity of the triplex IC-RT-PCR system for LSV, CMV and LMoV was 100% for field samples. The sensitivity of the triplex IC-RT-PCR system was 99.4%, 81.4% and 98.7% for LSV, CMV and LMoV, respectively. Agreement (κ) between the results obtained from the two tests was 0.968, 0.844 and 0.984 for LSV, CMV and LMoV, respectively. This is the first report of the simultaneous detection of LSV, CMV and LMoV in a triplex IC-RT-PCR assay. In particular we believe this convenient and reliable triplex IC-RT-PCR method could be used routinely for large-scale field surveys or crop health monitoring of lily. Copyright © 2017. Published by Elsevier B.V.

  9. Development of real-time multitask OSS based on cognitive task analysis

    International Nuclear Information System (INIS)

    Wang He; Cheng Shouyu

    2010-01-01

    A Real-time Multi-task Operator Support System (RMOSS) has been developed to support the operator's decision making process in the control room of NPP. VxWorks, one embedded real-time operation system, is used for RMOSS software development. According to the SRK modeling analysis result of the operator' decision making process, RMOSS is divided into five system subtasks, including Data Collection and Validation Task (DCVT), Operation Monitor Task (OMT), Fault Diagnostic Task (FDT), Operation Guideline Task (OGT) and Human Machine Interface Task (HMIT). The task test of RMOSS has been done in a real-time full scope simulator. The results showed that each task of RMOSS is capable of accomplishing their functions. (authors)

  10. Analysis and Synthesis of Communication-Intensive Heterogeneous Real-Time Systems

    DEFF Research Database (Denmark)

    Pop, Paul

    2003-01-01

    Embedded computer systems are now everywhere: from alarm clocks to PDAs, from mobile phones to cars, almost all the devices we use are controlled by embedded computer systems. An important class of embedded computer systems is that of real-time systems, which have to fulfill strict timing...... requirements. As realtime systems become more complex, they are often implemented using distributed heterogeneous architectures. The main objective of this thesis is to develop analysis and synthesis methods for communication-intensive heterogeneous hard real-time systems. The systems are heterogeneous...... is the synthesis of the communication infrastructure, which has a significant impact on the overall system performance and cost. To reduce the time-to-market of products, the design of real-time systems seldom starts from scratch. Typically, designers start from an already existing system, running certain...

  11. MAC-Level Communication Time Modeling and Analysis for Real-Time WSNs

    Directory of Open Access Journals (Sweden)

    STANGACIU, V.

    2016-02-01

    Full Text Available Low-level communication protocols and their timing behavior are essential to developing wireless sensor networks (WSNs able to provide the support and operating guarantees required by many current real-time applications. Nevertheless, this aspect still remains an issue in the state-of-the-art. In this paper we provide a detailed analysis of a recently proposed MAC-level communication timing model and demonstrate its usability in designing real-time protocols. The results of a large set of measurements are also presented and discussed here, in direct relation to the main time parameters of the analyzed model.

  12. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected wit...... of the twenty-three VI-positive specimens were negative when tested by RT-PCR-ELISA. The diagnostic sensitivity and specificity of the RT-PCR-ELISA was 91% and 97%, respectively, using VI in SPF eggs as the gold reference standard....

  13. Protein Analysis Using Real-Time PCR Instrumentation: Incorporation in an Integrated, Inquiry-Based Project

    Science.gov (United States)

    Southard, Jonathan N.

    2014-01-01

    Instrumentation for real-time PCR is used primarily for amplification and quantitation of nucleic acids. The capability to measure fluorescence while controlling temperature in multiple samples can also be applied to the analysis of proteins. Conformational stability and changes in stability due to ligand binding are easily assessed. Protein…

  14. Stacker’s Crane Position Fixing Based on Real Time Image Processing and Analysis

    Directory of Open Access Journals (Sweden)

    Kmeid Saad

    2015-06-01

    Full Text Available This study illustrates the usage of stacker cranes and image processing in automated warehouse systems. The aim is to use real time image processing and analysis for a stacker’s crane position fixing in order to use it as a pick-up and delivery system (P/D, to be controlled by a programmable logic controller unit (PLC.

  15. Assumption-free analysis of quantitative real-time polymerase chain reaction (PCR) data

    NARCIS (Netherlands)

    Ramakers, Christian; Ruijter, Jan M.; Deprez, Ronald H. Lekanne; Moorman, Antoon F. M.

    2003-01-01

    Quantification of mRNAs using real-time polymerase chain reaction (PCR) by monitoring the product formation with the fluorescent dye SYBR Green I is being extensively used in neurosciences, developmental biology, and medical diagnostics. Most PCR data analysis procedures assume that the PCR

  16. Improved SIRAP analysis for synchronization in hierarchical scheduled real-time systems

    NARCIS (Netherlands)

    Behnam, M.; Bril, R.J.; Nolte, T.

    2009-01-01

    We present our ongoing work on synchronization in hierarchical scheduled real-time systems, where tasks are scheduled using fixed-priority pre-emptive scheduling. In this paper, we show that the original local schedulability analysis of the synchronization protocol SIRAP [4] is very pessimistic when

  17. Hybrid Real-time Zero-day Malware Analysis and Reporting System

    OpenAIRE

    Ratinder Kaur; Maninder Singh

    2016-01-01

    To understand completely the malicious intents of a zero-day malware there is really no automated way. There is no single best approach for malware analysis so it demands to combine existing static, dynamic and manual malware analysis techniques in a single unit. In this paper a hybrid real-time analysis and reporting system is presented. The proposed system integrates various malware analysis tools and utilities in a component-based architecture. The system automatica...

  18. Dengue Virus NS1 Protein as a Diagnostic Marker: Commercially Available ELISA and Comparison to qRT-PCR and Serological Diagnostic Assays Currently Used by the State of Florida

    Directory of Open Access Journals (Sweden)

    Jason H. Ambrose

    2017-01-01

    Full Text Available Background. The proper management of patients infected with dengue virus requires early detection. Here, real-time molecular assays have proven useful but have limitations, whereas ELISAs that detect antibodies are still favored but results are obtained too late to be of clinical value. The production of DENV NS1 peaks early during infection and its detection can combine the advantages of both diagnostic approaches. Methods. This study compared assays currently used for detecting DENV infection at the Florida Department of Health including anti-DENV IgM and IgG ELISAs as well as qRT-PCR, against a commercially available DENV NS1 ELISA. These comparisons were made among a group of 21 human sera. Results. Nine of 14 (64.3% DENV qRT-PCR+ samples were also DENV NS1+. Interestingly, the 5 NS1− samples that were qRT-PCR+ were additionally IgM− and IgG+ suggesting a nonprimary infection. Compared to qRT-PCR, the NS1 assay had a sensitivity of 64.3%, specificity 100%, PPV of 100%, and NPV of 58.3%. Conclusions. The NS1 ELISA performed as expected in known DENV qRT-PCR+ samples; however negative NS1 results for qRT-PCR+ and IgG+ sera seemingly reduced the usefulness of the NS1 ELISA for nonprimary cases. We therefore conclude that diagnosis obtained via DENV NS1 ELISA deserves further investigation.

  19. Real-Time Analysis and Forecasting of Multisite River Flow Using a Distributed Hydrological Model

    Directory of Open Access Journals (Sweden)

    Mingdong Sun

    2014-01-01

    Full Text Available A spatial distributed hydrological forecasting system was developed to promote the analysis of river flow dynamic state in a large basin. The research presented the real-time analysis and forecasting of multisite river flow in the Nakdong River Basin using a distributed hydrological model with radar rainfall forecast data. A real-time calibration algorithm of hydrological distributed model was proposed to investigate the particular relationship between the water storage and basin discharge. Demonstrate the approach of simulating multisite river flow using a distributed hydrological model couple with real-time calibration and forecasting of multisite river flow with radar rainfall forecasts data. The hydrographs and results exhibit that calibrated flow simulations are very approximate to the flow observation at all sites and the accuracy of forecasting flow is gradually decreased with lead times extending from 1 hr to 3 hrs. The flow forecasts are lower than the flow observation which is likely caused by the low estimation of radar rainfall forecasts. The research has well demonstrated that the distributed hydrological model is readily applicable for multisite real-time river flow analysis and forecasting in a large basin.

  20. A comparative kinetic RT/-PCR strategy for the quantitation of mRNAs in microdissected human renal biopsy specimens.

    Science.gov (United States)

    Del Prete, D; Forino, M; Gambaro, G; D'Angelo, A; Baggio, B; Anglani, F

    1998-01-01

    Molecular biology techniques, to be applicable to a diagnostic renal biopsy specimen, should (1) be highly sensitive to be performed on a very small quantity of tissue; (2) be quantitative because they have to analyze genes normally expressed in the tissue and (3) allow the analysis of as large a number of genes as possible. Among different methods, only the reverse-transcriptase polymerase chain reaction (RT/-PCR) might comply with previous requisites, but the few RT/-PCR examples on renal biopsies in the literature do not allow starting RNA quantification and quality control; furthermore they have the drawback of analyzing only few genes. In an ongoing study to assess the expression of a number of genes in glomeruli and in tubulointerstitium of patients with different nephropathies, we developed a comparative RT/-PCR kinetic strategy based on the purification and quantification of total glomerular and tubulointerstitial RNA and on the use of an internal standard, the housekeeping gene G3PDH. We demonstrate that in microdissected diagnostic renal biopsies (1) glomerular and interstitial starting RNA can be quantified; (2) the G3PDH gene may be used both as an internal standard and as an indirect marker of RNA integrity; (3) as low as 28 ng of total RNA is sufficient to obtain PCR products of eight genes, and (4) it is worth to operate on microdissected biopsy specimens because of the different expression of genes in the two renal compartments.

  1. Detecting Newcastle disease virus in combination of RT-PCR with red blood cell absorption

    Directory of Open Access Journals (Sweden)

    Liu Chengqian

    2011-05-01

    Full Text Available Abstract Reverse transcription-polymerase chain reaction (RT-PCR has limited sensitivity when treating complicated samples, such as feces, waste-water in farms, and nucleic acids, protein rich tissue samples, all the factors may interfere with the sensitivity of PCR test or generate false results. In this study, we developed a sensitive RT-PCR, combination of red blood cell adsorption, for detecting Newcastle disease virus (NDV. One pair of primers which was highly homologous to three NDV pathotypes was designed according to the consensus nucleocapsid protein (NP gene sequence. To eliminate the interfere of microbes and toxic substances, we concentrated and purified NDV from varied samples utilizing the ability of NDV binding red blood cells (RBCs. The RT-PCR coupled with red blood cell adsorption was much more sensitive in comparison with regular RT-PCR. The approach could also be used to detect other viruses with the property of hemagglutination, such as influenza viruses.

  2. Methodology for object-oriented real-time systems analysis and design: Software engineering

    Science.gov (United States)

    Schoeffler, James D.

    1991-01-01

    Successful application of software engineering methodologies requires an integrated analysis and design life-cycle in which the various phases flow smoothly 'seamlessly' from analysis through design to implementation. Furthermore, different analysis methodologies often lead to different structuring of the system so that the transition from analysis to design may be awkward depending on the design methodology to be used. This is especially important when object-oriented programming is to be used for implementation when the original specification and perhaps high-level design is non-object oriented. Two approaches to real-time systems analysis which can lead to an object-oriented design are contrasted: (1) modeling the system using structured analysis with real-time extensions which emphasizes data and control flows followed by the abstraction of objects where the operations or methods of the objects correspond to processes in the data flow diagrams and then design in terms of these objects; and (2) modeling the system from the beginning as a set of naturally occurring concurrent entities (objects) each having its own time-behavior defined by a set of states and state-transition rules and seamlessly transforming the analysis models into high-level design models. A new concept of a 'real-time systems-analysis object' is introduced and becomes the basic building block of a series of seamlessly-connected models which progress from the object-oriented real-time systems analysis and design system analysis logical models through the physical architectural models and the high-level design stages. The methodology is appropriate to the overall specification including hardware and software modules. In software modules, the systems analysis objects are transformed into software objects.

  3. Simultaneous detection of enteropathogenic viruses in buffalos faeces using multiplex reverse transcription-polymerase chain reaction (mRT-PCR

    Directory of Open Access Journals (Sweden)

    U. Pagnini

    2010-02-01

    Full Text Available A multiplex reverse transcription- polymerase chain reaction (mRT-PCR assay that detects Bovine Viral Diarrhoea Virus, Bovine Coronavirus, and Group A Rotaviruses in infected cell-culture fluids and clinical faecal samples is described. One hundred twenty faecal samples from buffalo calves with acute gastroenteritis were tested. The mRT-PCR was validated against simplex RT-PCR with published primers for Pestivirus, Coronavirus and Rotavirus. The multiplex RT-PCR was equally sensitive and specific in detecting viral infections compared with simplex RT-PCR. The mRT-PCR readily identified viruses by discriminating the size of their amplified gene products. This mRT-PCR may be a sensitive and rapid assay for surveillance of buffalo enteric viruses in field specimens. This novel multiplex RT-PCR is an attractive technique for the rapid, specific, and cost-effective laboratory diagnosis of acute gastroenteritis.

  4. Norovirus Real Time RT-PCR Detection Technology Transition to the Joint Biological Identification and Diagnosis System (JBAIDS)

    Science.gov (United States)

    2012-09-21

    virus and Southampton virus, and II (GII), which includes Bristol virus, Lordsdale virus, Toronto virus, Mexico virus, Hawaii virus and Snow Mountain...Shigella flexneriATCC12022 1 Negative Shigella sonnei ATCC25931 1 Negative Vibrio cholera (NAG) (Culture) 2 Negative Vibrio cholera (Ogawa...Culture) 1 Negative Vibrio cholera (Inaga) (Culture) 1 Negative Sapovivus (Known specimen extract) 2 Negative Rotavirus (Known specimen extract) 2

  5. VEGF system expression by immunohistochemistry and real-time RT-PCR study on collared peccary placenta

    DEFF Research Database (Denmark)

    Santos, Tatiana C.; Oliveira, Moacir F.; Papa, Paula C.

    2014-01-01

    Vascular endothelial growth factor (VEGF) is known to induce endothelial cell proliferation, to promote cell migration, and to inhibit apoptosis, thus playing a central role in angiogenesis and in the regulation of vasculogenesis. The expression of the VEGF-ligand receptor system was studied in t...

  6. A real-time RT-PCR method to detect viable Giardia lamblia cysts in environmental waters.

    Science.gov (United States)

    Baque, Robert H; Gilliam, Amy O; Robles, Liza D; Jakubowski, Walter; Slifko, Theresa R

    2011-05-01

    Currently, USEPA Method 1623 is the standard assay used for simultaneous detection of Giardia cysts and Cryptosporidium oocysts in various water matrices. However, the method is unable to distinguish between species, genotype, or to assess viability. Therefore, the objective of the present study was to address the shortcomings of USEPA Method 1623 by developing a novel molecular-based method that can assess viability of Giardia cysts in environmental waters and identify genotypes that pose a human health threat (assemblage groups A and B). Primers and TaqMan(®) probes were designed to target the beta-giardin gene in order to discriminate among species and assemblages. Viability was determined by detection of de-novo mRNA synthesis after heat induction. The beta-giardin primer/probe sets were able to detect and differentiate between Giardia lamblia assemblages A and B, and did not detect Giardia muris (mouse species) or G. lamblia assemblages C, D, E and F (non-human), with the exception of Probe A which did detect G. lamblia assemblage F DNA. Additionally, DNA or cDNA of other waterborne organisms were not detected, suggesting that the method is specific to Giardia assemblages. Assay applicability was demonstrated by detection of viable G. lamblia cysts in spiked (assemblage B) and unspiked (assemblage A and B) reclaimed water samples. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Field Evaluation of a Deployable RT-PCR Assay System for Real-Time Identification of Dengue Virus

    National Research Council Canada - National Science Library

    McAvin, James C; Blow, Jamie A; Putnam, John L; Swaby, James A

    2004-01-01

    Dengue fever and the more severe form of the disease, dengue hemorrhagic fever, occurs in tropical and subtropical regions globally through infection by one or more of four viral serotypes, DEN-1, DEN-2, DEN-3 and DEN-4...

  8. Design base transient analysis using the real-time nuclear reactor simulator model

    International Nuclear Information System (INIS)

    Tien, K.K.; Yakura, S.J.; Morin, J.P.; Gregory, M.V.

    1987-01-01

    A real-time simulation model has been developed to describe the dynamic response of all major systems in a nuclear process reactor. The model consists of a detailed representation of all hydraulic components in the external coolant circulating loops consisting of piping, valves, pumps and heat exchangers. The reactor core is described by a three-dimensional neutron kinetics model with detailed representation of assembly coolant and moderator thermal hydraulics. The models have been developed to support a real-time training simulator, therefore, they reproduce system parameters characteristic of steady state normal operation with high precision. The system responses for postulated severe transients such as large pipe breaks, loss of pumping power, piping leaks, malfunctions in control rod insertion, and emergency injection of neutron absorber are calculated to be in good agreement with reference safety analyses. Restrictions were imposed by the requirement that the resulting code be able to run in real-time with sufficient spare time to allow interfacing with secondary systems and simulator hardware. Due to hardware set-up and real plant instrumentation, simplifications due to symmetry were not allowed. The resulting code represents a coarse-node engineering model in which the level of detail has been tailored to the available computing power of a present generation super-minicomputer. Results for several significant transients, as calculated by the real-time model, are compared both to actual plant data and to results generated by fine-mesh analysis codes

  9. Design base transient analysis using the real-time nuclear reactor simulator model

    International Nuclear Information System (INIS)

    Tien, K.K.; Yakura, S.J.; Morin, J.P.; Gregory, M.V.

    1987-01-01

    A real-time simulation model has been developed to describe the dynamic response of all major systems in a nuclear process reactor. The model consists of a detailed representation of all hydraulic components in the external coolant circulating loops consisting of piping, valves, pumps and heat exchangers. The reactor core is described by a three-dimensional neutron kinetics model with detailed representation of assembly coolant and mode-rator thermal hydraulics. The models have been developed to support a real-time training simulator, therefore, they reproduce system parameters characteristic of steady state normal operation with high precision. The system responses for postulated severe transients such as large pipe breaks, loss of pumping power, piping leaks, malfunctions in control rod insertion, and emergency injection of neutron absorber are calculated to be in good agreement with reference safety analyses. Restrictions were imposed by the requirement that the resulting code be able to run in real-time with sufficient spare time to allow interfacing with secondary systems and simulator hardware. Due to hardware set-up and real plant instrumentation, simplifications due to symmetry were not allowed. The resulting code represents a coarse-node engineering model in which the level of detail has been tailored to the available computing power of a present generation super-minicomputer. Results for several significant transients, as calculated by the real-time model, are compared both to actual plant data and to results generated by fine-mesh analysis codes

  10. An Analysis of a Hard Real-Time Execution Environment Extension for FreeRTOS

    Directory of Open Access Journals (Sweden)

    STANGACIU, C.

    2015-08-01

    Full Text Available FreeRTOS is a popular real-time operating system, which has been under a significant attention in the last years due to its main advantages: it is open source, portable, well documented and implemented on more than 30 architectures. FreeRTOS execution environment is dynamic, preemptive and priority based, but it is not suitable for hard real-time tasks, because it provides task execution determinism only to a certain degree and cannot guarantee the absence of task execution jitter. As a solution to this problem, we propose a hard real time execution extension to FreeRTOS in order to support a particular model of HRT tasks, called ModXs, which are executed with no jitter. This article presents a detailed analysis, in terms of scheduling, task execution and memory usage of this hard real time execution environment extension. The article is concluding with the advantages this extension brings to the system compared to the small memory and timing overhead introduced.

  11. Real-time GPS seismology using a single receiver: method comparison, error analysis and precision validation

    Science.gov (United States)

    Li, Xingxing

    2014-05-01

    Earthquake monitoring and early warning system for hazard assessment and mitigation has traditional been based on seismic instruments. However, for large seismic events, it is difficult for traditional seismic instruments to produce accurate and reliable displacements because of the saturation of broadband seismometers and problematic integration of strong-motion data. Compared with the traditional seismic instruments, GPS can measure arbitrarily large dynamic displacements without saturation, making them particularly valuable in case of large earthquakes and tsunamis. GPS relative positioning approach is usually adopted to estimate seismic displacements since centimeter-level accuracy can be achieved in real-time by processing double-differenced carrier-phase observables. However, relative positioning method requires a local reference station, which might itself be displaced during a large seismic event, resulting in misleading GPS analysis results. Meanwhile, the relative/network approach is time-consuming, particularly difficult for the simultaneous and real-time analysis of GPS data from hundreds or thousands of ground stations. In recent years, several single-receiver approaches for real-time GPS seismology, which can overcome the reference station problem of the relative positioning approach, have been successfully developed and applied to GPS seismology. One available method is real-time precise point positioning (PPP) relied on precise satellite orbit and clock products. However, real-time PPP needs a long (re)convergence period, of about thirty minutes, to resolve integer phase ambiguities and achieve centimeter-level accuracy. In comparison with PPP, Colosimo et al. (2011) proposed a variometric approach to determine the change of position between two adjacent epochs, and then displacements are obtained by a single integration of the delta positions. This approach does not suffer from convergence process, but the single integration from delta positions to

  12. Red blood cells in cerebrospinal fluid as possible inhibitory factor for enterovirus RT-PCR

    Directory of Open Access Journals (Sweden)

    Sérgio Monteiro de Almeida

    Full Text Available ABSTRACT The presence of hemoglobin in samples are considered an important inhibitory factor for polymerase chain reaction (PCR. The aim of this study was to examine the influence of red blood cells (RBCs in cerebrospinal fluid (CSF as an inhibitory factor to reverse transcription polymerase chain reaction (RT-PCR for enteroviruses (EV. Forty-four CSF samples from patients showing characteristics of viral meningitis were assessed for EV by RT-PCR. Viral RNA extracted with guanidine isothyocianate buffer and virus detection was performed by in-house nested PCR. Positivity for EV RT-PCR was higher in CSF samples without RBCs than in samples with RBCs: 13(26% and 36(9.2%, p = 0.001. In the group with positive EV RT-PCR, the mean + SD CSF RBC was 37 ± 183 cell/mm3; the group with negative results had 580 + 2,890 cell/mm3 (p = 0.007. The acceptable upper limit for CSF RBCs that could not influence RT-PCR was 108 cells/mm3. CSF samples with negative results for EV RT-PCR have more erythrocytes.

  13. The PWI [plutonium waste incinerator] expert system: Real time, PC-based process analysis

    International Nuclear Information System (INIS)

    Brown, K.G.; Smith, F.G.

    1987-01-01

    A real time, microcomputer-based expert system is being developed for a prototype plutonium waste incinerator (PWI) process at Du Pont's Savannah River Laboratory. The expert system will diagnose instrumentation problems, assist operator training, serve as a repository for engineering knowledge about the process, and provide continuous operation and performance information. A set of necessary operational criteria was developed from process and engineering constraints; it was used to define hardware and software needs. The most important criterion is operating speed because the analysis operates in real time. TURBO PROLOG by Borland International was selected. The analysis system is divided into three sections: the user-system interface, the inference engine and rule base, and the files representing the blackboard information center

  14. Real-time spectral analysis of HRV signals: an interactive and user-friendly PC system.

    Science.gov (United States)

    Basano, L; Canepa, F; Ottonello, P

    1998-01-01

    We present a real-time system, built around a PC and a low-cost data acquisition board, for the spectral analysis of the heart rate variability signal. The Windows-like operating environment on which it is based makes the computer program very user-friendly even for non-specialized personnel. The Power Spectral Density is computed through the use of a hybrid method, in which a classical FFT analysis follows an autoregressive finite-extension of data; the stationarity of the sequence is continuously checked. The use of this algorithm gives a high degree of robustness of the spectral estimation. Moreover, always in real time, the FFT of every data block is computed and displayed in order to corroborate the results as well as to allow the user to interactively choose a proper AR model order.

  15. Real-time impedance analysis of silica nanowire toxicity on epithelial breast cancer cells.

    Science.gov (United States)

    Alexander, Frank A; Huey, Eric G; Price, Dorielle T; Bhansali, Shekhar

    2012-12-21

    Silica nanowires have great potential for usage in the development of highly sensitive in vivo biosensors used for biomarker monitoring. However, careful analysis of nanowire toxicity is required prior to placing these sensors within the human body. This paper describes a real-time and quantitative analysis of nanowire cytotoxicity using impedance spectroscopy; improving upon studies that have utilized traditional endpoint assays. Silica nanowires were grown using the vapor liquid solid (VLS) method, mixed with Dulbecco's Modified Eagle Medium (DMEM) and exposed to Hs578T epithelial breast cancer cells at concentrations of 0 μg ml(-1), 1 μg ml(-1), 50 μg ml(-1) and 100 μg ml(-1). Real-time cellular responses to silica nanowires confirm that while not cytotoxic, silica nanowires at high concentrations (≥50 μg ml(-1)) are toxic to cells, and also suggest that cell death is due to mechanical disturbances of high numbers of nanowires.

  16. Detecting spatial patterns of rivermouth processes using a geostatistical framework for near-real-time analysis

    Science.gov (United States)

    Xu, Wenzhao; Collingsworth, Paris D.; Bailey, Barbara; Carlson Mazur, Martha L.; Schaeffer, Jeff; Minsker, Barbara

    2017-01-01

    This paper proposes a geospatial analysis framework and software to interpret water-quality sampling data from towed undulating vehicles in near-real time. The framework includes data quality assurance and quality control processes, automated kriging interpolation along undulating paths, and local hotspot and cluster analyses. These methods are implemented in an interactive Web application developed using the Shiny package in the R programming environment to support near-real time analysis along with 2- and 3-D visualizations. The approach is demonstrated using historical sampling data from an undulating vehicle deployed at three rivermouth sites in Lake Michigan during 2011. The normalized root-mean-square error (NRMSE) of the interpolation averages approximately 10% in 3-fold cross validation. The results show that the framework can be used to track river plume dynamics and provide insights on mixing, which could be related to wind and seiche events.

  17. Real-time measurement and control at JET signal processing and physics analysis for diagnostics

    International Nuclear Information System (INIS)

    Felton, R.; Joffrin, E.; Murari, A.

    2005-01-01

    To meet the requirements of the scientific programme, the EFDA JET real-time measurement and control project has developed an integrated set of real-time plasma measurements, experiment control and communication facilities. Traditional experiments collected instrument data during the plasma pulse and calculated physics data after the pulse. The challenge for continuous tokamak operation is to calculate the physics data in real-time, keeping up with the evolution of the plasma. In JET, many plasma diagnostics have been augmented with extra data acquisition and signal-processing systems so that they can both capture instrument data for conventional post-pulse analysis and calculate calibrated, validated physics results in real-time. During the pulse, the systems send sampled data sets into a network, which distributes the data to several destinations. The receiving systems may do further analysis, integrating data from several measurements, or may control the plasma scenario by heating or fuelling. The simplest real-time diagnostic systems apply scale factors to the signals, as with the electron cyclotron emission (ECE) diagnostic's 96 tuned radiometer channels, giving the electron temperature profile. In various spectroscopy diagnostics, spectral features are least-squares-fitted to measure spectra from several lines of sight, within 50 ms. Ion temperatures and rotation speed can be calculated from the line widths and shifts. For diagnostics using modulation techniques, the systems implement digital-signal processing phase trackers, lock-in amplifiers and filters, e.g., the far infrared (FIR) interferometer samples 15 channels at 400 kHz for 30 s, i.e., six million samples per second. Diagnostics have specific lines of sight, spatial channels, and various sampling rates. The heating/fuelling systems have relatively coarse spatial localisation. Analysis systems have been developed to integrate the basic physics data into smaller sets of controllable parameters on a

  18. Progress on RTSS simulation-based analysis for real-time systems development at two laboratories

    International Nuclear Information System (INIS)

    Shu, Y.; Jia, M.; Fei, Y.; Zhang, Y.; Liu, G.; Yang, S.; Chen, Y.

    1996-01-01

    A new object-oriented Real Time System Simulator (RTSS) with the capability for simulation graphics and animation, has been developed and used for modeling the distributed data acquisition and processing systems at JET and ASIPP. Simulation allows estimates of response time, throughput and resource utilization for a variety of configurations to be investigated. Performance measurements, simulation and analysis are used together to calibrate and validate each other

  19. Analysis of the LTE Access Reservation Protocol for Real-Time Traffic

    DEFF Research Database (Denmark)

    Thomsen, Henning; Kiilerich Pratas, Nuno; Stefanovic, Cedomir

    2013-01-01

    LTE is increasingly seen as a system for serving real-time Machine-to-Machine (M2M) communication needs. The asynchronous M2M user access in LTE is obtained through a two-phase access reservation protocol (contention and data phase). Existing analysis related to these protocols is based...... of the two-phase LTE reservation protocol and asses its performance, when assumptions (1) and (2) do not hold....

  20. An Analysis of Input/Output Paradigms for Real-Time Systems

    Science.gov (United States)

    1990-07-01

    timing and concurrency aspects of real - time systems . This paper illustrates how to build a mathematical model of the schedulability of a real-time...various design alternatives. The primary characteristic that distinguishes real-time system from non- real - time systems is the importance of time. The

  1. Stability Analysis and Variational Integrator for Real-Time Formation Based on Potential Field

    Directory of Open Access Journals (Sweden)

    Shengqing Yang

    2014-01-01

    Full Text Available This paper investigates a framework of real-time formation of autonomous vehicles by using potential field and variational integrator. Real-time formation requires vehicles to have coordinated motion and efficient computation. Interactions described by potential field can meet the former requirement which results in a nonlinear system. Stability analysis of such nonlinear system is difficult. Our methodology of stability analysis is discussed in error dynamic system. Transformation of coordinates from inertial frame to body frame can help the stability analysis focus on the structure instead of particular coordinates. Then, the Jacobian of reduced system can be calculated. It can be proved that the formation is stable at the equilibrium point of error dynamic system with the effect of damping force. For consideration of calculation, variational integrator is introduced. It is equivalent to solving algebraic equations. Forced Euler-Lagrange equation in discrete expression is used to construct a forced variational integrator for vehicles in potential field and obstacle environment. By applying forced variational integrator on computation of vehicles' motion, real-time formation of vehicles in obstacle environment can be implemented. Algorithm based on forced variational integrator is designed for a leader-follower formation.

