WorldWideScience

Sample records for reactor g1 mesure

  1. Neutron measurements in the core and blankets of the reactor Rapsodie; Mesures neutroniques dans le coeur et les couvertures de Rapsodie

    Energy Technology Data Exchange (ETDEWEB)

    Gourdon, J.; Edeline, J.C. [Commissariat a l' Energie Atomique, 13 - Cadarache (France). Centre d' Etudes Nucleaires

    1968-07-01

    Beside a brief general discussion, the report contains all the core and blanket neutronic measurements. It covers successively the methods, the measurements themselves and the results. The later concern: spectral indexes, axial and radial fission rates, activation foil measurements and neutronic power determination. (authors) [French] Apres une breve description generale de RAPSODIE, le rapport presente l'ensemble des mesures neutroniques faites dans le coeur et les couvertures. Il traite dans l'ordre des methodes, des mesures et enfin des resultats qui concernent: les indices de spectres, les taux de fission axiaux et radiaux, les mesures par detecteurs par activation, la determination de la puissance, neutronique. (auteurs)

  2. Recent progress in the detection of bursts in the canning in French reactors; Progres recents de la detection des ruptures de gaines dans les reacteurs francais G1, EL2, G3, EL3

    Energy Technology Data Exchange (ETDEWEB)

    Goupil, J.; Grenon, M.; Raffailhac, J.; Roguin, A. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1959-07-01

    electrostatic collecting method. A scintillator and an electronic system provide a specific signal of the fission products which is then marked on a recorder. In a case where the activity threshold is exceeded, the cell involved is isolated from the prospection system and taker, over by a 'follow-up' detector which follows the evolution of the crack. A year of working on the pile G{sub 1}, which is cooled by air at atmospheric pressure, has made it possible to obtain results on the operation of the canning-burst detection appliance, which has led us to perfect the original device by installing an 'evolution-meter' of the type described above for G{sub 3}. The reactor EL{sub 3}, cooled by heavy water, uses a detection system based on the measurement by GM counters of the activity of the fission gases carried by diluted helium into the heavy water, then extracted by hydro-cyclones. The selectivity of the system gives it a low sensitivity to parasite activities, and an excellent performance. (author) [French] Dans les piles refroidies par gaz carbonique sous pression, du type G{sub 3}, la radioactivite principale du gaz est celle de l'azote 16 creee par reaction {sup 16}O(n, p) {sup 16}N des neutrons rapides sur l'oxygene. Cette activite, de vie courte et de forte energie {beta}, masque l'activite des gaz de fission s'echappant par une fissure de gaine dans le gaz carbonique et oblige a utiliser une methode de separation materielle des produits de fission solides avant la detection proprement dite. Cette detection est faite par une chaine electronique speciale dont l'entree est un scintillateur associe a un photomultiplicateur. Un systeme de mesure d'evolution de fissure avec compensation des variations de puissance permet de suivre la vitesse d'evolution d'une fissure. Cet appareil, baptise evolumetre, est destine a ramener a une methode de zero la mesure de l'activite du gaz de refroidissement des canaux, il permet

  3. Measurement of the power and of the period of a nuclear reactor using a simultaneously linear and logarithmic channel; Mesure de la puissance et de la periode d'un reacteur nucleaire a l'aide d'une chaine simultanement lineaire et logarithmique

    Energy Technology Data Exchange (ETDEWEB)

    Feghahati, E.E.D. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1967-07-01

    A simultaneously logarithmic and linear channel for measuring the power of a nuclear reactor using a single detector has been developed. It consists of a linear element and of a logarithmic element in the counter-reaction circuit of the measurement amplifier. The operation of this channel appears to be perfectly satisfactory. It can be connected to a period meter. The range of the logarithmic measurement extends from 10{sup -10} to 1O{sup -4} A and that of the linear measurement from 10{sup -9} to 10{sup -3} A. It will be possible to extend the linear measurement to 10{sup -10} A. (author) [French] Une chaine de mesure, simultanement lineaire et logarithmique, de la puissance d'un reacteur nucleaire a partir d'un seul detecteur, a ete etudiee et realisee. Elle comporte un element lineaire et un element logarithmique dans le circuit de contre-reaction de l'amplificateur de mesure. Le fonctionnement parait parfaitement satisfaisant. Elle peut etre reliee a un periodimetre. La gamme de la mesure logarithmique s'etend de 10{sup -10} A a 10{sup -4} A et celle de la mesure lineaire de 10{sup -9} A a 10{sup -3} A. Une extension de la mesure lineaire a 10{sup -10} A est possible. (auteur)

  4. Measurement of neutrinos released in nuclear reactors through the Borexino experiment; Mesure des neutrinos de reacteurs nucleaires dans l'experience Borexino

    Energy Technology Data Exchange (ETDEWEB)

    Dadoun, O

    2003-06-01

    The main goal of the Borexino experiment is to measure in real time the solar neutrino flux from the beryllium (Be{sup 7}) line at 862 keV. Beyond this pioneer low energy neutrino detection, Borexino will be able to measure solar neutrinos above the MeV, (B{sup 8} neutrinos and pep neutrinos), nuclear reactor neutrinos (with an average energy of 3 MeV) and the supernova neutrinos (their spectrum goes up to some ten MeV). In this work I mainly focus on the study of the nuclear reactors neutrinos. This field has recently been enriched by the results of the KamLAND experiment, which have greatly improved the determination of the neutrino oscillation parameters. In order to measure these events which are above the MeV, the Borexino collaboration entrusted the PCC group at College de France, with the tasks of developing a fast digit system running at 400 MHz: the FADC cards. The PCC group designed the FADC cards and completed them at the beginning of 2002. The first cards which were introduced in the main electronic acquisition unit allowed us to control their functioning and that of the acquisition software. FADC cards were also installed in the Borexino prototype, CTF. The data are analysed in order to determine a limit to the expected background noise of Borexino in measuring the nuclear reactor neutrinos. (author)

  5. La mesure du danger

    CERN Document Server

    Manceron, Vanessa; Revet, Sandrine

    2014-01-01

    La mesure du danger permet d’explorer des dangers de nature aussi diverse que la délinquance, la pollution, l’écueil maritime, la maladie ou l’attaque sorcellaire, l’extinction d’espèces animales ou végétales, voire de la Planète tout entière. Au croisement de la sociologie, de l’anthropologie et de l’histoire, les différents articles analysent les pratiques concrètes de mesure pour tenter de comprendre ce qui se produit au cours de l’opération d’évaluation du danger sans préjuger de la nature de celui-ci. L’anthropologie a contribué à la réflexion sur l’infortune en s’intéressant aux temporalités de l’après : maladies, catastrophes, pandémies, etc. et en cherchant à rendre compte de l’expérience des victimes, de leur vie ordinaire bouleversée, de la recomposition du quotidien. Elle s’intéresse aussi aux autres types de mesures, les savoirs incorporés, qui reposent sur l’odorat, la vue ou le toucher et ceux qui ressortent d’une épistémologie « non ...

  6. Instruments de mesure en acoustique

    DEFF Research Database (Denmark)

    Tarnov, Viggo; Jacobsen, Finn

    2008-01-01

    La mesure en acoustique fait appel à des instruments qui mesurent, d'une part la pression, d'autre part l'intensité du signal. Ce dossier présentera, notamment, deux appareils spécialisés : les sonomètres et les microphones. Il abordera l'ensemble des informations majeures à connaître sur les...

  7. Contribution to development of SPNDs for instantaneous and selective measurement of different radiation fields in nuclear reactors; Contribution au developpement de collectrons pour la mesure instantanee et selective des differents champs de rayonnements en reacteurs nucleaires

    Energy Technology Data Exchange (ETDEWEB)

    Blandin, Christophe [Institut National Polytechnique, 38 - Grenoble (France)

    1998-02-20

    The objective of this work was conceiving and experimentally optimizing the SPNDs (Self-Powdered Neutron Detector) able to control fast power transients in test reactors and also to cope with requirements of surveillanceand protection of EDF reactors. Thus, different SPND emitters of platinum, gadolinium, hafnium and cobalt were provided according to their nature with sheathing and stainless steel plugs as well as with zirconium over-sheathing in order to render them faster, more selective and adapted for wear checking. Special experimental devices were designed for measuring inside the Siloe reactor the promptness of the signals from SPND, on one hand, and their sensitivity to thermal and epithermal neutrons as well as to gamma rays, on the other hand. The follow-up of power transients in test reactors is ensured by the instantaneous measurement of thermal and epithermal neutron flux as well as of gamma field by means of three special SPND with gadolinium, hafnium and platinum. Also, we have defined the characteristics of a new SPND with cobalt, that delivers a current of unique neutronic origin, able to ensure the surveillance and protection of a power reactor over a period of at least six years.

  8. MESURE DE LA PERFORMANCE GLOBALE DES ENTREPRISES

    OpenAIRE

    Renaud, Angèle; Berland, Nicolas

    2007-01-01

    International audience; L'engagement des entreprises dans le développement durable consiste à conjuguer performance et responsabilité. La performance financière ne suffit plus à apprécier la performance d'une entreprise. Dès lors, les entreprises doivent mesurer leurs progrès à partir d'une performance plus globale incluant, en dehors de la dimension économique, des dimensions sociale et environnementale. A présent, comment mesurer cette performance globale ? Existe-il des outils de mesure gl...

  9. The aging of equipment in service: Preventive measures taken in the design of the EPR reactor; Le vieillissement des materiaux en service mesures preventives prises pour la conception du reacteur EPR

    Energy Technology Data Exchange (ETDEWEB)

    Lefrancois, A. [AREVA NP, Dept. Materiaux, Technologie et Chimie, 92 - Paris la Defense (France)

    2009-07-15

    The design of a new Pressurized Water Reactor (PWR) has to take into account past experience, and in particular the lessons drawn from aging of components already in operation. The benefit of this process for tong term operation can be exceptionally high in the case of an evolutionary design such as that of the EPR{sup TM} reactor, for which the materials and the manufacturing conditions are the result of a very Long term optimization. Aging of materials in operation encompasses several damages, from the embrittlement caused by irradiation or thermal aging to the generation of cracks by fatigue or corrosion. These damages are known and characterized through international field experience and through a Cot of Laboratory studies performed worldwide, in France mainly by EDF, Cea and AREVA NP. Even if some damage mechanisms are not fully understood, good practice rules or empirical models were developed in order to give accurate predictions of damage kinetics and consequences. All this experience was taken into account during the design phase of the EPR{sup TM} project to define mate-rials and/or service conditions allowing to prevent or to minimize aging. (author)

  10. Resolving Multiple Stellar Populations in G1

    Science.gov (United States)

    Gregg, Michael

    2017-08-01

    The most luminous and massive compact stellar system in the Local Group is G1, a satellite of M31. It has been speculated that G1 is the remnant nucleus of a tidally stripped dwarf elliptical galaxy. As such, G1 is key to understanding both the evolution of dwarf galaxies and the hierarchical assembly of bright spirals. Recently, new U-B-V-I broad band imaging techniques have revealed multiple stellar populations in Milky Way globular clusters. We propose to obtain new deep WFC3/UVIS F336W and F814W images, to be combined with archival WFC3 data, to probe the star formation and enrichment history of G1. This study will yield new and definitive insights into the origin and evolution of G1, the relationship of globular clusters to dwarf galaxies, and the formation of luminous spirals like M31 and the Milky Way.

  11. MESUR: metrics from scholarly usage of resources

    CERN Multimedia

    CERN. Geneva

    2007-01-01

    The MESUR project is constructing a large-scale semantic model of the scholarly community that seamlessly integrates a wide range of bibliographic, citation and usage data. Functioning as a reference data set, this model is analyzed to characterize the intricate networks of typed relationships that exist in the scholarly community. The resulting ...

  12. MESUR metrics from scholarly usage of resources

    CERN Document Server

    CERN. Geneva; Van de Sompel, Herbert

    2007-01-01

    Usage data is increasingly regarded as a valuable resource in the assessment of scholarly communication items. However, the development of quantitative, usage-based indicators of scholarly impact is still in its infancy. The Digital Library Research & Prototyping Team at the Los Alamos National Laboratory's Research library has therefore started a program to expand the set of usage-based tools for the assessment of scholarly communication items. The two-year MESUR project, funded by the Andrew W. Mellon Foundation, aims to define and validate a range of usage-based impact metrics, and issue guidelines with regards to their characteristics and proper application. The MESUR project is constructing a large-scale semantic model of the scholarly community that seamlessly integrates a wide range of bibliographic, citation and usage data. Functioning as a reference data set, this model is analyzed to characterize the intricate networks of typed relationships that exist in the scholarly community. The resulting c...

  13. Peut-on mesurer la science ?

    OpenAIRE

    Lichtfouse, Eric

    2013-01-01

    Peut-on mesurer la science ? Il n'y a pas de réponse simple à cette question car la valeur, l'impact, les bénéfices fondamentaux ou appliqués d'une découverte sont subjectives et dépendent étroitement du contexte. A cet égard je donne souvent cet exemple dans mes cours de rédaction et communication scientifique : la découverte d'une nouvelle espèce végétale publiée dans une obscure revue de botanique va probablement passer inaperçue et sera donc peu citée. Par contre, si cette plante accumule...

  14. Evaluation des incertitudes de mesure sur le banc à rouleaux

    OpenAIRE

    BEILS, S

    2003-01-01

    Le but de cette étude est de déterminer l'incertitude des mesures d'émissions des polluants en g/km sur le dispositif expérimental du banc à rouleaux. L'étude porte sur les mesures d'émissions moyennes avec une attention particulière pour le dioxyde de carbone. L'objectif est de quantifier l'influence de chaque élément de la chaîne de mesure et de déterminer les causes réelles de la dispersion des mesures constatée. Après une approche statistique du problème, on procède à une mise en équation...

  15. 26 CFR 1.475(g)-1 - Effective dates.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 6 2010-04-01 2010-04-01 false Effective dates. 1.475(g)-1 Section 1.475(g)-1...) INCOME TAXES Inventories § 1.475(g)-1 Effective dates. (a)-(b) (c) Section 1.475(a)-3 (concerning... to apply to the security solely because of the effective dates in this paragraph (d) (rather than...

  16. Les tentations de la bibliométrie : mesure et démesure

    Directory of Open Access Journals (Sweden)

    Denise Pumain

    2004-09-01

    Full Text Available Ecrire pour être lu, s’afficher sur la toile pour être vu, et puis mesurer son audience. Tout nous y invite désormais, si l’on en juge la place consacrée aux palmarès des citations par le numéro spécial des Papers in Regional Science qui fêtait en ce début d’année 2004 les 50 ans de cette Association bien connue des géographes, jusqu’aux initiatives prises en France par le CNRS et pour l’Europe par la Fondation Européenne pour la Science, afin de créer un système de référence et d’évaluation ...

  17. Reduced hepatic tumor incidence in cyclin G1-deficient mice

    DEFF Research Database (Denmark)

    Jensen, Michael Rugaard; Factor, Valentina M; Fantozzi, Anna

    2003-01-01

    Cyclin G1 is a transcriptional target of the tumor suppressor p53, and its expression is increased after DNA damage. Recent data show that cyclin G1 can regulate the levels of p53 by a mechanism that involves dephosphorylation of Mdm2 by protein phosphatase 2A. To understand the biologic role...

  18. Rapid biodegradation of organophosphorus pesticides by Stenotrophomonas sp. G1

    Energy Technology Data Exchange (ETDEWEB)

    Deng, Shuyan; Chen, Yao [Key Laboratory of Agri-food Safety of Anhui Province, Lab of Quality & Safety and Risk Assessment for Agro-products on Storage and Preservation (Hefei), Ministry of Agriculture, School of Resource and Environment, Anhui Agricultural University, Hefei 230036 (China); Wang, Daosheng [School of Life Science, Anhui Agricultural University, Hefei 230036 (China); Shi, Taozhong; Wu, Xiangwei; Ma, Xin; Li, Xiangqiong [Key Laboratory of Agri-food Safety of Anhui Province, Lab of Quality & Safety and Risk Assessment for Agro-products on Storage and Preservation (Hefei), Ministry of Agriculture, School of Resource and Environment, Anhui Agricultural University, Hefei 230036 (China); Hua, Rimao, E-mail: rimaohua@ahau.edu.cn [Key Laboratory of Agri-food Safety of Anhui Province, Lab of Quality & Safety and Risk Assessment for Agro-products on Storage and Preservation (Hefei), Ministry of Agriculture, School of Resource and Environment, Anhui Agricultural University, Hefei 230036 (China); Tang, Xinyun [School of Life Science, Anhui Agricultural University, Hefei 230036 (China); Li, Qing X. [Department of Molecular Biosciences and Bioengineering, University of Hawaii at Manoa, 1955 East–West Road, Honolulu, HI 957822 (United States)

    2015-10-30

    Highlights: • Stenotrophomonas sp. G1 was isolated from chlorpyrifos contaminated sludge. • Strain G1 is closest to Stenotrophomonas acidaminiphila. • Strain G1 can efficiently degrade 8 organophosphorus pesticides (OPs). • Intracellular methyl parathion hydrolase is responsible for the OP degradation. • Three factors were orthogonally optimized for degradation of methyl parathion. - Abstract: Organophosphorus insecticides have been widely used, which are highly poisonous and cause serious concerns over food safety and environmental pollution. A bacterial strain being capable of degrading O,O-dialkyl phosphorothioate and O,O-dialkyl phosphate insecticides, designated as G1, was isolated from sludge collected at the drain outlet of a chlorpyrifos manufacture plant. Physiological and biochemical characteristics and 16S rDNA gene sequence analysis suggested that strain G1 belongs to the genus Stenotrophomonas. At an initial concentration of 50 mg/L, strain G1 degraded 100% of methyl parathion, methyl paraoxon, diazinon, and phoxim, 95% of parathion, 63% of chlorpyrifos, 38% of profenofos, and 34% of triazophos in 24 h. Orthogonal experiments showed that the optimum conditions were an inoculum volume of 20% (v/v), a substrate concentration of 50 mg/L, and an incubation temperature in 40 °C. p-Nitrophenol was detected as the metabolite of methyl parathion, for which intracellular methyl parathion hydrolase was responsible. Strain G1 can efficiently degrade eight organophosphorus pesticides (OPs) and is a very excellent candidate for applications in OP pollution remediation.

  19. Les mesures de métrologie pour le CLIC

    CERN Document Server

    Cherif, A

    2008-01-01

    Le projet CLIC est en tout point un défi technique majeur ; c?est le cas également pour la mesure dimensionnelle. Quels sont les équipements et les méthodes qui permettent de caractériser les pièces avec une incertitude de mesure aussi réduite que possible, vu les tolérances micrométriques imposées ? Afin de répondre à cette question, une veille technologique a été maintenue sur une longue période. Les acteurs relevants ont été contactés pour bénéficier d?une ouverture sur les dernières avancées dans le domaine. Différentes techniques ont été étudiées et comparées telles que la digitalisation, la tomographie X, la mesure tridimensionnelle. L'assemblage de haute précision des composants est aussi primordial. Sa mise en ?uvre sous un microscope optique ou à l'aide d'une machine tridimensionnelle est en cours d?étude. L'exposé traitera aussi de la mesure de rugosité, un domaine où nous disposons de moyens adaptés aux exigences spécifiques du projet.

  20. Tolerance of Deregulated G1/S Transcription Depends on Critical G1/S Regulon Genes to Prevent Catastrophic Genome Instability

    Directory of Open Access Journals (Sweden)

    Catia Caetano

    2014-12-01

    Full Text Available Expression of a G1/S regulon of genes that are required for DNA replication is a ubiquitous mechanism for controlling cell proliferation; moreover, the pathological deregulated expression of E2F-regulated G1/S genes is found in every type of cancer. Cellular tolerance of deregulated G1/S transcription is surprising because this regulon includes many dosage-sensitive proteins. Here, we used the fission yeast Schizosaccharomyces pombe to investigate this issue. We report that deregulating the MBF G1/S regulon by eliminating the Nrm1 corepressor increases replication errors. Homology-directed repair proteins, including MBF-regulated Ctp1CtIP, are essential to prevent catastrophic genome instability. Surprisingly, the normally inconsequential MBF-regulated S-phase cyclin Cig2 also becomes essential in the absence of Nrm1. This requirement was traced to cyclin-dependent kinase inhibition of the MBF-regulated Cdc18Cdc6 replication origin-licensing factor. Collectively, these results establish that, although deregulation of G1/S transcription is well tolerated by cells, nonessential G1/S target genes become crucial for preventing catastrophic genome instability.

  1. M/G/1 with Exceptional Service and Arrival Rate

    Science.gov (United States)

    1988-10-31

    The model M/G/1 is modified by 1) providing the pioneer customer, i. e. the customer who terminates an idle period (an initiates a busy period) with...distinguish between the perception of the observer and of the customer source. Keywords: Stochastic models.

  2. 26 CFR 1.167(g)-1 - Basis for depreciation.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Basis for depreciation. 1.167(g)-1 Section 1.167... for depreciation. The basis upon which the allowance for depreciation is to be computed with respect... property at that time, is the basis for computing depreciation. ...

  3. Evaluation de la mise en oeuvre des mesures de radioprotection ...

    African Journals Online (AJOL)

    Seulement 08.1% des services faisaient une surveillance médicale de leur personnel. Conclusion : Le niveau de mise en oeuvre des mesures de radioprotection des travailleurs dans les services de radiologie reste à améliorer et la création d'une autorité de réglementation est souhaitable pour une meilleure protection ...

  4. Identification of waiting time distribution of M/G/1, Mx/G/1, GIr/M/1 queueing systems

    Directory of Open Access Journals (Sweden)

    A. Ghosal

    1988-01-01

    Full Text Available This paper brings out relations among the moments of various orders of the waiting time of the 1st customer and a randomly selected customer of an arrival group for bulk arrivals queueing models, and as well as moments of the waiting time (in queue for M/G/1 queueing system. A numerical study of these relations has been developed in order to find the (β1,β2 measures of waiting time distribution in a comutable form. On the basis of these measures one can look into the nature of waiting time distribution of bulk arrival queues and the single server M/G/1 queue.

  5. H Reactor

    Data.gov (United States)

    Federal Laboratory Consortium — The H Reactor was the first reactor to be built at Hanford after World War II.It became operational in October of 1949, and represented the fourth nuclear reactor on...

  6. Reactor Physics

    Energy Technology Data Exchange (ETDEWEB)

    Ait Abderrahim, A

    2001-04-01

    The Reactor Physics and MYRRHA Department of SCK-CEN offers expertise in various areas of reactor physics, in particular in neutronics calculations, reactor dosimetry, reactor operation, reactor safety and control and non-destructive analysis of reactor fuel. This expertise is applied in the Department's own research projects in the VENUS critical facility, in the BR1 reactor and in the MYRRHA project (this project aims at designing a prototype Accelerator Driven System). Available expertise is also used in programmes external to the Department such as the reactor pressure steel vessel programme, the BR2 reactor dosimetry, and the preparation and interpretation of irradiation experiments by means of neutron and gamma calculations. The activities of the Fuzzy Logic and Intelligent Technologies in Nuclear Science programme cover several domains outside the department. Progress and achievements in these topical areas in 2000 are summarised.

  7. MESUR: USAGE-BASED METRICS OF SCHOLARLY IMPACT

    Energy Technology Data Exchange (ETDEWEB)

    BOLLEN, JOHAN [Los Alamos National Laboratory; RODRIGUEZ, MARKO A. [Los Alamos National Laboratory; VAN DE SOMPEL, HERBERT [Los Alamos National Laboratory

    2007-01-30

    The evaluation of scholarly communication items is now largely a matter of expert opinion or metrics derived from citation data. Both approaches can fail to take into account the myriad of factors that shape scholarly impact. Usage data has emerged as a promising complement to existing methods o fassessment but the formal groundwork to reliably and validly apply usage-based metrics of schlolarly impact is lacking. The Andrew W. Mellon Foundation funded MESUR project constitutes a systematic effort to define, validate and cross-validate a range of usage-based metrics of schlolarly impact by creating a semantic model of the scholarly communication process. The constructed model will serve as the basis of a creating a large-scale semantic network that seamlessly relates citation, bibliographic and usage data from a variety of sources. A subsequent program that uses the established semantic network as a reference data set will determine the characteristics and semantics of a variety of usage-based metrics of schlolarly impact. This paper outlines the architecture and methodology adopted by the MESUR project and its future direction.

  8. Reactor safeguards

    CERN Document Server

    Russell, Charles R

    1962-01-01

    Reactor Safeguards provides information for all who are interested in the subject of reactor safeguards. Much of the material is descriptive although some sections are written for the engineer or physicist directly concerned with hazards analysis or site selection problems. The book opens with an introductory chapter on radiation hazards, the construction of nuclear reactors, safety issues, and the operation of nuclear reactors. This is followed by separate chapters that discuss radioactive materials, reactor kinetics, control and safety systems, containment, safety features for water reactor

  9. Reactor operation

    CERN Document Server

    Shaw, J

    2013-01-01

    Reactor Operation covers the theoretical aspects and design information of nuclear reactors. This book is composed of nine chapters that also consider their control, calibration, and experimentation.The opening chapters present the general problems of reactor operation and the principles of reactor control and operation. The succeeding chapters deal with the instrumentation, start-up, pre-commissioning, and physical experiments of nuclear reactors. The remaining chapters are devoted to the control rod calibrations and temperature coefficient measurements in the reactor. These chapters also exp

  10. Research Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Martens, Frederick H. [Argonne National Laboratory; Jacobson, Norman H.

    1968-09-01

    This booklet discusses research reactors - reactors designed to provide a source of neutrons and/or gamma radiation for research, or to aid in the investigation of the effects of radiation on any type of material.

  11. CONVECTION REACTOR

    Science.gov (United States)

    Hammond, R.P.; King, L.D.P.

    1960-03-22

    An homogeneous nuclear power reactor utilizing convection circulation of the liquid fuel is proposed. The reactor has an internal heat exchanger looated in the same pressure vessel as the critical assembly, thereby eliminating necessity for handling the hot liquid fuel outside the reactor pressure vessel during normal operation. The liquid fuel used in this reactor eliminates the necessity for extensive radiolytic gas rocombination apparatus, and the reactor is resiliently pressurized and, without any movable mechanical apparatus, automatically regulates itself to the condition of criticality during moderate variations in temperature snd pressure and shuts itself down as the pressure exceeds a predetermined safe operating value.

  12. Mesure, intégration, probabilités

    OpenAIRE

    Gallouët, Thierry; Herbin, Raphaèle

    2013-01-01

    International audience; L’objectif de ce livre est de donner une vue d’ensemble de la théorie de la mesure, de l’intégration et des probabilités correspondant à un niveau de troisième année de licence ou de première année de master (en mathématiques).La lecture de ce livre requiert la connaissance des notions d’analyse réelle, d’algèbre linéaire et de calcul différentiel enseignées en première et deuxième année de licence de mathématiques dans la plupart des universités fra...

  13. Radioelements: their detection and measurement; Les radioelements: detection et mesure

    Energy Technology Data Exchange (ETDEWEB)

    Grinberg, B. [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires

    1960-07-01

    A brief review of the properties of nuclear radiations is followed by a description of the basic techniques used for their detection: autoradiography, methods using the ionisation of gases (ionisation chambers, proportional counters, Geiger-Muller counters), scintillation techniques. The principles of the different methods of measurement are explained, whether they concern the activity or the energy absorbed (dosimetry). This is followed by a description of the basic techniques (4 {pi} counter, defined solid angle, {beta}-{gamma} coincidences). (author) [French] Apres un bref rappel des proprietes des rayonnements nucleaires, on decrit les techniques fondamentales employees pour leur detection: autoradiographie, procedes utilisant l'ionisation des gaz (chambres d'ionisation, compteurs proportionnels, compteurs de Geiger-Muller), technique des scintillations. On expose le principe des differentes methodes de mesure concernant soit l'activite, soit l'energie absorbee (dosimetrie). Les techniques fondamentales (compteur 4 {pi}, angle solide defini, coincidences {beta}-{gamma}) sont ensuite decrites. (auteur)

  14. Une introduction à la convergence d'espaces métriques mesurés

    OpenAIRE

    Paulin, Frédéric

    2009-01-01

    Ce texte est une introduction élémentaire à la convergence d'espaces métriques compacts munis de mesures de probabilité, en suivant les textes de \\cite{Gro2,Fuk1,Vil,Stu,Jac}. Nous ne considérerons pas dans ces notes le cas d'espaces non compact et de mesures infinies, en renvoyant à ces références.

  15. Une mesure différente du bien-être : l'indice du bonheur national ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Une mesure différente du bien-être : l'indice du bonheur national brut du Bhoutan 2010. La demande de mesures novatrices, mais rigoureuses, du bien-être national allant au-delà du produit national brut ne cesse de croître. ... Réglementation du marché du travail en Chine : politiques en matière de salaire minimum.

  16. REACTOR COOLING

    Science.gov (United States)

    Quackenbush, C.F.

    1959-09-29

    A nuclear reactor with provisions for selectively cooling the fuel elements is described. The reactor has a plurality of tubes extending throughout. Cylindrical fuel elements are disposed within the tubes and the coolant flows through the tubes and around the fuel elements. The fuel elements within the central portion of the reactor are provided with roughened surfaces of material. The fuel elements in the end portions of the tubes within the reactor are provlded with low conduction jackets and the fuel elements in the region between the central portion and the end portions are provided with smooth surfaces of high heat conduction material.

  17. Multifunctional reactors

    NARCIS (Netherlands)

    Westerterp, K.R.

    1992-01-01

    Multifunctional reactors are single pieces of equipment in which, besides the reaction, other functions are carried out simultaneously. The other functions can be a heat, mass or momentum transfer operation and even another reaction. Multifunctional reactors are not new, but they have received much

  18. Le temps mesurable, réversible, insaisissable ?

    CERN Document Server

    Fink, Martin; Leduc , Michèle

    2016-01-01

    Depuis l'Antiquité, la nature du temps a fasciné nombre de grands penseurs. Cet ouvrage expose ce que la physique est capable de dire aujourd'hui sur le sujet. La mesure du temps, ou plus exactement celle d'une durée, se fait grâce à des horloges atomiques dont l'exactitude peut atteindre une seconde sur plusieurs milliards d'années. Nous décrivons la façon dont s'effectue le transfert du temps qui permet la synchronisation d'horloges en différents points de la Terre ou de l'espace au milliardième de seconde près, ou même mieux. Les relativités, restreinte et générale, ont bouleversé notre conception du temps et ont un impact considérable sur certains problèmes de la vie quotidienne comme l'utilisation du GPS. On abandonne l'idée d'un temps absolu, le temps devient multiple et insaisissable, et peut-être même une illusion. Enfin la flèche du temps, ou l'irréversibilité, implique que les phénomènes physiques se déroulent toujours dans un sens déterminé, en relation avec la croissan...

  19. 16 CFR Appendix G1 to Part 305 - Furnaces-Gas

    Science.gov (United States)

    2010-01-01

    ... DISCLOSURES REGARDING ENERGY CONSUMPTION AND WATER USE OF CERTAIN HOME APPLIANCES AND OTHER PRODUCTS REQUIRED UNDER THE ENERGY POLICY AND CONSERVATION ACT (âAPPLIANCE LABELING RULEâ) Pt. 305, App. G1 Appendix G1 to...

  20. Promoter polymorphism MMP-1 (-1607 2G/1G) and MMP-3 (-1612 ...

    Indian Academy of Sciences (India)

    1607 2G1G, -16071G/2G-1G/1G genotypes and -1607 1G allele were associatedwith the development of HAND (OR = 1.64, P = 0.05; OR = 1.45, P = 0.04; OR = 1.69, P = 0.05). MMP-1-16071G1G, MMP-3-16125A5A genotypes increased the risk ...

  1. 26 CFR 1.904(g)-1 - Overall domestic loss and the overall domestic loss account.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 9 2010-04-01 2010-04-01 false Overall domestic loss and the overall domestic loss account. 1.904(g)-1 Section 1.904(g)-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF... States § 1.904(g)-1 Overall domestic loss and the overall domestic loss account. For further guidance...

  2. NUCLEAR REACTOR

    Science.gov (United States)

    Miller, H.I.; Smith, R.C.

    1958-01-21

    This patent relates to nuclear reactors of the type which use a liquid fuel, such as a solution of uranyl sulfate in ordinary water which acts as the moderator. The reactor is comprised of a spherical vessel having a diameter of about 12 inches substantially surrounded by a reflector of beryllium oxide. Conventionnl control rods and safety rods are operated in slots in the reflector outside the vessel to control the operation of the reactor. An additional means for increasing the safety factor of the reactor by raising the ratio of delayed neutrons to prompt neutrons, is provided and consists of a soluble sulfate salt of beryllium dissolved in the liquid fuel in the proper proportion to obtain the result desired.

  3. NUCLEAR REACTOR

    Science.gov (United States)

    Grebe, J.J.

    1959-07-14

    High temperature reactors which are uniquely adapted to serve as the heat source for nuclear pcwered rockets are described. The reactor is comprised essentially of an outer tubular heat resistant casing which provides the main coolant passageway to and away from the reactor core within the casing and in which the working fluid is preferably hydrogen or helium gas which is permitted to vaporize from a liquid storage tank. The reactor core has a generally spherical shape formed entirely of an active material comprised of fissile material and a moderator material which serves as a diluent. The active material is fabricated as a gas permeable porous material and is interlaced in a random manner with very small inter-connecting bores or capillary tubes through which the coolant gas may flow. The entire reactor is divided into successive sections along the direction of the temperature gradient or coolant flow, each section utilizing materials of construction which are most advantageous from a nuclear standpoint and which at the same time can withstand the operating temperature of that particular zone. This design results in a nuclear reactor characterized simultaneously by a minimum critiral size and mass and by the ability to heat a working fluid to an extremely high temperature.

  4. Mouse-human immunoglobulin G1 chimeric antibodies with activities against Cryptococcus neoformans.

    OpenAIRE

    Zebedee, S L; Koduri, R K; Mukherjee, J; Mukherjee, S.; Lee, S; Sauer, D F; Scharff, M. D.; Casadevall, A

    1994-01-01

    Passive antibody administration is a potentially useful approach for the therapy of human Cryptococcus neoformans infections. To evaluate the efficacy of the human immunoglobulin G1 (IgG1) constant region against C. neoformans and to construct murine antibody derivatives with reduced immunogenicities and longer half-lives in humans, two mouse-human IgG1 chimeric antibodies were generated from the protective murine monoclonal antibodies 2D10 (IgM) and 18B7 (IgG1). The 2D10 mouse-human IgG1 chi...

  5. The protein source in embryo culture media influences birthweight: a comparative study between G1 v5 and G1-PLUS v5.

    Science.gov (United States)

    Zhu, Jinliang; Li, Ming; Chen, Lixue; Liu, Ping; Qiao, Jie

    2014-07-01

    Does protein source or human serum albumin (HSA) in embryo culture media influence the subsequent birthweight? A significant difference was observed in gestational age- and gender-adjusted birthweight (Z scores) and the proportion of large-for-gestational age (LGA) babies between embryos cultured in G1 v5 and those cultured in G1-PLUS v5 media. It has been reported that the birthweights of singletons born from embryos cultured in Vitrolife are significantly higher than those cultured in the Cook group of media, and that G1-PLUS (Vitrolife, Gothenburg, Sweden) is associated with increased birth and placenta weights compared with Medicult ISMI. This study was a retrospective analysis of neonatal birthweights, and included 1097 singletons born from fresh embryo transfer cycles at the Center for Reproductive Medicine of Peking University Third Hospital between January 2011 and August 2012. The number of singletons born from G1 v5 culture media was 489, and the number of singletons born from G1-PLUS v5 media was 608. Patients media groups. The absolute birthweights for singletons resulting from G1-PLUS v5 were not different from singletons resulting from G1 v5 (3375.9 ± 479.6 g versus 3333.2 ± 491.6 g, respectively; P = 0.14). However the Z scores for singletons from embryos cultured in G1-PLUS v5 were significantly higher than for singletons cultured in G1 v5 (0.28 ± 1.12 versus 0.09 ± 1.15, respectively; P = 0.04), and more LGA babies were born from G1-PLUS v5 culture compared with G1 v5 (16.8 versus 12.1%, respectively; P = 0.03) culture. Finally, multiple linear regression analysis suggested that female weight (P = 0.00), male height (P = 0.04), gestational age at birth (P = 0.00), infant gender (P = 0.00) and culture media (P = 0.04) all had significant effects on the birthweights of singleton newborns. This study was limited by its retrospective design. Our study suggests that protein source/HSA has a significant effect on birthweights of singleton newborns

  6. Reactor Neutrinos

    CERN Document Server

    Lasserre, T; Lasserre, Thierry; Sobel, Henry W.

    2005-01-01

    We review the status and the results of reactor neutrino experiments, that toe the cutting edge of neutrino research. Short baseline experiments have provided the measurement of the reactor neutrino spectrum, and are still searching for important phenomena such as the neutrino magnetic moment. They could open the door to the measurement of coherent neutrino scattering in a near future. Middle and long baseline oscillation experiments at Chooz and KamLAND have played a relevant role in neutrino oscillation physics in the last years. It is now widely accepted that a new middle baseline disappearance reactor neutrino experiment with multiple detectors could provide a clean measurement of the last undetermined neutrino mixing angle theta13. We conclude by opening on possible use of neutrinos for Society: NonProliferation of Nuclear materials and Geophysics.

  7. NEUTRONIC REACTORS

    Science.gov (United States)

    Wigner, E.P.; Young, G.J.

    1958-10-14

    A method is presented for loading and unloading rod type fuel elements of a neutronic reactor of the heterogeneous, solld moderator, liquid cooled type. In the embodiment illustrated, the fuel rods are disposed in vertical coolant channels in the reactor core. The fuel rods are loaded and unloaded through the upper openings of the channels which are immersed in the coolant liquid, such as water. Unloading is accomplished by means of a coffer dam assembly having an outer sleeve which is placed in sealing relation around the upper opening. A radiation shield sleeve is disposed in and reciprocable through the coffer dam sleeve. A fuel rod engaging member operates through the axial bore in the radiation shield sleeve to withdraw the fuel rod from its position in the reactor coolant channel into the shield, the shield snd rod then being removed. Loading is accomplished in the reverse procedure.

  8. Immunoglobulin G1 Allotype Influences Antibody Subclass Distribution in Response to HIV gp140 Vaccination

    Directory of Open Access Journals (Sweden)

    Sven Kratochvil

    2017-12-01

    Full Text Available Antibody subclasses exhibit extensive polymorphisms (allotypes that could potentially impact the quality of HIV-vaccine induced B cell responses. Allotypes of immunoglobulin (Ig G1, the most abundant serum antibody, have been shown to display altered functional properties in regard to serum half-life, Fc-receptor binding and FcRn-mediated mucosal transcytosis. To investigate the potential link between allotypic IgG1-variants and vaccine-generated humoral responses in a cohort of 14 HIV vaccine recipients, we developed a novel protocol for rapid IgG1-allotyping. We combined PCR and ELISA assays in a dual approach to determine the IgG1 allotype identity (G1m3 and/or G1m1 of trial participants, using human plasma and RNA isolated from PBMC. The IgG1-allotype distribution of our participants mirrored previously reported results for caucasoid populations. We observed elevated levels of HIV gp140-specific IgG1 and decreased IgG2 levels associated with the G1m1-allele, in contrast to G1m3 carriers. These data suggest that vaccinees homozygous for G1m1 are predisposed to develop elevated Ag-specific IgG1:IgG2 ratios compared to G1m3-carriers. This elevated IgG1:IgG2 ratio was further associated with higher FcγR-dimer engagement, a surrogate for potential antibody-dependent cellular cytotoxicity (ADCC and antibody-dependent cellular phagocytosis (ADCP function. Although preliminary, these results suggest that IgG1 allotype may have a significant impact on IgG subclass distribution in response to vaccination and associated Fc-mediated effector functions. These results have important implications for ongoing HIV vaccine efficacy studies predicated on engagement of FcγR-mediated cellular functions including ADCC and ADCP, and warrant further investigation. Our novel allotyping protocol provides new tools to determine the potential impact of IgG1 allotypes on vaccine efficacy.

  9. Protein elicitor PemG1 from Magnaporthe grisea induces systemic acquired resistance (SAR) in plants.

    Science.gov (United States)

    Peng, Dong-Hai; Qiu, De-Wen; Ruan, Li-Fang; Zhou, Chen-Fei; Sun, Ming

    2011-10-01

    Elicitors can stimulate defense responses in plants and have become a popular strategy in plant disease control. Previously, we isolated a novel protein elicitor, PemG1, from Magnaporthe grisea. In the present study, PemG1 protein expressed in and purified from Escherichia coli improved resistance of rice and Arabidopsis to bacterial infection, induced transient expression of pathogenesis-related (PR) genes, and increased accumulation of hydrogen peroxide in rice. The effects of PemG1 on disease resistance and PR gene expression were mobilized systemically throughout the rice plant and persisted for more than 28 days. PemG1-induced accumulation of OsPR-1a in rice was prevented by the calcium channel blockers LaCl₃, BAPTA, EGTA, W7, and TFP. Arabidopsis mutants that are insensitive to jasmonic acid (JA) and ethylene showed increased resistance to bacterial infection after PemG1 treatment but PemG1 did not affect resistance of mutants with an impaired salicylic acid (SA) transduction pathway. In rice, PemG1 induced overexpressions of the SA signal-related genes (OsEDS1, OsPAL1, and OsNH1) but not the JA pathway-related genes (OsLOX2 and OsAOS2). Our findings reveal that PemG1 protein can function as an activator of plant disease resistance, and the PemG1-mediated systemic acquired resistance is modulated by SA- and Ca(2+)-related signaling pathways.

  10. De la mesure de pertes à la caractérisation dynamique de dispositifs semiconducteurs

    Science.gov (United States)

    Lanco, L.; de Rossi, A.; Ducci, S.; Leo, G.; Marcadet, X.; Calligaro, M.; Berger, V.

    2006-10-01

    Nous proposons deux extensions de la méthode Fabry-Pérot, permettant la mesure des pertes optiques dans les guides d'onde semiconducteurs multimodes ainsi que la caractérisation dynamique de la température et des pertes dans un dispositif semiconducteur actif.

  11. Neutronic reactor

    Science.gov (United States)

    Wende, Charles W. J.; Babcock, Dale F.; Menegus, Robert L.

    1983-01-01

    A nuclear reactor includes an active portion with fissionable fuel and neutron moderating material surrounded by neutron reflecting material. A control element in the active portion includes a group of movable rods constructed of neutron-absorbing material. Each rod is movable with respect to the other rods to vary the absorption of neutrons and effect control over neutron flux.

  12. Neutronic reactor

    Energy Technology Data Exchange (ETDEWEB)

    Babcock, D.F.; Menegus, R.L.; Wende, C.W.

    1983-01-04

    A nuclear reactor includes an active portion with fissionable fuel and neutron moderating material surrounded by neutron reflecting material. A control element in the active portion includes a group of movable rods constructed of neutron-absorbing material. Each rod is movable with respect to the other rods to vary the absorption of neutrons and effect control over neutron flux.

  13. Beta1 integrins regulate chondrocyte rotation, G1 progression, and cytokinesis

    DEFF Research Database (Denmark)

    Aszodi, Attila; Hunziker, Ernst B; Brakebusch, Cord

    2003-01-01

    -actin organization. In addition, mutant chondrocytes show decreased proliferation caused by a defect in G1/S transition and cytokinesis. The G1/S defect is, at least partially, caused by overexpression of Fgfr3, nuclear translocation of Stat1/Stat5a, and up-regulation of the cell cycle inhibitors p16 and p21...

  14. 26 CFR 1.45G-1 - Railroad track maintenance credit.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 1 2010-04-01 2010-04-01 true Railroad track maintenance credit. 1.45G-1... TAXES Rules for Computing Credit for Investment in Certain Depreciable Property § 1.45G-1 Railroad track maintenance credit. (a) In general. For purposes of section 38, the railroad track maintenance credit (RTMC...

  15. A hyperactive transcriptional state marks genome reactivation at the mitosis-G1 transition.

    Science.gov (United States)

    Hsiung, Chris C-S; Bartman, Caroline R; Huang, Peng; Ginart, Paul; Stonestrom, Aaron J; Keller, Cheryl A; Face, Carolyne; Jahn, Kristen S; Evans, Perry; Sankaranarayanan, Laavanya; Giardine, Belinda; Hardison, Ross C; Raj, Arjun; Blobel, Gerd A

    2016-06-15

    During mitosis, RNA polymerase II (Pol II) and many transcription factors dissociate from chromatin, and transcription ceases globally. Transcription is known to restart in bulk by telophase, but whether de novo transcription at the mitosis-G1 transition is in any way distinct from later in interphase remains unknown. We tracked Pol II occupancy genome-wide in mammalian cells progressing from mitosis through late G1. Unexpectedly, during the earliest rounds of transcription at the mitosis-G1 transition, ∼50% of active genes and distal enhancers exhibit a spike in transcription, exceeding levels observed later in G1 phase. Enhancer-promoter chromatin contacts are depleted during mitosis and restored rapidly upon G1 entry but do not spike. Of the chromatin-associated features examined, histone H3 Lys27 acetylation levels at individual loci in mitosis best predict the mitosis-G1 transcriptional spike. Single-molecule RNA imaging supports that the mitosis-G1 transcriptional spike can constitute the maximum transcriptional activity per DNA copy throughout the cell division cycle. The transcriptional spike occurs heterogeneously and propagates to cell-to-cell differences in mature mRNA expression. Our results raise the possibility that passage through the mitosis-G1 transition might predispose cells to diverge in gene expression states. © 2016 Hsiung et al.; Published by Cold Spring Harbor Laboratory Press.

  16. Acrocentric Chromosomes in Cultured Leukocytes from Mothers of Children Affected With the G1- Trisomy Syndrome

    Science.gov (United States)

    And Others; Cotton, James E.

    1973-01-01

    Analysis of venous blood samples from 24 mothers of G1-trisomy-affected (Down's Syndrome) children and 23 mothers of chromosomally normal children indicated that mothers of G1-trisomy-affected children had a greater than expected involvement of the G-chromosomes in associations of acrocentric satellited (chromosome configuration) chromosomes.…

  17. Msa1 and Msa2 Modulate G1-Specific Transcription to Promote G1 Arrest and the Transition to Quiescence in Budding Yeast.

    Directory of Open Access Journals (Sweden)

    Shawna Miles

    2016-06-01

    Full Text Available Yeast that naturally exhaust their glucose source can enter a quiescent state that is characterized by reduced cell size, and high cell density, stress tolerance and longevity. The transition to quiescence involves highly asymmetric cell divisions, dramatic reprogramming of transcription and global changes in chromatin structure and chromosome topology. Cells enter quiescence from G1 and we find that there is a positive correlation between the length of G1 and the yield of quiescent cells. The Swi4 and Swi6 transcription factors, which form the SBF transcription complex and promote the G1 to S transition in cycling cells, are also critical for the transition to quiescence. Swi6 forms a second complex with Mbp1 (MBF, which is not required for quiescence. These are the functional analogues of the E2F complexes of higher eukaryotes. Loss of the RB analogue, Whi5, and the related protein Srl3/Whi7, delays G1 arrest, but it also delays recovery from quiescence. Two MBF- and SBF-Associated proteins have been identified that have little effect on SBF or MBF activity in cycling cells. We show that these two related proteins, Msa1 and Msa2, are specifically required for the transition to quiescence. Like the E2F complexes that are quiescence-specific, Msa1 and Msa2 are required to repress the transcription of many SBF target genes, including SWI4, the CLN2 cyclin and histones, specifically after glucose is exhausted from the media. They also activate transcription of many MBF target genes. msa1msa2 cells fail to G1 arrest and rapidly lose viability upon glucose exhaustion. msa1msa2 mutants that survive this transition are very large, but they attain the same thermo-tolerance and longevity of wild type quiescent cells. This indicates that Msa1 and Msa2 are required for successful transition to quiescence, but not for the maintenance of that state.

  18. Role of HLA-G1 in trophoblast cell proliferation, adhesion and invasion

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Feng, E-mail: jiangfeng1161@163.com [Department of Gynecology and Obstetrics, Tangdu Hospital, The Fourth Military Medical University, 569 Xinsi Road, Baqiao District, Xi' an 710038 (China); Zhao, Hongxi [Department of Gynecology and Obstetrics, Tangdu Hospital, The Fourth Military Medical University, 569 Xinsi Road, Baqiao District, Xi' an 710038 (China); Wang, Li [Department of Gynecology and Obstetrics, The Chinese PLA General Hospital, 28 Fuxing Road, Haidian District, Beijing 100853 (China); Guo, Xinyu [Assisted Reproductive Center, General Hospital of Guangzhou Military Command, Guangzhou 510010 (China); Wang, Xiaohong; Yin, Guowu [Department of Gynecology and Obstetrics, Tangdu Hospital, The Fourth Military Medical University, 569 Xinsi Road, Baqiao District, Xi' an 710038 (China); Hu, Yunsheng [Department of Orthopedics, Tangdu Hospital, The Fourth Military Medical University, Xi' an 710038 (China); Li, Yi [Department of Gynecology and Obstetrics, Tangdu Hospital, The Fourth Military Medical University, 569 Xinsi Road, Baqiao District, Xi' an 710038 (China); Yao, Yuanqing, E-mail: yuanqingyaoxa@163.com [Department of Gynecology and Obstetrics, The Chinese PLA General Hospital, 28 Fuxing Road, Haidian District, Beijing 100853 (China)

    2015-02-27

    Trophoblast cells are important in embryo implantation and fetomaternal tolerance. HLA-G is specifically expressed at the maternal–fetal interface and is a regulator in pregnancy. The aim of the present study was to detect the effect of HLA-G1 on trophoblast cell proliferation, adhesion, and invasion. Human trophoblast cell lines (JAR and HTR-8/SVneo cells) were infected with HLA-G1-expressing lentivirus. After infection, HLA-G1 expression of the cells was detected by western blotting. Cell proliferation was detected by the BrdU assay. The cell cycle and apoptosis of JAR and HTR-8/SVneo cells was measured by flow cytometry (FCM). The invasion of the cells under different conditions was detected by the transwell invasion chamber assay. HLA-G1 didn't show any significant influence on the proliferation, apoptosis, adhesion, and invasion of trophocytes in normal culture conditions. However, HLA-G1 inhibited JAR and HTR-8/SVneo cells invasion induced by hepatocyte growth factor (HGF) under normal oxygen conditions. In conditions of hypoxia, HLA-G1 couldn't inhibit the induction of cell invasion by HGF. HLA-G1 is not an independent factor for regulating the trophocytes. It may play an indirect role in embryo implantation and formation of the placenta. - Highlights: • HLA-G1 could not influence trophocytes under normal conditions. • HLA-G1 inhibited cell invasion induced by HGF under normal oxygen condition. • HLA-G1 could not influence cell invasion under hypoxia conditions.

  19. Mesure et retroaction sur un qubit multi-niveaux en electrodynamique quantique en circuit non lineair

    Science.gov (United States)

    Boissonneault, Maxime

    L'electrodynamique quantique en circuit est une architecture prometteuse pour le calcul quantique ainsi que pour etudier l'optique quantique. Dans cette architecture, on couple un ou plusieurs qubits supraconducteurs jouant le role d'atomes a un ou plusieurs resonateurs jouant le role de cavites optiques. Dans cette these, j'etudie l'interaction entre un seul qubit supraconducteur et un seul resonateur, en permettant cependant au qubit d'avoir plus de deux niveaux et au resonateur d'avoir une non-linearite Kerr. Je m'interesse particulierement a la lecture de l'etat du qubit et a son amelioration, a la retroaction du processus de mesure sur le qubit de meme qu'a l'etude des proprietes quantiques du resonateur a l'aide du qubit. J'utilise pour ce faire un modele analytique reduit que je developpe a partir de la description complete du systeme en utilisant principalement des transfprmations unitaires et une elimination adiabatique. J'utilise aussi une librairie de calcul numerique maison permettant de simuler efficacement l'evolution du systeme complet. Je compare les predictions du modele analytique reduit et les resultats de simulations numeriques a des resultats experimentaux obtenus par l'equipe de quantronique du CEASaclay. Ces resultats sont ceux d'une spectroscopie d'un qubit supraconducteur couple a un resonateur non lineaire excite. Dans un regime de faible puissance de spectroscopie le modele reduit predit correctement la position et la largeur de la raie. La position de la raie subit les decalages de Lamb et de Stark, et sa largeur est dominee par un dephasage induit par le processus de mesure. Je montre que, pour les parametres typiques de l'electrodynamique quantique en circuit, un accord quantitatif requiert un modele en reponse non lineaire du champ intra-resonateur, tel que celui developpe. Dans un regime de forte puissance de spectroscopie, des bandes laterales apparaissent et sont causees par les fluctuations quantiques du champ electromagnetique

  20. Gene expression profiles of HLA-G1 overexpressed in hES cells.

    Science.gov (United States)

    Zhu, Yajing; Zhao, Sanjun; Zhao, Hongxi; Yao, Yuanqing

    2012-10-01

    The goals of this study were to analyze the change in the global gene expression profile of exogenous human leukocyte antigen-G1 (HLA-G1) overexpressed in human embryonic stem (hES) cells and to explore the molecular mechanism by which the overexpression of HLA-G1 modifies immunologic pathways. Microarray and quantitative real-time PCR analyses were performed to quantify the differential expression pattern of HLA-G1 + H1 hES cells. The results showed that HLA-G1 differentially regulated the expression of 425 genes with at least a twofold increase or decrease. These differentially expressed genes were classified into 13 functional groups, including cellular components, biological processes, and molecular functions. The pathways of focal adhesion, the TGF-β signaling pathway, and the immune response were the most predominantly affected. The synergism of these genes could explain the mechanism of the immunosuppression of HLA-G1 + H1 hES cells. Thus, the expression pattern reflected a broad spectrum of roles of HLA-G1 in hES cells.

  1. Role of HLA-G1 in trophoblast cell proliferation, adhesion and invasion.

    Science.gov (United States)

    Jiang, Feng; Zhao, Hongxi; Wang, Li; Guo, Xinyu; Wang, Xiaohong; Yin, Guowu; Hu, Yunsheng; Li, Yi; Yao, Yuanqing

    2015-02-27

    Trophoblast cells are important in embryo implantation and fetomaternal tolerance. HLA-G is specifically expressed at the maternal-fetal interface and is a regulator in pregnancy. The aim of the present study was to detect the effect of HLA-G1 on trophoblast cell proliferation, adhesion, and invasion. Human trophoblast cell lines (JAR and HTR-8/SVneo cells) were infected with HLA-G1-expressing lentivirus. After infection, HLA-G1 expression of the cells was detected by western blotting. Cell proliferation was detected by the BrdU assay. The cell cycle and apoptosis of JAR and HTR-8/SVneo cells was measured by flow cytometry (FCM). The invasion of the cells under different conditions was detected by the transwell invasion chamber assay. HLA-G1 didn't show any significant influence on the proliferation, apoptosis, adhesion, and invasion of trophocytes in normal culture conditions. However, HLA-G1 inhibited JAR and HTR-8/SVneo cells invasion induced by hepatocyte growth factor (HGF) under normal oxygen conditions. In conditions of hypoxia, HLA-G1 couldn't inhibit the induction of cell invasion by HGF. HLA-G1 is not an independent factor for regulating the trophocytes. It may play an indirect role in embryo implantation and formation of the placenta. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Dispositif de mesure calorimétrique des pertes dans les condensateurs de puissance

    Science.gov (United States)

    Seguin, B.; Gosse, J. P.

    1997-02-01

    A calorimetric technique is used to measure the power losses in capacitors. The power dissipated in the component is measured as the difference between the heat powers delivered by a temperature regulation when the capacitor is energetized or not. The original feature of the apparatus lies in the use of the isothermal calorimetry and in the measurement of an electrical power, in condradistinction with previous and dissatisfacting attempts based on the measurement of a temperature increase. The result is an improvement of the accuracy and sensibility of the apparatus which can be used to determine the equivalent series resistance of capacitors having very low losses. Measurements realized on a polypropylene capacitor and a sinusoidal applied voltage have allowed us to separate the ohmic losses from the dielectric ones and to study their variations with temperature. Une technique de calorimétrie isotherme est appliquée à la mesure des pertes électriques dans les condensateurs. La puissance calorifique dissipée par le composant est mesurée comme la différence des puissances de chauffe délivrées par une régulation de température quand le condensateur est hors tension ou sous tension. L'originalité du dispositif réside dans l'utilisation du principe de calorimétrie isotherme et dans la nature de la grandeur physique mesurée qui est une puissance électrique alors que les tentatives antérieures de mesures calorimétriques reposaient sur la mesure d'une élévation de température. Il en résulte une amélioration de la précision et de la sensibilité de ce type d'appareillage qui peut être employé pour caractériser la résistance série équivalente des condensateurs à très faibles pertes. Une série de mesures, réalisée sur un condensateur au polypropylène soumis à une tension sinusoïdale, a permis de séparer les pertes ohmiques des pertes diélectriques et d'étudier leurs variations avec la température.

  3. Souci du social et action publique sur mesure

    Directory of Open Access Journals (Sweden)

    Bertrand Ravon

    2008-10-01

    Full Text Available L’engagement dans la lutte contre les problèmes sociaux s’est transformé. Avec l’individualisation et la territorialisation du traitement public des problèmes sociaux, se pose de plus en plus nettement la question d’une action publique de proximité, intersubjective. Mais plutôt que de renvoyer immédiatement les raisons de cette action publique sur mesure à une critique de la psychologisation des rapports sociaux ou du déclin des institutions, il s’agit de l’analyser comme une expérience publique, avec son lot d’actions et d’affects, de convictions et d’inquiétudes, de ressources et de préoccupations. La notion de souci s’impose alors pour tenir ce double mouvement de l’engagement, entre agir et subir, des épreuves qui nous conduisent dans l’action aux attentes qui nous y maintiennent. À partir de plusieurs exemples de formation de problèmes sociaux, l’article décline alors le souci des acteurs dans deux directions. D’une part, le souci de soi est analysé comme un engagement public au sens d’un travail d’orientation de soi dans un monde incertain via la reprise d’expériences sociales négatives. D’autre part, le souci commun est envisagé comme une « communauté de charge », c’est-à-dire comme un collectif d’action publique fondé non pas à partir de propriétés communes mais à partir d’affects partagés.“Concern” in the social sphere and public action adapted to the client: singular and critical public experience of social problemsCommitment in the struggle against social problems has changed. Along with the individualisation and territorial decentralisation of the public treatment of social problems, the question of very local and intersubjective public action has come more and more into focus. But rather than immediately relegating the reasons for this tailor-made version of social action to a critique of the increasing influence of psychological methods in social relations

  4. Accélération d'atomes ultrafroids: vers une mesure de h/M{Rb}

    Science.gov (United States)

    Cladé, P.; Battesti, R.; Guellati-Khélifa, S.; Schwob, C.; Grémaud, B.; Nez, F.; Julien, L.; Biraben, F.

    2004-11-01

    Le but de l'expérience est la mesure de la vitesse de recul d'atomes de rubidium. Une determination du rapport h/MRb ainsi que de la constante de structure fine α peuvent en être déduites. Les mesures préliminaires que nous avons effectuées conduisent à une incertitude de 0,4 ppm sur h/M87Rb.

  5. Control of cell cycle transcription during G1 and S phases.

    Science.gov (United States)

    Bertoli, Cosetta; Skotheim, Jan M; de Bruin, Robertus A M

    2013-08-01

    The accurate transition from G1 phase of the cell cycle to S phase is crucial for the control of eukaryotic cell proliferation, and its misregulation promotes oncogenesis. During G1 phase, growth-dependent cyclin-dependent kinase (CDK) activity promotes DNA replication and initiates G1-to-S phase transition. CDK activation initiates a positive feedback loop that further increases CDK activity, and this commits the cell to division by inducing genome-wide transcriptional changes. G1-S transcripts encode proteins that regulate downstream cell cycle events. Recent work is beginning to reveal the complex molecular mechanisms that control the temporal order of transcriptional activation and inactivation, determine distinct functional subgroups of genes and link cell cycle-dependent transcription to DNA replication stress in yeast and mammals.

  6. Redox-mediated bypass of restriction point via skipping of G1pm

    Directory of Open Access Journals (Sweden)

    Greene James J

    2006-07-01

    Full Text Available Abstract Background It is well known that cancer cells bypass the restriction point, R, and undergo uncontrolled cell proliferation. Hypothesis and evidence We suggest here that fibrosarcoma cells enter G1ps directly from M, skipping G1pm, hence bypassing R, in response to redox modulation. Evidence is presented from the published literature that demonstrate a shortening of the cycle period of transformed fibroblasts (SV-3T3 compared to the nontransformed 3T3 fibroblasts, corresponding to the duration of G1pm in the 3T3 fibroblasts. Evidence is also presented that demonstrate that redox modulation can induce the CUA-4 fibroblasts to bypass R, resulting in a cycle period closely corresponding to the cycle period of fibrosarcoma cells (HT1080. Conclusion The evidence supports our hypothesis that a low internal redox potential can cause fibrosarcoma cells to skip the G1pm phase of the cell cycle.

  7. Nuclear Reactors. Revised.

    Science.gov (United States)

    Hogerton, John F.

    This publication is one of a series of information booklets for the general public published by the United States Atomic Energy Commission. Among the topics discussed are: How Reactors Work; Reactor Design; Research, Teaching, and Materials Testing; Reactors (Research, Teaching and Materials); Production Reactors; Reactors for Electric Power…

  8. Lovastatin induces G1-phase synchronization of HEC-1-A cells and JEC cells

    Directory of Open Access Journals (Sweden)

    Huimin Shen

    2013-03-01

    Full Text Available Our study investigated lovastatin-induced G1 phase synchronization of HEC-1-A cells and JEC cells and the cell cycle progression after desynchronization of these cells. HEC-1-A cells and JEC cells were treated with by lovastatin and the proportion of cells in G1 phase was detected. Both cell types were incubated with lovastatin and the synchronization was determined. The cell cycle progression of both cell types was investigated. The proportion of Both cell types in G1 phase was 87.87 ± 0.70% and 85.00 ± 0.79%, respectively. At 20 h and 16 h after G1-phase desynchronization, the proportion of cells in S phase reached a maximal level and that in G1 phase was at the minimal level for HEC-1-A cells and JEC cells, respectively. Thus, at 20 h and 16 h after desynchronization, the proportion of cells in S phase was the highest and that in G1 phase the lowest for HEC-1-A cells and JEC cells, respectively.

  9. Photocatalytic reactor

    Science.gov (United States)

    Bischoff, Brian L.; Fain, Douglas E.; Stockdale, John A. D.