  2. Comparison of in-house and commercial real time-PCR based carbapenemase gene detection methods in Enterobacteriaceae and non-fermenting gram-negative bacterial isolates.

    Science.gov (United States)

    Smiljanic, M; Kaase, M; Ahmad-Nejad, P; Ghebremedhin, B

    2017-07-10

    Carbapenemase-producing gram-negative bacteria are increasing globally and have been associated with outbreaks in hospital settings. Thus, the accurate detection of these bacteria in infections is mandatory for administering the adequate therapy and infection control measures. This study aimed to establish and evaluate a multiplex real-time PCR assay for the simultaneous detection of carbapenemase gene variants in gram-negative rods and to compare the performance with a commercial RT-PCR assay (Check-Direct CPE). 116 carbapenem-resistant Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii isolates were genotyped for carbapenemase genes by PCR and sequencing. The defined isolates were used for the validation of the in-house RT-PCR by use of designed primer pairs and probes. Among the carbapenem-resistant isolates the genes bla KPC , bla VIM , bla NDM or bla OXA were detected. Both RT-PCR assays detected all bla KPC , bla VIM and bla NDM in the isolates. The in-house RT-PCR detected 53 of 67 (79.0%) whereas the commercial assay detected only 29 (43.3%) of the OXA genes. The in-house sufficiently distinguished the most prevalent OXA types (23-like and 48-like) in the melting curve analysis and direct detection of the genes from positive blood culture vials. The Check-Direct CPE and the in-house RT-PCR assay detected the carbapenem resistance from solid culture isolates. Moreover, the in-house assay enabled the identification of carbapenemase genes directly from positive blood-culture vials. However, we observed insufficient detection of various OXA genes in both assays. Nevertheless, the in-house RT-PCR detected the majority of the OXA type genes in Enterobacteriaceae and A. baumannii.

  3. Practical Testing and Performance Analysis of Phasor Measurement Unit Using Real Time Digital Simulator (RTDS)

    DEFF Research Database (Denmark)

    Liu, Leo; Rather, Zakir Hussain; Stearn, Nathen

    2012-01-01

    Wide Area Measurement Systems (WAMS) and Wide Area Monitoring, Protection and Control Systems (WAMPACS) have evolved rapidly over the last two decades [1]. This fast emerging technology enables real time synchronized monitoring of power systems. Presently, WAMS are mainly used for real time...... visualisation and post event analysis of power systems. It is expected however, that through integration with traditional Supervisory Control and Data Acquisition (SCADA) systems, closed loop control applications will be possible. Phasor Measurement Units (PMUs) are fundamental components of WAMS. Large WAMS...... proposed to realize highly precise phasoreasurements. Further a comparative study based on features of PMUs from different major manufacturers is presented. The selection of optimal parameters, such as phasor format and filter length is also discussed for various applications....

  4. Analysis of fault tolerance and reliability in distributed real-time system architectures

    International Nuclear Information System (INIS)

    Philippi, Stephan

    2003-01-01

    Safety critical real-time systems are becoming ubiquitous in many areas of our everyday life. Failures of such systems potentially have catastrophic consequences on different scales, in the worst case even the loss of human life. Therefore, safety critical systems have to meet maximum fault tolerance and reliability requirements. As the design of such systems is far from being trivial, this article focuses on concepts to specifically support the early architectural design. In detail, a simulation based approach for the analysis of fault tolerance and reliability in distributed real-time system architectures is presented. With this approach, safety related features can be evaluated in the early development stages and thus prevent costly redesigns in later ones

  5. A real-time data-acquisition and analysis system with distributed UNIX workstations

    International Nuclear Information System (INIS)

    Yamashita, H.; Miyamoto, K.; Maruyama, K.; Hirosawa, H.; Nakayoshi, K.; Emura, T.; Sumi, Y.

    1996-01-01

    A compact data-acquisition system using three RISC/UNIX TM workstations (SUN TM /SPARCstation TM ) with real-time capabilities of monitoring and analysis has been developed for the study of photonuclear reactions with the large-acceptance spectrometer TAGX. One workstation acquires data from memory modules in the front-end electronics (CAMAC and TKO) with a maximum speed of 300 Kbytes/s, where data size times instantaneous rate is 1 Kbyte x 300 Hz. Another workstation, which has real-time capability for run monitoring, gets the data with a buffer manager called NOVA. The third workstation analyzes the data and reconstructs the event. In addition to a general hardware and software description, priority settings and run control by shell scripts are described. This system has recently been used successfully in a two month long experiment. (orig.)

  6. Oxidative stress provokes distinct transcriptional responses in the stress-tolerant atr7 and stress-sensitive loh2 Arabidopsis thaliana mutants as revealed by multi-parallel quantitative real-time PCR analysis of ROS marker and antioxidant genes.

    Science.gov (United States)

    Mehterov, Nikolay; Balazadeh, Salma; Hille, Jacques; Toneva, Valentina; Mueller-Roeber, Bernd; Gechev, Tsanko

    2012-10-01

    The Arabidopsis thaliana atr7 mutant is tolerant to oxidative stress induced by paraquat (PQ) or the catalase inhibitor aminotriazole (AT), while its original background loh2 and wild-type plants are sensitive. Both, AT and PQ, which stimulate the intracellular formation of H₂O₂ or superoxide anions, respectively, trigger cell death in loh2 but do not lead to visible damage in atr7. To study gene expression during oxidative stress and ROS-induced programmed cell death, two platforms for multi-parallel quantitative real-time PCR (qRT-PCR) analysis of 217 antioxidant and 180 ROS marker genes were employed. The qRT-PCR analyses revealed AT- and PQ-induced expression of many ROS-responsive genes mainly in loh2, confirming that an oxidative burst plays a role in the activation of the cell death in this mutant. Some of the genes were specifically regulated by either AT or PQ, serving as markers for particular types of ROS. Genes significantly induced by both AT and PQ in loh2 included transcription factors (ANAC042/JUB1, ANAC102, DREB19, HSFA2, RRTF1, ZAT10, ZAT12, ethylene-responsive factors), signaling compounds, ferritins, alternative oxidases, and antioxidant enzymes. Many of these genes were upregulated in atr7 compared to loh2 under non-stress conditions at the first time point, indicating that higher basal levels of ROS and higher antioxidant capacity in atr7 are responsible for the enhanced tolerance to oxidative stress and suggesting a possible tolerance against multiple stresses of this mutant. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  7. A novel universal real-time PCR system using the attached universal duplex probes for quantitative analysis of nucleic acids

    Directory of Open Access Journals (Sweden)

    Wilson Zoe A

    2008-06-01

    Full Text Available Abstract Background Real-time PCR techniques are being widely used for nucleic acids analysis, but one limitation of current frequently employed real-time PCR is the high cost of the labeled probe for each target molecule. Results We describe a real-time PCR technique employing attached universal duplex probes (AUDP, which has the advantage of generating fluorescence by probe hydrolysis and strand displacement over current real-time PCR methods. AUDP involves one set of universal duplex probes in which the 5' end of the fluorescent probe (FP and a complementary quenching probe (QP lie in close proximity so that fluorescence can be quenched. The PCR primer pair with attached universal template (UT and the FP are identical to the UT sequence. We have shown that the AUDP technique can be used for detecting multiple target DNA sequences in both simplex and duplex real-time PCR assays for gene expression analysis, genotype identification, and genetically modified organism (GMO quantification with comparable sensitivity, reproducibility, and repeatability with other real-time PCR methods. Conclusion The results from GMO quantification, gene expression analysis, genotype identification, and GMO quantification using AUDP real-time PCR assays indicate that the AUDP real-time PCR technique has been successfully applied in nucleic acids analysis, and the developed AUDP real-time PCR technique will offer an alternative way for nucleic acid analysis with high efficiency, reliability, and flexibility at low cost.

  8. Portable Dew Point Mass Spectrometry System for Real-Time Gas and Moisture Analysis

    Science.gov (United States)

    Arkin, C.; Gillespie, Stacey; Ratzel, Christopher

    2010-01-01

    A portable instrument incorporates both mass spectrometry and dew point measurement to provide real-time, quantitative gas measurements of helium, nitrogen, oxygen, argon, and carbon dioxide, along with real-time, quantitative moisture analysis. The Portable Dew Point Mass Spectrometry (PDP-MS) system comprises a single quadrupole mass spectrometer and a high vacuum system consisting of a turbopump and a diaphragm-backing pump. A capacitive membrane dew point sensor was placed upstream of the MS, but still within the pressure-flow control pneumatic region. Pressure-flow control was achieved with an upstream precision metering valve, a capacitance diaphragm gauge, and a downstream mass flow controller. User configurable LabVIEW software was developed to provide real-time concentration data for the MS, dew point monitor, and sample delivery system pressure control, pressure and flow monitoring, and recording. The system has been designed to include in situ, NIST-traceable calibration. Certain sample tubing retains sufficient water that even if the sample is dry, the sample tube will desorb water to an amount resulting in moisture concentration errors up to 500 ppm for as long as 10 minutes. It was determined that Bev-A-Line IV was the best sample line to use. As a result of this issue, it is prudent to add a high-level humidity sensor to PDP-MS so such events can be prevented in the future.

  9. Assessment of Multiple GNSS Real-Time SSR Products from Different Analysis Centers

    Directory of Open Access Journals (Sweden)

    Zhiyu Wang

    2018-03-01

    Full Text Available The real-time State Space Representation (SSR product of the GNSS (Global Navigation Satellite System orbit and clock is one of the most essential corrections for real-time precise point positioning (PPP. In this work, the performance of current SSR products from eight analysis centers were assessed by comparing it with the final product and the accuracy of real-time PPP. Numerical results showed that (1 the accuracies of the GPS SSR product were better than 8 cm for the satellite orbit and 0.3 ns for the satellite clock; (2 the accuracies of the GLONASS (GLObalnaya NAvigatsionnaya Sputnikovaya Sistema SSR product were better than 10 cm for orbit RMS (Root Mean Square and 0.6 ns for clock STD (Standard Deviation; and (3 the accuracies of the BDS (BeiDou Navigation Satellite System and Galileo SSR products from CLK93 were about 14.54 and 4.42 cm for the orbit RMS and 0.32 and 0.18 ns for the clock STD, respectively. The simulated kinematic PPP results obtained using the SSR products from CLK93 and CLK51 performed better than those using other SSR products; and the accuracy of PPP based on all products was better than 6 and 10 cm in the horizontal and vertical directions, respectively. The real-time kinematic PPP experiment carried out in Beijing, Tianjin, and Shijiazhuang, China indicated that the SSR product CLK93 from Centre National d’Etudes Spatiales (CNES had a better performance than CAS01. Moreover, the PPP with GPS + BDS dual systems had a higher accuracy than those with only a GPS single system.

  10. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    Science.gov (United States)

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  11. Direct recovery of infectious Pestivirus from a full-length RT-PCR amplicon

    DEFF Research Database (Denmark)

    Rasmussen, Thomas Bruun; Reimann, Ilona; Hoffmann, Bernd

    2008-01-01

    This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro, and the result......This study describes the use of a novel and rapid long reverse transcription (RT)-PCR for the generation of infectious full-length cDNA of pestiviruses. To produce rescued viruses, full-length RT-PCR amplicons of 12.3 kb, including a T7-promotor, were transcribed directly in vitro......, and the resulting RNA transcripts were electroporated into ovine cells. Infectious virus was obtained after one cell culture passage. The rescued viruses had a phenotype similar to the parental Border Disease virus strain. Therefore, direct generation of infectious pestiviruses from full-length RT-PCR cDNA products...

  12. Identification of potential internal control genes for real-time PCR analysis during stress response in Pyropia haitanensis

    Science.gov (United States)

    Wang, Xia; Feng, Jianhua; Huang, Aiyou; He, Linwen; Niu, Jianfeng; Wang, Guangce

    2017-11-01

    Pyropia haitanensis has prominent stress-resistance characteristics and is endemic to China. Studies into the stress responses in these algae could provide valuable information on the stress-response mechanisms in the intertidal Rhodophyta. Here, the effects of salinity and light intensity on the quantum yield of photosystem II in Py. haitanensis were investigated using pulse-amplitude-modulation fluorometry. Total RNA and genomic DNA of the samples under different stress conditions were isolated. By normalizing to the genomic DNA quantity, the RNA content in each sample was evaluated. The cDNA was synthesized and the expression levels of seven potential internal control genes were evaluated using qRT-PCR method. Then, we used geNorm, a common statistical algorithm, to analyze the qRT-PCR data of seven reference genes. Potential genes that may constantly be expressed under different conditions were selected, and these genes showed stable expression levels in samples under a salinity treatment, while tubulin, glyceraldehyde-3-phosphate dehydrogenase and actin showed stability in samples stressed by strong light. Based on the results of the pulse amplitude-modulation fluorometry, an absolute quantification was performed to obtain gene copy numbers in certain stress-treated samples. The stably expressed genes as determined by the absolute quantification in certain samples conformed to the results of the geNorm screening. Based on the results of the software analysis and absolute quantification, we proposed that elongation factor 3 and 18S ribosomal RNA could be used as internal control genes when the Py. haitanensis blades were subjected to salinity stress, and that α-tubulin and 18S ribosomal RNA could be used as the internal control genes when the stress was from strong light. In general, our findings provide a convenient reference for the selection of internal control genes when designing experiments related to stress responses in Py. haitanensis.

  13. Identification and validation of reference genes for quantitative RT-PCR normalization in wheat

    Directory of Open Access Journals (Sweden)

    Porceddu Enrico

    2009-02-01

    Full Text Available Abstract Background Usually the reference genes used in gene expression analysis have been chosen for their known or suspected housekeeping roles, however the variation observed in most of them hinders their effective use. The assessed lack of validated reference genes emphasizes the importance of a systematic study for their identification. For selecting candidate reference genes we have developed a simple in silico method based on the data publicly available in the wheat databases Unigene and TIGR. Results The expression stability of 32 genes was assessed by qRT-PCR using a set of cDNAs from 24 different plant samples, which included different tissues, developmental stages and temperature stresses. The selected sequences included 12 well-known HKGs representing different functional classes and 20 genes novel with reference to the normalization issue. The expression stability of the 32 candidate genes was tested by the computer programs geNorm and NormFinder using five different data-sets. Some discrepancies were detected in the ranking of the candidate reference genes, but there was substantial agreement between the groups of genes with the most and least stable expression. Three new identified reference genes appear more effective than the well-known and frequently used HKGs to normalize gene expression in wheat. Finally, the expression study of a gene encoding a PDI-like protein showed that its correct evaluation relies on the adoption of suitable normalization genes and can be negatively affected by the use of traditional HKGs with unstable expression, such as actin and α-tubulin. Conclusion The present research represents the first wide screening aimed to the identification of reference genes and of the corresponding primer pairs specifically designed for gene expression studies in wheat, in particular for qRT-PCR analyses. Several of the new identified reference genes outperformed the traditional HKGs in terms of expression stability

  14. Combining real-time monitoring and knowledge-based analysis in MARVEL

    Science.gov (United States)

    Schwuttke, Ursula M.; Quan, A. G.; Angelino, R.; Veregge, J. R.

    1993-01-01

    Real-time artificial intelligence is gaining increasing attention for applications in which conventional software methods are unable to meet technology needs. One such application area is the monitoring and analysis of complex systems. MARVEL, a distributed monitoring and analysis tool with multiple expert systems, was developed and successfully applied to the automation of interplanetary spacecraft operations at NASA's Jet Propulsion Laboratory. MARVEL implementation and verification approaches, the MARVEL architecture, and the specific benefits that were realized by using MARVEL in operations are described.

  15. Analysis of writing inks on paper using direct analysis in real time mass spectrometry.

    Science.gov (United States)

    Jones, Roger W; McClelland, John F

    2013-09-10

    Ink analysis is central to questioned document examination. We applied direct analysis in real time mass spectrometry (DART MS) to ballpoint, gel, and fluid writing ink analysis. DART MS acquires the mass spectrum of an ink while it is still on a document without altering the appearance of the document. Spectra were acquired from ink on a variety of papers, and the spectrum of the blank paper could be subtracted out to produce a cleanly isolated ink spectrum in most cases. Only certain heavy or heavily processed papers interfered. The time since an ink is written on paper has a large effect on its spectrum. DART spectra change radically during the first few months after an ink is written as the more volatile components evaporate, but the spectra stabilize after that. A library-search study involving 166 well-aged inks assessed the ability to identify inks from their DART spectra. The aggregate success rate was 92%. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  16. Micromagnetic Cancer Cell Immobilization and Release for Real-Time Single Cell Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Jaiswal, Devina; Rad, Armin Tahmasbi [Department of Biomedical Engineering, University of Connecticut, Storrs, CT, 06269 (United States); Nieh, Mu-Ping [Department of Biomedical Engineering, University of Connecticut, Storrs, CT, 06269 (United States); Department of Chemical and Biomolecular Engineering, University of Connecticut, Storrs, CT 06269 (United States); Polymer Program, Institute of Materials Science, University of Connecticut, Storrs, CT 06269 (United States); Claffey, Kevin P. [Department of Cell Biology, University of Connecticut Health Center, Farmington, CT 06030 (United States); Hoshino, Kazunori, E-mail: hoshino@engr.uconn.edu [Department of Biomedical Engineering, University of Connecticut, Storrs, CT, 06269 (United States)

    2017-04-01

    Understanding the interaction of live cells with macromolecules is crucial for designing efficient therapies. Considering the functional heterogeneity found in cancer cells, real-time single cell analysis is necessary to characterize responses. In this study, we have designed and fabricated a microfluidic channel with patterned micromagnets which can temporarily immobilize the cells during analysis and release them after measurements. The microchannel is composed of plain coverslip top and bottom panels to facilitate easy microscopic observation and undisturbed application of analytes to the cells. Cells labeled with functionalized magnetic beads were immobilized in the device with an efficiency of 90.8±3.6%. Since the micromagnets are made of soft magnetic material (Ni), they released cells when external magnetic field was turned off from the channel. This allows the reuse of the channel for a new sample. As a model drug analysis, the immobilized breast cancer cells (MCF7) were exposed to fluorescent lipid nanoparticles and association and dissociation were measured through fluorescence analysis. Two concentrations of nanoparticles, 0.06 µg/ml and 0.08 µg/ml were tested and time lapse images were recorded and analyzed. The microfluidic device was able to provide a microenvironment for sample analysis, making it an efficient platform for real-time analysis.

  17. Diagnosis of intestinal parasites in a rural community of Venezuela: Advantages and disadvantages of using microscopy or RT-PCR.

    Science.gov (United States)

    Incani, Renzo Nino; Ferrer, Elizabeth; Hoek, Denise; Ramak, Robbert; Roelfsema, Jeroen; Mughini-Gras, Lapo; Kortbeek, Titia; Pinelli, Elena

    2017-03-01

    A cross-sectional study was carried out to determine the prevalence and diagnostic performance of microscopy and real time PCR (RT-PCR) for 14 intestinal parasites in a Venezuelan rural community with a long history of persistent intestinal parasitic infections despite the implementation of regular anthelminthic treatments. A total of 228 participants were included in this study. A multiplex RT-PCR was used for the detection of Dientamoeba fragilis, Giardia intestinalis, Cryptosporidium sp. and a monoplex RT-PCR for Entamoeba histolytica. Furthermore, a multiplex PCR was performed for detection of Ascaris lumbricoides, Strongyloides stercoralis, Necator americanus and Ancylostoma duodenale. Combined microscopy-PCR revealed prevalences of 49.3% for A. lumbricoides, 10.1% for N. americanus (no A. duodenale was detected), 2.0% for S. stercoralis, 40.4% for D. fragilis, 35.1% for G. intestinalis, and 7.9% for E. histolytica/dispar. Significant increases in prevalence at PCR vs. microscopy were found for A. lumbricoides, G. intestinalis and D. fragilis. Other parasites detected by microscopy alone were Trichuris trichiura (25.7%), Enterobius vermicularis (3.4%), Blastocystis sp. (65.8%), and the non-pathogenic Entamoeba coli (28.9%), Entamoeba hartmanni (12.3%), Endolimax nana (19.7%) and Iodamoeba bütschlii (7.5%). Age- but no gender-related differences in prevalences were found for A. lumbricoides, T. trichiura, G. intestinalis, and E. histolytica/dispar. The persistently high prevalences of intestinal helminths are probably related to the high faecal pollution as also evidenced by the high prevalences of non-pathogenic intestinal protozoans. These results highlight the importance of using sensitive diagnostic techniques in combination with microscopy to better estimate the prevalence of intestinal parasites, especially in the case of D. fragilis trophozoites, which deteriorate very rapidly and would be missed by microscopy. In addition, the differentiation between

  18. Detection of respiratory bacterial pathogens causing atypical pneumonia by multiplex Lightmix® RT-PCR.

    Science.gov (United States)

    Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M

    2018-04-01

    Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was

  19. Quantitative RT-PCR for titration of replication-defective recombinant Semliki Forest virus.

    Science.gov (United States)

    Puglia, Ana L P; Rezende, Alexandre G; Jorge, Soraia A C; Wagner, Renaud; Pereira, Carlos A; Astray, Renato M

    2013-11-01

    Virus titration may constitute a drawback in the development and use of replication-defective viral vectors like Semliki Forest virus (SFV). The standardization and validation of a reverse transcription quantitative PCR (qRT-PCR) method for SFV titration is presented here. The qRT-PCR target is located within the nsp1 gene of the non-structural polyprotein SFV region (SFV RNA), which allows the strategy to be used for several different recombinant SFV constructs. Titer determinations were carried out by performing virus titration and infection assays with SFVs containing an RNA coding region for the rabies virus glycoprotein (RVGP) or green fluorescent protein (GFP). Results showed that the standardized qRT-PCR is applicable for different SFV constructs, and showed good reproducibility. To evaluate the correlation between the amount of functional SFV RNA in a virus lot and its infectivity in BHK-21 cell cultures, a temperature mediated titer decrease was performed and successfully quantitated by qRT-PCR. When used for cell infection at the same multiplicity of infection (MOI), the temperature treated SFV-RVGP samples induced the same levels of RVGP expression. Similarly, when different SFV-GFP lots with different virus titers, as accessed by qRT-PCR, were used for cell infection at the same MOI, the cultures showed comparable amounts of fluorescent cells. The data demonstrate a good correlation between the amount of virus used for infection, as measured by its SFV RNA, and the protein synthesis in the cells. In conclusion, the qRT-PCR method developed here is accurate and enables the titration of replication-defective SFV vectors, an essential aid for viral vector development as well as for establishment of production bioprocesses. Copyright © 2013 Elsevier B.V. All rights reserved.

  20. Real time video processing software for the analysis of endoscopic guided-biopsies

    International Nuclear Information System (INIS)

    Ordoñez, C; Bouchet, A; Pastore, J; Blotta, E

    2011-01-01

    The severity in Barrett esophagus disease is, undoubtedly, the possibility of its malignization. To make an early diagnosis in order to avoid possible complications, it is absolutely necessary collect biopsies to make a histological analysis. This should be done under endoscopic control to avoid mucus areas that may co-exist within the columnar epithelial, which could lead to a false diagnosis. This paper presents a video processing software in real-time in order to delineate and enhance areas of interest to facilitate the work of the expert.

  1. Method for Hot Real-Time Analysis of Pyrolysis Vapors at Pilot Scale

    Energy Technology Data Exchange (ETDEWEB)

    Pomeroy, Marc D [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2017-09-29

    Pyrolysis oils contain more than 400 compounds, up to 60% of which do not re-volatilize for subsequent chemical analysis. Vapor chemical composition is also complicated as additional condensation reactions occur during quenching and collection of the product. Due to the complexity of the pyrolysis oil, and a desire to catalytically upgrade the vapor composition before condensation, online real-time analytical techniques such as Molecular Beam Mass Spectrometry (MBMS) are of great use. However, in order to properly sample hot pyrolysis vapors at the pilot scale, many challenges must be overcome.

  2. Optically selected GRB afterglows, a real time analysis system at the CFHT

    International Nuclear Information System (INIS)

    Malacrino, F.; Atteia, J.-L.; Klotz, A.; Boer, M.; Kavelaars, J.J.; Cuillandre, J.-C.

    2005-01-01

    We attempt to detect optical GRB afterglows on images taken by the Canada France Hawaii Telescope for the Very Wide survey, component of the Legacy Survey. To do so, a Real Time Analysis System called Optically Selected GRB Afterglows has been installed on a dedicated computer in Hawaii. This pipeline automatically and quickly analyzes Mega cam images and extracts from them a list of variable objects which is displayed on a web page far validation by a member of the collaboration. The Very Wide survey covers 1200 square degrees down to i 1 = 23.5. This paper briefly explain the RTAS process

  3. Real-time data analysis at the LHC: present and future

    CERN Document Server

    Gligorov, V.V.

    2015-01-01

    The Large Hadron Collider (LHC), which collides protons at an energy of 14 TeV, produces hundreds of exabytes of data per year, making it one of the largest sources of data in the world today. At present it is not possible to even transfer most of this data from the four main particle detectors at the LHC to "offline" data facilities, much less to permanently store it for future processing. For this reason the LHC detectors are equipped with real-time analysis systems, called triggers, which process this volume of data and select the most interesting proton-proton collisions. The LHC experiment triggers reduce the data produced by the LHC by between 1/1000 and 1/100000, to tens of petabytes per year, allowing its economical storage and further analysis. The bulk of the data-reduction is performed by custom electronics which ignores most of the data in its decision making, and is therefore unable to exploit the most powerful known data analysis strategies. I cover the present status of real-time data analysis ...

  4. The incidence and distribution characteristics of MLL rearrangements in Chinese acute myeloid leukemia patients by multiplex nested RT-PCR.

    Science.gov (United States)

    Yang, Hua; Cao, Tingting; Gao, Li; Wang, Lili; Zhu, Chengying; Xu, Yuanyuan; Jing, Yu; Zhu, Haiyan; Lv, Na; Yu, Li

    2017-07-20

    Occurrence of MLL (Mixed Lineage Leukemia) gene rearrangements indicates poor prognosis in acute myeloid leukemia (AML) patients. This is the first study to report the positive rate and distribution characteristics of MLL rearrangements in AML patients in north China. We used multiplex nested real time PCR (RT-PCR) to screen for incidence of 11 MLL rearrangements in 433 AML patients. Eleven MLL rearrangements included (MLL-PTD, MLL-AF9, MLL-ELL, MLL-AF10, MLL-AF17, MLL-AF6, MLL-ENL, MLL-AF1Q, MLL-CBP, MLL-AF1P, MLL-AFX1). There were 68 AML patients with MLL rearrangements, and the positive rate was 15.7%. MLL-PTD (4.84%) was detected in 21 patients, MLL-AF9 in 15, (3.46%), MLL-ELL in 10 (2.31%), MLL-AF10 in 8 (1.85%), MLL-AF1Q in 2 (0.46%), 3 cases each of MLL-AF17, MLL-AF6, MLL-ENL (0.69% each), a and single case each of MLL-CBP, MLL-AF1P, and MLL-AFX1 (0.23% each). The highest rate of MLL rearrangements was found in 24 patients with M5 subtype AML, occurring in 24 cases (35.3%). MLL rearrangements occurred in 21 patients with M2 subtype AML (30.9%), and in 10 patients with M4 subtype AML (14.7%). Screening fusion genes by multiplex nested RT-PCR is a convenient, fast, economical, and accurate method for diagnosis and predicting prognosis of AML.

  5. Real-Time Earthquake Intensity Estimation Using Streaming Data Analysis of Social and Physical Sensors

    Science.gov (United States)

    Kropivnitskaya, Yelena; Tiampo, Kristy F.; Qin, Jinhui; Bauer, Michael A.

    2017-06-01

    Earthquake intensity is one of the key components of the decision-making process for disaster response and emergency services. Accurate and rapid intensity calculations can help to reduce total loss and the number of casualties after an earthquake. Modern intensity assessment procedures handle a variety of information sources, which can be divided into two main categories. The first type of data is that derived from physical sensors, such as seismographs and accelerometers, while the second type consists of data obtained from social sensors, such as witness observations of the consequences of the earthquake itself. Estimation approaches using additional data sources or that combine sources from both data types tend to increase intensity uncertainty due to human factors and inadequate procedures for temporal and spatial estimation, resulting in precision errors in both time and space. Here we present a processing approach for the real-time analysis of streams of data from both source types. The physical sensor data is acquired from the U.S. Geological Survey (USGS) seismic network in California and the social sensor data is based on Twitter user observations. First, empirical relationships between tweet rate and observed Modified Mercalli Intensity (MMI) are developed using data from the M6.0 South Napa, CAF earthquake that occurred on August 24, 2014. Second, the streams of both data types are analyzed together in simulated real-time to produce one intensity map. The second implementation is based on IBM InfoSphere Streams, a cloud platform for real-time analytics of big data. To handle large processing workloads for data from various sources, it is deployed and run on a cloud-based cluster of virtual machines. We compare the quality and evolution of intensity maps from different data sources over 10-min time intervals immediately following the earthquake. Results from the joint analysis shows that it provides more complete coverage, with better accuracy and higher

  6. Real time analysis with the upgraded LHCb trigger in Run III

    Science.gov (United States)

    Szumlak, Tomasz

    2017-10-01

    The current LHCb trigger system consists of a hardware level, which reduces the LHC bunch-crossing rate of 40 MHz to 1.1 MHz, a rate at which the entire detector is read out. A second level, implemented in a farm of around 20k parallel processing CPUs, the event rate is reduced to around 12.5 kHz. The LHCb experiment plans a major upgrade of the detector and DAQ system in the LHC long shutdown II (2018-2019). In this upgrade, a purely software based trigger system is being developed and it will have to process the full 30 MHz of bunch crossings with inelastic collisions. LHCb will also receive a factor of 5 increase in the instantaneous luminosity, which further contributes to the challenge of reconstructing and selecting events in real time with the CPU farm. We discuss the plans and progress towards achieving efficient reconstruction and selection with a 30 MHz throughput. Another challenge is to exploit the increased signal rate that results from removing the 1.1 MHz readout bottleneck, combined with the higher instantaneous luminosity. Many charm hadron signals can be recorded at up to 50 times higher rate. LHCb is implementing a new paradigm in the form of real time data analysis, in which abundant signals are recorded in a reduced event format that can be fed directly to the physics analyses. These data do not need any further offline event reconstruction, which allows a larger fraction of the grid computing resources to be devoted to Monte Carlo productions. We discuss how this real-time analysis model is absolutely critical to the LHCb upgrade, and how it will evolve during Run-II.