    1999-01-01

    A photocatalytic reactor for processing selected reactants from a fluid medium comprising at least one permeable photocatalytic membrane having a photocatalytic material. The material forms an area of chemically active sites when illuminated by light at selected wavelengths. When the fluid medium is passed through the illuminated membrane, the reactants are processed at these sites separating the processed fluid from the unprocessed fluid. A light source is provided and a light transmitting means, including an optical fiber, for transmitting light from the light source to the membrane.

  10. Mesure de la vitesse d'infiltration des eaux dans le sol : Cas des sols ...

    African Journals Online (AJOL)

    SARAH

    30 avr. 2016 ... 9494. Mesure de la vitesse d'infiltration des eaux dans le sol : Cas des sols de la Vallée du Niari en République du Congo. Urbain Gampio MBILOU1; Médard NGOUALA MABONZO* 2, Timothée MIYOUNA 1. 1 Département de Géologie, Faculté des Sciences et Techniques ; Université Marien NGOUABI.

  11. Conception, réalisation et validation d'un dispositif de mesure de ...

    African Journals Online (AJOL)

    RÉSUMÉ. Dans le cadre de ses travaux de recherche dans le domaine de la Compatibilité Electromagnétique (CEM), l'IRSEEM (Institut de Recherche en Systèmes Electroniques Embarqués) a développé un banc de mesure automatisé. Il permet de caractériser en totalité le champ électromagnétique proche rayonné par ...

  12. Mesurer l'incidence des centres de services d'emplois au Liban ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Mesurer l'incidence des centres de services d'emplois au Liban. Ce projet améliorera la capacité des centres de services d'emplois (CSE) dans les camps palestiniens au Liban à offrir des conseils en matière d'emploi et des services de jumelage emploi-travailleur aux réfugiés palestiniens, hommes et femmes. En utilisant ...

  13. Façonnement des mesures de protection sociale en Afrique : les ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Façonnement des mesures de protection sociale en Afrique : les comptes de transfert nationaux. En Afrique, les taux de natalité et de mortalité demeurent plus élevés que presque partout ailleurs. Cependant, en raison de la baisse des taux de fécondité et de mortalité infantile, les populations africaines sont parmi les plus ...

  14. Hybrid adsorptive membrane reactor

    Energy Technology Data Exchange (ETDEWEB)

    Tsotsis, Theodore T [Huntington Beach, CA; Sahimi, Muhammad [Altadena, CA; Fayyaz-Najafi, Babak [Richmond, CA; Harale, Aadesh [Los Angeles, CA; Park, Byoung-Gi [Yeosu, KR; Liu, Paul K. T. [Lafayette Hill, PA

    2011-03-01

    A hybrid adsorbent-membrane reactor in which the chemical reaction, membrane separation, and product adsorption are coupled. Also disclosed are a dual-reactor apparatus and a process using the reactor or the apparatus.

  15. D and DR Reactors

    Data.gov (United States)

    Federal Laboratory Consortium — The world's second full-scale nuclear reactor was the D Reactor at Hanford which was built in the early 1940's and went operational in December of 1944.D Reactor ran...

  16. Reactor transient

    Energy Technology Data Exchange (ETDEWEB)

    Menegus, R.L.

    1956-05-31

    The authors are planning a calculation to be done on the Univac at the Louviers Building to estimate the effect of xenon transients, a high reactor power. This memorandum outlines the reasons why they prefer to do the work at Louviers rather than at another location, such as N.Y.U. They are to calculate the response of the reactor to a sudden change in position of the half rods. Qualitatively, the response will be a change in the rooftop ratio of the neutron flux. The rooftop ratio may oscillate with high damping, or, instead, it may oscillate for many cycles. It has not been possible for them to determine this response by hand calculation because of the complexity of the problem, and yet it is important for them to be certain that high power operation will not lead us to inherently unstable operation. Therefore they have resorted to machine computation. The system of differential equations that describes the response has seven dependent variables; therefore there are seven equations, each coupled with one or more of the others. The authors have discussed the problem with R.R. Haefner at the plant, and it is his opinion that the IBM 650 cannot adequately handle the system of seven equations because the characteristic time constants vary over a range of about 10{sup 8}. The Univac located at the Louviers Building is said to be satisfactory for this computation.

  17. Fbxl12 triggers G1 arrest by mediating degradation of calmodulin kinase I.

    Science.gov (United States)

    Mallampalli, Rama K; Kaercher, Leah; Snavely, Courtney; Pulijala, Roopa; Chen, Bill B; Coon, Tiffany; Zhao, Jing; Agassandian, Marianna

    2013-10-01

    Cell cycle progression through its regulatory control by changes in intracellular Ca(2+) levels at the G1/S transition mediates cellular proliferation and viability. Ca(2+)/CaM-dependent kinase 1 (CaMKI) appears critical in regulating the assembly of the cyclin D1/cdk4 complex essential for G1 progression, but how this occurs is unknown. Cyclin D1/cdk4 assembly in the early G1 phase is also regulated via binding to p27. Here, we show that a ubiquitin E3 ligase component, F-box protein Fbxl12, mediates CaMKI degradation via a proteasome-directed pathway leading to disruption of cyclin D1/cdk4 complex assembly and resultant G1 arrest in lung epithelia. We also demonstrate that i) CaMKI phosphorylates p27 at Thr(157) and Thr(198) in human cells and at Thr(170) and Thr(197) in mouse cells to modulate its subcellular localization; ii) Fbxl12-induced CaMKI degradation attenuates p27 phosphorylation at these sites in early G1 and iii) activation of CaMKI during G1 transition followed by p27 phosphorylation appears to be upstream to other p27 phosphorylation events, an effect abrogated by Fbxl12 overexpression. Lastly, known inducers of G1 arrest significantly increase Fbxl12 levels in cells. Thus, Fbxl12 may be a previously uncharacterized, functional growth inhibitor regulating cell cycle progression that might be used for mechanism-based therapy. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Replication-independent MCB gene induction and deoxyribonucleotide accumulation at G1/S in Saccharomyces cerevisiae.

    Science.gov (United States)

    Koç, Ahmet; Wheeler, Linda J; Mathews, Christopher K; Merrill, Gary F

    2003-03-14

    In Saccharomyces cerevisiae, many genes encoding enzymes involved in deoxyribonucleotide synthesis are expressed preferentially near the G1/S boundary of the cell cycle. The relationship between the induction of deoxyribonucleotide-synthesizing genes, deoxyribonucleoside triphosphate levels, and replication initiation was investigated using factor-synchronized wild-type yeast or dbf4 yeast that are temperature-sensitive for replication initiation. Neither the timing nor extent of gene induction was inhibited when factor-arrested dbf4 cells were released into medium containing the ribonucleotide reductase inhibitor hydroxyurea, which blocks replication fork progression, or were released at 37 degrees C, which blocks replication origin firing. Thus, the induction of deoxyribonucleotide-synthesizing genes at G1/S was fully independent of DNA chain elongation or initiation. Deoxyribonucleoside triphosphate levels increased severalfold at G1/S in wild-type cells and in dbf4 mutants incubated at the non-permissive temperature. Thus, deoxyribonucleoside triphosphate accumulation, like the induction of deoxyribonucleotide-synthesizing genes, was not dependent on replication initiation. Deoxyribonucleoside triphosphate accumulation at G1/S was suppressed in cells lacking Swi6, a transcription factor required for normal cell cycle regulation of deoxyribonucleotide-synthesizing genes. The results suggest that cells use gene induction at G1/S as a mechanism to pre-emptively, rather than reflexively, increase the synthesis of DNA precursors to meet the demand of the replication forks for deoxyribonucleotides.

  19. Selection of G1 Phase Yeast Cells for Synchronous Meiosis and Sporulation.

    Science.gov (United States)

    Stuart, David T

    2017-01-01

    Centrifugal elutriation is a procedure that allows the fractionation of cell populations based upon their size and shape. This allows cells in distinct cell cycle stages can be captured from an asynchronous population. The technique is particularly helpful when performing an experiment to monitor the progression of cells through the cell cycle or meiosis. Yeast sporulation like gametogenesis in other eukaryotes initiates from the G1 phase of the cell cycle. Conveniently, S. cerevisiae arrest in G1 phase when starved for nutrients and so withdrawal of nitrogen and glucose allows cells to abandon vegetative growth in G1 phase before initiating the sporulation program. This simple starvation protocol yields a partial synchronization that has been used extensively in studies of progression through meiosis and sporulation. By using centrifugal elutriation it is possible to isolate a homogeneous population of G1 phase cells and induce them to sporulate synchronously, which is beneficial for investigating progression through meiosis and sporulation. An additionally benefit of this protocol is that cell populations can be isolated based upon size and both large and small cell populations can be tested for progression through meiosis and sporulation. Here we present a protocol for purification of G1 phase diploid cells for examining synchronous progression through meiosis and sporulation.

  20. ORC function in late G1: maintaining the license for DNA replication.

    Science.gov (United States)

    Da-Silva, Lance F; Duncker, Bernard P

    2007-01-15

    The origin recognition complex (ORC) is essential as a scaffold for the assembly of prereplicative complexes (pre-RCs) in G(1) phase of the cell cycle. Some models have proposed that once origins have been licensed for DNA replication, ORC is dispensable for MCM protein association, and ensuing DNA replication. Although budding yeast Orc6 is not needed for origin recognition or binding in vitro, we have recently shown that this ORC subunit is required in late G(1) phase for maintenance of MCMs, and subsequent DNA replication. Further investigation shows that depletion of Orc6 results in displacement of MCM proteins from both early- and late-firing origins, and eventually results in the activation of the Rad53 checkpoint kinase, consistent with incomplete DNA replication. Loss of MCM association at origins may be mediated by the displacement of Mcm10 and/or Orc2 as a consequence of late G(1) Orc6 depletion.

  1. Nuclear reactor neutron shielding

    Science.gov (United States)

    Speaker, Daniel P; Neeley, Gary W; Inman, James B

    2017-09-12

    A nuclear reactor includes a reactor pressure vessel and a nuclear reactor core comprising fissile material disposed in a lower portion of the reactor pressure vessel. The lower portion of the reactor pressure vessel is disposed in a reactor cavity. An annular neutron stop is located at an elevation above the uppermost elevation of the nuclear reactor core. The annular neutron stop comprises neutron absorbing material filling an annular gap between the reactor pressure vessel and the wall of the reactor cavity. The annular neutron stop may comprise an outer neutron stop ring attached to the wall of the reactor cavity, and an inner neutron stop ring attached to the reactor pressure vessel. An excore instrument guide tube penetrates through the annular neutron stop, and a neutron plug comprising neutron absorbing material is disposed in the tube at the penetration through the neutron stop.

  2. Differential regulation of the cellular response to DNA double-strand breaks in G1

    DEFF Research Database (Denmark)

    Barlow, Jacqueline H; Lisby, Michael; Rothstein, Rodney

    2008-01-01

    Double-strand breaks (DSBs) are potentially lethal DNA lesions that can be repaired by either homologous recombination (HR) or nonhomologous end-joining (NHEJ). We show that DSBs induced by ionizing radiation (IR) are efficiently processed for HR and bound by Rfa1 during G1, while endonuclease......-induced breaks are recognized by Rfa1 only after the cell enters S phase. This difference is dependent on the DNA end-binding Yku70/Yku80 complex. Cell-cycle regulation is also observed in the DNA damage checkpoint response. Specifically, the 9-1-1 complex is required in G1 cells to recruit the Ddc2 checkpoint...

  3. Human hydatid disease in Peru is basically restricted to Echinococcus granulosus genotype G1.

    Science.gov (United States)

    Santivañez, Saul J; Gutierrez, Ariana M; Rosenzvit, Mara C; Muzulin, Patricia M; Rodriguez, Mary L; Vasquez, Julio C; Rodriguez, Silvia; Gonzalez, Armando E; Gilman, Robert H; Garcia, Hector H

    2008-07-01

    A molecular PCR study using DNA from 21 hydatid cysts was performed to determine which strain type is responsible for human infection in Peru. The mitochondrial cytochrome c oxidase subunit 1 (CO1) gene was amplified in 20 out of 21 samples, revealing that all but 1 sample (19/20, 95%) belonged to the common sheep strain (G1). The remaining samples belonged to the camel strain (G6). The G1 genotype was most frequently found in human cases of cystic hydatid disease (CHD) in Peru. Local control measures should focus primarily on decreasing dog and sheep infection rather than intermediate reservoirs.

  4. Analysis of EIF4G1 in Parkinson's disease among Asians.

    Science.gov (United States)

    Zhao, Yi; Ho, Patrick; Prakash, Kumar-M; Foo, Jia-Nee; Liu, Jian-Jun; Au, Wing-Lok; Tan, Louis C; Tan, Eng-King

    2013-04-01

    Sequence analysis of all the exons of EIF4G1 in 96 Asian patients with Parkinson's disease (PD) did not reveal any pathogenic mutations. A novel coding variant (Pro693Ser) in exon 15 (position 2077) was detected in one PD patient but not in 539 control subjects. Analysis of a coding polymorphic variant (rs2178403) in 1330 subjects revealed similar frequency between control subjects (0.638) and PD patients (0.640). EIF4G1 is an uncommon cause of PD in our Asian cohort. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. The ARIES tokamak reactor study

    Energy Technology Data Exchange (ETDEWEB)

    1989-10-01

    The ARIES study is a community effort to develop several visions of tokamaks as fusion power reactors. The aims are to determine the potential economics, safety, and environmental features of a range of possible tokamak reactors, and to identify physics and technology areas with the highest leverage for achieving the best tokamak reactor. Three ARIES visions are planned, each having a different degree of extrapolation from the present data base in physics and technology. The ARIES-I design assumes a minimum extrapolation from current tokamak physics (e.g., 1st stability) and incorporates technological advances that can be available in the next 20 to 30 years. ARIES-II is a DT-burning tokamak which would operate at a higher beta in the 2nd MHD stability regime. It employs both potential advances in the physics and expected advances in technology and engineering. ARIES-II will examine the potential of the tokamak and the D{sup 3}He fuel cycle. This report is a collection of 14 papers on the results of the ARIES study which were presented at the IEEE 13th Symposium on Fusion Engineering (October 2-6, 1989, Knoxville, TN). This collection describes the ARIES research effort, with emphasis on the ARIES-I design, summarizing the major results, the key technical issues, and the central conclusions.

  6. The ( G /G, 1/G ) -expansion method for solving nonlinear space ...

    Indian Academy of Sciences (India)

    2016-07-06

    Jul 6, 2016 ... G /G,1/G. ) -expansion method for solving fractional differential equations based on a fractional complex transform. We apply this method for solving space–time fractional Cahn–Allen equation and space–time fractional Klein–Gordon equation. The fractional derivatives are described in the sense.

  7. Positive feedback of G1 cyclins ensures coherent cell cycle entry.

    Science.gov (United States)

    Skotheim, Jan M; Di Talia, Stefano; Siggia, Eric D; Cross, Frederick R

    2008-07-17

    In budding yeast, Saccharomyces cerevisiae, the Start checkpoint integrates multiple internal and external signals into an all-or-none decision to enter the cell cycle. Here we show that Start behaves like a switch due to systems-level feedback in the regulatory network. In contrast to current models proposing a linear cascade of Start activation, transcriptional positive feedback of the G1 cyclins Cln1 and Cln2 induces the near-simultaneous expression of the approximately 200-gene G1/S regulon. Nuclear Cln2 drives coherent regulon expression, whereas cytoplasmic Cln2 drives efficient budding. Cells with the CLN1 and CLN2 genes deleted frequently arrest as unbudded cells, incurring a large fluctuation-induced fitness penalty due to both the lack of cytoplasmic Cln2 and insufficient G1/S regulon expression. Thus, positive-feedback-amplified expression of Cln1 and Cln2 simultaneously drives robust budding and rapid, coherent regulon expression. A similar G1/S regulatory network in mammalian cells, comprised of non-orthologous genes, suggests either conservation of regulatory architecture or convergent evolution.

  8. Nonparametric estimation of the stationary M/G/1 workload distribution function

    DEFF Research Database (Denmark)

    Hansen, Martin Bøgsted

    In this paper it is demonstrated how a nonparametric estimator of the stationary workload distribution function of the M/G/1-queue can be obtained by systematic sampling the workload process. Weak convergence results and bootstrap methods for empirical distribution functions for stationary...

  9. Nonparametric estimation of the stationary M/G/1 workload distribution function

    DEFF Research Database (Denmark)

    Hansen, Martin Bøgsted

    2005-01-01

    In this paper it is demonstrated how a nonparametric estimator of the stationary workload distribution function of the M/G/1-queue can be obtained by systematic sampling the workload process. Weak convergence results and bootstrap methods for empirical distribution functions for stationary...

  10. 10522 ASSESSMENT OF AFLATOXINS B1, B2, G1 AND G2 ...

    African Journals Online (AJOL)

    user

    2013-04-13

    Apr 13, 2013 ... Aflatoxins belong to a group of naturally occurring toxins which contaminate foodstuffs under favourable conditions. Aspergillus flavus and Aspergillus parasiticus produce aflatoxins; the four major aflatoxins which contaminate foodstuffs are B1, B2,. G1 and G2. Maize, groundnuts, rice, wheat and other ...

  11. Human IgG1 antibodies suppress angiogenesis in a target-independent manner

    NARCIS (Netherlands)

    Bogdanovich, Sasha; Kim, Younghee; Mizutani, Takeshi; Yasuma, Reo; Tudisco, Laura; Cicatiello, Valeria; Bastos-Carvalho, Ana; Kerur, Nagaraj; Hirano, Yoshio; Baffi, Judit Z; Tarallo, Valeria; Li, Shengjian; Yasuma, Tetsuhiro; Arpitha, Parthasarathy; Fowler, Benjamin J; Wright, Charles B; Apicella, Ivana; Greco, Adelaide; Brunetti, Arturo; Ruvo, Menotti; Sandomenico, Annamaria; Nozaki, Miho; Ijima, Ryo; Kaneko, Hiroki; Ogura, Yuichiro; Terasaki, Hiroko; Ambati, Balamurali K; Leusen, Jeanette HW; Langdon, Wallace Y; Clark, Michael R; Armour, Kathryn L; Bruhns, Pierre; Verbeek, J Sjef; Gelfand, Bradley D; De Falco, Sandro; Ambati, Jayakrishna

    2016-01-01

    Aberrant angiogenesis is implicated in diseases affecting nearly 10% of the world's population. The most widely used anti-angiogenic drug is bevacizumab, a humanized IgG1 monoclonal antibody that targets human VEGFA. Although bevacizumab does not recognize mouse Vegfa, it inhibits angiogenesis in

  12. Role of signal transduction and actin in G1 phase progression.

    Science.gov (United States)

    van Opstal, Angélique; Bijvelt, Jose J M; Margadant, Coert; Boonstra, Johannes

    2005-01-01

    Progression through the cell cycle of mammalian cells is dependent upon external factors such as growth- and ECM factors. These factors exert their effect predominantly during the G1 phase of the cell cycle. When cells are cultured in suspension or when growth factors are withdrawn from the medium, cells will stop cell cycle progression and enter a quiescent state. Cells will remain in this quiescent state until extracellular conditions change and cells are stimulated to re-enter the cell cycle. This stimulation is mediated by various signal transduction cascades such as the mitogen-activated protein kinase (MAPK) pathway and the phosphatidylinositol 3-kinase (PI3-kinase) pathway. In Chinese hamster ovary cells at least two serum-dependent points exist during G1 phase that lead to diffent cellular responses. The first point is located immediately after mitosis and is suggested to link with apoptosis. The second point is located in late G1 phase and probably corresponds with cellular differentiation. Signal transduction is mutually related to the cytoskeleton, especially the actin microfilament system. The actin microfilament system influences signal transduction and several signal transduction pathways influence the actin structure. Here we describe the role of the MAPK and PI3-kinase activities and of actin microfilaments in progression through the cell cycle and their role in the two G1 checkpoints.

  13. Human anti-rhesus D IgG1 antibody produced in transgenic plants

    DEFF Research Database (Denmark)

    Bouquin, Thomas; Thomsen, Mads; Nielsen, Leif Kofoed

    2002-01-01

    Transgenic plants represent an alternative to cell culture systems for producing cheap and safe antibodies for diagnostic and therapeutic use. To evaluate the functional properties of a 'plantibody', we generated transgenic Arabidopsis plants expressing full-length human IgG1 against the Rhesus D...

  14. Data of evolutionary structure change: 1N32G-1IQVA [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available ain>G 1N32G INKIM---RDGKK e>HHHH --- H...Chain> 1IQVA INKVMRSGGSSKK ...>HHHHH H> ATOM 293 CA ILE A 71 40.019 9.985 12....in> 1N32G QRPER---RAAVR > --- HHHH... 1IQVA AKCYRTKMSFAEA >HHHHH HHHH

  15. Modelling M/G/1 queueing systems with server vacations using ...

    African Journals Online (AJOL)

    The theory of non-Markovian stochastic Petri nets is employed in this paper to derive an alternative method for studying the steady state behaviour of the M/G/1 vacation queueing system with a limited service discipline. Three types of vacation schemes are considered, and sytems with both a finite population and those with ...

  16. Postdose 3 G1 serum neutralizing antibody as correlate of protection for pentavalent rotavirus vaccine.

    Science.gov (United States)

    Liu, G Frank; Hille, Darcy; Kaplan, Susan S; Goveia, Michelle G

    2017-10-03

    Although clinical trials of the pentavalent rotavirus vaccine (RotaTeq®, RV5) have demonstrated efficacy against RV gastroenteritis (RGE) in low and high-income settings, a clear correlate of protection or a measure of immune response that could predict efficacy has yet to be identified. This is the first time that immunogenicity data with both serum neutralized antibody (SNA) titers and anti-RV IgA titers from several clinical efficacy trials were pooled to provide a unique context for evaluating the correlation between immunogenicity and RGE risk or efficacy of RV5. The correlation between immunogenicity and RGE risk is evaluated with data at the individual subject level. The analyses show that higher Postdose 3 (PD3) G1 SNA titers are associated with lower odds of contracting any RGE. The correlation between immunogenicity and efficacy is assessed using aggregated population level data, which shows higher efficacy associated with higher PD3 G1 SNA geometric mean titer (GMT) ratio (between RV5 and placebo) and PD3 serum anti-RV IgA GMT ratio. Among high-income countries, efficacy plateaus over the range of PD3 G1 SNA GMT ratios and PD3 serum anti-RV IgA GMT ratios. From both individual- and population-level analyses, PD3 G1 SNA titers correlated most closely with the RGE risk or efficacy for RV5.

  17. Heavy-traffic analysis for the GI/G/1 queue with heavy-tailed distributions

    NARCIS (Netherlands)

    O.J. Boxma (Onno); J.W. Cohen

    1997-01-01

    textabstractWe consider a $GI/G/1$ queue in which the service time distribution and/or the interarrival time distribution has a heavy tail, i.e., a tail behaviour like $t^{-nu$ with $1

  18. Full genomic analysis of a human rotavirus G1P[8] strain isolated in South Korea.

    Science.gov (United States)

    Cho, Min-Kyu; Jheong, Weon-Hwa; Lee, Sung-Geun; Park, Chul Jong; Jung, Kum Hee; Paik, Soon-Young

    2013-01-01

    A rotavirus G1P[8] strain C1-81 was isolated from a 5-month-old female infant admitted to hospital with fever and severe diarrhea in Incheon, South Korea. To investigate its full genomic relatedness and its group, the full genome of strain C1-81 was determined. Based on a full genome classification system, C1-81 was shown to possess the typical Wa-like genotype constellation: G1-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1. On the basis of sequence similarities, the strain was shown to be the closest related strain to contemporary human rotavirus strains with recent strains isolated in Asia. This C1-81 strain showed the highest degree of nucleic acid similarity (98.8% and 97%) to G1 B4633-03 and P[8] (Thai-1604 and Dhaka8-02), respectively. This is the first report that group A rotavirus was analyzed with G1P[8] in South Korea. The study of the complete genome of the virus will help understanding of the evolution of rotavirus. Copyright © 2012 Wiley Periodicals, Inc.

  19. 26 CFR 1.665(g)-1A - Capital gain distribution.

    Science.gov (United States)

    2010-04-01

    ....665(g)-1A Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX... deemed under section 666(a) to be undistributed net income of the trust for all preceding taxable years..., the undistributed net income is the same as income under applicable local law. No income was...

  20. The queue M|G|1 with Markov modulated arrivals and services

    NARCIS (Netherlands)

    Regterschot, G.J.K.; de Smit, J.H.A.

    1986-01-01

    We study an M|G|1 queue in which both the arrival rate and the service time distribution depend on the state of an underlying finite-state Markov chain. The solution is obtained by a matrix factorization method. This leads to results for waiting times and queue lengths both at arrival epochs and in

  1. Binding specificity of the G1/S transcriptional regulators in budding yeast.

    Directory of Open Access Journals (Sweden)

    Michael R Harris

    Full Text Available BACKGROUND: G1/S transcriptional regulation in the budding yeast Saccharomyces cerevisiae depends on three main transcriptional components, Swi4, Swi6 and Mbp1. These proteins constitute two transcription factor complexes that regulate over 300 G1/S transcripts, namely SBF (Swi4-Swi6 and MBF (Mbp1-Swi6. SBF and MBF are involved in regulating largely non-overlapping sets of G1/S genes via clearly distinct mechanisms. METHODOLOGY/PRINCIPAL FINDINGS: Here we establish and confirm protein-protein and protein-DNA interactions using specific polyclonal antisera to whole Swi6 and to the C-terminal domains of related proteins Swi4 and Mbp1. Our data confirm the protein-protein binding specificity of Swi4 and Mbp1 to Swi6 but not to each other, and support the binding specificity of the transcriptional inhibitor Whi5 to SBF and of the corepressor Nrm1 to MBF. We also show the DNA binding preference of Swi4 to the CLN2 promoter and Mbp1 to the RNR1 promoter, while Swi6 binds both promoters. Finally, we establish the binding dynamics of Swi4 and Whi5 to the CLN2 promoter during the cell cycle. CONCLUSIONS/SIGNIFICANCE: These data confirm the binding specificity of the G1/S transcriptional regulators. Whereas previous observations were made using tagged Swi4, Swi6 and Mbp1, here we use specific polyclonal antisera to reestablish the protein-protein and protein-DNA interactions of these G1/S transcriptional components. Our data also reveal the dynamic changes in promoter binding of Swi4 during the cell cycle, which suggests a possible positive feedback loop involving Swi4.

  2. Energy transport, polar amplification, and ITCZ shifts in the GeoMIP G1 ensemble

    Directory of Open Access Journals (Sweden)

    R. D. Russotto

    2018-02-01

    Full Text Available The polar amplification of warming and the ability of the Intertropical Convergence Zone (ITCZ to shift to the north or south are two very important problems in climate science. Examining these behaviors in global climate models (GCMs running solar geoengineering experiments is helpful not only for predicting the effects of solar geoengineering but also for understanding how these processes work under increased carbon dioxide (CO2. Both polar amplification and ITCZ shifts are closely related to the meridional transport of moist static energy (MSE by the atmosphere. This study examines changes in MSE transport in 10 fully coupled GCMs in experiment G1 of the Geoengineering Model Intercomparison Project (GeoMIP, in which the solar constant is reduced to compensate for the radiative forcing from abruptly quadrupled CO2 concentrations. In G1, poleward MSE transport decreases relative to preindustrial conditions in all models, in contrast to the Coupled Model Intercomparison Project phase 5 (CMIP5 abrupt4xCO2 experiment, in which poleward MSE transport increases. We show that since poleward energy transport decreases rather than increases, and local feedbacks cannot change the sign of an initial temperature change, the residual polar amplification in the G1 experiment must be due to the net positive forcing in the polar regions and net negative forcing in the tropics, which arise from the different spatial patterns of the simultaneously imposed solar and CO2 forcings. However, the reduction in poleward energy transport likely plays a role in limiting the polar warming in G1. An attribution study with a moist energy balance model shows that cloud feedbacks are the largest source of uncertainty regarding changes in poleward energy transport in midlatitudes in G1, as well as for changes in cross-equatorial energy transport, which are anticorrelated with ITCZ shifts.

  3. Identification of G1-regulated genes in normally cycling human cells.

    Directory of Open Access Journals (Sweden)

    Maroun J Beyrouthy

    Full Text Available BACKGROUND: Obtaining synchronous cell populations is essential for cell-cycle studies. Methods such as serum withdrawal or use of drugs which block cells at specific points in the cell cycle alter cellular events upon re-entry into the cell cycle. Regulatory events occurring in early G1 phase of a new cell cycle could have been overlooked. METHODOLOGY AND FINDINGS: We used a robotic mitotic shake-off apparatus to select cells in late mitosis for genome-wide gene expression studies. Two separate microarray experiments were conducted, one which involved isolation of RNA hourly for several hours from synchronous cell populations, and one experiment which examined gene activity every 15 minutes from late telophase of mitosis into G1 phase. To verify synchrony of the cell populations under study, we utilized methods including BrdU uptake, FACS, and microarray analyses of histone gene activity. We also examined stress response gene activity. Our analysis enabled identification of 200 early G1-regulated genes, many of which currently have unknown functions. We also confirmed the expression of a set of genes candidates (fos, atf3 and tceb by qPCR to further validate the newly identified genes. CONCLUSION AND SIGNIFICANCE: Genome-scale expression analyses of the first two hours of G1 in naturally cycling cells enabled the discovery of a unique set of G1-regulated genes, many of which currently have unknown functions, in cells progressing normally through the cell division cycle. This group of genes may contain future targets for drug development and treatment of human disease.

  4. POUR UN ANCRAGE TERRITORIAL DU DEVELOPPEMENT DURABLE, LA MESURE DE LA QUALITE DES TERRITOIRES

    OpenAIRE

    Milon, Jean

    2004-01-01

    Date de redaction: mai 2004; L'ambition de ces travaux de recherche pour la mesure de la qualité d'un territoire est de formuler des hypothèses de complémentarité dans le domaine de la gestion, de la planification économique et écologique des espaces. Ils proposent de combler une lacune en abordant l'aménagement territorial sous un angle permettant une approche pluridisciplinaire en matière d'organisation spatiale. Nous suggérons que le problème de la rationalisation de la gestion de l'espace...

  5. Mesure du frottement en forge à froid par l'essai de forgeage en T

    OpenAIRE

    Felder, Eric; Zhang, Qi

    2009-01-01

    National audience; Après une revue critique des essais classiques de frottement en forge à froid, cet article présente un nouvel essai permettant la mesure du frottement sur la surface latérale d'un lopin : le forgeage en T, combinant écrasement et extrusion d'un cylindre entre un tas plat et une matrice présentant un sillon en V. Les simulations numériques montrent que la courbe force F-course C et la hauteur de la partie extrudée H sont sensibles au frottement. Les coefficients de frottemen...

  6. Suivi et validation des mesures pour un deversoir d'orage lateral a seuil court

    National Research Council Canada - National Science Library

    Crobeddu, Eric; Bennis, Saad

    2006-01-01

    ... de tests statistiques sur l’écart relatif entre les débits déversés mesurés et simulés. Dans un second temps, les valeurs erronées des débits déversés sont corrigées en suivant des règles de correction définies pour chaque type d’erreur. La procédure de validation a été testée en laboratoire sur un banc d’essai équipé de capteurs couramment utilisés en r...

  7. Resistin causes G1 arrest in colon cancer cells through upregulation of SOCS3.

    Science.gov (United States)

    Singh, Snahlata; Chouhan, Surbhi; Mohammad, Naoshad; Bhat, Manoj Kumar

    2017-05-01

    Resistin, a proinflammatory cytokine, is elevated in a number of pathological disorders, including cancer. The serum resistin level in colon cancer patients is elevated and correlates with tumor grade. However, the implications of increased resistin on colon cancer cells remain unclear. In the present study, we find that resistin binds to TLR4 on colon cancer cell membrane and initiates TLR4-MyD88-dependent activation of ERK. In addition, the upregulation of SOCS3 by ERK downregulates the JAK2/TAT3 pathway and causes the arrest of cells in G1 phase. Interestingly, we observe that resistin-exposed cells survive 5-fluorouracil treatment because of a decrease in drug uptake due to the arrest of cells in G1 phase. © 2017 Federation of European Biochemical Societies.

  8. Probabilistic Decomposition Method on the ServerIndices of an Mξ/G/1 Vacation Queue

    Directory of Open Access Journals (Sweden)

    Renbin Liu

    2014-01-01

    Full Text Available This paper develops a probabilistic decomposition method for an Mξ/G/1 repairable queueing system with multiple vacations, in which the customers who arrive during server vacations enter the system with probability p. Such a novel method is used to analyze the main performance indices of the server, such as the unavailability and the mean failure number during (0,t]. It is derived that the structures of server indices are two convolution equations. Further, comparisons with existing methods indicate that our method is effective and applicable for studying server performances in single-server Mξ/G/1 vacation queues and their complex variants. Finally, a stochastic order and production system with a multipurpose production facility is numerically presented for illustrative purpose.

  9. PIQA: pipeline for Illumina G1 genome analyzer data quality assessment.

    Science.gov (United States)

    Martínez-Alcántara, A; Ballesteros, E; Feng, C; Rojas, M; Koshinsky, H; Fofanov, V Y; Havlak, P; Fofanov, Y

    2009-09-15

    PIQA is a quality analysis pipeline designed to examine genomic reads produced by Next Generation Sequencing technology (Illumina G1 Genome Analyzer). A short statistical summary, as well as tile-by-tile and cycle-by-cycle graphical representation of clusters density, quality scores and nucleotide frequencies allow easy identification of various technical problems including defective tiles, mistakes in sample/library preparations and abnormalities in the frequencies of appearance of sequenced genomic reads. PIQA is written in the R statistical programming language and is compatible with bustard, fastq and scarf Illumina G1 Genome Analyzer data formats. The PIQA pipeline, installation instructions and examples are available at the supplementary web site (http://bioinfo.uh.edu/PIQA).

  10. Non-thermal properties of SNR G1.9+0.3

    Science.gov (United States)

    Ksenofontov, Leonid; Voelk, Heinrich; Berezhko, Evgeny

    The properties of the -presumably -youngest Galactic supernova remnant (SNR) G1.9+0.3 are investigated within the framework of nonlinear kinetic theory of cosmic ray acceleration in SNRs. The observed angular size and expansion speed as well as the radio and X-ray emission measurements are used to determine relevant physical parameters of this SNR. Under the assumption that SNR G1.9+0.3 is the result of a Type Ia supernova near the Galactic center (at the distance d=8.5 kpc) the nonthermal properties are calculated. In particular, the expected TeV-gamma ray spectral energy density is predicted to be as low as γ Fγ ≈ 5 × 10-15 erg cm-2 s-1 , strongly dependent (Fγ ∝ d-11 ) upon the source distance d.

  11. Nonthermal Properties of Supernova Remnant G1.9+0.3

    Science.gov (United States)

    Ksenofontov, L. T.; Völk, H. J.; Berezhko, E. G.

    2010-05-01

    The properties of the—presumably—youngest Galactic supernova remnant (SNR) G1.9+0.3 are investigated within the framework of nonlinear kinetic theory of cosmic ray acceleration in SNRs. The observed angular size and expansion speed as well as the radio and X-ray emission measurements are used to determine relevant physical parameters of this SNR. Under the assumption that SNR G1.9+0.3 is the result of a Type Ia supernova near the Galactic center (at the distance d = 8.5 kpc), the nonthermal properties are calculated. In particular, the expected TeV gamma-ray spectral energy density is predicted to be as low as epsilonγ F γ ≈ 5 × 10-15 erg cm-2 s-1, strongly dependent (F γ vprop d -11) upon the source distance d.

  12. Permanent draft genome sequence of the gliding predator Saprospira grandis strain Sa g1 (= HR1).

    Science.gov (United States)

    Mavromatis, Konstantinos; Chertkov, Olga; Lapidus, Alla; Nolan, Matt; Lucas, Susan; Tice, Hope; Del Rio, Tijana Glavina; Cheng, Jan-Fang; Han, Cliff; Tapia, Roxanne; Bruce, David; Goodwin, Lynne A; Pitluck, Sam; Huntemann, Marcel; Liolios, Konstantinos; Pagani, Ioanna; Ivanova, Natalia; Mikhailova, Natalia; Pati, Amrita; Chen, Amy; Palaniappan, Krishna; Land, Miriam; Brambilla, Evelyne-Marie; Rohde, Manfred; Spring, Stefan; Göker, Markus; Detter, John C; Bristow, James; Eisen, Jonathan A; Markowitz, Victor; Hugenholtz, Philip; Kyrpides, Nikos C; Klenk, Hans-Peter; Woyke, Tanja

    2012-05-25

    Saprospira grandis Gross 1911 is a member of the Saprospiraceae, a family in the class 'Sphingobacteria' that remains poorly characterized at the genomic level. The species is known for preying on other marine bacteria via 'ixotrophy'. S. grandis strain Sa g1 was isolated from decaying crab carapace in France and was selected for genome sequencing because of its isolated location in the tree of life. Only one type strain genome has been published so far from the Saprospiraceae, while the sequence of strain Sa g1 represents the second genome to be published from a non-type strain of S. grandis. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 4,495,250 bp long Improved-High-Quality draft of the genome with its 3,536 protein-coding and 62 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  13. Rare Coumarins Induce Apoptosis, G1 Cell Block and Reduce RNA Content in HL60 Cells

    Directory of Open Access Journals (Sweden)

    Widelski Jarosław

    2017-02-01

    Full Text Available The rare coumarins stenocarpin, stenocarpin isobutyrate, oficinalin, oficinalin isobutyrate, 8-methoxypeucedanin and the known xanthotoxin, isoimperatorin, bergapten, peucedanin and 8–methoxyisoimperatorin were isolated from Peucedanum luxurians Tamamsch. (Apiaceae and identified by means of spectral data (1D and 2D NMR. Their immunomodulating activity was evaluated by flow cytometry and their influence on HL60 cells as well as on PHA-stimulated PBLs was tested. All tested coumarins induce apoptosis (maximal in the 48 h culture and decrease cell proliferation in a time- and dose-dependent manner, especially in HL60 cells. They also induce partial G1 block, but only in HL60 cells (at 100 µM concentrations. Dose-dependent reduction of RNA content was also found in G1 cells treated by the coumarins. All of the tested coumarins also possessed immunomodulatory activities. Bergapten and xanthotoxin were found to be the best candidates for further evaluation as anti-cancer drugs.

  14. The MAP, M/G1,G2/1 queue with preemptive priority

    Directory of Open Access Journals (Sweden)

    Bong Dae Choi

    1997-01-01

    Full Text Available We consider the MAP, M/G1,G2/1 queue with preemptive resume priority, where low priority customers arrive to the system according to a Markovian arrival process (MAP and high priority customers according to a Poisson process. The service time density function of low (respectively: high priority customers is g1(x (respectively: g2(x. We use the supplementary variable method with Extended Laplace Transforms to obtain the joint transform of the number of customers in each priority queue, as well as the remaining service time for the customer in service in the steady state. We also derive the probability generating function for the number of customers of low (respectively, high priority in the system just after the service completion epochs for customers of low (respectively, high priority.

  15. On the Discrete-Time Geo/G/1 Queue with Vacations in Random Environment

    Directory of Open Access Journals (Sweden)

    Jianjun Li

    2016-01-01

    Full Text Available A discrete-time Geo/G/1 queue with vacations in random environment is analyzed. Using the method of supplementary variable, we give the probability generating function (PGF of the stationary queue length distribution at arbitrary epoch. The PGF of the stationary sojourn time distribution is also derived. And we present the various performance measures such as mean number of customers in the system, mean length of the type-i cycle, and mean time that the system resides in phase 0. In addition, we show that the M/G/1 queue with vacations in random environment can be approximated by its discrete-time counterpart. Finally, we present some special cases of the model and numerical examples.

  16. The MX/G/1 queue with queue length dependent service times

    Directory of Open Access Journals (Sweden)

    Bong Dae Choi

    2001-01-01

    Full Text Available We deal with the MX/G/1 queue where service times depend on the queue length at the service initiation. By using Markov renewal theory, we derive the queue length distribution at departure epochs. We also obtain the transient queue length distribution at time t and its limiting distribution and the virtual waiting time distribution. The numerical results for transient mean queue length and queue length distributions are given.

  17. M/G/1 Subject to an Initial Quorum of Customers.

    Science.gov (United States)

    1986-11-01

    size" for : i M/G/1(m). (Note: In that prior report m stands for the current m+1. The change simplifies somewhat the typography of many formulas.) We...2*A+x)+ 4)(A+2 x)+ 4(3*x)a + p (w.) ". where w. is the delay conditioned upon the server working. We simplify the typography of (1.4) and (1.4) by

  18. Modelling M/G/1 queueing systems with server vacations using ...

    African Journals Online (AJOL)

    Figure 2: MRSPN model of the single vacation M/G/1/N/Vl queueing system. There is an additional place PC in this model to record the fact that the server has com- pleted at least one service before going away on a vacation. The immediate transition S2, when enabled, places a token in PC, thus keeping a record of the first ...

  19. Long-Term Monitoring of 'Active Asteroid' P/2016 G1 (PANSTARRS)

    Science.gov (United States)

    Milewski, Dave Gerald; Jewitt, David; Rich, Robert Michael

    2017-10-01

    We present updated results of repeated monitoring of ‘Active Asteroid’ P/2016 G1 (PANSTARRS) using the 0.7-m, f/3.2 Jeanne Rich Telescope at the Jay Baum Rich Observatory in Frazier Park, CA, as well as the Keck 10-m telescope equipped with the LRIS instrument. The ‘Active Asteroids’ are a strange and newly discovered class of small bodies in the Solar System that have the orbital and dynamical properties of asteroids and also the physical properties of comets; for example, ejection of dust and volatile materials. P/2016 G1 (PANSTARRS) was detected in 2016 April by R. Weryk and R. Wainscoat using the 1.8-m PANSTARRS1 telescope and appears to exhibit activity potentially due to catastrophic impact of the main body (Moreno et al. 2016). In this work, we have monitored P/2016 G1 (PANSTARRS) from the months of April to August 2016 to better understand the mechanism and drivers of activity in this Solar System small body and detect changes in the appearance form which to form a more complete picture of this object.

  20. Optimized culture condition for enhancing lytic performance of waste activated sludge by Geobacillus sp. G1.

    Science.gov (United States)

    Yang, Chunxue; Zhou, Aijuan; Hou, Yanan; Zhang, Xu; Guo, Zechong; Wang, Aijie; Liu, Wenzong

    2014-01-01

    Hydrolysis is known as the rate-limiting step during waste activated sludge (WAS) digestion. The optimization of the culture conditions of Geobacillus sp. G1 for enhancing WAS hydrolysis was conducted in this study with uniform design and response surface methodology. Taking the lysis rate of Escherichia coli as the response, the Plackett-Burman design was used to screen the most important variables. Experimental results showed that the maximum predicted lysis rate of E. coli was 50.9% for 4 h treatment time with concentrations of skim milk, NaCl and NH4SO4 at 10.78, 4.36 and 11.28 g/L, respectively. The optimized dosage ratio of Geobacillus sp. G1 to WAS was 35%:65% (VG1:VWAS). Under this condition, soluble protein was increased to 695 mg chemical oxygen demand (COD)/L, which was 5.0 times higher than that obtained in the control (140 mg COD/L). The corresponding protease activity reached 1.1 Eu/mL. Scanning electron microscopy showed that abundant cells were apparently lysed with treatment of Geobacillus sp. G1.

  1. Clinical reactivity of celery cultivars in allergic patients: Role of Api g 1.

    Science.gov (United States)

    Dölle, S; Welter, S; Ruppel, E; Lehmann, K; Schwarz, D; Jensen-Jarolim, E; Zieglmayer, P; Franken, P; Worm, M

    2018-01-25

    Celery (Apium graveolens L.) is a vegetable consumed world-wide. Celery stalks and celeriac roots are often ingredients in convenient food products like spice blends and soups. In this study, we examined the allergenicity of distinct celeriac cultivars. Sixteen celery-allergic patients were identified using a double-blind, placebo-controlled food challenge. Ten different celeriac cultivars were used for skin prick testing in the patients. Two cultivars were further applied for oral food challenges; their protein composition was analysed by immunoblotting, and contents of major allergen Api g 1 were quantified. From the 10 investigated celeriac cultivars, two cultivars elicited significantly different skin reactivity ("Anita": 5.0 [2.0-12.0] mm vs "Prinz": 7.0 [3.0-9.5] mm; P = .047). Moreover, "Anita" induced fewer symptoms after a controlled oral-celeriac challenge in 14 patient (P Api g 1 in "Prinz" than in "Anita." Taken together, the data from this study suggest that cultivar Anita is better tolerated in celery-allergic patients than "Prinz." Differences in the protein expression profile between the cultivars, particularly the different content of Api g 1, could cause the different allergenicity. © 2018 John Wiley & Sons Ltd.

  2. Contrôle budgétaire diagnostic ou interactif ? Proposition d'un instrument de mesure

    OpenAIRE

    Sponem, Samuel

    2004-01-01

    National audience; Bien souvent, les recherches en contrôle de gestion n'accordent pas la même importance à la qualité des mesures utilisées que d'autres domaines de la gestion (le marketing notamment). Pourtant, la qualité de la mesure peut largement influencer les résultats d'une recherche. Ainsi une série d'articles dans la revue "Accounting Organisations and Society" permet de voir que les résultats divergents obtenus dans la recherche sur le RAPM s'expliquent au moins partiellement par l...

  3. Mesurer l’exposition au stress dans l’entreprise : le questionnaire des stresseurs organisationnels et sociaux (QSOS)

    OpenAIRE

    Baggio, Stéphanie; Iglesias, Katia; Sutter, P.-E.

    2016-01-01

    Objectif La mesure du stress professionnel, problématique désormais incontournable dans le monde de l’entreprise, reste peu consensuelle, les outils visant à l’évaluer présentant des failles méthodologiques ou conceptuelles. Cette étude vise à développer un outil de mesure de l’exposition au stress professionnel afin de pallier le manque de questionnaires validés, accessibles et généraux en langue française. Méthode Deux entreprises (n = 129 et n = 142) ont complété le questionnaire d’exposi...

  4. De l’importance du corps humain pour prendre la mesure du social

    Directory of Open Access Journals (Sweden)

    Jérôme Dubois

    2009-10-01

    Full Text Available Le corps humain comme étalon de mesure a participé et participe encore de la construction de la réalité sociale. Certaines parties du corps servent depuis des millénaires à quantifier et qualifier le monde qui nous entoure, y compris les humains entre eux. Par exemple, le pied a été le premier moyen de quantifier les terres pour les partager; tandis que le jet d’une chaussure sur un être humain qualifie encore la pire insulte en Irak. Aujourd’hui, la mesure du corps s’est affinée et la biométrie part du fait que tous les êtres humains possèdent une empreinte génétique différente, qui permet de les différencier les uns des autres à partir de leur corps et ainsi de les identifier, voire de les sélectionner. Certaines parties du corps ont en effet une qualité biométrique: si le nez n’a pas cette qualité, les oreilles, les lèvres, l’iris par exemple, possèdent cette qualité que les empreintes digitales ont révélée depuis plus d’un siècle en ouvrant la voie à la police scientifique.

  5. The H,G_1,G_2 photometric system with scarce observational data

    Science.gov (United States)

    Penttilä, A.; Granvik, M.; Muinonen, K.; Wilkman, O.

    2014-07-01

    The H,G_1,G_2 photometric system was officially adopted at the IAU General Assembly in Beijing, 2012. The system replaced the H,G system from 1985. The 'photometric system' is a parametrized model V(α; params) for the magnitude-phase relation of small Solar System bodies, and the main purpose is to predict the magnitude at backscattering, H := V(0°), i.e., the (absolute) magnitude of the object. The original H,G system was designed using the best available data in 1985, but since then new observations have been made showing certain features, especially near backscattering, to which the H,G function has troubles adjusting to. The H,G_1,G_2 system was developed especially to address these issues [1]. With a sufficient number of high-accuracy observations and with a wide phase-angle coverage, the H,G_1,G_2 system performs well. However, with scarce low-accuracy data the system has troubles producing a reliable fit, as would any other three-parameter nonlinear function. Therefore, simultaneously with the H,G_1,G_2 system, a two-parameter version of the model, the H,G_{12} system, was introduced [1]. The two-parameter version ties the parameters G_1,G_2 into a single parameter G_{12} by a linear relation, and still uses the H,G_1,G_2 system in the background. This version dramatically improves the possibility to receive a reliable phase-curve fit to scarce data. The amount of observed small bodies is increasing all the time, and so is the need to produce estimates for the absolute magnitude/diameter/albedo and other size/composition related parameters. The lack of small-phase-angle observations is especially topical for near-Earth objects (NEOs). With these, even the two- parameter version faces problems. The previous procedure with the H,G system in such circumstances has been that the G-parameter has been fixed to some constant value, thus only fitting a single-parameter function. In conclusion, there is a definitive need for a reliable procedure to produce

  6. Hybrid plasmachemical reactor

    Energy Technology Data Exchange (ETDEWEB)

    Lelevkin, V. M., E-mail: lelevkin44@mail.ru; Smirnova, Yu. G.; Tokarev, A. V. [Kyrgyz-Russian Slavic University (Kyrgyzstan)

    2015-04-15

    A hybrid plasmachemical reactor on the basis of a dielectric barrier discharge in a transformer is developed. The characteristics of the reactor as functions of the dielectric barrier discharge parameters are determined.

  7. Attrition reactor system

    Science.gov (United States)

    Scott, Charles D.; Davison, Brian H.

    1993-01-01

    A reactor vessel for reacting a solid particulate with a liquid reactant has a centrifugal pump in circulatory flow communication with the reactor vessel for providing particulate attrition, resulting in additional fresh surface where the reaction can occur.

  8. Guidebook to nuclear reactors

    Energy Technology Data Exchange (ETDEWEB)

    Nero, A.V. Jr.

    1976-05-01

    A general introduction to reactor physics and theory is followed by descriptions of commercial nuclear reactor types. Future directions for nuclear power are also discussed. The technical level of the material is suitable for laymen.

  9. Stabilization of IgG1 in spray-dried powders for inhalation.

    Science.gov (United States)

    Schüle, S; Schulz-Fademrecht, T; Garidel, P; Bechtold-Peters, K; Frieb, W

    2008-08-01

    The protein stabilizing capabilities of spray-dried IgG1/mannitol formulations were evaluated. The storage stability was tested at different residual moisture levels prepared by vacuum-drying or equilibration prior to storage. Vacuum-drying at 32 degrees C/0.1mbar for 24h reduced the moisture level below 1%, constituting an optimal basis for improved storage stability. The crystalline IgG1/mannitol powders with a weight ratio of 20/80 up to 40/60 failed to prevent the antibody aggregation as assessed by size exclusion chromatography during storage. Ratios of 60/40 up to 80/20 IgG1/mannitol provided superior stability of the antibody and the powders could be produced with high yields. The lower the residual moisture, the better was the stabilizing capability. An amount of 20% mannitol provided the best stabilization. Storage stability of 60/40, 70/30, and 80/20 IgG1/mannitol formulations over one year was adequate at 2-8 degrees C and 25 degrees C. Closed storage (sealed in vials) at 40 degrees C/75% RH and open storage at 25 degrees C/60% RH revealed that the stability still required optimization. The lower the protein content, the better was the powder flowability. The aerodynamic properties of powders spray-dried with 10% solids content were inadequate, as the particle size ranged between 5.1 and 7.2 microm and the fine particle fraction accounted for only 4-11%. Reduction of the solids content to 2.5% did improve the aerodynamic properties as the mass mean aerodynamic diameter was reduced to 3.6 microm and the fine particle fraction was increased to about 14%. The reduction of the solids content did not influence the storage stability significantly. Also spray-drying at higher temperatures had no significant impact on the storage stability, despite a higher tendency to form amorphous systems. In order to improve the storage stability and to maintain the good flowability of 70/30 IgG1/mannitol powder or to keep the storage stability but to improve the flowability

  10. The G1 restriction point as critical regulator of neocortical neuronogenesis

    Science.gov (United States)

    Caviness, V. S. Jr; Takahashi, T.; Nowakowski, R. S.

    1999-01-01

    Neuronogenesis in the pseudostratified ventricular epithelium is the initial process in a succession of histogenetic events which give rise to the laminate neocortex. Here we review experimental findings in mouse which support the thesis that the restriction point of the G1 phase of the cell cycle is the critical point of regulation of the overall neuronogenetic process. The neuronogenetic interval in mouse spans 6 days. In the course of these 6 days the founder population and its progeny execute 11 cell cycles. With each successive cycle there is an increase in the fraction of postmitotic cells which leaves the cycle (the Q fraction) and also an increase in the length of the cell cycle due to an increase in the length of the G1 phase of the cycle. Q corresponds to the probability that postmitotic cells will exit the cycle at the restriction point of the G1 phase of the cell cycle. Q increases non-linearly, but the rate of change of Q with cycle (i.e., the first derivative) over the course of the neuronogenetic interval is a constant, k, which appears to be set principally by cell internal mechanisms which are species specific. Q also seems to be modulated, but at low amplitude, by a balance of mitogenic and antimitogenic influences acting from without the cell. We suggest that intracellular signal transduction systems control a general advance of Q during development and thereby determine the general developmental plan (i.e., cell number and laminar composition) of the neocortex and that external mitogens and anti-mitogens modulate this advance regionally and temporally and thereby produce regional modifications of the general plan.

  11. Addition of calmodulin antagonists to NRK cells during G1 inhibits proliferating cell nuclear antigen expression.

    Science.gov (United States)

    López-Girona, A; Bosch, M; Bachs, O; Agell, N

    1995-07-01

    The mRNAs of most proteins involved in DNA synthesis show an S phase correlated expression when mammalian cells are stimulated to proliferate from G0. This is the case for proliferating cell nuclear antigen (PCNA), a cofactor of DNA polymerase delta that is essential for the synthesis of the leading and lagging strands of DNA. Normal rat kidney cells re-entering the cell cycle from quiescence start DNA synthesis at 12 h and reach a maximum at 20 h. The expression of PCNA parallels the synthesis of DNA. Progression through the S phase was inhibited by addition of the anticalmodulin drug W13 to the cells during G1, 5 h after activation. W13 also inhibited the increase in both PCNA protein and mRNA indicating that calmodulin regulates its expression. Using TK-ts13 cells transfected with a plasmid containing the thymidine kinase gene under the control of the human 2.8 kb PCNA promoter, we demonstrated that this promoter is not regulated by calmodulin. The half-life of PCNA mRNA during G1/S transition was not modified by the treatment with W13, indicating that the decrease in the mRNA found when calmodulin was inhibited is not due to changes in its stability. Run-on assays revealed that control cells produced predominantly complete PCNA transcripts during S phase, while short incomplete transcripts were generated in W13-treated cells at the same time. These results indicate that calmodulin participates in a more direct or indirect way during G1 in the activation of PCNA expression. From data presented here it can be suggested that calmodulin activates the release of a transcriptional block leading to an increase in the amount of PCNA during S phase.

  12. F-box protein specificity for g1 cyclins is dictated by subcellular localization.

    Directory of Open Access Journals (Sweden)

    Benjamin D Landry

    Full Text Available Levels of G1 cyclins fluctuate in response to environmental cues and couple mitotic signaling to cell cycle entry. The G1 cyclin Cln3 is a key regulator of cell size and cell cycle entry in budding yeast. Cln3 degradation is essential for proper cell cycle control; however, the mechanisms that control Cln3 degradation are largely unknown. Here we show that two SCF ubiquitin ligases, SCF(Cdc4 and SCF(Grr1, redundantly target Cln3 for degradation. While the F-box proteins (FBPs Cdc4 and Grr1 were previously thought to target non-overlapping sets of substrates, we find that Cdc4 and Grr1 each bind to all 3 G1 cyclins in cell extracts, yet only Cln3 is redundantly targeted in vivo, due in part to its nuclear localization. The related cyclin Cln2 is cytoplasmic and exclusively targeted by Grr1. However, Cdc4 can interact with Cdk-phosphorylated Cln2 and target it for degradation when cytoplasmic Cdc4 localization is forced in vivo. These findings suggest that Cdc4 and Grr1 may share additional redundant targets and, consistent with this possibility, grr1Δ cdc4-1 cells demonstrate a CLN3-independent synergistic growth defect. Our findings demonstrate that structurally distinct FBPs are capable of interacting with some of the same substrates; however, in vivo specificity is achieved in part by subcellular localization. Additionally, the FBPs Cdc4 and Grr1 are partially redundant for proliferation and viability, likely sharing additional redundant substrates whose degradation is important for cell cycle progression.

  13. M/G/1 vacation model with limited service discipline and hybrid switching-on policy

    Directory of Open Access Journals (Sweden)

    Alexander V. Babitsky

    1997-01-01

    Full Text Available The author studies an M/G/1 queueing system with multiple vacations. The server is turned off in accordance with the K-limited discipline, and is turned on in accordance with the T-N-hybrid policy. This is to say that the server will begin a vacation from the system if either the queue is empty or K customers were served during a busy period. The server idles until it finds at least N waiting units upon return from a vacation.

  14. Modelling M/G/1 queueing systems with server vacations using stochastic Petri nets

    Directory of Open Access Journals (Sweden)

    K Ramanath

    2006-12-01

    Full Text Available The theory of non-Markovian stochastic Petri nets is employed in this paper to derive an alternative method for studying the steady state behaviour of the M/G/1 vacation queueing system with a limited service discipline. Three types of vacation schemes are considered, and sytems with both a finite population and those with an infinite population (but finite capacity are considered. Simple numerical examples are also provided to illustrate the functionality of the methods and some useful performance measures for the system are obtained.

  15. IgG1 deficiency exacerbates experimental autoimmune myasthenia gravis in BALB/c mice

    OpenAIRE

    Huda, Ruksana; Strait, Richard T.; Tüzün, Erdem; Finkelman, Fred D.; Christadoss, Premkumar

    2015-01-01

    Myasthenia gravis is an autoimmune disease characterized by muscle weakness due to neuromuscular junction (NMJ) damage by anti-acetylcholine receptor (AChR) auto-antibodies and complement. In experimental autoimmune myasthenia gravis (EAMG), which is induced by immunization with Torpedo AChR in CFA, anti-AChR IgG2b and IgG1 are the predominant isotypes in the circulation. Complement activation by isotypes such as IgG2b plays a crucial role in EAMG pathogenesis; this suggested the possibility ...

  16. Cellular shear stiffness reflects progression of arsenic-induced transformation during G1

    DEFF Research Database (Denmark)

    Muñoz, Alexandra; Eldridge, Will J; Jakobsen, Nina Munkholt

    2017-01-01

    Cancer cells consistently exhibit decreased stiffness, however the onset and progression of this change has not been characterized. To study the development of cell stiffness changes we evaluated the shear stiffness of populations of cells during transformation to a carcinogenic state. Bronchial...... epithelial cells were exposed to sodium arsenite to initiate early stages of transformation. Exposed cells were cultured in soft agar to further transformation and select for clonal populations exhibiting anchorage independent growth. Shear stiffness of various cell populations in G1 was assessed using...

  17. Modeling and Optimization of M/G/1-Type Queueing Networks: An Efficient Sensitivity Analysis Approach

    Directory of Open Access Journals (Sweden)

    Liang Tang

    2010-01-01

    Full Text Available A mathematical model for M/G/1-type queueing networks with multiple user applications and limited resources is established. The goal is to develop a dynamic distributed algorithm for this model, which supports all data traffic as efficiently as possible and makes optimally fair decisions about how to minimize the network performance cost. An online policy gradient optimization algorithm based on a single sample path is provided to avoid suffering from a “curse of dimensionality”. The asymptotic convergence properties of this algorithm are proved. Numerical examples provide valuable insights for bridging mathematical theory with engineering practice.

  18. Properties of Multi-Stage M/G/1/K Queues with Series Arrangement

    Directory of Open Access Journals (Sweden)

    Hernández-González Salvador

    2015-07-01

    Full Text Available We propose a modification to the Buzacott & Shantikumar (1993 method to evaluate the properties of M/G/1/K queues with series arrangement. We made several tests and compared with simulation to validate the results. We observed that, with the proposed modification, the method has an acceptable level of exactitude. It can be considered an alternative calculation to other methods in the literature. The fact that this method requires less computational effort, can be useful to practitioners and managers that require tools to analyze the performance of systems in production and services areas.

  19. Optimal Policy for Mx/G/1 Queueing System with Bernoulli Feedback

    Directory of Open Access Journals (Sweden)

    Mukta Kalra

    2010-01-01

    Full Text Available We deal with Mx/G/1 Queueing System with Bernoulli feedback under N-Policy. The probability generating function and supplementary variable technique are utilized to evaluate the steady state probability distribution of the number of units in the system. The steady state results are used to establish the explicit expressions for the average number of units in the system and the mean response time for three different series time distribution. Some of the existing results are deduced as special cases. Cost analysis is performed to design the optimal N-policy at minimum cost. In order to validate the analytical approach by taking illustration we compute numerical results.

  20. Reservicing some customers in M/G/1 queues under three disciplines

    Directory of Open Access Journals (Sweden)

    M. R. Salehi-Rad

    2004-01-01

    Full Text Available Consider an M/G/1 production line in which a production item is failed with some probability and is then repaired. We consider three repair disciplines depending on whether the failed item is repaired immediately or first stockpiled and repaired after all customers in the main queue are served or the stockpile reaches a specified threshold. For each discipline, we find the probability generating function (p.g.f. of the steady-state size of the system at the moment of departure of the customer in the main queue, the mean busy period, and the probability of the idle period.

  1. Control de la estabilidad de ciclinas de G1 por nutrientes

    OpenAIRE

    Hernández Ortega, Sara

    2014-01-01

    El control del ciclo celular está altamente regulado mediante diferentes CDKs asociadas a ciclinas. En Saccharomyces cerevisiae, la CDK esencial Cdc28 es la que regula mayoritariamente este proceso. En la fase G1 del ciclo celular, otra CDK, Pho85, también colabora en este proceso asociada a las ciclinas Pcl1 y Pcl2. Pho85 se considera un enzima accesorio con funciones redundantes básicamente porqué: 1) su delección no da un fenotipo de letalidad (como si lo hace Cdc28) y 2) porqué los substr...

  2. NUCLEAR REACTOR CONTROL SYSTEM

    Science.gov (United States)

    Epler, E.P.; Hanauer, S.H.; Oakes, L.C.

    1959-11-01

    A control system is described for a nuclear reactor using enriched uranium fuel of the type of the swimming pool and other heterogeneous nuclear reactors. Circuits are included for automatically removing and inserting the control rods during the course of normal operation. Appropriate safety circuits close down the nuclear reactor in the event of emergency.