  7. Near Real-time Scientific Data Analysis and Visualization with the ArcGIS Platform

    Science.gov (United States)

    Shrestha, S. R.; Viswambharan, V.; Doshi, A.

    2017-12-01

    Scientific multidimensional data are generated from a variety of sources and platforms. These datasets are mostly produced by earth observation and/or modeling systems. Agencies like NASA, NOAA, USGS, and ESA produce large volumes of near real-time observation, forecast, and historical data that drives fundamental research and its applications in larger aspects of humanity from basic decision making to disaster response. A common big data challenge for organizations working with multidimensional scientific data and imagery collections is the time and resources required to manage and process such large volumes and varieties of data. The challenge of adopting data driven real-time visualization and analysis, as well as the need to share these large datasets, workflows, and information products to wider and more diverse communities, brings an opportunity to use the ArcGIS platform to handle such demand. In recent years, a significant effort has put in expanding the capabilities of ArcGIS to support multidimensional scientific data across the platform. New capabilities in ArcGIS to support scientific data management, processing, and analysis as well as creating information products from large volumes of data using the image server technology are becoming widely used in earth science and across other domains. We will discuss and share the challenges associated with big data by the geospatial science community and how we have addressed these challenges in the ArcGIS platform. We will share few use cases, such as NOAA High Resolution Refresh Radar (HRRR) data, that demonstrate how we access large collections of near real-time data (that are stored on-premise or on the cloud), disseminate them dynamically, process and analyze them on-the-fly, and serve them to a variety of geospatial applications. We will also share how on-the-fly processing using raster functions capabilities, can be extended to create persisted data and information products using raster analytics

  8. Real-time Position Based Population Data Analysis and Visualization Using Heatmap for Hazard Emergency Response

    Science.gov (United States)

    Ding, R.; He, T.

    2017-12-01

    With the increased popularity in mobile applications and services, there has been a growing demand for more advanced mobile technologies that utilize real-time Location Based Services (LBS) data to support natural hazard response efforts. Compared to traditional sources like the census bureau that often can only provide historical and static data, an LBS service can provide more current data to drive a real-time natural hazard response system to more accurately process and assess issues such as population density in areas impacted by a hazard. However, manually preparing or preprocessing the data to suit the needs of the particular application would be time-consuming. This research aims to implement a population heatmap visual analytics system based on real-time data for natural disaster emergency management. System comprised of a three-layered architecture, including data collection, data processing, and visual analysis layers. Real-time, location-based data meeting certain polymerization conditions are collected from multiple sources across the Internet, then processed and stored in a cloud-based data store. Parallel computing is utilized to provide fast and accurate access to the pre-processed population data based on criteria such as the disaster event and to generate a location-based population heatmap as well as other types of visual digital outputs using auxiliary analysis tools. At present, a prototype system, which geographically covers the entire region of China and combines population heat map based on data from the Earthquake Catalogs database has been developed. It Preliminary results indicate that the generation of dynamic population density heatmaps based on the prototype system has effectively supported rapid earthquake emergency rescue and evacuation efforts as well as helping responders and decision makers to evaluate and assess earthquake damage. Correlation analyses that were conducted revealed that the aggregation and movement of people

  9. Real-time breath analysis with active capillary plasma ionization-ambient mass spectrometry.

    Science.gov (United States)

    Bregy, Lukas; Sinues, Pablo Martinez-Lozano; Nudnova, Maryia M; Zenobi, Renato

    2014-06-01

    On-line analysis of exhaled human breath is a growing area in analytical science, for applications such as fast and non-invasive medical diagnosis and monitoring. In this work, we present a novel approach based on ambient ionization of compounds in breath and subsequent real-time mass spectrometric analysis. We introduce a plasma ionization source for this purpose, which has no need for additional gases, is very small, and is easily interfaced with virtually any commercial atmospheric pressure ionization mass spectrometer (API-MS) without major modifications. If an API-MS instrument exists in a laboratory, the cost to implement this technology is only around [Formula: see text]500, far less than the investment for a specialized mass spectrometric system designed for volatile organic compounds (VOCs) analysis. In this proof-of-principle study we were able to measure mass spectra of exhaled human breath and found these to be comparable to spectra obtained with other electrospray-based methods. We detected over 100 VOCs, including relevant metabolites like fatty acids, with molecular weights extending up to 340 Da. In addition, we were able to monitor the time-dependent evolution of the peaks and show the enhancement of the metabolism after a meal. We conclude that this approach may complement current methods to analyze breath or other types of vapors, offering an affordable option to upgrade any pre-existing API-MS to a real-time breath analyzer.

  10. Impact Analysis of Land Use on Traffic Congestion Using Real-Time Traffic and POI

    Directory of Open Access Journals (Sweden)

    Tianqi Zhang

    2017-01-01

    Full Text Available This paper proposed a new method to describe, compare, and classify the traffic congestion points in Beijing, China, by using the online map data and further revealed the relationship between traffic congestion and land use. The data of the point of interest (POI and the real-time traffic was extracted from an electronic map of the area in the fourth ring road of Beijing. The POIs were quantified based on the architectural area of the land use; the congestion points were identified based on real-time traffic. Then, the cluster analysis using the attributes of congestion time was conducted to identify the main traffic congestion areas. The result of a linear regression analysis between the congestion time and the land use showed that the influence of the high proportion of commercial land use on the traffic congestion was significant. Also, we considered five types of land use through performing a linear regression analysis between the congestion time and the ratio of four types of land use. The results showed that the reasonable ratio of land use types could efficiently reduce congestion time. This study makes contributions to the policy-making of urban land use.

  11. Identification and Evaluation of Reliable Reference Genes for Quantitative Real-Time PCR Analysis in Tea Plant (Camellia sinensis (L.) O. Kuntze)

    Science.gov (United States)

    Hao, Xinyuan; Horvath, David P.; Chao, Wun S.; Yang, Yajun; Wang, Xinchao; Xiao, Bin

    2014-01-01

    Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a crucial step in qRT-PCR normalization. To date, only a few housekeeping genes have been identified and used as reference genes in tea plant. The validity of those reference genes are not clear since their expression stabilities have not been rigorously examined. To identify more appropriate reference genes for qRT-PCR studies on tea plant, we examined the expression stability of 11 candidate reference genes from three different sources: the orthologs of Arabidopsis traditional reference genes and stably expressed genes identified from whole-genome GeneChip studies, together with three housekeeping gene commonly used in tea plant research. We evaluated the transcript levels of these genes in 94 experimental samples. The expression stabilities of these 11 genes were ranked using four different computation programs including geNorm, Normfinder, BestKeeper, and the comparative ∆CT method. Results showed that the three commonly used housekeeping genes of CsTUBULIN1, CsACINT1 and Cs18S rRNA1 together with CsUBQ1 were the most unstable genes in all sample ranking order. However, CsPTB1, CsEF1, CsSAND1, CsCLATHRIN1 and CsUBC1 were the top five appropriate reference genes for qRT-PCR analysis in complex experimental conditions. PMID:25474086

  12. Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

    Directory of Open Access Journals (Sweden)

    Vlademir Cantarelli

    2011-10-01

    Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

  13. Twitter data analysis: temporal and term frequency analysis with real-time event

    Science.gov (United States)

    Yadav, Garima; Joshi, Mansi; Sasikala, R.

    2017-11-01

    From the past few years, World Wide Web (www) has become a prominent and huge source for user generated content and opinionative data. Among various social media, Twitter gained popularity as it offers a fast and effective way of sharing users’ perspective towards various critical and other issues in different domain. As the data is hugely generated on cloud, it has opened doors for the researchers in the field of data science and analysis. There are various domains such as ‘Political’ domain, ‘Entertainment’ domain and ‘Business’ domain. Also there are various APIs that Twitter provides for developers 1) Search API, focus on the old tweets 2) Rest API, focuses on user details and allow to collect the user profile, friends and followers 3) Streaming API, which collects details like tweets, hashtags, geo locations. In our work we are accessing Streaming API in order to fetch real-time tweets for the dynamic happening event. For this we are focusing on ‘Entertainment’ domain especially ‘Sports’ as IPL-T20 is currently the trending on-going event. We are collecting these numerous amounts of tweets and storing them in MongoDB database where the tweets are stored in JSON document format. On this document we are performing time-series analysis and term frequency analysis using different techniques such as filtering, information extraction for text-mining that fulfils our objective of finding interesting moments for temporal data in the event and finding the ranking among the players or the teams based on popularity which helps people in understanding key influencers on the social media platform.

  14. Direct analysis in real time mass spectrometry for analysis of sexual assault evidence.

    Science.gov (United States)

    Musah, Rabi A; Cody, Robert B; Dane, A John; Vuong, Angela L; Shepard, Jason R E

    2012-05-15

    Sexual assault crimes are vastly underreported and suffer from alarmingly low prosecution and conviction rates. The key scientific method to aid in prosecution of such cases is forensic DNA analysis, where biological evidence such as semen collected using a rape test kit is used to determine a suspect's DNA profile. However, the growing awareness by criminals of the importance of DNA in the prosecution of sexual assaults has resulted in increased condom use by assailants as a means to avoid leaving behind their DNA. Thus, other types of trace evidence are important to help corroborate victims' accounts, exonerate the innocent, link suspects to the crime, or confirm penetration. Direct Analysis in Real Time Mass Spectrometry (DART-MS) was employed for the comprehensive characterization of non-DNA trace evidence associated with sexual assault. The ambient ionization method associated with DART-MS is extremely rapid and samples are processed instantaneously, without the need for extraction, sample preparation, or other means that might compromise forensic evidence for future analyses. In a single assay, we demonstrated the ability to identify lubricant formulations associated with sexual assault, such as the spermicide nonoxynol-9, compounds used in condom manufacture, and numerous other trace components as probative evidence. In addition, the method can also serve to identify compounds within trace biological residues, such as fatty acids commonly identified in latent fingerprints. Characterization of lubricant residues as probative evidence serves to establish a connection between the victim and the perpetrator, and the availability of these details may lead to higher rates of prosecution and conviction, as well as more severe penalties. The methodology described here opens the way for the adoption of a comprehensive, rapid, and sensitive analysis for use in crime labs, while providing knowledge that can inform and guide criminal justice policy and practice

  15. Surrogate analysis and index developer (SAID) tool and real-time data dissemination utilities

    Science.gov (United States)

    Domanski, Marian M.; Straub, Timothy D.; Wood, Molly S.; Landers, Mark N.; Wall, Gary R.; Brady, Steven J.

    2015-01-01

    The use of acoustic and other parameters as surrogates for suspended-sediment concentrations (SSC) in rivers has been successful in multiple applications across the Nation. Critical to advancing the operational use of surrogates are tools to process and evaluate the data along with the subsequent development of regression models from which real-time sediment concentrations can be made available to the public. Recent developments in both areas are having an immediate impact on surrogate research, and on surrogate monitoring sites currently in operation. The Surrogate Analysis and Index Developer (SAID) standalone tool, under development by the U.S. Geological Survey (USGS), assists in the creation of regression models that relate response and explanatory variables by providing visual and quantitative diagnostics to the user. SAID also processes acoustic parameters to be used as explanatory variables for suspended-sediment concentrations. The sediment acoustic method utilizes acoustic parameters from fixed-mount stationary equipment. The background theory and method used by the tool have been described in recent publications, and the tool also serves to support sediment-acoustic-index methods being drafted by the multi-agency Sediment Acoustic Leadership Team (SALT), and other surrogate guidelines like USGS Techniques and Methods 3-C4 for turbidity and SSC. The regression models in SAID can be used in utilities that have been developed to work with the USGS National Water Information System (NWIS) and for the USGS National Real-Time Water Quality (NRTWQ) Web site. The real-time dissemination of predicted SSC and prediction intervals for each time step has substantial potential to improve understanding of sediment-related water-quality and associated engineering and ecological management decisions.

  16. RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms.

    Science.gov (United States)

    Green, Clayton B; Cheng, Georgina; Chandra, Jyotsna; Mukherjee, Pranab; Ghannoum, Mahmoud A; Hoyer, Lois L

    2004-02-01

    An RT-PCR assay was developed to analyse expression patterns of genes in the Candida albicans ALS (agglutinin-like sequence) family. Inoculation of a reconstituted human buccal epithelium (RHE) model of mucocutaneous candidiasis with strain SC5314 showed destruction of the epithelial layer by C. albicans and also formation of an upper fungal layer that had characteristics similar to a biofilm. RT-PCR analysis of total RNA samples extracted from C. albicans-inoculated buccal RHE showed that ALS1, ALS2, ALS3, ALS4, ALS5 and ALS9 were consistently detected over time as destruction of the RHE progressed. Detection of transcripts from ALS7, and particularly from ALS6, was more sporadic, but not associated with a strictly temporal pattern. The expression pattern of ALS genes in C. albicans cultures used to inoculate the RHE was similar to that observed in the RHE model, suggesting that contact of C. albicans with buccal RHE does little to alter ALS gene expression. RT-PCR analysis of RNA samples extracted from model denture and catheter biofilms showed similar gene expression patterns to the buccal RHE specimens. Results from the RT-PCR analysis of biofilm RNA specimens were consistent between various C. albicans strains during biofilm development and were comparable to gene expression patterns in planktonic cells. The RT-PCR assay described here will be useful for analysis of human clinical specimens and samples from other disease models. The method will provide further insight into the role of ALS genes and their encoded proteins in the diverse interactions between C. albicans and its host.

  17. Development of a multiplex real-time PCR assay for phylogenetic analysis of Uropathogenic Escherichia coli.

    Science.gov (United States)

    Hasanpour, Mojtaba; Najafi, Akram

    2017-06-01

    Uropathogenic Escherichia coli (UPEC) is among major pathogens causing 80-90% of all episodes of urinary tract infections (UTIs). Recently, E. coli strains are divided into eight main phylogenetic groups including A, B1, B2, C, D, E, F, and clade I. This study was aimed to develop a rapid, sensitive, and specific multiplex real time PCR method capable of detecting phylogenetic groups of E. coli strains. This study was carried out on E. coli strains (isolated from the patient with UTI) in which the presence of all seven target genes had been confirmed in our previous phylogenetic study. An EvaGreen-based singleplex and multiplex real-time PCR with melting curve analysis was designed for simultaneous detection and differentiation of these genes. The primers were selected mainly based on the production of amplicons with melting temperatures (T m ) ranging from 82°C to 93°C and temperature difference of more than 1.5°C between each peak.The multiplex real-time PCR assays that have been developed in the present study were successful in detecting the eight main phylogenetic groups. Seven distinct melting peaks were discriminated, with Tm value of 93±0.8 for arpA, 89.2±0.1for chuA, 86.5±0.1 for yjaA, 82.3±0.2 for TspE4C2, 87.8±0.1for trpAgpC, 85.4±0.6 for arpAgpE genes, and 91±0.5 for the internal control. To our knowledge, this study is the first melting curve-based real-time PCR assay developed for simultaneous and discrete detection of these seven target genes. Our findings showed that this assay has the potential to be a rapid, reliable and cost-effective alternative for routine phylotyping of E. coli strains. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Development of Geometrical Quality Control Real-time Analysis Program using an Electronic Portal Imaging

    International Nuclear Information System (INIS)

    Lee, Sang Rok; Jung, Kyung Yong; Jang, Min Sun; Lee, Byung Gu; Kwon, Young Ho

    2012-01-01

    To develop a geometrical quality control real-time analysis program using an electronic portal imaging to replace film evaluation method. A geometrical quality control item was established with the Eclipse treatment planning system (Version 8.1, Varian, USA) after the Electronic Portal Imaging Device (EPID) took care of the problems occurring from the fixed substructure of the linear accelerator (CL-iX, Varian, USA). Electronic portal image (single exposure before plan) was created at the treatment room's 4DTC (Version 10.2, Varian, USA) and a beam was irradiated in accordance with each item. The gaining the entire electronic portal imaging at the Off-line review and was evaluated by a self-developed geometrical quality control real-time analysis program. As for evaluation methods, the intra-fraction error was analyzed by executing 5 times in a row under identical conditions and procedures on the same day, and in order to confirm the infer-fraction error, it was executed for 10 days under identical conditions of all procedures and was compared with the film evaluation method using an Iso-align quality control device. Measurement and analysis time was measured by sorting the time into from the device setup to data achievement and the time amount after the time until the completion of analysis and the convenience of the users and execution processes were compared. The intra-fraction error values for each average 0.1, 0.2, 0.3, 0.2 mm at light-radiation field coincidence, collimator rotation axis, couch rotation axis and gantry rotation axis. By checking the infer-fraction error through 10 days of continuous quality control, the error values obtained were average 1.7, 1.4, 0.7, 1.1 mm for each item. Also, the measurement times were average 36 minutes, 15 minutes for the film evaluation method and electronic portal imaging system, and the analysis times were average 30 minutes, 22 minutes. When conducting a geometrical quality control using an electronic portal imaging

  19. Real time analysis of electromagnetic radiation in a very wide frequency range

    International Nuclear Information System (INIS)

    Peralta, J.A.; Reyes L, P.; Yepez, E.

    2001-01-01

    In this work, we present an electronic apparatus that facilitates the monitoring and analysis of electromagnetic radiation in a very wide frequency range. The device is a combination of real and virtual instruments, taking advantage of new hardware and software; the measurable range of frequencies depends on the speed of an analog/digital converter, reaching tens of Megahertz. The device has been successfully used to monitor the environmental electromagnetic radiation at very low frequency, a very useful parameter in the research of electromagnetic precursors of earthquakes. The apparatus is a new configuration and has advantages with respect to those previously used: when the attached computer is fast, Fourier analysis can be done in real time, can display simultaneously several bands, the digitized data allow a variety of methods of analysis, and the apparatus is very cheap. (Author)

  20. Profiling of Piper betle Linn. cultivars by direct analysis in real time mass spectrometric technique.

    Science.gov (United States)

    Bajpai, Vikas; Sharma, Deepty; Kumar, Brijesh; Madhusudanan, K P

    2010-12-01

    Piper betle Linn. is a traditional plant associated with the Asian and southeast Asian cultures. Its use is also recorded in folk medicines in these regions. Several of its medicinal properties have recently been proven. Phytochemical analysis showed the presence of mainly terpenes and phenols in betel leaves. These constituents vary in the different cultivars of Piper betle. In this paper we have attempted to profile eight locally available betel cultivars using the recently developed mass spectral ionization technique of direct analysis in real time (DART). Principal component analysis has also been employed to analyze the DART MS data of these betel cultivars. The results show that the cultivars of Piper betle could be differentiated using DART MS data. Copyright © 2010 John Wiley & Sons, Ltd.

  1. Validation of the direct analysis in real time source for use in forensic drug screening.

    Science.gov (United States)

    Steiner, Robert R; Larson, Robyn L

    2009-05-01

    The Direct Analysis in Real Time (DART) ion source is a relatively new mass spectrometry technique that is seeing widespread use in chemical analyses world-wide. DART studies include such diverse topics as analysis of flavors and fragrances, melamine in contaminated dog food, differentiation of writing inks, characterization of solid counterfeit drugs, and as a detector for planar chromatography. Validation of this new technique for the rapid screening of forensic evidence for drugs of abuse, utilizing the DART source coupled to an accurate mass time-of-flight mass spectrometer, was conducted. The study consisted of the determination of the lower limit of detection for the method, determination of selectivity and a comparison of this technique to established analytical protocols. Examples of DART spectra are included. The results of this study have allowed the Virginia Department of Forensic Science to incorporate this new technique into their analysis scheme for the screening of solid dosage forms of drugs of abuse.

  2. Real time analysis of electromagnetic radiation in a very wide frequency range

    Energy Technology Data Exchange (ETDEWEB)

    Peralta, J.A.; Reyes L, P.; Yepez, E. [Escuela Superior de Fisica y Matematicas, Instituto Politecnico Nacional, Edificio 9, U.P. Adolfo Lopez Mateos, Zacatenco, 07738 Mexico D.F. (Mexico)

    2001-07-01

    In this work, we present an electronic apparatus that facilitates the monitoring and analysis of electromagnetic radiation in a very wide frequency range. The device is a combination of real and virtual instruments, taking advantage of new hardware and software; the measurable range of frequencies depends on the speed of an analog/digital converter, reaching tens of Megahertz. The device has been successfully used to monitor the environmental electromagnetic radiation at very low frequency, a very useful parameter in the research of electromagnetic precursors of earthquakes. The apparatus is a new configuration and has advantages with respect to those previously used: when the attached computer is fast, Fourier analysis can be done in real time, can display simultaneously several bands, the digitized data allow a variety of methods of analysis, and the apparatus is very cheap. (Author)

  3. A CAMAC based real-time noise analysis system for nuclear reactors

    International Nuclear Information System (INIS)

    Ciftcioglu, O.

    1987-01-01

    A CAMAC based real-time noise analysis system was designed for the TRIGA MARK II nuclear reactor at the Institute for Nuclear Energy, Istanbul. The input analog signals obtained from the radiation detectors are introduced to the system through CAMAC interface. The signals coverted into digital form are processed by a PDP-11 computer. The fast data processing based on auto/cross power spectral density computations is carried out by means of assembly written FFT algorithms in real-time and the spectra obtained are displayed on a CAMAC driven display system as an additional monitoring device. The system has the advantage of being software programmable and controlled by a CAMAC system so that it is operated under porgram control for reactor surveillance, anomaly detection and diagnosis. The system can also be used for the identification of nonstationary operational characteristics of the reactor in long term by comparing the noise power spectra with the corresponding reference noise patterns prepared in advance. (orig.)

  4. Real time data analysis with the ATLAS Trigger at the LHC in Run-2

    CERN Document Server

    Beauchemin, Pierre-Hugues; The ATLAS collaboration

    2018-01-01

    The trigger selection capabilities of the ATLAS detector have been significantly enhanced for the LHC Run- 2 in order to cope with the higher event rates and with the large number of simultaneous interactions (pile-up) per protonproton bunch crossing. A new hardware system, designed to analyse real time event-topologies at Level-1 came to full use in 2017. A hardware-based track reconstruction system, expected to be used real-time in 2018, is designed to provide track information to the high-level software trigger at its full input rate. The high-level trigger selections are largely relying on offline-like reconstruction techniques, and in some cases multivariate analysis methods. Despite the sudden change in LHC operations during the second half of 2017, which caused an increase in pile-up and therefore also in CPU usage of the trigger algorithms, the set of triggers (so called trigger menu) running online has undergone only minor modifications thanks to the robustness and redundancy of the trigger system, a...

  5. Real time data analysis with the ATLAS trigger at the LHC in Run-2

    CERN Document Server

    Beauchemin, Pierre-Hugues; The ATLAS collaboration

    2018-01-01

    The trigger selection capabilities of the ATLAS detector have been significantly enhanced for the LHC Run-2 in order to cope with the higher event rates and with the large number of simultaneous interactions (pile-up) per proton-proton bunch crossing. A new hardware system, designed to analyse real time event-topologies at Level-1 came to full use in 2017. A hardware-based track reconstruction system, expected to be used real-time in 2018, is designed to provide track information to the high-level software trigger at its full input rate. The high-level trigger selections are largely relying on offline-like reconstruction techniques, and in some cases multi-variate analysis methods. Despite the sudden change in LHC operations during the second half of 2017, which caused an increase in pile-up and therefore also in CPU usage of the trigger algorithms, the set of triggers (so called trigger menu) running online has undergone only minor modifications thanks to the robustness and redundancy of the trigger system, ...

  6. Distributed Resource Energy Analysis and Management System (DREAMS) Development for Real-time Grid Operations

    Energy Technology Data Exchange (ETDEWEB)

    Nakafuji, Dora [Hawaiian Electric Company, Honululu, HI (United States); Gouveia, Lauren [Hawaiian Electric Company, Honululu, HI (United States)

    2016-10-24

    This project supports development of the next generation, integrated energy management infrastructure (EMS) able to incorporate advance visualization of behind-the-meter distributed resource information and probabilistic renewable energy generation forecasts to inform real-time operational decisions. The project involves end-users and active feedback from an Utility Advisory Team (UAT) to help inform how information can be used to enhance operational functions (e.g. unit commitment, load forecasting, Automatic Generation Control (AGC) reserve monitoring, ramp alerts) within two major EMS platforms. Objectives include: Engaging utility operations personnel to develop user input on displays, set expectations, test and review; Developing ease of use and timeliness metrics for measuring enhancements; Developing prototype integrated capabilities within two operational EMS environments; Demonstrating an integrated decision analysis platform with real-time wind and solar forecasting information and timely distributed resource information; Seamlessly integrating new 4-dimensional information into operations without increasing workload and complexities; Developing sufficient analytics to inform and confidently transform and adopt new operating practices and procedures; Disseminating project lessons learned through industry sponsored workshops and conferences;Building on collaborative utility-vendor partnership and industry capabilities

  7. Analysis of actuator delay and its effect on uncertainty quantification for real-time hybrid simulation

    Science.gov (United States)

    Chen, Cheng; Xu, Weijie; Guo, Tong; Chen, Kai

    2017-10-01

    Uncertainties in structure properties can result in different responses in hybrid simulations. Quantification of the effect of these uncertainties would enable researchers to estimate the variances of structural responses observed from experiments. This poses challenges for real-time hybrid simulation (RTHS) due to the existence of actuator delay. Polynomial chaos expansion (PCE) projects the model outputs on a basis of orthogonal stochastic polynomials to account for influences of model uncertainties. In this paper, PCE is utilized to evaluate effect of actuator delay on the maximum displacement from real-time hybrid simulation of a single degree of freedom (SDOF) structure when accounting for uncertainties in structural properties. The PCE is first applied for RTHS without delay to determine the order of PCE, the number of sample points as well as the method for coefficients calculation. The PCE is then applied to RTHS with actuator delay. The mean, variance and Sobol indices are compared and discussed to evaluate the effects of actuator delay on uncertainty quantification for RTHS. Results show that the mean and the variance of the maximum displacement increase linearly and exponentially with respect to actuator delay, respectively. Sensitivity analysis through Sobol indices also indicates the influence of the single random variable decreases while the coupling effect increases with the increase of actuator delay.

  8. Tendency for interlaboratory precision in the GMO analysis method based on real-time PCR.

    Science.gov (United States)

    Kodama, Takashi; Kurosawa, Yasunori; Kitta, Kazumi; Naito, Shigehiro

    2010-01-01

    The Horwitz curve estimates interlaboratory precision as a function only of concentration, and is frequently used as a method performance criterion in food analysis with chemical methods. The quantitative biochemical methods based on real-time PCR require an analogous criterion to progressively promote method validation. We analyzed the tendency of precision using a simplex real-time PCR technique in 53 collaborative studies of seven genetically modified (GM) crops. Reproducibility standard deviation (SR) and repeatability standard deviation (Sr) of the genetically modified organism (GMO) amount (%) was more or less independent of GM crops (i.e., maize, soybean, cotton, oilseed rape, potato, sugar beet, and rice) and evaluation procedure steps. Some studies evaluated whole steps consisting of DNA extraction and PCR quantitation, whereas others focused only on the PCR quantitation step by using DNA extraction solutions. Therefore, SR and Sr for GMO amount (%) are functions only of concentration similar to the Horwitz curve. We proposed S(R) = 0.1971C 0.8685 and S(r) = 0.1478C 0.8424, where C is the GMO amount (%). We also proposed a method performance index in GMO quantitative methods that is analogous to the Horwitz Ratio.

  9. Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay

    Directory of Open Access Journals (Sweden)

    Gaya Prasad

    2013-06-01

    Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557

  10. Detecting the Presence of Nora Virus in "Drosophila" Utilizing Single Fly RT-PCR

    Science.gov (United States)

    Munn, Bethany; Ericson, Brad; Carlson, Darby J.; Carlson, Kimberly A.

    2015-01-01

    A single fly RT-PCR protocol has recently been developed to detect the presence of the persistent, horizontally transmitted Nora virus in "Drosophila." Wild-caught flies from Ohio were tested for the presence of the virus, with nearly one-fifth testing positive. The investigation presented can serve as an ideal project for biology…

  11. RT-PCR for detection of all seven genotypes of Lyssavirus genus.

    Science.gov (United States)

    Vázquez-Morón, S; Avellón, A; Echevarría, J E

    2006-08-01

    The Lyssavirus genus includes seven species or genotypes named 1-7. Rabies genotypes correlate with geographical distribution and specific hosts. Co-circulation of different lyssaviruses, imported cases, and the presence of unknown viruses, such as Aravan, Khujand, Irkut and West Caucasian Bat Virus, make it necessary to use generic methods able to detect all lyssaviruses. Primer sequences were chosen from conserved regions in all genotypes in order to optimise a generic RT-PCR. Serial dilutions of 12 RNA extracts from all seven Lyssavirus genotypes were examined to compare the sensitivity of the RT-PCR standardised in this study with a published RT-PCR optimised for EBLV1 detection and capable of amplifying RNA from all seven lyssaviruses. All seven genotypes were detected by both RT-PCRs, however, the sensitivity was higher with the new version of the test. Twenty samples submitted for rabies diagnosis were tested by the new RT-PCR. Eight out of 20 samples from six dogs, one horse and one bat were found positive, in agreement with immunofluorescence results. Seven samples from terrestrial mammals were genotype 1 and one from a bat was genotype 5. In conclusion, this method can be used to complement immunofluorescence for the diagnosis of rabies, enabling the detection of unexpected lyssaviruses during rabies surveillance.

  12. RT-PCR-ELISA as a tool for diagnosis of low-pathogenicity avian influenza

    DEFF Research Database (Denmark)

    Dybkaer, Karen; Munch, Mette; Handberg, Kurt Jensen

    2003-01-01

    A one-tube reverse transcriptase/polymerase chain reaction coupled with an enzyme-linked immunosorbent assay (RT-PCR-ELISA) was developed for the rapid detection of avian influenza virus (AIV) in clinical specimens. A total of 419 swab pools were analyzed from chickens experimentally infected...