  3. De l’apprentissage à la mesure du caring: réflexion épistémo-ontologique

    Directory of Open Access Journals (Sweden)

    PAWEL KROL

    2009-04-01

    Full Text Available Cet article, inspiré d’une perspective postmoderne, pose un regard critique sur le progrès et expose comment le développement frénétique et l’emploi peu questionné des technologies, ont concouru à l’objectivation de la personne, la déshumanisation des services de santé, la main mise sur la formation infirmière ainsi qu’ à l’instrumentalisation des pratiques de soins modernes. Cette réflexion épistémo-ontologique questionne l’étude de l’apprentissage du caring et problématise sa mesure où le postpositivisme semble s’imposer empiriquement, soulevant ainsi des interrogations quant à la cohérence épistémologique entre la théorie du caring et sa mesure. Enfin, nous avançons que la mesure la mesure du caring constitue une difficulté substantielle renfermant des incohérences épistémo-ontologiques qui demeurent incommensurables.

  4. Engineering upper hinge improves stability and effector function of a human IgG1.

    Science.gov (United States)

    Yan, Boxu; Boyd, Daniel; Kaschak, Timothy; Tsukuda, Joni; Shen, Amy; Lin, Yuwen; Chung, Shan; Gupta, Priyanka; Kamath, Amrita; Wong, Anne; Vernes, Jean-Michel; Meng, Gloria Y; Totpal, Klara; Schaefer, Gabriele; Jiang, Guoying; Nogal, Bartek; Emery, Craig; Vanderlaan, Martin; Carter, Paul; Harris, Reed; Amanullah, Ashraf

    2012-02-17

    Upper hinge is vulnerable to radical attacks that result in breakage of the heavy-light chain linkage and cleavage of the hinge of an IgG1. To further explore mechanisms responsible for the radical induced hinge degradation, nine mutants were designed to determine the roles that the upper hinge Asp and His play in the radical reactions. The observation that none of these substitutions could inhibit the breakage of the heavy-light chain linkage suggests that the breakage may result from electron transfer from Cys(231) directly to the heavy-light chain linkage upon radical attacks, and implies a pathway separate from His(229)-mediated hinge cleavage. On the other hand, the substitution of His(229) with Tyr showed promising advantages over the native antibody and other substitutions in improving the stability and function of the IgG1. This substitution inhibited the hinge cleavage by 98% and suggests that the redox active nature of Tyr did not enable it to replicate the ability of His to facilitate radical induced degradation. We propose that the lower redox potential of Tyr, a residue that may be the ultimate sink for oxidizing equivalents in proteins, is responsible for the inhibition. More importantly, the substitution increased the antibody's binding to FcγRIII receptors by 2-3-fold, and improved ADCC activity by 2-fold, while maintaining a similar pharmacokinetic profile with respect to the wild type. Implications of these observations for antibody engineering and development are discussed.

  5. Post-translational Regulation of Cas9 during G1 Enhances Homology-Directed Repair

    Directory of Open Access Journals (Sweden)

    Tony Gutschner

    2016-02-01

    Full Text Available CRISPR/Cas9 induces DNA double-strand breaks that are repaired by cell-autonomous repair pathways, namely, non-homologous end-joining (NHEJ, or homology-directed repair (HDR. While HDR is absent in G1, NHEJ is active throughout the cell cycle and, thus, is largely favored over HDR. We devised a strategy to increase HDR by directly synchronizing the expression of Cas9 with cell-cycle progression. Fusion of Cas9 to the N-terminal region of human Geminin converted this gene-editing protein into a substrate for the E3 ubiquitin ligase complex APC/Cdh1, resulting in a cell-cycle-tailored expression with low levels in G1 but high expression in S/G2/M. Importantly, Cas9-hGem(1/110 increased the rate of HDR by up to 87% compared to wild-type Cas9. Future developments may enable high-resolution expression of genome engineering proteins, which might increase HDR rates further, and may contribute to a better understanding of DNA repair pathways due to spatiotemporal control of DNA damage induction.

  6. Permanent draft genome sequence of the gliding predator Saprospira grandis strain Sa g1 (= HR1)

    Energy Technology Data Exchange (ETDEWEB)

    Mavromatis, K [U.S. Department of Energy, Joint Genome Institute; Chertkov, Olga [Los Alamos National Laboratory (LANL); Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Han, Cliff [Los Alamos National Laboratory (LANL); Tapia, Roxanne [Los Alamos National Laboratory (LANL); Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Huntemann, Marcel [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Mikhailova, Natalia [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute

    2012-01-01

    Saprospira grandis Gross et al. 1911 is a member of the Saprospiraceae, a family in the class 'Sphingobacteria' that remains poorly characterized at the genomic level. The species is known for preying on other marine bacteria via 'ixotrophy'. S. grandis strain Sa g1 was isolated from decaying crab carapace in France and was selected for genome sequencing because of its isolated location in the tree of life. Only one type strain genome has been published so far from the Saprospiraceae, while the sequence of strain Sa g1 represents the second genome to be published from a non-type strain of S. grandis. Here we describe the features of this organism, together with the complete genome sequence and annotation. The 4,495,250 bp long Improved-High-Quality draft of the genome with its 3,536 protein-coding and 62 RNA genes is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

  7. Comparative Evaluation of the Chemical Stability of 4 Well-Defined Immunoglobulin G1-Fc Glycoforms.

    Science.gov (United States)

    Mozziconacci, Olivier; Okbazghi, Solomon; More, Apurva S; Volkin, David B; Tolbert, Thomas; Schöneich, Christian

    2016-02-01

    As part of a series of articles in this special issue evaluating model IgG1-Fc glycoforms for biosimilarity analysis, 3 well-defined IgG1-Fc glycoforms (high mannose-Fc, Man5-Fc, and N-acetylglucosamine-Fc) and a nonglycosylated Fc protein (N297Q-Fc) were examined in this work to elucidate chemical degradation pathways. The 4 proteins underwent a combination of accelerated thermal stability studies and 4 independent forced degradation studies (UV light, metal-catalyzed oxidation, peroxyl radicals, and hydrogen peroxide) at pH 6.0. Our results highlight chemical degradations at Asn315, Met428, Trp277, and Trp313. A cross-comparison of the different Fc glycoforms, stress conditions, and the observed chemical reactions revealed that both the deamidation of Asn315 and the transformation of Trp277 into glycine hydroperoxide were glycan dependent during incubation for 3 months at 40 °C. Our data will show that different glycans not only affect chemical degradation differently but also do lead to different impurity profiles, which can affect chemical degradation. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  8. Nuclear reactor overflow line

    Science.gov (United States)

    Severson, Wayne J.

    1976-01-01

    The overflow line for the reactor vessel of a liquid-metal-cooled nuclear reactor includes means for establishing and maintaining a continuous bleed flow of coolant amounting to 5 to 10% of the total coolant flow through the overflow line to prevent thermal shock to the overflow line when the reactor is restarted following a trip. Preferably a tube is disposed concentrically just inside the overflow line extending from a point just inside the reactor vessel to an overflow tank and a suction line is provided opening into the body of liquid metal in the reactor vessel and into the annulus between the overflow line and the inner tube.

  9. Light water reactor safety

    CERN Document Server

    Pershagen, B

    2013-01-01

    This book describes the principles and practices of reactor safety as applied to the design, regulation and operation of light water reactors, combining a historical approach with an up-to-date account of the safety, technology and operating experience of both pressurized water reactors and boiling water reactors. The introductory chapters set out the basic facts upon which the safety of light water reactors depend. The central section is devoted to the methods and results of safety analysis. The accidents at Three Mile Island and Chernobyl are reviewed and their implications for light wate

  10. Nuclear reactor physics

    CERN Document Server

    Stacey, Weston M

    2010-01-01

    Nuclear reactor physics is the core discipline of nuclear engineering. Nuclear reactors now account for a significant portion of the electrical power generated worldwide, and new power reactors with improved fuel cycles are being developed. At the same time, the past few decades have seen an ever-increasing number of industrial, medical, military, and research applications for nuclear reactors. The second edition of this successful comprehensive textbook and reference on basic and advanced nuclear reactor physics has been completely updated, revised and enlarged to include the latest developme

  11. Spinning fluids reactor

    Science.gov (United States)

    Miller, Jan D; Hupka, Jan; Aranowski, Robert

    2012-11-20

    A spinning fluids reactor, includes a reactor body (24) having a circular cross-section and a fluid contactor screen (26) within the reactor body (24). The fluid contactor screen (26) having a plurality of apertures and a circular cross-section concentric with the reactor body (24) for a length thus forming an inner volume (28) bound by the fluid contactor screen (26) and an outer volume (30) bound by the reactor body (24) and the fluid contactor screen (26). A primary inlet (20) can be operatively connected to the reactor body (24) and can be configured to produce flow-through first spinning flow of a first fluid within the inner volume (28). A secondary inlet (22) can similarly be operatively connected to the reactor body (24) and can be configured to produce a second flow of a second fluid within the outer volume (30) which is optionally spinning.

  12. Développement de la pupillométrie pour la mesure objective des émotions dans le contexte de la consommation alimentaire

    OpenAIRE

    Lemercier, Anaïs

    2014-01-01

    Les perceptions sensorielles et hédoniques résultent de processus complexes d’intégration, qui ne sont pas seulement rationnels, mais aussi fondés sur des sentiments, des émotions et des souvenirs. Afin d'appréhender au mieux le comportement du consommateur, il est devenu indispensable de mesurer les émotions afin de comprendre leur rôle fondamental dans la prise de décision. En science du consommateur, les émotions sont principalement mesurées par questionnaire. Malheureusement, cette mesure...

  13. Imaginaire des nombres et systèmes de mesure au Mexique

    OpenAIRE

    Hocquet, Jean-Claude

    2012-01-01

    Ce n’est pas d’aujourd’hui que les historiens du Mexique montrent beaucoup d’attention aux problèmes de la mesure. En juin 1990, Virginia organisait un congrès à Villahermosa (Tabasco) sur le thème de l’histoire des prix et, démarche originale, inédite en Europe où l’histoire des prix avait beaucoup occupé les historiens à l’époque où l’historiographie était dominée par l’école de Fernand Braudel et par la thèse de Pierre Chaunu, pour produire la synthèse dirigée par Braudel et Spooner, Price...

  14. On ne gère bien que ce que l'on mesure

    OpenAIRE

    Berland, Nicolas; Chevalier, Catherine; Sponem, Samuel

    2008-01-01

    Gérer est une activité sérieuse qui ne tolère pas l'approximation. Le gestionnaire qui se respecte se doit ainsi de « gérer en bon père de famille ». Gérer est un acte rationnel qui consiste à éliminer de la prise de décision l'impulsion, les rêveries et les spéculations. Pour contraindre les actions humaines, quoi de plus sage que d'encadrer les comportements par des mesures qui les rationalisent ? Il s'agit de dire le vrai, de faire triompher le rationnel sur les sentiments et les humeurs. ...

  15. Compte-rendu de Dozo (Björn-Olav, Mesures de l’écrivain

    Directory of Open Access Journals (Sweden)

    Samuel Coavoux

    2012-01-01

    Full Text Available Mesures de l’écrivain est avant tout un texte méthodologique : un préambule aux travaux réunis dans un ouvrage précédent, La vie littéraire à la toise. Il a pour objectif d’éclairer les conditions et le processus de production des données sur la vie littéraire belge contenues dans la base du Collectif interuniversitaire d’étude du littéraire (CIEL, ainsi que quelques méthodes statistiques d’analyse sociologique mobilisant ces données. Ce faisant, il s’agit de montrer quel peut être l’intérêt...

  16. Characterization of the basic charge variants of a human IgG1

    Science.gov (United States)

    Lu, Franklin; Derfus, Gayle; Kluck, Brian; Nogal, Bartek; Emery, Craig; Summers, Christie; Zheng, Kai; Bayer, Robert; Amanullah, Ashraf

    2011-01-01

    We report a case study of an IgG1 with a unique basic charge variant profile caused by C-terminal proline amidation on either one or two heavy chains. The proline amidation was sensitive to copper ion concentration in the production media during cell culture: the higher the Cu2+ ion concentration, the higher the level of proline amidation detected. This conclusion was supported by the analysis of samples that revealed direct correlation between the proline amidation level observed from peptide maps and the level of basic peaks measured by imaged capillary isoelectric focusing and a pH gradient ion-exchange chromatography method. The importance of these observations to therapeutic antibody production is discussed. PMID:22123059

  17. The M/G/1 retrial queue: New descriptors of the customer's behavior

    Science.gov (United States)

    Amador, J.; Artalejo, J. R.

    2009-01-01

    We consider queuing systems where customers are not allowed to queue; instead of that they make repeated attempts, or retrials, in order to enter service after some time. The performance of telephone systems and communication networks modelled as retrial queues differs from standard waiting lines because typically the retrial group is an invisible queue which cannot be observed. As a result, the original flow of primary arrivals and the flow of repeated attempts become undistinguished. Our aim in this paper is to consider some aspects of this problem. Thus, we focus on the main retrial model of M/G/1 type and investigate the distribution of the successful and blocked events made by the primary customers and the retrial customers.

  18. Preliminary stratigraphic and petrologic characterization of core samples from USW-G1, Yucca Mountain, Nevada

    Energy Technology Data Exchange (ETDEWEB)

    Waters, A.C.; Carroll, P.R. (eds.)

    1981-11-01

    Tuffs of the Nevada Test Site are currently under investigation to determine their potential for long-term storage of radioactive waste. As part of this program, hole USW-G1 was drilled to a depth of 6000 ft below the surface, in the central part of the Yucca Mountain area, Nevada Test Site, Nevada. Petrographic study of the USW-G1 core is presented in this report and shows the tuffs (which generally were variably welded ash flows) are partly recrystallized to a variety of secondary minerals. The important alteration products are zeolites (heulandite, clinoptilolite, mordenite and analcime), smectite clays with minor interstratified illite, albite, micas, potassium feldspar, and various forms of silica. Iijima`s zeolite zones I through IV of burial metamorphism can be recognized in the core. Zeolites are first observed at about the 1300-ft depth, and the high-temperature boundary of zeolite stability in this core occurs at about 4350 ft. Analcime persists, either metastably or as a retrograde mineral, deeper in the core. The oxidation state of Fe-Ti oxide minerals, through most of the core, increases as the degree of welding decreases, but towards the bottom of the hole, reducing conditions generally prevail. Four stratigraphic units transected by the core may be potentially favorable sites for a waste repository. These four units, in order of increasing depth in the core, are (1) the lower cooling unit of the Topopah Spring Member, (2) cooling unit II of the Bullfrog Member, (3) the upper part of the Tram tuff, and (4) the Lithic-rich tuff.

  19. Un appareillage simple pour la mesure de la diffusivité thermique de plaques minces

    Science.gov (United States)

    Hadisaroyo, D.; Batsale, J. C.; Degiovanni, A.

    1992-01-01

    The aim of this work is to present a new method for the measurement of the thermal diffusivity of samples of low thickness (lower than 1mm). The unsteady one-dimensional heat transfer problem is considered in a straight fin using the Laplace transform for the time variable. Two temperature measurements are made versus time at two different absicas. It allows to set out two parameters: the characteristic time of the sample and the Biot number relative to the lateral heat exchange. The sensitivity of the parameters is studied and a domain of Laplace variable is determined for the identification. Ce travail propose une méthode originale de mesure de la diffusivité thermique de matériaux de faible épaisseur (inférieure à 1mm). L'équation de la chaleur est résolue en régime transitoire en utilisant les hypothèses de l'ailette et dans l'espace de Laplace. La mesure de température au cours du temps en deux points de l'échantillon permet de mettre en évidence deux paramètres : le temps caractéristique de l'échantillon et le nombre de Biot associé aux échanges. Une étude de sensibilité est effectuée et une méthode d'identification est déduite pour un certain domaine de la variable de Laplace. Un dispositif expérimental simple et une validation sont présentés dans le cas de matériaux métalliques. Une extension pour les isolants est en cours de montage.

  20. Neutron fluxes in test reactors

    Energy Technology Data Exchange (ETDEWEB)

    Youinou, Gilles Jean-Michel [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2017-01-01

    Communicate the fact that high-power water-cooled test reactors such as the Advanced Test Reactor (ATR), the High Flux Isotope Reactor (HFIR) or the Jules Horowitz Reactor (JHR) cannot provide fast flux levels as high as sodium-cooled fast test reactors. The memo first presents some basics physics considerations about neutron fluxes in test reactors and then uses ATR, HFIR and JHR as an illustration of the performance of modern high-power water-cooled test reactors.

  1. 17 CFR 270.17g-1 - Bonding of officers and employees of registered management investment companies.

    Science.gov (United States)

    2010-04-01

    ...: Amount of registered management investment company gross assets—at the end of the most recent fiscal... company at his last known residence address of (i) any cancellation, termination or modification of the... employees of registered management investment companies. 270.17g-1 Section 270.17g-1 Commodity and...

  2. Comparaison instrumentale de la mesure des précipitations en climat méditerranéen semi-aride

    OpenAIRE

    Brunel, Jean-Pierre

    1986-01-01

    La pluie est un élément important du cycle de l'eau mesuré à l'aide d'appareils très divers. A partir des données d'une station agrométéorologique du Nord de la Tunisie (zone semi-aride), il est montré dans quelles proportions peuvent varier les précipitations mesurées par différents capteurs. L'influence du vent est mise en évidence dans l'écart observé entre pluie mesurée au sol et pluie mesurée au-dessus du sol. (Résumé d'auteur)

  3. Structural Properties of Polyphenols Causing Cell Cycle Arrest at G1 Phase in HCT116 Human Colorectal Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Yoongho Lim

    2013-08-01

    Full Text Available Plant-derived polyphenols are being tested as chemopreventive agents; some polyphenols arrest the cell cycle at G1 phase, whereas others inhibit cell cycle proliferation at G2/M phase. Therefore, polyphenols have been proposed to inhibit cell cycle progression at different phases via distinct mechanisms. Indeed, our previous studies showed that small structural differences in polyphenols cause large differences in their biological activities; however, the details of the structural properties causing G1 cell cycle arrest remain unknown. In this study, we prepared 27 polyphenols, including eight different scaffolds, to gain insight into the structural conditions that arrest the cell cycle at G1 phase in a quantitative structure–activity relationship study. We used cell cycle profiles to determine the biophores responsible for G1 cell cycle arrest and believe that the biophores identified in this study will help design polyphenols that cause G1 cell cycle arrest.

  4. HORIZONTAL BOILING REACTOR SYSTEM

    Science.gov (United States)

    Treshow, M.

    1958-11-18

    Reactors of the boiling water type are described wherein water serves both as the moderator and coolant. The reactor system consists essentially of a horizontal pressure vessel divided into two compartments by a weir, a thermal neutronic reactor core having vertical coolant passages and designed to use water as a moderator-coolant posltioned in one compartment, means for removing live steam from the other compartment and means for conveying feed-water and water from the steam compartment to the reactor compartment. The system further includes auxiliary apparatus to utilize the steam for driving a turbine and returning the condensate to the feed-water inlet of the reactor. The entire system is designed so that the reactor is self-regulating and has self-limiting power and self-limiting pressure features.

  5. Fast Spectrum Reactors

    CERN Document Server

    Todd, Donald; Tsvetkov, Pavel

    2012-01-01

    Fast Spectrum Reactors presents a detailed overview of world-wide technology contributing to the development of fast spectrum reactors. With a unique focus on the capabilities of fast spectrum reactors to address nuclear waste transmutation issues, in addition to the well-known capabilities of breeding new fuel, this volume describes how fast spectrum reactors contribute to the wide application of nuclear power systems to serve the global nuclear renaissance while minimizing nuclear proliferation concerns. Readers will find an introduction to the sustainable development of nuclear energy and the role of fast reactors, in addition to an economic analysis of nuclear reactors. A section devoted to neutronics offers the current trends in nuclear design, such as performance parameters and the optimization of advanced power systems. The latest findings on fuel management, partitioning and transmutation include the physics, efficiency and strategies of transmutation, homogeneous and heterogeneous recycling, in addit...

  6. G1/ELE Functions in the Development of Rice Lemmas in Addition to Determining Identities of Empty Glumes.

    Science.gov (United States)

    Liu, Mengjia; Li, Haifeng; Su, Yali; Li, Wenqiang; Shi, Chunhai

    2016-01-01

    Rice empty glumes, also named sterile lemmas or rudimentary lemmas according to different interpretations, are distinct from lemmas in morphology and cellular pattern. Consistently, the molecular mechanism to control the development of lemmas is different from that of empty glumes. Rice LEAFY HULL STERILE1(OsLHS1) and DROOPING LEAF(DL) regulate the cellular pattern and the number of vascular bundles of lemmas respectively, while LONG STERILE LEMMA1 (G1)/ELONGATED EMPTY GLUME (ELE) and PANICLE PHYTOMER2 (PAP2)/OsMADS34 determine identities of empty glumes. Though some progress has been made, identities of empty glumes remain unclear, and genetic interactions between lemma genes and glume genes have been rarely elucidated. In this research, a new G1/ELE mutant g1-6 was identified and the phenotype was analyzed. Similar to previously reported mutant lines of G1/ELE, empty glumes of g1-6 plants transform into lemma-like organs. Furthermore, Phenotypes of single and double mutant plants suggest that, in addition to their previously described gene-specific functions, G1/ELE and OsLHS1 play redundant roles in controlling vascular bundle number, cell volume, and cell layer number of empty glumes and lemmas. Meanwhile, expression patterns of G1/ELE in osmads1-z flowers and OsLHS1 in g1-6 flowers indicate they do not regulate each other at the level of transcription. Finally, down-regulation of the empty glume gene OsMADS34/PAP2 and ectopic expression of the lemma gene DL, in the g1-6 plants provide further evidence that empty glumes are sterile lemmas. Generally, our findings provided valuable information for better understanding functions of G1 and OsLHS1 in flower development and identities of empty glumes.

  7. THERMAL NEUTRONIC REACTOR

    Science.gov (United States)

    Spinrad, B.I.

    1960-01-12

    A novel thermal reactor was designed in which a first reflector formed from a high atomic weight, nonmoderating material is disposed immediately adjacent to the reactor core. A second reflector composed of a moderating material is disposed outwardly of the first reflector. The advantage of this novel reflector arrangement is that the first reflector provides a high slow neutron flux in the second reflector, where irradiation experiments may be conducted with a small effect on reactor reactivity.

  8. Approche combinée expérimentale/numérique pour la mesure de la conductivité électrique locale avec minimisation de l'incertitude de mesure

    OpenAIRE

    Arbenz, Laure; Benabou, Abdelkader; Clénet, Stéphane; Coorevits, Thierry; Mipo, Jean-Claude; Faverolle, Pierre

    2014-01-01

    La mesure de la conductivité électrique est classiquement réalisée sur des échantillons de géométrie simple à partir desquelles la grandeur d'intérêt peut être aisément déduite. Lorsqu'il n'est pas possible d'extraire des échantillons respectant ces critères géométriques, dans le cadre d'une étude non-intrusive par exemple, d'autres approches doivent être considérées. Ainsi, dans le cadre de ce travail, une méthode de mesure combinant une démarche opératoire et la simulation par éléments fini...

  9. Flight Tests of Instrumentation for Airborne Carbon Dioxide Flux Measurement (Essais en vol de L’Appareillage de Mesure en vol du Flux de Dioxyde de Carbone).

    Science.gov (United States)

    1983-10-01

    des mesures r~alistes des flux de chaleur et de CO2 i partir d’un avion muni d’lnstrument. capables de mesurer lee raales verticales. On a utilis6 des...based fuels, much less well understood are the rates of exchange between the atmosphere and the oceans and vegetation. For several years the...Agrometeorology Section of Agriculture Canada has been developing instrumentation and conducting ground- based experiments to measure the CO 2 exchange rate

  10. Remote Reactor Monitoring

    Energy Technology Data Exchange (ETDEWEB)

    Bernstein, Adam [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Dazeley, Steve [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Dobie, Doug [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Marleau, Peter [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Brennan, Jim [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Gerling, Mark [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Sumner, Matthew [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Sweany, Melinda [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2014-10-21

    The overall goal of the WATCHMAN project is to experimentally demonstrate the potential of water Cerenkov antineutrino detectors as a tool for remote monitoring of nuclear reactors. In particular, the project seeks to field a large prototype gadolinium-doped, water-based antineutrino detector to demonstrate sensitivity to a power reactor at ~10 kilometer standoff using a kiloton scale detector. The technology under development, when fully realized at large scale, could provide remote near-real-time information about reactor existence and operational status for small operating nuclear reactors out to distances of many hundreds of kilometers.

  11. Development of reactor graphite

    Science.gov (United States)

    Haag, G.; Mindermann, D.; Wilhelmi, G.; Persicke, H.; Ulsamer, W.

    1990-04-01

    The German graphite development programme for High Temperature Reactors has been based on the assumption that reactor graphite for core components with lifetime fluences of up to 4 × 10 22 neutrons per cm 2 (EDN) at 400°C can be manufactured from regular pitch coke. The use of secondary coke and vibrational moulding techniques have allowed production of materials with very small anisotropy, high strength, and high purity which are the most important properties of reactor graphite. A variety of graphite grades has been tested in fast neutron irradiation experiments. The results show that suitable graphites for modern High Temperature Reactors with spherical fuel elements are available.

  12. Oscillatory flow chemical reactors

    National Research Council Canada - National Science Library

    Slavnić Danijela S; Bugarski Branko M; Nikačević Nikola M

    2014-01-01

    .... However, the reactions of interests for the mentioned industry sectors are often slow, thus continuous tubular reactors would be impractically long for flow regimes which provide sufficient heat...

  13. Membrane reactors at Degussa.

    Science.gov (United States)

    Wöltinger, Jens; Karau, Andreas; Leuchtenberger, Wolfgang; Drauz, Karlheinz

    2005-01-01

    The review covers the development of membrane reactor technologies at Degussa for the synthesis of fine chemicals. The operation of fed-batch or continuous biocatalytic processes in the enzyme membrane reactor (EMR) is well established at Degussa. Degussa has experience of running EMRs from laboratory gram scale up to a production scale of several hundreds of tons per year. The transfer of the enzyme membrane reactor from biocatalysis to chemical catalysis in the chemzyme membrane reactor (CMR) is discussed. Various homogeneous catalysts have been investigated in the CMR, and the scope and limitation of this new technique is discussed.

  14. Pressurizing new reactors

    Energy Technology Data Exchange (ETDEWEB)

    Neill, J.S.

    1956-01-30

    The Technical Division was asked recently to consider designs for new reactors that would add 8000 MW capacity to the Savannah River Plant. One modification of the existing SRP design that would enable a higher power rating, and therefore require fewer new reactors, is an increase in the maximum pressure in the D{sub 2}O system. The existing reactors at SRP are designed for a maximum pressure in the gas plenum of only 5 psig. Higher pressures enable higher D{sub 2} temperatures and higher sheath temperatures without local boiling or burnout. The requirements in reactor cooling facilities at any given power level would therefore be reduced by pressurizing.

  15. HOMOGENEOUS NUCLEAR POWER REACTOR

    Science.gov (United States)

    King, L.D.P.

    1959-09-01

    A homogeneous nuclear power reactor utilizing forced circulation of the liquid fuel is described. The reactor does not require fuel handling outside of the reactor vessel during any normal operation including complete shutdown to room temperature, the reactor being selfregulating under extreme operating conditions and controlled by the thermal expansion of the liquid fuel. The liquid fuel utilized is a uranium, phosphoric acid, and water solution which requires no gus exhaust system or independent gas recombining system, thereby eliminating the handling of radioiytic gas.

  16. Antiviral therapy in chronic hepatitis C (G1 in Russia: cost and effectiveness

    Directory of Open Access Journals (Sweden)

    A. V. Rudakova

    2015-01-01

    Full Text Available Genotype 1 HCV treatment in Russia assume as bitherapy (pegylated interferon – PG plus ribavirin – RBV as three therapy based on HCV protease inhibitor such as telaprevir (TLV, boceprevir (BCV or simeprevir (SMV plus PG/RBV. Medical technologies characterize neither clinical effectiveness, safety profile nor cost-effectiveness so it’s crucial to assess different costs related antiviral regimens. Three therapy costs for naïve patients including TLV, BCV, SMV are higher bitherapy 2,6; 2,5; 3,1 times accordingly. Similar TLV and BCV effectiveness for naïve patients defines TLV or BCV as the preferable 1-st line regimen, depending on regional features of pricing. SMV and TLV efficacy is similar among naïve patients and ralapsers but SMV is affordable for partially responders and non-responders after previous bitherapy. SMV cost is 1,4 times higher vs TLV but SMV has improved tolerability, less drug-drug interactions and shorter course. Insufficient bitherapy effectiveness for G1 HCV (SVR 24 – 39%-55% is required repeated course of three therapy for half of patient population. The first line regimen based on innovation will improve clinical outcomes for more patients and provide cost saving vs previous bitherapy based on PG/RBV. 

  17. Dimethylfumarate effectively inhibits lymphangiogenesis via p21 induction and G1 cell cycle arrest.

    Science.gov (United States)

    Valesky, Eva Maria; Hrgovic, Igor; Doll, Monika; Wang, Xiao-Fan; Pinter, Andreas; Kleemann, Johannes; Kaufmann, Roland; Kippenberger, Stefan; Meissner, Markus

    2016-03-01

    Different pathologies, such as lymphoedema, cancer or psoriasis, are associated with abnormal lymphatic vessel formation. Therefore, influencing lymphangiogenesis is an interesting target. Recent evidence suggests that dimethylfumarate (DMF), an antipsoriatic agent, might have antitumorigenic and antilymphangiogenic properties. To prove this assumption, we performed proliferation and functional assays with primary human dermal lymphendothelial cells (DLEC). We could demonstrated that DMF suppresses DLEC proliferation and formation of capillary-like structures. Underlying apoptotic mechanisms could be ruled out. Cell cycle analysis demonstrated a pronounced G1-arrest. Further evaluations revealed increases in p21 expression. In addition, DMF suppressed Cyclin D1 and Cyclin A expression in a concentration-dependent manner. p21 knockdown experiments demonstrated a p21-dependent mechanism of regulation. Further analysis showed an increased p21 mRNA expression after DMF treatment. This transcriptional regulation was enforced by post-transcriptional and post-translational mechanisms. In addition, we could demonstrate that the combination of a proteasomal inhibitor and DMF superinduced the p21 expression. Hence, DMF is a new antilymphangiogenic compound and might be used in various illnesses associated with increased lymphangiogenesis. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  18. A gradient in the duration of the G1 phase in the murine neocortical proliferative epithelium

    Science.gov (United States)

    Miyama, S.; Takahashi, T.; Nowakowski, R. S.; Caviness, V. S. Jr

    1997-01-01

    Neuronogenesis in the neocortical pseudostratified ventricular epithelium (PVE) is initiated rostrolaterally and progresses caudo-medially as development progresses. Here we have measured the cytokinetic parameters and the fractional neuronal output parameter, Q, of laterally located early-maturing regions over the principal embryonic days (E12-E15) of neocortical neuronogenesis in the mouse. These measures are compared with ones previously made of a medial, late-maturing portion of the PVE. Laterally, as medially, the duration of the neuronogenetic interval is 6 days and comprises 11 integer cell cycles. Also, in both lateral and medial areas the length of G1 phase (TG1) increases nearly 4-fold and is the only cell cycle parameter to change. Q progresses essentially identically laterally and medially with respect to the succession of integer cell cycles. Most importantly, from E12 to E13 there is a steeply declining lateral to medial gradient in TG1. The gradient is due both to the lateral to medial graded stage of neuronogenesis and to the stepwise increase in TG1 with each integer cycle during the neuronogenetic interval. To our knowledge this gradient in TG1 of the cerebral PVE is the first cell biological gradient to be demonstrated experimentally in such an extensive proliferative epithelial sheet. We suggest that this gradient in TG1 is the cellular mechanism for positionally encoding a protomap of the neocortex within the PVE.

  19. Disrupted Asteroid P/2016 G1. II. Follow-up Observations from the Hubble Space Telescope

    Science.gov (United States)

    Moreno, F.; Licandro, J.; Mutchler, M.; Cabrera-Lavers, A.; Pinilla-Alonso, N.; Pozuelos, F. J.

    2017-12-01

    After the early observations of the disrupted asteroid P/2016 G1 with the 10.4 m Gran Telescopio Canarias (GTC) and modeling of the dust ejecta, we have performed a follow-up observational campaign of this object using the Hubble Space Telescope (HST) during two epochs (2016 June 28 and July 11). The analysis of these HST images with the same model inputs obtained from the GTC images revealed a good consistency with the predicted evolution from the GTC images, so that the model is applicable to the entire observational period from 2016 late April to early July. This result confirms that the resulting dust ejecta was caused by a relatively short-duration event with onset about 350 days before perihelion and spanning about 30 days (HWHM). For a size distribution of particles with a geometric albedo of 0.15, having radii limits of 1 μm and 1 cm, and following a power-law with index -3.0, the total dust mass ejected is ˜2 × 107 kg. As was the case with the GTC observations, no condensations in the images that could be attributed to a nucleus or fragments released after the disruption event were found. However, the higher limiting magnitude reachable with the HST images in comparison to those from GTC allowed us to impose a more stringent upper limit to the observed fragments of ˜30 m.

  20. Biosimilarity Assessments of Model IgG1-Fc Glycoforms Using a Machine Learning Approach.

    Science.gov (United States)

    Kim, Jae Hyun; Joshi, Sangeeta B; Tolbert, Thomas J; Middaugh, C Russell; Volkin, David B; Smalter Hall, Aaron

    2016-02-01

    Biosimilarity assessments are performed to decide whether 2 preparations of complex biomolecules can be considered "highly similar." In this work, a machine learning approach is demonstrated as a mathematical tool for such assessments using a variety of analytical data sets. As proof-of-principle, physical stability data sets from 8 samples, 4 well-defined immunoglobulin G1-Fragment crystallizable glycoforms in 2 different formulations, were examined (see More et al., companion article in this issue). The data sets included triplicate measurements from 3 analytical methods across different pH and temperature conditions (2066 data features). Established machine learning techniques were used to determine whether the data sets contain sufficient discriminative power in this application. The support vector machine classifier identified the 8 distinct samples with high accuracy. For these data sets, there exists a minimum threshold in terms of information quality and volume to grant enough discriminative power. Generally, data from multiple analytical techniques, multiple pH conditions, and at least 200 representative features were required to achieve the highest discriminative accuracy. In addition to classification accuracy tests, various methods such as sample space visualization, similarity analysis based on Euclidean distance, and feature ranking by mutual information scores are demonstrated to display their effectiveness as modeling tools for biosimilarity assessments. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  1. Screening of recombinant glycosyltransferases reveals the broad acceptor specificity of stevia UGT-76G1.

    Science.gov (United States)

    Dewitte, Griet; Walmagh, Maarten; Diricks, Margo; Lepak, Alexander; Gutmann, Alexander; Nidetzky, Bernd; Desmet, Tom

    2016-09-10

    UDP-glycosyltransferases (UGTs) are a promising class of biocatalysts that offer a sustainable alternative for chemical glycosylation of natural products. In this study, we aimed to characterize plant-derived UGTs from the GT-1 family with an emphasis on their acceptor promiscuity and their potential application in glycosylation processes. Recombinant expression in E. coli provided sufficient amounts of enzyme for the in-depth characterization of the salicylic acid UGT from Capsella rubella (UGT-SACr) and the stevia UGT from Stevia rebaudiana (UGT-76G1Sr). The latter was found to have a remarkably broad specificity with activities on a wide diversity of structures, from aliphatic and branched alcohols, over small phenolics to larger flavonoids, terpenoids and even higher glycoside compounds. As an example for its industrial potential, the glycosylation of curcumin was thoroughly evaluated. Under optimized conditions, 96% of curcumin was converted within 24h into the corresponding curcumin β-glycosides. In addition, the reaction was performed in a coupled system with sucrose synthase from Glycine max, to enable the cost-efficient (re)generation of UDP-Glc from sucrose as abundant and renewable resource. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Inhibition of G0/G1 Switch 2 Ameliorates Renal Inflammation in Chronic Kidney Disease.

    Science.gov (United States)

    Matsunaga, Naoya; Ikeda, Eriko; Kakimoto, Keisuke; Watanabe, Miyako; Shindo, Naoya; Tsuruta, Akito; Ikeyama, Hisako; Hamamura, Kengo; Higashi, Kazuhiro; Yamashita, Tomohiro; Kondo, Hideaki; Yoshida, Yuya; Matsuda, Masaki; Ogino, Takashi; Tokushige, Kazutaka; Itcho, Kazufumi; Furuichi, Yoko; Nakao, Takaharu; Yasuda, Kaori; Doi, Atsushi; Amamoto, Toshiaki; Aramaki, Hironori; Tsuda, Makoto; Inoue, Kazuhide; Ojida, Akio; Koyanagi, Satoru; Ohdo, Shigehiro

    2016-11-01

    Chronic kidney disease (CKD) is a global health problem, and novel therapies to treat CKD are urgently needed. Here, we show that inhibition of G0/G1 switch 2 (G0s2) ameliorates renal inflammation in a mouse model of CKD. Renal expression of chemokine (C-C motif) ligand 2 (Ccl2) was increased in response to p65 activation in the kidneys of wild-type 5/6 nephrectomy (5/6Nx) mice. Moreover, 5/6Nx Clk/Clk mice, which carry homozygous mutations in the gene encoding circadian locomotor output cycles kaput (CLOCK), did not exhibit aggravation of apoptosis or induction of F4/80-positive cells. The renal expression of G0s2 in wild-type 5/6Nx mice was important for the transactivation of Ccl2 by p65. These pathologies were ameliorated by G0s2 knockdown. Furthermore, a novel small-molecule inhibitor of G0s2 expression was identified by high-throughput chemical screening, and the inhibitor suppressed renal inflammation in 5/6Nx mice. These findings indicated that G0s2 inhibitors may have applications in the treatment of CKD. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  3. Emergence and Characterization of Unusual DS-1-Like G1P[8] Rotavirus Strains in Children with Diarrhea in Thailand.

    Directory of Open Access Journals (Sweden)

    Satoshi Komoto

    Full Text Available The emergence and rapid spread of unusual DS-1-like G1P[8] rotaviruses in Japan have been recently reported. During rotavirus surveillance in Thailand, three DS-1-like G1P[8] strains (RVA/Human-wt/THA/PCB-180/2013/G1P[8], RVA/Human-wt/THA/SKT-109/2013/G1P[8], and RVA/Human-wt/THA/SSKT-41/2013/G1P[8] were identified in stool specimens from hospitalized children with severe diarrhea. In this study, we sequenced and characterized the complete genomes of strains PCB-180, SKT-109, and SSKT-41. On whole genomic analysis, all three strains exhibited a unique genotype constellation including both genogroup 1 and 2 genes: G1-P[8]-I2-R2-C2-M2-A2-N2-T2-E2-H2. This novel genotype constellation is shared with Japanese DS-1-like G1P[8] strains. Phylogenetic analysis revealed that the G/P genes of strains PCB-180, SKT-109, and SSKT-41 appeared to have originated from human Wa-like G1P[8] strains. On the other hand, the non-G/P genes of the three strains were assumed to have originated from human DS-1-like strains. Thus, strains PCB-180, SKT-109, and SSKT-41 appeared to be derived through reassortment event(s between Wa-like G1P[8] and DS-1-like human rotaviruses. Furthermore, strains PCB-180, SKT-109, and SSKT-41 were found to have the 11-segment genome almost indistinguishable from one another in their nucleotide sequences and phylogenetic lineages, indicating the derivation of the three strains from a common origin. Moreover, all the 11 genes of the three strains were closely related to those of Japanese DS-1-like G1P[8] strains. Therefore, DS-1-like G1P[8] strains that have emerged in Thailand and Japan were assumed to have originated from a recent common ancestor. To our knowledge, this is the first report on whole genome-based characterization of DS-1-like G1P[8] strains that have emerged in an area other than Japan. Our observations will provide important insights into the evolutionary dynamics of emerging DS-1-like G1P[8] rotaviruses.

  4. Cleavage of IgG1 in gingival crevicular fluid is associated with the presence of Porphyromonas gingivalis.

    Science.gov (United States)

    Guentsch, A; Hirsch, C; Pfister, W; Vincents, B; Abrahamson, M; Sroka, A; Potempa, J; Eick, S

    2013-08-01

    Immunoglobulin (Ig) G1 plays an important role in the adaptive immune response. Kgp, a lysine-specific cysteine protease from Porphyromonas gingivalis, specifically hydrolyses IgG1 heavy chains. The purpose of this study was to examine whether cleavage of IgG1 occurs in gingival crevicular fluid (GCF) in vivo, and whether there is any association with the presence of Porphyromonas gingivalis and other periodontopathogens. GCF was obtained from nine patients with aggressive periodontitis, nine with chronic periodontitis and five periodontally healthy individuals. The bacterial loads of Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Treponema denticola, Prevotella intermedia and Tannerella forsythia were analysed by real-time polymerase chain reaction, and the presence and cleavage of IgG1 and IgG2 were determined using Western blotting. Kgp levels were measured by ELISA. Cleaved IgG1 was identified in the GCF from 67% of patients with aggressive periodontitis and in 44% of patients with chronic periodontitis. By contrast, no cleaved IgG1 was detectable in healthy controls. No degradation of IgG2 was detected in any of the samples, regardless of health status. Porphyromonas gingivalis was found in high numbers in all samples in which cleavage of IgG1 was detected (P Porphyromonas gingivalis (r = 0.425, P Porphyromonas gingivalis. © 2012 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Les fondements de la mesure du temps comment les fréquences atomiques règlent le monde

    CERN Document Server

    Audoin, Claude

    1998-01-01

    La mesure du temps fondée sur des propriétés atomiques est née en 1955, avec le premier étalon de fréquence à jet de césium. Depuis, les horloges atomiques ne cessent de progresser et sont au coeur de nombreuses activités, telles que les comparaisons de temps, l'unification mondiale de l'heure ou la recherche en astronomie, géodésie, géophysique, télécommunications, etc. Cet ouvrage fournira des réponses détaillées au lecteur intéressé par la mesure du temps appliquée aux divers domaines cités.

  6. Bancroftian filariasis: the patterns of filarial-specific immunoglobulin G1 (IgG1), IgG4, and circulating antigens in an endemic community of northeastern Tanzania

    DEFF Research Database (Denmark)

    Simonsen, P E; Lemnge, M M; Msangeni, H A

    1996-01-01

    in the examined population was 29%. Fifty-one percent of the population were positive for IgG1 (39% among mf-positive individuals and 63% among mf-negative individuals), whereas 90% were positive for IgG4 (97% among mf-positives and 87% among mf-negatives). The levels of IgG1 and IgG4 were clearly related to mf......The profile of filarial-specific immunoglobulin G1 (IgG1), IgG4, and Wuchereria bancrofti-specific circulating antigen (Og4C3) was analyzed in individuals one year of age and older in a community with high endemicity for Bancroftian filariasis. The overall microfilarial (mf) prevalence...

  7. Modelling of aflatoxin G1 reduction by kefir grain using response surface methodology.

    Science.gov (United States)

    Ansari, Farzaneh; Khodaiyan, Faramarz; Rezaei, Karamatollah; Rahmani, Anosheh

    2015-01-01

    Aflatoxin G1 (AFG1) is one of the main toxic contaminants in pistachio nuts and causes potential health hazards. Hence, AFG1 reduction is one of the main concerns in food safety. Kefir-grains contain symbiotic association of microorganisms well known for their aflatoxin decontamination effects. In this study, a central composite design (CCD) using response surface methodology (RSM) was applied to develop a model in order to predict AFG1 reduction in pistachio nuts by kefir-grain (already heated at 70 and 110°C). The independent variables were: toxin concentration (X1: 5, 10, 15, 20 and 25 ng/g), kefir-grain level (X2: 5, 10, 20, 10 and 25%), contact time (X3: 0, 2, 4, 6 and 8 h), and incubation temperature (X4: 20, 30, 40, 50 and 60°C). There was a significant reduction in AFG1 (p kefir-grain used. The variables including X1, X3 and the interactions between X2-X4 as well as X3-X4 have significant effects on AFG1 reduction. The model provided a good prediction of AFG1 reduction under the assay conditions. Optimization was used to enhance the efficiency of kefir-grain on AFG1 reduction. The optimum conditions for the highest AFG1 reduction (96.8%) were predicted by the model as follows: toxin concentration = 20 ng/g, kefir-grain level = 10%, contact time = 6 h, and incubation temperature = 30°C which validated practically in six replications.

  8. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-06-01

    Full Text Available Weiyi Huang,* Haihua Huang,* Lei Wang, Jiong Hu, Weifeng Song Department of Oncology, The First People’s Hospital Affiliated to Shanghai Jiaotong University, Shanghai, People’s Republic of China *These authors contributed equally to this work Purpose: Cytoskeleton is critical for carcinoma cell proliferation, migration, and invasion. Sad-1 and UNC-84 domain containing 1 (SUN1 is one of the core linkers of nucleoskeleton and cytoskeleton. However, the functions of SUN1 in lung adenocarcinoma are largely unknown.Methods: In this study, we first transduced the lentivirus delivering the short hairpin RNA (shRNA against SUN1 to lung adenocarcinoma cells (A549 and 95D cells with high efficiency. After lentivirus infection, quantitative real-time polymerase chain reaction and Western blotting were used to detect the expressions of SUN1 mRNA and protein. The cell proliferation and colony formation were detected by MTT assay and colony formation assay, respectively. The cell distribution in the cell cycle was analyzed by flow cytometry.Results: Both mRNA and protein levels of SUN1 were significantly decreased in A549 and 95D cells after lentivirus infection, as indicated by quantitative real-time polymerase chain reaction and Western blot. Next, we found that cell proliferation and colony formation were markedly reduced in SUN1 silenced cells. Moreover, suppression of SUN1 led to cell cycle arrest at G0/G1 phase. Furthermore, Cyclin D1, CDK6, and CDK2 expressions were obviously reduced in A549 cells after SUN1 silencing.Conclusion: These results suggest that SUN1 plays an essential role in proliferation of lung adenocarcinoma cells in vitro and may be used as a potential therapeutic target for the treatment of lung adenocarcinoma in the future. Keywords: SUN1, lung cancer, proliferation

  9. Differential Regulation of G1 CDK Complexes by the Hsp90-Cdc37 Chaperone System

    Directory of Open Access Journals (Sweden)

    Stephen T. Hallett

    2017-10-01

    Full Text Available Summary: Selective recruitment of protein kinases to the Hsp90 system is mediated by the adaptor co-chaperone Cdc37. We show that assembly of CDK4 and CDK6 into protein complexes is differentially regulated by the Cdc37-Hsp90 system. Like other Hsp90 kinase clients, binding of CDK4/6 to Cdc37 is blocked by ATP-competitive inhibitors. Cdc37-Hsp90 relinquishes CDK6 to D3- and virus-type cyclins and to INK family CDK inhibitors, whereas CDK4 is relinquished to INKs but less readily to cyclins. p21CIP1 and p27KIP1 CDK inhibitors are less potent than the INKs at displacing CDK4 and CDK6 from Cdc37. However, they cooperate with the D-type cyclins to generate CDK4/6-containing ternary complexes that are resistant to cyclin D displacement by Cdc37, suggesting a molecular mechanism to explain the assembly factor activity ascribed to CIP/KIP family members. Overall, our data reveal multiple mechanisms whereby the Hsp90 system may control formation of CDK4- and CDK6-cyclin complexes under different cellular conditions. : Hallett et al. reconstitute CDK4/6 client kinase handover from Cdc37-Hsp90 to CDK regulatory partners and propose a model for the assembly factor activity of CIP/KIP CDK inhibitors. They find that CDK4/6 inhibitors in clinical use can displace G1 CDKs from the Cdc37-Hsp90 chaperone system at submicromolar concentrations. Keywords: Cdc37, CDK, chaperone, CIP/KIP, cyclin D, Hsp90, INK, kinase, palbociclib, ribociclib

  10. Acetylbritannilactone induces G1 arrest and apoptosis in vascular smooth muscle cells.

    Science.gov (United States)

    Liu, Bin; Han, Mei; Sun, Rong-Hua; Wang, Jun-Jie; Liu, Yue-Ping; Wen, Jin-Kun

    2011-05-19

    The present study was designed to determine the effects of Acetylbritannilactone (ABL), a naturally occurring Inula britannica L., on vascular smooth muscle cell (VSMC) proliferation and apoptosis. In vitro experiments were performed to evaluate the effects of ABL on the VSMC cycle and apoptosis stimulated by chemoattractant. In addition, to examine the effects of ABL in vivo, balloon injury to rat carotid arteries was performed. ABL treatment inhibited platelet-derived growth factor (PDGF) induced DNA synthesis and proliferation in cultured VSMC. Such growth-inhibitory effects of ABL were associated with G1 phase arrest, which were correlated with reduction of cyclins D1, A, and E expression and cyclin-dependent kinase (CDK) 2, CDK4, and CDK6 proteins, increased the CDK inhibitory protein p21cip1 expression, and enhanced the binding of p21cip1 to CDKs. In addition, ABL also induced apoptosis in proliferative VSMCs, as evidenced by the induction of a higher ratio of Bax/Bcl-2, activation of caspase-9, caspase-3, and the cleavage of endogenous substrate Poly (ADP-ribose) polymerase. However, pretreatment with pan-caspases inhibitor (z-VAD-fmk) only partially reversed ABL-induced apoptosis, suggesting the involvement of both caspase-dependent and caspase-independent pathways in these processes. Furthermore, the effects of ABL on VSMCs were associated with the downregulation of extracellular signal-regulated kinase (ERK) 1/2 signaling pathways. In vivo, ABL (26 mg/kg/day) significantly suppressed injury-induced ERK1/2 phosphorylation, and increased VSMC apoptosis 14 days after balloon injury. Our findings demonstrated that ABL was capable of suppressing the abnormal VSMC proliferation, accompanied by the induction of apoptosis in vivo and in vitro. It suggested that ABL could be considered a pharmacological candidate for the prevention of restenosis after balloon angioplasty. Copyright © 2009 Elsevier Ireland Ltd. All rights reserved.

  11. The g0/g1 switch gene 2 is an important regulator of hepatic triglyceride metabolism.

    Directory of Open Access Journals (Sweden)

    Yinfang Wang

    Full Text Available Nonalcoholic fatty liver disease is associated with obesity and insulin resistance. Factors that regulate the disposal of hepatic triglycerides contribute to the development of hepatic steatosis. G0/G1 switch gene 2 (G0S2 is a target of peroxisome proliferator-activated receptors and plays an important role in regulating lipolysis in adipocytes. Therefore, we investigated whether G0S2 plays a role in hepatic lipid metabolism. Adenovirus-mediated expression of G0S2 (Ad-G0S2 potently induced fatty liver in mice. The liver mass of Ad-G0S2-infected mice was markedly increased with excess triglyceride content compared to the control mice. G0S2 did not change cellular cholesterol levels in hepatocytes. G0S2 was found to be co-localized with adipose triglyceride lipase at the surface of lipid droplets. Hepatic G0S2 overexpression resulted in an increase in plasma Low-density lipoprotein (LDL/Very-Low-density (VLDL lipoprotein cholesterol level. Plasma High-density lipoprotein (HDL cholesterol and ketone body levels were slightly decreased in Ad-G0S2 injected mice. G0S2 also increased the accumulation of neutral lipids in cultured HepG2 and L02 cells. However, G0S2 overexpression in the liver significantly improved glucose tolerance in mice. Livers expressing G0S2 exhibited increased 6-(N-(7-nitrobenz-2-oxa-1-3-diazol-4-yl amino-6-deoxyglucose uptake compared with livers transfected with control adenovirus. Taken together, our results provide evidence supporting an important role for G0S2 as a regulator of triglyceride content in the liver and suggest that G0S2 may be a molecular target for the treatment of insulin resistance and other obesity-related metabolic disorders.

  12. Asymmetric Expansion of the Youngest Galactic Supernova Remnant G1.9+0.3

    Science.gov (United States)

    Borkowski, Kazimierz J.; Gwynne, Peter; Reynolds, Stephen P.; Green, David A.; Hwang, Una; Petre, Robert; Willett, Rebecca

    2017-03-01

    The youngest Galactic supernova remnant (SNR) G1.9+0.3, produced by a (probable) SN Ia that exploded ˜1900 CE, is strongly asymmetric at radio wavelengths, much brighter in the north, but bilaterally symmetric in X-rays. We present the results of X-ray expansion measurements that illuminate the origin of the radio asymmetry. We confirm the mean expansion rate (2011-2015) of 0.58% yr-1, but large spatial variations are present. Using the nonparametric “Demons” method, we measure the velocity field throughout the entire SNR, finding that motions vary by a factor of 5, from 0\\buildrel{\\prime\\prime}\\over{.} 09 to 0\\buildrel{\\prime\\prime}\\over{.} 44 yr-1. The slowest shocks are at the outer boundary of the bright northern radio rim, with velocities v s as low as 3600 km s-1 (for an assumed distance of 8.5 kpc), much less than v s = 12,000-13,000 km s-1 along the X-ray-bright major axis. Such strong deceleration of the northern blast wave most likely arises from the collision of SN ejecta with a much denser than average ambient medium there. This asymmetric ambient medium naturally explains the radio asymmetry. In several locations, significant morphological changes and strongly nonradial motions are apparent. The spatially integrated X-ray flux continues to increase with time. Based on Chandra observations spanning 8.3 yr, we measure its increase at 1.3 % +/- 0.8 % yr-1. The SN ejecta are likely colliding with the asymmetric circumstellar medium ejected by the SN progenitor prior to its explosion.

  13. Mesure du taux de la capture radiative du muon par l'hydrogene liquide

    Science.gov (United States)

    Jonkmans, Guy

    À basse énergie, l'interaction faible entre leptons et quarks est décrite par une interaction de la forme courant × courant de type V - A. La présence de l'interaction forte induit des couplages additionnels qui doivent être déterminés expérimentalement. De ceux-ci, le couplage pseudoscalaire induit, gp , est mesuré avec la plus grande incertitude et fait l'objet de la présente recherche. L'hypothèse du Courant Axial Partiellement Conservé (CAPC) et l'usage de la relation de Goldberger-Treiman relie gp au couplage axial ga . Cette relation a été vérifiée traditionnellement par la Capture Ordinaire du Muon (COM) à une valeur fixe du moment de transfert q. La Capture Radiative du Muon (CRM), m- p-->nnmg , est un meilleur outil pour l'étude de gp à cause de sa dépendance variable en q2 qui offre une plus grande sensibilité dans la partie à haute énergie du spectre des photons. Toutefois, le petit rapport d'embranchement (~10-8) de la CRM par rapport à la désintégration du muon a retardé cette mesure jusqu'à ce jour. La théorie et les difficultés expérimentales associées à la détection des photons de CRM sont présentées au deuxième chapitre. On décrit ensuite, au troisième chapitre, les composantes du système de détection. Ce détecteur est un spectromètre à paires de grand angle solide (~3p) et qui permet l'observation des photons par l'analyse des électrons et des positrons de photo-conversion. Ainsi, le bruit de fond important des neutrons de la COM ne constitue pas un problème pour cette mesure. Nous décrivons, au quatrième chapitre, toutes les étapes de l'analyse, nécessaires pour la réduction des multiples bruits de fond. Le cinquième chapitre présente le calcul des efficacités ainsi que l'estimation des erreurs systématiques. Le sixième chapitre démontre comment l'on extrait le rapport d'embranchement pour la CRM ainsi que la valeur ae gp . On insiste sur la dépendance de gp en fonction de la valeur de

  14. Absolute measurement of {beta} emitters with a 4 {pi} counter; Mesure absolue des emetteurs {beta} au compteur 4 {pi}

    Energy Technology Data Exchange (ETDEWEB)

    Le Gallic, Y. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1959-06-15

    The object of this work is to investigate the conditions under which the activity of {beta}-emitting radionuclides may be measured with a maximum of precision, and as a result to study the relevant corrections. The various problems relating to activity measurements with a 4 {pi} counter have been examined successively: - comparison of 4 {pi}, GM and proportional counters; - study of the preparation of sources; - corrections on the counting of sources; - self-absorption; - correction for absorption. The precision obtained on these measurements varies from 1.2 to 3 per cent, with the result that the 4 {pi} counter can be considered a very satisfactory calibration instrument. (author) [French] Le but de ce travail est de rechercher les conditions permettant d'obtenir avec le maximum de precision, la mesure de l'activite des radionuclides se desintegrant par emission et par consequent d'etudier les corrections qui s'y rapportent. Nous avons examine successivement les differents problemes se rapportant aux mesures d'activite au compteur 4 {pi}: - Comparaison des compteurs 4 {pi}, GM et proportionnel; - etude de la preparation des sources; - corrections sur la numeration des sources; - auto-absorption; - correction d'absorption. La precision obtenue dans ces mesures, variant de 1,2 a 3 pour cent, on peut donc considerer le compteur 4 {pi} comme un instrument d'etalonnage tres satisfaisant. (auteur)

  15. Dispositif de mesure de pertes dans les conducteurs supraconducteurs utilisés en régime variable

    Science.gov (United States)

    Le Naour, S.; Lacaze, A.; Laumond, Y.

    1998-01-01

    A thermometric apparatus to measure AC losses in superconductor wires for 50 Hz applications is described. This method consists in isolating the sample from a helium bath via a thermal resistance. Dissipated power is determined by two thermometers located on both edges of a thermal resistance. The measurement's calibration is done using an ohmic heater. The measurement accuracy is 10% for losses in excess of 2 mW/m. Un dispositif expérimental, pour mesurer les pertes générées dans les conducteurs supraconducteurs utilisés en régime alternatif 50 Hz, est décrit. La méthode, basée sur le principe thermométrique, consiste à isoler l'échantillon du bain d'hélium par une résistance thermique. La puissance dissipée est déterminée à l'aide de deux sondes de température disposées de part et d'autre de la résistance. L'étalonnage de la mesure est assuré par une chaufferette. La précision des mesures est de 10% pour des pertes linéiques supérieures à 2 mW/m.

  16. Technical specifications, Hanford production reactors

    Energy Technology Data Exchange (ETDEWEB)

    Gilbert, W.D. [comp.

    1962-06-25

    These technical specifications are applicable to the eight operating production reactor facilities, B, C, D, DR, F, H, KE, and KW. Covered are operating and performance restrictions and administrative procedures. Areas covered by the operating and performance restrictions are reactivity, reactor control and safety elements, power level, temperature and heat flux, reactor fuel loadings, reactor coolant systems, reactor confinement, test facilities, code compliance, and reactor scram set points. Administrative procedures include process control procedures, training programs, audits and inspections, and reports and records.

  17. Reactor Materials Research

    Energy Technology Data Exchange (ETDEWEB)

    Van Walle, E

    2001-04-01

    The activities of the Reactor Materials Research Department of the Belgian Nuclear Research Centre SCK-CEN in 2000 are summarised. The programmes within the department are focussed on studies concerning (1) fusion, in particular mechanical testing; (2) Irradiation Assisted Stress Corrosion Cracking (IASCC); (3) nuclear fuel; and (4) Reactor Pressure Vessel Steel (RPVS)

  18. Space Nuclear Reactor Engineering

    Energy Technology Data Exchange (ETDEWEB)

    Poston, David Irvin [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-03-06

    We needed to find a space reactor concept that could be attractive to NASA for flight and proven with a rapid turnaround, low-cost nuclear test. Heat-pipe-cooled reactors coupled to Stirling engines long identified as the easiest path to near-term, low-cost concept.

  19. REFLECTOR FOR NEUTRONIC REACTORS

    Science.gov (United States)

    Fraas, A.P.

    1963-08-01

    A reflector for nuclear reactors that comprises an assembly of closely packed graphite rods disposed with their major axes substantially perpendicular to the interface between the reactor core and the reflector is described. Each graphite rod is round in transverse cross section at (at least) its interface end and is provided, at that end, with a coaxial, inwardly tapering hole. (AEC)

  20. Mirror reactor surface study

    Energy Technology Data Exchange (ETDEWEB)

    Hunt, A. L.; Damm, C. C.; Futch, A. H.; Hiskes, J. R.; Meisenheimer, R. G.; Moir, R. W.; Simonen, T. C.; Stallard, B. W.; Taylor, C. E.

    1976-09-01

    A general survey is presented of surface-related phenomena associated with the following mirror reactor elements: plasma first wall, ion sources, neutral beams, director converters, vacuum systems, and plasma diagnostics. A discussion of surface phenomena in possible abnormal reactor operation is included. Several studies which appear to merit immediate attention and which are essential to the development of mirror reactors are abstracted from the list of recommended areas for surface work. The appendix contains a discussion of the fundamentals of particle/surface interactions. The interactions surveyed are backscattering, thermal desorption, sputtering, diffusion, particle ranges in solids, and surface spectroscopic methods. A bibliography lists references in a number of categories pertinent to mirror reactors. Several complete published and unpublished reports on surface aspects of current mirror plasma experiments and reactor developments are also included.

  1. Nuclear reactor design

    CERN Document Server

    2014-01-01

    This book focuses on core design and methods for design and analysis. It is based on advances made in nuclear power utilization and computational methods over the past 40 years, covering core design of boiling water reactors and pressurized water reactors, as well as fast reactors and high-temperature gas-cooled reactors. The objectives of this book are to help graduate and advanced undergraduate students to understand core design and analysis, and to serve as a background reference for engineers actively working in light water reactors. Methodologies for core design and analysis, together with physical descriptions, are emphasized. The book also covers coupled thermal hydraulic core calculations, plant dynamics, and safety analysis, allowing readers to understand core design in relation to plant control and safety.

  2. Status of French reactors

    Energy Technology Data Exchange (ETDEWEB)

    Ballagny, A. [Commissariat a l`Energie Atomique, Saclay (France)

    1997-08-01

    The status of French reactors is reviewed. The ORPHEE and RHF reactors can not be operated with a LEU fuel which would be limited to 4.8 g U/cm{sup 3}. The OSIRIS reactor has already been converted to LEU. It will use U{sub 3}Si{sub 2} as soon as its present stock of UO{sub 2} fuel is used up, at the end of 1994. The decision to close down the SILOE reactor in the near future is not propitious for the start of a conversion process. The REX 2000 reactor, which is expected to be commissioned in 2005, will use LEU (except if the fast neutrons core option is selected). Concerning the end of the HEU fuel cycle, the best option is reprocessing followed by conversion of the reprocessed uranium to LEU.

  3. Study of interactions between odorant molecules and the hOR1G1 olfactory receptor by molecular modeling

    Directory of Open Access Journals (Sweden)

    Assia Belhassan

    2017-11-01

    Full Text Available In order to initiate the process of determining how the molecular level receptor-odorant interactions are related to odor perception, we used the SWISS-MODEL modeling server to predict the three dimensional (3D structure of the human olfactory receptor (hOR1G1. The model was refined using minimization and side-chain optimization using SCWRL. We then used the Autodockvina and Autodock tools to predict the binding site and binding energy for the library of 13 odorants characterized by different retention/release property values to hOR1G1 receptor, to investigate the relationship between this property and the ligand-hOR1G1 interactions. We find that when the retention property increases, hydrogen bond interactions between ligands and olfactory receptor (hOR1G1 become favorable.

  4. Final COMPASS results on the deuteron spin-dependent structure function g1d and the Bjorken sum rule

    Directory of Open Access Journals (Sweden)

    C. Adolph

    2017-06-01

    Full Text Available Final results are presented from the inclusive measurement of deep-inelastic polarised-muon scattering on longitudinally polarised deuterons using a 6LiD target. The data were taken at 160 GeV beam energy and the results are shown for the kinematic range 1(GeV/c24GeV/c2 in the mass of the hadronic final state. The deuteron double-spin asymmetry A1d and the deuteron longitudinal-spin structure function g1d are presented in bins of x and Q2. Towards lowest accessible values of x, g1d decreases and becomes consistent with zero within uncertainties. The presented final g1d values together with the recently published final g1p values of COMPASS are used to again evaluate the Bjorken sum rule and perform the QCD fit to the g1 world data at next-to-leading order of the strong coupling constant. In both cases, changes in central values of the resulting numbers are well within statistical uncertainties. The flavour-singlet axial charge a0, which is identified in the MS‾ renormalisation scheme with the total contribution of quark helicities to the nucleon spin, is extracted at next-to-leading order accuracy from only the COMPASS deuteron data: a0(Q2=3(GeV/c2=0.32±0.02stat±0.04syst±0.05evol. Together with the recent results on the proton spin structure function g1p, the results on g1d constitute the COMPASS legacy on the measurements of g1 through inclusive spin-dependent deep inelastic scattering.

  5. Evaluation of NK cell level and HLA-G1 expression in peripheral blood in threatened-abortion

    Directory of Open Access Journals (Sweden)

    Saeideh Sadat Shobeiri

    2015-05-01

    Conclusion: Decreasing of human leukocyte antigen-G1 expression with increasing of natural killer cells level in threatened-abortion pregnant women is an indicator of mother's immune system dysregulation in comparison with control group. Therefore, it is concluded that in the threatened-abortion pregnant women, human leukocyte antigen-G1 expression level with natural killer cells percent as diagnostic marker must be determine.

  6. Endothelial ATP-binding cassette G1 in mouse endothelium protects against hemodynamic-induced atherosclerosis

    Energy Technology Data Exchange (ETDEWEB)

    Xue, Shanshan [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Department of Pediatrics, Baodi District People’s Hospital of Tianjin City, Tianjin, 301800 (China); Wang, Jiaxing [Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, 100191 (China); Zhang, Xu; Shi, Ying; Li, Bochuan; Bao, Qiankun [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Pang, Wei [Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, 100191 (China); Ai, Ding [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Zhu, Yi [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China); Department of Physiology and Pathophysiology, Peking University Health Science Center, Beijing, 100191 (China); He, Jinlong, E-mail: hejinlong@tmu.edu.cn [Department of Physiology and Pathophysiology, Tianjin Medical University, Tianjin, 300070 (China)

    2016-08-19

    Activated vascular endothelium inflammation under persistent hyperlipidemia is the initial step of atherogenesis. ATP-binding cassette G1 (ABCG1) is a crucial factor maintaining sterol and lipid homeostasis by transporting cholesterol efflux to high-density lipoprotein. In this study, we investigated the protective effects of ABCG1 in endothelial inflammation activation during early-stage atherogenesis in mice and the underlying mechanisms. Endothelial cell (EC)-specific ABCG1 transgenic (EC-ABCG1-Tg) mice were generated and cross-bred with low-density lipoprotein receptor–deficient (Ldlr{sup −/−}) mice. After a 4-week Western-type diet, the mice were sacrificed for assessing atherosclerosis. Human umbilical vein ECs were treated with different flows, and ABCG1 was adenovirally overexpressed to investigate the mechanism in vitro. Compared with Ldlr{sup −/−} mouse aortas, EC-ABCG1-Tg/Ldlr{sup −/−} aortas showed decreased early-stage lesions. Furthermore, the lesion area in the EC-ABCG1-Tg/Ldlr{sup −/−} mouse aortic arch but not thoracic aorta was significantly reduced, which suggests a protective role of ABCG1 under atheroprone flow. In vitro, overexpression of ABCG1 attenuated EC activation caused by oscillatory shear stress. Overexpression of ABCG1 blunted cholesterol-activated ECs in vitro. In exploring the mechanisms of ABCG1 attenuating endothelial inflammation, we found that ABCG1 inhibited oscillatory flow-activated nuclear factor kappa B and NLRP3 inflammasome in ECs. ABCG1 may play a protective role in early-stage atherosclerosis by reducing endothelial activation induced by oscillatory shear stress via suppressing the inflammatory response. - Highlights: • EC-ABCG1-Tg mice in a Ldlr{sup −/−} background showed decreased atherosclerosis. • Overexpression of ABCG1 in ECs decreased OSS-induced EC activation. • NLRP3 and NF-κB might be an underlying mechanism of ABCG1 protective role.

  7. FACT prevents the accumulation of free histones evicted from transcribed chromatin and a subsequent cell cycle delay in G1.

    Directory of Open Access Journals (Sweden)

    Macarena Morillo-Huesca

    2010-05-01

    Full Text Available The FACT complex participates in chromatin assembly and disassembly during transcription elongation. The yeast mutants affected in the SPT16 gene, which encodes one of the FACT subunits, alter the expression of G1 cyclins and exhibit defects in the G1/S transition. Here we show that the dysfunction of chromatin reassembly factors, like FACT or Spt6, down-regulates the expression of the gene encoding the cyclin that modulates the G1 length (CLN3 in START by specifically triggering the repression of its promoter. The G1 delay undergone by spt16 mutants is not mediated by the DNA-damage checkpoint, although the mutation of RAD53, which is otherwise involved in histone degradation, enhances the cell-cycle defects of spt16-197. We reveal how FACT dysfunction triggers an accumulation of free histones evicted from transcribed chromatin. This accumulation is enhanced in a rad53 background and leads to a delay in G1. Consistently, we show that the overexpression of histones in wild-type cells down-regulates CLN3 in START and causes a delay in G1. Our work shows that chromatin reassembly factors are essential players in controlling the free histones potentially released from transcribed chromatin and describes a new cell cycle phenomenon that allows cells to respond to excess histones before starting DNA replication.

  8. Developpement d'une methode calorimetrique de mesure des pertes ac pour des rubans supraconducteurs a haute temperature critique

    Science.gov (United States)

    Dolez, Patricia

    Le travail de recherche effectue dans le cadre de ce projet de doctorat a permis la mise au point d'une methode de mesure des pertes ac destinee a l'etude des supraconducteurs a haute temperature critique. Pour le choix des principes de cette methode, nous nous sommes inspires de travaux anterieurs realises sur les supraconducteurs conventionnels, afin de proposer une alternative a la technique electrique, presentant lors du debut de cette these des problemes lies a la variation du resultat des mesures selon la position des contacts de tension sur la surface de l'echantillon, et de pouvoir mesurer les pertes ac dans des conditions simulant la realite des futures applications industrielles des rubans supraconducteurs: en particulier, cette methode utilise la technique calorimetrique, associee a une calibration simultanee et in situ. La validite de la methode a ete verifiee de maniere theorique et experimentale: d'une part, des mesures ont ete realisees sur des echantillons de Bi-2223 recouverts d'argent ou d'alliage d'argent-or et comparees avec les predictions theoriques donnees par Norris, nous indiquant la nature majoritairement hysteretique des pertes ac dans nos echantillons; d'autre part, une mesure electrique a ete realisee in situ dont les resultats correspondent parfaitement a ceux donnes par notre methode calorimetrique. Par ailleurs, nous avons compare la dependance en courant et en frequence des pertes ac d'un echantillon avant et apres qu'il ait ete endommage. Ces mesures semblent indiquer une relation entre la valeur du coefficient de la loi de puissance modelisant la dependance des pertes avec le courant, et les inhomogeneites longitudinales du courant critique induites par l'endommagement. De plus, la variation en frequence montre qu'au niveau des grosses fractures transverses creees par l'endommagement dans le coeur supraconducteur, le courant se partage localement de maniere a peu pres equivalente entre les quelques grains de matiere

  9. Divergence of VP7 genes of G1 rotaviruses isolated from infants vaccinated with reassortant rhesus rotaviruses.

    Science.gov (United States)

    Jin, Q; Ward, R L; Knowlton, D R; Gabbay, Y B; Linhares, A C; Rappaport, R; Woods, P A; Glass, R I; Gentsch, J R

    1996-01-01

    A large placebo-controlled efficacy trial of the rhesus tetravalent (RRV-TV) and serotype G1 monovalent (RRV-S1) rotavirus vaccines was conducted in 1991-1992 at 24 sites across the United States. Protection was 49% and 54% against all diarrhea but 80% and 69% against very severe gastroenteritis for the two vaccines, respectively. Post-vaccination neutralizing antibody titers to the G1 Wa strain, whose VP7 protein is nearly identical to that of the D strain of rotavirus contained in both vaccines, did not correlate with protection against subsequent illness with G1 strains. This result raised the possibility that in infants who developed post-vaccination neutralizing antibody to Wa, breakthrough (i.e., vaccine failure-the occurrence of rotavirus diarrhea after immunization) may have been due to infection by G1 strains that were sufficiently antigenically distinct from the vaccine strain to evade the neutralizing antibodies elicited by vaccination. To test this hypothesis, we initially compared post-vaccination neutralizing antibody titers of vaccinees against Wa and G1 breakthrough strains using sera from subjects who experienced breakthrough. Post-immunization neutralizing antibody titers to Wa elicited by vaccination were significantly (P correlate with lack of protection since similar differences in titer to Wa and breakthrough strains were found using post-vaccination sera from vaccinees who either experienced asymptomatic rotavirus infections or no infections. To determine the genetic basis for these differences, we compared the VP7 gene sequences of Wa with vaccine strain D, 12 G1 breakthrough strains, and 3 G1 control strains isolated during the same trial from placebo recipients. All breakthrough strains were distinct from Wa and D in antigenically important regions throughout the VP7 protein, but these differences were conserved between breakthrough and placebo strains. Furthermore, a comparative analysis of the deduced amino sequences form VP7 genes of G1

  10. Nuclear reactor control column

    Science.gov (United States)

    Bachovchin, Dennis M.

    1982-01-01

    The nuclear reactor control column comprises a column disposed within the nuclear reactor core having a variable cross-section hollow channel and containing balls whose vertical location is determined by the flow of the reactor coolant through the column. The control column is divided into three basic sections wherein each of the sections has a different cross-sectional area. The uppermost section of the control column has the greatest cross-sectional area, the intermediate section of the control column has the smallest cross-sectional area, and the lowermost section of the control column has the intermediate cross-sectional area. In this manner, the area of the uppermost section can be established such that when the reactor coolant is flowing under normal conditions therethrough, the absorber balls will be lifted and suspended in a fluidized bed manner in the upper section. However, when the reactor coolant flow falls below a predetermined value, the absorber balls will fall through the intermediate section and into the lowermost section, thereby reducing the reactivity of the reactor core and shutting down the reactor.

  11. Reactor Safety Research Programs

    Energy Technology Data Exchange (ETDEWEB)

    Edler, S. K.

    1981-07-01

    This document summarizes the work performed by Pacific Northwest Laboratory (PNL) from January 1 through March 31, 1981, for the Division of Reactor Safety Research within the U.S. Nuclear Regulatory Commission (NRC). Evaluations of nondestructive examination (NDE) techniques and instrumentation are reported; areas of investigation include demonstrating the feasibility of determining the strength of structural graphite, evaluating the feasibility of detecting and analyzing flaw growth in reactor pressure boundary systems, examining NDE reliability and probabilistic fracture mechanics, and assessing the integrity of pressurized water reactor (PWR) steam generator tubes where service-induced degradation has been indicated. Experimental data and analytical models are being provided to aid in decision-making regarding pipeto- pipe impacts following postulated breaks in high-energy fluid system piping. Core thermal models are being developed to provide better digital codes to compute the behavior of full-scale reactor systems under postulated accident conditions. Fuel assemblies and analytical support are being provided for experimental programs at other facilities. These programs include loss-ofcoolant accident (LOCA) simulation tests at the NRU reactor, Chalk River, Canada; fuel rod deformation, severe fuel damage, and postaccident coolability tests for the ESSOR reactor Super Sara Test Program, Ispra, Italy; the instrumented fuel assembly irradiation program at Halden, Norway; and experimental programs at the Power Burst Facility, Idaho National Engineering Laboratory (INEL). These programs will provide data for computer modeling of reactor system and fuel performance during various abnormal operating conditions.

  12. Reactor power monitoring device

    Energy Technology Data Exchange (ETDEWEB)

    Oda, Naotaka; Igawa, Shinji; Kitazono, Hideaki

    1998-02-13

    The present invention provides a reactor power monitoring device capable of ensuring circumstance resistance, high reliability and high speed transmission even if an APRM is disposed in a reactor building (R/B). Namely, signal processing sections (APRM) for transmitting data to a central control chamber are distributed in the reactor building at an area at the lowest temperature among areas where the temperature control in an emergency state is regulated, and a transmission processing section (APRM-I/F) for transmitting data to the other systems is disposed to the central control chamber. An LPRM signal transmission processing section is constituted such that LPRM signals can be transmitted at a high speed by DMA. Set values relevant to reactor tripping (neutron flux high, thermal output high and sudden reduction of a reactor core flow rate) are stored in the APRM-I/F, and reactor tripping calculation is conducted in the APRM-I/F. With such procedure, a reactor power monitoring device having enhanced control function can be attained. (N.H.)

  13. Nuclear reactor reflector

    Science.gov (United States)

    Hopkins, R.J.; Land, J.T.; Misvel, M.C.

    1994-06-07

    A nuclear reactor reflector is disclosed that comprises a stack of reflector blocks with vertical water flow passages to cool the reflector. The interface between blocks is opposite support points for reactor fuel rods. Water flows between the reflector and the reactor barrel from passages in a bottom block. The top block contains a flange to limit this flow and the flange has a slot to receive an alignment pin that is welded to the barrel. The pin is held in the slot by two removable shims. Alignment bars extend the length of the stack in slots machined in each block when the stack is assembled. 12 figs.

  14. Fast Breeder Reactor studies

    Energy Technology Data Exchange (ETDEWEB)

    Till, C.E.; Chang, Y.I.; Kittel, J.H.; Fauske, H.K.; Lineberry, M.J.; Stevenson, M.G.; Amundson, P.I.; Dance, K.D.

    1980-07-01

    This report is a compilation of Fast Breeder Reactor (FBR) resource documents prepared to provide the technical basis for the US contribution to the International Nuclear Fuel Cycle Evaluation. The eight separate parts deal with the alternative fast breeder reactor fuel cycles in terms of energy demand, resource base, technical potential and current status, safety, proliferation resistance, deployment, and nuclear safeguards. An Annex compares the cost of decommissioning light-water and fast breeder reactors. Separate abstracts are included for each of the parts.

  15. Reactor flux calculations

    Energy Technology Data Exchange (ETDEWEB)

    Lhuillier, D. [Commissariat à l' Énergie Atomique et aux Énergies Alternatives, Centre de Saclay, IRFU/SPhN, 91191 Gif-sur-Yvette (France)

    2013-02-15

    The status of the prediction of reactor anti-neutrino spectra is presented. The most accurate method is still the conversion of total β spectra of fissionning isotopes as measured at research reactors. Recent re-evaluations of the conversion process led to an increased predicted flux by few percent and were at the origin of the so-called reactor anomaly. The up to date predictions are presented with their main sources of error. Perspectives are given on the complementary ab-initio predictions and upcoming experimental cross-checks of the predicted spectrum shape.

  16. NEUTRONIC REACTOR CONTROL

    Science.gov (United States)

    Metcalf, H.E.

    1958-10-14

    Methods of controlling reactors are presented. Specifically, a plurality of neutron absorber members are adjustably disposed in the reactor core at different distances from the center thereof. The absorber members extend into the core from opposite faces thereof and are operated by motive means coupled in a manner to simultaneously withdraw at least one of the absorber members while inserting one of the other absorber members. This feature effects fine control of the neutron reproduction ratio by varying the total volume of the reactor effective in developing the neutronic reaction.

  17. Nuclear reactor reflector

    Science.gov (United States)

    Hopkins, Ronald J.; Land, John T.; Misvel, Michael C.

    1994-01-01

    A nuclear reactor reflector is disclosed that comprises a stack of reflector blocks with vertical water flow passages to cool the reflector. The interface between blocks is opposite support points for reactor fuel rods. Water flows between the reflector and the reactor barrel from passages in a bottom block. The top block contains a flange to limit this flow and the flange has a slot to receive an alignment pin that is welded to the barrel. The pin is held in the slot by two removable shims. Alignment bars extend the length of the stack in slots machined in each block when the stack is assembled.

  18. Microfluidic electrochemical reactors

    Science.gov (United States)

    Nuzzo, Ralph G [Champaign, IL; Mitrovski, Svetlana M [Urbana, IL

    2011-03-22

    A microfluidic electrochemical reactor includes an electrode and one or more microfluidic channels on the electrode, where the microfluidic channels are covered with a membrane containing a gas permeable polymer. The distance between the electrode and the membrane is less than 500 micrometers. The microfluidic electrochemical reactor can provide for increased reaction rates in electrochemical reactions using a gaseous reactant, as compared to conventional electrochemical cells. Microfluidic electrochemical reactors can be incorporated into devices for applications such as fuel cells, electrochemical analysis, microfluidic actuation, pH gradient formation.

  19. Copy number variation and transposable elements feature in recent, ongoing adaptation at the Cyp6g1 locus.

    Science.gov (United States)

    Schmidt, Joshua M; Good, Robert T; Appleton, Belinda; Sherrard, Jayne; Raymant, Greta C; Bogwitz, Michael R; Martin, Jon; Daborn, Phillip J; Goddard, Mike E; Batterham, Philip; Robin, Charles

    2010-06-24

    The increased transcription of the Cyp6g1 gene of Drosophila melanogaster, and consequent resistance to insecticides such as DDT, is a widely cited example of adaptation mediated by cis-regulatory change. A fragment of an Accord transposable element inserted upstream of the Cyp6g1 gene is causally associated with resistance and has spread to high frequencies in populations around the world since the 1940s. Here we report the existence of a natural allelic series at this locus of D. melanogaster, involving copy number variation of Cyp6g1, and two additional transposable element insertions (a P and an HMS-Beagle). We provide evidence that this genetic variation underpins phenotypic variation, as the more derived the allele, the greater the level of DDT resistance. Tracking the spatial and temporal patterns of allele frequency changes indicates that the multiple steps of the allelic series are adaptive. Further, a DDT association study shows that the most resistant allele, Cyp6g1-[BP], is greatly enriched in the top 5% of the phenotypic distribution and accounts for approximately 16% of the underlying phenotypic variation in resistance to DDT. In contrast, copy number variation for another candidate resistance gene, Cyp12d1, is not associated with resistance. Thus the Cyp6g1 locus is a major contributor to DDT resistance in field populations, and evolution at this locus features multiple adaptive steps occurring in rapid succession.

  20. Copy number variation and transposable elements feature in recent, ongoing adaptation at the Cyp6g1 locus.

    Directory of Open Access Journals (Sweden)

    Joshua M Schmidt

    2010-06-01

    Full Text Available The increased transcription of the Cyp6g1 gene of Drosophila melanogaster, and consequent resistance to insecticides such as DDT, is a widely cited example of adaptation mediated by cis-regulatory change. A fragment of an Accord transposable element inserted upstream of the Cyp6g1 gene is causally associated with resistance and has spread to high frequencies in populations around the world since the 1940s. Here we report the existence of a natural allelic series at this locus of D. melanogaster, involving copy number variation of Cyp6g1, and two additional transposable element insertions (a P and an HMS-Beagle. We provide evidence that this genetic variation underpins phenotypic variation, as the more derived the allele, the greater the level of DDT resistance. Tracking the spatial and temporal patterns of allele frequency changes indicates that the multiple steps of the allelic series are adaptive. Further, a DDT association study shows that the most resistant allele, Cyp6g1-[BP], is greatly enriched in the top 5% of the phenotypic distribution and accounts for approximately 16% of the underlying phenotypic variation in resistance to DDT. In contrast, copy number variation for another candidate resistance gene, Cyp12d1, is not associated with resistance. Thus the Cyp6g1 locus is a major contributor to DDT resistance in field populations, and evolution at this locus features multiple adaptive steps occurring in rapid succession.

  1. Therapeutic application of human leukocyte antigen-G1 improves atopic dermatitis-like skin lesions in mice.

    Science.gov (United States)

    Maeda, Naoyoshi; Yamada, Chisato; Takahashi, Ami; Kuroki, Kimiko; Maenaka, Katsumi

    2017-09-01

    Human leukocyte antigen (HLA)-G is an immune checkpoint molecule that plays critical roles in immune response and in triggering inhibitory signaling to immune cells such as T cells, natural killer cells, and antigen-presenting cells. Thus, the application of HLA-G can be considered for treating immune response-related inflammatory disorders. We have previously reported that treatment with HLA-G1 and HLA-G2 ameliorates the joint swelling associated with collagen-induced arthritis of DBA/1 mice, an animal model for rheumatoid arthritis. In this study, we further investigated the effects of HLA-G1 on atopic dermatitis (AD), the most common inflammatory skin disorder. AD-like lesions were induced with the extract of the house dust mite Dermatophagoides farinae in NC/Nga mice. Continuous administration of HLA-G1 ameliorated the AD-like skin lesions in the mice. Furthermore, production of immunoglobulin E, interleukin (IL)-13, and IL-17A was significantly reduced in HLA-G1-treated mice, suggesting a Th2/Th17-mediated immune-inhibitory function of HLA-G1 in vivo. Our studies shed light on novel therapeutic strategies with recombinant HLA-G proteins for immune reaction-mediated chronic inflammatory disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. The spin structure function g1p of the proton and a test of the Bjorken sum rule

    Directory of Open Access Journals (Sweden)

    C. Adolph

    2016-02-01

    Full Text Available New results for the double spin asymmetry A1p and the proton longitudinal spin structure function g1p are presented. They were obtained by the COMPASS Collaboration using polarised 200 GeV muons scattered off a longitudinally polarised NH3 target. The data were collected in 2011 and complement those recorded in 2007 at 160 GeV, in particular at lower values of x. They improve the statistical precision of g1p(x by about a factor of two in the region x≲0.02. A next-to-leading order QCD fit to the g1 world data is performed. It leads to a new determination of the quark spin contribution to the nucleon spin, ΔΣ, ranging from 0.26 to 0.36, and to a re-evaluation of the first moment of g1p. The uncertainty of ΔΣ is mostly due to the large uncertainty in the present determinations of the gluon helicity distribution. A new evaluation of the Bjorken sum rule based on the COMPASS results for the non-singlet structure function g1NS(x,Q2 yields as ratio of the axial and vector coupling constants |gA/gV|=1.22±0.05 (stat.±0.10 (syst., which validates the sum rule to an accuracy of about 9%.

  3. The spin-dependent structure function $g_1(x)$ of the proton from polarized deep-inelastic muon scattering

    CERN Document Server

    Adeva, B; Arvidson, A; Badelek, B; Bardin, G; Baum, G; Berglund, P; Betev, L; Birsa, R; De Botton, N R; Bradamante, Franco; Bravar, A; Bressan, A; Bültmann, S; Burtin, E; Crabb, D; Cranshaw, J; Çuhadar-Dönszelmann, T; Dalla Torre, S; Van Dantzig, R; Derro, B R; Deshpande, A A; Dhawan, S K; Dulya, C M; Eichblatt, S; Fasching, D; Feinstein, F; Fernández, C; Forthmann, S; Frois, Bernard; Gallas, A; Garzón, J A; Gilly, H; Giorgi, M A; Görtz, S; Gracia, G; De Groot, N; Haft, K; Von Harrach, D; Hasegawa, T; Hautle, P; Hayashi, N; Heusch, C A; Horikawa, N; Hughes, V W; Igo, G; Ishimoto, S; Iwata, T; Kabuss, E M; Kageya, T; Karev, A G; Ketel, T; Kiryluk, J; Kiselev, Yu F; Krivokhizhin, V G; Kröger, W; Kukhtin, V V; Kurek, K; Kyynäräinen, J; Lamanna, M; Landgraf, U; Le Goff, J M; Lehár, F; de Lesquen, A; Lichtenstadt, J; Litmaath, M; Magnon, A; Mallot, G K; Marie, F; Martin, A; Martino, J; Matsuda, T; Mayes, B W; McCarthy, J S; Medved, K S; Meyer, W T; Van Middelkoop, G; Miller, D; Miyachi, Y; Mori, K; Moromisato, J H; Nassalski, J P; Naumann, Lutz; Niinikoski, T O; Oberski, J; Ogawa, A; Grosse-Perdekamp, M; Pereira, H; Perrot-Kunne, F; Peshekhonov, V D; Pinsky, L; Platchkov, S K; Pló, M; Pose, D; Postma, H; Pretz, J; Puntaferro, R; Rädel, G; Rijllart, A; Reicherz, G; Rodríguez, M; Rondio, Ewa; Roscherr, B; Sabo, I; Saborido, J; Sandacz, A; Savin, I A; Schiavon, R P; Schiller, A; Sichtermann, E P; Simeoni, F; Smirnov, G I; Staude, A; Steinmetz, A; Stiegler, U; Stuhrmann, H B; Szleper, M; Tessarotto, F; Thers, D; Tlaczala, W; Tripet, A; Ünel, G; Velasco, M; Vogt, J; Voss, Rüdiger; Whitten, C; Windmolders, R; Wislicki, W; Witzmann, A; Ylöstalo, J; Zanetti, A M; Zaremba, K

    1997-01-01

    We present a new measurement of the virtual photon proton asymmetry $A_1^{\\rm p}$ from deep inelastic scattering of polarized muons on polarized protons in the kinematic range $0.0008 1$ GeV$^{2}$. A perturbative QCD evolution in next-to-leading order is used to determine $g_1^{\\rm p}(x)$ at a constant $Q^2$. At $Q^{2} = 10$ GeV$^{2}$ we find, in the measured range, $\\int_{0.003}^{0.7} g_{1}^{\\rm p}(x){\\rm d}x = 0.139 \\pm 0.006~({\\rm stat})\\pm 0.008~({\\rm syst)} \\pm 0.006~({\\rm evol})$. The value of the first moment $\\Gamma_{1}^{\\rm p} = \\int_{0}^{1} g_{1}^{\\rm p}(x){\\rm d}x$ of $g_{1}^{\\rm p}$ depends on the approach used to describe the behaviour of $g_{1}^{\\rm p}$ at low $x$. We find that the Ellis-Jaffe sum rule is violated. With our published result for $\\Gamma_{1}^{\\rm d}$ we confirm the Bjorken sum rule with an accuracy of $\\approx 15\\%$ at the one standard deviation level.

  4. The Spin Structure Function $g_1^{\\rm p}$ of the Proton and a Test of the Bjorken Sum Rule

    CERN Document Server

    Adolph, C.; Alexeev, M.G.; Alexeev, G.D.; Amoroso, A.; Andrieux, V.; Anosov, V.; Austregesilo, A.; Azevedo, C.; Badelek, B.; Balestra, F.; Barth, J.; Baum, G.; Beck, R.; Bedfer, Y.; Bernhard, J.; Bicker, K.; Bielert, E.R.; Birsa, R.; Bisplinghoff, J.; Bodlak, M.; Boer, M.; Bordalo, P.; Bradamante, F.; Braun, C.; Bressan, A.; Buchele, M.; Burtin, E.; Capozza, L.; Chang, W.C.; Chiosso, M.; Choi, I.; Chung, S.U.; Cicuttin, A.; Crespo, M.L.; Curiel, Q.; Dalla Torre, S.; Dasgupta, S.S.; Dasgupta, S.; Denisov, O.Yu.; Dhara, L.; Donskov, S.V.; Doshita, N.; Duic, V.; Dziewiecki, M.; Efremov, A.; Eversheim, P.D.; Eyrich, W.; Ferrero, A.; Finger, M.; M. Finger jr; Fischer, H.; Franco, C.; von Hohenesche, N. du Fresne; Friedrich, J.M.; Frolov, V.; Fuchey, E.; Gautheron, F.; Gavrichtchouk, O.P.; Gerassimov, S.; Giordano, F.; Gnesi, I.; Gorzellik, M.; Grabmuller, S.; Grasso, A.; Grosse-Perdekamp, M.; Grube, B.; Grussenmeyer, T.; Guskov, A.; Haas, F.; Hahne, D.; von Harrach, D.; Hashimoto, R.; Heinsius, F.H.; Herrmann, F.; Hinterberger, F.; Horikawa, N.; d'Hose, N.; Hsieh, C.Yu; Huber, S.; Ishimoto, S.; Ivanov, A.; Ivanshin, Yu.; Iwata, T.; Jahn, R.; Jary, V.; Jorg, P.; Joosten, R.; Kabuss, E.; Ketzer, B.; Khaustov, G.V.; Khokhlov, Yu. A.; Kisselev, Yu.; Klein, F.; Klimaszewski, K.; Koivuniemi, J.H.; Kolosov, V.N.; Kondo, K.; Konigsmann, K.; Konorov, I.; Konstantinov, V.F.; Kotzinian, A.M.; Kouznetsov, O.; Kramer, M.; Kremser, P.; Krinner, F.; Kroumchtein, Z.V.; Kuchinski, N.; Kunne, F.; Kurek, K.; Kurjata, R.P.; Lednev, A.A.; Lehmann, A.; Levillain, M.; Levorato, S.; Lichtenstadt, J.; Longo, R.; Maggiora, A.; Magnon, A.; Makins, N.; Makke, N.; Mallot, G.K.; Marchand, C.; Martin, A.; Marzec, J.; Matousek, J.; Matsuda, H.; Matsuda, T.; Meshcheryakov, G.; Meyer, W.; Michigami, T.; Mikhailov, Yu. V.; Miyachi, Y.; Nagaytsev, A.; Nagel, T.; Nerling, F.; Neyret, D.; Nikolaenko, V.I.; Novy, J.; Nowak, W.D.; Nunes, A.S.; Olshevsky, A.G.; Orlov, I.; Ostrick, M.; Panzieri, D.; Parsamyan, B.; Paul, S.; Peng, J.C.; Pereira, F.; Pesek, M.; Peshekhonov, D.V.; Platchkov, S.; Pochodzalla, J.; Polyakov, V.A.; Pretz, J.; Quaresma, M.; Quintans, C.; Ramos, S.; Regali, C.; Reicherz, G.; Riedl, C.; Rocco, E.; Rossiyskaya, N.S.; Ryabchikov, D.I.; Rychter, A.; Samoylenko, V.D.; Sandacz, A.; Santos, C.; Sarkar, S.; Savin, I.A.; Sbrizzai, G.; Schiavon, P.; Schmidt, K.; Schmieden, H.; Schonning, K.; Schopferer, S.; Selyunin, A.; Shevchenko, O.Yu.; Silva, L.; Sinha, L.; Sirtl, S.; Slunecka, M.; Sozzi, F.; Srnka, A.; Stolarski, M.; Sulc, M.; Suzuki, H.; Szabelski, A.; Szameitat, T.; Sznajder, P.; Takekawa, S.; Wolbeek, J. ter; Tessaro, S.; Tessarotto, F.; Thibaud, F.; Tosello, F.; Tskhay, V.; Uhl, S.; Veloso, J.; Virius, M.; Weisrock, T.; Wilfert, M.; Windmolders, R.; Zaremba, K.; Zavertyaev, M.; Zemlyanichkina, E.; Ziembicki, M.; Zink, A.

    2016-02-10

    New results for the double spin asymmetry $A_1^{\\rm p}$ and the proton longitudinal spin structure function $g_1^{\\rm p}$ are presented. They were obtained by the COMPASS collaboration using polarised 200 GeV muons scattered off a longitudinally polarised NH$_3$ target. The data were collected in 2011 and complement those recorded in 2007 at 160\\,GeV, in particular at lower values of $x$. They improve the statistical precision of $g_1^{\\rm p}(x)$ by about a factor of two in the region $x\\lesssim 0.02$. A next-to-leading order QCD fit to the $g_1$ world data is performed. It leads to a new determination of the quark spin contribution to the nucleon spin, $\\Delta \\Sigma$ ranging from 0.26 to 0.36, and to a re-evaluation of the first moment of $g_1^{\\rm p}$. The uncertainty of $\\Delta \\Sigma$ is mostly due to the large uncertainty in the present determinations of the gluon helicity distribution. A new evaluation of the Bjorken sum rule based on the COMPASS results for the non-singlet structure function $g_1^{\\rm...

  5. Molecular Dynamics Simulation of the Crystallizable Fragment of IgG1—Insights for the Design of Fcabs

    Science.gov (United States)

    Lai, Balder; Hasenhindl, Christoph; Obinger, Christian; Oostenbrink, Chris

    2014-01-01

    An interesting format in the development of therapeutic monoclonal antibodies uses the crystallizable fragment of IgG1 as starting scaffold. Engineering of its structural loops allows generation of an antigen binding site. However, this might impair the molecule’s conformational stability, which can be overcome by introducing stabilizing point mutations in the CH3 domains. These point mutations often affect the stability and unfolding behavior of both the CH2 and CH3 domains. In order to understand this cross-talk, molecular dynamics simulations of the domains of the Fc fragment of human IgG1 are reported. The structure of human IgG1-Fc obtained from X-ray crystallography is used as a starting point for simulations of the wild-type protein at two different pH values. The stabilizing effect of a single point mutation in the CH3 domain as well as the impact of the hinge region and the glycan tree structure connected to the CH2 domains is investigated. Regions of high local flexibility were identified as potential sites for engineering antigen binding sites. Obtained data are discussed with respect to the available X-ray structure of IgG1-Fc, directed evolution approaches that screen for stability and use of the scaffold IgG1-Fc in the design of antigen binding Fc proteins. PMID:24451126

  6. Impacts, Effectiveness and Regional Inequalities of the GeoMIP G1 to G4 Solar Radiation Management Scenarios

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Xiaoyong; Moore, John; Cui, Xuefeng; Rinke, Annette; Ji, Duoying; Kravitz, Benjamin S.; Yoon, Jin-Ho

    2015-06-01

    We evaluate the regional effectiveness of solar radiation management (SRM) to compensate for simultaneous changes in temperature and precipitation induced by increased greenhouse gas concentrations. We analyze results from multiple earth system models under four Geoengineering Model Intercomparison Project(GeoMIP) experiments with a modified form of the Residual Climate Response approach. Under the solar dimming geoengineering experiments G1(4xCO2) and G2(increasing CO2 by 1% per year), global average temperature is successfully restored to pre-industrial level over 50 years simulations. However, these two SRM experiments also produce a robust global precipitation decrease. The stratospheric aerosol GeoMIP geoengineering experiment, G4 has significantly greater regional inequality and lower effectiveness for compensating temperature change than G1 and G2. G4 also has significantly larger regional inequality for compensating precipitation change than G1and G2. However, there is no significant difference between precipitation change compensation effectiveness of G4 and G2, though there is much larger across model variability in G4 results. G3 has significant greater regional inequality for compensating temperature change than G1 and G2, and has significant lower effectiveness than G1. The effectiveness of four SRMs to compensate for temperature change is much higher than for precipitation. The large cross-model variation in adjustment percentage of compensated SAT and precipitation change by SRM to achieve optimal compensation effectiveness shed a light on the uncertainty accumulation effect in optimizing compensation effectiveness of SRM.

  7. Predominance of rotavirus G1[P8] genotype among under-five children with gastroenteritis in Mwanza, Tanzania.

    Science.gov (United States)

    Hokororo, Adolfine; Kidenya, Benson R; Seni, Jeremiah; Mapaseka, Seheri; Mphahlele, Jeffrey; Mshana, Stephen E

    2014-10-01

    We analyzed stool samples from underfives with gastroenteritis for rotavirus infection between January 2010 and June 2011. A total of 393 stool specimens were examined for rotavirus infection using enzyme-linked immunosorbent assay (ELISA). Hundred selected positive specimens were genotyped using multiplex polymerase chain reaction. Out of 393 underfives, 194 (49.4%) had rotavirus infection, with 96.9% of infected underfives being rotavirus had prolonged hospital stay than those without rotavirus infection (P = 0.0001). G1 was the most predominant G type (59%) followed by G8 (13%) while P[8] was the most predominant P type (25%). In single-type infection, common G-P combinations were G1P[8] (24%) and G1P[6] (17%). Common mixed infections were G1/G8 (16%) and P4/P8 (13%). G1 genotype is common among underfives with gastroenteritis in Mwanza. Diversity of genotypes causing gastroenteritis in Mwanza necessitates a continuous surveillance after the introduction of RotaRix® vaccine. © The Author [2014]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. New reactor type proposed

    CERN Multimedia

    2003-01-01

    "Russian scientists at the Research Institute of Nuclear Power Engineering in Moscow are hoping to develop a new reactor that will use lead and bismuth as fuel instead of uranium and plutonium" (1/2 page).

  9. Department of Reactor Technology

    DEFF Research Database (Denmark)

    Risø National Laboratory, Roskilde

    The general development of the Department of Reactor Technology at Risø during 1981 is presented, and the activities within the major subject fields are described in some detail. Lists of staff, publications, and computer programs are included.......The general development of the Department of Reactor Technology at Risø during 1981 is presented, and the activities within the major subject fields are described in some detail. Lists of staff, publications, and computer programs are included....

  10. Precision measurements of g1 of the proton and the deuteron with 6 GeV electrons

    Energy Technology Data Exchange (ETDEWEB)

    Prok, Yelena; Bosted, Peter; Kvaltine, Nicholas; Adhikari, Krishna; Adikaram-Mudiyanselage, Dasuni; Aghasyan, Mher; Amaryan, Moskov; Anderson, Mark; Anefalos Pereira, Sergio; Avagyan, Harutyun; Baghdasaryan, Hovhannes; Ball, Jacques; Baltzell, Nathan; Battaglieri, Marco; Biselli, Angela; Bono, Jason; Briscoe, William; Brock, Joseph; Brooks, William; Bueltmann, Stephen; Burkert, Volker; Carlin, Christopher; Carman, Daniel; Celentano, Andrea; Chandavar, Shloka; Colaneri, Luca; Cole, Philip; Contalbrigo, Marco; Cortes, Olga; Crabb, Donald; Crede, Volker; D' Angelo, Annalisa; Dashyan, Natalya; De Vita, Raffaella; De Sanctis, Enzo; Deur, Alexandre; Djalali, Chaden; Dodge, Gail; Doughty, David; Dupre, Raphael; El Alaoui, Ahmed; El Fassi, Lamiaa; Elouadrhiri, Latifa; Fedotov, Gleb; Fegan, Stuart; Fersch, Robert; Fleming, Jamie; Forest, Tony; Garcon, Michel; Gevorgyan, Nerses; Ghandilyan, Yeranuhi; Gilfoyle, Gerard; Girod-Gard, Francois-Xavier; Giovanetti, Kevin; Goetz, John; Gohn, Wesley; Gothe, Ralf; Griffioen, Keith; Guegan, Baptiste; Guler, Nevzat; Hafidi, Kawtar; Hanretty, Charles; Harrison, Nathan; Hattawy, Mohammad; Hicks, Kenneth; Ho, Dao; Holtrop, Maurik; Ilieva, Yordanka; Ireland, David; Ishkhanov, Boris; Isupov, Evgeny; Jawalkar, Sucheta; Jiang, Xiaodong; Jo, Hyon-Suk; Joo, Kyungseon; Kalantarians, Narbe; Keith, Christopher; Keller, Daniel; Khandaker, Mahbubul; Kim, Andrey; Kim, Wooyoung; Klein, Andreas; Klein, Franz; Koirala, Suman; Kubarovsky, Valery; Kuhn, Sebastian; Kuleshov, Sergey; Lenisa, Paolo; Livingston, Kenneth; Lu, Haiyun; MacGregor, Ian; Markov, Nikolai; Mayer, Michael; McKinnon, Bryan; Meekins, David; Mineeva, Taisiya; Mirazita, Marco; Mokeev, Viktor; Montgomery, Rachel; MOUTARDE, Herve; Movsisyan, Aram; Munevar Espitia, Edwin; Munoz Camacho, Carlos; Nadel-Turonski, Pawel; Niccolai, Silvia; Niculescu, Gabriel; Niculescu, Maria; Osipenko, Mikhail; Ostrovidov, Alexander; Pappalardo, Luciano; Paremuzyan, Rafayel; Park, K; Peng, Peng; Phillips, J J; Pierce, Joshua; Pisano, Silvia; Pogorelko, Oleg; Pozdniakov, Serguei; Price, John; Procureur, Sebastien; Protopopescu, Dan; Puckett, Andrew; Raue, Brian; Rimal, Dipak; Ripani, Marco; Rizzo, Alessandro; Rosner, Guenther; Rossi, Patrizia; Roy, Priyashree; Sabatie, Franck; Saini, Mukesh; Salgado, Carlos; Schott, Diane; Schumacher, Reinhard; Seder, Erin; Sharabian, Youri; Simonyan, Ani; Smith, Claude; Smith, Gregory; Sober, Daniel; Sokhan, Daria; Stepanyan, Stepan; Stepanyan, Samuel; Strakovski, Igor; Strauch, Steffen; Sytnik, Valeriy; Taiuti, Mauro; Tang, Wei; Tkachenko, Svyatoslav; Ungaro, Maurizio; Vernarsky, Brian; Vlasov, Alexander; Voskanyan, Hakob; Voutier, Eric; Walford, Natalie; Watts, Daniel; Weinstein, Lawrence; Zachariou, Nicholas; Zana, Lorenzo; Zhang, Jixie; Zhao, Bo; Zhao, Zhiwen; Zonta, Irene

    2014-08-01

    The inclusive polarized structure functions of the proton and deuteron, g1p and g1d, were measured with high statistical precision using polarized 6 GeV electrons incident on a polarized ammonia target in Hall B at Jefferson Laboratory. Electrons scattered at lab angles between 18 and 45 degrees were detected using the CEBAF Large Acceptance Spectrometer (CLAS). For the usual DIS kinematics, Q^2>1 GeV^2 and the final-state invariant mass W>2 GeV, the ratio of polarized to unpolarized structure functions g1/F1 is found to be nearly independent of Q^2 at fixed x. Significant resonant structure is apparent at values of W up to 2.3 GeV. In the framework of perturbative QCD, the high-W results can be used to better constrain the polarization of quarks and gluons in the nucleon, as well as high-twist contributions.

  11. G1/S-regulated E2F-containing protein complexes bind to the mouse thymidine kinase gene promoter

    DEFF Research Database (Denmark)

    Dou, Q P; Zhao, S; Levin, A H

    1994-01-01

    By performing DNase I footprint analysis, we had identified three distinct protein binding sequences (MT1, MT2, and MT3) located on the mouse thymidine kinase (TK) upstream promoter (Dou, Q.-P., Fridovich-Keil, J. L., and Pardee, A.B. (1991) Proc. Natl. Acad. Sci. U.S.A. 88, 1157-1161). Here we....... (iii) Formation of both these DNA-protein complexes were cell cycle-dependent: a G0/G1 phase-specific complex (E2F.G0/G1) was replaced by an S phase-specific complex(es) (E2F.S), whereas "free" E2F increased after the G1/S transition. (iv) Pulse inhibition of protein synthesis with cycloheximide...

  12. Mean time for the development of large workloads and large queue lengths in the GI/G/1 queue

    Directory of Open Access Journals (Sweden)

    Charles Knessl

    1996-01-01

    Full Text Available We consider the GI/G/1 queue described by either the workload U(t (unfinished work or the number of customers N(t in the system. We compute the mean time until U(t reaches excess of the level K, and also the mean time until N(t reaches N0. For the M/G/1 and GI/M/1 models, we obtain exact contour integral representations for these mean first passage times. We then compute the mean times asymptotically, as K and N0→∞, by evaluating these contour integrals. For the general GI/G/1 model, we obtain asymptotic results by a singular perturbation analysis of the appropriate backward Kolmogorov equation(s. Numerical comparisons show that the asymptotic formulas are very accurate even for moderate values of K and N0.

  13. Natural convection reactor

    Energy Technology Data Exchange (ETDEWEB)

    Babcock, D.F.; Bernath, L.; Menegus, R.L.; Ring, H.F.

    1956-05-01

    A previous report described the conceptual design of a plutonium producing reactor that may be characterized as follows: Power output (2000 MW); cooling - (natural convection of light water through the reactor, up through a draft tube to an evaporative cooling pond, then back to the reactor, and fuel (400 to 500 tons of uranium enriched to 1.2% U-235). Because this reactor would be cooled by the natural convection of light water, it is believed that the construction costs would be significantly less than for a Savannah or Hanford type reactor. Such expensive items as water treatment and water pumping facilities would be eliminated entirely. The inventory of 500 tons of slightly enriched uranium, however, is an unattractive feature. It represents not only a large dollar investment but also makes the reactor less attractive for construction during periods of national emergency because of the almost certain scarcity of even slightly enriched uranium at that time. The Atomic Energy Commission asked that the design be reviewed with the objective of reducing the inventory of uranium, The results of this review are given in this report.

  14. Improvement of vascular function by acute and chronic treatment with the GPR30 agonist G1 in experimental diabetes mellitus.

    Directory of Open Access Journals (Sweden)

    Zi-lin Li

    Full Text Available The G-protein coupled estrogen receptor 30 (GPR30 is a seven-transmembrane domain receptor that mediates rapid estrogen responses in a wide variety of cell types. This receptor is highly expressed in the cardiovascular system, and exerts vasodilatory effects. The objective of the present study was to investigate the effects of GPR30 on vascular responsiveness in diabetic ovariectomized (OVX rats and elucidate the possible mechanism involved. The roles of GPR30 were evaluated in the thoracic aorta and cultured endothelial cells. The GPR30 agonist G1 induced a dose-dependent vasodilation in the thoracic aorta of the diabetic OVX rats, which was partially attenuated by the nitric oxide synthase (NOS inhibitor, nitro-L-arginine methylester (L-NAME and the GPR30-selective antagonist G15. Dose-dependent vasoconstrictive responses to phenylephrine were attenuated significantly in the rings of the thoracic aorta following the acute G1 administration in the diabetic OVX rats. This effect of G1 was abolished partially by L-NAME and G15. The acute administration of G1 increased significantly the eNOS activity and the concentration of NO in the endothelial cells exposed to high glucose. G1 treatment induced an enhanced endothelium-dependent relaxation to acetylcholine (Ach in the diabetic OVX rats. Further examination revealed that G1 induced vasodilation in the diabetic OVX rats by increasing the phosphorylation of eNOS. These findings provide preliminary evidence that GPR30 activation leads to eNOS activation, as well as vasodilation, to a certain degree and has beneficial effects on vascular function in diabetic OVX rats.

  15. A novel single virus infection system reveals that influenza virus preferentially infects cells in g1 phase.

    Directory of Open Access Journals (Sweden)

    Ryuta Ueda

    Full Text Available BACKGROUND: Influenza virus attaches to sialic acid residues on the surface of host cells via the hemagglutinin (HA, a glycoprotein expressed on the viral envelope, and enters into the cytoplasm by receptor-mediated endocytosis. The viral genome is released and transported in to the nucleus, where transcription and replication take place. However, cellular factors affecting the influenza virus infection such as the cell cycle remain uncharacterized. METHODS/RESULTS: To resolve the influence of cell cycle on influenza virus infection, we performed a single-virus infection analysis using optical tweezers. Using this newly developed single-virus infection system, the fluorescence-labeled influenza virus was trapped on a microchip using a laser (1064 nm at 0.6 W, transported, and released onto individual H292 human lung epithelial cells. Interestingly, the influenza virus attached selectively to cells in the G1-phase. To clarify the molecular differences between cells in G1- and S/G2/M-phase, we performed several physical and chemical assays. Results indicated that: 1 the membranes of cells in G1-phase contained greater amounts of sialic acids (glycoproteins than the membranes of cells in S/G2/M-phase; 2 the membrane stiffness of cells in S/G2/M-phase is more rigid than those in G1-phase by measurement using optical tweezers; and 3 S/G2/M-phase cells contained higher content of Gb3, Gb4 and GlcCer than G1-phase cells by an assay for lipid composition. CONCLUSIONS: A novel single-virus infection system was developed to characterize the difference in influenza virus susceptibility between G1- and S/G2/M-phase cells. Differences in virus binding specificity were associated with alterations in the lipid composition, sialic acid content, and membrane stiffness. This single-virus infection system will be useful for studying the infection mechanisms of other viruses.

  16. Association of pKi-67 with satellite DNA of the human genome in early G1 cells.

    Science.gov (United States)

    Bridger, J M; Kill, I R; Lichter, P

    1998-01-01

    pKi-67 is a nucleolar antigen that provides a specific marker for proliferating cells. It has been shown previously that pKi-67's distribution varies in a cell cycle-dependent manner: it coats all chromosomes during mitosis, accumulates in nuclear foci during G1 phase (type I distribution) and localizes within nucleoli in late G1 S and G2 phase (type II distribution). Although no function has as yet been ascribed to pKi-67, it has been found associated with centromeres in G1. In the present study the distribution pattern of pKi-67 during G1 in human dermal fibroblasts (HDFs) was analysed in more detail. Synchronization experiments show that in very early G1 cells pKi-67 coincides with virtually all satellite regions analysed, i.e. with centromeric (alpha-satellite), telomeric (minisatellite) and heterochromatic blocks (satellite III) on chromosomes 1 and Y (type Ia distribution). In contrast, later in the G1 phase, a smaller fraction of satellite DNA regions are found collocalized with pKi-67 foci (type Ib distribution). When all pKi-67 becomes localized within nucleoli, even fewer satellite regions remain associated with the pKi-67 staining. However, all centromeric and short arm regions of the acrocentric chromosomes, which are in very close proximity to or even contain the rRNA genes, are collocalized with anti-pKi-67 staining throughout the remaining interphase of the cell cycle. Thus, our data demonstrate that during post-mitotic reformation and nucleogenesis there is a progressive decline in the fraction of specific satellite regions of DNA that remain associated with pKi-67. This may be relevant to nucleolar reformation following mitosis.

  17. Timing of the G1/S transition in tobacco pollen vegetative cells as a primary step towards androgenesis in vitro.

    Science.gov (United States)

    Kyo, Masaharu; Nagano, Ai; Yamaji, Naoki; Hashimoto, Yuhki

    2014-09-01

    Mid-bicellular pollen vegetative cells in tobacco escape from G1 arrest and proceed to the G1/S transition towards androgenesis within 1 day under glutamine starvation conditions in vitro. In the Nicotiana tabacum pollen culture system, immature pollen grains at the mid-bicellular stage can mature in the presence of glutamine; however, if glutamine is absent, they deviate from their native cell fate in a few days. The glutamine-starved pollen grains cannot undergo maturation, even when supplied with glutamine later. Instead, they undergo cell division towards androgenesis slowly within 10 days in a medium containing appropriate nutrients. During the culture period, they ought to escape from G1 arrest to proceed into S phase as the primary step towards androgenesis. However, this event has not been experimentally confirmed. Here, we demonstrated that the pollen vegetative cells proceeded to the G1/S transition within approximately 15-36 h after the start of culture. These results were obtained by analyzing transgenic pollen possessing a fusion gene encoding nuclear-localizing GFP under the control of an E2F motif-containing promoter isolated from a gene encoding one of DNA replication licensing factors. Observations using a 5-ethynyl-2'-deoxyuridine DNA labeling and detection technique uncovered that the G1/S transition was soon followed by S phase. These hallmarks of vegetative cells undergoing dedifferentiation give us new insights into upstream events causing the G1/S transition and also provide a novel strategy to increase the frequency of the androgenic response in tobacco and other species, including recalcitrants.

  18. Base substitution mutations in uridinediphosphate-dependent glycosyltransferase 76G1 gene of Stevia rebaudiana causes the low levels of rebaudioside A: mutations in UGT76G1, a key gene of steviol glycosides synthesis.

    Science.gov (United States)

    Yang, Yong-Heng; Huang, Su-Zhen; Han, Yu-Lin; Yuan, Hai-Yan; Gu, Chun-Sun; Zhao, Yan-Hai

    2014-07-01

    Steviol glycosides, extracted from the leaves of Stevia rebaudiana (Bert) Bertoni, are calorie-free sugar substitute of natural origin with intensely sweet (Boileau et al., 2012). Stevioside and rebaudioside A are the two main kinds of the diterpenic glycosides. We analyzed the concentration of stevioside and rebaudioside A in Stevia leaves of about 500 samples (hybrid progenies) and discovered a mutation plant "Z05" with very low levels of rebaudioside A. Because UGT76G1, a uridinediphosphate-dependent glycosyltransferases, is responsible for the conversion from stevioside to rebaudioside A (Richman et al., 2005), so mutation identification was done by sequencing the candidate gene, UGT76G1. In this study molecular analysis of two strains revealed a heterozygotic nonsense mutation of c.389T > G (p.L121X) in UGT76G1. Meanwhile, we found some amino acid substitutions significant change the protein structure. And the difference of enzyme activity between two strains proved the lack of functionality of UGT76G1 of the mutation "Z05". So the nonsense mutation and amino acid substitution mutation resulted in the low levels of rebaudioside A. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  19. Glut1 deficiency (G1D): epilepsy and metabolic dysfunction in a mouse model of the most common human phenotype.

    Science.gov (United States)

    Marin-Valencia, Isaac; Good, Levi B; Ma, Qian; Duarte, Joao; Bottiglieri, Teodoro; Sinton, Christopher M; Heilig, Charles W; Pascual, Juan M

    2012-10-01

    Brain glucose supplies most of the carbon required for acetyl-coenzyme A (acetyl-CoA) generation (an important step for myelin synthesis) and for neurotransmitter production via further metabolism of acetyl-CoA in the tricarboxylic acid (TCA) cycle. However, it is not known whether reduced brain glucose transporter type I (GLUT-1) activity, the hallmark of the GLUT-1 deficiency (G1D) syndrome, leads to acetyl-CoA, TCA or neurotransmitter depletion. This question is relevant because, in its most common form in man, G1D is associated with cerebral hypomyelination (manifested as microcephaly) and epilepsy, suggestive of acetyl-CoA depletion and neurotransmitter dysfunction, respectively. Yet, brain metabolism in G1D remains underexplored both theoretically and experimentally, partly because computational models of limited brain glucose transport are subordinate to metabolic assumptions and partly because current hemizygous G1D mouse models manifest a mild phenotype not easily amenable to investigation. In contrast, adult antisense G1D mice replicate the human phenotype of spontaneous epilepsy associated with robust thalamocortical electrical oscillations. Additionally, and in consonance with human metabolic imaging observations, thalamus and cerebral cortex display the lowest GLUT-1 expression and glucose uptake in the mutant mouse. This depletion of brain glucose is associated with diminished plasma fatty acids and elevated ketone body levels, and with decreased brain acetyl-CoA and fatty acid contents, consistent with brain ketone body consumption and with stimulation of brain beta-oxidation and/or diminished cerebral lipid synthesis. In contrast with other epilepsies, astrocyte glutamine synthetase expression, cerebral TCA cycle intermediates, amino acid and amine neurotransmitter contents are also intact in G1D. The data suggest that the TCA cycle is preserved in G1D because reduced glycolysis and acetyl-CoA formation can be balanced by enhanced ketone body

  20. Evaluation of Palm PCRTM G1-12 System: a portable battery-operated PCR thermal cycler

    Directory of Open Access Journals (Sweden)

    Siti Aminah Ahmed

    2016-08-01

    Full Text Available Polymerase chain reaction (PCR is the basis of recombinant and other molecular biological techniques. Availability of cheap and robust PCR platforms enables the tests to be performed easily, even in resource constrained settings. Herein we compared the efficacy of a portable thermal cycler ( Palm PCRTM G1-12 System for rapid DNA amplification against the standard Peltier-based thermal cycler using plasmid DNA and genomic DNA in single and multiplex PCR experiments. Our study revealed that the Palm PCRTM G1-12 System could be a portable DNA amplification system to conduct various molecular techniques, especially in places where resources are limited.

  1. G1 cyclin degradation: the PEST motif of yeast Cln2 is necessary, but not sufficient, for rapid protein turnover.

    OpenAIRE

    Salama, S R; Hendricks, K B; Thorner, J

    1994-01-01

    The 545-residue Cln2 protein, like the other G1 cyclins of Saccharomyces cerevisiae, is a very unstable protein. This instability is thought to play a critical role in regulating cell cycle progression. The carboxyl-terminal domains of Cln2 and the other G1 cyclins contain sequences rich in Pro, Glu (and Asp), Ser, and Thr (so-called PEST motifs) that have been postulated to make up the signals that are responsible for the rapid degradation of these and other unstable proteins. To test this h...

  2. Piperine Causes G1 Phase Cell Cycle Arrest and Apoptosis in Melanoma Cells through Checkpoint Kinase-1 Activation

    OpenAIRE

    Fofaria, Neel M.; Sung-Hoon Kim; Sanjay K. Srivastava

    2014-01-01

    In this study, we determined the cytotoxic effects of piperine, a major constituent of black and long pepper in melanoma cells. Piperine treatment inhibited the growth of SK MEL 28 and B16 F0 cells in a dose and time-dependent manner. The growth inhibitory effects of piperine were mediated by cell cycle arrest of both the cell lines in G1 phase. The G1 arrest by piperine correlated with the down-regulation of cyclin D1 and induction of p21. Furthermore, this growth arrest by piperine treatmen...

  3. Glut1 deficiency (G1D): Epilepsy and metabolic dysfunction in a mouse model of the most common human phenotype

    Science.gov (United States)

    Marin-Valencia, Isaac; Good, Levi B.; Ma, Qian; Duarte, Joao; Bottiglieri, Teodoro; Sinton, Christopher M.; Heilig, Charles W.; Pascual, Juan M.

    2012-01-01

    Brain glucose supplies most of the carbon required for acetyl-coenzyme A (acetyl-CoA) generation (an important step for myelin synthesis) and for neurotransmitter production via further metabolism of acetyl-CoA in the tricarboxylic acid (TCA) cycle. However, it is not known whether reduced brain glucose transporter type I (GLUT-1) activity, the hallmark of the GLUT-1 deficiency (G1D) syndrome, leads to acetyl-CoA, TCA or neurotransmitter depletion. This question is relevant because, in its most common form in man, G1D is associated with cerebral hypomyelination (manifested as microcephaly) and epilepsy, suggestive of acetyl-CoA depletion and neurotransmitter dysfunction, respectively. Yet, brain metabolism in G1D remains underexplored both theoretically and experimentally, partly because computational models of limited brain glucose transport are subordinate to metabolic assumptions and partly because current hemizygous G1D mouse models manifest a mild phenotype not easily amenable to investigation. In contrast, adult antisense G1D mice replicate the human phenotype of spontaneous epilepsy associated with robust thalamocortical electrical oscillations. Additionally, and in consonance with human metabolic imaging observations, thalamus and cerebral cortex display the lowest GLUT-1 expression and glucose uptake in the mutant mouse. This depletion of brain glucose is associated with diminished plasma fatty acids and elevated ketone body levels, and with decreased brain acetyl-CoA and fatty acid contents, consistent with brain ketone body consumption and with stimulation of brain beta-oxidation and/or diminished cerebral lipid synthesis. In contrast with other epilepsies, astrocyte glutamine synthetase expression, cerebral TCA cycle intermediates, amino acid and amine neurotransmitter contents are also intact in G1D. The data suggest that the TCA cycle is preserved in G1D because reduced glycolysis and acetyl-CoA formation can be balanced by enhanced ketone body

  4. Determination of the concentration of {alpha} emitting radioactive aerosols; Mesure de la concentration des aerosols radioactifs emetteurs {alpha}

    Energy Technology Data Exchange (ETDEWEB)

    Labeyrie, J. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1953-06-15

    In the first part of this work the techniques used for the quantitative measurement of the concentrations of aerosols carrying short lived (radon or thoron daughters) or long lived (uranium) {alpha} radioactive emitters are described. In the second part the author investigates the problem of the determination of radon concentration in air by means of activity determinations on airborne dusts. Special reference is made to the measurement of the radon active deposit on two types of dusts (iron oxide (yellow) and uranium oxide) in small chambers (6 liters). In the third part are given data resulting from determinations of radon and thoron concentrations in atmospheric air in the south of Paris area using this method. (author) [French] Dans la premiere partie de ce travail on expose les techniques utilisees pour la mesure quantitative des concentrations d'aerosols contenant des emetteurs radioactifs {alpha}, tant pour ceux a vie courte (derives du radon ou du thoron) que pour ceux a vie longue (uranium). Dans la seconde partie on traite le probleme de la determination de la concentration de l'air en radon par la mesure de l'activite des poussieres ayant sejourne dans cet air. En particulier, on indique pour de petits volumes (6 litres) la proportion de depot actif du radon qui est fixee sur deux types de poussieres (limonite et oxyde d'uranium) en fonction de la concentration de celles-ci. Dans la troisieme partie on donne quelques exemples de mesure par cette methode de la concentration en radon et en thoron de l'atmosphere de la region parisienne. (auteur)

  5. Reactor Safety Planning for Prometheus Project, for Naval Reactors Information

    Energy Technology Data Exchange (ETDEWEB)

    P. Delmolino

    2005-05-06

    The purpose of this letter is to submit to Naval Reactors the initial plan for the Prometheus project Reactor Safety work. The Prometheus project is currently developing plans for cold physics experiments and reactor prototype tests. These tests and facilities may require safety analysis and siting support. In addition to the ground facilities, the flight reactor units will require unique analyses to evaluate the risk to the public from normal operations and credible accident conditions. This letter outlines major safety documents that will be submitted with estimated deliverable dates. Included in this planning is the reactor servicing documentation and shipping analysis that will be submitted to Naval Reactors.

  6. Conception et validation d'un protocole pour induire du stress et le mesurer dans des signaux physiologiques

    OpenAIRE

    Jeunet, Camille; Mühl, Christian; Lotte, Fabien

    2013-01-01

    International audience; Le stress est un problème majeur pour la société de par son impact négatif sur l'économie et la santé. Les nouvelles technologies alliant informatique et physiologie permettent aujourd'hui une mesure du stress non invasive, directe et continue. Cependant, le stress est un procédé complexe dont les corrélats physiologiques peuvent varier selon son origine : psychologique ou psychosociale. Dans ce poster, nous validons la capacité de notre protocole à générer indépendamm...