  13. Identification and characterization of a novel tospovirus species using a new RT-PCR approach

    NARCIS (Netherlands)

    Cortez, I.; Saaijer, J.; Wonjkaew, K.S.; Pereira, A.M.; Goldbach, R.W.; Peters, D.; Kormelink, R.

    2001-01-01

    Summary. A novel tospovirus serologically distinct from all established tospo- virus species was found in Thailand in Physalis minima L. The S RNA of this virus was cloned by a new RT-PCR approach revealing a nucleotide sequence of 3257 nucleotides. The ambisense RNA segment encoded a nonstructural

  14. Collaborative real-time motion video analysis by human observer and image exploitation algorithms

    Science.gov (United States)

    Hild, Jutta; Krüger, Wolfgang; Brüstle, Stefan; Trantelle, Patrick; Unmüßig, Gabriel; Heinze, Norbert; Peinsipp-Byma, Elisabeth; Beyerer, Jürgen

    2015-05-01

    Motion video analysis is a challenging task, especially in real-time applications. In most safety and security critical applications, a human observer is an obligatory part of the overall analysis system. Over the last years, substantial progress has been made in the development of automated image exploitation algorithms. Hence, we investigate how the benefits of automated video analysis can be integrated suitably into the current video exploitation systems. In this paper, a system design is introduced which strives to combine both the qualities of the human observer's perception and the automated algorithms, thus aiming to improve the overall performance of a real-time video analysis system. The system design builds on prior work where we showed the benefits for the human observer by means of a user interface which utilizes the human visual focus of attention revealed by the eye gaze direction for interaction with the image exploitation system; eye tracker-based interaction allows much faster, more convenient, and equally precise moving target acquisition in video images than traditional computer mouse selection. The system design also builds on prior work we did on automated target detection, segmentation, and tracking algorithms. Beside the system design, a first pilot study is presented, where we investigated how the participants (all non-experts in video analysis) performed in initializing an object tracking subsystem by selecting a target for tracking. Preliminary results show that the gaze + key press technique is an effective, efficient, and easy to use interaction technique when performing selection operations on moving targets in videos in order to initialize an object tracking function.

  15. [REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].

    Science.gov (United States)

    Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A

    2015-01-01

    Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.

  16. A Real-Time PCR with Melting Curve Analysis for Molecular Typing of Vibrio parahaemolyticus.

    Science.gov (United States)

    He, Peiyan; Wang, Henghui; Luo, Jianyong; Yan, Yong; Chen, Zhongwen

    2018-05-23

    Foodborne disease caused by Vibrio parahaemolyticus is a serious public health problem in many countries. Molecular typing has a great scientific significance and application value for epidemiological research of V. parahaemolyticus. In this study, a real-time PCR with melting curve analysis was established for molecular typing of V. parahaemolyticus. Eighteen large variably presented gene clusters (LVPCs) of V. parahaemolyticus which have different distributions in the genome of different strains were selected as targets. Primer pairs of 18 LVPCs were distributed into three tubes. To validate this newly developed assay, we tested 53 Vibrio parahaemolyticus strains, which were classified in 13 different types. Furthermore, cluster analysis using NTSYS PC 2.02 software could divide 53 V. parahaemolyticus strains into six clusters at a relative similarity coefficient of 0.85. This method is fast, simple, and conveniently for molecular typing of V. parahaemolyticus.

  17. Timing Analysis of Mixed-Criticality Hard Real-Time Applications Implemented on Distributed Partitioned Architectures

    DEFF Research Database (Denmark)

    Marinescu, Sorin Ovidiu; Tamas-Selicean, Domitian; Acretoaie, Vlad

    In this paper we are interested in the timing analysis of mixed-criticality embedded real-time applications mapped on distributed heterogeneous architectures. Mixedcriticality tasks can be integrated onto the same architecture only if there is enough spatial and temporal separation among them. We...... in partitions using fixedpriority preemptive scheduling. We have extended the stateof- the-art algorithms for schedulability analysis to take into account the partitions. The proposed algorithm has been evaluated using several synthetic and real-life benchmarks....... consider that the separation is provided by partitioning, such that applications run in separate partitions, and each partition is allocated several time slots on a processor. Each partition can have its own scheduling policy. We are interested to determine the worst-case response times of tasks scheduled...

  18. Verus: A Tool for Quantitative Analysis of Finite-State Real-Time Systems.

    Science.gov (United States)

    1996-08-12

    Symbolic model checking is a technique for verifying finite-state concurrent systems that has been extended to handle real - time systems . Models with...up to 10(exp 30) states can often be verified in minutes. In this paper, we present a new tool to analyze real - time systems , based on this technique...We have designed a language, called Verus, for the description of real - time systems . Such a description is compiled into a state-transition graph and

  19. Direct analysis in real time mass spectrometry, a process analytical technology tool for real-time process monitoring in botanical drug manufacturing.

    Science.gov (United States)

    Wang, Lu; Zeng, Shanshan; Chen, Teng; Qu, Haibin

    2014-03-01

    A promising process analytical technology (PAT) tool has been introduced for batch processes monitoring. Direct analysis in real time mass spectrometry (DART-MS), a means of rapid fingerprint analysis, was applied to a percolation process with multi-constituent substances for an anti-cancer botanical preparation. Fifteen batches were carried out, including ten normal operations and five abnormal batches with artificial variations. The obtained multivariate data were analyzed by a multi-way partial least squares (MPLS) model. Control trajectories were derived from eight normal batches, and the qualification was tested by R(2) and Q(2). Accuracy and diagnosis capability of the batch model were then validated by the remaining batches. Assisted with high performance liquid chromatography (HPLC) determination, process faults were explained by corresponding variable contributions. Furthermore, a batch level model was developed to compare and assess the model performance. The present study has demonstrated that DART-MS is very promising in process monitoring in botanical manufacturing. Compared with general PAT tools, DART-MS offers a particular account on effective compositions and can be potentially used to improve batch quality and process consistency of samples in complex matrices. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Development of a one-step RT-PCR assay for detection of pancoronaviruses (α-, β-, γ-, and δ-coronaviruses) using newly designed degenerate primers for porcine and avian `fecal samples.

    Science.gov (United States)

    Hu, Hui; Jung, Kwonil; Wang, Qiuhong; Saif, Linda J; Vlasova, Anastasia N

    2018-06-01

    Coronaviruses (CoVs) are critical human and animal pathogens because of their potential to cause severe epidemics of respiratory or enteric diseases. In pigs, the newly emerged porcine deltacoronavirus (PDCoV) and re-emerged porcine epidemic diarrhea virus (PEDV) reported in the US and Asia, as well as the discovery of novel CoVs in wild bats or birds, has necessitated development of improved detection and control measures for these CoVs. Because the previous pancoronavirus (panCoV) RT-PCR established in our laboratory in 2007-2011 did not detect deltacoronaviruses (δ-CoVs) in swine fecal and serum samples, our goal was to develop a new panCoV RT-PCR assay to detect known human and animal CoVs, including δ-CoVs. In this study, we designed a new primer set to amplify a 668 bp-region within the RNA-dependent RNA polymerase (RdRP) gene that encodes the most conserved protein domain of α-, β-, γ-, and δ-CoVs. We established a one-step panCoV RT-PCR assay and standardized the assay conditions. The newly established panCoV RT-PCR assay was demonstrated to have a high sensitivity and specificity. Using a panel of 60 swine biological samples (feces, intestinal contents, and sera) characterized by PEDV, PDCoV and transmissible gastroenteritis virus-specific RT-PCR assays, we demonstrated that sensitivity and specificity of the newly established panCoV RT-PCR assay were 100%. 400 avian fecal (RNA) samples were further tested simultaneously for CoV by the new panCoV RT-PCR and a one-step RT-PCR assay with the δ-CoV nucleocapsid-specific universal primers. Four of 400 avian samples were positive for CoV, three of which were positive for δ-CoV by the conventional RT-PCR. PanCoV RT-PCR fragments for 3 of the 4 CoVs were sequenced. Phylogenetic analysis revealed the presence of one γ-CoV and two δ-CoV in the sequenced samples. The newly designed panCoV RT-PCR assay should be useful for the detection of currently known CoVs in animal biological samples. Copyright © 2018

  1. Sensitivity and specificity of real-time reverse transcription polymerase chain reaction, histopathology, and immunohistochemical labeling for the detection of Rift Valley fever virus in naturally infected cattle and sheep.

    Science.gov (United States)

    Odendaal, Lieza; Fosgate, Geoffrey T; Romito, Marco; Coetzer, Jacobus A W; Clift, Sarah J

    2014-01-01

    Real-time reverse transcription polymerase chain reaction (real-time RT-PCR), histopathology, and immunohistochemical labeling (IHC) were performed on liver specimens from 380 naturally infected cattle and sheep necropsied during the 2010 Rift Valley fever (RVF) epidemic in South Africa. Sensitivity (Se) and specificity (Sp) of real-time RT-PCR, histopathology, and IHC were estimated in a latent-class model using a Bayesian framework. The Se and Sp of real-time RT-PCR were estimated as 97.4% (95% confidence interval [CI] = 95.2-98.8%) and 71.7% (95% CI = 65-77.9%) respectively. The Se and Sp of histopathology were estimated as 94.6% (95% CI = 91-97.2%) and 92.3% (95% CI = 87.6-95.8%), respectively. The Se and Sp of IHC were estimated as 97.6% (95% CI = 93.9-99.8%) and 99.4% (95% CI = 96.9-100%), respectively. Decreased Sp of real-time RT-PCR was ascribed to cross-contamination of samples. Stratified analysis of the data suggested variations in test accuracy with fetuses and severely autolyzed specimens. The Sp of histopathology in fetuses (83%) was 9.3% lower than the sample population (92.3%). The Se of IHC decreased from 97.6% to 81.5% in the presence of severe autolysis. The diagnostic Se and Sp of histopathology was higher than expected, confirming the value of routine postmortem examinations and histopathology of liver specimens. Aborted fetuses, however, should be screened using a variety of tests in areas endemic for RVF, and results from severely autolyzed specimens should be interpreted with caution. The most feasible testing option for countries lacking suitably equipped laboratories seems to be routine histology in combination with IHC.

  2. Evaluation and analysis of real-time precise orbits and clocks products from different IGS analysis centers

    Science.gov (United States)

    Zhang, Liang; Yang, Hongzhou; Gao, Yang; Yao, Yibin; Xu, Chaoqian

    2018-06-01

    To meet the increasing demands from the real-time Precise Point Positioning (PPP) users, the real-time satellite orbit and clock products are generated by different International GNSS Service (IGS) real-time analysis centers and can be publicly received through the Internet. Based on different data sources and processing strategies, the real-time products from different analysis centers therefore differ in availability and accuracy. The main objective of this paper is to evaluate availability and accuracy of different real-time products and their effects on real-time PPP. A total of nine commonly used Real-Time Service (RTS) products, namely IGS01, IGS03, CLK01, CLK15, CLK22, CLK52, CLK70, CLK81 and CLK90, will be evaluated in this paper. Because not all RTS products support multi-GNSS, only GPS products are analyzed in this paper. Firstly, the availability of all RTS products is analyzed in two levels. The first level is the epoch availability, indicating whether there is outage for that epoch. The second level is the satellite availability, which defines the available satellite number for each epoch. Then the accuracy of different RTS products is investigated on nominal accuracy and the accuracy degradation over time. Results show that Root-Mean-Square Error (RMSE) of satellite orbit ranges from 3.8 cm to 7.5 cm for different RTS products. While the mean Standard Deviations of Errors (STDE) of satellite clocks range from 1.9 cm to 5.6 cm. The modified Signal In Space Range Error (SISRE) for all products are from 1.3 cm to 5.5 cm for different RTS products. The accuracy degradation of the orbit has the linear trend for all RTS products and the satellite clock degradation depends on the satellite clock types. The Rb clocks on board of GPS IIF satellites have the smallest degradation rate of less than 3 cm over 10 min while the Cs clocks on board of GPS IIF have the largest degradation rate of more than 10 cm over 10 min. Finally, the real-time kinematic PPP is

  3. Generic detection of poleroviruses using an RT-PCR assay targeting the RdRp coding sequence.

    Science.gov (United States)

    Lotos, Leonidas; Efthimiou, Konstantinos; Maliogka, Varvara I; Katis, Nikolaos I

    2014-03-01

    In this study a two-step RT-PCR assay was developed for the generic detection of poleroviruses. The RdRp coding region was selected as the primers' target, since it differs significantly from that of other members in the family Luteoviridae and its sequence can be more informative than other regions in the viral genome. Species specific RT-PCR assays targeting the same region were also developed for the detection of the six most widespread poleroviral species (Beet mild yellowing virus, Beet western yellows virus, Cucurbit aphid-borne virus, Carrot red leaf virus, Potato leafroll virus and Turnip yellows virus) in Greece and the collection of isolates. These isolates along with other characterized ones were used for the evaluation of the generic PCR's detection range. The developed assay efficiently amplified a 593bp RdRp fragment from 46 isolates of 10 different Polerovirus species. Phylogenetic analysis using the generic PCR's amplicon sequence showed that although it cannot accurately infer evolutionary relationships within the genus it can differentiate poleroviruses at the species level. Overall, the described generic assay could be applied for the reliable detection of Polerovirus infections and, in combination with the specific PCRs, for the identification of new and uncharacterized species in the genus. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. A multiplex RT-PCR assay for the rapid and differential diagnosis of classical swine fever and other pestivirus infections.

    Science.gov (United States)

    Díaz de Arce, Heidy; Pérez, Lester J; Frías, Maria T; Rosell, Rosa; Tarradas, Joan; Núñez, José I; Ganges, Llilianne

    2009-11-18

    Classical swine fever is a highly contagious viral disease causing severe economic losses in pig production almost worldwide. All pestivirus species can infect pigs, therefore accurate and rapid pestivirus detection and differentiation is of great importance to assure control measures in swine farming. Here we describe the development and evaluation of a novel multiplex, highly sensitive and specific RT-PCR for the simultaneous detection and rapid differentiation between CSFV and other pestivirus infections in swine. The universal and differential detection was based on primers designed to amplify a fragment of the 5' non-coding genome region for the detection of pestiviruses and a fragment of the NS5B gene for the detection of classical swine fever virus. The assay proved to be specific when different pestivirus strains from swine and ruminants were evaluated. The analytical sensitivity was estimated to be as little as 0.89TCID(50). The assay analysis of 30 tissue homogenate samples from naturally infected and non-CSF infected animals and 40 standard serum samples evaluated as part of two European Inter-laboratory Comparison Tests conducted by the European Community Reference Laboratory, Hanover, Germany proved that the multiplex RT-PCR method provides a rapid, highly sensitive, and cost-effective laboratory diagnosis for classical swine fever and other pestivirus infections in swine.

  5. CyNC - towards a General Tool for Performance Analysis of Complex Distributed Real Time Systems

    DEFF Research Database (Denmark)

    Schiøler, Henrik; Jessen, Jan Jakob; Nielsen, Jens F. Dalsgaard

    2005-01-01

    The paper addresses the current state and the ongoing activities of a tool for performance analysis of complex real time systems. The tool named CyNC is based on network calculus allowing for the computation of backlogs and delays in a system from specified lower and upper bounds of external...... workflow and computational resources. The current version of the tool implements an extension to previous work in that it allows for general workflow and resource bounds and provides optimal solutions even to systems with cyclic dependencies. Despite the virtues of the current tool, improvements...... and extensions still remain, which are in focus of ongoing activities. Improvements include accounting for phase information to improve bounds, whereas the tool awaits extension to include flow control models, which both depend on the possibility of accounting for propagation delay. Since the current version...

  6. Quasi-real-time photon pulse duration measurement by analysis of FEL radiation spectra

    Energy Technology Data Exchange (ETDEWEB)

    Engel, Robin, E-mail: robin.engel@uni-oldenburg.de [Deutsches Elektronen-Synchrotron, Notkestrasse 85, D-22603 Hamburg (Germany); Institut für Physik, Carl von Ossietzky Universität Oldenburg, D-26111 Oldenburg (Germany); Institut für Laser und Optik, Hochschule Emden/Leer, University of Applied Sciences, Constantiaplatz 4, D-26723 Emden (Germany); Düsterer, Stefan; Brenner, Günter [Deutsches Elektronen-Synchrotron, Notkestrasse 85, D-22603 Hamburg (Germany); Teubner, Ulrich [Deutsches Elektronen-Synchrotron, Notkestrasse 85, D-22603 Hamburg (Germany); Institut für Physik, Carl von Ossietzky Universität Oldenburg, D-26111 Oldenburg (Germany); Institut für Laser und Optik, Hochschule Emden/Leer, University of Applied Sciences, Constantiaplatz 4, D-26723 Emden (Germany)

    2016-01-01

    Considering the second-order spectral correlation function of SASE-FEL radiation allows a real-time observation of the photon pulse duration during spectra acquisition. For photon diagnostics at free-electron lasers (FELs), the determination of the photon pulse duration is an important challenge and a complex task. This is especially true for SASE FELs with strongly fluctuating pulse parameters. However, most techniques require an extensive experimental setup, data acquisition and evaluation time, limiting the usability in all-day operation. In contrast, the presented work uses an existing approach based on the analysis of statistical properties of measured SASE FEL spectra and implements it as a software tool, integrated in FLASH’s data acquisition system. This allows the calculation of the average pulse durations from a set of measured spectral distributions with only seconds of delay, whenever high-resolution spectra are recorded.

  7. Off-line real-time FTIR analysis of a process step in imipenem production

    Science.gov (United States)

    Boaz, Jhansi R.; Thomas, Scott M.; Meyerhoffer, Steven M.; Staskiewicz, Steven J.; Lynch, Joseph E.; Egan, Richard S.; Ellison, Dean K.

    1992-08-01

    We have developed an FT-IR method, using a Spectra-Tech Monit-IR 400 systems, to monitor off-line the completion of a reaction in real-time. The reaction is moisture-sensitive and analysis by more conventional methods (normal-phase HPLC) is difficult to reproduce. The FT-IR method is based on the shift of a diazo band when a conjugated beta-diketone is transformed into a silyl enol ether during the reaction. The reaction mixture is examined directly by IR and does not require sample workup. Data acquisition time is less than one minute. The method has been validated for specificity, precision and accuracy. The results obtained by the FT-IR method for known mixtures and in-process samples compare favorably with those from a normal-phase HPLC method.

  8. Tradeoff analysis for Dependable Real-Time Embedded Systems during the Early Design Phases

    DEFF Research Database (Denmark)

    Gan, Junhe

    Embedded systems are becoming increasingly complex and have tight competing constraints in terms of performance, cost, energy consumption, dependability, flexibility, security, etc. The objective of this thesis is to propose design methods and tools for supporting the tradeoff analysis of competing...... to processing elements, as well as the processor voltage and frequency levels for executing each task, such that transient faults are tolerated, the real-time constraints of the application are satisfied, and the energy consumed is minimized. In this thesis, we target the early design phases, when decisions...... have a high impact on the subsequent implementation choices. However, due to a lack of information, the early design phases are characterized by uncertainties, e.g., in the worst-case execution times (WCETs), in the functionality requirements, or in the hardware component costs. In this context, we...

  9. AEP Ohio gridSMART Demonstration Project Real-Time Pricing Demonstration Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Widergren, Steven E.; Subbarao, Krishnappa; Fuller, Jason C.; Chassin, David P.; Somani, Abhishek; Marinovici, Maria C.; Hammerstrom, Janelle L.

    2014-02-01

    This report contributes initial findings from an analysis of significant aspects of the gridSMART® Real-Time Pricing (RTP) – Double Auction demonstration project. Over the course of four years, Pacific Northwest National Laboratory (PNNL) worked with American Electric Power (AEP), Ohio and Battelle Memorial Institute to design, build, and operate an innovative system to engage residential consumers and their end-use resources in a participatory approach to electric system operations, an incentive-based approach that has the promise of providing greater efficiency under normal operating conditions and greater flexibility to react under situations of system stress. The material contained in this report supplements the findings documented by AEP Ohio in the main body of the gridSMART report. It delves into three main areas: impacts on system operations, impacts on households, and observations about the sensitivity of load to price changes.

  10. Adaptive pattern recognition in real-time video-based soccer analysis

    DEFF Research Database (Denmark)

    Schlipsing, Marc; Salmen, Jan; Tschentscher, Marc

    2017-01-01

    are taken into account. Our contribution is twofold: (1) the deliberate use of machine learning and pattern recognition techniques allows us to achieve high classification accuracy in varying environments. We systematically evaluate combinations of image features and learning machines in the given online......Computer-aided sports analysis is demanded by coaches and the media. Image processing and machine learning techniques that allow for "live" recognition and tracking of players exist. But these methods are far from collecting and analyzing event data fully autonomously. To generate accurate results......, human interaction is required at different stages including system setup, calibration, supervision of classifier training, and resolution of tracking conflicts. Furthermore, the real-time constraints are challenging: in contrast to other object recognition and tracking applications, we cannot treat data...

  11. Real Time Analysis of Bioanalytes in Healthcare, Food, Zoology and Botany.

    Science.gov (United States)

    Wang, Tianqi; Ramnarayanan, Ashwin; Cheng, Huanyu

    2017-12-21

    The growing demand for real time analysis of bioanalytes has spurred development in the field of wearable technology to offer non-invasive data collection at a low cost. The manufacturing processes for creating these sensing systems vary significantly by the material used, the type of sensors needed and the subject of study as well. The methods predominantly involve stretchable electronic sensors to monitor targets and transmit data mainly through flexible wires or short-range wireless communication devices. Capable of conformal contact, the application of wearable technology goes beyond the healthcare to fields of food, zoology and botany. With a brief review of wearable technology and its applications to various fields, we believe this mini review would be of interest to the reader in broad fields of materials, sensor development and areas where wearable sensors can provide data that are not available elsewhere.

  12. Study on Real-Time Simulation Analysis and Inverse Analysis System for Temperature and Stress of Concrete Dam

    Directory of Open Access Journals (Sweden)

    Lei Zhang

    2015-01-01

    Full Text Available In the concrete dam construction, it is very necessary to strengthen the real-time monitoring and scientific management of concrete temperature control. This paper constructs the analysis and inverse analysis system of temperature stress simulation, which is based on various useful data collected in real time in the process of concrete construction. The system can produce automatically data file of temperature and stress calculation and then achieve the remote real-time simulation calculation of temperature stress by using high performance computing techniques, so the inverse analysis can be carried out based on a basis of monitoring data in the database; it fulfills the automatic feedback calculation according to the error requirement and generates the corresponding curve and chart after the automatic processing and analysis of corresponding results. The system realizes the automation and intellectualization of complex data analysis and preparation work in simulation process and complex data adjustment in the inverse analysis process, which can facilitate the real-time tracking simulation and feedback analysis of concrete temperature stress in construction process and enable you to discover problems timely, take measures timely, and adjust construction scheme and can well instruct you how to ensure project quality.

  13. QPCR: Application for real-time PCR data management and analysis

    Directory of Open Access Journals (Sweden)

    Eichhorn Heiko

    2009-08-01

    Full Text Available Abstract Background Since its introduction quantitative real-time polymerase chain reaction (qPCR has become the standard method for quantification of gene expression. Its high sensitivity, large dynamic range, and accuracy led to the development of numerous applications with an increasing number of samples to be analyzed. Data analysis consists of a number of steps, which have to be carried out in several different applications. Currently, no single tool is available which incorporates storage, management, and multiple methods covering the complete analysis pipeline. Results QPCR is a versatile web-based Java application that allows to store, manage, and analyze data from relative quantification qPCR experiments. It comprises a parser to import generated data from qPCR instruments and includes a variety of analysis methods to calculate cycle-threshold and amplification efficiency values. The analysis pipeline includes technical and biological replicate handling, incorporation of sample or gene specific efficiency, normalization using single or multiple reference genes, inter-run calibration, and fold change calculation. Moreover, the application supports assessment of error propagation throughout all analysis steps and allows conducting statistical tests on biological replicates. Results can be visualized in customizable charts and exported for further investigation. Conclusion We have developed a web-based system designed to enhance and facilitate the analysis of qPCR experiments. It covers the complete analysis workflow combining parsing, analysis, and generation of charts into one single application. The system is freely available at http://genome.tugraz.at/QPCR

  14. Statistical quality analysis of schedulers under soft-real-time constraints

    NARCIS (Netherlands)

    Baarsma, H.E.; Hurink, Johann L.; Jansen, P.G.

    2007-01-01

    This paper describes an algorithm to determine the performance of real-time systems with tasks using stochastic processing times. Such an algorithm can be used for guaranteeing Quality of Service of periodic tasks with soft real-time constraints. We use a discrete distribution model of processing

  15. WCET Analysis of ARM Processors using Real-Time Model Checking

    DEFF Research Database (Denmark)

    Toft, Martin; Olesen, Mads Christian; Dalsgaard, Andreas

    2009-01-01

    This paper presents a flexible method that utilises real-time model checking to determine safe and sharp WCETs for processes running on hardware platforms featuring pipelining and caching.......This paper presents a flexible method that utilises real-time model checking to determine safe and sharp WCETs for processes running on hardware platforms featuring pipelining and caching....

  16. Development and evaluation of a real-time one step Reverse-Transcriptase PCR for quantitation of Chandipura Virus

    Directory of Open Access Journals (Sweden)

    Tandale Babasaheb V

    2008-12-01

    Full Text Available Abstract Background Chandipura virus (CHPV, a member of family Rhabdoviridae was attributed to an explosive outbreak of acute encephalitis in children in Andhra Pradesh, India in 2003 and a small outbreak among tribal children from Gujarat, Western India in 2004. The case-fatality rate ranged from 55–75%. Considering the rapid progression of the disease and high mortality, a highly sensitive method for quantifying CHPV RNA by real-time one step reverse transcriptase PCR (real-time one step RT-PCR using TaqMan technology was developed for rapid diagnosis. Methods Primers and probe for P gene were designed and used to standardize real-time one step RT-PCR assay for CHPV RNA quantitation. Standard RNA was prepared by PCR amplification, TA cloning and run off transcription. The optimized real-time one step RT-PCR assay was compared with the diagnostic nested RT-PCR and different virus isolation systems [in vivo (mice in ovo (eggs, in vitro (Vero E6, PS, RD and Sand fly cell line] for the detection of CHPV. Sensitivity and specificity of real-time one step RT-PCR assay was evaluated with diagnostic nested RT-PCR, which is considered as a gold standard. Results Real-time one step RT-PCR was optimized using in vitro transcribed (IVT RNA. Standard curve showed linear relationship for wide range of 102-1010 (r2 = 0.99 with maximum Coefficient of variation (CV = 5.91% for IVT RNA. The newly developed real-time RT-PCR was at par with nested RT-PCR in sensitivity and superior to cell lines and other living systems (embryonated eggs and infant mice used for the isolation of the virus. Detection limit of real-time one step RT-PCR and nested RT-PCR was found to be 1.2 × 100 PFU/ml. RD cells, sand fly cells, infant mice, and embryonated eggs showed almost equal sensitivity (1.2 × 102 PFU/ml. Vero and PS cell-lines (1.2 × 103 PFU/ml were least sensitive to CHPV infection. Specificity of the assay was found to be 100% when RNA from other viruses or healthy

  17. Tier-1 and Tier-2 real-time analysis experience in CMS Data Challenge 2004

    CERN Document Server

    De Filippis, N; Pierro, A; Silvestris, L; Fanfani, A; Grandi, C; Hernández, J M; Bonacorsi, D; Corvo, M; Fanzago, F

    2005-01-01

    During the CMS Data Challenge 2004 a real-time analysis was attempted at INFN and PIC Tier-1 and Tier-2s in order to test the ability of the instrumented methods to quickly process the data. Several agents and automatic procedures were implemented to perform the analysis at the Tier-1/2 synchronously with the data transfer from Tier-0 at CERN. The system was implemented in the LCG-2 Grid environment and allowed on-the-fly job preparation and subsequent submission to the Resource Broker as new data came along. Running job accessed data from the Storage Elements via remote file protocol, whenever possible, or copying them locally with replica manager commands. Details of the procedures adopted to run the analysis jobs and the expected results are described. An evaluation of the ability of the system to maintain an analysis rate at Tier-1 and Tier-2 comparable with the data transfer rate is also presented. The results on the analysis timeline, the statistics of submitted jobs, the overall efficiency of the GRID ...

  18. Rapid quality assessment of Radix Aconiti Preparata using direct analysis in real time mass spectrometry.

    Science.gov (United States)

    Zhu, Hongbin; Wang, Chunyan; Qi, Yao; Song, Fengrui; Liu, Zhiqiang; Liu, Shuying

    2012-11-08

    This study presents a novel and rapid method to identify chemical markers for the quality control of Radix Aconiti Preparata, a world widely used traditional herbal medicine. In the method, the samples with a fast extraction procedure were analyzed using direct analysis in real time mass spectrometry (DART MS) combined with multivariate data analysis. At present, the quality assessment approach of Radix Aconiti Preparata was based on the two processing methods recorded in Chinese Pharmacopoeia for the purpose of reducing the toxicity of Radix Aconiti and ensuring its clinical therapeutic efficacy. In order to ensure the safety and effectivity in clinical use, the processing degree of Radix Aconiti should be well controlled and assessed. In the paper, hierarchical cluster analysis and principal component analysis were performed to evaluate the DART MS data of Radix Aconiti Preparata samples in different processing times. The results showed that the well processed Radix Aconiti Preparata, unqualified processed and the raw Radix Aconiti could be clustered reasonably corresponding to their constituents. The loading plot shows that the main chemical markers having the most influence on the discrimination amongst the qualified and unqualified samples were mainly some monoester diterpenoid aconitines and diester diterpenoid aconitines, i.e. benzoylmesaconine, hypaconitine, mesaconitine, neoline, benzoylhypaconine, benzoylaconine, fuziline, aconitine and 10-OH-mesaconitine. The established DART MS approach in combination with multivariate data analysis provides a very flexible and reliable method for quality assessment of toxic herbal medicine. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Reachability analysis of real-time systems using time Petri nets.

    Science.gov (United States)

    Wang, J; Deng, Y; Xu, G

    2000-01-01

    Time Petri nets (TPNs) are a popular Petri net model for specification and verification of real-time systems. A fundamental and most widely applied method for analyzing Petri nets is reachability analysis. The existing technique for reachability analysis of TPNs, however, is not suitable for timing property verification because one cannot derive end-to-end delay in task execution, an important issue for time-critical systems, from the reachability tree constructed using the technique. In this paper, we present a new reachability based analysis technique for TPNs for timing property analysis and verification that effectively addresses the problem. Our technique is based on a concept called clock-stamped state class (CS-class). With the reachability tree generated based on CS-classes, we can directly compute the end-to-end time delay in task execution. Moreover, a CS-class can be uniquely mapped to a traditional state class based on which the conventional reachability tree is constructed. Therefore, our CS-class-based analysis technique is more general than the existing technique. We show how to apply this technique to timing property verification of the TPN model of a command and control (C2) system.

  20. Direct analysis in real time-Mass spectrometry (DART-MS) in forensic and security applications.

    Science.gov (United States)

    Pavlovich, Matthew J; Musselman, Brian; Hall, Adam B

    2018-03-01

    Over the last decade, direct analysis in real time (DART) has emerged as a viable method for fast, easy, and reliable "ambient ionization" for forensic analysis. The ability of DART to generate ions from chemicals that might be present at the scene of a criminal activity, whether they are in the gas, liquid, or solid phase, with limited sample preparation has made the technology a useful analytical tool in numerous forensic applications. This review paper summarizes many of those applications, ranging from the analysis of trace evidence to security applications, with a focus on providing the forensic scientist with a resource for developing their own applications. The most common uses for DART in forensics are in studying seized drugs, drugs of abuse and their metabolites, bulk and detonated explosives, toxic chemicals, chemical warfare agents, inks and dyes, and commercial plant and animal products that have been adulterated for economic gain. This review is meant to complement recent reviews that have described the fundamentals of the ionization mechanism and the general use of DART. We describe a wide range of forensic applications beyond the field of analyzing drugs of abuse, which dominates the literature, including common experimental and data analysis methods. © 2016 Wiley Periodicals, Inc. Mass Spec Rev 37:171-187, 2018. © 2016 Wiley Periodicals, Inc.

  1. The Maximum Entropy Method for Optical Spectrum Analysis of Real-Time TDDFT

    International Nuclear Information System (INIS)

    Toogoshi, M; Kano, S S; Zempo, Y

    2015-01-01

    The maximum entropy method (MEM) is one of the key techniques for spectral analysis. The major feature is that spectra in the low frequency part can be described by the short time-series data. Thus, we applied MEM to analyse the spectrum from the time dependent dipole moment obtained from the time-dependent density functional theory (TDDFT) calculation in real time. It is intensively studied for computing optical properties. In the MEM analysis, however, the maximum lag of the autocorrelation is restricted by the total number of time-series data. We proposed that, as an improved MEM analysis, we use the concatenated data set made from the several-times repeated raw data. We have applied this technique to the spectral analysis of the TDDFT dipole moment of ethylene and oligo-fluorene with n = 8. As a result, the higher resolution can be obtained, which is closer to that of FT with practically time-evoluted data as the same total number of time steps. The efficiency and the characteristic feature of this technique are presented in this paper. (paper)

  2. TaqMan探针荧光定量PCR检测花生油中掺入棕榈油的研究%Determination of palm oil adulterated in peanut oil with the TaqMan probe -based RT- PCR method

    Institute of Scientific and Technical Information of China (English)

    周慧; 梁宇斌; 吴苏喜; 李晓明; 裴伟; 杨涛

    2011-01-01

    The method of Real - time fluorescence quantitative polymerase chain reaction ( RT - PCR) with TaqMan fluorescent probe was chosen to fast detect the amount of palm oil mixed in peanut oil. MT3 - B gene of palm was selected as target gene to detect palm oil from peanut oil. The primers of MT3 - B and TaqMan probe were designed, MT3 - B gene reconstructed plasmid was built as absolute quantitative criteria for quantitative RT - PCR to establish standard curve. Peanut oil blended with 1% -40% concentration gradient palm oil was extracted DNA to test palm content by RT - PCR. The result showed that the correlation coefficient (R1) of standard curve with logarithmic linear regression analysis was 0.996. When the adulteration of palm oil in peanut oil reached 5% volume, MT3 - B gene of 17.431 copies per milli-liter of mixed oil could be detected . The method showed good sensitivity, specificity and repeatability.%根据棕榈内源基因MT3 -B设计引物和TaqMan探针,采用基因重组技术构建用于检测棕榈基因MT3 -B的重组质粒作为绝对定量标准品,建立标准曲线,对花生油中掺入棕榈油1% ~40%梯度混合油品提取DNA进行棕榈成分定量检测.结果表明,重组质粒标准品荧光定量标准曲线对数线性回归分析相关系数(R2)为0.996;花生油中掺入棕榈油达到5%时,可检出每亳升混合油品中棕榈MT3 -B基因17.431 copies,检测的重复性和特异性好.

  3. Investigations for a multi-marker RT-PCR to improve sensitivity of disseminated tumor cell detection.

    NARCIS (Netherlands)

    Vlems, F.A.; Diepstra, J.H.S.; Cornelissen, I.M.; Ligtenberg, M.J.L.; Wobbes, Th.; Punt, C.J.A.; Krieken, J.H.J.M. van; Ruers, T.J.M.; Muijen, G.N.P. van

    2003-01-01

    BACKGROUND: In order to develop a multi-marker RT-PCR, which as such may be more sensitive than a single marker assay for the detection of disseminated tumor cells, we evaluated six RT-PCR markers: cytokeratin 20 (CK20), carcinoembryonic antigen (CEA), guanylyl cyclase C (GCC), epidermal growth

  4. Investigations for a multi-marker RT-PCR to improve sensitivity of disseminated tumor cell detection

    NARCIS (Netherlands)

    Vlems, F. A.; Diepstra, J. H. S.; Cornelissen, I. M. H. A.; Ligtenberg, M. J. L.; Wobbes, Th; Punt, C. J. A.; van Krieken, J. H. J. M.; Ruers, T. J. M.; van Muijen, G. N. P.

    2003-01-01

    In order to develop a multi-marker RT-PCR, which as such may be more sensitive than a single marker assay for the detection of disseminated tumor cells, we evaluated six RT-PCR markers: cytokeratin 20 (CK20), carcinoembryonic antigen (CEA), guanylyl cyclase C (GCC), epidermal growth factor receptor

  5. Subtyping of swine influenza viruses using a high-throughput real time PCR platform

    DEFF Research Database (Denmark)

    Goecke, Nicole Bakkegård; Krog, Jesper Schak; Hjulsager, Charlotte Kristiane

    ). The results revealed that the performance of the dynamic chip was similar to conventional real time analysis. Discussion and conclusion. Application of the chip for subtyping of swine influenza has resulted in a significant reduction in time, cost and working hours. Thereby, it is possible to offer diagnostic...... test and subsequent subtyping is performed by real time RT-PCR (RT-qPCR) but several assays are needed to cover the wide range of circulating subtypes which is expensive,resource and time demanding. To mitigate these restrictions the high-throughput qPCR platform BioMark (Fluidigm) has been explored...... services with reduced price and turnover time which will facilitate choice of vaccines and by that lead to reduction of antibiotic used....

  6. A real-time digital control, data acquisition and analysis system for the DIII-D multipulse Thomson scattering diagnostic

    International Nuclear Information System (INIS)

    Greenfield, C.M.; Campbell, G.L.; Carlstrom, T.N.; DeBoo, J.C.; Hsieh, C.-L.; Snider, R.T.; Trost, P.K.

    1990-10-01

    A VME-based real-time computer systems for laser control, data acquisition and analysis for the DIII-D multipulse Thomson scattering diagnostic is described. The laser control task requires precise timing of up to 8 Nd:YAG lasers, each with an average firing rate of 20 Hz. A cpu module in real-time multiprocessing computer system will operate the lasers with evenly staggered laser pulses or in a ''burst mode'', where all available (fully charged) lasers can be fired at 50--100 μsec intervals upon receipt of an external event trigger signal. One of more cpu modules, along with a LeCroy FERA (Fast Encoding and Readout ADC) system, will perform real-time data acquisition and analysis. Partial electron temperature and density profiles will be available for plasma feedback control within 1 msec following each laser pulse. The VME-based computer system consists of 2 or more target processor modules (25 MHz Motorola 68030) running the VMEexec real-time operating system connected to a Unix based host system (also a 68030). All real-time software is fully interrupt driven to maximize system efficiency. Operator interaction and (non real-time) data analysis takes place on a MicroVAX 3400 connected via DECnet. 17 refs., 1 fig

  7. Real-time digital control, data acquisition, and analysis system for the DIII-D multipulse Thomson scattering diagnostic

    International Nuclear Information System (INIS)

    Greenfield, C.M.; Campbell, G.L.; Carlstrom, T.N.; DeBoo, J.C.; Hsieh, C.; Snider, R.T.; Trost, P.K.

    1990-01-01

    A VME-based real-time computer system for laser control, data acquisition, and analysis for the DIII-D multipulse Thomson scattering diagnostic is described. The laser control task requires precise timing of up to eight Nd:YAG lasers, each with an average firing rate of 20 Hz. A cpu module in a real-time multiprocessing computer system will operate the lasers with evenly staggered laser pulses or in a ''burst mode,'' where all available (fully charged) lasers can be fired at 50--100 μs intervals upon receipt of an external event trigger signal. One or more cpu modules, along with a LeCroy FERA (fast encoding and readout ADC) system, will perform real-time data acquisition and analysis. Partial electron temperature and density profiles will be available for plasma feedback control within 1 ms following each laser pulse. The VME-based computer system consists of two or more target processor modules (25 MHz Motorola 68030) running the VMEexec real-time operating system connected to a Unix-based host system (also a 68030). All real-time software is fully interrupt driven to maximize system efficiency. Operator interaction and (non-real-time) data analysis takes place on a MicroVAX 3400 connected via DECnet

  8. REAL-TIME ANALYSIS AND SELECTION BIASES IN THE SUPERNOVA LEGACY SURVEY

    International Nuclear Information System (INIS)

    Perrett, K.; Conley, A.; Carlberg, R.; Balam, D.; Hook, I. M.; Sullivan, M.; Pritchet, C.; Astier, P.; Balland, C.; Guy, J.; Hardin, D.; Pain, R.; Regnault, N.; Basa, S.; Fouchez, D.; Howell, D. A.

    2010-01-01

    The Supernova Legacy Survey (SNLS) has produced a high-quality, homogeneous sample of Type Ia supernovae (SNe Ia) out to redshifts greater than z = 1. In its first four years of full operation (to 2007 June), the SNLS discovered more than 3000 transient candidates, 373 of which have been spectroscopically confirmed as SNe Ia. Use of these SNe Ia in precision cosmology critically depends on an analysis of the observational biases incurred in the SNLS survey due to the incomplete sampling of the underlying SN Ia population. This paper describes our real-time supernova detection and analysis procedures, and uses detailed Monte Carlo simulations to examine the effects of Malmquist bias and spectroscopic sampling. Such sampling effects are found to become apparent at z ∼ 0.6, with a significant shift in the average magnitude of the spectroscopically confirmed SN Ia sample toward brighter values for z ∼> 0.75. We describe our approach to correct for these selection biases in our three-year SNLS cosmological analysis (SNLS3) and present a breakdown of the systematic uncertainties involved.

  9. Direct Analysis in Real Time Mass Spectrometry for Characterization of Large Saccharides.

    Science.gov (United States)

    Ma, Huiying; Jiang, Qing; Dai, Diya; Li, Hongli; Bi, Wentao; Da Yong Chen, David

    2018-03-06

    Polysaccharide characterization posts the most difficult challenge to available analytical technologies compared to other types of biomolecules. Plant polysaccharides are reported to have numerous medicinal values, but their effect can be different based on the types of plants, and even regions of productions and conditions of cultivation. However, the molecular basis of the differences of these polysaccharides is largely unknown. In this study, direct analysis in real time mass spectrometry (DART-MS) was used to generate polysaccharide fingerprints. Large saccharides can break down into characteristic small fragments in the DART source via pyrolysis, and the products are then detected by high resolution MS. Temperature was shown to be a crucial parameter for the decomposition of large polysaccharide. The general behavior of carbohydrates in DART-MS was also studied through the investigation of a number of mono- and oligosaccharide standards. The chemical formula and putative ionic forms of the fragments were proposed based on accurate mass with less than 10 ppm mass errors. Multivariate data analysis shows the clear differentiation of different plant species. Intensities of marker ions compared among samples also showed obvious differences. The combination of DART-MS analysis and mechanochemical extraction method used in this work demonstrates a simple, fast, and high throughput analytical protocol for the efficient evaluation of molecular features in plant polysaccharides.

  10. Real-time visualization and analysis of airflow field by use of digital holography

    Science.gov (United States)

    Di, Jianglei; Wu, Bingjing; Chen, Xin; Liu, Junjiang; Wang, Jun; Zhao, Jianlin

    2013-04-01

    The measurement and analysis of airflow field is very important in fluid dynamics. For airflow, smoke particles can be added to visually observe the turbulence phenomena by particle tracking technology, but the effect of smoke particles to follow the high speed airflow will reduce the measurement accuracy. In recent years, with the advantage of non-contact, nondestructive, fast and full-field measurement, digital holography has been widely applied in many fields, such as deformation and vibration analysis, particle characterization, refractive index measurement, and so on. In this paper, we present a method to measure the airflow field by use of digital holography. A small wind tunnel model made of acrylic glass is built to control the velocity and direction of airflow. Different shapes of samples such as aircraft wing and cylinder are placed in the wind tunnel model to produce different forms of flow field. With a Mach-Zehnder interferometer setup, a series of digital holograms carrying the information of airflow filed distributions in different states are recorded by CCD camera and corresponding holographic images are numerically reconstructed from the holograms by computer. Then we can conveniently obtain the velocity or pressure information of the airflow deduced from the quantitative phase information of holographic images and visually display the airflow filed and its evolution in the form of a movie. The theory and experiment results show that digital holography is a robust and feasible approach for real-time visualization and analysis of airflow field.

  11. A Real-Time Analysis Method for Pulse Rate Variability Based on Improved Basic Scale Entropy

    Directory of Open Access Journals (Sweden)

    Yongxin Chou

    2017-01-01

    Full Text Available Base scale entropy analysis (BSEA is a nonlinear method to analyze heart rate variability (HRV signal. However, the time consumption of BSEA is too long, and it is unknown whether the BSEA is suitable for analyzing pulse rate variability (PRV signal. Therefore, we proposed a method named sliding window iterative base scale entropy analysis (SWIBSEA by combining BSEA and sliding window iterative theory. The blood pressure signals of healthy young and old subjects are chosen from the authoritative international database MIT/PhysioNet/Fantasia to generate PRV signals as the experimental data. Then, the BSEA and the SWIBSEA are used to analyze the experimental data; the results show that the SWIBSEA reduces the time consumption and the buffer cache space while it gets the same entropy as BSEA. Meanwhile, the changes of base scale entropy (BSE for healthy young and old subjects are the same as that of HRV signal. Therefore, the SWIBSEA can be used for deriving some information from long-term and short-term PRV signals in real time, which has the potential for dynamic PRV signal analysis in some portable and wearable medical devices.

  12. Immunohistochemical detection of the BRAF V600E mutation in papillary thyroid carcinoma. Evaluation against real-time polymerase chain reaction.

    Science.gov (United States)

    Paja Fano, Miguel; Ugalde Olano, Aitziber; Fuertes Thomas, Elena; Oleaga Alday, Amelia

    2017-02-01

    The BRAF V600E mutation is the most common genetic change in papillary thyroid carcinoma and is associated with a poorer clinical course. Usual methods for its study (DNA sequencing or molecular test based on PCR) are expensive and time-consuming. Recently, immunohistochemistry (IHC) for BRAF mutation has been introduced. To compare the results of IHC and real time PCR (RT-PCR) in the detection of BRAF V600E mutation in papillary thyroid carcinoma. Analysis of clinical and pathological differences depending on RT-PCR results is included. A prospective study was performed in 82 consecutive samples, 54 of them taken through a core needle biopsy. IHC was performed on tissue fixed for 24hours with 10% neutral formalin using the anti-BRAF V600E (VE-1) mouse monoclonal primary antibody and was rated as positive or negative. DNA was extracted from formalin-fixed, paraffin-embedded tissues by manual microdissection, and BRAF mutation was detected by RT-PCR using the Cobas® 4800 BRAF V600 mutation test (Roche). Both techniques were concordant in 81 cases, and BRAF was positive in 49. Discordance appeared in a follicular variant showing positive IHC and negative RT-PCR, attributed to histological heterogeneity. Cost of materials for IHC was less than half of the cost for RT-PCR. IHC appears to be a reliable, economical and easily available alternative to molecular biology techniques for routine detection of the BRAF V600E mutation in papillary thyroid carcinoma patients, provided optimal fixation conditions are used. It may be a useful technique in hospitals with no access to molecular biology techniques. Copyright © 2017 SEEN. Publicado por Elsevier España, S.L.U. All rights reserved.

  13. Identification and validation of reference genes for quantitative real-time PCR in Drosophila suzukii (Diptera: Drosophilidae.

    Directory of Open Access Journals (Sweden)

    Yifan Zhai

    Full Text Available To accurately evaluate gene expression levels and obtain more accurate quantitative real-time RT-PCR (qRT-PCR data, normalization relative to reliable reference gene(s is required. Drosophila suzukii, is an invasive fruit pest native to East Asia, and recently invaded Europe and North America, the stability of its reference genes have not been previously investigated. In this study, ten candidate reference genes (RPL18, RPS3, AK, EF-1β, TBP, NADH, HSP22, GAPDH, Actin, α-Tubulin, were evaluated for their suitability as normalization genes under different biotic (developmental stage, tissue and population, and abiotic (photoperiod, temperature conditions. The three statistical approaches (geNorm, NormFinder and BestKeeper and one web-based comprehensive tool (RefFinder were used to normalize analysis of the ten candidate reference genes identified α-Tubulin, TBP and AK as the most stable candidates, while HSP22 and Actin showed the lowest expression stability. We used three most stable genes (α-Tubulin, TBP and AK and one unstably expressed gene to analyze the expression of P-glycoprotein in abamectin-resistant and sensitive strains, and the results were similar to reference genes α-Tubulin, TBP and AK, which show good stability, while the result of HSP22 has a certain bias. The three validated reference genes can be widely used for quantification of target gene expression with qRT-PCR technology in D.suzukii.

  14. Real time spectroscopic ellipsometry for analysis and control of thin film polycrystalline semiconductor deposition in photovoltaics

    Energy Technology Data Exchange (ETDEWEB)

    Koirala, Prakash; Attygalle, Dinesh; Aryal, Puruswottam; Pradhan, Puja; Chen, Jie [Center for Photovoltaics Innovation and Commercialization and Department of Physics and Astronomy, University of Toledo, Toledo, OH 43606 (United States); Marsillac, Sylvain [Department of Electrical and Computer Engineering, Old Dominion University, Norfolk, VA 23529 (United States); Ferlauto, Andre S.; Podraza, Nikolas J.; Collins, Robert W. [Center for Photovoltaics Innovation and Commercialization and Department of Physics and Astronomy, University of Toledo, Toledo, OH 43606 (United States)

    2014-11-28

    Real time spectroscopic ellipsometry (RTSE) from the near-infrared to ultraviolet has been applied for analysis of the deposition of polycrystalline thin films that form the basis of two key photovoltaic heterojunction configurations, superstrate SnO{sub 2}/CdS/CdTe and substrate Mo/Cu(In{sub 1−x}Ga{sub x})Se{sub 2}/CdS. The focus of this work is to develop capabilities for monitoring and controlling the key steps in the fabrication of these device structures. Analysis of RTSE data collected during sputter deposition of CdS on a rough SnO{sub 2} transparent top contact provides the time evolution of the CdS effective thickness, or film volume per unit substrate area. This thickness includes interface, bulk, and surface roughness layer components and affects the CdS/CdTe heterojunction performance and the quantum efficiency of the solar cell in the blue region of the solar spectrum. Similarly, analysis of RTSE data collected during co-evaporation of Cu(In{sub 1−x}Ga{sub x})Se{sub 2} (CIGS; x ∼ 0.3) on a rough Mo back contact provides the evolution of a second phase of Cu{sub 2−x}Se within the CIGS layer. During the last stage of CIGS deposition, the In, Ga, and Se co-evaporants convert this Cu{sub 2−x}Se phase to CIGS, and RTSE identifies the endpoint, specifically the time at which complete conversion occurs and single-phase, large-grain CIGS is obtained in this key stage. - Highlights: • Real time spectroscopic ellipsometry (RTSE) study of CdS and CuIn{sub 1−x}Ga{sub x}Se{sub 2} (CIGS) films. • RTSE during CdS deposition provides the evolution of the CdS effective thickness. • RTSE for CIGS film enables to measure and control the composition and thickness. • The work leads to the development of optical models for processing steps.

  15. Development of duplex RT-PCR-ELISA for the simultaneous detection of hepatitis A virus and hepatitis E virus.

    Science.gov (United States)

    Tahk, Hongmin; Lee, Min Hwa; Lee, Kang Bum; Cheon, Doo-Sung; Choi, Changsun

    2011-07-01

    This study aimed to develop a specific and sensitive duplex reverse transcription polymerase chain reaction enzyme-linked immunosorbent assay (duplex RT-PCR-ELISA) for hepatitis A virus (HAV) and hepatitis E virus (HEV). Duplex RT-PCR-ELISA could detect and differentiate HAV and HEV with specific probes. When ELISA technique was used to detect probe-bound RT-PCR products, duplex RT-PCR-ELISA could detect as little as 0.1 ng/μL HAV and HEV from clinical samples. Human norovirus, enterovirus, poliovirus, murine norovirus and feline calicivirus were used for the specificity test; all were negative. Therefore duplex RT-PCR-ELISA can be used for the simultaneous detection of HAV and HEV in contaminated fecal samples. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. A sensitive, reproducible, and economic real-time reverse transcription PCR detecting avian metapneumovirus subtypes A and B.

    Science.gov (United States)

    Franzo, G; Drigo, M; Lupini, C; Catelli, E; Laconi, A; Listorti, V; Bonci, M; Naylor, C J; Martini, M; Cecchinato, M

    2014-06-01

    Use of real-time PCR is increasing in the diagnosis of infectious disease due to its sensitivity, specificity, and speed of detection. These characteristics make it particularly suited for the diagnosis of viral infections, like avian metapneumovirus (AMPV), for which effective control benefits from continuously updated knowledge of the epidemiological situation. Other real-time reverse transcription (RT)-PCRs have been published based on highly specific fluorescent dye-labeled probes, but they have high initial cost, complex validation, and a marked susceptibility to the genetic variability of their target sequence. With this in mind, we developed and validated a SYBR Green I-based quantitative RT-PCR for the detection of the two most prevalent AMPV subtypes (i.e., subtypes A and B). The assay demonstrated an analytical sensitivity comparable with that of a previously published real-time RT-PCR and the ability to detect RNA equivalent to approximately 0.5 infectious doses for both A and B subtypes. The high efficiency and linearity between viral titer and crossing point displayed for both subtypes make it suited for viral quantification. Optimization of reaction conditions and the implementation of melting curve analysis guaranteed the high specificity of the assay. The stable melting temperature difference between the two subtypes indicated the possibility of subtyping through melting temperature analysis. These characteristics make our assay a sensitive, specific, and rapid tool, enabling contemporaneous detection, quantification, and discrimination of AMPV subtype A and B.

  17. Real-Time Analysis of Beats in Music for Entertainment Robots

    OpenAIRE

    Yue-Der Lin; Ting-Tsao Wu; Yu-Ren Chen; Yen-Ting Lin; Wen-Hsiu Chen; Shih-Fan Wang; Jinghom Chakhap

    2012-01-01

    The dancing actions for entertainment robots are usually designed in advance and saved in a database according to the beats and rhythm of the given music. This research is devoted to developing a real-time algorithm that can detect the primary information of the music needed for the actions of entertainment robots. The computation of the proposed algorithm is very efficient and can satisfy the requirement of real-time processing by a digital signal controller. The digitized music signal is fi...

  18. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  19. Real-time analysis, visualization, and steering of microtomography experiments at photon sources

    International Nuclear Information System (INIS)

    Laszeski, G. von; Insley, J.A.; Foster, I.; Bresnahan, J.; Kesselman, C.; Su, M.; Thiebaux, M.; Rivers, M.L.; Wang, S.; Tieman, B.; McNulty, I.

    2000-01-01

    A new generation of specialized scientific instruments called synchrotron light sources allow the imaging of materials at very fine scales. However, in contrast to a traditional microscope, interactive use has not previously been possible because of the large amounts of data generated and the considerable computation required translating this data into a useful image. The authors describe a new software architecture that uses high-speed networks and supercomputers to enable quasi-real-time and hence interactive analysis of synchrotron light source data. This architecture uses technologies provided by the Globus computational grid toolkit to allow dynamic creation of a reconstruction pipeline that transfers data from a synchrotron source beamline to a preprocessing station, next to a parallel reconstruction system, and then to multiple visualization stations. Collaborative analysis tools allow multiple users to control data visualization. As a result, local and remote scientists can see and discuss preliminary results just minutes after data collection starts. The implications for more efficient use of this scarce resource and for more effective science appear tremendous

  20. Detection of Low Molecular Weight Adulterants in Beverages by Direct Analysis in Real Time Mass Spectrometry.

    Science.gov (United States)

    Sisco, Edward; Dake, Jeffrey

    2016-04-14

    Direct Analysis in Real Time Mass Spectrometry (DART-MS) has been used to detect the presence of non-narcotic adulterants in beverages. The non-narcotic adulterants that were examined in this work incorporated a number low molecular weight alcohols, acetone, ammonium hydroxide, and sodium hypochlorite. Analysis of the adulterants was completed by pipetting 1 µL deposits onto glass microcapillaries along with an appropriate dopant species followed by introduction into the DART gas stream. It was found that detection of these compounds in the complex matrices of common beverages (soda, energy drinks, etc.) was simplified through the use of a dopant species to allow for adduct formation with the desired compound(s) of interest. Other parameters that were investigated included DART gas stream temperature, in source collision induced dissociation, ion polarity, and DART needle voltage. Sensitivities of the technique were found to range from 0.001 % volume fraction to 0.1 % volume fraction, comparable to traditional analyses completed using headspace gas chromatography mass spectrometry (HS-GC/MS). Once a method was established using aqueous solutions, , fifteen beverages were spiked with each of the nine adulterants, to simulate real world detection, and in nearly all cases the adulterant could be detected either in pure form, or complexed with the added dopant species. This technique provides a rapid way to directly analyze beverages believed to be contaminated with non-narcotic adulterants at sensitivities similar to or exceeding those of traditional confirmatory analyses.

  1. Two-dimensional statistical linear discriminant analysis for real-time robust vehicle-type recognition

    Science.gov (United States)

    Zafar, I.; Edirisinghe, E. A.; Acar, S.; Bez, H. E.

    2007-02-01

    Automatic vehicle Make and Model Recognition (MMR) systems provide useful performance enhancements to vehicle recognitions systems that are solely based on Automatic License Plate Recognition (ALPR) systems. Several car MMR systems have been proposed in literature. However these approaches are based on feature detection algorithms that can perform sub-optimally under adverse lighting and/or occlusion conditions. In this paper we propose a real time, appearance based, car MMR approach using Two Dimensional Linear Discriminant Analysis that is capable of addressing this limitation. We provide experimental results to analyse the proposed algorithm's robustness under varying illumination and occlusions conditions. We have shown that the best performance with the proposed 2D-LDA based car MMR approach is obtained when the eigenvectors of lower significance are ignored. For the given database of 200 car images of 25 different make-model classifications, a best accuracy of 91% was obtained with the 2D-LDA approach. We use a direct Principle Component Analysis (PCA) based approach as a benchmark to compare and contrast the performance of the proposed 2D-LDA approach to car MMR. We conclude that in general the 2D-LDA based algorithm supersedes the performance of the PCA based approach.

  2. Real-Time EEG Signal Enhancement Using Canonical Correlation Analysis and Gaussian Mixture Clustering

    Directory of Open Access Journals (Sweden)

    Chin-Teng Lin

    2018-01-01

    Full Text Available Electroencephalogram (EEG signals are usually contaminated with various artifacts, such as signal associated with muscle activity, eye movement, and body motion, which have a noncerebral origin. The amplitude of such artifacts is larger than that of the electrical activity of the brain, so they mask the cortical signals of interest, resulting in biased analysis and interpretation. Several blind source separation methods have been developed to remove artifacts from the EEG recordings. However, the iterative process for measuring separation within multichannel recordings is computationally intractable. Moreover, manually excluding the artifact components requires a time-consuming offline process. This work proposes a real-time artifact removal algorithm that is based on canonical correlation analysis (CCA, feature extraction, and the Gaussian mixture model (GMM to improve the quality of EEG signals. The CCA was used to decompose EEG signals into components followed by feature extraction to extract representative features and GMM to cluster these features into groups to recognize and remove artifacts. The feasibility of the proposed algorithm was demonstrated by effectively removing artifacts caused by blinks, head/body movement, and chewing from EEG recordings while preserving the temporal and spectral characteristics of the signals that are important to cognitive research.

  3. Automated methods for real-time analysis of spent-fuel measurement data

    International Nuclear Information System (INIS)

    Bosler, G.E.; Rinard, P.M.; Klosterbuer, S.F.; Painter, J.

    1988-01-01

    Software has been developed for ''real-time'' analysis of neutron and gamma data from GRAND-1/fork measurements on spent-fuel assemblies. Three modules compose the software package. The modules are linked through a database system of files. The first module is part of a general data-base processing code. This module prepares input data files with inventory and correction-factor information for the second module. The second module, called OLAF, operates on a computer attached to the GRAND-1 electronics unit. In this second module, neutron and gamma data from spent-fuel assemblies are analyzed to verify consistency in the facility operator declarations for exposure (burnup) and cooling time. From the analysis, potential discrepancies in the measurement data are questioned while equipment is still installed at the facility and is available for additional measurements. During the measurements, data are written to an output file, called a results file, which can be processed by the third module of the software package. In the third module, printed reports summarizing the data and results are prepared, and neutron and gamma data are written to files that are process by the Deming curve-fitting code

  4. Evaluation of Rice Resistance to Southern Rice Black-Streaked Dwarf Virus and Rice Ragged Stunt Virus through Combined Field Tests, Quantitative Real-Time PCR, and Proteome Analysis.