  7. La protection dans les échanges commerciaux : arguments, formes, mesures et applications aux pays de l'Afrique subsaharienne

    OpenAIRE

    Dem, I.; Sogodogo, A. (collab.); Verlaeten, Marie-Paule

    1991-01-01

    L'étude apporte un éclairage sur la question du protectionnisme en Afrique, au départ d'un survol des arguments de celui-ci, d'une présentation de ces formes et indicateurs de mesure et enfin d'une application de ces derniers aux pays subsahariens de ce continent. Elle permet de conclure que les pays ne peuvent être véritablement taxés de protectionnisme contrairement à ce qui est souvent avancé. (Résumé d'auteur)

  8. Excessive precipitation of CaCO₃ as aragonite in a continuous aerobic granular sludge reactor.

    Science.gov (United States)

    Liu, Yong-Qiang; Lan, Gui-Hong; Zeng, Ping

    2015-10-01

    A hybrid airlift reactor was adopted to retain aerobic granules in the reactor successfully for continuous operation. It was found that aerobic granules maintained excellent physical structure stability in the continuous-flow reactor with reactor performance as good as batch operation. However, flocs appeared after batch operation was switched to continuous operation, and chemical oxygen demand (COD) in the wastewater was thus removed by co-existed granules and flocs in the reactor. Furthermore, excessive precipitation of CaCO3 as needled shaped aragonite in the continuous aerobic granular sludge reactor was observed, which led to the further enhancement of settling ability of granules with sludge volume index (SVI) reduction from 32 to 2 ml g(-1) but specific oxygen utilization rate (SOUR) decrease from 61 to 23 mg O2 g(-1) MLVSS h(-1). Thus, apart from the physical structure stability, bioactivity stability of granules should be also considered as an important parameter to evaluate the continuous operation of aerobic granular sludge. Furthermore, the decrease in granule polysaccharide content implied that protein was more important for aragonite precipitation. The excessive aragonite precipitation in the continuous-flow reactor could be due to the competition between flocs and granules. In addition, the degradation of polysaccharide in aerobic granules under a continuous-flow mode may also contribute to excessive aragonite precipitation.

  9. Scaleable, High Efficiency Microchannel Sabatier Reactor Project

    Data.gov (United States)

    National Aeronautics and Space Administration — A Microchannel Sabatier Reactor System (MSRS) consisting of cross connected arrays of isothermal or graded temperature reactors is proposed. The reactor array...

  10. The transient M/G/1/0 queue: some bounds and approximations for light traffic with application to reliability

    Directory of Open Access Journals (Sweden)

    J. Ben Atkinson

    1995-01-01

    Full Text Available We consider the transient analysis of the M/G/1/0 queue, for which Pn(t denotes the probability that there are no customers in the system at time t, given that there are n(n=0,1 customers in the system at time 0. The analysis, which is based upon coupling theory, leads to simple bounds on Pn(t for the M/G/1/0 and M/PH/1/0 queues and improved bounds for the special case M/Er/1/0. Numerical results are presented for various values of the mean arrival rate λ to demonstrate the increasing accuracy of approximations based upon the above bounds in light traffic, i.e., as λ→0. An important area of application for the M/G/1/0 queue is as a reliability model for a single repairable component. Since most practical reliability problems have λ values that are small relative to the mean service rate, the approximations are potentially useful in that context. A duality relation between the M/G/1/0 and GI/M/1/0 queues is also described.

  11. Isolation and characterization of a monoclonal anti CK-2 alpha subunit antibody of the IgG1 subclass

    DEFF Research Database (Denmark)

    Schmidt-Spaniol, I; Boldyreff, B; Issinger, O G

    1992-01-01

    A monoclonal antibody was produced against the recombinant human alpha subunit of CK-2. The antibody was of the IgG1 subclass and it was isolated from serum-free cell culture media and purified by affinity chromatography on Protein G Sepharose. The antibody can be used to detect specifically the ...

  12. G0/G1 switch gene-2 regulates human adipocyte lipolysis by affecting activity and localization of adipose triglyceride lipase

    NARCIS (Netherlands)

    Schweiger, M.; Paar, M.; Eder, C.; Brandis, J.; Moser, E.; Gorkiewisz, G.; Grond, S.; Radner, F.P.W.; Cerk, I.; Cornaciu, I.; Oberer, M.; Kersten, A.H.; Zechner, R.; Zimmermann, M.B.; Lass, A.

    2012-01-01

    The hydrolysis of triglycerides in adipocytes, termed lipolysis, provides free fatty acids as energy fuel. Murine lipolysis largely depends on the activity of adipose triglyceride lipase (ATGL)5, which is regulated by two proteins annotated as comparative gene identification-58 (CGI-58) and G0/G1

  13. 26 CFR 1.904(g)-1T - Overall domestic loss and the overall domestic loss account (temporary).

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 9 2010-04-01 2010-04-01 false Overall domestic loss and the overall domestic... United States § 1.904(g)-1T Overall domestic loss and the overall domestic loss account (temporary). (a) Overview of regulations. This section provides rules for determining a taxpayer's overall domestic losses...

  14. Predicted 3D structures of olfactory receptors with details of odorant binding to OR1G1

    Science.gov (United States)

    Kim, Soo-Kyung; Goddard, William A.

    2014-12-01

    Olfactory receptors (ORs) are responsible for mediating the sense of smell; they allow humans to recognize an enormous number of odors but the connection between binding and perception is not known. We predict the ensemble of low energy structures for the human OR1G1 (hOR1G1) and also for six other diverse ORs, using the G protein-coupled receptor Ensemble of Structures in Membrane BiLayer Environment complete sampling method that samples 13 trillion different rotations and tilts using four different templates to predict the 24 structures likely to be important in binding and activation. Our predicted most stable structures of hOR1G1 have a salt-bridge between the conserved D3.49 and K6.30 in the D(E)RY region, that we expect to be associated with an inactive form. The hOR1G1 structure also has specific interaction in transmembrane domains (TMD) 3-6 (E3.39 and H6.40), which is likely an important conformational feature for all hORs because of the 94 to 98 % conservation among all hOR sequences. Of the five ligands studied (nonanal, 9-decen-1-ol, 1-nonanol, camphor, and n-butanal), we find that the 4 expected to bind lead to similar binding energies with nonanol the strongest.

  15. Genome-Wide Evolutionary Analyses of G1P[8] Strains Isolated Before and After Rotavirus Vaccine Introduction.

    Science.gov (United States)

    Zeller, Mark; Donato, Celeste; Trovão, Nídia Sequeira; Cowley, Daniel; Heylen, Elisabeth; Donker, Nicole C; McAllen, John K; Akopov, Asmik; Kirkness, Ewen F; Lemey, Philippe; Van Ranst, Marc; Matthijnssens, Jelle; Kirkwood, Carl D

    2015-08-08

    Rotaviruses are the most important etiological agent of acute gastroenteritis in young children worldwide. Among the first countries to introduce rotavirus vaccines into their national immunization programs were Belgium (November 2006) and Australia (July 2007). Surveillance programs in Belgium (since 1999) and Australia (since 1989) offer the opportunity to perform a detailed comparison of rotavirus strains circulating pre- and postvaccine introduction. G1P[8] rotaviruses are the most prominent genotype in humans, and a total of 157 G1P[8] rotaviruses isolated between 1999 and 2011 were selected from Belgium and Australia and their complete genomes were sequenced. Phylogenetic analysis showed evidence of frequent reassortment among Belgian and Australian G1P[8] rotaviruses. Although many different phylogenetic subclusters were present before and after vaccine introduction, some unique clusters were only identified after vaccine introduction, which could be due to natural fluctuation or the first signs of vaccine-driven evolution. The times to the most recent common ancestors for the Belgian and Australian G1P[8] rotaviruses ranged from 1846 to 1955 depending on the gene segment, with VP7 and NSP4 resulting in the most recent estimates. We found no evidence that rotavirus population size was affected after vaccine introduction and only six amino acid sites in VP2, VP3, VP7, and NSP1 were identified to be under positive selective pressure. Continued surveillance of G1P[8] strains is needed to determine long-term effects of vaccine introductions, particularly now rotavirus vaccines are implemented in the national immunization programs of an increasing number of countries worldwide. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Piperine causes G1 phase cell cycle arrest and apoptosis in melanoma cells through checkpoint kinase-1 activation.

    Directory of Open Access Journals (Sweden)

    Neel M Fofaria

    Full Text Available In this study, we determined the cytotoxic effects of piperine, a major constituent of black and long pepper in melanoma cells. Piperine treatment inhibited the growth of SK MEL 28 and B16 F0 cells in a dose and time-dependent manner. The growth inhibitory effects of piperine were mediated by cell cycle arrest of both the cell lines in G1 phase. The G1 arrest by piperine correlated with the down-regulation of cyclin D1 and induction of p21. Furthermore, this growth arrest by piperine treatment was associated with DNA damage as indicated by phosphorylation of H2AX at Ser139, activation of ataxia telangiectasia and rad3-related protein (ATR and checkpoint kinase 1 (Chk1. Pretreatment with AZD 7762, a Chk1 inhibitor not only abrogated the activation of Chk1 but also piperine mediated G1 arrest. Similarly, transfection of cells with Chk1 siRNA completely protected the cells from G1 arrest induced by piperine. Piperine treatment caused down-regulation of E2F1 and phosphorylation of retinoblastoma protein (Rb. Apoptosis induced by piperine was associated with down-regulation of XIAP, Bid (full length and cleavage of Caspase-3 and PARP. Furthermore, our results showed that piperine treatment generated ROS in melanoma cells. Blocking ROS by tiron protected the cells from piperine mediated cell cycle arrest and apoptosis. These results suggest that piperine mediated ROS played a critical role in inducing DNA damage and activation of Chk1 leading to G1 cell cycle arrest and apoptosis.

  17. Dual regulation by pairs of cyclin-dependent protein kinases and histone deacetylases controls G1 transcription in budding yeast.

    Directory of Open Access Journals (Sweden)

    Dongqing Huang

    2009-09-01

    Full Text Available START-dependent transcription in Saccharomyces cerevisiae is regulated by two transcription factors SBF and MBF, whose activity is controlled by the binding of the repressor Whi5. Phosphorylation and removal of Whi5 by the cyclin-dependent kinase (CDK Cln3-Cdc28 alleviates the Whi5-dependent repression on SBF and MBF, initiating entry into a new cell cycle. This Whi5-SBF/MBF transcriptional circuit is analogous to the regulatory pathway in mammalian cells that features the E2F family of G1 transcription factors and the retinoblastoma tumor suppressor protein (Rb. Here we describe genetic and biochemical evidence for the involvement of another CDK, Pcl-Pho85, in regulating G1 transcription, via phosphorylation and inhibition of Whi5. We show that a strain deleted for both PHO85 and CLN3 has a slow growth phenotype, a G1 delay, and is severely compromised for SBF-dependent reporter gene expression, yet all of these defects are alleviated by deletion of WHI5. Our biochemical and genetic tests suggest Whi5 mediates repression in part through interaction with two histone deacetylases (HDACs, Hos3 and Rpd3. In a manner analogous to cyclin D/CDK4/6, which phosphorylates Rb in mammalian cells disrupting its association with HDACs, phosphorylation by the early G1 CDKs Cln3-Cdc28 and Pcl9-Pho85 inhibits association of Whi5 with the HDACs. Contributions from multiple CDKs may provide the precision and accuracy necessary to activate G1 transcription when both internal and external cues are optimal.

  18. Piperine causes G1 phase cell cycle arrest and apoptosis in melanoma cells through checkpoint kinase-1 activation.

    Science.gov (United States)

    Fofaria, Neel M; Kim, Sung-Hoon; Srivastava, Sanjay K

    2014-01-01

    In this study, we determined the cytotoxic effects of piperine, a major constituent of black and long pepper in melanoma cells. Piperine treatment inhibited the growth of SK MEL 28 and B16 F0 cells in a dose and time-dependent manner. The growth inhibitory effects of piperine were mediated by cell cycle arrest of both the cell lines in G1 phase. The G1 arrest by piperine correlated with the down-regulation of cyclin D1 and induction of p21. Furthermore, this growth arrest by piperine treatment was associated with DNA damage as indicated by phosphorylation of H2AX at Ser139, activation of ataxia telangiectasia and rad3-related protein (ATR) and checkpoint kinase 1 (Chk1). Pretreatment with AZD 7762, a Chk1 inhibitor not only abrogated the activation of Chk1 but also piperine mediated G1 arrest. Similarly, transfection of cells with Chk1 siRNA completely protected the cells from G1 arrest induced by piperine. Piperine treatment caused down-regulation of E2F1 and phosphorylation of retinoblastoma protein (Rb). Apoptosis induced by piperine was associated with down-regulation of XIAP, Bid (full length) and cleavage of Caspase-3 and PARP. Furthermore, our results showed that piperine treatment generated ROS in melanoma cells. Blocking ROS by tiron protected the cells from piperine mediated cell cycle arrest and apoptosis. These results suggest that piperine mediated ROS played a critical role in inducing DNA damage and activation of Chk1 leading to G1 cell cycle arrest and apoptosis.

  19. Genome-Wide Evolutionary Analyses of G1P[8] Strains Isolated Before and After Rotavirus Vaccine Introduction

    Science.gov (United States)

    Zeller, Mark; Donato, Celeste; Trovão, Nídia Sequeira; Cowley, Daniel; Heylen, Elisabeth; Donker, Nicole C.; McAllen, John K.; Akopov, Asmik; Kirkness, Ewen F.; Lemey, Philippe; Van Ranst, Marc; Matthijnssens, Jelle; Kirkwood, Carl D.

    2015-01-01

    Rotaviruses are the most important etiological agent of acute gastroenteritis in young children worldwide. Among the first countries to introduce rotavirus vaccines into their national immunization programs were Belgium (November 2006) and Australia (July 2007). Surveillance programs in Belgium (since 1999) and Australia (since 1989) offer the opportunity to perform a detailed comparison of rotavirus strains circulating pre- and postvaccine introduction. G1P[8] rotaviruses are the most prominent genotype in humans, and a total of 157 G1P[8] rotaviruses isolated between 1999 and 2011 were selected from Belgium and Australia and their complete genomes were sequenced. Phylogenetic analysis showed evidence of frequent reassortment among Belgian and Australian G1P[8] rotaviruses. Although many different phylogenetic subclusters were present before and after vaccine introduction, some unique clusters were only identified after vaccine introduction, which could be due to natural fluctuation or the first signs of vaccine-driven evolution. The times to the most recent common ancestors for the Belgian and Australian G1P[8] rotaviruses ranged from 1846 to 1955 depending on the gene segment, with VP7 and NSP4 resulting in the most recent estimates. We found no evidence that rotavirus population size was affected after vaccine introduction and only six amino acid sites in VP2, VP3, VP7, and NSP1 were identified to be under positive selective pressure. Continued surveillance of G1P[8] strains is needed to determine long-term effects of vaccine introductions, particularly now rotavirus vaccines are implemented in the national immunization programs of an increasing number of countries worldwide. PMID:26254487

  20. Caractérisation de dispositifs de récupération d'horloge tout-optique par la mesure de taux d'erreur binaire

    OpenAIRE

    Ngo, Minh Nguyet; Roncin, Vincent; Le, Quang Trung; Bramerie, Laurent; Shen, Alexandre; Duan, Guang-Hua; Simon, Jean-Claude; Gay, Mathilde; Lobo, Sebastien

    2008-01-01

    session affiches A5 « Systèmes et Réseaux de télécommunications » [A5.2]; National audience; Nous proposons de caractériser différentes récupérations d'horloge tout-optiques, à base de lasers auto-pulsants à semiconducteurs, par la mesure de taux d'erreur binaire à 42,66 Gbit/s. Nous utilisons pour cela une technique de remodulation de l'horloge optique qui permet, via la mesure de taux d'erreur binaire, de comparer leurs performances et de quantifier leur sensibilité à la polarisation....

  1. MERCHANT MARINE SHIP REACTOR

    Science.gov (United States)

    Mumm, J.F.; North, D.C. Jr.; Rock, H.R.; Geston, D.K.

    1961-05-01

    A nuclear reactor is described for use in a merchant marine ship. The reactor is of pressurized light water cooled and moderated design in which three passes of the water through the core in successive regions of low, intermediate, and high heat generation and downflow in a fuel region are made. The foregoing design makes a compact reactor construction with extended core life. The core has an egg-crate lattice containing the fuel elements confined between a lower flow baffle and upper grid plate, with the latter serving also as part of a turn- around manifold from which the entire coolant is distributed into the outer fuel elements for the second pass through the core. The inner fuel elements are cooled in the third pass.

  2. Nuclear Rocket Engine Reactor

    CERN Document Server

    Lanin, Anatoly

    2013-01-01

    The development of a nuclear rocket engine reactor (NRER ) is presented in this book. The working capacity of an active zone NRER under mechanical and thermal load, intensive neutron fluxes, high energy generation (up to 30 MBT/l) in a working medium (hydrogen) at temperatures up to 3100 K is displayed. Design principles and bearing capacity of reactors area discussed on the basis of simulation experiments and test data of a prototype reactor. Property data of dense constructional, porous thermal insulating and fuel materials like carbide and uranium carbide compounds in the temperatures interval 300 - 3000 K are presented. Technological aspects of strength and thermal strength resistance of materials are considered. The design procedure of possible emergency processes in the NRER is developed and risks for their origination are evaluated. Prospects of the NRER development for pilotless space devices and piloted interplanetary ships are viewed.

  3. Nuclear reactor safety device

    Science.gov (United States)

    Hutter, Ernest

    1986-01-01

    A safety device is disclosed for use in a nuclear reactor for axially repositioning a control rod with respect to the reactor core in the event of an upward thermal excursion. Such safety device comprises a laminated helical ribbon configured as a tube-like helical coil having contiguous helical turns with slidably abutting edges. The helical coil is disclosed as a portion of a drive member connected axially to the control rod. The laminated ribbon is formed of outer and inner laminae. The material of the outer lamina has a greater thermal coefficient of expansion than the material of the inner lamina. In the event of an upward thermal excursion, the laminated helical coil curls inwardly to a smaller diameter. Such inward curling causes the total length of the helical coil to increase by a substantial increment, so that the control rod is axially repositioned by a corresponding amount to reduce the power output of the reactor.

  4. Heat dissipating nuclear reactor

    Science.gov (United States)

    Hunsbedt, A.; Lazarus, J.D.

    1985-11-21

    Disclosed is a nuclear reactor containment adapted to retain and cool core debris in the unlikely event of a core meltdown and subsequent breach in the reactor vessel. The reactor vessel is seated in a cavity which has a thick metal sidewall that is integral with a thick metal basemat at the bottom of the cavity. The basemat extends beyond the perimeter of the cavity sidewall. Underneath the basemat is a porous bed with water pipes and steam pipes running into it. Water is introduced into the bed and converted into steam which is vented to the atmosphere. A plurality of metal pilings in the form of H-beams extend from the metal base plate downwardly and outwardly into the earth.

  5. Reactor for exothermic reactions

    Science.gov (United States)

    Smith, Jr., Lawrence A.; Hearn, Dennis; Jones, Jr., Edward M.

    1993-01-01

    A liquid phase process for oligomerization of C.sub.4 and C.sub.5 isoolefins or the etherification thereof with C.sub.1 to C.sub.6 alcohols wherein the reactants are contacted in a reactor with a fixed bed acid cation exchange resin catalyst at an LHSV of 5 to 20, pressure of 0 to 400 psig and temperature of 120.degree. to 300.degree. F. Wherein the improvement is the operation of the reactor at a pressure to maintain the reaction mixture at its boiling point whereby at least a portion but less than all of the reaction mixture is vaporized. By operating at the boiling point and allowing a portion of the reaction mixture to vaporize, the exothermic heat of reaction is dissipated by the formation of more boil up and the temperature in the reactor is controlled.

  6. An Overview of Reactor Concepts, a Survey of Reactor Designs.

    Science.gov (United States)

    1985-02-01

    implies, this reactor uses gas as the primary coolant . The coolant has a higher exit temperature when leaving the core than the PWR water 6 AFWL-TN-84...nuclear reactors, coolants must be used to ensure material components are not subject to failure due to the temperature exceeding melting points...Reactors that use deu- terium (heavy water) as a coolant can use natural uranium as a fuel. The * Canadian reactor, CANDU , utilizes this concept

  7. Oscillatory flow chemical reactors

    Directory of Open Access Journals (Sweden)

    Slavnić Danijela S.

    2014-01-01

    Full Text Available Global market competition, increase in energy and other production costs, demands for high quality products and reduction of waste are forcing pharmaceutical, fine chemicals and biochemical industries, to search for radical solutions. One of the most effective ways to improve the overall production (cost reduction and better control of reactions is a transition from batch to continuous processes. However, the reactions of interests for the mentioned industry sectors are often slow, thus continuous tubular reactors would be impractically long for flow regimes which provide sufficient heat and mass transfer and narrow residence time distribution. The oscillatory flow reactors (OFR are newer type of tube reactors which can offer solution by providing continuous operation with approximately plug flow pattern, low shear stress rates and enhanced mass and heat transfer. These benefits are the result of very good mixing in OFR achieved by vortex generation. OFR consists of cylindrical tube containing equally spaced orifice baffles. Fluid oscillations are superimposed on a net (laminar flow. Eddies are generated when oscillating fluid collides with baffles and passes through orifices. Generation and propagation of vortices create uniform mixing in each reactor cavity (between baffles, providing an overall flow pattern which is close to plug flow. Oscillations can be created by direct action of a piston or a diaphragm on fluid (or alternatively on baffles. This article provides an overview of oscillatory flow reactor technology, its operating principles and basic design and scale - up characteristics. Further, the article reviews the key research findings in heat and mass transfer, shear stress, residence time distribution in OFR, presenting their advantages over the conventional reactors. Finally, relevant process intensification examples from pharmaceutical, polymer and biofuels industries are presented.

  8. Reactor Materials Research

    Energy Technology Data Exchange (ETDEWEB)

    Van Walle, E

    2002-04-01

    The activities of SCK-CEN's Reactor Materials Research Department for 2001 are summarised. The objectives of the department are: (1) to evaluate the integrity and behaviour of structural materials used in nuclear power industry; (2) to conduct research to unravel and understand the parameters that determine the material behaviour under or after irradiation; (3) to contribute to the interpretation, the modelling of the material behaviour and to develop and assess strategies for optimum life management of nuclear power plant components. The programmes within the department are focussed on studies concerning (1) Irradiation Assisted Stress Corrosion Cracking (IASCC); (2) nuclear fuel; and (3) Reactor Pressure Vessel Steel.

  9. Nuclear reactor apparatus

    Science.gov (United States)

    Wade, Elman E.

    1978-01-01

    A lifting, rotating and sealing apparatus for nuclear reactors utilizing rotating plugs above the nuclear reactor core. This apparatus permits rotation of the plugs to provide under the plug refueling of a nuclear core. It also provides a means by which positive top core holddown can be utilized. Both of these operations are accomplished by means of the apparatus lifting the top core holddown structure off the nuclear core while stationary, and maintaining this structure in its elevated position during plug rotation. During both of these operations, the interface between the rotating member and its supporting member is sealingly maintained.

  10. Perspectives on reactor safety

    Energy Technology Data Exchange (ETDEWEB)

    Haskin, F.E. [New Mexico Univ., Albuquerque, NM (United States). Dept. of Chemical and Nuclear Engineering; Camp, A.L. [Sandia National Labs., Albuquerque, NM (United States)

    1994-03-01

    The US Nuclear Regulatory Commission (NRC) maintains a technical training center at Chattanooga, Tennessee to provide appropriate training to both new and experienced NRC employees. This document describes a one-week course in reactor, safety concepts. The course consists of five modules: (1) historical perspective; (2) accident sequences; (3) accident progression in the reactor vessel; (4) containment characteristics and design bases; and (5) source terms and offsite consequences. The course text is accompanied by slides and videos during the actual presentation of the course.

  11. Safe reactor power

    Energy Technology Data Exchange (ETDEWEB)

    Menegus, R.L.; Ring, H.F.; Bernath, L.

    1956-05-15

    The upper limit on reactor operating power is established not only by safety considerations during steady-state operation but also by the requirement that during an accident no permanent damage be inflicted upon the reactor or the fuel charge. Two general categories of accidents are recognized; they are the ``nuclear runaway`` and the ``loss of coolant flow`` incidents. In this memorandum an incident of the latter type is analyzed. It is assumed that the safety rods function normally, and a method is defined for establishing the highest operating power that may be permitted if the postulated accident is to do no damage.

  12. Mesure directe de la distribution de température dans un cristal laser par thermographie infrarouge

    Science.gov (United States)

    Forget, S.; Chénais, S.; Druon, F.; Balembois, F.; Georges, P.

    2004-11-01

    La montée en puissance des lasers solides est fondamentalement limitée par des problèmes thermiques, qui découlent de la transformation d'une partie de l'énergie de pompe en chaleur. Nous présentons ici une méthode simple pour mesurer directement la température absolue à la surface d'un cristal, lorsqu'il est pompé longitudinalement par diode laser. La technique se base sur une caméra infrarouge sensible dans la bande 8-12 μm, et permet de cartographier de façon absolue la température avec une excellente résolution spatiale (de l'ordre de quelques dizaines de μm). Une étude systématique de l'influence du contact thermique sur la distribution de température est présentée, ainsi que la mesure des coefficients de transfert H pour quatre types de contacts thermiques largement utilisés.

  13. High Flux Isotope Reactor (HFIR)

    Data.gov (United States)

    Federal Laboratory Consortium — The HFIR at Oak Ridge National Laboratory is a light-water cooled and moderated reactor that is the United States’ highest flux reactor-based neutron source. HFIR...

  14. Reactor operation environmental information document

    Energy Technology Data Exchange (ETDEWEB)

    Haselow, J.S.; Price, V.; Stephenson, D.E.; Bledsoe, H.W.; Looney, B.B.

    1989-12-01

    The Savannah River Site (SRS) produces nuclear materials, primarily plutonium and tritium, to meet the requirements of the Department of Defense. These products have been formed in nuclear reactors that were built during 1950--1955 at the SRS. K, L, and P reactors are three of five reactors that have been used in the past to produce the nuclear materials. All three of these reactors discontinued operation in 1988. Currently, intense efforts are being extended to prepare these three reactors for restart in a manner that protects human health and the environment. To document that restarting the reactors will have minimal impacts to human health and the environment, a three-volume Reactor Operations Environmental Impact Document has been prepared. The document focuses on the impacts of restarting the K, L, and P reactors on both the SRS and surrounding areas. This volume discusses the geology, seismology, and subsurface hydrology. 195 refs., 101 figs., 16 tabs.

  15. Crystal Structures of Glycosyltransferase UGT78G1 Reveal the Molecular Basis for Glycosylation and Deglycosylation of (Iso)flavonoids

    Energy Technology Data Exchange (ETDEWEB)

    Modolo, Luzia V.; Li, Lenong; Pan, Haiyun; Blount, Jack W.; Dixon, Richard A.; Wang, Xiaoqiang; (SRNF)

    2010-09-21

    The glycosyltransferase UGT78G1 from Medicago truncatula catalyzes the glycosylation of various (iso)flavonoids such as the flavonols kaempferol and myricetin, the isoflavone formononetin, and the anthocyanidins pelargonidin and cyanidin. It also catalyzes a reverse reaction to remove the sugar moiety from glycosides. The structures of UGT78G1 bound with uridine diphosphate or with both uridine diphosphate and myricetin were determined at 2.1 {angstrom} resolution, revealing detailed interactions between the enzyme and substrates/products and suggesting a distinct binding mode for the acceptor/product. Comparative structural analysis and mutagenesis identify glutamate 192 as a key amino acid for the reverse reaction. This information provides a basis for enzyme engineering to manipulate substrate specificity and to design effective biocatalysts with glycosylation and/or deglycosylation activity.

  16. Evolutionarily conserved transcription factor Apontic controls the G1/S progression by inducing cyclin e during eye development

    KAUST Repository

    Liu, Qingxin

    2014-06-16

    During Drosophila eye development, differentiation initiates in the posterior region of the eye disk and progresses anteriorly as a wave marked by the morphogenetic furrow (MF), which demarcates the boundary between anterior undifferentiated cells and posterior differentiated photoreceptors. However, the mechanism underlying the regulation of gene expression immediately before the onset of differentiation remains unclear. Here, we show that Apontic (Apt), which is an evolutionarily conserved transcription factor, is expressed in the differentiating cells posterior to the MF. Moreover, it directly induces the expression of cyclin E and is also required for the G1-to-S phase transition, which is known to be essential for the initiation of cell differentiation at the MF. These observations identify a pathway crucial for eye development, governed by a mechanism in which Cyclin E promotes the G1-to-S phase transition when regulated by Apt.

  17. Molecular characterization of cystic echinococcosis: First record of G7 in Egypt and G1 in Yemen.

    Science.gov (United States)

    Alam-Eldin, Yosra H; Abdel Aaty, Heba E; Ahmed, Mona A

    2015-12-01

    Few molecular studies have identified the current status of cystic echinococcosis in Egypt. The present study aimed to ascertain the genotype(s) of Echinococcus granulosus responsible for human hydatidosis in different Egyptian governorates (regions). Animal isolates were collected from 40 camels, 5 pigs and 44 sheep. 27 human isolates were included in the present study. Specific PCR was performed and followed by DNA sequencing for mitochondrial 12S ribosomal RNA gene and BLAST analysis.The sheep cysts were not hydatid cysts. G6 genotype (camel starin) predominates in human, camel and pig isolates. G7 genotype (pig strain) was detected in two human isolates and one pig isolate. G1 genotype (sheep strain) was detected in one human isolate from Yemen and in no animal isolates. This is the first record of G7 in Egypt and G1 in Yemen.

  18. TopBP1 is required at mitosis to reduce transmission of DNA damage to G1 daughter cells

    DEFF Research Database (Denmark)

    Pedersen, Rune Troelsgaard; Kruse, Thomas; Nilsson, Jakob

    2015-01-01

    mitotic entry. In early mitosis, TopBP1 marks sites of and promotes unscheduled DNA synthesis. Moreover, TopBP1 is required for focus formation of the structure-selective nuclease and scaffold protein SLX4 in mitosis. Persistent TopBP1 foci transition into 53BP1 nuclear bodies (NBs) in G1 and precise...... temporal depletion of TopBP1 just before mitotic entry induced formation of 53BP1 NBs in the next cell cycle, showing that TopBP1 acts to reduce transmission of DNA damage to G1 daughter cells. Based on these results, we propose that TopBP1 maintains genome integrity in mitosis by controlling chromatin...

  19. Reassortment of Human and Animal Rotavirus Gene Segments in Emerging DS-1-Like G1P[8] Rotavirus Strains.

    Science.gov (United States)

    Komoto, Satoshi; Tacharoenmuang, Ratana; Guntapong, Ratigorn; Ide, Tomihiko; Tsuji, Takao; Yoshikawa, Tetsushi; Tharmaphornpilas, Piyanit; Sangkitporn, Somchai; Taniguchi, Koki

    2016-01-01

    The emergence and rapid spread of novel DS-1-like G1P[8] human rotaviruses in Japan were recently reported. More recently, such intergenogroup reassortant strains were identified in Thailand, implying the ongoing spread of unusual rotavirus strains in Asia. During rotavirus surveillance in Thailand, three DS-1-like intergenogroup reassortant strains having G3P[8] (RVA/Human-wt/THA/SKT-281/2013/G3P[8] and RVA/Human-wt/THA/SKT-289/2013/G3P[8]) and G2P[8] (RVA/Human-wt/THA/LS-04/2013/G2P[8]) genotypes were identified in fecal samples from hospitalized children with acute gastroenteritis. In this study, we sequenced and characterized the complete genomes of strains SKT-281, SKT-289, and LS-04. On whole genomic analysis, all three strains exhibited unique genotype constellations including both genogroup 1 and 2 genes: G3-P[8]-I2-R2-C2-M2-A2-N2-T2-E2-H2 for strains SKT-281 and SKT-289, and G2-P[8]-I2-R2-C2-M2-A2-N2-T2-E2-H2 for strain LS-04. Except for the G genotype, the unique genotype constellation of the three strains (P[8]-I2-R2-C2-M2-A2-N2-T2-E2-H2) is commonly shared with DS-1-like G1P[8] strains. On phylogenetic analysis, nine of the 11 genes of strains SKT-281 and SKT-289 (VP4, VP6, VP1-3, NSP1-3, and NSP5) appeared to have originated from DS-1-like G1P[8] strains, while the remaining VP7 and NSP4 genes appeared to be of equine and bovine origin, respectively. Thus, strains SKT-281 and SKT-289 appeared to be reassortant strains as to DS-1-like G1P[8], animal-derived human, and/or animal rotaviruses. On the other hand, seven of the 11 genes of strain LS-04 (VP7, VP6, VP1, VP3, and NSP3-5) appeared to have originated from locally circulating DS-1-like G2P[4] human rotaviruses, while three genes (VP4, VP2, and NSP1) were assumed to be derived from DS-1-like G1P[8] strains. Notably, the remaining NSP2 gene of strain LS-04 appeared to be of bovine origin. Thus, strain LS-04 was assumed to be a multiple reassortment strain as to DS-1-like G1P[8], locally circulating

  20. Reassortment of Human and Animal Rotavirus Gene Segments in Emerging DS-1-Like G1P[8] Rotavirus Strains.

    Directory of Open Access Journals (Sweden)

    Satoshi Komoto

    Full Text Available The emergence and rapid spread of novel DS-1-like G1P[8] human rotaviruses in Japan were recently reported. More recently, such intergenogroup reassortant strains were identified in Thailand, implying the ongoing spread of unusual rotavirus strains in Asia. During rotavirus surveillance in Thailand, three DS-1-like intergenogroup reassortant strains having G3P[8] (RVA/Human-wt/THA/SKT-281/2013/G3P[8] and RVA/Human-wt/THA/SKT-289/2013/G3P[8] and G2P[8] (RVA/Human-wt/THA/LS-04/2013/G2P[8] genotypes were identified in fecal samples from hospitalized children with acute gastroenteritis. In this study, we sequenced and characterized the complete genomes of strains SKT-281, SKT-289, and LS-04. On whole genomic analysis, all three strains exhibited unique genotype constellations including both genogroup 1 and 2 genes: G3-P[8]-I2-R2-C2-M2-A2-N2-T2-E2-H2 for strains SKT-281 and SKT-289, and G2-P[8]-I2-R2-C2-M2-A2-N2-T2-E2-H2 for strain LS-04. Except for the G genotype, the unique genotype constellation of the three strains (P[8]-I2-R2-C2-M2-A2-N2-T2-E2-H2 is commonly shared with DS-1-like G1P[8] strains. On phylogenetic analysis, nine of the 11 genes of strains SKT-281 and SKT-289 (VP4, VP6, VP1-3, NSP1-3, and NSP5 appeared to have originated from DS-1-like G1P[8] strains, while the remaining VP7 and NSP4 genes appeared to be of equine and bovine origin, respectively. Thus, strains SKT-281 and SKT-289 appeared to be reassortant strains as to DS-1-like G1P[8], animal-derived human, and/or animal rotaviruses. On the other hand, seven of the 11 genes of strain LS-04 (VP7, VP6, VP1, VP3, and NSP3-5 appeared to have originated from locally circulating DS-1-like G2P[4] human rotaviruses, while three genes (VP4, VP2, and NSP1 were assumed to be derived from DS-1-like G1P[8] strains. Notably, the remaining NSP2 gene of strain LS-04 appeared to be of bovine origin. Thus, strain LS-04 was assumed to be a multiple reassortment strain as to DS-1-like G1P[8], locally

  1. Reactor operation safety information document

    Energy Technology Data Exchange (ETDEWEB)

    1990-01-01

    The report contains a reactor facility description which includes K, P, and L reactor sites, structures, operating systems, engineered safety systems, support systems, and process and effluent monitoring systems; an accident analysis section which includes cooling system anomalies, radioactive materials releases, and anticipated transients without scram; a summary of onsite doses from design basis accidents; severe accident analysis (reactor core disruption); a description of operating contractor organization and emergency planning; and a summary of reactor safety evolution. (MB)

  2. On the Steady-State System Size Distribution for a Discrete-Time Geo/G/1 Repairable Queue

    Directory of Open Access Journals (Sweden)

    Renbin Liu

    2014-01-01

    Full Text Available This paper studies a discrete-time N-policy Geo/G/1 queueing system with feedback and repairable server. With a probabilistic analysis method and renewal process theory, the steady-state system size distribution is derived. Further, the steady-state system size distribution derived in this work is extremely suitable for numerical calculations. Numerical example illustrates the important application of steady-state system size distribution in system capacity design for a network access proxy system.

  3. Selective Subnormal IgG1 in 54 Adult Index Patients with Frequent or Severe Bacterial Respiratory Tract Infections.

    Science.gov (United States)

    Barton, James C; Bertoli, Luigi F; Barton, J Clayborn; Acton, Ronald T

    2016-01-01

    We characterized 54 adult index patients with reports of frequent or severe bacterial respiratory tract infections at diagnosis of selective subnormal IgG1. Mean age was 50 ± 13 (SD) y; 87.0% were women. Associated disorders included the following: autoimmune conditions 50.0%; hypothyroidism 24.1%; atopy 38.9%; and other allergy 31.5%. In 35.5%, proportions of protective S. pneumoniae serotype-specific IgG levels did not increase after polyvalent pneumococcal polysaccharide vaccination (PPPV). Blood lymphocyte subset levels were within reference limits in most patients. Regressions on IgG1 and IgG3 revealed no significant association with age, sex, autoimmune conditions, hypothyroidism, atopy, other allergy, corticosteroid therapy, or lymphocyte subsets. Regression on IgG2 revealed significant associations with PPPV response (negative) and CD19+ lymphocytes (positive). Regression on IgG4 revealed significant positive associations with episodic corticosteroid use and IgA. Regression on IgA revealed positive associations with IgG2 and IgG4. Regression on IgM revealed negative associations with CD56+/CD16+ lymphocytes. Regressions on categories of infection revealed a negative association of urinary tract infections and IgG1. HLA-A(⁎)03, HLA-B(⁎)55 and HLA-A(⁎)24, HLA-B(⁎)35 haplotype frequencies were greater in 38 patients than 751 controls. We conclude that nonprotective S. pneumoniae IgG levels and atopy contribute to increased susceptibility to respiratory tract infections in patients with selective subnormal IgG1.

  4. Detailed petrographic descriptions and microprobe data for tertiary silicic volcanic rocks in drill hole USW G-1, Yucca Mountain, Nevada

    Energy Technology Data Exchange (ETDEWEB)

    Caporuscio, F.A.; Warren, R.G.; Broxton, D.E.

    1985-12-01

    This report contains detailed petrographic descriptions of 74 thin sections from drill hole USW G-1 at Yucca Mountain, Nevada. These descriptions are keyed to the distinctions between devitrified, vitrophyre, vitric, and zeolitized intervals below the Topopah Spring Member repository horizon. The petrographic features of the zeolitized intervals down through the Crater Flat tuff, as well as the sorption properties determined from these intervals, suggest that these zeolite occurrences may each have comparable sorptive capability.

  5. MKP1 phosphatase mediates G1-specific dephosphorylation of H3Serine10P in response to DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Sharma, Ajit K.; Khan, Shafqat A.; Sharda, Asmita; Reddy, Divya V; Gupta, Sanjay, E-mail: sgupta@actrec.gov.in

    2015-08-15

    Highlights: • Reversible reduction of H3S10 phosphorylation after DNA damage is G1 phase specific. • Dynamic balance between MAP kinases, MKP1 and MSK1 regulate H3S10P during DDR. • MKP1 associates with chromatin bearing γH2AX in response to DNA damage. • Inhibition of MKP1 activity with specific inhibitor promotes radiation-induced cell death. - Abstract: Histone mark, H3S10 phosphorylation plays a dual role in a cell by maintaining relaxed chromatin for active transcription in interphase and condensed chromatin state in mitosis. The level of H3S10P has also been shown to alter on DNA damage; however, its cell cycle specific behavior and regulation during DNA damage response is largely unexplored. In the present study, we demonstrate G1 cell cycle phase specific reversible loss of H3S10P in response to IR-induced DNA damage is mediated by opposing activities of phosphatase, MKP1 and kinase, MSK1 of the MAP kinase pathway. We also show that the MKP1 recruits to the chromatin in response to DNA damage and correlates with the decrease of H3S10P, whereas MKP1 is released from chromatin during recovery phase of DDR. Furthermore, blocking of H3S10 dephosphorylation by MKP1 inhibition impairs DNA repair process and results in poor survival of WRL68 cells. Collectively, our data proposes a pathway regulating G1 cell cycle phase specific reversible reduction of H3S10P on IR induced DNA damage and also raises the possibility of combinatorial modulation of H3S10P with specific inhibitors to target the cancer cells in G1-phase of cell cycle.

  6. In vitro glycoengineering of IgG1 and its effect on Fc receptor binding and ADCC activity.

    Directory of Open Access Journals (Sweden)

    Marco Thomann

    Full Text Available The importance and effect of Fc glycosylation of monoclonal antibodies with regard to biological activity is widely discussed and has been investigated in numerous studies. Fc glycosylation of monoclonal antibodies from current production systems is subject to batch-to-batch variability. If there are glycosylation changes between different batches, these changes are observed not only for one but multiple glycan species. Therefore, studying the effect of distinct Fc glycan species such as galactosylated and sialylated structures is challenging due to the lack of well-defined differences in glycan patterns of samples used. In this study, the influence of IgG1 Fc galactosylation and sialylation on its effector functions has been investigated using five different samples which were produced from one single drug substance batch by in vitro glycoengineering. This sample set comprises preparations with minimal and maximal galactosylation and different levels of sialylation of fully galactosylated Fc glycans. Among others, Roche developed the glycosyltransferase enzyme sialyltransferase which was used for the in vitro glycoengineering activities at medium scale. A variety of analytical assays, including Surface Plasmon Resonance and recently developed FcγR affinity chromatography, as well as an optimized cell-based ADCC assay were applied to investigate the effect of Fc galactosylation and sialylation on the in vitro FcγRI, IIa, and IIIa receptor binding and ADCC activity of IgG1. The results of our studies do not show an impact, neither positive nor negative, of sialic acid- containing Fc glycans of IgG1 on ADCC activity, FcγRI, and RIIIa receptors, but a slightly improved binding to FcγRIIa. Furthermore, we demonstrate a galactosylation-induced positive impact on the binding activity of the IgG1 to FcγRIIa and FcγRIIIa receptors and ADCC activity.

  7. Singularity-conquering ZG controllers of z2g1 type for tracking control of the IPC system

    Science.gov (United States)

    Zhang, Yunong; Yu, Xiaotian; Yin, Yonghua; Peng, Chen; Fan, Zhengping

    2014-09-01

    With wider investigations and applications of autonomous robotics and intelligent vehicles, the inverted pendulum on a cart (IPC) system has become more attractive for numerous researchers due to its concise and representative structure. In this article, the tracking-control problem of the IPC system is considered and investigated. Based on Zhang dynamics (ZD) and gradient dynamics (GD), a novel kind of ZG controllers are developed and investigated for achieving the tracking-control purpose, which contains controllers of z2g0 and z2g1 types according to the number of times of using the ZD and GD methods. Besides, theoretical analyses are presented to guarantee the global and exponential convergence performance of both z2g0 and z2g1 controllers. Computer simulations are further performed to substantiate the feasibility and effectiveness of ZG controllers. More importantly, comparative simulation results demonstrate that controllers of z2g1 type can conquer the singularity problem (i.e. the division-by-zero problem).

  8. Performance of a newly isolated salt-tolerant yeast strain Pichia occidentalis G1 for degrading and detoxifying azo dyes.

    Science.gov (United States)

    Song, Li; Shao, Yifan; Ning, Shuxiang; Tan, Liang

    2017-06-01

    A salt-tolerant yeast named G1 which could decolorize various azo dyes was recently isolated and identified as Pichia occidentalis. Systematic researches on characterization, degradation pathway, detoxification effects and enzymes analysis of this yeast were done. The results showed that the optimal metabolism and growth parameters for strain G1 were: 2.0gL-1 glucose, 0.6gL-1 ammonium sulfate, 0.08gL-1 yeast extract, 30gL-1 NaCl, 160rmin-1, 30°C and pH 5.0. More than 98% of 50mgL-1 Acid Red B (ARB) could be decolorized within 16h under the optimal conditions. Additionally, strain G1 degraded and obviously detoxified ARB through a possible pathway successively consisting of decolorization, deamination/desulfonation and TCA cycle processes. Moreover, NADH-DCIP reductase was estimated as the key reductase for decolorization and ligninases including lignin peroxidase, manganese peroxidase and laccase were important oxidoreductases for further degradation of decolorization intermediates. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. The Spin-dependent Structure Function of the Proton $g_{1}^p$ and a Test of the Bjorken Sum Rule

    CERN Document Server

    Alekseev, M.G.; Alexandrov, Yu.; Alexeev, G.D.; Amoroso, A.; Austregesilo, A.; Badelek, B.; Balestra, F.; Ball, J.; Barth, J.; Baum, G.; Bedfer, Y.; Bernhard, J.; Bertini, R.; Bettinelli, M.; Birsa, R.; Bisplinghoff, J.; Bordalo, P.; Bradamante, F.; Bravar, A.; Bressan, A.; Brona, G.; Burtin, E.; Bussa, M.P.; Chaberny, D.; Cotic, D.; Chiosso, M.; Chung, S.U.; Cicuttin, A.; Colantoni, M.; Crespo, M.L.; Dalla Torre, S.; Das, S.; Dasgupta, S.S.; Denisov, O.Yu.; Dhara, L.; Diaz, V.; Donskov, S.V.; Doshita, N.; Duic, V.; Dunnweber, W.; Efremov, A.; El Alaoui, A.; Eversheim, P.D.; Eyrich, W.; Faessler, M.; Ferrero, A.; Filin, A.; Finger, M.; Finger, M., Jr.; Fischer, H.; Franco, C.; Friedrich, J.M.; Garfagnini, R.; Gautheron, F.; Gavrichtchouk, O.P.; Gazda, R.; Gerassimov, S.; Geyer, R.; Giorgi, M.; Gnesi, I.; Gobbo, B.; Goertz, S.; Grabmuller, S.; Grasso, A.; Grube, B.; Gushterski, R.; Guskov, A.; Haas, F.; von Harrach, D.; Hasegawa, T.; Heinsius, F.H.; Hermann, R.; Herrmann, F.; Hess, C.; Hinterberger, F.; Horikawa, N.; Hoppner, Ch.; d'Hose, N.; Ilgner, C.; Ishimoto, S.; Ivanov, O.; Ivanshin, Yu.; Iwata, T.; Jahn, R.; Jasinski, P.; Jegou, G.; Joosten, R.; Kabuss, E.; Kafer, W.; Kang, D.; Ketzer, B.; Khaustov, G.V.; Khokhlov, Yu.A.; Kisselev, Yu.; Klein, F.; Klimaszewski, K.; Koblitz, S.; Koivuniemi, J.H.; Kolosov, V.N.; Kondo, K.; Konigsmann, K.; Konopka, R.; Konorov, I.; Konstantinov, V.F.; Korzenev, A.; Kotzinian, A.M.; Kouznetsov, O.; Kowalik, K.; Kramer, M.; Kral, A.; Kroumchtein, Z.V.; Kuhn, R.; Kunne, F.; Kurek, K.; Lauser, L.; Le Goff, J.M.; Lednev, A.A.; Lehmann, A.; Levorato, S.; Lichtenstadt, J.; Liska, T.; Maggiora, A.; Maggiora, M.; Magnon, A.; Mallot, G.K.; Mann, A.; Marchand, C.; Marroncle, J.; Martin, A.; Marzec, J.; Massmann, F.; Matsuda, T.; Maximov, A.N.; Meyer, W.; Michigami, T.; Mikhailov, Yu.V.; Moinester, M.A.; Mutter, A.; Nagaytsev, A.; Nagel, T.; Nassalski, J.; Negrini, T.; Nerling, F.; Neubert, S.; Neyret, D.; Nikolaenko, V.I.; Nunes, A.S.; Olshevsky, A.G.; Ostrick, M.; Padee, A.; Panknin, R.; Panzieri, D.; Parsamyan, B.; Paul, S.; Pawlukiewicz-Kaminska, B.; Perevalova, E.; Pesaro, G.; Peshekhonov, D.V.; Piragino, G.; Platchkov, S.; Pochodzalla, J.; Polak, J.; Polyakov, V.A.; Pontecorvo, G.; Pretz, J.; Quintans, C.; Rajotte, J.F.; Ramos, S.; Rapatsky, V.; Reicherz, G.; Richter, A.; Robinet, F.; Rocco, E.; Rondio, E.; Ryabchikov, D.I.; Samoylenko, V.D.; Sandacz, A.; Santos, H.; Sapozhnikov, M.G.; Sarkar, S.; Savin, I.A.; Sbrizzai, G.; Schiavon, P.; Schill, C.; Schmitt, L.; Schluter, T.; Schopferer, S.; Schroder, W.; Shevchenko, O.Yu.; Siebert, H.W.; Silva, L.; Sinha, L.; Sissakian, A.N.; Slunecka, M.; Smirnov, G.I.; Sosio, S.; Sozzi, F.; Srnka, A.; Stolarski, M.; Sulc, M.; Sulej, R.; Takekawa, S.; Tessaro, S.; Tessarotto, F.; Teufel, A.; Tkatchev, L.G.; Uhl, S.; Uman, I.; Virius, M.; Vlassov, N.V.; Vossen, A.; Weitzel, Q.; Windmolders, R.; Wislicki, W.; Wollny, H.; Zaremba, K.; Zavertyaev, M.; Zemlyanichkina, E.; Ziembicki, M.; Zhao, J.; Zhuravlev, N.; Zvyagin, A.

    2010-01-01

    The inclusive double-spin asymmetry, $A_{1}^{p}$, has been measured at COMPASS in deepinelastic polarised muon scattering off a large polarised NH3 target. The data, collected in the year 2007, cover the range Q2 > 1 (GeV/c)^2, 0.004 < x < 0.7 and improve the statistical precision of g_{1}^{p}(x) by a factor of two in the region x < 0.02. The new proton asymmetries are combined with those previously published for the deuteron to extract the non-singlet spin-dependent structure function g_1^NS(x,Q2). The isovector quark density, Delta_q_3(x,Q2), is evaluated from a NLO QCD fit of g_1^NS. The first moment of Delta_q3 is in good agreement with the value predicted by the Bjorken sum rule and corresponds to a ratio of the axial and vector coupling constants g_A/g_V = 1.28+-0.07(stat)+-0.10(syst).

  10. Fast reactor programme in India

    Indian Academy of Sciences (India)

    2015-09-04

    Sep 4, 2015 ... criteria; passive shutdown and decay heat removal systems; fast breeder reactors in India. PACS No. 28.41.−i. 1. ... water reactors, mainly pressurized heavy water reactors (PHWRs) to extract ∼10 GWe capacity for ..... commissioning phase and most of the supporting systems have been commissioned and.

  11. Engineering reactors for catalytic reactions

    Indian Academy of Sciences (India)

    Extensive studies have been conducted to establish sound basis for design and engineering of reactors for practising such catalytic reactions and for realizing improvements in reactor performance. In this article, application of recent (and not so recent) developments in engineering reactors for catalytic reactions is ...

  12. REACTOR FUEL ELEMENTS TESTING CONTAINER

    Science.gov (United States)

    Whitham, G.K.; Smith, R.R.

    1963-01-15

    This patent shows a method for detecting leaks in jacketed fuel elements. The element is placed in a sealed tank within a nuclear reactor, and, while the reactor operates, the element is sparged with gas. The gas is then led outside the reactor and monitored for radioactive Xe or Kr. (AEC)

  13. Fast reactor programme in India

    Indian Academy of Sciences (India)

    2015-09-04

    Sep 4, 2015 ... Home; Journals; Pramana – Journal of Physics; Volume 85; Issue 3. Fast reactor programme in India. P Chellapandi P R ... Keywords. Sodium fast reactor; design challenges; construction challenges; emerging safety criteria; passive shutdown and decay heat removal systems; fast breeder reactors in India.

  14. Stabilized Spheromak Fusion Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Fowler, T

    2007-04-03

    The U.S. fusion energy program is focused on research with the potential for studying plasmas at thermonuclear temperatures, currently epitomized by the tokamak-based International Thermonuclear Experimental Reactor (ITER) but also continuing exploratory work on other plasma confinement concepts. Among the latter is the spheromak pursued on the SSPX facility at LLNL. Experiments in SSPX using electrostatic current drive by coaxial guns have now demonstrated stable spheromaks with good heat confinement, if the plasma is maintained near a Taylor state, but the anticipated high current amplification by gun injection has not yet been achieved. In future experiments and reactors, creating and maintaining a stable spheromak configuration at high magnetic field strength may require auxiliary current drive using neutral beams or RF power. Here we show that neutral beam current drive soon to be explored on SSPX could yield a compact spheromak reactor with current drive efficiency comparable to that of steady state tokamaks. Thus, while more will be learned about electrostatic current drive in coming months, results already achieved in SSPX could point to a productive parallel development path pursuing auxiliary current drive, consistent with plans to install neutral beams on SSPX in the near future. Among possible outcomes, spheromak research could also yield pulsed fusion reactors at lower capital cost than any fusion concept yet proposed.

  15. Nuclear Reactors and Technology

    Energy Technology Data Exchange (ETDEWEB)

    Cason, D.L.; Hicks, S.C. [eds.

    1992-01-01

    This publication Nuclear Reactors and Technology (NRT) announces on a monthly basis the current worldwide information available from the open literature on nuclear reactors and technology, including all aspects of power reactors, components and accessories, fuel elements, control systems, and materials. This publication contains the abstracts of DOE reports, journal articles, conference papers, patents, theses, and monographs added to the Energy Science and Technology Database during the past month. Also included are US information obtained through acquisition programs or interagency agreements and international information obtained through the International Energy Agency`s Energy Technology Data Exchange or government-to-government agreements. The digests in NRT and other citations to information on nuclear reactors back to 1948 are available for online searching and retrieval on the Energy Science and Technology Database and Nuclear Science Abstracts (NSA) database. Current information, added daily to the Energy Science and Technology Database, is available to DOE and its contractors through the DOE Integrated Technical Information System. Customized profiles can be developed to provide current information to meet each user`s needs.

  16. Nuclear reactor building

    Science.gov (United States)

    Gou, P.F.; Townsend, H.E.; Barbanti, G.

    1994-04-05

    A reactor building for enclosing a nuclear reactor includes a containment vessel having a wetwell disposed therein. The wetwell includes inner and outer walls, a floor, and a roof defining a wetwell pool and a suppression chamber disposed there above. The wetwell and containment vessel define a drywell surrounding the reactor. A plurality of vents are disposed in the wetwell pool in flow communication with the drywell for channeling into the wetwell pool steam released in the drywell from the reactor during a LOCA for example, for condensing the steam. A shell is disposed inside the wetwell and extends into the wetwell pool to define a dry gap devoid of wetwell water and disposed in flow communication with the suppression chamber. In a preferred embodiment, the wetwell roof is in the form of a slab disposed on spaced apart support beams which define there between an auxiliary chamber. The dry gap, and additionally the auxiliary chamber, provide increased volume to the suppression chamber for improving pressure margin. 4 figures.

  17. JACKETED REACTOR FUEL ELEMENT

    Science.gov (United States)

    Smith, K.F.; Van Thyne, R.J.

    1958-12-01

    A fuel element is described for fast reactors comprised of a core of uranium metal containing material and a jacket around the core, the jacket consisting of from 2.5 to 15 percent of titanium, from 1 to 5 percent of niobium, and from 80 to 96.5 percent of vanadium.

  18. Nuclear rocket engine reactor

    Energy Technology Data Exchange (ETDEWEB)

    Lanin, Anatoly

    2013-07-01

    Covers a new technology of nuclear reactors and the related materials aspects. Integrates physics, materials science and engineering Serves as a basic book for nuclear engineers and nuclear physicists. The development of a nuclear rocket engine reactor (NRER) is presented in this book. The working capacity of an active zone NRER under mechanical and thermal load, intensive neutron fluxes, high energy generation (up to 30 MBT/l) in a working medium (hydrogen) at temperatures up to 3100 K is displayed. Design principles and bearing capacity of reactors area discussed on the basis of simulation experiments and test data of a prototype reactor. Property data of dense constructional, porous thermal insulating and fuel materials like carbide and uranium carbide compounds in the temperatures interval 300 - 3000 K are presented. Technological aspects of strength and thermal strength resistance of materials are considered. The design procedure of possible emergency processes in the NRER is developed and risks for their origination are evaluated. Prospects of the NRER development for pilotless space devices and piloted interplanetary ships are viewed.

  19. WATER BOILER REACTOR

    Science.gov (United States)

    King, L.D.P.

    1960-11-22

    As its name implies, this reactor utilizes an aqueous solution of a fissionable element salt, and is also conventional in that it contains a heat exchanger cooling coil immersed in the fuel. Its novelty lies in the utilization of a cylindrical reactor vessel to provide a critical region having a large and constant interface with a supernatant vapor region, and the use of a hollow sleeve coolant member suspended from the cover assembly in coaxial relation with the reactor vessel. Cool water is circulated inside this hollow coolant member, and a gap between its outer wall and the reactor vessel is used to carry off radiolytic gases for recombination in an external catalyst chamber. The central passage of the coolant member defines a reflux condenser passage into which the externally recombined gases are returned and condensed. The large and constant interface between fuel solution and vapor region prevents the formation of large bubbles and minimizes the amount of fuel salt carried off by water vapor, thus making possible higher flux densities, specific powers and power densities.

  20. Fossil fuel furnace reactor

    Science.gov (United States)

    Parkinson, William J.

    1987-01-01

    A fossil fuel furnace reactor is provided for simulating a continuous processing plant with a batch reactor. An internal reaction vessel contains a batch of shale oil, with the vessel having a relatively thin wall thickness for a heat transfer rate effective to simulate a process temperature history in the selected continuous processing plant. A heater jacket is disposed about the reactor vessel and defines a number of independent controllable temperature zones axially spaced along the reaction vessel. Each temperature zone can be energized to simulate a time-temperature history of process material through the continuous plant. A pressure vessel contains both the heater jacket and the reaction vessel at an operating pressure functionally selected to simulate the continuous processing plant. The process yield from the oil shale may be used as feedback information to software simulating operation of the continuous plant to provide operating parameters, i.e., temperature profiles, ambient atmosphere, operating pressure, material feed rates, etc., for simulation in the batch reactor.

  1. NEUTRONIC REACTOR SHIELD

    Science.gov (United States)

    Fermi, E.; Zinn, W.H.

    1957-09-24

    The reactor radiation shield material is comprised of alternate layers of iron-containing material and compressed cellulosic material, such as masonite. The shielding material may be prefabricated in the form of blocks, which can be stacked together in ary desired fashion to form an effective shield.

  2. Neutronic Reactor Structure

    Science.gov (United States)

    Vernon, H. C.; Weinberg, A. M.

    1961-05-30

    The neutronic reactor is comprised of a core consisting of natural uranium and heavy water with a K-factor greater than unity. The core is surrounded by a reflector consisting of natural uranium and ordinary water with a Kfactor less than unity. (AEC)

  3. NEUTRONIC REACTOR CONTROL ELEMENT

    Science.gov (United States)

    Beaver, R.J.; Leitten, C.F. Jr.

    1962-04-17

    A boron-10 containing reactor control element wherein the boron-10 is dispersed in a matrix material is describeri. The concentration of boron-10 in the matrix varies transversely across the element from a minimum at the surface to a maximum at the center of the element, prior to exposure to neutrons. (AEC)

  4. Thermal Reactor Safety

    Energy Technology Data Exchange (ETDEWEB)

    1980-06-01

    Information is presented concerning fire risk and protection; transient thermal-hydraulic analysis and experiments; class 9 accidents and containment; diagnostics and in-service inspection; risk and cost comparison of alternative electric energy sources; fuel behavior and experiments on core cooling in LOCAs; reactor event reporting analysis; equipment qualification; post facts analysis of the TMI-2 accident; and computational methods.

  5. Research on the reactor physics and reactor safety of VVER reactors. AER Symposium 2016

    Energy Technology Data Exchange (ETDEWEB)

    Kliem, S.

    2017-09-15

    The selected paperscan be attributed to the following main subjects: Reactor start-up tests and use of corresponding data for code validation, code development and application, approaches for safety analyses, closure of nuclear fuel cycle, prospective reactor concepts.

  6. Sequencing Bacth Reactors; Reactores biologicos secuenciados

    Energy Technology Data Exchange (ETDEWEB)

    Nolasco, D.; Manoharan, M.

    1999-06-01

    The application of sequencing batch reactors (SBR) for wastewater treatment is becoming increasingly popular. However, published information on process performance and construction costs for SBRs is scarce. For this reason. Environment Canada, the Ontario Ministry of the Environment (MOE), and the Water Environment Association of Ontario (WEAO) decided to sponsor a program to evaluate the performance of 75 municipal SBRs in Canada and the United States. Effluent quality, construction costs, and design and operating problems were investigated. Areas for optimization found as a result of this investigation were classified an prioritized based on their impact on operational costs, treatment capacity, effluent quality, and frequency of occurrence. A list of recommendations for process optimization was prepared. A construction cost comparison between activated sludge systems of continuous flow and SBRs was prepared. (Author) 12 refs.

  7. Units for ionisation chamber measurements of {beta} and {gamma} activity; Ensemble de mesure d'activite {beta} et {gamma} par chambre d'ionisation

    Energy Technology Data Exchange (ETDEWEB)

    Engelmann, J.J.; Roquefort, H. [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires

    1960-07-01

    In this paper two methods for ionisation chamber measurements of {beta} and {gamma} activity are discussed. Two ionisation chambers associated with continuous current amplifiers are described: - the first, type C {beta} {gamma} 1, is intended chiefly for measuring the specific activity of {beta}-emitting solutions and the dose rate on the surface of radioactive application systems, - the second, type CCP{gamma} 1, known as a well chamber, serves mainly for measuring the activity of {gamma}-emitting sources or solutions. (author) [French] Dans cet article, nous etudions 2 methodes de mesure d'activite {beta} et {gamma} par chambre d'ionisation. Nous decrirons deux chambres d'ionisation associees a des amplificateurs a courant continu: - l'une, type C {beta} {gamma} 1, permet principalement la mesure de l'activite specifique des solutions emettrices {beta}, et la mesure de dose a la surface d'applicateurs radioactifs; - l'autre, type CCP{gamma} 1, dite chambre a puits, permet principalement la mesure de l'activite de sources ou solutions emettrices {gamma}. (auteur)

  8. CER. Research reactors in France

    Energy Technology Data Exchange (ETDEWEB)

    Estrade, Jerome [CEA, DEN, DER, Saint-Paul-lez-Durance (France). Jules Horowitz Reactor (JHR)

    2012-10-15

    Networking and the establishment of coalitions between research reactors are important to guarantee a high technical quality of the facility, to assure well educated and trained personnel, to harmonize the codes of standards and the know-ledge of the personnel as well as to enhance research reactor utilization. In addition to the European co-operation, country-specific working groups have been established for many years, such as the French research reactor Club d'Exploitants des Reacteurs (CER). It is the association of French research reactors representing all types of research reactors from zero power up to high flux reactors. CER was founded in 1990 and today a number of 14 research reactors meet twice a year for an exchange of experience. (orig.)

  9. Methanogenesis in Thermophilic Biogas Reactors

    DEFF Research Database (Denmark)

    Ahring, Birgitte Kiær

    1995-01-01

    Methanogenesis in thermophilic biogas reactors fed with different wastes is examined. The specific methanogenic activity with acetate or hydrogen as substrate reflected the organic loading of the specific reactor examined. Increasing the loading of thermophilic reactors stabilized the process...... as indicated by a lower concentration of volatile fatty acids in the effluent from the reactors. The specific methanogenic activity in a thermophilic pilot-plant biogas reactor fed with a mixture of cow and pig manure reflected the stability of the reactor. The numbers of methanogens counted by the most...... against Methanothrix soehngenii or Methanothrix CALS-I in any of the thermophilic biogas reactors examined. Studies using 2-14C-labeled acetate showed that at high concentrations (more than approx. 1 mM) acetate was metabolized via the aceticlastic pathway, transforming the methyl-group of acetate...

  10. Etude du méson Bs et mesure de sa durée de vie avec le détecteur ALEPH

    CERN Document Server

    Duarte, Helder

    A partir des données de 1991 et 1992 du détecteur ALEPH au LEP, nous obtenons un signal provenant du méson Bos en étudiant ses désintégrations semi-leptoniques en un méson D-s et un lepton de signe opposé. L'optimisation du rejet des bruits de fond et de l'efficacité de sélection utilise, entre autres, la mesure d'ionisation des particules chargées. Pour déterminer la durée de vie du B0s, il est nécessaire de mesurer l'énergie de chaque candidat. Cette énergie est la somme des énergies des particules chargées D-s et lepton et de l'énergie manquante, incluant une correction de masse des hémisphères, identifiée à l'énergie du neutrino. Nous utilisons cette mesure d'énergie manquante pour réduire les bruits de fond et mesurer la probabilité Ps qu'un quark beau produise un méson B0s lors de l'hadronisation: Ps = P (b→Bs) = (13,2 ± 4,3 ± 4,4)%. Pour la mesure de la durée de vie du B0s, nous reconstruisons les vertex de désintégration du D-s et du B0s à partir de leurs produits d...

  11. Nuclear reactor construction with bottom supported reactor vessel

    Science.gov (United States)

    Sharbaugh, John E.

    1987-01-01

    An improved liquid metal nuclear reactor construction has a reactor core and a generally cylindrical reactor vessel for holding a large pool of low pressure liquid metal coolant and housing the core within the pool. The reactor vessel has an open top end, a closed flat bottom end wall and a continuous cylindrical closed side wall interconnecting the top end and bottom end wall. The reactor also has a generally cylindrical concrete containment structure surrounding the reactor vessel and being formed by a cylindrical side wall spaced outwardly from the reactor vessel side wall and a flat base mat spaced below the reactor vessel bottom end wall. A central support pedestal is anchored to the containment structure base mat and extends upwardly therefrom to the reactor vessel and upwardly therefrom to the reactor core so as to support the bottom end wall of the reactor vessel and the lower end of the reactor core in spaced apart relationship above the containment structure base mat. Also, an annular reinforced support structure is disposed in the reactor vessel on the bottom end wall thereof and extends about the lower end of the core so as to support the periphery thereof. In addition, an annular support ring having a plurality of inward radially extending linear members is disposed between the containment structure base mat and the bottom end of the reactor vessel wall and is connected to and supports the reactor vessel at its bottom end on the containment structure base mat so as to allow the reactor vessel to expand radially but substantially prevent any lateral motions that might be imposed by the occurrence of a seismic event. The reactor construction also includes a bed of insulating material in sand-like granular form, preferably being high density magnesium oxide particles, disposed between the containment structure base mat and the bottom end wall of the reactor vessel and uniformly supporting the reactor vessel at its bottom end wall on the containment

  12. Reactor core stability monitoring method for BWR type reactor

    Energy Technology Data Exchange (ETDEWEB)

    Kanemoto, Shigeru; Ebata, Shigeo.

    1992-09-01

    In an operation for a BWR type reactor, reactor power is usually increased or decreased by controlling both of control rods and reactor core flow rate. Under a certain condition, the reactor core is made unstable by the coupling of nuclear and thermohydrodynamic characteristics in the reactor. Therefore, the reactor power and the reactor core flow rate are changed within a range predetermined by a design calculation. However, if reactor core stability can be always measured and monitored, it is useful for safe operation, as well as an existent operation range can be extended to enable more effective operation. That is, autoregressive a coefficient is determined successively on real time based on fluctuation components of neutron flux signals. Based on the result, an amplification ratio, as a typical measure of the reactor core stability, is determined on a real time. A time constant of the successive calculation for the autoregressive coefficient can be made variable by the amplification ratio. Then, the amplification ratio is estimated at a constant accuracy. With such procedures, the reactor core stability can be monitored successively in an ON-line manner at a high accuracy, thereby enabling to improve the operation performance. (I.S.).

  13. Telomerase expression is sufficient for chromosomal integrity in cells lacking p53 dependent G1 checkpoint function

    Directory of Open Access Journals (Sweden)

    Simpson Dennis A

    2005-10-01

    Full Text Available Abstract Background Secondary cultures of human fibroblasts display a finite lifespan ending at senescence. Loss of p53 function by mutation or viral oncogene expression bypasses senescence, allowing cell division to continue for an additional 10 – 20 doublings. During this time chromosomal aberrations seen in mitotic cells increase while DNA damage and decatenation checkpoint functions in G2 cells decrease. Methods To explore this complex interplay between chromosomal instability and checkpoint dysfunction, human fibroblast lines were derived that expressed HPV16E6 oncoprotein or dominant-negative alleles of p53 (A143V and H179Q with or without the catalytic subunit of telomerase. Results Cells with normal p53 function displayed 86 – 93% G1 arrest after exposure to 1.5 Gy ionizing radiation (IR. Expression of HPV16E6 or p53-H179Q severely attenuated G1 checkpoint function (3 – 20% arrest while p53-A143V expression induced intermediate attenuation (55 – 57% arrest irrespective of telomerase expression. All cell lines, regardless of telomerase expression or p53 status, exhibited a normal DNA damage G2 checkpoint response following exposure to 1.5 Gy IR prior to the senescence checkpoint. As telomerase-negative cells bypassed senescence, the frequencies of chromosomal aberrations increased generally congruent with attenuation of G2 checkpoint function. Telomerase expression allowed cells with defective p53 function to grow >175 doublings without chromosomal aberrations or attenuation of G2 checkpoint function. Conclusion Thus, chromosomal instability in cells with defective p53 function appears to depend upon telomere erosion not loss of the DNA damage induced G1 checkpoint.

  14. Prolyl hydroxylase PHD3 enhances the hypoxic survival and G1 to S transition of carcinoma cells.

    Directory of Open Access Journals (Sweden)

    Heidi Högel

    Full Text Available Hypoxia restricts cell proliferation and cell cycle progression at the G1/S interface but at least a subpopulation of carcinoma cells can escape the restriction. In carcinoma hypoxia may in fact select for cells with enhanced hypoxic survival and increased aggressiveness. The cellular oxygen sensors HIF proline hydroxylases (PHDs adapt the cellular functions to lowered environmental oxygen tension. PHD3 isoform has shown the strongest hypoxic upregulation among the family members. We detected a strong PHD3 mRNA expression in tumors of head and neck squamous cell carcinoma (HNSCC. The PHD3 expression associated with expression of hypoxic marker gene. Using siRNA in cell lines derived from HNSCC we show that specific inhibition of PHD3 expression in carcinoma cells caused reduced cell survival in hypoxia. The loss of PHD3, but not that of PHD2, led to marked cell number reduction. Although caspase-3 was activated at early hypoxia no induction of apoptosis was detected. However, hypoxic PHD3 inhibition caused a block in cell cycle progression. Cell population in G1 phase was increased and the population in S phase reduced demonstrating a block in G1 to S transition under PHD3 inhibition. In line with this, the level of hyperphosphorylated retinoblastoma protein Rb was reduced by PHD3 knock-down in hypoxia. PHD3 loss led to increase in cyclin-dependent kinase inhibitor p27 expression but not that of p21 or p16. The data demonstrated that increased PHD3 expression under hypoxia enhances cell cycle progression and survival of carcinoma cells.

  15. On the Discrete-Time GeoX/G/1 Queues under N-Policy with Single and Multiple Vacations

    Directory of Open Access Journals (Sweden)

    Sung J. Kim

    2013-01-01

    Full Text Available We consider the discrete-time GeoX/G/1 queue under N-policy with single and multiple vacations. In this queueing system, the server takes multiple vacations and a single vacation whenever the system becomes empty and begins to serve customers only if the queue length is at least a predetermined threshold value N. Using the well-known property of stochastic decomposition, we derive the stationary queue-length distributions for both vacation models in a simple and unified manner. In addition, we derive their busy as well as idle-period distributions. Some classical vacation models are considered as special cases.

  16. Transient Behaviour of Batch Arrival Queue with N-Policy and Single Vacation (Mx/G/1/N-POLICY)

    Science.gov (United States)

    Solanki, Anjana

    2009-07-01

    In this paper Mx/G/1 queuing system with N-policy and single vacation is considered. As soon as the system becomes empty, the server leaves the system for a vacation of random length V. When he returns from the vacation, if the system size is greater then or equal to predetermined value N (threshold), he begins to serve the customers. If not, the server waits in the system until the system size reaches or exceeds N. Here the time dependent system size distribution is obtained.

  17. Waiting time analysis for MX/G/1 priority queues with/without vacations under random order of service discipline

    Directory of Open Access Journals (Sweden)

    Norikazu Kawasaki

    2000-01-01

    Full Text Available We study MX/G/1 nonpreemptive and preemptive-resume priority queues with/without vacations under random order of service (ROS discipline within each class. By considering the conditional waiting times given the states of the system, which an arbitrary message observes upon arrival, we derive the Laplace-Stieltjes transforms of the waiting time distributions and explicitly obtain the first two moments. The relationship for the second moments under ROS and first-come first-served disciplines extends the one found previously by Takacs and Fuhrmann for non-priority single arrival queues.

  18. Molecular basis for vulnerability to mitochondrial and oxidative stress in a neuroendocrine CRI-G1 cell line.

    Directory of Open Access Journals (Sweden)

    Natasha Chandiramani

    2011-01-01

    Full Text Available Many age-associated disorders (including diabetes, cancer, and neurodegenerative diseases are linked to mitochondrial dysfunction, which leads to impaired cellular bioenergetics and increased oxidative stress. However, it is not known what genetic and molecular pathways underlie differential vulnerability to mitochondrial dysfunction observed among different cell types.Starting with an insulinoma cell line as a model for a neuronal/endocrine cell type, we isolated a novel subclonal line (named CRI-G1-RS that was more susceptible to cell death induced by mitochondrial respiratory chain inhibitors than the parental CRI-G1 line (renamed CRI-G1-RR for clarity. Compared to parental RR cells, RS cells were also more vulnerable to direct oxidative stress, but equally vulnerable to mitochondrial uncoupling and less vulnerable to protein kinase inhibition-induced apoptosis. Thus, differential vulnerability to mitochondrial toxins between these two cell types likely reflects differences in their ability to handle metabolically generated reactive oxygen species rather than differences in ATP production/utilization or in downstream apoptotic machinery. Genome-wide gene expression analysis and follow-up biochemical studies revealed that, in this experimental system, increased vulnerability to mitochondrial and oxidative stress was associated with (1 inhibition of ARE/Nrf2/Keap1 antioxidant pathway; (2 decreased expression of antioxidant and phase I/II conjugation enzymes, most of which are Nrf2 transcriptional targets; (3 increased expression of molecular chaperones, many of which are also considered Nrf2 transcriptional targets; (4 increased expression of β cell-specific genes and transcription factors that specify/maintain β cell fate; and (5 reconstitution of glucose-stimulated insulin secretion.The molecular profile presented here will enable identification of individual genes or gene clusters that shape vulnerability to mitochondrial dysfunction and

  19. On M|G|1 queue with state-dependent heterogeneous batch arrivals, inverse service order and probabilistic priority

    Science.gov (United States)

    Razumchik, Rostislav R.

    2017-07-01

    Consideration is given to M|G|1 queueing system with inverse service order and probabilistic priority. Customers arrive in batches and the arrival rate depends on the total number of customers in the system. The size of the batch and the service times of the customers in the batch are governed by a given joint probability distribution. It is shown that the joint probability distribution of the total number of customers in the system and the remaining service time of the customer in service can be obtained as a solution of the system of integro-differential equations. The solution can be performed in a recursive way.

  20. Approximation of the steady state system state distribution of the M/G/1 retrial queue with impatient customers

    Directory of Open Access Journals (Sweden)

    Stihi Nadjet

    2012-01-01

    Full Text Available For M/G/1 retrial queues with impatient customers, we review the results, concerning the steady state distribution of the system state, presented in the literature. Since the existing formulas are cumbersome (so their utilization in practice becomes delicate or the obtaining of these formulas is impossible, we apply the information theoretic techniques for estimating the above mentioned distribution. More concretely, we use the principle of maximum entropy which provides an adequate methodology for computing a unique estimate for an unknown probability distribution based on information expressed in terms of some given mean value constraints.

  1. Compact fusion reactors

    CERN Multimedia

    CERN. Geneva

    2015-01-01

    Fusion research is currently to a large extent focused on tokamak (ITER) and inertial confinement (NIF) research. In addition to these large international or national efforts there are private companies performing fusion research using much smaller devices than ITER or NIF. The attempt to achieve fusion energy production through relatively small and compact devices compared to tokamaks decreases the costs and building time of the reactors and this has allowed some private companies to enter the field, like EMC2, General Fusion, Helion Energy, Lawrenceville Plasma Physics and Lockheed Martin. Some of these companies are trying to demonstrate net energy production within the next few years. If they are successful their next step is to attempt to commercialize their technology. In this presentation an overview of compact fusion reactor concepts is given.

  2. HOMOGENEOUS NUCLEAR REACTOR

    Science.gov (United States)

    Hammond, R.P.; Busey, H.M.

    1959-02-17

    Nuclear reactors of the homogeneous liquid fuel type are discussed. The reactor is comprised of an elongated closed vessel, vertically oriented, having a critical region at the bottom, a lower chimney structure extending from the critical region vertically upwardly and surrounded by heat exchanger coils, to a baffle region above which is located an upper chimney structure containing a catalyst functioning to recombine radiolyticallydissociated moderator gages. In operation the liquid fuel circulates solely by convection from the critical region upwardly through the lower chimney and then downwardly through the heat exchanger to return to the critical region. The gases formed by radiolytic- dissociation of the moderator are carried upwardly with the circulating liquid fuel and past the baffle into the region of the upper chimney where they are recombined by the catalyst and condensed, thence returning through the heat exchanger to the critical region.

  3. AIR COOLED NEUTRONIC REACTOR

    Science.gov (United States)

    Fermi, E.; Szilard, L.

    1958-05-27

    A nuclear reactor of the air-cooled, graphite moderated type is described. The active core consists of a cubicle mass of graphite, approximately 25 feet in each dimension, having horizontal channels of square cross section extending between two of the opposite faces, a plurality of cylindrical uranium slugs disposed in end to end abutting relationship within said channels providing a space in the channels through which air may be circulated, and a cadmium control rod extending within a channel provided in the moderator. Suitable shielding is provlded around the core, as are also provided a fuel element loading and discharge means, and a means to circulate air through the coolant channels through the fuel charels to cool the reactor.

  4. NEUTRONIC REACTOR CORE INSTRUMENT

    Science.gov (United States)

    Mims, L.S.

    1961-08-22

    A multi-purpose instrument for measuring neutron flux, coolant flow rate, and coolant temperature in a nuclear reactor is described. The device consists essentially of a hollow thimble containing a heat conducting element protruding from the inner wall, the element containing on its innermost end an amount of fissionsble materinl to function as a heat source when subjected to neutron flux irradiation. Thermocouple type temperature sensing means are placed on the heat conducting element adjacent the fissionable material and at a point spaced therefrom, and at a point on the thimble which is in contact with the coolant fluid. The temperature differentials measured between the thermocouples are determinative of the neutron flux, coolant flow, and temperature being measured. The device may be utilized as a probe or may be incorporated in a reactor core. (AE C)

  5. A COOLED NEUTRONIC REACTOR

    Science.gov (United States)

    Wigner, E.P.; Creutz, E.C.

    1960-03-15

    A nuclear reactor comprising a pair of graphite blocks separated by an air gap is described. Each of the blocks contains a plurality of channels extending from the gap through the block with a plurality of fuel elements being located in the channels. Means are provided for introducing air into the gap between the graphite blocks and for exhausting the air from the ends of the channels opposite the gap.

  6. Gaseous fuel reactor research

    Science.gov (United States)

    Thom, K.; Schneider, R. T.

    1977-01-01

    The paper reviews studies dealing with the concept of a gaseous fuel reactor and describes the structure and plans of the current NASA research program of experiments on uranium hexafluoride systems and uranium plasma systems. Results of research into the basic properties of uranium plasmas and fissioning gases are reported. The nuclear pumped laser is described, and the main results of experiments with these devices are summarized.

  7. Mesurer la puberté. La médicalisation de l'adolescence en Suisse, 1950-1970

    OpenAIRE

    Piccand Laura

    2015-01-01

    Entre 1954 et la fin des années 1970 une étude longitudinale sur la croissance et le développement de l’enfant dit normal a été menée à Zurich. Mesuré e s photographié e s radiographié e s environ 300 garçons et filles de la ville de Zurich ont participé alors et durant plus de vingt ans à une des premières enquêtes de ce genre en Europe. Cet article montre comment cette étude est partie prenante de la création de normes genrées contemporaines autour de la puberté. Il évoque tout d’abord le c...

  8. Mesure de la qualité des services d’enseignement et restructuration des secteurs éducatifs

    OpenAIRE

    Vinokur, Annie

    2012-01-01

    L’article de Romuald Normand a décrit la genèse, aux États-Unis, du mouvement de mobilisation des technologies de mesure de la qualité pour rationaliser la pédagogie scolaire sur le modèle industriel. Ce modèle tend maintenant à s’étendre à l’évaluation de la qualité des producteurs de services d’enseignement et à se déployer à l’échelle mondiale dans le but d’accroître l’efficacité des secteurs éducatifs et de réguler leur transnationalisation. On tente ici d’en montrer la fonctionnalité – m...

  9. Intervalles de confiance bilatéraux et unilatéraux d'une proportion de mesures

    OpenAIRE

    Bertrand, Frédéric; Maumy, Myriam

    2007-01-01

    4 pages; International audience; Nous proposons une manière appropriée de construire des intervalles de confiance unilatéraux pour une proportion de mesures et nous améliorons la qualité des intervalles de confiance bilatéraux existants en utilisant à la fois des résultats récents sur les intervalles de confiance du paramètre proportion d'une loi binomiale et les développements d'Edgeworth obtenus précédemment par les auteurs. Ces résultats sont motivés par leurs applications dans les laborat...

  10. Apport des mesures de champs pour la modélisation statistique de l'écaillage d'alumine

    OpenAIRE

    Maurel, Vincent; Harvey, Mark; Rémy, Luc

    2009-01-01

    http://hdl.handle.net/2042/37148; International audience; L'écaillage de l'alumine, formée à haute température, accélère les cinétiques d'oxydation et de diffusion pour les revêtements aluminoformeurs utilisés en aéronautique. La corrélation entre mesure de champs de déformation et de champ d'endommagement par écaillage a permis de modéliser ce phénomène d'écaillage à différentes échelles. Une approche statistique permet en outre d'estimer l'effet de la déformation de croissance induite par l...

  11. BOILER-SUPERHEATED REACTOR

    Science.gov (United States)

    Heckman, T.P.

    1961-05-01

    A nuclear power reactor of the type in which a liquid moderator-coolant is transformed by nuclear heating into a vapor that may be used to drive a turbo- generator is described. The core of this reactor comprises a plurality of freely suspended tubular fuel elements, called fuel element trains, within which nonboiling pressurized liquid moderator-coolant is preheated and sprayed through orifices in the walls of the trains against the outer walls thereof to be converted into vapor. Passage of the vapor ovcr other unwetted portions of the outside of the fuel elements causes the steam to be superheated. The moderatorcoolant within the fuel elements remains in the liqUid state, and that between the fuel elements remains substantiaily in the vapor state. A unique liquid neutron-absorber control system is used. Advantages expected from the reactor design include reduced fuel element failure, increased stability of operation, direct response to power demand, and circulation of a minimum amount of liquid moderatorcoolant. (A.G.W.)

  12. NUCLEAR REACTOR CORE DESIGN

    Science.gov (United States)

    Mahlmeister, J.E.; Peck, W.S.; Haberer, W.V.; Williams, A.C.

    1960-03-22

    An improved core design for a sodium-cooled, graphitemoderated nuclear reactor is described. The improved reactor core comprises a number of blocks of moderator material, each block being in the shape of a regular prism. A number of channels, extending the length of each block, are disposed around the periphery. When several blocks are placed in contact to form the reactor core, the channels in adjacent blocks correspond with each other to form closed conduits extending the length of the core. Fuel element clusters are disposed in these closed conduits, and liquid coolant is forced through the annulus between the fuel cluster and the inner surface of the conduit. In a preferred embodiment of the invention, the moderator blocks are in the form of hexagonal prisms with longitudinal channels cut into the corners of the hexagon. The main advantage of an "edge-loaded" moderator block is that fewer thermal neutrons are absorbed by the moderator cladding, as compared with a conventional centrally loaded moderator block.

  13. Nuclear reactor sealing system

    Science.gov (United States)

    McEdwards, James A.

    1983-01-01

    A liquid metal-cooled nuclear reactor sealing system. The nuclear reactor includes a vessel sealed at its upper end by a closure head. The closure head comprises at least two components, one of which is rotatable; and the two components define an annulus therebetween. The sealing system includes at least a first and second inflatable seal disposed in series in an upper portion of the annulus. The system further includes a dip seal extending into a body of insulation located adjacent a bottom portion of the closure head. The dip seal comprises a trough formed by a lower portion of one of the components, and a seal blade pendently supported from the other component and extending downwardly into the trough. A body of liquid metal is contained in the trough which submerges a portion of the seal blade. The seal blade is provided with at least one aperture located above the body of liquid metal for providing fluid communication between the annulus intermediate the dip seal and the inflatable seals, and a body of cover gas located inside the vessel. There also is provided means for introducing a purge gas into the annulus intermediate the inflatable seals and the seal blade. The purge gas is introduced in an amount sufficient to substantially reduce diffusion of radioactive cover gas or sodium vapor up to the inflatable seals. The purge gas mixes with the cover gas in the reactor vessel where it can be withdrawn from the vessel for treatment and recycle to the vessel.

  14. Nuclear research reactors in Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Cota, Anna Paula Leite; Mesquita, Amir Zacarias, E-mail: aplc@cdtn.b, E-mail: amir@cdtn.b [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2011-07-01

    The rising concerns about global warming and energy security have spurred a revival of interest in nuclear energy, giving birth to a 'nuclear power renaissance' in several countries in the world. Particularly in Brazil, in the recent years, the nuclear power renaissance can be seen in the actions that comprise its nuclear program, summarily the increase of the investments in nuclear research institutes and the government target to design and build the Brazilian Multipurpose research Reactor (BMR). In the last 50 years, Brazilian research reactors have been used for training, for producing radioisotopes to meet demands in industry and nuclear medicine, for miscellaneous irradiation services and for academic research. Moreover, the research reactors are used as laboratories to develop technologies in power reactors, which are evaluated today at around 450 worldwide. In this application, those reactors become more viable in relation to power reactors by the lowest cost, by the operation at low temperatures and, furthermore, by lower demand for nuclear fuel. In Brazil, four research reactors were installed: the IEA-R1 and the MB-01 reactors, both at the Instituto de Pesquisas Energeticas Nucleares (IPEN, Sao Paulo); the Argonauta, at the Instituto de Engenharia Nuclear (IEN, Rio de Janeiro) and the IPR-R1 TRIGA reactor, at the Centro de Desenvolvimento da Tecnologia Nuclear (CDTN, Belo Horizonte). The present paper intends to enumerate the characteristics of these reactors, their utilization and current academic research. Therefore, through this paper, we intend to collaborate on the BMR project. (author)

  15. Comparative Diagnosis of Serum IgG1 and Coproantigen ELISA for Fasciolosis Detection of Goats in Mexico

    Science.gov (United States)

    Molina-Mendoza, Pedro; Hernández-Guzmán, Karina; Olivares-Pérez, Jaime; Sarracent-Pérez, Jorge; Zumaquero-Ríos, José

    2016-01-01

    The objective of present study was to determine the prevalence of natural caprine fasciolosis in the Mixteca region of Mexico using coproantigen and serum IgG1 ELISA tests for comparative purposes. A total of 1070 serum and faecal samples were analyzed for IgG1 antibodies and coproantigens, using ELISA with E/S products as antigen and a monoclonal antibody-based sandwich ELISA. Prevalence of 73.46% was found using the serological ELISA and a percentage of 77.20 was found for coproantigen ELISA. The diagnostic sensitivity and specificity for serum ELISA were 86.7% and 96.4%, and for the coproantigen ELISA they were 93.1% and 97.8%, respectively. The seropositive samples were further categorized as low, medium, or high positivity. Results show a great proportion of low and medium positive goats when the serum ELISA test was used. Correlation coefficients between coproantigens and seropositivity were statistically significant (P < 0.01) for low seropositivity (r = 0.93) and medium seropositivity (r = 0.84). The accuracy of faecal antigen ELISA was higher compared to indirect ELISA serological test. Two ELISAs were shown to be useful for demonstrating the current status of F. hepatica infection in the endemic areas and can be employed in studies on epidemiology as well as anthelmintics treatment for preventing economic loss and the risk of transmission to humans. PMID:27563665

  16. DNA damage during the G0/G1 phase triggers RNA-templated, Cockayne syndrome B-dependent homologous recombination.

    Science.gov (United States)

    Wei, Leizhen; Nakajima, Satoshi; Böhm, Stefanie; Bernstein, Kara A; Shen, Zhiyuan; Tsang, Michael; Levine, Arthur S; Lan, Li

    2015-07-07

    Damage repair mechanisms at transcriptionally active sites during the G0/G1 phase are largely unknown. To elucidate these mechanisms, we introduced genome site-specific oxidative DNA damage and determined the role of transcription in repair factor assembly. We find that KU and NBS1 are recruited to damage sites independent of transcription. However, assembly of RPA1, RAD51C, RAD51, and RAD52 at such sites is strictly governed by active transcription and requires both wild-type Cockayne syndrome protein B (CSB) function and the presence of RNA in the G0/G1 phase. We show that the ATPase activity of CSB is indispensable for loading and binding of the recombination factors. CSB counters radiation-induced DNA damage in both cells and zebrafish models. Taken together, our results have uncovered a novel, RNA-based recombination mechanism by which CSB protects genome stability from strand breaks at transcriptionally active sites and may provide insight into the clinical manifestations of Cockayne syndrome.

  17. Mitotic catastrophe occurs in the absence of apoptosis in p53-null cells with a defective G1 checkpoint.

    Directory of Open Access Journals (Sweden)

    Michalis Fragkos

    Full Text Available Cell death occurring during mitosis, or mitotic catastrophe, often takes place in conjunction with apoptosis, but the conditions in which mitotic catastrophe may exhibit features of programmed cell death are still unclear. In the work presented here, we studied mitotic cell death by making use of a UV-inactivated parvovirus (adeno-associated virus; AAV that has been shown to induce a DNA damage response and subsequent death of p53-defective cells in mitosis, without affecting the integrity of the host genome. Osteosarcoma cells (U2OSp53DD that are deficient in p53 and lack the G1 cell cycle checkpoint respond to AAV infection through a transient G2 arrest. We found that the infected U2OSp53DD cells died through mitotic catastrophe with no signs of chromosome condensation or DNA fragmentation. Moreover, cell death was independent of caspases, apoptosis-inducing factor (AIF, autophagy and necroptosis. These findings were confirmed by time-lapse microscopy of cellular morphology following AAV infection. The assays used readily revealed apoptosis in other cell types when it was indeed occurring. Taken together the results indicate that in the absence of the G1 checkpoint, mitotic catastrophe occurs in these p53-null cells predominantly as a result of mechanical disruption induced by centrosome overduplication, and not as a consequence of a suicide signal.

  18. Comparative Diagnosis of Serum IgG1 and Coproantigen ELISA for Fasciolosis Detection of Goats in Mexico.

    Science.gov (United States)

    Villa-Mancera, Abel; Molina-Mendoza, Pedro; Hernández-Guzmán, Karina; Olivares-Pérez, Jaime; Sarracent-Pérez, Jorge; Zumaquero-Ríos, José

    2016-01-01

    The objective of present study was to determine the prevalence of natural caprine fasciolosis in the Mixteca region of Mexico using coproantigen and serum IgG1 ELISA tests for comparative purposes. A total of 1070 serum and faecal samples were analyzed for IgG1 antibodies and coproantigens, using ELISA with E/S products as antigen and a monoclonal antibody-based sandwich ELISA. Prevalence of 73.46% was found using the serological ELISA and a percentage of 77.20 was found for coproantigen ELISA. The diagnostic sensitivity and specificity for serum ELISA were 86.7% and 96.4%, and for the coproantigen ELISA they were 93.1% and 97.8%, respectively. The seropositive samples were further categorized as low, medium, or high positivity. Results show a great proportion of low and medium positive goats when the serum ELISA test was used. Correlation coefficients between coproantigens and seropositivity were statistically significant (P < 0.01) for low seropositivity (r = 0.93) and medium seropositivity (r = 0.84). The accuracy of faecal antigen ELISA was higher compared to indirect ELISA serological test. Two ELISAs were shown to be useful for demonstrating the current status of F. hepatica infection in the endemic areas and can be employed in studies on epidemiology as well as anthelmintics treatment for preventing economic loss and the risk of transmission to humans.

  19. TopBP1 is required at mitosis to reduce transmission of DNA damage to G1 daughter cells

    Science.gov (United States)

    Pedersen, Rune Troelsgaard; Kruse, Thomas; Nilsson, Jakob

    2015-01-01

    Genome integrity is critically dependent on timely DNA replication and accurate chromosome segregation. Replication stress delays replication into G2/M, which in turn impairs proper chromosome segregation and inflicts DNA damage on the daughter cells. Here we show that TopBP1 forms foci upon mitotic entry. In early mitosis, TopBP1 marks sites of and promotes unscheduled DNA synthesis. Moreover, TopBP1 is required for focus formation of the structure-selective nuclease and scaffold protein SLX4 in mitosis. Persistent TopBP1 foci transition into 53BP1 nuclear bodies (NBs) in G1 and precise temporal depletion of TopBP1 just before mitotic entry induced formation of 53BP1 NBs in the next cell cycle, showing that TopBP1 acts to reduce transmission of DNA damage to G1 daughter cells. Based on these results, we propose that TopBP1 maintains genome integrity in mitosis by controlling chromatin recruitment of SLX4 and by facilitating unscheduled DNA synthesis. PMID:26283799

  20. Betulinic Acid Inhibits Growth of Cultured Vascular Smooth Muscle Cells In Vitro by Inducing G1 Arrest and Apoptosis

    Directory of Open Access Journals (Sweden)

    Raja Kumar Vadivelu

    2012-01-01

    Full Text Available Betulinic acid is a widely available plant-derived triterpene which is reported to possess selective cytotoxic activity against cancer cells of neuroectodermal origin and leukemia. However, the potential of betulinic acid as an antiproliferative and cytotoxic agent on vascular smooth muscle (VSMC is still unclear. This study was carried out to demonstrate the antiproliferative and cytotoxic effect of betulinic acid on VSMCs using 3-[4,5-dimethylthizol-2-yl]-2,5-diphenyltetrazolium bromide (MTT assay, flow cytometry cell cycle assay, BrdU proliferation assay, acridine orange/propidium iodide staining, and comet assay. Result from MTT and BrdU assays indicated that betulinic acid was able to inhibit the growth and proliferation of VSMCs in a dose-dependent manner with IC50 of 3.8 μg/mL significantly (P<0.05. Nevertheless, betulinic acid exhibited G1 cell cycle arrest in flow cytometry cell cycle profiling and low level of DNA damage against VSMC in acridine orange/propidium iodide and comet assay after 24 h of treatment. In conclusion, betulinic acid induced G1 cell cycle arrest and dose-dependent DNA damage on VSMC.

  1. Comparative Diagnosis of Serum IgG1 and Coproantigen ELISA for Fasciolosis Detection of Goats in Mexico

    Directory of Open Access Journals (Sweden)

    Abel Villa-Mancera

    2016-01-01

    Full Text Available The objective of present study was to determine the prevalence of natural caprine fasciolosis in the Mixteca region of Mexico using coproantigen and serum IgG1 ELISA tests for comparative purposes. A total of 1070 serum and faecal samples were analyzed for IgG1 antibodies and coproantigens, using ELISA with E/S products as antigen and a monoclonal antibody-based sandwich ELISA. Prevalence of 73.46% was found using the serological ELISA and a percentage of 77.20 was found for coproantigen ELISA. The diagnostic sensitivity and specificity for serum ELISA were 86.7% and 96.4%, and for the coproantigen ELISA they were 93.1% and 97.8%, respectively. The seropositive samples were further categorized as low, medium, or high positivity. Results show a great proportion of low and medium positive goats when the serum ELISA test was used. Correlation coefficients between coproantigens and seropositivity were statistically significant (P<0.01 for low seropositivity (r=0.93 and medium seropositivity (r=0.84. The accuracy of faecal antigen ELISA was higher compared to indirect ELISA serological test. Two ELISAs were shown to be useful for demonstrating the current status of F. hepatica infection in the endemic areas and can be employed in studies on epidemiology as well as anthelmintics treatment for preventing economic loss and the risk of transmission to humans.

  2. p27Kip1 Is Required to Mediate a G1 Cell Cycle Arrest Downstream of ATM following Genotoxic Stress.

    Directory of Open Access Journals (Sweden)

    Erica K Cassimere

    Full Text Available The DNA damage response (DDR is a coordinated signaling network that ensures the maintenance of genome stability under DNA damaging stress. In response to DNA lesions, activation of the DDR leads to the establishment of cell cycle checkpoints that delay cell-cycle progression and allow repair of the defects. The tumor suppressor p27Kip1 is a cyclin-CDK inhibitor that plays an important role in regulating quiescence in a variety of tissues. Several studies have suggested that p27Kip1 also plays a role in the maintenance of genomic integrity. Here we demonstrate that p27Kip1 is essential for the establishment of a G1 checkpoint arrest after DNA damage. We also uncovered that ATM phosphorylates p27Kip1 on a previously uncharacterized residue (Ser-140, which leads to its stabilization after induction of DNA double-strand breaks. Inhibition of this stabilization by replacing endogenous p27Kip1 with a Ser-140 phospho-mutant (S140A significantly sensitized cells to IR treatments. Our findings reveal a novel role for p27Kip1 in the DNA damage response pathway and suggest that part of its tumor suppressing functions relies in its ability to mediate a G1 arrest after the induction of DNA double strand breaks.

  3. Transfection of wild-type CFTR into cystic fibrosis lymphocytes restores chloride conductance at G1 of the cell cycle.

    Science.gov (United States)

    Krauss, R D; Bubien, J K; Drumm, M L; Zheng, T; Peiper, S C; Collins, F S; Kirk, K L; Frizzell, R A; Rado, T A

    1992-01-01

    We complemented the Cl- conductance defect in cystic fibrosis lymphocytes by transfection with wild-type cDNA for the cystic fibrosis transmembrane conductance regulator (CFTR). Stable transfectants were selected and subjected to molecular and functional analyses. We detected expression of endogenous CFTR mRNA in several CF and non-CF lymphoid cell lines by PCR. Expression from cDNA in the transfectants was demonstrated by amplifying vector-specific sequences. Both fluorescence and patch-clamp assays showed that transfectants expressing wild-type CFTR acquired properties previously associated with Cl- conductance (GCl) regulation in non-CF lymphocytes: (i) GCl was elevated in the G1 phase of the cell cycle, (ii) cells fixed at G1 increase GCl in response to increased cellular cAMP or Ca2+, (iii) agonist-induced increases in GCl were lost as the cells progressed to the S phase of the cell cycle. The cell cycle and agonist dependent regulation of GCl was not observed in CF lymphocytes transfected with CFTR cDNA containing stop codons in all reading frames at exon 6. Our findings indicate that lymphocytes express functional CFTR since wild-type CFTR corrects the defects in Cl- conductance regulation found in CF lymphocytes. Evaluation of the mechanism of this novel, CFTR-mediated regulation of GCl during cell cycling should provide further insights into the function of CFTR. Images PMID:1372253

  4. YOUNG REMNANTS OF TYPE Ia SUPERNOVAE AND THEIR PROGENITORS: A STUDY OF SNR G1.9+0.3

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborti, Sayan; Childs, Francesca; Soderberg, Alicia, E-mail: schakraborti@post.harvard.edu [Institute for Theory and Computation, Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

    2016-03-01

    SNe Ia, with their remarkably homogeneous light curves and spectra, have been used as standardizable candles to measure the accelerating expansion of the universe. Yet, their progenitors remain elusive. Common explanations invoke a degenerate star (white dwarf) that explodes upon almost reaching the Chandrasekhar limit, by either steadily accreting mass from a companion star or violently merging with another degenerate star. We show that circumstellar interaction in young Galactic supernova remnants can be used to distinguish between these single and double degenerate (DD) progenitor scenarios. Here we propose a new diagnostic, the surface brightness index, which can be computed from theory and compared with Chandra and Very Large Array (VLA) observations. We use this method to demonstrate that a DD progenitor can explain the decades-long flux rise and size increase of the youngest known galactic supernova remnant (SNR), G1.9+0.3. We disfavor a single degenerate scenario for SNR G1.9+0.3. We attribute the observed properties to the interaction between a steep ejecta profile and a constant density environment. We suggest using the upgraded VLA, ASKAP, and MeerKAT to detect circumstellar interaction in the remnants of historical SNe Ia in the Local Group of galaxies. This may settle the long-standing debate over their progenitors.

  5. Human IgG1 Responses to Surface Localised Schistosoma mansoni Ly6 Family Members Drop following Praziquantel Treatment.

    Directory of Open Access Journals (Sweden)

    Iain W Chalmers

    Full Text Available The heptalaminate-covered, syncytial tegument is an important anatomical adaptation that enables schistosome parasites to maintain long-term, intravascular residence in definitive hosts. Investigation of the proteins present in this surface layer and the immune responses elicited by them during infection is crucial to our understanding of host/parasite interactions. Recent studies have revealed a number of novel tegumental surface proteins including three (SmCD59a, SmCD59b and Sm29 containing uPAR/Ly6 domains (renamed SmLy6A SmLy6B and SmLy6D in this study. While vaccination with SmLy6A (SmCD59a and SmLy6D (Sm29 induces protective immunity in experimental models, human immunoglobulin responses to representative SmLy6 family members have yet to be thoroughly explored.Using a PSI-BLAST-based search, we present a comprehensive reanalysis of the Schistosoma mansoni Ly6 family (SmLy6A-K. Our examination extends the number of members to eleven (including three novel proteins and provides strong evidence that the previously identified vaccine candidate Sm29 (renamed SmLy6D is a unique double uPAR/Ly6 domain-containing representative. Presence of canonical cysteine residues, signal peptides and GPI-anchor sites strongly suggest that all SmLy6 proteins are cell surface-bound. To provide evidence that SmLy6 members are immunogenic in human populations, we report IgG1 (as well as IgG4 and IgE responses against two surface-bound representatives (SmLy6A and SmLy6B within a cohort of S. mansoni-infected Ugandan males before and after praziquantel treatment. While pre-treatment IgG1 prevalence for SmLy6A and SmLy6B differs amongst the studied population (7.4% and 25.3% of the cohort, respectively, these values are both higher than IgG1 prevalence (2.7% for a sub-surface tegumental antigen, SmTAL1. Further, post-treatment IgG1 levels against surface-associated SmLy6A and SmLy6B significantly drop (p = 0.020 and p < 0.001, respectively when compared to rising IgG

  6. Mesure Objective De L'attenuation et De L'effet D'occlusion Des Protecteurs Auditifs a Partir Des Potentiels Evoques Stationnaires et Multiples =

    Science.gov (United States)

    Valentin, Olivier

    Selon l'Organisation mondiale de la sante, le nombre de travailleurs exposes quotidiennement a des niveaux de bruit prejudiciables a leur audition est passe de 120 millions en 1995 a 250 millions en 2004. Meme si la reduction du bruit a la source devrait etre toujours privilegiee, la solution largement utilisee pour lutter contre le bruit au travail reste la protection auditive individuelle. Malheureusement, le port des protecteurs auditifs n'est pas toujours respecte par les travailleurs car il est difficile de fournir un protecteur auditif dont le niveau d'attenuation effective est approprie a l'environnement de travail d'un individu. D'autre part, l'occlusion du canal auditif induit une modification de la perception de la parole, ce qui cree un inconfort incitant les travailleurs a retirer leurs protecteurs. Ces deux problemes existent parce que les methodes actuelles de mesure de l'effet d'occlusion et de l'attenuation sont limitees. Les mesures objectives basees sur des mesures microphoniques intra-auriculaires ne tiennent pas compte de la transmission directe du son a la cochlee par conduction osseuse. Les mesures subjectives au seuil de l'audition sont biaisees a cause de l'effet de masquage aux basses frequences induit par le bruit physiologique. L'objectif principal de ce travail de these de doctorat est d'ameliorer la mesure de l'attenuation et de l'effet d'occlusion des protecteurs auditifs intra-auriculaires. L'approche generale consiste a : (i) verifier s'il est possible de mesurer l'attenuation des protecteurs auditifs grâce au recueil des potentiels evoques stationnaires et multiples (PEASM) avec et sans protecteur auditif (protocole 1), (ii) adapter cette methodologie pour mesurer l'effet d'occlusion induit par le port de protecteur auditifs intra-auriculaires (protocole 2), et (iii) valider chaque protocole par l'intermediaire de mesures realisees sur sujets humains. Les resultats du protocole 1 demontrent que les PEASM peuvent etre utilises pour

  7. Serum immunoglobulin G4 and immunoglobulin G1 for distinguishing immunoglobulin G4-associated cholangitis from primary sclerosing cholangitis.

    Science.gov (United States)

    Boonstra, Kirsten; Culver, Emma L; de Buy Wenniger, Lucas Maillette; van Heerde, Marianne J; van Erpecum, Karel J; Poen, Alexander C; van Nieuwkerk, Karin M J; Spanier, B W Marcel; Witteman, Ben J M; Tuynman, Hans A R E; van Geloven, Nan; van Buuren, Henk; Chapman, Roger W; Barnes, Eleanor; Beuers, Ulrich; Ponsioen, Cyriel Y

    2014-05-01

    The recent addition of immunoglobulin (Ig)G4-associated cholangitis (IAC), also called IgG4-related sclerosing cholangitis (IRSC), to the spectrum of chronic cholangiopathies has created the clinical need for reliable methods to discriminate between IAC and the more common cholestatic entities, primary (PSC) and secondary sclerosing cholangitis. The current American Association for the Study of Liver Diseases practice guidelines for PSC advise on the measurement of specific Ig (sIg)G4 in PSC patients, but interpretation of elevated sIgG4 levels remains unclear. We aimed to provide an algorithm to distinguish IAC from PSC using sIgG analyses. We measured total IgG and IgG subclasses in serum samples of IAC (n = 73) and PSC (n = 310) patients, as well as in serum samples of disease controls (primary biliary cirrhosis; n = 22). sIgG4 levels were elevated above the upper limit of normal (ULN = >1.4 g/L) in 45 PSC patients (15%; 95% confidence interval [CI]: 11-19). The highest specificity and positive predictive value (PPV; 100%) for IAC were reached when applying the 4 × ULN (sIgG4 > 5.6 g/L) cutoff with a sensitivity of 42% (95% CI: 31-55). However, in patients with a sIgG4 between 1 × and 2 × ULN (n = 38/45), the PPV of sIgG4 for IAC was only 28%. In this subgroup, the sIgG4/sIgG1 ratio cutoff of 0.24 yielded a sensitivity of 80% (95% CI: 51-95), a specificity of 74% (95% CI: 57-86), a PPV of 55% (95% CI: 33-75), and a negative predictive value of 90% (95% CI: 73-97). Elevated sIgG4 (>1.4 g/L) occurred in 15% of patients with PSC. In patients with a sIgG4 >1.4 and <2.8 g/L, incorporating the IgG4/IgG1 ratio with a cutoff at 0.24 in the diagnostic algorithm significantly improved PPV and specificity. We propose a new diagnostic algorithm based on IgG4/IgG1 ratio that may be used in clinical practice to distinguish PSC from IAC. © 2014 by the American Association for the Study of Liver Diseases.

  8. G0/G1 arrest and S phase inhibition of human cancer cell lines by inositol hexaphosphate (IP6).

    Science.gov (United States)

    El-Sherbiny, Y M; Cox, M C; Ismail, Z A; Shamsuddin, A M; Vucenik, I

    2001-01-01

    Inositol hexaphosphate (InsP6 or IP6) has shown a striking anti-cancer activity in both in vivo and in vitro models. In an attempt to elucidate the mechanism(s) underlying the anti-neoplastic potential of IP6, we investigated its effect on cell cycle progression of MCF-7 estrogen receptor (ER)-positive and MDA-MB 231 ER-negative human breast cancer cell lines and HT-29 human colon cancer cells. The anti-proliferative effect of IP6 was evaluated using dual-parameter flow cytometric measurements of DNA content, versus the incorporation of 5-bromo-2-deoxyuridine (BrdU) to determine cells actively synthesizing DNA. Combined analysis of the expression of cell cycle-related proteins, proliferation marker Ki-67 and proliferating cell nuclear antigen (PCNA) versus DNA content were used to determine the amount of proliferating cells in each phase, engaged in cell cycle transit. After 3 days of treatment with 5 mM IP6, S-phase, as estimated by BrdU uptake, was significantly decreased in all three cell lines (p = 0.002). MCF-7 and HT-29 cells accumulated in the G0/G1 range of DNA contents (p = 0.002 and p = 0.001, respectively). MDA MB-231 cells transiently accumulated in G0/G1 only after 2 days (p = 0.01). There was a significant decrease in the percentage of Ki-67 expression in IP6-treated cells, from 82.8+/-3.0% to 66.8+/-4.2% in MCF-7 (p = 0.007), from 93.4+/-4.6% to 71.7+/-3.3% in MDA-MB 231 (p = 0.004), and from 95.2+/-1.2% to 73.5+/-2.5% in HT-29 cells (p = 0.002) respectively. PCNA expression levels were also significantly decreased by IP6 in all three cell lines (MCF-7 p = 0.0007; MDA-MB 231 p = 0.0006; HT-29 p = 0.0001). These results show that IP6 controls the progression of cells through the cycle by decreasing S- phase and arresting cells in the G0/G1-phase of the cell cycle. A significant decrease in the expression of proliferation markers indicated that IP6 disengaged cells from actively cycling. Further investigations of cell cycle regulators may lead us to a

  9. Spiral-shaped disinfection reactors

    KAUST Repository

    Ghaffour, Noreddine

    2015-08-20

    This disclosure includes disinfection reactors and processes for the disinfection of water. Some disinfection reactors include a body that defines an inlet, an outlet, and a spiral flow path between the inlet and the outlet, in which the body is configured to receive water and a disinfectant at the inlet such that the water is exposed to the disinfectant as the water flows through the spiral flow path. Also disclosed are processes for disinfecting water in such disinfection reactors.

  10. Acceptability of reactors in space

    Energy Technology Data Exchange (ETDEWEB)

    Buden, D.

    1981-04-01

    Reactors are the key to our future expansion into space. However, there has been some confusion in the public as to whether they are a safe and acceptable technology for use in space. The answer to these questions is explored. The US position is that when reactors are the preferred technical choice, that they can be used safely. In fact, it dies not appear that reactors add measurably to the risk associated with the Space Transportation System.

  11. Neutrino Oscillation Studies with Reactors

    CERN Document Server

    Vogel, Petr; Zhang, Chao

    2015-01-01

    Nuclear reactors are one of the most intense, pure, controllable, cost-effective, and well-understood sources of neutrinos. Reactors have played a major role in the study of neutrino oscillations, a phenomenon that indicates that neutrinos have mass and that neutrino flavors are quantum mechanical mixtures. Over the past several decades reactors were used in the discovery of neutrinos, were crucial in solving the solar neutrino puzzle, and allowed the determination of the smallest mixing angle $\\theta_{13}$. In the near future, reactors will help to determine the neutrino mass hierarchy and to solve the puzzling issue of sterile neutrinos.

  12. On the virtual waiting time for an M/G/1 retrial queue with two types of calls

    Directory of Open Access Journals (Sweden)

    Bong Dae Choi

    1993-01-01

    Full Text Available We consider an M/G/1 retrial queueing system with two types of calls which models a telephone switching system. In the case that arriving calls are blocked due to the channel being busy, the outgoing calls are queued in priority group whereas the incoming calls enter the retrial group in order to try service again after a random amount of time. In this paper we find the Laplace-Stieltjes transform of the distribution of the virtual waiting time for an incoming call. When the arrival rate of outgoing calls is zero, it is shown that our result is consistent with the known result for a retrial queueing system with one type of call.

  13. Some applications of the (G'/G, 1/G)-expansion method to find new exact solutions of NLEEs

    Science.gov (United States)

    Mamun Miah, M.; Shahadat Ali, H. M.; Ali Akbar, M.; Majid Wazwaz, Abdul

    2017-06-01

    The double (G'/G, 1/G)-expansion method is an influential, effective and well-suited method to examine closed form traveling wave solutions to nonlinear evolution equations (NLEEs). In this article, we extract abundant wave solutions to the (2+1)-dimensional typical breaking soliton equation and the (1+1)-dimensional classical Boussinesq equation through this method. The wave solutions are presented in terms of hyperbolic function, trigonometric function and rational function. By means of the wave transformation, the NLEEs are reduced to nonlinear ordinary differential equation (ODE) and then the nonlinear ODE is utilized to examine the necessary NLEE. The method can be considered as the generalization of the (G'/G-expansion method established by Wang et al. and it is shown that the suggested method is a powerful mathematical tool for investigating nonlinear evolution equations.

  14. On the Two-Moment Approximation of the Discrete-Time GI/G/1 Queue with a Single Vacation

    Directory of Open Access Journals (Sweden)

    Doo Ho Lee

    2016-01-01

    Full Text Available We consider a discrete-time GI/G/1 queue in which the server takes exactly one vacation each time the system becomes empty. The interarrival times of arriving customers, the service times, and the vacation times are all generic discrete random variables. Under our study, we derive an exact transform-free expression for the stationary system size distribution through the modified supplementary variable technique. Utilizing obtained results, we introduce a simple two-moment approximation for the system size distribution. From this, approximations for the mean system size along with the system size distribution could be obtained. Finally, some numerical examples are given to validate the proposed approximation method.

  15. Optimal management for infinite capacity N-policy M/G/1 queue with a removable service station

    Science.gov (United States)

    Chang, Y. C.; Pearn, W. L.

    2011-07-01

    In this article, we consider an infinite capacity N-policy M/G/1 queueing system with a single removable server. Poisson arrivals and general distribution service times are assumed. The server is controllable that may be turned on at arrival epochs or off at service completion epochs. We apply a differential technique to study system sensitivity, which examines the effect of different system input parameters on the system. A cost model for infinite capacity queueing system under steady-state condition is developed, to determine the optimal management policy at minimum cost. Analytical results for sensitivity analysis are derived. We also provide extensive numerical computations to illustrate the analytical sensitivity properties obtained. Finally, an application example is presented to demonstrate how the model could be used in real applications to obtain the optimal management policy.

  16. A midiatização do ativismo nas coberturas do G1 e do Mídia Ninja

    Directory of Open Access Journals (Sweden)

    Maria Clara Aquino Bittencourt

    2014-04-01

    Full Text Available Este trabalho compara as coberturas realizadas pelo coletivo midiático Mídia Ninja e pelo site de notícias G1 sobre a desocupação de imóveis na Favela do Metrô, no Rio de Janeiro. A partir do entendimento de que ocorre um processo de midiatização do ativismo na atuação do Mídia Ninja, discute-se a relação entre essa atuação e o modelo comunicacional que fundamenta as práticas da mídia de massa, diante das oportunidades de mídia adotadas pelo coletivo.

  17. Phylogenetic relationships among Brazilian howler monkeys, genus Alouatta (Platyrrhini, Atelidae, based on g1-globin pseudogene sequences

    Directory of Open Access Journals (Sweden)

    Carla Maria Meireles

    1999-09-01

    Full Text Available The genus Alouatta (howler monkeys is the most widely distributed of New World primates, and has been arranged in three species groups: the Central American Alouatta palliata group and the South American Alouatta seniculus and Alouatta caraya groups. While the latter is monotypic, the A. seniculus group encompasses at least three species (A. seniculus, A. belzebul and A. fusca. In the present study, approximately 600 base pairs of the g1-globin pseudogene were sequenced in the four Brazilian species (A. seniculus, A. belzebul, A. fusca and A. caraya. Maximum parsimony and maximum likelihood methods yielded phylogenetic trees with the same arrangement: {A. caraya [A. seniculus (A. fusca, A. belzebul]}. The most parsimonious tree had bootstrap values greater than 82% for all groupings, and strength of grouping values of at least 2, supporting the sister clade of A. fusca and A. belzebul. The study also confirmed the presence of a 150-base pair Alu insertion element and a 1.8-kb deletion in the g1-globin pseudogene in A. fusca, features found previously in the remaining three species. The cladistic classification based on molecular data agrees with those of morphological studies, with the monospecific A. caraya group being clearly differentiated from the A. seniculus group.Os guaribas, do gênero Alouatta, que são os primatas do Novo Mundo com maior distribuição geográfica, têm sido colocados em três grupos de espécies: o grupo Alouatta palliata da América central, e os grupos sulamericanos Alouatta seniculus e Alouatta caraya. Este último é monotípico, mas o grupo A. seniculus inclui pelo menos três espécies (A. seniculus, A. belzebul e A. fusca. Neste estudo, foram seqüenciados aproximadamente 600 pares de base do pseudogene globina g1 nas quatro espécies brasileiras (A. seniculus, A. belzebul, A. fusca e A. caraya. Os métodos de máxima parcimônia e máxima verossimilhança produziram árvores filogenéticas com o mesmo arranjo

  18. A short G1 phase imposes constitutive replication stress and fork remodelling in mouse embryonic stem cells

    DEFF Research Database (Denmark)

    Ahuja, Akshay K.; Jodkowska, Karolina; Teloni, Federico

    2016-01-01

    phosphorylation is dependent on Ataxia telangiectasia and Rad3 related (ATR) and is associated with chromatin loading of the ssDNA-binding proteins RPA and RAD51. Single-molecule analysis of replication intermediates reveals massive ssDNA gap accumulation, reduced fork speed and frequent fork reversal. All...... these marks of replication stress do not impair the mitotic process and are rapidly lost at differentiation onset. Delaying the G1/S transition in ESCs allows formation of 53BP1 nuclear bodies and suppresses ssDNA accumulation, fork slowing and reversal in the following S-phase. Genetic inactivation of fork...... slowing and reversal leads to chromosomal breakage in unperturbed ESCs. We propose that rapid cell cycle progression makes ESCs dependent on effective replication-coupled mechanisms to protect genome integrity....

  19. Analysis of an M|G|1|R queue with batch arrivals and two hysteretic overload control policies

    Directory of Open Access Journals (Sweden)

    Gaidamaka Yuliya

    2014-09-01

    Full Text Available Hysteretic control of arrivals is one of the most easy-to-implement and effective solutions of overload problems occurring in SIP-servers. A mathematical model of an SIP server based on the queueing system M[X]|G|1(L,H|(H,R with batch arrivals and two hysteretic loops is being analyzed. This paper proposes two analytical methods for studying performance characteristics related to the number of customers in the system. Two control policies defined by instants when it is decided to change the system’s mode are considered. The expression for an important performance characteristic of each policy (the mean time between changes in the system mode is presented. Numerical examples that allow comparison of the efficiency of both policies are given

  20. Upregulation of P53 promoted G1 arrest and apoptosis in human umbilical cord vein endothelial cells from preeclampsia.

    Science.gov (United States)

    Gao, Qinqin; Zhu, Xiaolin; Chen, Jie; Mao, Caiping; Zhang, Lubo; Xu, Zhice

    2016-07-01

    Preeclampsia is a leading cause of maternal and perinatal morbidity and mortality. Current research has focused on endothelial dysfunction regarding pathogenesis of preeclampsia. However, very limited or no studies so far have been performed to assess possible damaged endothelial cell growth/development in the placenta-umbilical cord circulation system in human preeclampsia. We isolated and cultured human umbilical cord vein endothelial cells (HUVECs) from normal and preeclampsia pregnancies in vitro. We used 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay to measure cell growth and flow cytometric analysis to determine cell-cycle distribution. Annexin V-fluorescein isothiocyanate/propidium iodide double staining was employed for cell apoptosis experiments. The study showed that the cell growth was significantly suppressed, accompanied by the increased G1 arrest and apoptosis in cultured HUVECs from preeclampsia pregnancies comparing with normotensive controls. Protein P53 was upregulated in the cultured HUVECs from preeclampsia pregnancies, which induced G1 arrest, followed by upregulating P21 expression, and downregulating cyclin E expression and CDK2-cyclin E complexes. On the other hand, upregulation of P53 also activated Bax gene and repressed Bcl-2 and BIRC5 genes, resulting in an increase of the Bax/Bcl-2 ratio and subsequently activating caspase cascade, ultimately led to an initiation of the apoptotic machinery. These results indicated that in preeclampsia, vascular endothelial cells could be damaged and cellular proliferation was depressed in human placenta-umbilical cord circulation, adding new information on endothelial cell injury for better understanding the pathogenesis of preeclampsia.

  1. Mechanisms of G1 cell cycle arrest and apoptosis in myeloma cells induced by hybrid-compound histone deacetylase inhibitor

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Seiko [Division of Infections and Molecular Biology, Kyushu Dental University (Japan); Division of Maxillofacial Surgery, Kyushu Dental University (Japan); Okinaga, Toshinori; Ariyoshi, Wataru [Division of Infections and Molecular Biology, Kyushu Dental University (Japan); Oral Biology Research Center, Kyushu Dental University (Japan); Takahashi, Osamu; Iwanaga, Kenjiro [Division of Maxillofacial Surgery, Kyushu Dental University (Japan); Nishino, Norikazu [Oral Biology Research Center, Kyushu Dental University (Japan); Tominaga, Kazuhiro [Division of Maxillofacial Surgery, Kyushu Dental University (Japan); Nishihara, Tatsuji, E-mail: tatsujin@kyu-dent.ac.jp [Division of Infections and Molecular Biology, Kyushu Dental University (Japan); Oral Biology Research Center, Kyushu Dental University (Japan)

    2013-05-10

    Highlights: •Novel histone deacetylase inhibitor Ky-2, remarkably inhibits myeloma cell growth. •Ky-2 demonstrates no cytotoxicity against normal lymphocytic cells. •Ky-2 induces cell cycle arrest through the cell cycle-associated proteins. •Ky-2 induces Bcl-2-inhibitable apoptosis through a caspase-dependent cascade. -- Abstract: Objectives: Histone deacetylase (HDAC) inhibitors are new therapeutic agents, used to treat various types of malignant cancers. In the present study, we investigated the effects of Ky-2, a hybrid-compound HDAC inhibitor, on the growth of mouse myeloma cells. Materials and methods: Myeloma cells, HS-72, P3U1, and mouse normal cells were used in this study. Effect of HDAC inhibitors on cell viability was determined by WST-assay and trypan blue assay. Cell cycle was analyzed using flow cytometer. The expression of cell cycle regulatory and the apoptosis associated proteins were examined by Western blot analysis. Hoechst’s staining was used to detect apoptotic cells. Results: Our findings showed that Ky-2 decreased the levels of HDACs, while it enhanced acetylation of histone H3. Myeloma cell proliferation was inhibited by Ky-2 treatment. Interestingly, Ky-2 had no cytotoxic effects on mouse normal cells. Ky-2 treatment induced G1-phase cell cycle arrest and accumulation of a sub-G1 phase population, while Western blotting analysis revealed that expressions of the cell cycle-associated proteins were up-regulated. Also, Ky-2 enhanced the cleavage of caspase-9 and -3 in myeloma cells, followed by DNA fragmentation. In addition, Ky-2 was not found to induce apoptosis in bcl-2 overexpressing myeloma cells. Conclusion: These findings suggest that Ky-2 induces apoptosis via a caspase-dependent cascade and Bcl-2-inhibitable mechanism in myeloma cells.

  2. Arctigenin, a natural lignan compound, induces G0/G1 cell cycle arrest and apoptosis in human glioma cells.

    Science.gov (United States)

    Maimaitili, Aisha; Shu, Zunhua; Cheng, Xiaojiang; Kaheerman, Kadeer; Sikandeer, Alifu; Li, Weimin

    2017-02-01

    The aim of the current study was to investigate the anticancer potential of arctigenin, a natural lignan compound, in malignant gliomas. The U87MG and T98G human glioma cell lines were treated with various concentrations of arctigenin for 48 h and the effects of arctigenin on the aggressive phenotypes of glioma cells were assessed. The results demonstrated that arctigenin dose-dependently inhibited the growth of U87MG and T98G cells, as determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and bromodeoxyuridine incorporation assays. Arctigenin exposure also induced a 60-75% reduction in colony formation compared with vehicle-treated control cells. However, arctigenin was not observed to affect the invasiveness of glioma cells. Arctigenin significantly increased the proportion of cells in the G0/G1 phase and reduced the number of cells in the S phase, as compared with the control group (Parctigenin increased the expression levels of p21, retinoblastoma and p53 proteins, and significantly decreased the expression levels of cyclin D1 and cyclin-dependent kinase 4 proteins. Additionally, arctigenin was able to induce apoptosis in glioma cells, coupled with increased expression levels of cleaved caspase-3 and the pro-apoptotic BCL2-associated X protein. Furthermore, arctigenin-induced apoptosis was significantly suppressed by the pretreatment of cells with Z-DEVD-FMK, a caspase-3 inhibitor. In conclusion, the results suggest that arctigenin is able to inhibit cell proliferation and may induce apoptosis and cell cycle arrest at the G0/G1 phase in glioma cells. These results warrant further investigation of the anticancer effects of arctigenin in animal models of gliomas.

  3. Stabilizing two IgG1 monoclonal antibodies by surfactants: Balance between aggregation prevention and structure perturbation.