    Science.gov (United States)

    Wang, Zhenchao; Yu, Lu; Jin, Linhong; Wang, Wenli; Zhao, Qi; Ran, Longlu; Li, Xiangyang; Chen, Zhuo; Guo, Rong; Wei, Yongtian; Yang, Zhongcheng; Liu, Enlong; Hu, Deyu; Song, Baoan

    2017-02-22

    Diseases caused by southern rice black-streaked dwarf virus (SRBSDV) and rice ragged stunt virus (RRSV) considerably decrease grain yield. Therefore, determining rice cultivars with high resistance to SRBSDV and RRSV is necessary. In this study, rice cultivars with high resistance to SRBSDV and RRSV were evaluated through field trials in Shidian and Mangshi county, Yunnan province, China. SYBR Green I-based quantitative real-time polymerase chain reaction (qRT-PCR) analysis was used to quantitatively detect virus gene expression levels in different rice varieties. The following parameters were applied to evaluate rice resistance: acre yield (A.Y.), incidence of infected plants (I.I.P.), virus load (V.L.), disease index (D.I.), and insect quantity (I.Q.) per 100 clusters. Zhongzheyou1 (Z1) and Liangyou2186 (L2186) were considered the most suitable varieties with integrated higher A.Y., lower I.I.P., V.L., D.I. and I.Q. In order to investigate the mechanism of rice resistance, comparative label-free shotgun liquid chromatography tandem-mass spectrometry (LC-MS/MS) proteomic approaches were applied to comprehensively describe the proteomics of rice varieties' SRBSDV tolerance. Systemic acquired resistance (SAR)-related proteins in Z1 and L2186 may result in the superior resistance of these varieties compared with Fengyouxiangzhan (FYXZ).

  5. Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

    Science.gov (United States)

    Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

    2015-10-01

    We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  6. Real-time myoelectric control of a multi-fingered hand prosthesis using principal components analysis

    Directory of Open Access Journals (Sweden)

    Matrone Giulia C

    2012-06-01

    Full Text Available Abstract Background In spite of the advances made in the design of dexterous anthropomorphic hand prostheses, these sophisticated devices still lack adequate control interfaces which could allow amputees to operate them in an intuitive and close-to-natural way. In this study, an anthropomorphic five-fingered robotic hand, actuated by six motors, was used as a prosthetic hand emulator to assess the feasibility of a control approach based on Principal Components Analysis (PCA, specifically conceived to address this problem. Since it was demonstrated elsewhere that the first two principal components (PCs can describe the whole hand configuration space sufficiently well, the controller here employed reverted the PCA algorithm and allowed to drive a multi-DoF hand by combining a two-differential channels EMG input with these two PCs. Hence, the novelty of this approach stood in the PCA application for solving the challenging problem of best mapping the EMG inputs into the degrees of freedom (DoFs of the prosthesis. Methods A clinically viable two DoFs myoelectric controller, exploiting two differential channels, was developed and twelve able-bodied participants, divided in two groups, volunteered to control the hand in simple grasp trials, using forearm myoelectric signals. Task completion rates and times were measured. The first objective (assessed through one group of subjects was to understand the effectiveness of the approach; i.e., whether it is possible to drive the hand in real-time, with reasonable performance, in different grasps, also taking advantage of the direct visual feedback of the moving hand. The second objective (assessed through a different group was to investigate the intuitiveness, and therefore to assess statistical differences in the performance throughout three consecutive days. Results Subjects performed several grasp, transport and release trials with differently shaped objects, by operating the hand with the myoelectric

  7. Rapid quality assessment of Radix Aconiti Preparata using direct analysis in real time mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Zhu Hongbin; Wang Chunyan; Qi Yao [Changchun Center of Mass Spectrometry and Chemical Biology Laboratory, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); University of Chinese Academy of Sciences, Beijing 100039 (China); Song Fengrui, E-mail: songfr@ciac.jl.cn [Changchun Center of Mass Spectrometry and Chemical Biology Laboratory, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China); Liu Zhiqiang; Liu Shuying [Changchun Center of Mass Spectrometry and Chemical Biology Laboratory, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, Changchun 130022 (China)

    2012-11-08

    Highlights: Black-Right-Pointing-Pointer DART MS combined with PCA and HCA was used to rapidly identify markers of Radix Aconiti. Black-Right-Pointing-Pointer The DART MS behavior of six aconitine-type alkaloids was investigated. Black-Right-Pointing-Pointer Chemical markers were recognized between the qualified and unqualified samples. Black-Right-Pointing-Pointer DART MS was shown to be an effective tool for quality control of Radix Aconiti Preparata. - Abstract: This study presents a novel and rapid method to identify chemical markers for the quality control of Radix Aconiti Preparata, a world widely used traditional herbal medicine. In the method, the samples with a fast extraction procedure were analyzed using direct analysis in real time mass spectrometry (DART MS) combined with multivariate data analysis. At present, the quality assessment approach of Radix Aconiti Preparata was based on the two processing methods recorded in Chinese Pharmacopoeia for the purpose of reducing the toxicity of Radix Aconiti and ensuring its clinical therapeutic efficacy. In order to ensure the safety and effectivity in clinical use, the processing degree of Radix Aconiti should be well controlled and assessed. In the paper, hierarchical cluster analysis and principal component analysis were performed to evaluate the DART MS data of Radix Aconiti Preparata samples in different processing times. The results showed that the well processed Radix Aconiti Preparata, unqualified processed and the raw Radix Aconiti could be clustered reasonably corresponding to their constituents. The loading plot shows that the main chemical markers having the most influence on the discrimination amongst the qualified and unqualified samples were mainly some monoester diterpenoid aconitines and diester diterpenoid aconitines, i.e. benzoylmesaconine, hypaconitine, mesaconitine, neoline, benzoylhypaconine, benzoylaconine, fuziline, aconitine and 10-OH-mesaconitine. The established DART MS approach in

  8. Rapid quality assessment of Radix Aconiti Preparata using direct analysis in real time mass spectrometry

    International Nuclear Information System (INIS)

    Zhu Hongbin; Wang Chunyan; Qi Yao; Song Fengrui; Liu Zhiqiang; Liu Shuying

    2012-01-01

    Highlights: ► DART MS combined with PCA and HCA was used to rapidly identify markers of Radix Aconiti. ► The DART MS behavior of six aconitine-type alkaloids was investigated. ► Chemical markers were recognized between the qualified and unqualified samples. ► DART MS was shown to be an effective tool for quality control of Radix Aconiti Preparata. - Abstract: This study presents a novel and rapid method to identify chemical markers for the quality control of Radix Aconiti Preparata, a world widely used traditional herbal medicine. In the method, the samples with a fast extraction procedure were analyzed using direct analysis in real time mass spectrometry (DART MS) combined with multivariate data analysis. At present, the quality assessment approach of Radix Aconiti Preparata was based on the two processing methods recorded in Chinese Pharmacopoeia for the purpose of reducing the toxicity of Radix Aconiti and ensuring its clinical therapeutic efficacy. In order to ensure the safety and effectivity in clinical use, the processing degree of Radix Aconiti should be well controlled and assessed. In the paper, hierarchical cluster analysis and principal component analysis were performed to evaluate the DART MS data of Radix Aconiti Preparata samples in different processing times. The results showed that the well processed Radix Aconiti Preparata, unqualified processed and the raw Radix Aconiti could be clustered reasonably corresponding to their constituents. The loading plot shows that the main chemical markers having the most influence on the discrimination amongst the qualified and unqualified samples were mainly some monoester diterpenoid aconitines and diester diterpenoid aconitines, i.e. benzoylmesaconine, hypaconitine, mesaconitine, neoline, benzoylhypaconine, benzoylaconine, fuziline, aconitine and 10-OH-mesaconitine. The established DART MS approach in combination with multivariate data analysis provides a very flexible and reliable method for quality

  9. Comparison of IHC, FISH and RT-PCR methods for detection of ALK rearrangements in 312 non-small cell lung cancer patients in Taiwan.

    Science.gov (United States)

    Wu, Yi-Cheng; Chang, Il-Chi; Wang, Chi-Liang; Chen, Tai-Di; Chen, Ya-Ting; Liu, Hui-Ping; Chu, Yen; Chiu, Yu-Ting; Wu, Tzu-Hua; Chou, Li-Hui; Chen, Yi-Rong; Huang, Shiu-Feng

    2013-01-01

    Recently Echinoderm microtubule-associated protein-like 4- anaplastic lymphoma kinase (EML4-ALK) fusion gene has become an important biomarker for ALK tyrosine kinase inhibitor (crizotinib) treatment in NSCLC. However, the best detection method and the significance of EML4-ALK variant types remain uncertain. Reverse transcriptase-polymerase chain reaction (RT-PCR), fluorescence in Situ hybridization (FISH) and Immunohistochemical (IHC) stain were performed on tumor tissues of 312 NSCLC patients for detection of ALK rearrangements. Mutation analyses for EGFR and KRAS genes were also performed. Thirteen of the 312 patients (4.17%) had ALK rearrangements detected by RT-PCR. If RT-PCR data was used as the gold standard, FISH tests had a low sensitivity (58.33%), but very good specificity (99.32%). IHC stain had better sensitivity (91.67%) than FISH, but lower specificity (79.52%), when the cut off was IHC2+. All of the 8 patients with high abundance of EML4-ALK positive cells in tumor tissues (assessed by the signal intensities of the RT-PCR product), were also have high expression of ALK protein (IHC3+), and positive for FISH, except one failed in FISH. Variants 3a+3b (4/5, 80%) of EML4-ALK fusion gene were more common to have high abundance of EML4-ALK positive cells in tumor tissues than variant 1 (1/3, 33.3%). Meta-analysis of the published data of 2273 NSCLC patients revealed that variant 3 (23/44, 52.3%) was the most common type in Chinese population, while variant 1 (28/37, 75.7%) was most common in Caucasian. Among the three detection methods, RT-PCR could detect not only the presence of EML4-ALK fusion gene and their variant types, but also the abundance of EML4-ALK positive cells in NSCLC tumor tissues. The latter two factors might affect the treatment response to anti-ALK inhibitor. Including RT-PCR as a diagnostic test for ALK inhibitor treatment in the prospective clinical trials is recommended.

  10. Comparison of IHC, FISH and RT-PCR methods for detection of ALK rearrangements in 312 non-small cell lung cancer patients in Taiwan.

    Directory of Open Access Journals (Sweden)

    Yi-Cheng Wu

    Full Text Available BACKGROUND: Recently Echinoderm microtubule-associated protein-like 4- anaplastic lymphoma kinase (EML4-ALK fusion gene has become an important biomarker for ALK tyrosine kinase inhibitor (crizotinib treatment in NSCLC. However, the best detection method and the significance of EML4-ALK variant types remain uncertain. METHODS: Reverse transcriptase-polymerase chain reaction (RT-PCR, fluorescence in Situ hybridization (FISH and Immunohistochemical (IHC stain were performed on tumor tissues of 312 NSCLC patients for detection of ALK rearrangements. Mutation analyses for EGFR and KRAS genes were also performed. RESULTS: Thirteen of the 312 patients (4.17% had ALK rearrangements detected by RT-PCR. If RT-PCR data was used as the gold standard, FISH tests had a low sensitivity (58.33%, but very good specificity (99.32%. IHC stain had better sensitivity (91.67% than FISH, but lower specificity (79.52%, when the cut off was IHC2+. All of the 8 patients with high abundance of EML4-ALK positive cells in tumor tissues (assessed by the signal intensities of the RT-PCR product, were also have high expression of ALK protein (IHC3+, and positive for FISH, except one failed in FISH. Variants 3a+3b (4/5, 80% of EML4-ALK fusion gene were more common to have high abundance of EML4-ALK positive cells in tumor tissues than variant 1 (1/3, 33.3%. Meta-analysis of the published data of 2273 NSCLC patients revealed that variant 3 (23/44, 52.3% was the most common type in Chinese population, while variant 1 (28/37, 75.7% was most common in Caucasian. CONCLUSIONS: Among the three detection methods, RT-PCR could detect not only the presence of EML4-ALK fusion gene and their variant types, but also the abundance of EML4-ALK positive cells in NSCLC tumor tissues. The latter two factors might affect the treatment response to anti-ALK inhibitor. Including RT-PCR as a diagnostic test for ALK inhibitor treatment in the prospective clinical trials is recommended.

  11. The U-tube sampling methodology and real-time analysis of geofluids

    International Nuclear Information System (INIS)

    Freifeld, Barry; Perkins, Ernie; Underschultz, James; Boreham, Chris

    2009-01-01

    The U-tube geochemical sampling methodology, an extension of the porous cup technique proposed by Wood (1973), provides minimally contaminated aliquots of multiphase fluids from deep reservoirs and allows for accurate determination of dissolved gas composition. The initial deployment of the U-tube during the Frio Brine Pilot CO 2 storage experiment, Liberty County, Texas, obtained representative samples of brine and supercritical CO 2 from a depth of 1.5 km. A quadrupole mass spectrometer provided real-time analysis of dissolved gas composition. Since the initial demonstration, the U-tube has been deployed for (1) sampling of fluids down gradient of the proposed Yucca Mountain High-Level Waste Repository, Armagosa Valley, Nevada (2) acquiring fluid samples beneath permafrost in Nunuvut Territory, Canada, and (3) at a CO 2 storage demonstration project within a depleted gas reservoir, Otway Basin, Victoria, Australia. The addition of in-line high-pressure pH and EC sensors allows for continuous monitoring of fluid during sample collection. Difficulties have arisen during U-tube sampling, such as blockage of sample lines from naturally occurring waxes or from freezing conditions; however, workarounds such as solvent flushing or heating have been used to address these problems. The U-tube methodology has proven to be robust, and with careful consideration of the constraints and limitations, can provide high quality geochemical samples.

  12. Expression analysis of fiber related genes in cotton (gossypium hirsutum l.) through real time pcr

    International Nuclear Information System (INIS)

    Iqbal, N.; Khatoon, A.; Asif, M.; Bashir, A.

    2016-01-01

    Cotton fibers are unicellular seed trichomes and the largest known plant cells. Fiber morphogenesis in cotton is a complex process involving a large number of genes expressed throughout fiber development process. The expression profiling of five gene families in various cotton tissues was carried out through real time PCR. Expression analysis revealed that transcripts of expansin, tubulin and E6 were elevated from 5 to 20 days post anthesis (DPA) fibers. Three Lipid transfer proteins (LTPs) including LTP1, LTP3, LTP7 exhibited highest expression in 10 - 20 DPA fibers. Transcripts of LTP3 were detected in fibers and non fiber tissues that of LTP7 were almost negligible in non fiber tissues. Sucrose phosphate synthase gene showed highest expression in 10 DPA fibers while sucrose synthse (susy) expressed at higher rate in 5-20 DPA fibers as well as roots. The results reveal that most of fiber related genes showed high expression in 5-20 DPA fibers. Comprehensive expression study may help to determine tissue and stage specificity of genes under study. The study may also help to explore complex process of fiber development and understand the role of these genes in fiber development process. Highly expressed genes in fibers may be transformed in cotton for improvement of fiber quality traits. Genes that were expressed specifically in fibers or other tissues could be used for isolation of upstream regulatory sequences. (author)

  13. Compositional schedulability analysis of real-time actor-based systems.

    Science.gov (United States)

    Jaghoori, Mohammad Mahdi; de Boer, Frank; Longuet, Delphine; Chothia, Tom; Sirjani, Marjan

    2017-01-01

    We present an extension of the actor model with real-time, including deadlines associated with messages, and explicit application-level scheduling policies, e.g.,"earliest deadline first" which can be associated with individual actors. Schedulability analysis in this setting amounts to checking whether, given a scheduling policy for each actor, every task is processed within its designated deadline. To check schedulability, we introduce a compositional automata-theoretic approach, based on maximal use of model checking combined with testing. Behavioral interfaces define what an actor expects from the environment, and the deadlines for messages given these assumptions. We use model checking to verify that actors match their behavioral interfaces. We extend timed automata refinement with the notion of deadlines and use it to define compatibility of actor environments with the behavioral interfaces. Model checking of compatibility is computationally hard, so we propose a special testing process. We show that the analyses are decidable and automate the process using the Uppaal model checker.

  14. Real-time systems

    OpenAIRE

    Badr, Salah M.; Bruztman, Donald P.; Nelson, Michael L.; Byrnes, Ronald Benton

    1992-01-01

    This paper presents an introduction to the basic issues involved in real-time systems. Both real-time operating sys and real-time programming languages are explored. Concurrent programming and process synchronization and communication are also discussed. The real-time requirements of the Naval Postgraduate School Autonomous Under Vehicle (AUV) are then examined. Autonomous underwater vehicle (AUV), hard real-time system, real-time operating system, real-time programming language, real-time sy...

  15. Biomarker discovery for colon cancer using a 761 gene RT-PCR assay

    Directory of Open Access Journals (Sweden)

    Hackett James R

    2007-08-01

    Full Text Available Abstract Background Reverse transcription PCR (RT-PCR is widely recognized to be the gold standard method for quantifying gene expression. Studies using RT-PCR technology as a discovery tool have historically been limited to relatively small gene sets compared to other gene expression platforms such as microarrays. We have recently shown that TaqMan® RT-PCR can be scaled up to profile expression for 192 genes in fixed paraffin-embedded (FPE clinical study tumor specimens. This technology has also been used to develop and commercialize a widely used clinical test for breast cancer prognosis and prediction, the Onco typeDX™ assay. A similar need exists in colon cancer for a test that provides information on the likelihood of disease recurrence in colon cancer (prognosis and the likelihood of tumor response to standard chemotherapy regimens (prediction. We have now scaled our RT-PCR assay to efficiently screen 761 biomarkers across hundreds of patient samples and applied this process to biomarker discovery in colon cancer. This screening strategy remains attractive due to the inherent advantages of maintaining platform consistency from discovery through clinical application. Results RNA was extracted from formalin fixed paraffin embedded (FPE tissue, as old as 28 years, from 354 patients enrolled in NSABP C-01 and C-02 colon cancer studies. Multiplexed reverse transcription reactions were performed using a gene specific primer pool containing 761 unique primers. PCR was performed as independent TaqMan® reactions for each candidate gene. Hierarchal clustering demonstrates that genes expected to co-express form obvious, distinct and in certain cases very tightly correlated clusters, validating the reliability of this technical approach to biomarker discovery. Conclusion We have developed a high throughput, quantitatively precise multi-analyte gene expression platform for biomarker discovery that approaches low density DNA arrays in numbers of

  16. Performance of real-time elastography for the staging of hepatic fibrosis: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Huisuo Hong

    Full Text Available BACKGROUND: With the rapid development of real-time elastography (RTE, a variety of measuring methods have been developed for the assessment of hepatic fibrosis. We evaluated the overall performance of four methods based on RTE by performing meta-analysis of published literature. METHODS: Online journal databases and a manual search from April 2000 to April 2014 were used. Studies from different databases that meet inclusion criteria were enrolled. The statistical analysis was performed using a random-effects model and fixed-effects model for the overall effectiveness of RTE. The area under the receiver operating characteristic curve (AUROC was calculated for various means. Fagan plot analysis was used to estimate the clinical utility of RTE, and the heterogeneity of the studies was explored with meta-regression analysis. RESULTS: Thirteen studies from published articles were enrolled and analyzed. The combined AUROC of the liver fibrosis index (LFI for the evaluation of significant fibrosis (F≥2, advanced fibrosis (F≥3, and cirrhosis (F = 4 were 0.79, 0.94, and 0.85, respectively. The AUROC of the elasticity index (EI ranged from 0.75 to 0.92 for F≥2 and 0.66 to 0.85 for F = 4. The overall AUROC of the elastic ratio of the liver for the intrahepatic venous vessels were 0.94, 0.93, and 0.96, respectively. The AUROC of the elastic ratio of the liver for the intercostal muscle in diagnosing advanced fibrosis and cirrhosis were 0.96 and 0.92, respectively. There was significant heterogeneity in the diagnostic odds ratio (DOR for F≥2 of LFI mainly due to etiology (p<0.01. CONCLUSION: The elastic ratio of the liver for the intrahepatic vein has excellent precision in differentiating each stage of hepatic fibrosis and is recommend to be applied to the clinic.

  17. [Construction and analysis of a monitoring system with remote real-time multiple physiological parameters based on cloud computing].

    Science.gov (United States)

    Zhu, Lingyun; Li, Lianjie; Meng, Chunyan

    2014-12-01

    There have been problems in the existing multiple physiological parameter real-time monitoring system, such as insufficient server capacity for physiological data storage and analysis so that data consistency can not be guaranteed, poor performance in real-time, and other issues caused by the growing scale of data. We therefore pro posed a new solution which was with multiple physiological parameters and could calculate clustered background data storage and processing based on cloud computing. Through our studies, a batch processing for longitudinal analysis of patients' historical data was introduced. The process included the resource virtualization of IaaS layer for cloud platform, the construction of real-time computing platform of PaaS layer, the reception and analysis of data stream of SaaS layer, and the bottleneck problem of multi-parameter data transmission, etc. The results were to achieve in real-time physiological information transmission, storage and analysis of a large amount of data. The simulation test results showed that the remote multiple physiological parameter monitoring system based on cloud platform had obvious advantages in processing time and load balancing over the traditional server model. This architecture solved the problems including long turnaround time, poor performance of real-time analysis, lack of extensibility and other issues, which exist in the traditional remote medical services. Technical support was provided in order to facilitate a "wearable wireless sensor plus mobile wireless transmission plus cloud computing service" mode moving towards home health monitoring for multiple physiological parameter wireless monitoring.

  18. An integrated real-time diagnostic concept using expert systems, qualitative reasoning and quantitative analysis

    International Nuclear Information System (INIS)

    Edwards, R.M.; Lee, K.Y.; Kumara, S.; Levine, S.H.

    1989-01-01

    An approach for an integrated real-time diagnostic system is being developed for inclusion as an integral part of a power plant automatic control system. In order to participate in control decisions and automatic closed loop operation, the diagnostic system must operate in real-time. Thus far, an expert system with real-time capabilities has been developed and installed on a subsystem at the Experimental Breeder Reactor (EBR-II) in Idaho, USA. Real-time simulation testing of advanced power plant concepts at the Pennsylvania State University has been developed and was used to support the expert system development and installation at EBR-II. Recently, the US National Science Foundation (NSF) and the US Department of Energy (DOE) have funded a Penn State research program to further enhance application of real-time diagnostic systems by pursuing implementation in a distributed power plant computer system including microprocessor based controllers. This paper summarizes past, current, planned, and possible future approaches to power plant diagnostic systems research at Penn State. 34 refs., 9 figs

  19. Development of real-time plasma analysis and control algorithms for the TCV tokamak using SIMULINK

    International Nuclear Information System (INIS)

    Felici, F.; Le, H.B.; Paley, J.I.; Duval, B.P.; Coda, S.; Moret, J.-M.; Bortolon, A.; Federspiel, L.; Goodman, T.P.; Hommen, G.; Karpushov, A.; Piras, F.; Pitzschke, A.; Romero, J.; Sevillano, G.; Sauter, O.; Vijvers, W.

    2014-01-01

    Highlights: • A new digital control system for the TCV tokamak has been commissioned. • The system is entirely programmable by SIMULINK, allowing rapid algorithm development. • Different control system nodes can run different algorithms at varying sampling times. • The previous control system functions have been emulated and improved. • New capabilities include MHD control, profile control, equilibrium reconstruction. - Abstract: One of the key features of the new digital plasma control system installed on the TCV tokamak is the possibility to rapidly design, test and deploy real-time algorithms. With this flexibility the new control system has been used for a large number of new experiments which exploit TCV's powerful actuators consisting of 16 individually controllable poloidal field coils and 7 real-time steerable electron cyclotron (EC) launchers. The system has been used for various applications, ranging from event-based real-time MHD control to real-time current diffusion simulations. These advances have propelled real-time control to one of the cornerstones of the TCV experimental program. Use of the SIMULINK graphical programming language to directly program the control system has greatly facilitated algorithm development and allowed a multitude of different algorithms to be deployed in a short time. This paper will give an overview of the developed algorithms and their application in physics experiments

  20. Construction of an adult barnacle (Balanus amphitrite cDNA library and selection of reference genes for quantitative RT-PCR studies

    Directory of Open Access Journals (Sweden)

    Burgess J Grant

    2009-06-01

    Full Text Available Abstract Background Balanus amphitrite is a barnacle commonly used in biofouling research. Although many aspects of its biology have been elucidated, the lack of genetic information is impeding a molecular understanding of its life cycle. As part of a wider multidisciplinary approach to reveal the biogenic cues influencing barnacle settlement and metamorphosis, we have sequenced and annotated the first cDNA library for B. amphitrite. We also present a systematic validation of potential reference genes for normalization of quantitative real-time PCR (qRT-PCR data obtained from different developmental stages of this animal. Results We generated a cDNA library containing expressed sequence tags (ESTs from adult B. amphitrite. A total of 609 unique sequences (comprising 79 assembled clusters and 530 singlets were derived from 905 reliable unidirectionally sequenced ESTs. Bioinformatics tools such as BLAST, HMMer and InterPro were employed to allow functional annotation of the ESTs. Based on these analyses, we selected 11 genes to study their ability to normalize qRT-PCR data. Total RNA extracted from 7 developmental stages was reverse transcribed and the expression stability of the selected genes was compared using geNorm, BestKeeper and NormFinder. These software programs produced highly comparable results, with the most stable gene being mt-cyb, while tuba, tubb and cp1 were clearly unsuitable for data normalization. Conclusion The collection of B. amphitrite ESTs and their annotation has been made publically available representing an important resource for both basic and applied research on this species. We developed a qRT-PCR assay to determine the most reliable reference genes. Transcripts encoding cytochrome b and NADH dehydrogenase subunit 1 were expressed most stably, although other genes also performed well and could prove useful to normalize gene expression studies.

  1. PRIMAS: a real-time 3D motion-analysis system

    Science.gov (United States)

    Sabel, Jan C.; van Veenendaal, Hans L. J.; Furnee, E. Hans

    1994-03-01

    The paper describes a CCD TV-camera-based system for real-time multicamera 2D detection of retro-reflective targets and software for accurate and fast 3D reconstruction. Applications of this system can be found in the fields of sports, biomechanics, rehabilitation research, and various other areas of science and industry. The new feature of real-time 3D opens an even broader perspective of application areas; animations in virtual reality are an interesting example. After presenting an overview of the hardware and the camera calibration method, the paper focuses on the real-time algorithms used for matching of the images and subsequent 3D reconstruction of marker positions. When using a calibrated setup of two cameras, it is now possible to track at least ten markers at 100 Hz. Limitations in the performance are determined by the visibility of the markers, which could be improved by adding a third camera.

  2. [Disappearance of residual disease confirmed by RT-PCR following induction chemotherapy in two hypoplastic leukemia patients with t(8;21)].

    Science.gov (United States)

    Sawada, M; Tsurumi, H; Yamada, T; Hara, T; Oyama, M; Moriwaki, H

    1999-04-01

    Reverse transcriptase-polymerase chain reaction (RT-PCR) methods often detect the AML1/MTG8 fusion transcript even in acute myelogenous leukemia (AML) patients with t(8;21) who have been in long-term remission. We encountered 2 hypoplastic leukemia patients with t(8;21) who achieved cytogenetic remission with short-term conventional chemotherapy. Patient 1 was a 42-year-old woman. Chromosomal analysis detected t(8;21) (q22;q22) and PCR analysis (35 cycles PCR amplification; detection limit 1 x 10(-5) cells) detected the AML1/MTG8 fusion transcript. Complete remission was obtained with 1 course of chemotherapy consisting of low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days). After 2 courses of consolidation chemotherapy consisting of conventional-dose cytarabine and mitoxantrone, the RT-PCR findings were negative for the AML1/MTG8 fusion transcript. Patient 2 was a 67-year-old man. Cytogenetic analysis detected t(8;21) (q22;q22), and was positive for the AML1/MTG8 fusion transcript. After 2 courses of induction chemotherapy comprising low-dose cytarabine (20 mg x 14 days) and etoposide (50 mg x 14 days), and 3 courses of conventional consolidation chemotherapy, RT-PCR analysis confirmed the disappearance of the AML1/MTG8 fusion transcript.

  3. St. Patrick's Day 2015 geomagnetic storm analysis based on Real Time Ionosphere Monitoring

    Science.gov (United States)

    García-Rigo, Alberto

    2017-04-01

    Ionosphere Monitoring (RTIM) is a new Working Group within the International Association of Geodesy (IAG) Sub-Commission 4.3 "Atmosphere Remote Sensing". The complementary expertise of the participating research groups allows to analyse the ionospheric behaviour from a broad perspective, taking benefit of comparing multiple independent real time and near real time ionospheric approaches. In this context, a detailed analysis will be presented for the days in March, 2015 surrounding St. Patrick's Day 2015 geomagnetic storm, based on the existing ionospheric models (global or regional) within the group, which are mainly based on Global Navigation Satellite Systems (GNSS) and ionosonde data. For this purpose, a variety of ionospheric parameters will be considered, including Total Electron Content (TEC), F2 layer critical frequency (foF2), F2 layer peak (hmF2), bottomside half-thickness (B0) and ionospheric disturbance W-index. Also, ionospheric high-frequency perturbations such as Travelling Ionospheric Disturbances (TIDs), scintillations and the impact of solar flares facing the Earth will be presented to derive a clear picture of the ionospheric dynamics. Among other sources of information to take part in the comparisons, there will be (1) scintillation results -from MONITOR ESA/ESTEC-funded project- derived by means of S4 index and Sigma Phi (IEEA), specially significant in the African sector and European high latitudes, (2) dynamics of the global maps of W-index with 1h resolution derived from JPL Global Ionospheric Maps (GIMs; IZMIRAN), (3) deviations from expected quiet-time behavior analysed in terms of foF2, hmF2, B0 and B1 based on IRTAM and GIRO network of digisondes (Lowell), showing F2 layer peculiar changes due to the storm, (4) statistics based on the median of the VTEC for the 15 previous days considering VTEC european regional maps (ROB), (5) time series of VTEC data that are derived by running the NRT ionosphere model of DGFI-TUM in offline mode, which show

  4. Real-time face and gesture analysis for human-robot interaction

    Science.gov (United States)

    Wallhoff, Frank; Rehrl, Tobias; Mayer, Christoph; Radig, Bernd

    2010-05-01

    Human communication relies on a large number of different communication mechanisms like spoken language, facial expressions, or gestures. Facial expressions and gestures are one of the main nonverbal communication mechanisms and pass large amounts of information between human dialog partners. Therefore, to allow for intuitive human-machine interaction, a real-time capable processing and recognition of facial expressions, hand and head gestures are of great importance. We present a system that is tackling these challenges. The input features for the dynamic head gestures and facial expressions are obtained from a sophisticated three-dimensional model, which is fitted to the user in a real-time capable manner. Applying this model different kinds of information are extracted from the image data and afterwards handed over to a real-time capable data-transferring framework, the so-called Real-Time DataBase (RTDB). In addition to the head and facial-related features, also low-level image features regarding the human hand - optical flow, Hu-moments are stored into the RTDB for the evaluation process of hand gestures. In general, the input of a single camera is sufficient for the parallel evaluation of the different gestures and facial expressions. The real-time capable recognition of the dynamic hand and head gestures are performed via different Hidden Markov Models, which have proven to be a quick and real-time capable classification method. On the other hand, for the facial expressions classical decision trees or more sophisticated support vector machines are used for the classification process. These obtained results of the classification processes are again handed over to the RTDB, where other processes (like a Dialog Management Unit) can easily access them without any blocking effects. In addition, an adjustable amount of history can be stored by the RTDB buffer unit.

  5. Automated multivariate analysis of multi-sensor data submitted online: Real-time environmental monitoring.

    Science.gov (United States)

    Eide, Ingvar; Westad, Frank

    2018-01-01

    A pilot study demonstrating real-time environmental monitoring with automated multivariate analysis of multi-sensor data submitted online has been performed at the cabled LoVe Ocean Observatory located at 258 m depth 20 km off the coast of Lofoten-Vesterålen, Norway. The major purpose was efficient monitoring of many variables simultaneously and early detection of changes and time-trends in the overall response pattern before changes were evident in individual variables. The pilot study was performed with 12 sensors from May 16 to August 31, 2015. The sensors provided data for chlorophyll, turbidity, conductivity, temperature (three sensors), salinity (calculated from temperature and conductivity), biomass at three different depth intervals (5-50, 50-120, 120-250 m), and current speed measured in two directions (east and north) using two sensors covering different depths with overlap. A total of 88 variables were monitored, 78 from the two current speed sensors. The time-resolution varied, thus the data had to be aligned to a common time resolution. After alignment, the data were interpreted using principal component analysis (PCA). Initially, a calibration model was established using data from May 16 to July 31. The data on current speed from two sensors were subject to two separate PCA models and the score vectors from these two models were combined with the other 10 variables in a multi-block PCA model. The observations from August were projected on the calibration model consecutively one at a time and the result was visualized in a score plot. Automated PCA of multi-sensor data submitted online is illustrated with an attached time-lapse video covering the relative short time period used in the pilot study. Methods for statistical validation, and warning and alarm limits are described. Redundant sensors enable sensor diagnostics and quality assurance. In a future perspective, the concept may be used in integrated environmental monitoring.

  6. Automated multivariate analysis of multi-sensor data submitted online: Real-time environmental monitoring.

    Directory of Open Access Journals (Sweden)

    Ingvar Eide

    Full Text Available A pilot study demonstrating real-time environmental monitoring with automated multivariate analysis of multi-sensor data submitted online has been performed at the cabled LoVe Ocean Observatory located at 258 m depth 20 km off the coast of Lofoten-Vesterålen, Norway. The major purpose was efficient monitoring of many variables simultaneously and early detection of changes and time-trends in the overall response pattern before changes were evident in individual variables. The pilot study was performed with 12 sensors from May 16 to August 31, 2015. The sensors provided data for chlorophyll, turbidity, conductivity, temperature (three sensors, salinity (calculated from temperature and conductivity, biomass at three different depth intervals (5-50, 50-120, 120-250 m, and current speed measured in two directions (east and north using two sensors covering different depths with overlap. A total of 88 variables were monitored, 78 from the two current speed sensors. The time-resolution varied, thus the data had to be aligned to a common time resolution. After alignment, the data were interpreted using principal component analysis (PCA. Initially, a calibration model was established using data from May 16 to July 31. The data on current speed from two sensors were subject to two separate PCA models and the score vectors from these two models were combined with the other 10 variables in a multi-block PCA model. The observations from August were projected on the calibration model consecutively one at a time and the result was visualized in a score plot. Automated PCA of multi-sensor data submitted online is illustrated with an attached time-lapse video covering the relative short time period used in the pilot study. Methods for statistical validation, and warning and alarm limits are described. Redundant sensors enable sensor diagnostics and quality assurance. In a future perspective, the concept may be used in integrated environmental monitoring.

  7. GENEASE: Real time bioinformatics tool for multi-omics and disease ontology exploration, analysis and visualization.

    Science.gov (United States)

    Ghandikota, Sudhir; Hershey, Gurjit K Khurana; Mersha, Tesfaye B

    2018-03-24

    Advances in high-throughput sequencing technologies have made it possible to generate multiple omics data at an unprecedented rate and scale. The accumulation of these omics data far outpaces the rate at which biologists can mine and generate new hypothesis to test experimentally. There is an urgent need to develop a myriad of powerful tools to efficiently and effectively search and filter these resources to address specific post-GWAS functional genomics questions. However, to date, these resources are scattered across several databases and often lack a unified portal for data annotation and analytics. In addition, existing tools to analyze and visualize these databases are highly fragmented, resulting researchers to access multiple applications and manual interventions for each gene or variant in an ad hoc fashion until all the questions are answered. In this study, we present GENEASE, a web-based one-stop bioinformatics tool designed to not only query and explore multi-omics and phenotype databases (e.g., GTEx, ClinVar, dbGaP, GWAS Catalog, ENCODE, Roadmap Epigenomics, KEGG, Reactome, Gene and Phenotype Ontology) in a single web interface but also to perform seamless post genome-wide association downstream functional and overlap analysis for non-coding regulatory variants. GENEASE accesses over 50 different databases in public domain including model organism-specific databases to facilitate gene/variant and disease exploration, enrichment and overlap analysis in real time. It is a user-friendly tool with point-and-click interface containing links for support information including user manual and examples. GENEASE can be accessed freely at http://research.cchmc.org/mershalab/genease_new/login.html. Tesfaye.Mersha@cchmc.org, Sudhir.Ghandikota@cchmc.org. Supplementary data are available at Bioinformatics online.

  8. Improving practices in nanomedicine through near real-time pharmacokinetic analysis

    Science.gov (United States)

    Magafia, Isidro B.

    More than a decade into the development of gold nanoparticles, with multiple clinical trials underway, ongoing pre-clinical research continues towards better understanding in vivo interactions. The goal is treatment optimization through improved best practices. In an effort to collect information for healthcare providers enabling informed decisions in a relevant time frame, instrumentation for real-time plasma concentration (multi-wavelength photoplethysmography) and protocols for rapid elemental analysis (energy dispersive X-Ray fluorescence) of biopsied tumor tissue have been developed in a murine model. An initial analysis, designed to demonstrate the robust nature and utility of the techniques, revealed that area under the bioavailability curve (AUC) alone does not currently inform tumor accumulation with a high degree of accuracy (R2=0.56), marginally better than injected dose (R2=0.46). This finding suggests that the control of additional experimental and physiological variables (chosen through modeling efforts) may yield more predictable tumor accumulation. Subject core temperature, blood pressure, and tumor perfusion are evaluated relative to particle uptake in a murine tumor model. New research efforts are also focused on adjuvant therapies that are employed to modify circulation parameters, including the AUC, of nanorods and gold nanoshells. Preliminary studies demonstrated a greater than 300% increase in average AUC using a reticuloendothelial blockade agent versus control groups. Given a better understanding of the relative importance of the physiological factors that influence rates of tumor accumulation, a set of experimental best practices is presented. This dissertation outlines the experimental protocols conducted, and discusses the real-world needs discovered and how these needs became specifications of developed protocols.

  9. MTF analysis of the near-real time neutron radiography facility at MURR

    International Nuclear Information System (INIS)

    Lindsay, J.T.; Alger, D.M.; Bull, S.R.; Miller, W.H.

    1983-01-01

    Several neutron radiography systems designed to view transient processes on a real-time basis have been developed. With the advent of these different real-time systems comes the necessity to develop a means to quantitatively evaluate and compare these systems. A suitable method for measuring the resolution capabilities of the image-forming system is the determination of the modulation transfer function (MTF). The MTF is a measure of an imaging system's ability to reproduce the spatial frequencies present in an image. The system in use at the University of Missouri Research Reactor is described. (Auth.)

  10. Real-time systems design and analysis tools for the practitioner

    CERN Document Server

    Laplante, Phillip A

    2012-01-01

    An important resource, this book offers an introduction and overview of real-time systems: systems where timeliness is a crucial part of the correctness of the system. It contains a pragmatic overview of key topics (computer architecture and organization, operating systems, software engineering, programming languages, and compiler theory) from the perspective of the real-time systems designer and is organized into chapters that are essentially self-contained. In addition, each chapter contains both basic and more challenging exercises that will help the reader to confront actual problems.

  11. Quantitative RT-PCR based platform for rapid quantification of the transcripts of highly homologous multigene families and their members during grain development

    DEFF Research Database (Denmark)

    Kaczmarczyk, Agnieszka Ewa; Bowra, Steve; Elek, Zoltan

    2012-01-01

    expression combined with genetic variation in large multigene families with high homology among the alleles is very challenging. Results We designed a rapid qRT-PCR system with the aim of characterising the variation in the expression of hordein genes families. All the known D-, C-, B-, and gamma......-hordein sequences coding full length open reading frames were collected from commonly available databases. Phylogenetic analysis was performed and the members of the different hordein families were classified into subfamilies. Primer sets were designed to discriminate the gene expression level of whole families...... and its subgroups. More over the results indicate the genotypic specific gene expression. Conclusions Quantitative RT-PCR with SYBR Green labelling can be a useful technique to follow gene expression levels of large gene families with highly homologues members. We showed variation in the temporal...

  12. A one-step multiplex RT-PCR assay for simultaneous detection of four viruses that infect peach.

    Science.gov (United States)

    Yu, Y; Zhao, Z; Jiang, D; Wu, Z; Li, S

    2013-10-01

    A multiplex reverse transcription polymerase chain reaction (mRT-PCR) assay was developed to enable the simultaneous detection and differentiation of four viruses that infect peach, namely Apple chlorotic leaf spot virus (ACLSV), Cherry green ring mottle virus (CGRMV), Prunus necrotic ringspot virus (PNRSV) and Apricot pseudo-chlorotic leaf spot virus (APCLSV). In this study, four pairs of primers, one specific for each virus, were designed; the corresponding PCR products were 632, 439, 346 and 282 bp in length for ACLSV, CGRMV, PNRSV and APCLSV, respectively, and the fragments could be distinguished clearly by agarose gel electrophoresis. The sensitivity and specificity of the method were tested using individual RT-PCR and enzyme-linked immunosorbent assay (ELISA), and the identity of the RT-PCR amplification products was also confirmed by DNA sequencing. The results of RT-PCR and ELISA, along with batch detection using samples collected from peach orchards, revealed that this rapid and simple technique is an effective way to identify the four viruses simultaneously. The mRT-PCR assay described in this study was developed for the simultaneous detection of four peach viruses from infected peach samples is reliable and sensitive. In contrast to conventional uniplex RT-PCR, mRT-PCR is more efficient, reducing costs, time and handling when testing large numbers of samples. This rapid and simple method is useful for large-scale surveys of viruses that infect peach. © 2013 The Society for Applied Microbiology.

  13. Simultaneous Expression of GUS and Actin Genes by Using the Multiplex RT-PCR and Multiplex Gold Nanoparticle Probes.

    Science.gov (United States)

    Ghazi, Yaser; Vaseghi, Akbar; Ahmadi, Sepideh; Haddadi, Fatemeh

    2018-04-23

    Gene expression analysis is considered to be extremely important in many different biological researches. DNA-based diagnostic test, which contributes to DNA identification, has higher specificity, cost, and speed than some biochemical and molecular methods. In this study, we try to use the novel nano technology approach with Multiplex RT-PCR and Gold nano particular probes (GNPs-probes) in order to get gene expression in Curcumas melons. We used Agrobacterium tumefactions for gene transfer and GUS reporter gene as a reporter. After cDNA synthesis, Multiplex PCR and Multiplex RT-PCR techniques were used. Finally, probes were designed for RNA of GUS and Actin genes, and then the analysis of the gene expression using the probes attached to GNPs was carried out and the color changes in the GNPs were applied. In the following, probes hybridization was checked with DNA between 400 to 700 nm wavelengths and the highest rate was observed in the 550 to 650 nm. The results show that the simultaneous use of GNP-attached detectors and Multiplex RT-PCRcan reduce time and costmore considerably than somelaboratory methods for gene expiration investigation. Additionally, it can be seen thatthere is an increase in sensitivity and specificity of our investigation. Based on our findings, this can bea novel study doneusingMultiplex RT-PCRand unmodified AuNPs for gene transfer and expression detection to plants. We can claim that this assay has a remarkable advantage including rapid, cost-effectiveness, specificity and accuracy to detect transfer and expression genes in plants. Also,we can use this technique from other gene expressionsin many different biology samples.

  14. Chemometric brand differentiation of commercial spices using direct analysis in real time mass spectrometry.

    Science.gov (United States)

    Pavlovich, Matthew J; Dunn, Emily E; Hall, Adam B

    2016-05-15

    Commercial spices represent an emerging class of fuels for improvised explosives. Being able to classify such spices not only by type but also by brand would represent an important step in developing methods to analytically investigate these explosive compositions. Therefore, a combined ambient mass spectrometric/chemometric approach was developed to quickly and accurately classify commercial spices by brand. Direct analysis in real time mass spectrometry (DART-MS) was used to generate mass spectra for samples of black pepper, cayenne pepper, and turmeric, along with four different brands of cinnamon, all dissolved in methanol. Unsupervised learning techniques showed that the cinnamon samples clustered according to brand. Then, we used supervised machine learning algorithms to build chemometric models with a known training set and classified the brands of an unknown testing set of cinnamon samples. Ten independent runs of five-fold cross-validation showed that the training set error for the best-performing models (i.e., the linear discriminant and neural network models) was lower than 2%. The false-positive percentages for these models were 3% or lower, and the false-negative percentages were lower than 10%. In particular, the linear discriminant model perfectly classified the testing set with 0% error. Repeated iterations of training and testing gave similar results, demonstrating the reproducibility of these models. Chemometric models were able to classify the DART mass spectra of commercial cinnamon samples according to brand, with high specificity and low classification error. This method could easily be generalized to other classes of spices, and it could be applied to authenticating questioned commercial samples of spices or to examining evidence from improvised explosives. Copyright © 2016 John Wiley & Sons, Ltd.

  15. The role of real-time in biomedical science: a meta-analysis on computational complexity, delay and speedup.

    Science.gov (United States)

    Faust, Oliver; Yu, Wenwei; Rajendra Acharya, U

    2015-03-01

    The concept of real-time is very important, as it deals with the realizability of computer based health care systems. In this paper we review biomedical real-time systems with a meta-analysis on computational complexity (CC), delay (Δ) and speedup (Sp). During the review we found that, in the majority of papers, the term real-time is part of the thesis indicating that a proposed system or algorithm is practical. However, these papers were not considered for detailed scrutiny. Our detailed analysis focused on papers which support their claim of achieving real-time, with a discussion on CC or Sp. These papers were analyzed in terms of processing system used, application area (AA), CC, Δ, Sp, implementation/algorithm (I/A) and competition. The results show that the ideas of parallel processing and algorithm delay were only recently introduced and journal papers focus more on Algorithm (A) development than on implementation (I). Most authors compete on big O notation (O) and processing time (PT). Based on these results, we adopt the position that the concept of real-time will continue to play an important role in biomedical systems design. We predict that parallel processing considerations, such as Sp and algorithm scaling, will become more important. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Specification and Analysis of Soft Real-Time Systems: Quantity and Quality

    NARCIS (Netherlands)

    d' Argenio, P.R.; Katoen, Joost P.; Brinksma, Hendrik

    This paper presents a process algebra for specifying soft real-time constraints in a compositional way. For these soft constraints we take a stochastic point of view and allow arbitrary probability distributions to express delays of activities. The semantics of this process algebra is given in terms

  17. Analysis and optimization techniques for real-time streaming image processing software on general purpose systems

    NARCIS (Netherlands)

    Westmijze, Mark

    2018-01-01

    Commercial Off The Shelf (COTS) Chip Multi-Processor (CMP) systems are for cost reasons often used in industry for soft real-time stream processing. COTS CMP systems typically have a low timing predictability, which makes it difficult to develop software applications for these systems with tight

  18. Temporal analysis and scheduling of hard real-time radios running on a multi-processor

    NARCIS (Netherlands)

    Moreira, O.

    2012-01-01

    On a multi-radio baseband system, multiple independent transceivers must share the resources of a multi-processor, while meeting each its own hard real-time requirements. Not all possible combinations of transceivers are known at compile time, so a solution must be found that either allows for

  19. Developmental stage of strongyle eggs affects the outcome variations of real-time PCR analysis

    DEFF Research Database (Denmark)

    Andersen, Ulla Vestergaard; Haakansson, I. T.; Roust, Tina

    2013-01-01

    extent developmental stages can affect the variation of diagnostic test results. This study investigated the influence of developmental stages of strongyle eggs on the variation real-time polymerase chain reaction (PCR) results. Mixed species strongyle eggs were obtained from the faeces of a naturally...

  20. Reliable 5-min real-time MR technique for left-ventricular-wall motion analysis

    International Nuclear Information System (INIS)

    Katoh, Marcus; Spuentrup, Elmar; Guenther, Rolf W.; Buecker, Arno; Kuehl, Harald P.; Lipke, Claudia S.A.

    2007-01-01

    The aim of this study was to investigate the value of a real-time magnetic resonance imaging (MRI) approach for the assessment of left-ventricular-wall motion in patients with insufficient transthoracic echocardiography in terms of accuracy and temporal expenditure. Twenty-five consecutive patients were examined on a 1.5-Tesla whole-body MR system (ACS-NT, Philips Medical Systems, Best, NL) using a real-time and ECG-gated (the current gold standard) steady-state free-precession (SSFP) sequence. Wall motion was analyzed by three observers by consensus interpretation. In addition, the preparation, scanning, and overall examination times were measured. The assessment of the wall motion demonstrated a close agreement between the two modalities resulting in a mean κ coefficient of 0.8. At the same time, each stage of the examination was significantly shortened using the real-time MR approach. Real-time imaging allows for accurate assessment of left-ventricular-wall motion with the added benefit of decreased examination time. Therefore, it may serve as a cost-efficient alternative in patients with insufficient echocardiography. (orig.)

  1. WCET analysis in shared resources real-time systems with TDMA buses

    NARCIS (Netherlands)

    Rihani, H.; Moy, M.; Maiza, C.; Altmeyer, S.

    2015-01-01

    Predictability is an important aspect in real-time and safety-critical systems, where non-functional properties -- such as the timing behavior -- have high impact on the system correctness. As many safety-critical systems have a growing performance demand, simple, but outdated architectures are not

  2. Performance analysis of a real-time database with optimistic concurrency control

    NARCIS (Netherlands)

    Sassen, S.A.E.; Wal, van der J.

    1997-01-01

    For a real-time shared-memory database with Optimistic Concurrency Control (OCC), an approximation for the transaction response-time distribution and thus for the deadline miss probability is obtained. Transactions arrive at the database according to a Poisson process. There is a limited number of

  3. Design-time performance analysis of component-based real-time systems

    NARCIS (Netherlands)

    Bondarev, E.

    2009-01-01

    In current real-time systems, performance metrics are one of the most challenging properties to specify, predict and measure. Performance properties depend on various factors, like environmental context, load profile, middleware, operating system, hardware platform and sharing of internal resources.

  4. Feasibility analysis of real-time physical modeling using WaveCore processor technology on FPGA

    NARCIS (Netherlands)

    Verstraelen, Martinus Johannes Wilhelmina; Pfeifle, Florian; Bader, Rolf

    2015-01-01

    WaveCore is a scalable many-core processor technology. This technology is specifically developed and optimized for real-time acoustical modeling applications. The programmable WaveCore soft-core processor is silicon-technology independent and hence can be targeted to ASIC or FPGA technologies. The

  5. INTEGRITY ANALYSIS OF REAL-TIME PPP TECHNIQUE WITH IGS-RTS SERVICE FOR MARITIME NAVIGATION

    Directory of Open Access Journals (Sweden)

    M. El-Diasty

    2017-10-01

    Full Text Available Open sea and inland waterways are the most widely used mode for transporting goods worldwide. It is the International Maritime Organization (IMO that defines the requirements for position fixing equipment for a worldwide radio-navigation system, in terms of accuracy, integrity, continuity, availability and coverage for the various phases of navigation. Satellite positioning systems can contribute to meet these requirements, as well as optimize marine transportation. Marine navigation usually consists of three major phases identified as Ocean/Coastal/Port approach/Inland waterway, in port navigation and automatic docking with alert limit ranges from 25 m to 0.25 m. GPS positioning is widely used for many applications and is currently recognized by IMO for a future maritime navigation. With the advancement in autonomous GPS positioning techniques such as Precise Point Positioning (PPP and with the advent of new real-time GNSS correction services such as IGS-Real-Time-Service (RTS, it is necessary to investigate the integrity of the PPP-based positioning technique along with IGS-RTS service in terms of availability and reliability for safe navigation in maritime application. This paper monitors the integrity of an autonomous real-time PPP-based GPS positioning system using the IGS real-time service (RTS for maritime applications that require minimum availability of integrity of 99.8 % to fulfil the IMO integrity standards. To examine the integrity of the real-time IGS-RTS PPP-based technique for maritime applications, kinematic data from a dual frequency GPS receiver is collected onboard a vessel and investigated with the real-time IGS-RTS PPP-based GPS positioning technique. It is shown that the availability of integrity of the real-time IGS-RTS PPP-based GPS solution is 100 % for all navigation phases and therefore fulfil the IMO integrity standards (99.8 % availability immediately (after 1 second, after 2 minutes and after 42 minutes

  6. Integrity Analysis of Real-Time Ppp Technique with Igs-Rts Service for Maritime Navigation

    Science.gov (United States)

    El-Diasty, M.

    2017-10-01

    Open sea and inland waterways are the most widely used mode for transporting goods worldwide. It is the International Maritime Organization (IMO) that defines the requirements for position fixing equipment for a worldwide radio-navigation system, in terms of accuracy, integrity, continuity, availability and coverage for the various phases of navigation. Satellite positioning systems can contribute to meet these requirements, as well as optimize marine transportation. Marine navigation usually consists of three major phases identified as Ocean/Coastal/Port approach/Inland waterway, in port navigation and automatic docking with alert limit ranges from 25 m to 0.25 m. GPS positioning is widely used for many applications and is currently recognized by IMO for a future maritime navigation. With the advancement in autonomous GPS positioning techniques such as Precise Point Positioning (PPP) and with the advent of new real-time GNSS correction services such as IGS-Real-Time-Service (RTS), it is necessary to investigate the integrity of the PPP-based positioning technique along with IGS-RTS service in terms of availability and reliability for safe navigation in maritime application. This paper monitors the integrity of an autonomous real-time PPP-based GPS positioning system using the IGS real-time service (RTS) for maritime applications that require minimum availability of integrity of 99.8 % to fulfil the IMO integrity standards. To examine the integrity of the real-time IGS-RTS PPP-based technique for maritime applications, kinematic data from a dual frequency GPS receiver is collected onboard a vessel and investigated with the real-time IGS-RTS PPP-based GPS positioning technique. It is shown that the availability of integrity of the real-time IGS-RTS PPP-based GPS solution is 100 % for all navigation phases and therefore fulfil the IMO integrity standards (99.8 % availability) immediately (after 1 second), after 2 minutes and after 42 minutes of convergence

  7. Real-Time QoS Routing Protocols in Wireless Multimedia Sensor Networks: Study and Analysis.

    Science.gov (United States)

    Alanazi, Adwan; Elleithy, Khaled

    2015-09-02

    Many routing protocols have been proposed for wireless sensor networks. These routing protocols are almost always based on energy efficiency. However, recent advances in complementary metal-oxide semiconductor (CMOS) cameras and small microphones have led to the development of Wireless Multimedia Sensor Networks (WMSN) as a class of wireless sensor networks which pose additional challenges. The transmission of imaging and video data needs routing protocols with both energy efficiency and Quality of Service (QoS) characteristics in order to guarantee the efficient use of the sensor nodes and effective access to the collected data. Also, with integration of real time applications in Wireless Senor Networks (WSNs), the use of QoS routing protocols is not only becoming a significant topic, but is also gaining the attention of researchers. In designing an efficient QoS routing protocol, the reliability and guarantee of end-to-end delay are critical events while conserving energy. Thus, considerable research has been focused on designing energy efficient and robust QoS routing protocols. In this paper, we present a state of the art research work based on real-time QoS routing protocols for WMSNs that have already been proposed. This paper categorizes the real-time QoS routing protocols into probabilistic and deterministic protocols. In addition, both categories are classified into soft and hard real time protocols by highlighting the QoS issues including the limitations and features of each protocol. Furthermore, we have compared the performance of mobility-aware query based real-time QoS routing protocols from each category using Network Simulator-2 (NS2). This paper also focuses on the design challenges and future research directions as well as highlights the characteristics of each QoS routing protocol.

  8. Detection of poliovirus type 2 in oysters by using cell culture and RT-PCR Detecção de poliovírus tipo 2 em ostras através de cultura celular e RT-PCR

    Directory of Open Access Journals (Sweden)

    Cecília E.B. Vinatea

    2006-03-01

    Full Text Available Shellfish are readily contaminated with viruses present in water containing sewage due to the concentrating effect of filter feeding. Enteroviruses are generally used as a model for the detection of viruses from shellfish due to their public health significance. In the present work, oysters were placed in glass aquaria containing seawater plus unicellular algae. Two experiments were performed: 1 oysters bioaccumulating four different poliovirus type 2 concentrations: 5 x 10(4, 2.5 x 10(4, 5 x 10³ and 5 x 10² PFU/mL during 20h; 2 oyster tissues directly inoculated with 6.0 x 10(5 and 1.0 x 10(5 PFU/mL. After viruses seeding, tissue samples were processed by an adsorption-elution-precipitation method. Positive controls were performed by seeding 6.0 x 10(5 PFU/mL of poliovirus type 2 directly on the final oyster tissue extracts. Oyster extracts were assayed for viruses recovery by plaque assay, RT-PCR and integrated cell culture-PCR methodologies (ICC/PCR. The last one was based on the inoculation of the samples onto VERO cell monolayer followed by RT-PCR analysis of the infected cell fluid. In the first experiment (20h bioaccumulation until 5 x 10³ PFU were detected after 24 and 48h growth on VERO cells. Direct RT-PCR and ICC/PCR were able to detect 3 and 0.04 PFU of poliovirus, respectively, when bioaccumulation assay was used. When direct tissue virus seeding was performed, the plaque assays showed that polioviruses were recovered in all tested concentrations. Based on these results, it is possible to conclude that viable polioviruses can be detected in oysters after bioaccumulation and these techniques can be directly applied for monitoring virus contamination in environmental samples.Devido ao hábito alimentar filtrante, os moluscos bivalves são contaminados por vírus presentes em águas contaminadas por esgoto. Os enterovírus são geralmente usados como modelos para a detecção de vírus em moluscos bivalves devido a sua import

  9. RT-PCR for confirmation of echovirus 30 isolated in Belém, Brazil

    Directory of Open Access Journals (Sweden)

    Maria de Lourdes C. Gomes

    Full Text Available Echovirus (Echo 30 or human enterovirus B is the most frequent enterovirus associated with meningitis cases. Epidemics and outbreaks of this disease caused by Echo 30 have occurred in several countries. In Brazil, Echo 30 has been isolated from sporadic cases and outbreaks that occurred mainly in the south and southeast regions. We used RT-PCR to examine Echo 30 isolates from meningitis cases detected from March 2002 to December 2003 in Belém, state of Pará, in northern Brazil. The patients were attended in a Basic Health Unit (State Health Secretary of Pará, where cerebrospinal fluid (CSF was collected and stored in liquid nitrogen. Weekly visits were made by technicians from Evandro Chagas Institute to the health unit and samples were stored at -70ºC in the laboratory until use. HEp-2 and RD cell lines were used for viral isolation and neutralization with specific antisera for viral identification. RNA extraction was made using Trizol reagent. The RT-PCR was made in one step, and the total mixture (50 µL was composed of: RNA, reaction buffer, dNTP, primers, Rnase inhibitor, reverse transcriptase, Taq polymerase and water. The products were visualized in agarose gel stained with ethidium bromide, visualized under UV light. Among the 279 CSF samples examined, 30 (10.7% were EV positive, 29 being Echo 30 and one was Cox B. Nineteen Echo 30 were examined with RT-PCR; 18 tested positive (762 and 494 base pairs. The use of this technique permitted viral identification in less time than usual, which benefits the patient and is of importance for public-health interventions.

  10. DETECTION OF CLASSICAL SWINE FEVER VIRUS BY RT-PCR IN WEST BENGAL, INDIA

    Directory of Open Access Journals (Sweden)

    Sumit Chowdhury

    2016-12-01

    Full Text Available Classical swine fever is a deadly disease of swine, caused by a RNA virus. The present study has identified presence of the classical swine fever virus (CSFV in pigs of West Bengal by one step reverse transcriptase PCR (RT-PCR performed using 5’ NTR specific primers. Internal organs from clinically affected pigs were examined from three districts of West Bengal. RT-PCT has identified presence of CSFV in all the tissues examined confirming presence of CSFV in different parts of the state.