    Science.gov (United States)

    Wang, Shujing; Wu, Guoliang; Zhang, Xinyi; Tian, Zhou; Zhang, Ning; Hu, Tao; Dai, Weiguo; Qian, Feng

    2017-05-01

    Surfactants are widely used as stabilizers in the biopharmaceutical formulations to minimize protein aggregation. Under a fixed stress condition, the protecting and destabilizing effects of surfactants are hypothesized to be highly dependent on the species and concentrations of surfactants and mAb. Therefore, we here studied the aggregation-prevention and structure-perturbation effects of eight commonly used surfactants (Tw20, Tw80, Brij35, Chaps, TrX-100, SDS, Pluronic F68 and F127) on two IgG1 solution formulations under agitation, using analytical methodologies including visual inspection, OD350 measurement, HPLC-SEC, circular dicroism, fluorescence spectroscopy and differential scanning calorimetry. We found that: (1) With concentrations range from 0.02 to 2mg/mL, nonionic surfactants were found to offer efficient aggregation-prevention effect, which is superior than the ionic surfactants; and higher surfactant concentration prevented mAb aggregation better especially under prolonged stability test under stress conditions. (2) The surfactant induced structure-perturbation emerged when even higher surfactant concentration (≥2mg/mL) was used, and such effect was surfactant-property dependent; and (3) the two IgG1 demonstrated different aggregation mechanisms and surfactant dependency, especially at high mAb concentrations. In conclusion, surfactants usage in mAb formulations, including the types and concentrations, should strike an optimal balance between the desirable aggregation-prevention and the detrimental structure-perturbation effects, while the consideration of mAb aggregation mechanism and concentration is also required for surfactant assessment. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Modeling ERBB receptor-regulated G1/S transition to find novel targets for de novo trastuzumab resistance

    Directory of Open Access Journals (Sweden)

    Thieffry Denis

    2009-01-01

    Full Text Available Abstract Background In breast cancer, overexpression of the transmembrane tyrosine kinase ERBB2 is an adverse prognostic marker, and occurs in almost 30% of the patients. For therapeutic intervention, ERBB2 is targeted by monoclonal antibody trastuzumab in adjuvant settings; however, de novo resistance to this antibody is still a serious issue, requiring the identification of additional targets to overcome resistance. In this study, we have combined computational simulations, experimental testing of simulation results, and finally reverse engineering of a protein interaction network to define potential therapeutic strategies for de novo trastuzumab resistant breast cancer. Results First, we employed Boolean logic to model regulatory interactions and simulated single and multiple protein loss-of-functions. Then, our simulation results were tested experimentally by producing single and double knockdowns of the network components and measuring their effects on G1/S transition during cell cycle progression. Combinatorial targeting of ERBB2 and EGFR did not affect the response to trastuzumab in de novo resistant cells, which might be due to decoupling of receptor activation and cell cycle progression. Furthermore, examination of c-MYC in resistant as well as in sensitive cell lines, using a specific chemical inhibitor of c-MYC (alone or in combination with trastuzumab, demonstrated that both trastuzumab sensitive and resistant cells responded to c-MYC perturbation. Conclusion In this study, we connected ERBB signaling with G1/S transition of the cell cycle via two major cell signaling pathways and two key transcription factors, to model an interaction network that allows for the identification of novel targets in the treatment of trastuzumab resistant breast cancer. Applying this new strategy, we found that, in contrast to trastuzumab sensitive breast cancer cells, combinatorial targeting of ERBB receptors or of key signaling intermediates does not

  5. Disease and Carrier Isolates of Neisseria meningitidis Cause G1 Cell Cycle Arrest in Human Epithelial Cells.

    Science.gov (United States)

    von Papen, Michael; Oosthuysen, Wilhelm F; Becam, Jérôme; Claus, Heike; Schubert-Unkmeir, Alexandra

    2016-10-01

    Microbial pathogens have developed several mechanisms to modulate and interfere with host cell cycle progression. In this study, we analyzed the effect of the human pathogen Neisseria meningitidis on the cell cycle of epithelial cells. Two pathogenic isolates, as well as two carrier isolates, were tested for their ability to adhere to and invade into the epithelial cell lines Detroit 562 and NP69 and to modulate the cell cycle. We found that all isolates adhered equally well to both Detroit 562 and NP69 cells, whereas the carrier isolates were significantly less invasive. Using propidium iodide staining and 5-ethynyl-2'-deoxyuridine pulse-labeling, we provide evidence that meningococcal infection arrested cells in the G1 phase of the cell cycle at 24 h postinfection. In parallel, a significant decrease of cells in the S phase was observed. Interestingly, G1-phase arrest was only induced after infection with live bacteria but not with heat-killed bacteria. By Western blotting we demonstrate that bacterial infection resulted in a decreased protein level of the cell cycle regulator cyclin D1, whereas cyclin E expression levels were increased. Furthermore, N. meningitidis infection induced an accumulation of the cyclin-dependent kinase inhibitor (CKI) p21(WAF1/CIP1) that was accompanied by a redistribution of this CKI to the cell nucleus, as shown by immunofluorescence analysis. Moreover, the p27(CIP1) CKI was redistributed and showed punctate foci in infected cells. In summary, we present data that N. meningitidis can interfere with the processes of host cell cycle regulation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  6. Accelerator based fusion reactor

    Science.gov (United States)

    Liu, Keh-Fei; Chao, Alexander Wu

    2017-08-01

    A feasibility study of fusion reactors based on accelerators is carried out. We consider a novel scheme where a beam from the accelerator hits the target plasma on the resonance of the fusion reaction and establish characteristic criteria for a workable reactor. We consider the reactions d+t\\to n+α,d+{{}3}{{H}\\text{e}}\\to p+α , and p+{{}11}B\\to 3α in this study. The critical temperature of the plasma is determined from overcoming the stopping power of the beam with the fusion energy gain. The needed plasma lifetime is determined from the width of the resonance, the beam velocity and the plasma density. We estimate the critical beam flux by balancing the energy of fusion production against the plasma thermo-energy and the loss due to stopping power for the case of an inert plasma. The product of critical flux and plasma lifetime is independent of plasma density and has a weak dependence on temperature. Even though the critical temperatures for these reactions are lower than those for the thermonuclear reactors, the critical flux is in the range of {{10}22}-{{10}24}~\\text{c}{{\\text{m}}-2}~{{\\text{s}}-1} for the plasma density {ρt}={{10}15}~\\text{c}{{\\text{m}}-3} in the case of an inert plasma. Several approaches to control the growth of the two-stream instability are discussed. We have also considered several scenarios for practical implementation which will require further studies. Finally, we consider the case where the injected beam at the resonance energy maintains the plasma temperature and prolongs its lifetime to reach a steady state. The equations for power balance and particle number conservation are given for this case.

  7. Nuclear Reactor Safety; (USA)

    Energy Technology Data Exchange (ETDEWEB)

    Cason, D.L.; Hicks, S.C. (eds.)

    1991-01-01

    This publication announces on an monthly basis the current worldwide information available on all safety-related aspects of reactors, including: accident analysis, safety systems, radiation protection, decommissioning and dismantling, and security measures. This publication contains the abstracts of DOE reports, journal articles, conference papers, patents, theses, and monographs added to the Energy Science and Technology Database (EDB) during the past month. Also included are other US information obtained through acquisition programs or interagency agreements and international information obtained through the International Energy Agency's Technology Data Exchange, the International Atomic Energy Agency's International Nuclear Information System, or government-to-government agreements.

  8. Iris reactor development

    Energy Technology Data Exchange (ETDEWEB)

    Paramonov, D.V.; Carelli, M.D. [Westinghouse Electric Corp., Baltimore, MD (United States); Miller, K. [BNFL, Inc., (United Kingdom); Lombardi, C.V.; Ricotti, M.E. [Polytechnic of Milan, Polimi (Italy); Todreas, N.E. [Masachussets Institute of Technology, MIT (United States); Greenspan, E. [University of California at Berkeley, UCB (United States); Yamamoto, K. [JAPC Japan Atomic Power Co., Tokyo (Japan); Nagano, A. [Mitsubishi Heavy Industries Ltd., Tokyo (Japan); Ninokata, H. [Tokyo Institut of Technology, TIT (Japan); Robertson, J. [Westinghouse and bechtel (United States); Oriolo, F. [Pisa Univ. (Italy)

    2001-07-01

    The development progress of the IRIS (International Reactor Innovative and Secure) nuclear power system is presented. IRIS is currently being developed by an international consortium of industry, laboratory, university and utility establishments, led by Westinghouse. It is aimed at achieving the four major objectives of the Generation IV nuclear systems, i.e., proliferation resistance, enhanced safety, economic competitiveness and reduced waste. The project first year activities, which are summarized here, were focused on core neutronics, in-vessel configuration, steam generator and containment design, safety approach and economic performance. Details of these studies are provided in parallel papers in these proceedings. (author)

  9. NEUTRONIC REACTOR CONSTRUCTION

    Science.gov (United States)

    Vernon, H.C.; Goett, J.J.

    1958-09-01

    A cover device is described for the fuel element receiving tube of a neutronic reactor of the heterogeneous, water cooled type wherein said tubes are arranged in a moderator with their longitudinal axes vertical. The cover is provided with means to support a rod-type fuel element from the bottom thereof and means to lock the cover in place, the latter being adapted for remote operation. This cover device is easily removable and seals the opening in the upper end of the fuel tube against leakage of coolant.

  10. Reactor coolant pump flywheel

    Science.gov (United States)

    Finegan, John Raymond; Kreke, Francis Joseph; Casamassa, John Joseph

    2013-11-26

    A flywheel for a pump, and in particular a flywheel having a number of high density segments for use in a nuclear reactor coolant pump. The flywheel includes an inner member and an outer member. A number of high density segments are provided between the inner and outer members. The high density segments may be formed from a tungsten based alloy. A preselected gap is provided between each of the number of high density segments. The gap accommodates thermal expansion of each of the number of segments and resists the hoop stress effect/keystoning of the segments.

  11. SODIUM DEUTERIUM REACTOR

    Science.gov (United States)

    Oppenheimer, E.D.; Weisberg, R.A.

    1963-02-26

    This patent relates to a barrier system for a sodium heavy water reactor capable of insuring absolute separation of the metal and water. Relatively cold D/sub 2/O moderator and reflector is contained in a calandria into which is immersed the fuel containing tubes. The fuel elements are cooled by the sodium which flows within the tubes and surrounds the fuel elements. The fuel containing tubes are surrounded by concentric barrier tubes forming annular spaces through which pass inert gases at substantially atmospheric pressure. Header rooms above and below the calandria are provided for supplying and withdrawing the sodium and inert gases in the calandria region. (AEC)

  12. Fast Reactor Fuel Type and Reactor Safety Performance

    Energy Technology Data Exchange (ETDEWEB)

    R. Wigeland; J. Cahalan

    2009-09-01

    Fast Reactor Fuel Type and Reactor Safety Performance R. Wigeland , Idaho National Laboratory J. Cahalan, Argonne National Laboratory The sodium-cooled fast neutron reactor is currently being evaluated for the efficient transmutation of the highly-hazardous, long-lived, transuranic elements that are present in spent nuclear fuel. One of the fundamental choices that will be made is the selection of the fuel type for the fast reactor, whether oxide, metal, carbide, nitride, etc. It is likely that a decision on the fuel type will need to be made before many of the related technologies and facilities can be selected, from fuel fabrication to spent fuel reprocessing. A decision on fuel type should consider all impacts on the fast reactor system, including safety. Past work has demonstrated that the choice of fuel type may have a significant impact on the severity of consequences arising from accidents, especially for severe accidents of low probability. In this paper, the response of sodium-cooled fast reactors is discussed for both oxide and metal fuel types, highlighting the similarities and differences in reactor response and accident consequences. Any fast reactor facility must be designed to be able to successfully prevent, mitigate, or accommodate all consequences of potential events, including accidents. This is typically accomplished by using multiple barriers to the release of radiation, including the cladding on the fuel, the intact primary cooling system, and most visibly the reactor containment building. More recently, this has also included the use of ‘inherent safety’ concepts to reduce or eliminate the potential for serious damage in some cases. Past experience with oxide and metal fuel has demonstrated that both fuel types are suitable for use as fuel in a sodium-cooled fast reactor. However, safety analyses for these two fuel types have also shown that there can be substantial differences in accident consequences due to the neutronic and

  13. Reactor Physics Analysis Models for a CANDU Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Hang Bok

    2007-10-15

    Canada deuterium uranium (CANDU) reactor physics analysis is typically performed in three steps. At first, macroscopic cross-sections of the reference lattice is produced by modeling the reference fuel channel. Secondly macroscopic cross-sections of reactivity devices in the reactor are generated. The macroscopic cross-sections of a reactivity device are calculated as incremental cross-sections by subtracting macroscopic cross-sections of a three-dimensional lattice without reactivity device from those of a three-dimensional lattice with a reactivity device. Using the macroscopic cross-sections of the reference lattice and incremental cross-sections of the reactivity devices, reactor physics calculations are performed. This report summarizes input data of typical CANDU reactor physics codes, which can be utilized for the future CANDU reactor physics analysis.

  14. Decommissioning of commercial reactor

    Energy Technology Data Exchange (ETDEWEB)

    Yui, Kohei [Japan Atomic Power Co., Tokyo (Japan)

    1997-02-01

    In the case of nuclear reactors, the diversion is often difficult as they are highly purposive, the disassembling is not easy as they are robust, and attention is required to handle the equipment containing radioactive substances. Decommissioning is defined as all the measures taken from the state that facilities become unused to the state of becoming green field. In Japan, already 40 years have elapsed since the effort for nuclear power was begun, and in this paper, the present state and future subjects of the decommissioning of nuclear power stations are summarized at the opportunity that the stop of commercial operation of Tokai Nuclear Power Station was decided recently. In the Tokai Nuclear Power Station, 166 MWe graphite-moderated, carbon dioxide-cooled reactor called improved Calder Hall type is installed, which started the operation in 1966. The circumstances of the decision to stop its operation are explained. The basic policy of the decommissioning of commercial nuclear power stations has been already published by the Advisory Committee for Energy. The state of the decommissioning in various foreign countries is reported. In Japan, the state of green field was realized in 1996 in the decommissioning of the JPDR in Japan Atomic Energy Research institute, and the decommissioning of the atomic powered ship ``Mutsu`` was completed. (K.I.)

  15. Michel Ledoux - Isopérimétrie dans les espaces métriques mesurés : Colloquium MathAlp 2016

    OpenAIRE

    Ledoux, Michel; Bastien, Fanny

    2016-01-01

    Le problème isopérimétrique (à volume donné, minimiser la mesure de bord, et déterminer les ensembles extrémaux), remonte aux temps les plus anciens. Tout à la fois, il peut se formuler de façon générale dans un espace métrique mesuré, et dans le même temps assez peu d’exemples explicites, en particuliers de minimiseurs, sont connus. Les questions se portent ainsi vers des propriétés de comparaison avec les des espaces modèles, comme ceux de la géométrie, euclidienne, sphérique et hyperboliqu...

  16. Solvent refined coal reactor quench system

    Science.gov (United States)

    Thorogood, R.M.

    1983-11-08

    There is described an improved SRC reactor quench system using a condensed product which is recycled to the reactor and provides cooling by evaporation. In the process, the second and subsequent reactors of a series of reactors are cooled by the addition of a light oil fraction which provides cooling by evaporation in the reactor. The vaporized quench liquid is recondensed from the reactor outlet vapor stream. 1 fig.

  17. Brookhaven leak reactor to close

    CERN Multimedia

    MacIlwain, C

    1999-01-01

    The DOE has announced that the High Flux Beam Reactor at Brookhaven is to close for good. Though the news was not unexpected researchers were angry the decision had been taken before the review to assess the impact of reopening the reactor had been concluded (1 page).

  18. Rotary reactor and use thereof

    NARCIS (Netherlands)

    Bakker Wridzer, J.W.; Kapteijn, F.; Moulijn, J.A.

    1998-01-01

    The invention relates to a rotary reactor consisting of a number of tubular reaction compartments (A), each provided with a first end and a second end, a ceramic first reactor end plate (B) in which said first ends are received, and a second end plate (B) in which said second ends are received,

  19. Mesures de procédure spéciales et respect des droits de l'homme Rapport général

    NARCIS (Netherlands)

    Vervaele, J.A.E.

    2009-01-01

    Le but du rapport général est de mener une analyse comparative des rapports nationaux en vue de présenter les processus de transformation des systèmes de justice pénale internes, en particulier du procès pénal, étant donné que des mesures procédurales spéciales sont introduites pour appréhender le

  20. Pour mesurer le débit de l'Indus : un nouveau système de prévision ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    15 juil. 2011 ... Le Pakistan étant surtout une région aride ou semi-aride, l'Indus y joue un rôle crucial. Le bassin ... Presque tous les scientifiques pakistanais s'opposent à cette idée, tout comme Faruqui, qui s'inquiète des répercussions que cette mesure pourrait avoir à long terme sur l'environnement et le climat.

  1. Radiation Shielding for Fusion Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Santoro, R.T.

    1999-10-01

    Radiation shielding requirements for fusion reactors present different problems than those for fission reactors and accelerators. Fusion devices, particularly tokamak reactors, are complicated by geometry constraints that complicate disposition of fully effective shielding. This paper reviews some of these shielding issues and suggested solutions for optimizing the machine and biological shielding. Radiation transport calculations are essential for predicting and confirming the nuclear performance of the reactor and, as such, must be an essential part of the reactor design process. Development and optimization of reactor components from the first wall and primary shielding to the penetrations and containment shielding must be carried out in a sensible progression. Initial results from one-dimensional transport calculations are used for scoping studies and are followed by detailed two- and three-dimensional analyses to effectively characterize the overall radiation environment. These detail model calculations are essential for accounting for the radiation leakage through ports and other penetrations in the bulk shield. Careful analysis of component activation and radiation damage is cardinal for defining remote handling requirements, in-situ replacement of components, and personnel access at specific locations inside the reactor containment vessel. Radiation shielding requirements for fusion reactors present different problems than those for fission reactors and accelerators. Fusion devices, particularly tokamak reactors, are complicated by geometry constraints that complicate disposition of fully effective shielding. This paper reviews some of these shielding issues and suggested solutions for optimizing the machine and biological shielding. Radiation transport calculations are essential for predicting and confirming the nuclear performance of the reactor and, as such, must be an essential part of the reactor design process. Development and optimization of reactor

  2. Final checkup of neoplastic DNA replication: evidence for failure in decision-making at the mitotic cell cycle checkpoint G(1)/S.

    Science.gov (United States)

    Prindull, Gregor

    2008-11-01

    Processing of epigenomic transcriptional information by cell cycle phase G(1) and decision-making at checkpoint G(1)/S are the final organizational steps preceding gene replication in transcriptional reorientation programs (i.e., switches from proliferation to cycle arrest and neoplastic transformation). Further analyses of cycle progression will open up new approaches in antineoplastic therapy. The following bibliographic databases were consulted: Central Medical Library Cologne, PubMed (English), the last search was done on April 23,2008 and key words searched were: cell cycle, cell memory, DNA methylation, embryonal/neoplastic stem cells, enzyme-modulated chromatin, G(1)-G(1)/S checkpoint, genomic/epigenomics, genomic viral DNA, histones, telomere/telomerases, transcription factors, neoplastic transformation, senescence. Gene transcription and epigenomic surveillance form a functional entity. In proliferation programs, transcriptional information is mediated by chromatin and DNA methylation, analyzed and processed in G(1) phase, and converged on the parental checkpoint G(1)/S for final decision-making on DNA replication. Genomic reorientation appears to be associated with transcriptional instability, which normally is corrected, possibly during the G(2)/M phase, to new levels of epigenomic equilibria. We speculate that daughter stem cells inherit persistent neoplasm-specific transcriptional instabilities through failure of the parental G(1)/S checkpoint. Foreign, silenced, potentially oncogenic DNA sequences, i.e. regular components of the human genome such as endogenous retroviruses, could conceivably be activated for expression in neoplastic transformation by epigenomic histone deacetylase/acetyl transferase/histone methyltransferase-mixed lineage leukemia deregulations. Failure of cell cycle G(1)/S decision-making for DNA replication is the final and possibly a major cause in neoplastic transformation. Therefore, further analysis of the dynamics of G(1)-G(1

  3. Electronic temperature measurement on the deca II plasma using the Bremsstrahlung; Mesure de la temperature electronique du plasma de deca II par etude du rayonnement de freinage

    Energy Technology Data Exchange (ETDEWEB)

    Dumas, A. [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires

    1967-06-01

    The electronic temperature of the DECA II machine's plasma is determined by studying the Bremsstrahlung. Two types of detectors are used for this measurement, a set scintillator-photo-multiplicator and a photoelectric effect detector with a massive silver target. The method used is the classical 'absorbent method', The absorbents used are thin formvar foils whose thickness is between 600 and 12 500 angstrom. The measurements done in two different working conditions of the DECA II machine have given: Te {approx_equal} 200 eV in the first case and Te {approx_equal} 70 eV in the second case. (author) [French] Nous avons determine la temperature electronique du plasma de la machine DECA II par l'etude du rayonnement de freinage. Pour cette mesure nous avons utilise deux types de detecteurs: des ensembles scintillateur-photomultiplicateur et un detecteur a effet photoelectrique a cible massive en argent. La methode utilisee pour cette mesure est la classique methode des absorbants. Nous avons utilise des feuilles de format tres mince (de 600 a 12 500 angstrom) comme absorbant. Les mesures faites dans deux regimes de travail differents de la machine DECA II nous ont conduit a: Te {approx_equal} 200 eV dans un cas et Te {approx_equal} eV dans l'autre cas. (auteur)

  4. CALCUL DU DEPHASAGE A LA REFLEXION ET DES INDICES OPTIQUES DE L’ALLIAGE AMORPHE PD30Y70 A PARTIR DE LA MESURE DE SA REFLEXION

    Directory of Open Access Journals (Sweden)

    H BELBAH

    2002-06-01

    Full Text Available Les couches minces de l’alliage amorphe de composition Pd30Y70 sont déposées par pulvérisation cathodique sur des substrats en silice, sous un vide de 10-7 Torr. Les couches obtenues sont opaques et par conséquent leur transmission est nulle. Le spectre de réflexion de Pd30Y70  est mesuré dans le domaine d’énergie entre 0,5 et 6,2 eV. Cette mesure sert au calcul du déphasage à la réflexion de l’alliage à partir de l’intégrale de Kramers-Kronig. Les valeurs mesurées de la réflexion et les valeurs calculées du déphasage à la réflexion permettent de remonter aux constantes optiques (indices de réfraction et d’extinction de l’alliage et à sa structure électronique à partir des spectres d’absorption optique calculés. Le spectre d’absorption optique de Pd30Y70 amorphe est dominé par deux structures dont l’une est due aux états 4d de Pd centrée autour de 4 eV et l’autre aux états 4d de Y aux basses énergies.

  5. Mesures magnetiques relatives au comportement du champ magnetique dans un boitier de blindage place a proximite d'un aimant dipolaire de correction de type MCH

    CERN Document Server

    chritin, R

    1999-01-01

    L'objectif des ces mesures fut de connaître de quelle faèon se comporte le champ à l'intérieur et à proximité d'un blindage magnétique, placé à différentes positions par rapport à l'aimant type MCH (voir réf. 1). Ces positions étaient: A l'extérieur de l'aimant, affleurant à l'aimant, et partiellement entrant dans l'aimant. Pour chaque position du boîtier, on a réalisé une première mesure avec une excursion importante de la sonde dans le boîtier et dans l'aimant, avec un pas de 5 mm suffisant pour connaître l'allure générale de la courbe de champ, puis une seconde mesure avec une course réduite et un pas de 1 mm pour connaître précisément l'évolution du champ dans la zone de transition que constitue la sortie de boîtier de blindage. La faèon dont chutait le champ en entrant dans le boîtier suivant sa position par rapport à l'aimant constituant la principale incertitude comparée aux valeurs calculées par simulation informatique.

  6. Inhibition of G1P3 expression found in the differential display study on respiratory syncytial virus infection

    Directory of Open Access Journals (Sweden)

    Li Lei

    2008-10-01

    Full Text Available Abstract Background Respiratory syncytial virus (RSV is the leading viral pathogen associated with bronchiolitis and lower respiratory tract disease in infants and young children worldwide. The respiratory epithelium is the primary initiator of pulmonary inflammation in RSV infections, which cause significant perturbations of global gene expression controlling multiple cellular processes. In this study, differential display reverse transcription polymerase chain reaction amplification was performed to examine mRNA expression in a human alveolar cell line (SPC-A1 infected with RSV. Results Of the 2,500 interpretable bands on denaturing polyacrylamide gels, 40 (1.6% cDNA bands were differentially regulated by RSV, in which 28 (70% appeared to be upregulated and another 12 (30% appeared to be downregulated. Forty of the expressed sequence tags (EST were isolated, and 20 matched homologs in GenBank. RSV infection upregulated the mRNA expression of chemokines CC and CXC and interfered with type α/β interferon-inducible gene expression by upregulation of MG11 and downregulation of G1P3. Conclusion RSV replication could induce widespread changes in gene expression including both positive and negative regulation and play a different role in the down-regulation of IFN-α and up-regulation of IFN-γ inducible gene expression, which suggests that RSV interferes with the innate antiviral response of epithelial cells by multiple mechanisms.

  7. Comparison of SEC and CE-SDS methods for monitoring hinge fragmentation in IgG1 monoclonal antibodies.

    Science.gov (United States)

    Dada, Oluwatosin O; Rao, Romesh; Jones, Natalie; Jaya, Nomalie; Salas-Solano, Oscar

    2017-10-25

    Fragmentation of monoclonal antibodies is a critical quality attribute routinely monitored to assess the purity and integrity of the product from development to commercialization. Cleavage in the upper hinge region of IgG1 monoclonal antibodies is a common fragmentation pattern widely studied by size exclusion chromatography (SEC). Capillary electrophoresis with sodium dodecylsulfate (CE-SDS) is a well-established technique commonly used for monitoring antibody fragments as well, but its comparability to SEC in monitoring hinge fragments has not been established until now. We report a characterization strategy that establishes the correlation between hinge region fragments analyzed by SEC and CE-SDS. Monoclonal antibodies with elevated hinge fragments were generated under low pH stress conditions and analyzed by SEC and CE-SDS. The masses of the fragments generated were determined by LC-MS. Electrophoretic migration of the hinge fragmentation products in CE-SDS were determined based on their mass values. Comparative assessment of fragments by SEC, and CE-SDS showed similar correlation with incubation time. This study demonstrates that CE-SDS can be employed as a surrogate technique to SEC for monitoring hinge region fragments. Most importantly, combination of these techniques can be used to obtain comprehensive understanding of fragment related characteristics of therapeutic protein products. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Huang W

    2017-12-01

    Full Text Available Huang W, Huang H, Wang L, Hu J, Song W. SUN1 silencing inhibits cell growth through G0/G1 phase arrest in lung adenocarcinoma. OncoTargets and Therapy. 2017;10:2825–2833.This article has been retracted at the request of the Editor-in-Chief of OncoTargets and Therapy. It was brought to the attention of the Editorial team by the authors that in Lentivirus package and transfection part of the Materials and Methods section, the authors noted “a nontargeting shRNA (5′-GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT-3′ was used as control”. Recently the authors were advised by the supplier of the lentivirus there was an error in the illustration concerning the control group sequence. The correct sequence should be TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT rather than GCGGAGGGTTTGAAAGAATATCTCGAGATATTCTTTCAAACCCTCCGCTTTTTT. The authors cannot confirm that the sequence carried by the control group lentivirus was TTCTCCGAACGTGTCACGTCTCGA GACGTGACACGTTCGGAGAATTTTT so they have decided to respectfully retract this original research paper and perform the experiments again to retest the data. This retraction relates to

  9. Ponatinib promotes a G1 cell-cycle arrest of merlin/NF2-deficient human schwann cells.

    Science.gov (United States)

    Petrilli, Alejandra M; Garcia, Jeanine; Bott, Marga; Klingeman Plati, Stephani; Dinh, Christine T; Bracho, Olena R; Yan, Denise; Zou, Bing; Mittal, Rahul; Telischi, Fred F; Liu, Xue-Zhong; Chang, Long-Sheng; Welling, D Bradley; Copik, Alicja J; Fernández-Valle, Cristina

    2017-05-09

    Neurofibromatosis type 2 (NF2) is a genetic syndrome that predisposes individuals to multiple benign tumors of the central and peripheral nervous systems, including vestibular schwannomas. Currently, there are no FDA approved drug therapies for NF2. Loss of function of merlin encoded by the NF2 tumor suppressor gene leads to activation of multiple mitogenic signaling cascades, including platelet-derived growth factor receptor (PDGFR) and SRC in Schwann cells. The goal of this study was to determine whether ponatinib, an FDA-approved ABL/SRC inhibitor, reduced proliferation and/or survival of merlin-deficient human Schwann cells (HSC). Merlin-deficient HSC had higher levels of phosphorylated PDGFRα/β, and SRC than merlin-expressing HSC. A similar phosphorylation pattern was observed in phospho-protein arrays of human vestibular schwannoma samples compared to normal HSC. Ponatinib reduced merlin-deficient HSC viability in a dose-dependent manner by decreasing phosphorylation of PDGFRα/β, AKT, p70S6K, MEK1/2, ERK1/2 and STAT3. These changes were associated with decreased cyclin D1 and increased p27Kip1levels, leading to a G1 cell-cycle arrest as assessed by Western blotting and flow cytometry. Ponatinib did not modulate ABL, SRC, focal adhesion kinase (FAK), or paxillin phosphorylation levels. These results suggest that ponatinib is a potential therapeutic agent for NF2-associated schwannomas and warrants further in vivo investigation.

  10. The hard X-ray view of the young supernova remnant G1.9+0.3

    DEFF Research Database (Denmark)

    Zoglauer, Andreas; Reynolds, Stephen P.; An, Hongjun

    2015-01-01

    NuSTAR observed G1.9+0.3, the youngest known supernova remnant in the Milky Way, for 350 ks and detected emission up to ~30 keV. The remnant's X-ray morphology does not change significantly across the energy range from 3 to 20 keV. A combined fit between NuSTAR and Chandra shows that the spectrum....... This can be explained by particle acceleration, to a maximum energy set by the finite remnant age, in a magnetic field of about 10 μG, for which our roll-off implies a maximum energy of about 100 TeV for both electrons and ions. Much higher magnetic-field strengths would produce an electron spectrum...... that was cut off by radiative losses, giving a much higher roll-off frequency that is independent of magnetic-field strength. In this case, ions could be accelerated to much higher energies. A search for 44Ti emission in the 67.9 keV line results in an upper limit of 1.5 × 10-5 photons cm-2 s-1 assuming a line...

  11. Phosphorylation-dependent and -independent functions of p130 cooperate to evoke a sustained G1 block

    DEFF Research Database (Denmark)

    Hansen, Klaus; Farkas, T; Lukas, J

    2001-01-01

    The retinoblastoma (pRb)-related p130 pocket protein is a regulator of cell growth and differentiation, and a candidate tumour suppressor. Both pRb and p130 operate through interactions with cellular proteins, including the E2F transcription factors. While such interactions are controlled...... by phosphorylation of multiple sites of pRb, regulation of p130 remains poorly understood. We now identify 22 in vivo phosphorylation sites of p130, targeted by diverse kinases, and present evidence for three cyclin-dependent kinase 4(6) [Cdk4(6)] specific phosphorylations, which appear critical for controlling...... the growth-restraining activity of p130. When expressed in U2OS cells, the phosphorylation-deficient mutant p130(Delta)(CDK4), in which the Cdk4 specific sites were mutated to alanine residues, imposed a more sustained G1 arrest than a constitutively active pRb(Delta)(CDK), known to repress all cellular E2F...

  12. Resibufogenin Induces G1-Phase Arrest through the Proteasomal Degradation of Cyclin D1 in Human Malignant Tumor Cells.

    Directory of Open Access Journals (Sweden)

    Masami Ichikawa

    Full Text Available Huachansu, a traditional Chinese medicine prepared from the dried toad skin, has been used in clinical studies for various cancers in China. Resibufogenin is a component of huachansu and classified as bufadienolides. Resibufogenin has been shown to exhibit the anti-proliferative effect against cancer cells. However, the molecular mechanism of resibufogenin remains unknown. Here we report that resibufogenin induces G1-phase arrest with hypophosphorylation of retinoblastoma (RB protein and down-regulation of cyclin D1 expression in human colon cancer HT-29 cells. Since the down-regulation of cyclin D1 was completely blocked by a proteasome inhibitor MG132, the suppression of cyclin D1 expression by resibufogenin was considered to be in a proteasome-dependent manner. It is known that glycogen synthase kinase-3β (GSK-3β induces the proteasomal degradation of cyclin D1. The addition of GSK-3β inhibitor SB216763 inhibited the reduction of cyclin D1 caused by resibufogenin. These effects on cyclin D1 by resibufogenin were also observed in human lung cancer A549 cells. These findings suggest that the anti-proliferative effect of resibufogenin may be attributed to the degradation of cyclin D1 caused by the activation of GSK-3β.

  13. Glioma-associated protein CHI3L2 suppresses cells viability and induces G1/S transition arrest

    Directory of Open Access Journals (Sweden)

    Avdieiev S. S.

    2015-08-01

    Full Text Available Aim. To analyze the effect of the CHI3L2 protein on malignant and non-malignant cell viability, and determined the CHI3L2 impact on the cell cycle and signaling pathways involved in the cell cycle regulation. Methods. MTT-based cell proliferation assay, FACS, western blot analysis. Results. The CHI3L2 protein inhibits the glioma cells viability and potentiates the effect of anti-cancer cytotoxic agents. The CHI3L2 treatment results in the G1/S transition arrest. CHI3L2 provoked a dramatic reduction of pRB phosphorylation and a significant decrease in the cyclin D1 expression, whereas the p53 and p21 expression levels were substantially increased. Conclusions. The CHI3L2 protein, which is overexpressed in human gliomas, is a negative regulator of the glioma cells viability. The reduced cell viability after the CHI3L2 treatment could be due to the activation of pRB and p53 and the downregulation of cyclin D.

  14. A study on M/G/1 retrial G - queue with two phases of service, immediate feedback and working vacations

    Science.gov (United States)

    Varalakshmi, M.; Chandrasekaran, V. M.; Saravanarajan, M. C.

    2017-11-01

    In this paper, we discuss about the steady state behaviour of M/G/1 retrial queueing system with two phases of services and immediate feedbacks under working vacation policy where the regular busy server is affected due to the arrival of negative customers. Upon arrival if the customer finds the server busy, breakdown or on working vacation it enters an orbit; otherwise the customer enters into the service area immediately. After service completion, the customer is allowed to make finite number of immediate feedback. The feedback service also consists of two phases. At the service completion epoch of a positive customer, if the orbit is empty the server goes for a working vacation. The server works at a lower service rate during working vacation (WV) period. Using the supplementary variable technique, we found out the steady state probability generating function for the system and in orbit. System performance measures and reliability measures are discussed. Finally, some numerical examples are presented to validate the analyticalresults.

  15. Determination of aflatoxins B1, B2, G1, and G2 in olive oil, peanut oil, and sesame oil.

    Science.gov (United States)

    Bao, Lei; Trucksess, Mary W; White, Kevin D

    2010-01-01

    Edible oils are consumed directly, and used as ingredients in food, soaps, and skin products. However, oils such as olive oil, peanut oil, and sesame oil could be contaminated with aflatoxins, which are detrimental to human and animal health. A method using immunoaffinity column cleanup with RPLC separation and fluorescence detection (FLD) for determination of aflatoxins (AF) B1, B2, G1, and G2 in olive oil, peanut oil, and sesame oil was developed and validated. Test samples were extracted with methanol-water (55 + 45, v/v). After shaking and centrifuging, the lower layer was filtered, diluted with water, and filtered through glass microfiber filter paper. The filtrate was then passed through an immunoaffinity column, and the toxins were eluted with methanol. The toxins were then subjected to RPLC/FLD analysis after postcolumn UV photochemical derivatization. The accuracy and repeatability characteristics of the method were determined. Recoveries of AFB1 spiked at levels from 1.0 to 10.0 microg/kg in olive oil, peanut oil, and sesame oil ranged from 82.9 to 98.6%. RSDs ranged from 0.6 to 8.9%. HorRat values were oil.

  16. Squamocin modulates histone H3 phosphorylation levels and induces G1 phase arrest and apoptosis in cancer cells.

    Science.gov (United States)

    Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Lin, Pei-Chin; Wu, Yang-Chang; Chang, Jan-Gowth

    2011-02-08

    Histone modifications in tumorigenesis are increasingly recognized as important epigenetic factors leading to cancer. Increased phosphorylation levels of histone H3 as a result of aurora B and pMSK1 overexpression were observed in various tumors. We selected aurora B and MSK1 as representatives for testing various compounds and drugs, and found that squamocin, a bis-tetrahydrofuran annonaceous acetogenin, exerted a potent effect on histone H3 phosphorylation. GBM8401, Huh-7, and SW620 cells were incubated with 15, 30, and 60 μM squamocin for 24 h. The expressions of mRNA and proteins were analyzed by qRT-PCR and Western blotting, respectively. The cell viability was determined by an MTT assay. Cell cycle distribution and apoptotic cells were analyzed by flow cytometry. Our results showed that squamocin inhibited the proliferation of GBM8401, Huh-7, and SW620 cells, arrested the cell cycle at the G1 phase, and activated both intrinsic and extrinsic pathways to apoptosis. In addition, we demonstrated that squamocin had the ability to modulate the phosphorylation levels of H3S10 (H3S10p) and H3S28 (H3S28p) in association with the downregulation of aurora B and pMSK1 expressions. This study is the first to show that squamocin affects epigenetic alterations by modulating histone H3 phosphorylation at S10 and S28, providing a novel view of the antitumor mechanism of squamocin.

  17. Synthetic study on cystinyl peptides using solution and solid phase methodology: human IgG1 hinge region.

    Science.gov (United States)

    Niederhafner, P; Gut, V; Jezek, J; Budesínský, M; Kasicka, V; Wünsch, E; Hlavácek, J

    2010-08-01

    Synthetic study on cystinyl peptides using solution and solid phase methodology was carried out with the central hinge region of immunoglobulin IgG1. In the solid phase synthesis of hexadecapeptide 1c, the time necessary for the formation of disulfide bonds between linear precursors was shortened four times by the action of pure oxygen in buffered solution, in comparison with air oxidation. The product was thus obtained devoid of impurities from side reactions. In the preparation of the shortened bis-cystinyl analogs 2k and 3d of the natural hexadecapeptide 1c, both the classical and polyethylene glycol (PEG6000) solution methods were utilized using a disulfide synthon (Boc-Cys-OPfp)2 to obtain peptide chains in a natural parallel alignment. In the PEG6000 strategy, lysine as a linker on both sides of the polymer was attached to enhance the loading capacity. The leucine residue, instead of proline one, was introduced to the carboxy terminus to facilitate a specific enzymatic cleavage of the peptides from PEG6000 by thermolysine.

  18. The G1/S Specific Cyclin D2 Is a Regulator of HIV-1 Restriction in Non-proliferating Cells

    Science.gov (United States)

    Badia, Roger; Pujantell, Maria; Riveira-Muñoz, Eva; Puig, Teresa; Torres-Torronteras, Javier; Martí, Ramón; Clotet, Bonaventura; Ampudia, Rosa M.; Ballana, Ester

    2016-01-01

    Macrophages are a heterogeneous cell population strongly influenced by differentiation stimuli that become susceptible to HIV-1 infection after inactivation of the restriction factor SAMHD1 by cyclin-dependent kinases (CDK). Here, we have used primary human monocyte-derived macrophages differentiated through different stimuli to evaluate macrophage heterogeneity on cell activation and proliferation and susceptibility to HIV-1 infection. Stimulation of monocytes with GM-CSF induces a non-proliferating macrophage population highly restrictive to HIV-1 infection, characterized by the upregulation of the G1/S-specific cyclin D2, known to control early steps of cell cycle progression. Knockdown of cyclin D2, enhances HIV-1 replication in GM-CSF macrophages through inactivation of SAMHD1 restriction factor by phosphorylation. Co-immunoprecipitation experiments show that cyclin D2 forms a complex with CDK4 and p21, a factor known to restrict HIV-1 replication by affecting the function of the downstream cascade that leads to SAMHD1 deactivation. Thus, we demonstrate that cyclin D2 acts as regulator of cell cycle proteins affecting SAMHD1-mediated HIV-1 restriction in non-proliferating macrophages. PMID:27541004

  19. Characterization of the Expression of the RNA Binding Protein eIF4G1 and Its Clinicopathological Correlation with Serous Ovarian Cancer.

    Science.gov (United States)

    Li, Lanfang; Luo, Qingya; Xie, Zhe; Li, Guiqin; Mao, Chengyi; Liu, Yi; Wen, Xin; Yin, Na; Cao, Jianzhong; Wang, Jing; Li, Li; Yu, Jianhua; Wang, Fang; Yi, Ping

    Ovarian cancer is the most lethal type of malignant tumor in gynecological cancers and is associated with a high percentage of late diagnosis and chemotherapy resistance. Thus, it is urgent to identify a tumor marker or a molecular target that allows early detection and effective treatment. RNA-binding proteins (RBPs) are crucial in various cellular processes at the post-transcriptional level. The eukaryotic translation initiation factor 4 gamma, 1(eIF4G1), an RNA-binding protein, facilitates the recruitment of mRNA to the ribosome, which is a rate-limiting step during the initiation phase of protein synthesis. However, little is known regarding the characteristics of eIF4G1 expression and its clinical significance in ovarian cancer. Therefore, we propose to investigate the expression and clinicopathological significance of eIF4G1 in ovarian cancer patients. We performed Real-time PCR in 40 fresh serous ovarian cancer tissues and 27 normal ovarian surface epithelial cell specimens to assess eIF4G1mRNA expression. Immunohistochemistry (IHC) was used to examine the expression of eIF4G1 at the protein level in 134 patients with serous ovarian cancer and 18 normal ovarian tissues. Statistical analysis was conducted to determine the correlation of the eIF4G1 protein levels with the clinicopathological characteristics and prognosis in ovarian cancer. The expression of eIF4G1 was upregulated in serous ovarian cancer tissues at both the mRNA (P = 0.0375) and the protein (P = 0.0007) levels. The eIF4G1 expression was significantly correlated with the clinical tumor stage (P = 0.0004) and omentum metastasis (P = 0.024). Moreover, patients with low eIF4G1 protein expression had a longer overall survival time (P = 0.026). These data revealed that eIF4G1 is markedly expressed in serous ovarian cancer and that upregulation of the eIF4G1 protein expression is significantly associated with an advanced tumor stage. Besides, the patients with lower expression of eIF4G1 tend to have

  20. Characterization of the Expression of the RNA Binding Protein eIF4G1 and Its Clinicopathological Correlation with Serous Ovarian Cancer.

    Directory of Open Access Journals (Sweden)

    Lanfang Li

    Full Text Available Ovarian cancer is the most lethal type of malignant tumor in gynecological cancers and is associated with a high percentage of late diagnosis and chemotherapy resistance. Thus, it is urgent to identify a tumor marker or a molecular target that allows early detection and effective treatment. RNA-binding proteins (RBPs are crucial in various cellular processes at the post-transcriptional level. The eukaryotic translation initiation factor 4 gamma, 1(eIF4G1, an RNA-binding protein, facilitates the recruitment of mRNA to the ribosome, which is a rate-limiting step during the initiation phase of protein synthesis. However, little is known regarding the characteristics of eIF4G1 expression and its clinical significance in ovarian cancer. Therefore, we propose to investigate the expression and clinicopathological significance of eIF4G1 in ovarian cancer patients.We performed Real-time PCR in 40 fresh serous ovarian cancer tissues and 27 normal ovarian surface epithelial cell specimens to assess eIF4G1mRNA expression. Immunohistochemistry (IHC was used to examine the expression of eIF4G1 at the protein level in 134 patients with serous ovarian cancer and 18 normal ovarian tissues. Statistical analysis was conducted to determine the correlation of the eIF4G1 protein levels with the clinicopathological characteristics and prognosis in ovarian cancer.The expression of eIF4G1 was upregulated in serous ovarian cancer tissues at both the mRNA (P = 0.0375 and the protein (P = 0.0007 levels. The eIF4G1 expression was significantly correlated with the clinical tumor stage (P = 0.0004 and omentum metastasis (P = 0.024. Moreover, patients with low eIF4G1 protein expression had a longer overall survival time (P = 0.026.These data revealed that eIF4G1 is markedly expressed in serous ovarian cancer and that upregulation of the eIF4G1 protein expression is significantly associated with an advanced tumor stage. Besides, the patients with lower expression of eIF4G1 tend

  1. Neutrino Experiments at Reactors

    Science.gov (United States)

    Reines, F.; Gurr, H. S.; Jenkins, T. L.; Munsee, J. H.

    1968-09-09

    A description is given of the electron-antineutrino program using a large fission reactor. A search has been made for a neutral weak interaction via the reaction (electron antineutrino + d .> p + n + electron antineutrino), the reaction (electron antineutrino + d .> n + n + e{sup +}) has now been detected, and an effort is underway to observe the elastic scattering reaction (electron antineutrino + e{sup -} .> electron antineutrino + e{sup -}) as well as to measure more precisely the reaction (electron antineutrino + p .> n + e{sup+}). The upper limit on the elastic scattering reaction which we have obtained with our large composite NaI, plastic, liquid scintillation detector is now about 50 times the predicted value.

  2. Licensed reactor nuclear safety criteria applicable to DOE reactors

    Energy Technology Data Exchange (ETDEWEB)

    1993-11-01

    This document is a compilation and source list of nuclear safety criteria that the Nuclear Regulatory Commission (NRC) applies to licensed reactors; it can be used by DOE and DOE contractors to identify NRC criteria to be evaluated for application to the DOE reactors under their cognizance. The criteria listed are those that are applied to the areas of nuclear safety addressed in the safety analysis report of a licensed reactor. They are derived from federal regulations, USNRC regulatory guides, Standard Review Plan (SRP) branch technical positions and appendices, and industry codes and standards.

  3. Advanced fusion reactor

    Energy Technology Data Exchange (ETDEWEB)

    Tomita, Yukihiro [National Inst. for Fusion Science, Toki, Gifu (Japan)

    2003-04-01

    The main subjects on fusion research are now on D-T fueled fusion, mainly due to its high fusion reaction rate. However, many issues are still remained on the wall loading by the 14 MeV neutrons. In the case of D-D fueled fusion, the neutron wall loading is still remained, though the technology related to tritium breeding is not needed. The p-{sup 6}Li and p-{sup 11}B fueled fusions are not estimated to be the next generation candidate until the innovated plasma confinement technologies come in useful to achieve the high performance plasma parameters. The fusion reactor of D-{sup 3}He fuels has merits on the smaller neutron wall loading and tritium handling. However, there are difficulties on achieving the high temperature plasma more than 100 keV. Furthermore the high beta plasma is needed to decrease synchrotron radiation loss. In addition, the efficiency of the direct energy conversion from protons coming out from fusion reaction is one of the key parameters in keeping overall power balance. Therefore, open magnetic filed lines should surround the plasma column. In this paper, we outlined the design of the commercial base reactor (ARTEMIS) of 1 GW electric output power configured by D-{sup 3}He fueled FRC (Field Reversed Configuration). The ARTEMIS needs 64 kg of {sup 3}He per a year. On the other hand, 1 million tons of {sup 3}He is estimated to be in the moon. The {sup 3}He of about 10{sup 23} kg are to exist in gaseous planets such as Jupiter and Saturn. (Y. Tanaka)

  4. Loss of lysosomal membrane protein NCU-G1 in mice results in spontaneous liver fibrosis with accumulation of lipofuscin and iron in Kupffer cells

    Directory of Open Access Journals (Sweden)

    Xiang Y. Kong

    2014-03-01

    Full Text Available Human kidney predominant protein, NCU-G1, is a highly conserved protein with an unknown biological function. Initially described as a nuclear protein, it was later shown to be a bona fide lysosomal integral membrane protein. To gain insight into the physiological function of NCU-G1, mice with no detectable expression of this gene were created using a gene-trap strategy, and Ncu-g1gt/gt mice were successfully characterized. Lysosomal disorders are mainly caused by lack of or malfunctioning of proteins in the endosomal-lysosomal pathway. The clinical symptoms vary, but often include liver dysfunction. Persistent liver damage activates fibrogenesis and, if unremedied, eventually leads to liver fibrosis/cirrhosis and death. We demonstrate that the disruption of Ncu-g1 results in spontaneous liver fibrosis in mice as the predominant phenotype. Evidence for an increased rate of hepatic cell death, oxidative stress and active fibrogenesis were detected in Ncu-g1gt/gt liver. In addition to collagen deposition, microscopic examination of liver sections revealed accumulation of autofluorescent lipofuscin and iron in Ncu-g1gt/gt Kupffer cells. Because only a few transgenic mouse models have been identified with chronic liver injury and spontaneous liver fibrosis development, we propose that the Ncu-g1gt/gt mouse could be a valuable new tool in the development of novel treatments for the attenuation of fibrosis due to chronic liver damage.

  5. Yeast Cip1 is activated by environmental stress to inhibit Cdk1-G1 cyclins via Mcm1 and Msn2/4.

    Science.gov (United States)

    Chang, Ya-Lan; Tseng, Shun-Fu; Huang, Yu-Ching; Shen, Zih-Jie; Hsu, Pang-Hung; Hsieh, Meng-Hsun; Yang, Chia-Wei; Tognetti, Silvia; Canal, Berta; Subirana, Laia; Wang, Chien-Wei; Chen, Hsiao-Tan; Lin, Chi-Ying; Posas, Francesc; Teng, Shu-Chun

    2017-07-04

    Upon environmental changes, proliferating cells delay cell cycle to prevent further damage accumulation. Yeast Cip1 is a Cdk1 and Cln2-associated protein. However, the function and regulation of Cip1 are still poorly understood. Here we report that Cip1 expression is co-regulated by the cell-cycle-mediated factor Mcm1 and the stress-mediated factors Msn2/4. Overexpression of Cip1 arrests cell cycle through inhibition of Cdk1-G1 cyclin complexes at G1 stage and the stress-activated protein kinase-dependent Cip1 T65, T69, and T73 phosphorylation may strengthen the Cip1and Cdk1-G1 cyclin interaction. Cip1 accumulation mainly targets Cdk1-Cln3 complex to prevent Whi5 phosphorylation and inhibit early G1 progression. Under osmotic stress, Cip1 expression triggers transient G1 delay which plays a functionally redundant role with another hyperosmolar activated CKI, Sic1. These findings indicate that Cip1 functions similarly to mammalian p21 as a stress-induced CDK inhibitor to decelerate cell cycle through G1 cyclins to cope with environmental stresses.A G1 cell cycle regulatory kinase Cip1 has been identified in budding yeast but how this is regulated is unclear. Here the authors identify cell cycle (Mcm1) and stress-mediated (Msn 2/4) transcription factors as regulating Cip1, causing stress induced CDK inhibition and delay in cell cycle progression.

  6. Evolutionary changes in gene expression, coding sequence and copy-number at the Cyp6g1 locus contribute to resistance to multiple insecticides in Drosophila.

    Science.gov (United States)

    Harrop, Thomas W R; Sztal, Tamar; Lumb, Christopher; Good, Robert T; Daborn, Phillip J; Batterham, Philip; Chung, Henry

    2014-01-01

    Widespread use of insecticides has led to insecticide resistance in many populations of insects. In some populations, resistance has evolved to multiple pesticides. In Drosophila melanogaster, resistance to multiple classes of insecticide is due to the overexpression of a single cytochrome P450 gene, Cyp6g1. Overexpression of Cyp6g1 appears to have evolved in parallel in Drosophila simulans, a sibling species of D. melanogaster, where it is also associated with insecticide resistance. However, it is not known whether the ability of the CYP6G1 enzyme to provide resistance to multiple insecticides evolved recently in D. melanogaster or if this function is present in all Drosophila species. Here we show that duplication of the Cyp6g1 gene occurred at least four times during the evolution of different Drosophila species, and the ability of CYP6G1 to confer resistance to multiple insecticides exists in D. melanogaster and D. simulans but not in Drosophila willistoni or Drosophila virilis. In D. virilis, which has multiple copies of Cyp6g1, one copy confers resistance to DDT and another to nitenpyram, suggesting that the divergence of protein sequence between copies subsequent to the duplication affected the activity of the enzyme. All orthologs tested conferred resistance to one or more insecticides, suggesting that CYP6G1 had the capacity to provide resistance to anthropogenic chemicals before they existed. Finally, we show that expression of Cyp6g1 in the Malpighian tubules, which contributes to DDT resistance in D. melanogaster, is specific to the D. melanogaster-D. simulans lineage. Our results suggest that a combination of gene duplication, regulatory changes and protein coding changes has taken place at the Cyp6g1 locus during evolution and this locus may play a role in providing resistance to different environmental toxins in different Drosophila species.

  7. Evolutionary changes in gene expression, coding sequence and copy-number at the Cyp6g1 locus contribute to resistance to multiple insecticides in Drosophila.

    Directory of Open Access Journals (Sweden)

    Thomas W R Harrop

    Full Text Available Widespread use of insecticides has led to insecticide resistance in many populations of insects. In some populations, resistance has evolved to multiple pesticides. In Drosophila melanogaster, resistance to multiple classes of insecticide is due to the overexpression of a single cytochrome P450 gene, Cyp6g1. Overexpression of Cyp6g1 appears to have evolved in parallel in Drosophila simulans, a sibling species of D. melanogaster, where it is also associated with insecticide resistance. However, it is not known whether the ability of the CYP6G1 enzyme to provide resistance to multiple insecticides evolved recently in D. melanogaster or if this function is present in all Drosophila species. Here we show that duplication of the Cyp6g1 gene occurred at least four times during the evolution of different Drosophila species, and the ability of CYP6G1 to confer resistance to multiple insecticides exists in D. melanogaster and D. simulans but not in Drosophila willistoni or Drosophila virilis. In D. virilis, which has multiple copies of Cyp6g1, one copy confers resistance to DDT and another to nitenpyram, suggesting that the divergence of protein sequence between copies subsequent to the duplication affected the activity of the enzyme. All orthologs tested conferred resistance to one or more insecticides, suggesting that CYP6G1 had the capacity to provide resistance to anthropogenic chemicals before they existed. Finally, we show that expression of Cyp6g1 in the Malpighian tubules, which contributes to DDT resistance in D. melanogaster, is specific to the D. melanogaster-D. simulans lineage. Our results suggest that a combination of gene duplication, regulatory changes and protein coding changes has taken place at the Cyp6g1 locus during evolution and this locus may play a role in providing resistance to different environmental toxins in different Drosophila species.

  8. The Post-periapsis Evolution of Galactic Center Source G1: The Second Case of a Resolved Tidal Interaction with a Supermassive Black Hole

    Science.gov (United States)

    Witzel, G.; Sitarski, B. N.; Ghez, A. M.; Morris, M. R.; Hees, A.; Do, T.; Lu, J. R.; Naoz, S.; Boehle, A.; Martinez, G.; Chappell, S.; Schödel, R.; Meyer, L.; Yelda, S.; Becklin, E. E.; Matthews, K.

    2017-09-01

    We present new adaptive optics (AO) imaging and spectroscopic measurements of Galactic center source G1 from W. M. Keck Observatory. Our goal is to understand its nature and relationship to G2, which is the first example of a spatially resolved object interacting with a supermassive black hole (SMBH). Both objects have been monitored with AO for the past decade (2003-2014) and are comparatively close to the black hole (a min ˜ 200-300 au) on very eccentric orbits (e G1 ˜ 0.99 e G2 ˜ 0.96). While G2 has been tracked before and during periapsis passage (T 0 ˜ 2014.2), G1 has been followed since soon after emerging from periapsis (T 0 ˜ 2001.3). Our observations of G1 double the previously reported observational time baseline, which improves its orbital parameter determinations. G1's orbital trajectory appears to be in the same plane as that of G2 but with a significantly different argument of periapsis (Δω = 21° ± 4°). This suggests that G1 is an independent object and not part of a gas stream containing G2, as has been proposed. Furthermore, we show for the first time that (1) G1 is extended in the epochs closest to periapsis along the direction of orbital motion, and (2) it becomes significantly smaller over time (450 au in 2004 to less than 170 au in 2009). Based on these observations, G1 appears to be the second example of an object tidally interacting with an SMBH. G1's existence 14 yr after periapsis, along with its compactness in epochs further from the time of periapsis, suggest that this source is stellar in nature.

  9. The Rts1 regulatory subunit of protein phosphatase 2A is required for control of G1 cyclin transcription and nutrient modulation of cell size.

    Directory of Open Access Journals (Sweden)

    Karen Artiles

    2009-11-01

    Full Text Available The key molecular event that marks entry into the cell cycle is transcription of G1 cyclins, which bind and activate cyclin-dependent kinases. In yeast cells, initiation of G1 cyclin transcription is linked to achievement of a critical cell size, which contributes to cell-size homeostasis. The critical cell size is modulated by nutrients, such that cells growing in poor nutrients are smaller than cells growing in rich nutrients. Nutrient modulation of cell size does not work through known critical regulators of G1 cyclin transcription and is therefore thought to work through a distinct pathway. Here, we report that Rts1, a highly conserved regulatory subunit of protein phosphatase 2A (PP2A, is required for normal control of G1 cyclin transcription. Loss of Rts1 caused delayed initiation of bud growth and delayed and reduced accumulation of G1 cyclins. Expression of the G1 cyclin CLN2 from an inducible promoter rescued the delayed bud growth in rts1Delta cells, indicating that Rts1 acts at the level of transcription. Moreover, loss of Rts1 caused altered regulation of Swi6, a key component of the SBF transcription factor that controls G1 cyclin transcription. Epistasis analysis revealed that Rts1 does not work solely through several known critical upstream regulators of G1 cyclin transcription. Cells lacking Rts1 failed to undergo nutrient modulation of cell size. Together, these observations demonstrate that Rts1 is a key player in pathways that link nutrient availability, cell size, and G1 cyclin transcription. Since Rts1 is highly conserved, it may function in similar pathways in vertebrates.

  10. Live imaging-based model selection reveals periodic regulation of the stochastic G1/S phase transition in vertebrate axial development.

    Directory of Open Access Journals (Sweden)

    Mayu Sugiyama

    2014-12-01

    Full Text Available In multicellular organism development, a stochastic cellular response is observed, even when a population of cells is exposed to the same environmental conditions. Retrieving the spatiotemporal regulatory mode hidden in the heterogeneous cellular behavior is a challenging task. The G1/S transition observed in cell cycle progression is a highly stochastic process. By taking advantage of a fluorescence cell cycle indicator, Fucci technology, we aimed to unveil a hidden regulatory mode of cell cycle progression in developing zebrafish. Fluorescence live imaging of Cecyil, a zebrafish line genetically expressing Fucci, demonstrated that newly formed notochordal cells from the posterior tip of the embryonic mesoderm exhibited the red (G1 fluorescence signal in the developing notochord. Prior to their initial vacuolation, these cells showed a fluorescence color switch from red to green, indicating G1/S transitions. This G1/S transition did not occur in a synchronous manner, but rather exhibited a stochastic process, since a mixed population of red and green cells was always inserted between newly formed red (G1 notochordal cells and vacuolating green cells. We termed this mixed population of notochordal cells, the G1/S transition window. We first performed quantitative analyses of live imaging data and a numerical estimation of the probability of the G1/S transition, which demonstrated the existence of a posteriorly traveling regulatory wave of the G1/S transition window. To obtain a better understanding of this regulatory mode, we constructed a mathematical model and performed a model selection by comparing the results obtained from the models with those from the experimental data. Our analyses demonstrated that the stochastic G1/S transition window in the notochord travels posteriorly in a periodic fashion, with doubled the periodicity of the neighboring paraxial mesoderm segmentation. This approach may have implications for the characterization of

  11. Heating device for nuclear reactor

    Energy Technology Data Exchange (ETDEWEB)

    Shiratori, Yoshitake; Ijima, Takashi; Katano, Yoshiaki; Saito, Masaki

    1996-05-31

    The present invention provides a control system of a heating device which elevates the temperature of a reactor from a normal temperature to an operation temperature by using a nuclear heating. Namely, the device of the present invention comprises (1) means for detecting reactor temperature, (2) means for detecting reactor power, (3) means for memorizing the corresponding relation of each value of the means (1) and means (2) as standard data when temperature is elevated at a predetermined temperature elevation rate, (4) means for calculating the power corresponding to the current temperature based on the standard data upon elevation of the reactor temperature, and (5) means for controlling the progress or retraction of the power control material of the reactor core based on the power calculated by the means (4). With such a constitution, since the current reactor power elevation rate corresponding to the coolants is controlled based on the standard data upon actual start-up of the reactor, the control for the temperature of coolants can be facilitated. (I.S.)

  12. Contributions of direct versus indirect mechanisms for regulatory dendritic cell suppression of asthmatic allergen-specific IgG1 antibody responses

    OpenAIRE

    Ma, Yanna; Dawicki, Wojciech; Zhang, Xiaobei; Gordon, John R.

    2018-01-01

    IL-10-differentiated dendritic cells (DC10) can reverse the asthma phenotype in mice, but how they suppress the asthmatic B cell response is unclear. Herein we assessed the mechanism(s) by which DC10 and DC10-induced Treg affect IgG1 production in asthma. We observed a rapid decline in lung-resident OVA-specific IgG1-secreting B cells on cessation of airway allergen challenge, and intraperitoneal DC10 therapy did not amplify that (p>0.05). It did however increase the loss of IgG1-B cells from...

  13. Mesures de contrôle en psychiatrie : impacts cliniques et juridiques de la recherche interprétative

    Directory of Open Access Journals (Sweden)

    EMMANUELLE BERNHEIM

    2009-01-01

    Full Text Available L’utilisation des mesures de contrôle (isolement et contention est une pratique très controversée en psychiatrie, tant sur les plans thérapeutique que légal. Le projet de recherche dont il est question dans cet article vise à mettre au jour l’expérience subjective des infirmières et des patients, dans un objectif d’amélioration des pratiques cliniques. La valorisation du discours des patients, à travers une posture épistémologique interprétative, se heurte aux exigences peu adaptées de comités d’éthique de la recherche habitués aux caractéristiques de la recherche positiviste. Pourtant, c’est par la mise au jour des expériences des usagers que des progrès, tant au niveau clinique que juridique, ont pu être faits dans le passé. Aujourd’hui, la recherche doit servir à redonner une place aux patients, non seulement au sein de l’hôpital, mais également au sein de la société.