  11. Real-Time Measurement of Electronic Cigarette Aerosol Size Distribution and Metals Content Analysis.

    Science.gov (United States)

    Mikheev, Vladimir B; Brinkman, Marielle C; Granville, Courtney A; Gordon, Sydney M; Clark, Pamela I

    2016-09-01

    Electronic cigarette (e-cigarette) use is increasing worldwide and is highest among both daily and nondaily smokers. E-cigarettes are perceived as a healthier alternative to combustible tobacco products, but their health risk factors have not yet been established, and one of them is lack of data on aerosol size generated by e-cigarettes. We applied a real-time, high-resolution aerosol differential mobility spectrometer to monitor the evolution of aerosol size and concentration during puff development. Particles generated by e-cigarettes were immediately delivered for analysis with minimal dilution and therefore with minimal sample distortion, which is critically important given the highly dynamic aerosol/vapor mixture inherent to e-cigarette emissions. E-cigarette aerosols normally exhibit a bimodal particle size distribution: nanoparticles (11-25nm count median diameter) and submicron particles (96-175nm count median diameter). Each mode has comparable number concentrations (10(7)-10(8) particles/cm(3)). "Dry puff" tests conducted with no e-cigarette liquid (e-liquid) present in the e-cigarette tank demonstrated that under these conditions only nanoparticles were generated. Analysis of the bulk aerosol collected on the filter showed that e-cigarette emissions contained a variety of metals. E-cigarette aerosol size distribution is different from that of combustible tobacco smoke. E-cigarettes generate high concentrations of nanoparticles and their chemical content requires further investigation. Despite the small mass of nanoparticles, their toxicological impact could be significant. Toxic chemicals that are attached to the small nanoparticles may have greater adverse health effects than when attached to larger submicron particles. The e-cigarette aerosol size distribution is different from that of combustible tobacco smoke and typically exhibits a bimodal behavior with comparable number concentrations of nanoparticles and submicron particles. While vaping the e

  12. Sensitive real-time PCR detection of pathogenic Leptospira spp. and a comparison of nucleic acid amplification methods for the diagnosis of leptospirosis.

    Science.gov (United States)

    Waggoner, Jesse J; Balassiano, Ilana; Abeynayake, Janaki; Sahoo, Malaya K; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Vital-Brazil, Juliana Magalhães; Pinsky, Benjamin A

    2014-01-01

    Bacteria of the genus Leptospira, the causative agents of leptospirosis, are categorized into pathogenic and non-pathogenic species. However, the benefit of using a clinical diagnostic that is specific for pathogenic species remains unclear. In this study, we present the development of a real-time PCR (rtPCR) for the detection of pathogenic Leptospira (the pathogenic rtPCR), and we perform a comparison of the pathogenic rtPCR with a published assay that detects all Leptospira species [the undifferentiated febrile illness (UFI) assay] and a reference 16S Leptospira rtPCR, which was originally designed to detect pathogenic species. For the pathogenic rtPCR, a new hydrolysis probe was designed for use with primers from the UFI assay, which targets the 16S gene. The pathogenic rtPCR detected Leptospira DNA in 37/37 cultured isolates from 5 pathogenic and one intermediate species. Two strains of the non-pathogenic L. biflexa produced no signal. Clinical samples from 65 patients with suspected leptospirosis were then tested using the pathogenic rtPCR and a reference Leptospira 16S rtPCR. All 65 samples had tested positive for Leptospira using the UFI assay; 62 (95.4%) samples tested positive using the pathogenic rtPCR (p = 0.24). Only 24 (36.9%) samples tested positive in the reference 16S rtPCR (pLeptospira species in 49/50 cases, including 3 cases that were only detected using the UFI assay. The pathogenic rtPCR displayed similar sensitivity to the UFI assay when testing clinical specimens with no difference in specificity. Both assays proved significantly more sensitive than a real-time molecular test used for comparison. Future studies are needed to investigate the clinical and epidemiologic significance of more sensitive Leptospira detection using these tests.

  13. Modeling and analysis of real-time and embedded systems with UML and MARTE developing cyber-physical systems

    CERN Document Server

    Selic, Bran

    2013-01-01

    Modeling and Analysis of Real-Time and Embedded Systems with UML and MARTE explains how to apply the complex MARTE standard in practical situations. This approachable reference provides a handy user guide, illustrating with numerous examples how you can use MARTE to design and develop real-time and embedded systems and software. Expert co-authors Bran Selic and Sébastien Gérard lead the team that drafted and maintain the standard and give you the tools you need apply MARTE to overcome the limitations of cyber-physical systems. The functional sophistication required of modern cyber-physical

  14. Analysis of Real Time Technical Data Obtained While Shotcreting: An Approach Towards Automation

    OpenAIRE

    Rodríguez, Ángel; Río, Olga

    2010-01-01

    Automation of shotcreting process is a key factor in both improving the working conditions and increasing productivity; as well as in increasing the quality of shotcrete. The confidence in the quality of the automation process itself and shotcrete linings can be improved by real time monitoring of pumping as well as other shotcreting machine related parameters. Prediction of how the difIerent technical parameters of application are governing the whole process is being a subject of increasing ...

  15. A Schedulability Analysis Framework for Real-time Infrastructure Systems Managing Heterogeneous Resources

    OpenAIRE

    Kim, Jinhyun; Kang, Sungwon

    2012-01-01

    REACTION 2012. 1st International workshop on Real-time and distributed computing in emerging applications. December 4th, 2012, San Juan, Puerto Rico. Electricity generating systems, such as smart grid systems, and water management systems are infrastructure systems that manage resources critical to human life. In the systems, resources are produced and managed to supply them to various consumers, such as building, car, factory, and household, according to their needs and pri...

  16. Efficient Feasibility Analysis for Real-Time Systems with EDF Scheduling

    OpenAIRE

    Albers , Karsten; Slomka , Frank

    2005-01-01

    Submitted on behalf of EDAA (http://www.edaa.com/); International audience; This paper presents new fast exact feasibility tests for uniprocessor real-time systems using preemptive EDF scheduling. Task sets which are accepted by previously described sufficient tests will be evaluated in nearly the same time as with the old tests by the new algorithms. Many task sets are not accepted by the earlier tests despite them beeing feasible. These task sets will be evaluated by the new algorithms a lo...

  17. RCNF: Real-time Collaborative Network Forensic Scheme for Evidence Analysis

    OpenAIRE

    Moustafa, Nour; Slay, Jill

    2017-01-01

    Network forensic techniques help in tracking different types of cyber attack by monitoring and inspecting network traffic. However, with the high speed and large sizes of current networks, and the sophisticated philosophy of attackers, in particular mimicking normal behaviour and/or erasing traces to avoid detection, investigating such crimes demands intelligent network forensic techniques. This paper suggests a real-time collaborative network Forensic scheme (RCNF) that can monitor and inves...

  18. A Platform for Real-time Acquisition and Analysis of Physiological Data in Hospital Emergency Departments

    Science.gov (United States)

    2014-08-01

    with the Department of Emergency Medicine, Massachusetts General Hospital, Boston, MA 02114 USA (corresponding author; phone: 617 -726-2241; e-mail...programming interface ( API ). Algorithms are used to determine the reliability of waveform (e.g., electrocardiogram) and vital-sign data (e.g., heart rate...and comparing of real-time decision- support algorithms in mobile environments," Conf Proc IEEE Eng Med Biol Soc, vol. 2009 , pp. 3417-20, 2009 . [3

  19. MTF analysis of the MURR real-time neutron radiography facility

    International Nuclear Information System (INIS)

    Lindsay, J.T.

    1982-01-01

    In neutron radiography, as in other forms of NDE, it is sometimes desirable to observe dynamic events. This need has generated increased interest in real-time neutron radiography systems. As in other forms of radiography, a standard method for measuring the image forming capability of real-time systems is necessary in order to compare the various methods and systems used. A technique which has been used extensively in general photography and has been applied in the characterization of several screen-film combinations used in conventional neutron radiography is to determine the imaging system's modulation transfer function (MTF). This gives a graphical representation of the system's spatial resolution capabilities and was therefore chosen as the method for evaluation of the real-time neutron radiography facility at the University of Missouri Research Reactor (MURR). The method used was to image a knife-edge, differentiate the edge gradient to obtain the line spread function (LSF) to obtain the system MTF. A Gd foil was used for the knife-edge on several neutron converter screens and was imaged by a low-light level ISIT camera. The video signal was then digitized and presented to a PDP-11/05 microcomputer for the numerical calculations

  20. Selection of reference genes for expression analysis using quantitative real-time PCR in the pea aphid, Acyrthosiphon pisum (Harris (Hemiptera, Aphidiae.

    Directory of Open Access Journals (Sweden)

    Chunxiao Yang

    Full Text Available To facilitate gene expression study and obtain accurate qRT-PCR analysis, normalization relative to stable expressed housekeeping genes is required. In this study, expression profiles of 11 candidate reference genes, including actin (Actin, elongation factor 1 α (EF1A, TATA-box-binding protein (TATA, ribosomal protein L12 (RPL12, β-tubulin (Tubulin, NADH dehydrogenase (NADH, vacuolar-type H+-ATPase (v-ATPase, succinate dehydrogenase B (SDHB, 28S ribosomal RNA (28S, 16S ribosomal RNA (16S, and 18S ribosomal RNA (18S from the pea aphid Acyrthosiphon pisum, under different developmental stages and temperature conditions, were investigated. A total of four analytical tools, geNorm, Normfinder, BestKeeper, and the ΔCt method, were used to evaluate the suitability of these genes as endogenous controls. According to RefFinder, a web-based software tool which integrates all four above-mentioned algorithms to compare and rank the reference genes, SDHB, 16S, and NADH were the three most stable house-keeping genes under different developmental stages and temperatures. This work is intended to establish a standardized qRT-PCR protocol in pea aphid and serves as a starting point for the genomics and functional genomics research in this emerging insect model.

  1. Near-real-time Forensic Disaster Analysis: experiences from hurricane Sandy

    Science.gov (United States)

    Kunz, Michael; Mühr, Bernhard; Schröter, Kai; Kunz-Plapp, Tina; Daniell, James; Khazai, Bijan; Wenzel, Friedemann; Vannieuwenhuyse, Marjorie; Comes, Tina; Münzberg, Thomas; Elmer, Florian; Fohringer, Joachim; Lucas, Christian; Trieselmann, Werner; Zschau, Jochen

    2013-04-01

    Hurricane Sandy was the last tropical cyclone of the 2012 Northern Atlantic Hurricane season that made landfall. It moved on an unusual track from the Caribbean to the East Coast of the United States from 24 to 30 October as a Category 1 and 2 Hurricane according to the Saffir-Simpson Scale. Along its path, the severe storm event caused widespread damage including almost 200 fatalities. In the early hours of 30 October, Sandy made landfall near Atlantic City, N.J. Sandy was an extraordinary event due to its multihazard nature and several cascading effects in the aftermath. From the hydro-meteorological perspective, most unusual was the very large spatial extent of up to 1,700 km. High wind speeds were associated with record breaking storm surges at the U.S. Mid- Atlantic and New England Coast during high (astronomical) tide, leading to widespread flooding. Though Sandy was not the most severe storm event in terms of wind speed and precipitation, the impact in the U.S. was enormous with total damage estimates of up to 90 billion US (own estimate from Dec. 2012). Although much better data emerge weeks after such an event, the Forensic Disaster Analysis (FDA) Task Force of the Center for Disaster Management and Risk Reduction Technology (CEDIM) made an effort to obtain a comprehensive and holistic overview of the causes, hazardous effects and consequences associated with Sandy immediately after landfall at the U.S. coast on 30 October 2012. This was done in an interdisciplinary way by collecting and compiling scattered and distributed information from available databases and sources via the Internet, by applying own methodologies and models for near-real time analyses developed in recent years, and by expert knowledge. This contribution gives an overview about the CEDIM-FDA analyses' results. It describes the situation that led to the extraordinary event, highlights the interaction of the tropical cyclone with other hydro-meteorological events, and examines the

  2. Urethra-Sparing, Intraoperative, Real-Time Planned, Permanent-Seed Prostate Brachytherapy: Toxicity Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Zilli, Thomas [Department of Radiation Oncology, Centre hospitalier de l' Universite de Montreal-Hopital Notre-Dame, Montreal, QC (Canada); Taussky, Daniel, E-mail: daniel.taussky.chum@ssss.gouv.qc.ca [Department of Radiation Oncology, Centre hospitalier de l' Universite de Montreal-Hopital Notre-Dame, Montreal, QC (Canada); Donath, David; Le, Hoa Phong; Larouche, Renee-Xaviere; Beliveau-Nadeau, Dominique; Hervieux, Yannick; Delouya, Guila [Department of Radiation Oncology, Centre hospitalier de l' Universite de Montreal-Hopital Notre-Dame, Montreal, QC (Canada)

    2011-11-15

    Purpose: To report the toxicity outcome in patients with localized prostate cancer undergoing {sup 125}I permanent-seed brachytherapy (BT) according to a urethra-sparing, intraoperative (IO), real-time planned conformal technique. Methods and Materials: Data were analyzed on 250 patients treated consecutively for low- or intermediate-risk prostate cancer between 2005 and 2009. The planned goal was urethral V{sub 150} = 0. Acute and late genitourinary (GU), gastrointestinal (GI), and erectile toxicities were scored with the International Prostate Symptom Score (IPSS) questionnaire and Common Terminology Criteria for Adverse Events (version 3.0). Median follow-up time for patients with at least 2 years of follow-up (n = 130) was 34.4 months (range, 24-56.9 months). Results: Mean IO urethra V{sub 150} was 0.018% {+-} 0.08%. Mean prostate D{sub 90} and V{sub 100} on day-30 computed tomography scan were 158.0 {+-} 27.0 Gy and 92.1% {+-} 7.2%, respectively. Mean IPSS peak was 9.5 {+-} 6.3 1 month after BT (mean difference from baseline IPSS, 5.3). No acute GI toxicity was observed in 86.8% of patients. The 3-year probability of Grade {>=}2 late GU toxicity-free survival was 77.4% {+-} 4.0%, with Grade 3 late GU toxicity encountered in only 3 patients. Three-year Grade 1 late GI toxicity-free survival was 86.1% {+-} 3.2%. No patient presented Grade {>=}2 late GI toxicity. Of patients with normal sexual status at baseline, 20.7% manifested Grade {>=}2 erectile dysfunction after BT. On multivariate analysis, elevated baseline IPSS (p = 0.016) and high-activity sources (median 0.61 mCi) (p = 0.033) predicted increased Grade {>=}2 late GU toxicity. Conclusions: Urethra-sparing IO BT results in low acute and late GU toxicity compared with the literature. High seed activity and elevated IPSS at baseline increased long-term GU toxicity.

  3. On the relationship between fiscal plans in the European Union: An empirical analysis based on real-time data

    NARCIS (Netherlands)

    Giuliodori, M.; Beetsma, R.M.W.J.

    2007-01-01

    We investigate the interdependence of fiscal policies, and in particular deficits, in the European Union using an empirical analysis based on real-time fiscal data. There are many potential reasons why fiscal policies could be interdependent, such as direct externalities due to cross-border public

  4. On the relationship between fiscal plans in the European Union: an empirical analysis based on real-time data

    NARCIS (Netherlands)

    Giuliodori, M.; Beetsma, R.

    2008-01-01

    We investigate the interdependence of fiscal policies, and in particular deficits, in the European Union using an empirical analysis based on real-time fiscal data. There are many potential reasons why fiscal policies could be interdependent, such as direct externalities due to cross-border public

  5. Validation of putative reference genes for normalization of Q-RT-PCR data from paraffin-embedded lymphoid tissue

    DEFF Research Database (Denmark)

    Green, Tina Marie; de Stricker, Karin; Møller, Michael Boe

    2009-01-01

    Normalization of quantitative reverse transcription-PCR (Q-RT-PCR) data to appropriate tissue-specific reference genes is an essential part of interpreting the results. This study aimed to determine the most appropriate reference genes for normalizing gene expressions in lymphatic tissue...... was 0.93 (Pnormalization with the appropriate reference genes. Thus, we show that formalin-fixed, paraffin-embedded lymphoid samples are suitable for Q-RT-PCR when using thoroughly validated reference genes....

  6. A simple RT-PCR-based strategy for screening connexin identity

    Directory of Open Access Journals (Sweden)

    M. Urban

    1999-08-01

    Full Text Available Vertebrate gap junctions are aggregates of transmembrane channels which are composed of connexin (Cx proteins encoded by at least fourteen distinct genes in mammals. Since the same Cx type can be expressed in different tissues and more than one Cx type can be expressed by the same cell, the thorough identification of which connexin is in which cell type and how connexin expression changes after experimental manipulation has become quite laborious. Here we describe an efficient, rapid and simple method by which connexin type(s can be identified in mammalian tissue and cultured cells using endonuclease cleavage of RT-PCR products generated from "multi primers" (sense primer, degenerate oligonucleotide corresponding to a region of the first extracellular domain; antisense primer, degenerate oligonucleotide complementary to the second extracellular domain that amplify the cytoplasmic loop regions of all known connexins except Cx36. In addition, we provide sequence information on RT-PCR primers used in our laboratory to screen individual connexins and predictions of extension of the "multi primer" method to several human connexins.

  7. Strategy for the maximization of clinically relevant information from hepatitis C virus, RT-PCR quantification.

    LENUS (Irish Health Repository)

    Levis, J

    2012-02-03

    BACKGROUND: The increasing clinical application of viral load assays for monitoring viral infections has been an incentive for the development of standardized tests for the hepatitis C virus. OBJECTIVE: To develop a simple model for the prediction of baseline viral load in individuals infected with the hepatitis C virus. METHODOLOGY: Viral load quantification of each patient\\'s first sample was assessed by RT-PCR-ELISA using the Roche MONITOR assay in triplicate. Genotype of the infecting virus was identified by reverse line probe hybridization, using amplicons resulting from the qualitative HCV Roche AMPLICOR assay. RESULTS: Retrospective evaluation of first quantitative values suggested that 82.4% (n=168\\/204) of individuals had a viral load between 4.3 and 6.7 log(10) viral copies per ml. A few patients (3.4%; n=7\\/204) have a serum viremia less than the lower limit of the linear range of the RT-PCR assay. Subsequent, prospective evaluation of hepatitis C viral load of all new patients using a model based on the dynamic range of viral load in the retrospective group correctly predicted the dynamic range in 75.9% (n=33\\/54). CONCLUSION: The dynamic range of hepatitis C viremia extends beyond the linear range of the Roche MONITOR assay. Accurate determination of serum viremia is substantially improved by dilution of specimens prior to quantification.

  8. Evaluation of gamma-sterilization (60Co) by RT-PCR by DHFR expression detection

    International Nuclear Information System (INIS)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de; Vieira, Daniel P.

    2007-01-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a 60 Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  9. Evaluation of gamma-sterilization ({sup 60}Co) by RT-PCR by DHFR expression detection

    Energy Technology Data Exchange (ETDEWEB)

    Converso, Ana Paula G.; Andrade Junior, Heitor F. de [Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil)]. E-mail: anapaulagconverso@gmail.com; hfandrad@usp.br; Vieira, Daniel P. [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil); Instituto de Medicina Tropical de Sao Paulo, Sao Paulo, SP (Brazil); E-mail: dperezv@usp.br

    2007-07-01

    The improvement of techniques to detect pathogen agents in blood had reduced significantly the contamination mechanisms by hemocomponents in blood transfusion procedures. Ionizing radiation is a method that has presented several applications on medicine and in currently days has been showing special attention on blood banks which has been applied to avoid TA-GVHD development. DHFR is an enzyme constitutive in Plasmodium protozoa and has an important role in folate metabolism on these parasites. Detecting the expression of RNAm coder for this enzyme is possible to evaluate the viability of this parasite in blood samples. Plasmodium chabaudi AJ is a parasite that induces lethal malaria in rodents similar to human malaria In this work, the objective was to detect the presence of plasmodium protozoa in irradiated blood samples, infected experimentally, through the application of a RT-PCR using primers for the coder sequence of DHFR's mRNA. We studied doses of ionizing radiation between 0 and 75 Gy. The irradiation procedures were accomplished in Center of Radiation Technology of IPEN-CNEN in a {sup 60}Co panoramic source. Our results had demonstrated that RT-PCR is a sensible method to evaluate the viability of plasmodium in blood samples because the technique could detect low parasite burden in all tested samples. (author)

  10. Highly Specific Detection of Five Exotic Quarantine Plant Viruses using RT-PCR

    Directory of Open Access Journals (Sweden)

    Hoseong Choi

    2013-03-01

    Full Text Available To detect five plant viruses (Beet black scorch virus, Beet necrotic yellow vein virus, Eggplant mottled dwarf virus, Pelargonium zonate spot virus, and Rice yellow mottle virus for quarantine purposes, we designed 15 RT-PCR primer sets. Primer design was based on the nucleotide sequence of the coat protein gene, which is highly conserved within species. All but one primer set successfully amplified the targets, and gradient PCRs indicated that the optimal temperature for the 14 useful primer sets was 51.9°C. Some primer sets worked well regardless of annealing temperature while others required a very specific annealing temperature. A primer specificity test using plant total RNAs and cDNAs of other plant virus-infected samples demonstrated that the designed primer sets were highly specific and generated reproducible results. The newly developed RT-PCR primer sets would be useful for quarantine inspections aimed at preventing the entry of exotic plant viruses into Korea.

  11. Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

    International Nuclear Information System (INIS)

    Gebara, C.M.S.; Wosiachi, S.R.; Negrao, F.J.; Oliveira, D.B. de; Beloni, S.N.E.; Alfieri, A.A.; Alfieri, A.F.

    2004-01-01

    The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV) nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control) included 20 assymptomatic dogs. A c2 was used to test RT-PCR results according to clinical form and hematological characteristics. The RT-PCR was positive for CDV in 47% (41/87) of the urine samples from dogs with clinical signs. All samples from assymptomatic dogs were RT-PCR negatives. Positive samples were found in all groups of dogs with distemper symptoms according to the following propositions: 51.2% (21/41), 29% (11/37) and 100% (9/9) for groups A, B and C, respectively. In all clinical forms (groups A, B and C) leucocytosis was the most frequent observed hematological alteration. No relationship between RT-PCR results and hematological changes was observed. The results showed that independently of the clinical stage of the illness the RT-PCR based on urine sample can be applied for ante mortem diagnosis of CDV

  12. Unequal distribution of RT-PCR artifacts along the E1-E2 region of Hepatitis C virus.

    Science.gov (United States)

    Domingo-Calap, Pilar; Sentandreu, Vicente; Bracho, Maria Alma; González-Candelas, Fernando; Moya, Andrés; Sanjuán, Rafael

    2009-10-01

    Although viral variability studies have focused traditionally on consensus sequences, the relevance of molecular clone sequences for studying viral evolution at the intra-host level is being increasingly recognized. However, for this approach to be reliable, RT-PCR artifacts do not have to contribute excessively to the observed variability. Molecular clone sequences were obtained from an in vitro transcript to estimate the maximum error rate associated to RT-PCR for the Hepatitis C virus (HCV) E1-E2 region. On average, the frequency of RT-PCR errors was one order of magnitude lower than the level of intra-host genetic variability observed in samples from an HCV outbreak. However, RT-PCR errors were not distributed evenly along the E1-E2 region and were concentrated heavily in the hypervariable region 2 (HVR 2). Although it is concluded that RT-PCR molecular clone sequences are reliable, these results warn against extrapolation of RT-PCR error rates to different genome regions. The data suggest that the RNA sequence context or secondary structure can determine the fidelity of in vitro transcription or reverse transcription. Potentially, these factors might also modify the fidelity of the viral polymerase.

  13. Real Time Processing

    CERN Multimedia

    CERN. Geneva; ANDERSON, Dustin James; DOGLIONI, Caterina

    2015-01-01

    The LHC provides experiments with an unprecedented amount of data. Experimental collaborations need to meet storage and computing requirements for the analysis of this data: this is often a limiting factor in the physics program that would be achievable if the whole dataset could be analysed. In this talk, I will describe the strategies adopted by the LHCb, CMS and ATLAS collaborations to overcome these limitations and make the most of LHC data: data parking, data scouting, and real-time analysis.

  14. Análise de citocinas pela RT-PCR em pacientes com rinite alérgica RT-PCR cytokine study in patients with allergic rhinitis

    Directory of Open Access Journals (Sweden)

    Tarcimara Moreira da Silva

    2009-02-01

    Full Text Available Rinite alérgica é uma doença que decorre de um processo inflamatório da mucosa nasal conseqüente à reação de hipersensibilidade a alérgenos inalatórios e, eventualmente, alimentares. É mediada por IgE, envolvendo diferentes células, mediadores e citocinas. OBJETIVO: Avaliar as transcrições para as seguintes citocinas: IL-4, IL-5, IL-8 e IFN-gama, particularmente importantes no processo alérgico nasal, principalmente IL-4 e IL-5. Neste estudo, optou-se por avaliar os pacientes atópicos fora das crises alérgicas, com a finalidade de se conhecer as expressões das citocinas neste período. MATERIAL E MÉTODO: Realizou-se um estudo transversal e prospectivo, selecionando-se 30 pacientes, sendo 13 pacientes portadores de rinite alérgica paucissintomáticos e 17 pacientes não-atópicos. Os grupos foram selecionados através da história, do exame clínico otorrinolaringológico e do teste alérgico cutâneo - Prick Test. O perfil das citocinas foi pesquisado nos fragmentos de mucosa nasal, através da RT-PCR semiquantitativa, escolhida por apresentar boa reprodutibilidade e especificidade, utilizando-se como referência o gene da Beta-actina. RESULTADOS: Os valores de IL-5, IL-8, IFN-gama mantiveram-se homogêneos em relação ao grupo controle. A IL-4 apresentou diferença com significância estatística. CONCLUSÃO: Os pacientes alérgicos paucissintomáticos apresentaram normalização da expressão das citocinas na mucosa nasal à exceção de IL-4.Allergic rhinitis is an inflammatory reaction of the nasal mucosa, in consequence of an IgE mediated hypersensitive reaction to inhaling allergens, involving different mediators and cytokine cells. AIM: The purpose of this study was to evaluate the transcriptions for IL-4, IL-5, IL-8 and IFN-gama, particularly important in the nasal allergy process, especially IL-4 and IL-5. For this study we decided to evaluate atopic patients who were free from allergic crises, with the purpose of

  15. Simulation and real-time analysis of pulse shapes from segmented HPGe-detectors

    Energy Technology Data Exchange (ETDEWEB)

    Schlarb, Michael Christian

    2009-11-17

    The capabilities of future HPGe arrays consisting of highly segmented detectors, like AGATA will depend heavily on the performance of {gamma}-ray tracking. The most crucial component in the whole concept is the pulse shape analysis (PSA). The working principle of PSA is to compare the experimental signal shape with signals available from a basis set with known interaction locations. The efficiency of the tracking algorithm hinges on the ability of the PSA to reconstruct the interaction locations accurately, especially for multiple {gamma}-interactions. Given the size of the arrays the PSA algorithm must be run in a real-time environment. A prerequisite to a successful PSA is an accurate knowledge of the detectors response. Making a full coincidence scan of a single AGATA detector, however takes between two and three months, which is too long to produce an experimental signal basis for all detector elements. A straight forward possibility is to use a precise simulation of the detector and to provide a basis of simulated signals. For this purpose the Java Agata Signal Simulation (JASS) was developed in the course of this thesis. The geometry of the detector is given with numerical precision and models describing the anisotropic mobilities of the charge carriers in germanium were taken from the literature. The pulse shapes of the transient and net-charge signals are calculated using weighting potentials on a finite grid. Special care was taken that the interpolation routine not only reproduces the weighting potentials precisely in the highly varying areas of the segment boundaries but also that its performance is independent of the location within the detector. Finally data from a coincidence scan and a pencil beam experiment were used to verify JASS. The experimental signals are reproduced accurately by the simulation. Pulse Shape Analysis (PSA) reconstructs the positions of the individual interactions and the corresponding energy deposits within the detector. This

  16. Simulation and real-time analysis of pulse shapes from segmented HPGe-detectors

    International Nuclear Information System (INIS)

    Schlarb, Michael Christian

    2009-01-01

    The capabilities of future HPGe arrays consisting of highly segmented detectors, like AGATA will depend heavily on the performance of γ-ray tracking. The most crucial component in the whole concept is the pulse shape analysis (PSA). The working principle of PSA is to compare the experimental signal shape with signals available from a basis set with known interaction locations. The efficiency of the tracking algorithm hinges on the ability of the PSA to reconstruct the interaction locations accurately, especially for multiple γ-interactions. Given the size of the arrays the PSA algorithm must be run in a real-time environment. A prerequisite to a successful PSA is an accurate knowledge of the detectors response. Making a full coincidence scan of a single AGATA detector, however takes between two and three months, which is too long to produce an experimental signal basis for all detector elements. A straight forward possibility is to use a precise simulation of the detector and to provide a basis of simulated signals. For this purpose the Java Agata Signal Simulation (JASS) was developed in the course of this thesis. The geometry of the detector is given with numerical precision and models describing the anisotropic mobilities of the charge carriers in germanium were taken from the literature. The pulse shapes of the transient and net-charge signals are calculated using weighting potentials on a finite grid. Special care was taken that the interpolation routine not only reproduces the weighting potentials precisely in the highly varying areas of the segment boundaries but also that its performance is independent of the location within the detector. Finally data from a coincidence scan and a pencil beam experiment were used to verify JASS. The experimental signals are reproduced accurately by the simulation. Pulse Shape Analysis (PSA) reconstructs the positions of the individual interactions and the corresponding energy deposits within the detector. This is

  17. Impact Analysis of Land Use on Traffic Congestion Using Real-Time Traffic and POI

    OpenAIRE

    Zhang, Tianqi; Sun, Lishan; Yao, Liya; Rong, Jian

    2017-01-01

    This paper proposed a new method to describe, compare, and classify the traffic congestion points in Beijing, China, by using the online map data and further revealed the relationship between traffic congestion and land use. The data of the point of interest (POI) and the real-time traffic was extracted from an electronic map of the area in the fourth ring road of Beijing. The POIs were quantified based on the architectural area of the land use; the congestion points were identified based on ...

  18. Real-time analysis and display of reactor system mass inventory

    International Nuclear Information System (INIS)

    Dao, L.T.; Meachum, T.R.

    1982-01-01

    A mass