  14. La thèse de Feldstein-Horioka: Ue mesure de la mobilité internationale du capital

    Directory of Open Access Journals (Sweden)

    de Sousa Andrade Alberto Joao

    2007-01-01

    Full Text Available (portugalski Nous présentons la thèse de Feldstein-Horioka (F-H sur la mobilité du capital et les développements qu’elle a suscités. Il s’agit d’une thèse qui est très ouverte à la possibilité de réfutation et dont l’histoire illustre bien la pensée méthodologique nonnaïve de Karl Popper: les discussions sur sa réfutation, en parallèle avec les tentatives de consolidation ("d’immunisation", au sens de K. Popper, ont conduit à de nouvelles lectures sur la mobilité du capital. Ces efforts de consolidation (d’ "immunization" ont conduit cette thèse à intégrer des nouvelles méthodologies économétriques et à changer partiellement son objet, en mesurant aussi la soutenabilité externe. La thèse de F-H constitue un cas exemplaire d’intégration de l’analyse théorique et d’analyse empirique.

  15. [Study of a population-wide epidemic outbreak of mumps virus G1 in Jerez de la Frontera (Spain)].

    Science.gov (United States)

    González, Pascasio Peña; Barrios, José Almenara; Morales Serna, Juan Carlos

    2012-06-01

    To characterize the mumps outbreak, assess the effectiveness of vaccines and discuss prevention and control measures. Observational cross-sectional study of cases by person, place, and time. City Jerez de la Frontera and 8 Primary Care centres. A total of 116 cases of mumps were reported throughout seven months, with the last case in June 2008. age, sex, place of study or work, symptoms start date, clinical description, complications, and genotype of virus isolation, history and vaccination compositions. Calculation of total vaccine effectiveness. Active case finding and contact studies were performed on the families, work places and leisure areas. The mean age of the cases was 16.24 years(SD 10.6). The majority (68.96%) of the cases were children at school and 31.03% arose from family and work areas. Mumps vaccine coverage rates were above 90%. The complete vaccine effectiveness (2 doses); for those under 20 years-old it was: 99.84% (95% CI=99.77 - 99.89), being lower in schools with the highest attack rate, immunised with current vaccine from Jeryl Lynn strain: 71.01% (95% CI=55.85 80.97). Two doses of this strain were used in 13.79% of the cases. Susceptible populations were vaccinated at the start of the outbreak: 11,381 doses used in schools and 93 outside schools. An outbreak of mumps virus G 1 population with high rates of mumps vaccine coverage, with areas with low vaccine effectiveness with current vaccine. Mass vaccination of population has contributed to the resolution of the outbreak. Copyright © 2011 Elsevier España, S.L. All rights reserved.

  16. Kinetic partitioning during de novo septin filament assembly creates a critical G1 "window of opportunity" for mutant septin function.

    Science.gov (United States)

    Schaefer, Rachel M; Heasley, Lydia R; Odde, David J; McMurray, Michael A

    2016-09-16

    Septin proteins form highly conserved cytoskeletal filaments composed of hetero-oligomers with strict subunit stoichiometry. Mutations within one hetero-oligomerization interface (the "G" interface) bias the mutant septin toward conformations that are incompatible with filament assembly, causing disease in humans and, in budding yeast cells, temperature-sensitive defects in cytokinesis. We previously found that, when the amount of other hetero-oligomerization partners is limiting, wild-type and G interface-mutant alleles of a given yeast septin "compete" along parallel but distinct folding pathways for occupancy of a limited number of positions within septin hetero-octamers. Here, we synthesize a mathematical model that outlines the requirements for this phenomenon: if a wild-type septin traverses a folding pathway that includes a single rate-limiting folding step, the acquisition by a mutant septin of additional slow folding steps creates an initially large disparity between wild-type and mutant in the cellular concentrations of oligomerization-competent monomers. When the 2 alleles are co-expressed, this kinetic disparity results in mutant exclusion from hetero-oligomers, even when the folded mutant monomer is oligomerization-competent. To test this model experimentally, we first visualize the kinetic delay in mutant oligomerization in living cells, and then narrow or widen the "window of opportunity" for mutant septin oligomerization by altering the length of the G1 phase of the yeast cell cycle, and observe the predicted exacerbation or suppression, respectively, of mutant cellular phenotypes. These findings reveal a fundamental kinetic principle governing in vivo assembly of multiprotein complexes, independent of the ability of the subunits to associate with each other.

  17. The use of regenerated immunoaffinity columns for aflatoxins B1, B2, G1and G2in peanut confection.

    Science.gov (United States)

    Iha, Maria Helena; Mini, Camila Alessandra; Okada, Isaura Akemi; Briganti, Rita de Cássia; Trucksess, Mary W

    2017-02-03

    The aim of this study was to investigate the feasibility of using multitime-regenerated immunoaffinity column (IAC) for aflatoxins B 1 , B 2 , G 1 and G 2 in peanut confection. After each use, the IAC was washed immediately with phosphate-buffered saline and stored for >12h prior to reuse. The evaluation procedure consisted of using extracts of naturallycontaminated peanut confection (4 replicates), aflatoxin-free peanut confection (duplicates), and aflatoxin-free peanut confection sample spiked with the 4 aflatoxins (AFT) at 3 levels in 4 replicates. Each day, 18 test extracts were analyzed using 18 designated IACs. After each use, the IACs were regenerated and reused for corresponding test extracts on the following day. This procedure was repeated daily over the course of 9days. Analytical steps included passing the test extracts through the IACs, washing the columns with water, and eluting AFT with methanol. The eluates were diluted with water and were subjected to reversed phase LC separation, post-column photochemical derivatization and fluorescence detection. After eluting AFT, IACs were immediately regenerated by washing with phosphate buffer solution and storing overnight at 8°C for re-use the following day. Results were analyzed using ANOVA and Tukey tests. The numbers of reuse varied for each AF: For AFB 1 AFB 2 , AFG 1 and AFG 2 could be reused for 9, 6, 6 and 0 times, respectively. According to AOAC method performance criteria, recoveries ranging from 70% to 125% are considered acceptable at the spiking levels used in this study. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Identification of a Selective G1-Phase Benzimidazolone Inhibitor by a Senescence-Targeted Virtual Screen Using Artificial Neural Networks.

    Science.gov (United States)

    Bilsland, Alan E; Pugliese, Angelo; Liu, Yu; Revie, John; Burns, Sharon; McCormick, Carol; Cairney, Claire J; Bower, Justin; Drysdale, Martin; Narita, Masashi; Sadaie, Mahito; Keith, W Nicol

    2015-09-01

    Cellular senescence is a barrier to tumorigenesis in normal cells, and tumor cells undergo senescence responses to genotoxic stimuli, which is a potential target phenotype for cancer therapy. However, in this setting, mixed-mode responses are common with apoptosis the dominant effect. Hence, more selective senescence inducers are required. Here we report a machine learning-based in silico screen to identify potential senescence agonists. We built profiles of differentially affected biological process networks from expression data obtained under induced telomere dysfunction conditions in colorectal cancer cells and matched these to a panel of 17 protein targets with confirmatory screening data in PubChem. We trained a neural network using 3517 compounds identified as active or inactive against these targets. The resulting classification model was used to screen a virtual library of ~2M lead-like compounds. One hundred and forty-seven virtual hits were acquired for validation in growth inhibition and senescence-associated β-galactosidase assays. Among the found hits, a benzimidazolone compound, CB-20903630, had low micromolar IC50 for growth inhibition of HCT116 cells and selectively induced senescence-associated β-galactosidase activity in the entire treated cell population without cytotoxicity or apoptosis induction. Growth suppression was mediated by G1 blockade involving increased p21 expression and suppressed cyclin B1, CDK1, and CDC25C. In addition, the compound inhibited growth of multicellular spheroids and caused severe retardation of population kinetics in long-term treatments. Preliminary structure-activity and structure clustering analyses are reported, and expression analysis of CB-20903630 against other cell cycle suppressor compounds suggested a PI3K/AKT-inhibitor-like profile in normal cells, with different pathways affected in cancer cells. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  19. Identification of a Selective G1-Phase Benzimidazolone Inhibitor by a Senescence-Targeted Virtual Screen Using Artificial Neural Networks

    Directory of Open Access Journals (Sweden)

    Alan E. Bilsland

    2015-09-01

    Full Text Available Cellular senescence is a barrier to tumorigenesis in normal cells, and tumor cells undergo senescence responses to genotoxic stimuli, which is a potential target phenotype for cancer therapy. However, in this setting, mixed-mode responses are common with apoptosis the dominant effect. Hence, more selective senescence inducers are required. Here we report a machine learning–based in silico screen to identify potential senescence agonists. We built profiles of differentially affected biological process networks from expression data obtained under induced telomere dysfunction conditions in colorectal cancer cells and matched these to a panel of 17 protein targets with confirmatory screening data in PubChem. We trained a neural network using 3517 compounds identified as active or inactive against these targets. The resulting classification model was used to screen a virtual library of ~2M lead-like compounds. One hundred and forty-seven virtual hits were acquired for validation in growth inhibition and senescence-associated β-galactosidase assays. Among the found hits, a benzimidazolone compound, CB-20903630, had low micromolar IC50 for growth inhibition of HCT116 cells and selectively induced senescence-associated β-galactosidase activity in the entire treated cell population without cytotoxicity or apoptosis induction. Growth suppression was mediated by G1 blockade involving increased p21 expression and suppressed cyclin B1, CDK1, and CDC25C. In addition, the compound inhibited growth of multicellular spheroids and caused severe retardation of population kinetics in long-term treatments. Preliminary structure-activity and structure clustering analyses are reported, and expression analysis of CB-20903630 against other cell cycle suppressor compounds suggested a PI3K/AKT-inhibitor–like profile in normal cells, with different pathways affected in cancer cells.

  20. Antimicrobial Activity of Synthesized 2-Methylthiobenzo[g][1,2,4]- triazolo[1,5-a]quinazoline Derivatives.

    Science.gov (United States)

    Al-Salahi, Rashad; Abuelizz, Hatem A; Wadi, Mahasin; El Dib, Rabab A; Alotaibi, Mshari A; Marzouk, Mohamed

    2016-01-01

    The present study was carried out to evaluate the antimicrobial activity of a synthesized 2-methylthio-benzo[g][1,2,4]triazolo[1,5- a]quinazoline series. The compounds (1-21) were tested against a variety of Gram-positive bacterial species including Bacillus subtilis (RCMB 01001 69-3), Enterococcus faecalis (RCMB 0100154-2), Staphylococcus aureus (RCMB 0100183-9), Staphylococcus epidermidis (RCMB 0100183-9) and Streptococcus pyogenes (RCMB 0100172-5). In addition, Gram-negative bacteria were also tested including Pseudomonas aeruginosa (RCMB 0100243-5), Escherichia coli (RCMB 010052-6), Proteus mirabilis (RCMB 01002 54-2), Klebsiella oxytoca (RCMB 01002 83-4) and Enterobacter cloacae (RCMB 01002 64-5). Furthermore, their activities were screened against ten types of fungi i.e. Aspergillus fumigatus (RCMB 02568), Syncephalastrum racemosum (RCMB 05922), Geotricum candidum (RCMB 05097), Candida albicans (RCMB 05036), Aspergillus niger (RCMB 02724), Cryptococcus neoformans (RCMB 05642), Candida tropicalis (RCMBA 05239), Penicillium expansum (RCMB 01924), Microsporum canis (RCMB 0834) and Trichophyton mentagrophytes (RCMB 0925). Evaluation of antimicrobial activity was performed using agar well diffusion method in comparison with ampicillin and gentamycin as antibacterial reference drugs, and amphotericin B as antifungal reference drug. The minimum inhibitory concentration (MIC) was determined using the broth double dilution technique. The MIC values of the tested compounds were reported in .g/mL in which ampicillin, gentamicin and amphotericin B were used as standard reference drugs. The obtained results revealed that compounds 3, 4, 7, 8, 9, 10, 11, 14, 17, 18, 19, 20 and 21 showed significant antimicrobial activity against six bacterial and six fungal strains. The promising compounds could be employed as useful scaffolds for building of new derivatives with more potent antimicrobial effects.

  1. PKCeta enhances cell cycle progression, the expression of G1 cyclins and p21 in MCF-7 cells.

    Science.gov (United States)

    Fima, E; Shtutman, M; Libros, P; Missel, A; Shahaf, G; Kahana, G; Livneh, E

    2001-10-11

    Protein kinase C encodes a family of enzymes implicated in cellular differentiation, growth control and tumor promotion. However, not much is known with respect to the molecular mechanisms that link protein kinase C to cell cycle control. Here we report that the expression of PKCeta in MCF-7 cells, under the control of a tetracycline-responsive inducible promoter, enhanced cell growth and affected the cell cycle at several points. The induced expression of another PKC isoform, PKCdelta, in MCF-7 cells had opposite effects and inhibited their growth. PKCeta expression activated cellular pathways in these cells that resulted in the increased expression of the G1 phase cyclins, cyclin D and cyclin E. Expression of the cyclin-dependent kinase inhibitor p21(WAF1) was also specifically elevated in PKCeta expressing cells, but its overall effects were not inhibitory. Although, the protein levels of the cyclin-dependent kinase inhibitor p27(KIP1) were not altered by the induced expression of PKCeta, the cyclin E associated Cdk2 kinase activity was in correlation with the p27(KIP1) bound to the cyclin E complex and not by p21(WAF1) binding. PKCeta expression enhanced the removal of p27(KIP1) from this complex, and its re-association with the cyclin D/Cdk4 complex. Reduced binding of p27(KIP1) to the cyclin D/Cdk4 complex at early time points of the cell cycle also enhanced the activity of this complex, while at later time points the decrease in bound p21(WAF1) correlated with its increased activity in PKCeta-expressing cells. Thus, PKCeta induces altered expression of several cell cycle functions, which may contribute to its ability to affect cell growth.

  2. Squamocin modulates histone H3 phosphorylation levels and induces G1 phase arrest and apoptosis in cancer cells

    Directory of Open Access Journals (Sweden)

    Wu Yang-Chang

    2011-02-01

    Full Text Available Abstract Background Histone modifications in tumorigenesis are increasingly recognized as important epigenetic factors leading to cancer. Increased phosphorylation levels of histone H3 as a result of aurora B and pMSK1 overexpression were observed in various tumors. We selected aurora B and MSK1 as representatives for testing various compounds and drugs, and found that squamocin, a bis-tetrahydrofuran annonaceous acetogenin, exerted a potent effect on histone H3 phosphorylation. Methods GBM8401, Huh-7, and SW620 cells were incubated with 15, 30, and 60 μM squamocin for 24 h. The expressions of mRNA and proteins were analyzed by qRT-PCR and Western blotting, respectively. The cell viability was determined by an MTT assay. Cell cycle distribution and apoptotic cells were analyzed by flow cytometry. Results Our results showed that squamocin inhibited the proliferation of GBM8401, Huh-7, and SW620 cells, arrested the cell cycle at the G1 phase, and activated both intrinsic and extrinsic pathways to apoptosis. In addition, we demonstrated that squamocin had the ability to modulate the phosphorylation levels of H3S10 (H3S10p and H3S28 (H3S28p in association with the downregulation of aurora B and pMSK1 expressions. Conclusions This study is the first to show that squamocin affects epigenetic alterations by modulating histone H3 phosphorylation at S10 and S28, providing a novel view of the antitumor mechanism of squamocin.

  3. Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

    Science.gov (United States)

    Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

    2014-03-15

    Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Methods for determining thermal stresses values. Some examples relating to nuclear reactors; Methodes de determination des contraintes thermiques. Quelques exemples d'application aux reacteurs

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, J.; Gautier, A. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires; Peres, A. [Israel Institute of Technology, Dept. of Nuclear Science Technion (Israel)

    1958-07-01

    As modern techniques develop more elaborate machines, and make their way towards higher and higher temperatures and pressures, the thermal stresses become a matter of major importance in the design of mechanical structures. In the first part of this paper, the authors examine the problem from a theoretical standpoint, and try to evaluate the aptitude and limitation of mathematical techniques to attain the quantitative values of thermal stresses. This paper deals mainly with the experimental methods to measure thermal stresses. The authors show some examples relating to nuclear reactors. (author)Fren. [French] Au fur et a mesure que la technique moderne developpe des machines plus poussees et s'oriente vers des temperatures et des pressions toujours plus elevees, les contraintes thermiques deviennent un facteur d'importance capitale dans le calcul des structures mecaniques. Les auteurs examinent d'abord l'aspect theorique du probleme, ainsi que l'aptitude et les limites du calcul pour exprimer quantitativement la valeur des contraintes thermiques. Les auteurs exposent principalement, ensuite, les methodes experimentales qui permettent de mesurer ces contraintes, et illustrent cet expose de quelques exemples relatifs aux installations nucleaires. (auteur)

  5. Random processes in nuclear reactors

    CERN Document Server

    Williams, M M R

    1974-01-01

    Random Processes in Nuclear Reactors describes the problems that a nuclear engineer may meet which involve random fluctuations and sets out in detail how they may be interpreted in terms of various models of the reactor system. Chapters set out to discuss topics on the origins of random processes and sources; the general technique to zero-power problems and bring out the basic effect of fission, and fluctuations in the lifetime of neutrons, on the measured response; the interpretation of power reactor noise; and associated problems connected with mechanical, hydraulic and thermal noise sources

  6. Nuclear reactor downcomer flow deflector

    Science.gov (United States)

    Gilmore, Charles B [Greensburg, PA; Altman, David A [Pittsburgh, PA; Singleton, Norman R [Murrysville, PA

    2011-02-15

    A nuclear reactor having a coolant flow deflector secured to a reactor core barrel in line with a coolant inlet nozzle. The flow deflector redirects incoming coolant down an annulus between the core barrel and the reactor vessel. The deflector has a main body with a front side facing the fluid inlet nozzle and a rear side facing the core barrel. The rear side of the main body has at least one protrusion secured to the core barrel so that a gap exists between the rear side of the main body adjacent the protrusion and the core barrel. Preferably, the protrusion is a relief that circumscribes the rear side of the main body.

  7. Reactor neutrons in nuclear astrophysics

    Science.gov (United States)

    Reifarth, René; Glorius, Jan; Göbel, Kathrin; Heftrich, Tanja; Jentschel, Michael; Jurado, Beatriz; Käppeler, Franz; Köster, Ulli; Langer, Christoph; Litvinov, Yuri A.; Weigand, Mario

    2017-09-01

    The huge neutron fluxes offer the possibility to use research reactors to produce isotopes of interest, which can be investigated afterwards. An example is the half-lives of long-lived isotopes like 129I. A direct usage of reactor neutrons in the astrophysical energy regime is only possible, if the corresponding ions are not at rest in the laboratory frame. The combination of an ion storage ring with a reactor and a neutron guide could open the path to direct measurements of neutron-induced cross sections on short-lived radioactive isotopes in the astrophysically interesting energy regime.

  8. Safety of VVER-440 reactors

    CERN Document Server

    Slugen, Vladimir

    2011-01-01

    Safety of VVER-440 Reactors endeavours to promote an increase in the safety of VVER-440 nuclear reactors via the improvement of fission products limitation systems and the implementation of special non-destructive spectroscopic methods for materials testing. All theoretical and experimental studies performed the by author over the last 25 years have been undertaken with the aim of improving VVER-440 defence in depth, which is one of the most important principle for ensuring safety in nuclear power plants. Safety of VVER-440 Reactors is focused on the barrier system through which the safety pri

  9. Fuel Fabrication and Nuclear Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Karpius, Peter Joseph [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-02-02

    The uranium from the enrichment plant is still in the form of UF6. UF6 is not suitable for use in a reactor due to its highly corrosive chemistry as well as its phase diagram. UF6 is converted into UO2 fuel pellets, which are in turn placed in fuel rods and assemblies. Reactor designs are variable in moderators, coolants, fuel, performance etc.The dream of energy ‘too-cheap to meter’ is no more, and now the nuclear power industry is pushing ahead with advanced reactor designs.

  10. Nuclear reactor PBMR and cogeneration; Reactor nuclear PBMR y cogeneracion

    Energy Technology Data Exchange (ETDEWEB)

    Ramirez S, J. R.; Alonso V, G., E-mail: ramon.ramirez@inin.gob.mx [ININ, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)

    2013-10-15

    In recent years the nuclear reactor designs for the electricity generation have increased their costs, so that at the moment costs are managed of around the 5000 US D for installed kw, reason for which a big nuclear plant requires of investments of the order of billions of dollars, the designed reactors as modular of low power seek to lighten the initial investment of a big reactor dividing the power in parts and dividing in modules the components to lower the production costs, this way it can begin to build a module and finished this to build other, differing the long term investment, getting less risk therefore in the investment. On the other hand the reactors of low power can be very useful in regions where is difficult to have access to the electric net being able to take advantage of the thermal energy of the reactor to feed other processes like the water desalination or the vapor generation for the processes industry like the petrochemical, or even more the possible hydrogen production to be used as fuel. In this work the possibility to generate vapor of high quality for the petrochemical industry is described using a spheres bed reactor of high temperature. (Author)

  11. FASTER test reactor preconceptual design report summary

    Energy Technology Data Exchange (ETDEWEB)

    Grandy, C. [Argonne National Lab. (ANL), Argonne, IL (United States); Belch, H. [Argonne National Lab. (ANL), Argonne, IL (United States); Brunett, A. [Argonne National Lab. (ANL), Argonne, IL (United States); Heidet, F. [Argonne National Lab. (ANL), Argonne, IL (United States); Hill, R. [Argonne National Lab. (ANL), Argonne, IL (United States); Hoffman, E. [Argonne National Lab. (ANL), Argonne, IL (United States); Jin, E. [Argonne National Lab. (ANL), Argonne, IL (United States); Mohamed, W. [Argonne National Lab. (ANL), Argonne, IL (United States); Moisseytsev, A. [Argonne National Lab. (ANL), Argonne, IL (United States); Passerini, S. [Argonne National Lab. (ANL), Argonne, IL (United States); Sienicki, J. [Argonne National Lab. (ANL), Argonne, IL (United States); Sumner, T. [Argonne National Lab. (ANL), Argonne, IL (United States); Vilim, R. [Argonne National Lab. (ANL), Argonne, IL (United States); Hayes, Steven [Argonne National Lab. (ANL), Argonne, IL (United States)

    2016-02-29

    The FASTER reactor plant is a sodium-cooled fast spectrum test reactor that provides high levels of fast and thermal neutron flux for scientific research and development. The 120MWe FASTER reactor plant has a superheated steam power conversion system which provides electrical power to a local grid allowing for recovery of operating costs for the reactor plant.

  12. FASTER Test Reactor Preconceptual Design Report

    Energy Technology Data Exchange (ETDEWEB)

    Grandy, C. [Argonne National Lab. (ANL), Argonne, IL (United States); Belch, H. [Argonne National Lab. (ANL), Argonne, IL (United States); Brunett, A. J. [Argonne National Lab. (ANL), Argonne, IL (United States); Heidet, F. [Argonne National Lab. (ANL), Argonne, IL (United States); Hill, R. [Argonne National Lab. (ANL), Argonne, IL (United States); Hoffman, E. [Argonne National Lab. (ANL), Argonne, IL (United States); Jin, E. [Argonne National Lab. (ANL), Argonne, IL (United States); Mohamed, W. [Argonne National Lab. (ANL), Argonne, IL (United States); Moisseytsev, A. [Argonne National Lab. (ANL), Argonne, IL (United States); Passerini, S. [Argonne National Lab. (ANL), Argonne, IL (United States); Sienicki, J. [Argonne National Lab. (ANL), Argonne, IL (United States); Sumner, T. [Argonne National Lab. (ANL), Argonne, IL (United States); Vilim, R. [Argonne National Lab. (ANL), Argonne, IL (United States); Hayes, S. [Argonne National Lab. (ANL), Argonne, IL (United States)

    2016-03-31

    The FASTER test reactor plant is a sodium-cooled fast spectrum test reactor that provides high levels of fast and thermal neutron flux for scientific research and development. The 120MWe FASTER reactor plant has a superheated steam power conversion system which provides electrical power to a local grid allowing for recovery of operating costs for the reactor plant.

  13. ADAPTIVE CONTROL SYSTEM OF INDUSTRIAL REACTORS

    Directory of Open Access Journals (Sweden)

    Vyacheslav K. Mayevski

    2014-01-01

    Full Text Available This paper describes a mathematical model of an industrial chemical reactor for production of synthetic rubber. During reactor operation the model parameters vary considerably. To create a control algorithm performed transformation of mathematical model of the reactor in order to obtain a dependency that can be used to determine the model parameters are changing during reactor operation.

  14. Combined effect of honokiol and rosiglitazone on cell growth inhibition through enhanced G0/G1 phase arrest in hepatoma cells

    Directory of Open Access Journals (Sweden)

    Hsiao-Chi Chen

    2016-08-01

    Conclusion: Honokiol combined with rosiglitazone showed more effective growth inhibition in hepatoma cells mediated through the regulation of G0/G1 phase-related proteins p21, cyclin D1, cyclin E1, and Rb and cell cycle progression.

  15. Locations of All Shotpoints for R/V GYRE Cruise G1-99-GM (99002) - GOM99SHTALLG.SHP

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — All shotpoint locations from multichannel seismics survey, USGS cruise G1-99-GM During June 1998 and April 1999, the U.S. Geological Survey (USGS) conducted two...

  16. Reassortant DS-1-like G1P[4] Rotavirus A strains generated from co-circulating strains in Vietnam, 2012/2013.

    Science.gov (United States)

    Agbemabiese, Chantal Ama; Nakagomi, Toyoko; Nguyen, Minh Quang; Gauchan, Punita; Nakagomi, Osamu

    2017-08-01

    One major mechanism by which Rotavirus A (RVA) evolves is genetic reassortment between strains with different genotype constellations. However, the parental strains of the reassortants generated have seldom been identified. Here, the whole genome of two suspected reassortants, RVA/Human-wt/VNM/SP127/2013/G1P[4] and RVA/Human-wt/VNM/SP193/2013/G1P[4], with short RNA electropherotypes were examined by Illumina MiSeq sequencing and their ancestral phylogenies reconstructed. Their genotype constellation, G1-P[4]-I2-R2-C2-M2-A2-N2-T2-E2-H2, indicated that they were G1 VP7 mono-reassortants possessing DS-1-like genetic backbones. The two strains were ≧99.7% identical across the genome. While their VP7 genes were ≧99.7 identical to that of a Wa-like strain RVA/Human-wt/VNM/SP110/2012/G1P[8] which co-circulated during the 2012/2013 season, 10 genes were ≧99.8% identical to that of the DS-1-like strains RVA/Human-wt/VNM/SP015/2012/G2P[4] (and SP108) that co-circulated during the season. The identities were consistent with the phylogenetic relationships observed between the genes of the reassortants and those of the afore-mentioned strains. Consequently, the G1P[4] strains appear to have been generated by genetic reassortment between SP110-like and SP015-like strains. In conclusion, this study provides robust molecular evidence for the first time that G1P[4] strains detected in Hanoi Vietnam were generated by inter-genogroup reassortment between co-circulating G1P[8] and G2P[4] strains within the same place and season. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  17. Reactor operation environmental information document

    Energy Technology Data Exchange (ETDEWEB)

    Bauer, L.R.; Hayes, D.W.; Hunter, C.H.; Marter, W.L.; Moyer, R.A.

    1989-12-01

    This volume is a reactor operation environmental information document for the Savannah River Plant. Topics include meteorology, surface hydrology, transport, environmental impacts, and radiation effects. 48 figs., 56 tabs. (KD)

  18. Reactor containment research and development

    Energy Technology Data Exchange (ETDEWEB)

    Weil, N. A.

    1963-06-15

    An outline is given of containment concepts, sources and release rates of energy, responses of containment structures, effects of projectiles, and leakage rates of radioisotopes, with particular regard to major reactor accidents. (T.F.H.)

  19. Actinide transmutation in nuclear reactors

    Energy Technology Data Exchange (ETDEWEB)

    Ganev, I.K.; Lopatkin, A.V.; Naumov, V.V.; Tocheny, L.V.

    1993-12-31

    Of some interest is the comparison between the actinide nuclide burning up (fission) rates such as americium 241, americium 242, curium 244, and neptunium 237, in the reactors with fast or thermal neutron spectra.

  20. Advanced Carbothermal Electric Reactor Project

    Data.gov (United States)

    National Aeronautics and Space Administration — ORBITEC proposes to develop the Advanced Carbothermal Electric (ACE) reactor to efficiently extract oxygen from lunar regolith. Unlike state-of-the-art carbothermal...

  1. Combustion synthesis continuous flow reactor

    Energy Technology Data Exchange (ETDEWEB)

    Maupin, G.D.; Chick, L.A.; Kurosky, R.P.

    1998-01-06

    The present invention is a reactor for combustion synthesis of inorganic powders. The reactor includes a reaction vessel having a length and a first end and a second end. The reaction vessel further has a solution inlet and a carrier gas inlet. The reactor further has a heater for heating both the solution and the carrier gas. In a preferred embodiment, the reaction vessel is heated and the solution is in contact with the heated reaction vessel. It is further preferred that the reaction vessel be cylindrical and that the carrier gas is introduced tangentially into the reaction vessel so that the solution flows helically along the interior wall of the reaction vessel. As the solution evaporates and combustion produces inorganic material powder, the carrier gas entrains the powder and carries it out of the reactor. 10 figs.

  2. Combustion synthesis continuous flow reactor

    Energy Technology Data Exchange (ETDEWEB)

    Maupin, Gary D. (Richland, WA); Chick, Lawrence A. (West Richland, WA); Kurosky, Randal P. (Maple Valley, WA)

    1998-01-01

    The present invention is a reactor for combustion synthesis of inorganic powders. The reactor includes a reaction vessel having a length and a first end and a second end. The reaction vessel further has a solution inlet and a carrier gas inlet. The reactor further has a heater for heating both the solution and the carrier gas. In a preferred embodiment, the reaction vessel is heated and the solution is in contact with the heated reaction vessel. It is further preferred that the reaction vessel be cylindrical and that the carrier gas is introduced tangentially into the reaction vessel so that the solution flows helically along the interior wall of the reaction vessel. As the solution evaporates and combustion produces inorganic material powder, the carrier gas entrains the powder and carries it out of the reactor.

  3. Advanced Carbothermal Electric Reactor Project

    Data.gov (United States)

    National Aeronautics and Space Administration — The overall objective of the Phase 1 effort was to demonstrate the technical feasibility of the Advanced Carbothermal Electric (ACE) Reactor concept. Unlike...

  4. Advanced Catalytic Hydrogenation Retrofit Reactor

    Energy Technology Data Exchange (ETDEWEB)

    Reinaldo M. Machado

    2002-08-15

    Industrial hydrogenation is often performed using a slurry catalyst in large stirred-tank reactors. These systems are inherently problematic in a number of areas, including industrial hygiene, process safety, environmental contamination, waste production, process operability and productivity. This program proposed the development of a practical replacement for the slurry catalysts using a novel fixed-bed monolith catalyst reactor, which could be retrofitted onto an existing stirred-tank reactor and would mitigate many of the minitations and problems associated with slurry catalysts. The full retrofit monolith system, consisting of a recirculation pump, gas/liquid ejector and monolith catalyst, is described as a monolith loop reactor or MLR. The MLR technology can reduce waste and increase raw material efficiency, which reduces the overall energy required to produce specialty and fine chemicals.

  5. Engineering reactors for catalytic reactions

    Indian Academy of Sciences (India)

    Chemical Engineering and Process Development Division, CSIR - National Chemical Laboratory,. Pune 411 008, India ... Abstract. Catalytic reactions are ubiquitous in chemical and allied industries. ... strategies and recent advances in process intensification/ multifunctional reactors are discussed to illustrate the approach.

  6. Jules Horowitz Reactor, basic design

    Energy Technology Data Exchange (ETDEWEB)

    Bergamaschi, Y.; Bouilloux, Y.; Chantoin, P.; Guigon, B.; Bravo, X.; Germain, C.; Rommens, M.; Tremodeux, P

    2003-07-01

    Since the shutdown of the SILOE reactor in 1997, the OSIRIS reactor has ensured the needs regarding technological irradiation at CEA including those of its industrial partners and customers. The Jules Horowitz Reactor will replace it. It has the ambition to provide the necessary nuclear data and maintain a fission research capacity in Europe after 2010. This capacity should be service-oriented. It will be established in Cadarache. The Jules Horowitz reactor will also: - represent a significant step in term of performances and experimental capabilities, - be designed with a high flexibility, in order to satisfy the current demand from European industry, research and be able to accommodate future requirements, - reach a high level of safety, according to the best current practice. This paper will present the main functionalities and the design options resulting from the 'preliminary design' studies. (authors)

  7. Aerosol concentration and size distribution measured below, in, and above cloud from the DOE G-1 during VOCALS-REx

    Science.gov (United States)

    Kleinman, L. I.; Daum, P. H.; Lee, Y.-N.; Lewis, E. R.; Sedlacek, A. J., III; Senum, G. I.; Springston, S. R.; Wang, J.; Hubbe, J.; Jayne, J.; Min, Q.; Yum, S. S.; Allen, G.

    2012-01-01

    During the VOCALS Regional Experiment, the DOE G-1 aircraft was used to sample a varying aerosol environment pertinent to properties of stratocumulus clouds over a longitude band extending 800 km west from the Chilean coast at Arica. Trace gas and aerosol measurements are presented as a function of longitude, altitude, and dew point in this study. Spatial distributions are consistent with an upper atmospheric source for O3 and South American coastal sources for marine boundary layer (MBL) CO and aerosol, most of which is acidic sulfate. Pollutant layers in the free troposphere (FT) can be a result of emissions to the north in Peru or long range transport from the west. At a given altitude in the FT (up to 3 km), dew point varies by 40 °C with dry air descending from the upper atmospheric and moist air having a boundary layer (BL) contribution. Ascent of BL air to a cold high altitude results in the condensation and precipitation removal of all but a few percent of BL water along with aerosol that served as CCN. Thus, aerosol volume decreases with dew point in the FT. Aerosol size spectra have a bimodal structure in the MBL and an intermediate diameter unimodal distribution in the FT. Comparing cloud droplet number concentration (CDNC) and pre-cloud aerosol (Dp>100 nm) gives a linear relation up to a number concentration of ~150 cm-3, followed by a less than proportional increase in CDNC at higher aerosol number concentration. A number balance between below cloud aerosol and cloud droplets indicates that ~25 % of aerosol with Dp>100 nm are interstitial (not activated). A direct comparison of pre-cloud and in-cloud aerosol yields a higher estimate. Artifacts in the measurement of interstitial aerosol due to droplet shatter and evaporation are discussed. Within each of 102 constant altitude cloud transects, CDNC and interstitial aerosol were anti-correlated. An examination of one cloud as a case study shows that the interstitial aerosol appears to have a background

  8. Solid State Reactor Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Mays, G.T.

    2004-03-10

    The Solid State Reactor (SSR) is an advanced reactor concept designed to take advantage of Oak Ridge National Laboratory's (ORNL's) recently developed graphite foam that has enhanced heat transfer characteristics and excellent high-temperature mechanical properties, to provide an inherently safe, self-regulated, source of heat for power and other potential applications. This work was funded by the U.S. Department of Energy's Nuclear Energy Research Initiative (NERI) program (Project No. 99-064) from August 1999 through September 30, 2002. The initial concept of utilizing the graphite foam as a basis for developing an advanced reactor concept envisioned that a suite of reactor configurations and power levels could be developed for several different applications. The initial focus was looking at the reactor as a heat source that was scalable, independent of any heat removal/power conversion process. These applications might include conventional power generation, isotope production and destruction (actinides), and hydrogen production. Having conducted the initial research on the graphite foam and having performed the scoping parametric analyses from neutronics and thermal-hydraulic perspectives, it was necessary to focus on a particular application that would (1) demonstrate the viability of the overall concept and (2) require a reasonably structured design analysis process that would synthesize those important parameters that influence the concept the most as part of a feasible, working reactor system. Thus, the application targeted for this concept was supplying power for remote/harsh environments and a design that was easily deployable, simplistic from an operational standpoint, and utilized the new graphite foam. Specifically, a 500-kW(t) reactor concept was pursued that is naturally load following, inherently safe, optimized via neutronic studies to achieve near-zero reactivity change with burnup, and proliferation resistant. These four major areas

  9. Gene duplication and co-evolution of G1/S transcription factor specificity in fungi are essential for optimizing cell fitness

    Science.gov (United States)

    Kishkevich, Anastasiya; Abu-Qarn, Mehtap; Klier, Steffi; de Bruin, Robertus A. M.; Aharoni, Amir

    2017-01-01

    Transcriptional regulatory networks play a central role in optimizing cell survival. How DNA binding domains and cis-regulatory DNA binding sequences have co-evolved to allow the expansion of transcriptional networks and how this contributes to cellular fitness remains unclear. Here we experimentally explore how the complex G1/S transcriptional network evolved in the budding yeast Saccharomyces cerevisiae by examining different chimeric transcription factor (TF) complexes. Over 200 G1/S genes are regulated by either one of the two TF complexes, SBF and MBF, which bind to specific DNA binding sequences, SCB and MCB, respectively. The difference in size and complexity of the G1/S transcriptional network across yeast species makes it well suited to investigate how TF paralogs (SBF and MBF) and DNA binding sequences (SCB and MCB) co-evolved after gene duplication to rewire and expand the network of G1/S target genes. Our data suggests that whilst SBF is the likely ancestral regulatory complex, the ancestral DNA binding element is more MCB-like. G1/S network expansion took place by both cis- and trans- co-evolutionary changes in closely related but distinct regulatory sequences. Replacement of the endogenous SBF DNA-binding domain (DBD) with that from more distantly related fungi leads to a contraction of the SBF-regulated G1/S network in budding yeast, which also correlates with increased defects in cell growth, cell size, and proliferation. PMID:28505153

  10. Gene duplication and co-evolution of G1/S transcription factor specificity in fungi are essential for optimizing cell fitness.

    Directory of Open Access Journals (Sweden)

    Adi Hendler

    2017-05-01

    Full Text Available Transcriptional regulatory networks play a central role in optimizing cell survival. How DNA binding domains and cis-regulatory DNA binding sequences have co-evolved to allow the expansion of transcriptional networks and how this contributes to cellular fitness remains unclear. Here we experimentally explore how the complex G1/S transcriptional network evolved in the budding yeast Saccharomyces cerevisiae by examining different chimeric transcription factor (TF complexes. Over 200 G1/S genes are regulated by either one of the two TF complexes, SBF and MBF, which bind to specific DNA binding sequences, SCB and MCB, respectively. The difference in size and complexity of the G1/S transcriptional network across yeast species makes it well suited to investigate how TF paralogs (SBF and MBF and DNA binding sequences (SCB and MCB co-evolved after gene duplication to rewire and expand the network of G1/S target genes. Our data suggests that whilst SBF is the likely ancestral regulatory complex, the ancestral DNA binding element is more MCB-like. G1/S network expansion took place by both cis- and trans- co-evolutionary changes in closely related but distinct regulatory sequences. Replacement of the endogenous SBF DNA-binding domain (DBD with that from more distantly related fungi leads to a contraction of the SBF-regulated G1/S network in budding yeast, which also correlates with increased defects in cell growth, cell size, and proliferation.

  11. Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains

    Directory of Open Access Journals (Sweden)

    Espinola Emilio E

    2006-05-01

    Full Text Available Abstract In recent years it was reported that the accumulation of point mutations in VP4 and VP7 genes of rotavirus strains was the main cause of the failure of the G or P-typing. Failures in the correct genotyping of G1, G2, G8, G9 and G10 rotavirus strains were reported in the most commonly used reverse transcription (RT-PCR strategies. Collecting VP7 gene sequences of G1 rotavirus strains from databases we found that 74 (61.2 % out of 121 G1 strains from lineage I showed the four specific mismatches at the 5' end of the 9T1-1 primer, previously associated with the failure of G1-typing. Thus, a great percentage of the G1 strains from lineage I worldwide reported could not have been typed if the Das's RT-PCR strategy were used. This analysis shows that the failure on the detection of the G1 strains could be due to the diversification of rotavirus strains in phylogenetic lineages. Therefore, the use of different RT-PCR strategies with different primer binding locations on the VP7 gene or new typing methodologies -like microarrays procedures- could be a better option to avoid the failure of the G-typing of rotavirus strains detected during surveillance programs.

  12. Microchannel Reactors for ISRU Applications

    Science.gov (United States)

    Carranza, Susana; Makel, Darby B.; Blizman, Brandon; Ward, Benjamin J.

    2005-02-01

    Affordable planning and execution of prolonged manned space missions depend upon the utilization of local resources and the waste products which are formed in manned spacecraft and surface bases. Successful in-situ resources utilization (ISRU) will require component technologies which provide optimal size, weight, volume, and power efficiency. Microchannel reactors enable the efficient chemical processing of in situ resources. The reactors can be designed for the processes that generate the most benefit for each mission. For instance, propellants (methane) can be produced from carbon dioxide from the Mars atmosphere using the Sabatier reaction and ethylene can be produced from the partial oxidation of methane. A system that synthesizes ethylene could be the precursor for systems to synthesize ethanol and polyethylene. Ethanol can be used as a nutrient for Astrobiology experiments, as well as the production of nutrients for human crew (e.g. sugars). Polyethylene can be used in the construction of habitats, tools, and replacement parts. This paper will present recent developments in miniature chemical reactors using advanced Micro Electro Mechanical Systems (MEMS) and microchannel technology to support ISRU of Mars and lunar missions. Among other applications, the technology has been demonstrated for the Sabatier process and for the partial oxidation of methane. Microchannel reactors were developed based on ceramic substrates as well as metal substrates. In both types of reactors, multiple layers coated with catalytic material are bonded, forming a monolithic structure. Such reactors are readily scalable with the incorporation of extra layers. In addition, this reactor structure minimizes pressure drop and catalyst settling, which are common problems in conventional packed bed reactors.

  13. Reactor antineutrinos and nuclear physics

    Energy Technology Data Exchange (ETDEWEB)

    Balantekin, A.B. [University of Wisconsin, Department of Physics, Madison, WI (United States)

    2016-11-15

    Short-baseline reactor neutrino experiments successfully measured the neutrino parameters they set out to measure, but they also identified a shape distortion in the 5-7 MeV range as well as a reduction from the predicted value of the flux. Nuclear physics input into the calculations of reactor antineutrino spectra needs to be better refined if this anomaly is to be interpreted as due to sterile neutrino states. (orig.)

  14. Calculation of reactor antineutrino spectra in TEXONO

    CERN Document Server

    Chen Dong Liang; Mao Ze Pu; Wong, T H

    2002-01-01

    In the low energy reactor antineutrino physics experiments, either for the researches of antineutrino oscillation and antineutrino reactions, or for the measurement of abnormal magnetic moment of antineutrino, the flux and the spectra of reactor antineutrino must be described accurately. The method of calculation of reactor antineutrino spectra was discussed in detail. Furthermore, based on the actual circumstances of NP2 reactors and the arrangement of detectors, the flux and the spectra of reactor antineutrino in TEXONO were worked out

  15. Propellant actuated nuclear reactor steam depressurization valve

    Science.gov (United States)

    Ehrke, Alan C.; Knepp, John B.; Skoda, George I.

    1992-01-01

    A nuclear fission reactor combined with a propellant actuated depressurization and/or water injection valve is disclosed. The depressurization valve releases pressure from a water cooled, steam producing nuclear reactor when required to insure the safety of the reactor. Depressurization of the reactor pressure vessel enables gravity feeding of supplementary coolant water through the water injection valve to the reactor pressure vessel to prevent damage to the fuel core.

  16. Reactor Simulator Testing Overview

    Science.gov (United States)

    Schoenfeld, Michael P.

    2013-01-01

    Test Objectives Summary: a) Verify operation of the core simulator, the instrumentation & control system, and the ground support gas and vacuum test equipment. b) Examine cooling & heat regeneration performance of the cold trap purification. c) Test the ALIP pump at voltages beyond 120V to see if the targeted mass flow rate of 1.75 kg/s can be obtained in the RxSim. Testing Highlights: a) Gas and vacuum ground support test equipment performed effectively for operations (NaK fill, loop pressurization, and NaK drain). b) Instrumentation & Control system effectively controlled loop temperature and flow rates or pump voltage to targeted settings and ramped within prescribed constraints. It effectively interacted with reactor simulator control model and defaulted back to temperature control mode if the transient fluctuations didn't dampen. c) Cold trap design was able to obtain the targeted cold temperature of 480 K. An outlet temperature of 636 K was obtained which was lower than the predicted 750 K but 156 K higher than the minimum temperature indicating the design provided some heat regeneration. d) ALIP produce a maximum flow rate of 1.53 kg/s at 800 K when operated at 150 V and 53 Hz.

  17. Reactor Simulator Testing

    Science.gov (United States)

    Schoenfeld, Michael P.; Webster, Kenny L.; Pearson, Boise J.

    2013-01-01

    As part of the Nuclear Systems Office Fission Surface Power Technology Demonstration Unit (TDU) project, a reactor simulator test loop (RxSim) was design & built to perform integrated testing of the TDU components. In particular, the objectives of RxSim testing was to verify the operation of the core simulator, the instrumentation and control system, and the ground support gas and vacuum test equipment. In addition, it was decided to include a thermal test of a cold trap purification design and a pump performance test at pump voltages up to 150 V since the targeted mass flow rate of 1.75 kg/s was not obtained in the RxSim at the originally constrained voltage of 120 V. This paper summarizes RxSim testing. The gas and vacuum ground support test equipment performed effectively in NaK fill, loop pressurization, and NaK drain operations. The instrumentation and control system effectively controlled loop temperature and flow rates or pump voltage to targeted settings. The cold trap design was able to obtain the targeted cold temperature of 480 K. An outlet temperature of 636 K was obtained which was lower than the predicted 750 K but 156 K higher than the cold temperature indicating the design provided some heat regeneration. The annular linear induction pump (ALIP) tested was able to produce a maximum flow rate of 1.53 kg/s at 800 K when operated at 150 V and 53 Hz.

  18. Novel Catalytic Membrane Reactors

    Energy Technology Data Exchange (ETDEWEB)

    Stuart Nemser, PhD

    2010-10-01

    There are many industrial catalytic organic reversible reactions with amines or alcohols that have water as one of the products. Many of these reactions are homogeneously catalyzed. In all cases removal of water facilitates the reaction and produces more of the desired chemical product. By shifting the reaction to right we produce more chemical product with little or no additional capital investment. Many of these reactions can also relate to bioprocesses. Given the large number of water-organic compound separations achievable and the ability of the Compact Membrane Systems, Inc. (CMS) perfluoro membranes to withstand these harsh operating conditions, this is an ideal demonstration system for the water-of-reaction removal using a membrane reactor. Enhanced reaction synthesis is consistent with the DOE objective to lower the energy intensity of U.S. industry 25% by 2017 in accord with the Energy Policy Act of 2005 and to improve the United States manufacturing competitiveness. The objective of this program is to develop the platform technology for enhancing homogeneous catalytic chemical syntheses.

  19. REACTOR CONTROL MECHANISM

    Science.gov (United States)

    Lane, J.A.; Engberg, R.E.; Welch, J.M.

    1959-05-12

    A quick-releasing mechanism is described which may be used to rapidiy drop a device supported from beneath during normal use, such as a safety rod in a nuclear reactor. In accordance with this invention an electrical control signal, such as may be provided by radiation detection or other alarm condition sensing devices, is delivered to an electromagnetic solenoid, the armature of which is coupled to an actuating mechanism. The solenoid is energized when the mechanism is in its upper or cocked position. In such position, the mechanism engages a plurality of retaining balls, forcing them outward into engagement with a shoulder or recess in a corresponding section of a tubular extension on the upheld device. When the control signal to the solenoid suddenly ceases, the armature drops out, allowing the actuating mechanism to move slightly but rapidly under the force of a compressed spring. The weight of the device will urge the balls inward against a beveled portion of the actuating mechanism and away from the engaging section on the tubular extension, thus allowing the upheld device to fall freely under the influence of gravity.

  20. IgG1 as a potential biomarker of post-chemotherapeutic relapse in visceral leishmaniasis, and adaptation to a rapid diagnostic test.

    Directory of Open Access Journals (Sweden)

    Tapan Bhattacharyya

    2014-10-01

    Full Text Available BACKGROUND: Visceral leishmaniasis (VL, caused by protozoa of the Leishmania donovani complex, is a widespread parasitic disease of great public health importance; without effective chemotherapy symptomatic VL is usually fatal. Distinction of asymptomatic carriage from progressive disease and the prediction of relapse following treatment are hampered by the lack of prognostic biomarkers for use at point of care. METHODOLOGY/PRINCIPAL FINDINGS: All IgG subclass and IgG isotype antibody levels were determined using unpaired serum samples from Indian and Sudanese patients with differing clinical status of VL, which included pre-treatment active VL, post-treatment cured, post-treatment relapsed, and post kala-azar dermal leishmaniasis (PKDL, as well as seropositive (DAT and/or rK39 endemic healthy controls (EHCs and seronegative EHCs. L. donovani antigen-specific IgG1 levels were significantly elevated in relapsed versus cured VL patients (p<0.0001. Using paired Indian VL sera, consistent with the known IgG1 half-life, IgG1 levels had not decreased significantly at day 30 after the start of treatment (p = 0.8304, but were dramatically decreased by 6 months compared to day 0 (p = 0.0032 or day 15 (p<0.0001 after start of treatment. Similarly, Sudanese sera taken soon after treatment did not show a significant change in the IgG1 levels (p = 0.3939. Two prototype lateral flow immunochromatographic rapid diagnostic tests (RDTs were developed to detect IgG1 levels following VL treatment: more than 80% of the relapsed VL patients were IgG1 positive; at least 80% of the cured VL patients were IgG1 negative (p<0.0001. CONCLUSIONS/SIGNIFICANCE: Six months after treatment of active VL, elevated levels of specific IgG1 were associated with treatment failure and relapse, whereas no IgG1 or low levels were detected in cured VL patients. A lateral flow RDT was successfully developed to detect anti-Leishmania IgG1 as a potential biomarker of post

  1. IgG1 antiendomysium and IgG antitissue transglutaminase (anti-tTG) antibodies in coeliac patients with selective IgA deficiency

    Science.gov (United States)

    Cataldo, F; Lio, D; Marino, V; Picarelli, A; Ventura, A; Corazza, G; a SIGEP

    2000-01-01

    BACKGROUND—In selective IgA deficiency (IgAD), there is no reliable screening test for coeliac disease (CD).
AIM—To evaluate the usefulness of IgG1 antiendomysium and IgG antitissue transglutaminase tests for CD diagnosis in IgAD.
METHODS—IgA and IgG antigliadin antibodies (IgA- and IgG-AGA), IgA and IgG1 antiendomysium antibodies (IgA- and IgG1-EMA), and IgA and IgG antitissue transglutaminase (IgA- and IgG-anti-tTG) were assayed in: (a) 20 untreated IgAD/CD patients; (b) 34 IgAD/CD patients on a strict gluten free diet (GFD); (c) 10 IgAD/CD patients not on a strict GFD; (d) 11 untreated CD patients without IgAD; (e) 10 healthy IgAD patients; and (f) 25 healthy controls.
RESULTS—In all untreated IgAD/CD patients, IgG1-EMA, IgG-anti-tTG, and IgG-AGA were positive whereas IgA antibodies against these antigens were negative. IgAD/CD patients on a strict GFD did not produce IgG-AGA or IgG1-EMA but four of 34 produced IgG anti-tTG. IgAD/CD subjects not on a strict GFD produced IgG-AGA whereas 5/10 and 4/10 were IgG1- EMA and IgG-anti-tTG negative, respectively. Untreated CD patients without IgAD were AGA (IgA and IgG), EMA (IgA and IgG1), and anti-tTG (IgA and IgG) positive. Healthy controls were AGA and EMA negative whereas two of 10 apparently healthy IgAD subjects and one of 25 healthy negative control were IgG-anti-tTG positive.
CONCLUSIONS—Both IgG1-EMA and IgG-anti-tTG tests appear to be useful for identification of IgAD/CD patients whereas they are less satisfactory for monitoring dietary compliance in these subjects. In addition, our findings seem to suggest that IgG-EMA autoantibodies produced by coeliac patients are mainly of the IgG1 subtype.


Keywords: IgG1 antiendomysium antibodies; IgG antitissue transglutaminase antibodies; selective IgA deficiency; coeliac disease PMID:10940273

  2. 78 FR 71675 - Update of the Office of Nuclear Reactor Regulation's Electronic Operating Reactor Correspondence

    Science.gov (United States)

    2013-11-29

    ... From the Federal Register Online via the Government Publishing Office NUCLEAR REGULATORY COMMISSION Update of the Office of Nuclear Reactor Regulation's Electronic Operating Reactor Correspondence... Regulatory Commission. Michele G. Evans, Director, Division of Operating Reactor Licensing, Office of Nuclear...

  3. Comparison of Antigenic Dominants of VP7 in G9 and G1 Rotavirus Strains Circulating in La Rioja, Argentina, with the Vaccine Strains.

    Science.gov (United States)

    Cuffia, Valeria I; Díaz Ariza, María Del Carmen; Silvera, Alejandro; Sabini, Liliana I; Cordoba, Patricia A

    2016-01-01

    A massive vaccination in Argentina was implemented recently. The antigenic dominants of VP7 in G9 and G1 rotavirus strains, circulating in La Rioja, Argentina with strain vaccines were compared. From 2000 to 2010 in several attention centers of La Rioja, at northwestern Argentina, 418 stool samples from children younger than 5 years old were collected. Ninety were positive by immunochromatography and 51 were genotyped by reverse transcriptase-polymerase chain reaction followed by nested-multiplex polymerase chain reaction (PCR) with type-specific primers. Six G9 strains and four G1 strains were sequenced by MACROGEN Korea. The phylogenetic analysis was conducted in MEGA 6.0. The 940 bp were aligned using CLUSTALW and the tree was inferred using the UPGMA method. The antigenic dominants of VP7, 7-1a, 7-1b, and 7-2 were studied using BioEdit, 7.2.5. In the comparison between G9-lineage III d rotavirus (RV) strains circulating in La Rioja with ROTAVAC vaccine strain, three differences were detected corresponding to 100, 211, and 145 positions. In the comparison between G1-Lineage 1 strains and G1 Rotarix and G1 RotaTeq, three differences were observed in 94, 123, and 217 positions. All these positions were important for the escape to neutralization for study with monoclonal antibody. In conclusion, the differences between the G1 strains in La Rioja, Argentina and the G1 components of the RotaTeq and Rotarix vaccine strains are few, but important for the escape immunologic, and need to be monitored for appropriate evaluation of long-term impact of vaccine used in Argentina. Nevertheless, the VP7 antigenic regions of G9 RV strains circulating in La Rioja and ROTAVAC vaccine strains are different to other zones of Argentina and could play an important role in the failure of vaccine response in these regions and Argentina.

  4. Comparative analysis of the Rotarix™ vaccine strain and G1P[8] rotaviruses detected before and after vaccine introduction in Belgium

    Directory of Open Access Journals (Sweden)

    Mark Zeller

    2017-01-01

    Full Text Available G1P[8] rotaviruses are responsible for the majority of human rotavirus infections worldwide. The effect of universal mass vaccination with rotavirus vaccines on circulating G1P[8] rotaviruses is still poorly understood. Therefore we analyzed the complete genomes of the Rotarix™ vaccine strain, and 70 G1P[8] rotaviruses, detected between 1999 and 2010 in Belgium (36 before and 34 after vaccine introduction to investigate the impact of rotavirus vaccine introduction on circulating G1P[8] strains. All rotaviruses possessed a complete Wa-like genotype constellation, but frequent intra-genogroup reassortments were observed as well as multiple different cluster constellations circulating in a single season. In addition, identical cluster constellations were found to circulate persistently over multiple seasons. The Rotarix™ vaccine strain possessed a unique cluster constellation that was not present in currently circulating G1P[8] strains. At the nucleotide level, the VP6, VP2 and NSP2 gene segments of Rotarix™ were relatively distantly related to any Belgian G1P[8] strain, but other gene segments of Rotarix™ were found in clusters also containing circulating Belgian strains. At the amino acid level, the genetic distance between Rotarix™ and circulating Belgian strains was considerably lower, except for NSP1. When we compared the Belgian G1P[8] strains collected before and after vaccine introduction a reduction in the proportion of strains that were found in the same cluster as the Rotarix™ vaccine strain was observed for most gene segments. The reduction in the proportion of strains belonging to the same cluster may be the result of the vaccine introduction, although natural fluctuations cannot be ruled out.

  5. Double-negative feedback between S-phase cyclin-CDK and CKI generates abruptness in the G1/S switch

    Directory of Open Access Journals (Sweden)

    Rainis eVenta

    2012-12-01

    Full Text Available The G1/S transition is a crucial decision point in the cell cycle. At G1/S, there is an abrupt switch from a state of high CDK inhibitor (CKI levels and low S-phase CDK activity to a state of high S-phase CDK activity and degraded CKI. In budding yeast, this transition is triggered by phosphorylation of the Cdk1 inhibitor Sic1 at multiple sites by G1-phase CDK (Cln1,2-Cdk1 and S-phase CDK (Clb5,6-Cdk1 complexes. Using mathematical modeling we demonstrate that the mechanistic basis for the abruptness and irreversibility of the G1/S transition is the highly specific phosphorylation of Sic1 by S-phase CDK complex. This switch is generated by a double negative feedback loop in which S-CDK1 phosphorylates Sic1, thus targeting it for destruction, and thereby liberating further S-CDK1 from the inhibitory Sic1-S-CDK1 complex. Our model predicts that the abruptness of the switch depends upon a strong binding affinity within the Sic1-S-CDK inhibitory complex. In vitro phosphorylation analysis using purified yeast proteins revealed that free Clb5-Cdk1 can create positive feedback by phosphorylating Sic1 that is bound in the inhibitory complex, and that Sic1 inhibits Clb5-Cdk1 with a sub-nanomolar inhibition constant. Our model also predicts that if the G1-phase CDK complex is too efficient at targeting Sic1 for destruction, then G1/S becomes a smooth and readily reversible transition. We propose that the optimal role for the G1-phase CDK in the switch would not be to act as a kinase activity directly responsible for abrupt degradation of CKI, but rather to act as a priming signal that initiates a positive feedback loop driven by emerging free S-phase CDK.

  6. Comparative analysis of the Rotarix™ vaccine strain and G1P[8] rotaviruses detected before and after vaccine introduction in Belgium.

    Science.gov (United States)

    Zeller, Mark; Heylen, Elisabeth; Tamim, Sana; McAllen, John K; Kirkness, Ewen F; Akopov, Asmik; De Coster, Sarah; Van Ranst, Marc; Matthijnssens, Jelle

    2017-01-01

    G1P[8] rotaviruses are responsible for the majority of human rotavirus infections worldwide. The effect of universal mass vaccination with rotavirus vaccines on circulating G1P[8] rotaviruses is still poorly understood. Therefore we analyzed the complete genomes of the Rotarix™ vaccine strain, and 70 G1P[8] rotaviruses, detected between 1999 and 2010 in Belgium (36 before and 34 after vaccine introduction) to investigate the impact of rotavirus vaccine introduction on circulating G1P[8] strains. All rotaviruses possessed a complete Wa-like genotype constellation, but frequent intra-genogroup reassortments were observed as well as multiple different cluster constellations circulating in a single season. In addition, identical cluster constellations were found to circulate persistently over multiple seasons. The Rotarix™ vaccine strain possessed a unique cluster constellation that was not present in currently circulating G1P[8] strains. At the nucleotide level, the VP6, VP2 and NSP2 gene segments of Rotarix™ were relatively distantly related to any Belgian G1P[8] strain, but other gene segments of Rotarix™ were found in clusters also containing circulating Belgian strains. At the amino acid level, the genetic distance between Rotarix™ and circulating Belgian strains was considerably lower, except for NSP1. When we compared the Belgian G1P[8] strains collected before and after vaccine introduction a reduction in the proportion of strains that were found in the same cluster as the Rotarix™ vaccine strain was observed for most gene segments. The reduction in the proportion of strains belonging to the same cluster may be the result of the vaccine introduction, although natural fluctuations cannot be ruled out.

  7. Repairing liner of the reactor; Reparacion del liner del reactor

    Energy Technology Data Exchange (ETDEWEB)

    Aguilar H, F. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico)

    2001-07-15

    Due to the corrosion problems of the aluminum coating of the reactor pool, a periodic inspections program by ultrasound to evaluate the advance grade and the corrosion speed was settled down. This inspections have shown the necessity to repair some areas, in those that the slimming is significant, of not making it can arrive to the water escape of the reactor pool. The objective of the repair is to place patches of plates of 1/4 inch aluminum thickness in the areas of the reactor 'liner', in those that it has been detected by ultrasound a smaller thickness or similar to 3 mm. To carry out this the fuels are move (of the core and those that are decaying) to a temporary storage, the structure of the core is confined in a tank that this placed inside the pool of the reactor, a shield is placed in the thermal column and it is completely extracted the water for to leave uncover the 'liner' of the reactor. (Author)

  8. SPRAY CALCINATION REACTOR

    Science.gov (United States)

    Johnson, B.M.

    1963-08-20

    A spray calcination reactor for calcining reprocessin- g waste solutions is described. Coaxial within the outer shell of the reactor is a shorter inner shell having heated walls and with open regions above and below. When the solution is sprayed into the irner shell droplets are entrained by a current of gas that moves downwardly within the inner shell and upwardly between it and the outer shell, and while thus being circulated the droplets are calcined to solids, whlch drop to the bottom without being deposited on the walls. (AEC) H03 H0233412 The average molecular weights of four diallyl phthalate polymer samples extruded from the experimental rheometer were redetermined using the vapor phase osmometer. An amine curing agent is required for obtaining suitable silver- filled epoxy-bonded conductive adhesives. When the curing agent was modified with a 47% polyurethane resin, its effectiveness was hampered. Neither silver nor nickel filler impart a high electrical conductivity to Adiprenebased adhesives. Silver filler was found to perform well in Dow-Corning A-4000 adhesive. Two cascaded hot-wire columns are being used to remove heavy gaseous impurities from methane. This purified gas is being enriched in the concentric tube unit to approximately 20% carbon-13. Studies to count low-level krypton-85 in xenon are continuing. The parameters of the counting technique are being determined. The bismuth isotopes produced in bismuth irradiated for polonium production are being determined. Preliminary data indicate the presence of bismuth207 and bismuth-210m. The light bismuth isotopes are probably produced by (n,xn) reactions bismuth-209. The separation of uranium-234 from plutonium-238 solutions was demonstrated. The bulk of the plutonium is removed by anion exchange, and the remainder is extracted from the uranium by solvent extraction techniques. About 99% of the plutonium can be removed in each thenoyltrifluoroacetone extraction. The viscosity, liquid density, and

  9. Absolute measurement of {beta} activities and application to the determination of neutronic densities; Mesure absolue d'activites {beta} et application a la determination des densites neutronique

    Energy Technology Data Exchange (ETDEWEB)

    Cohen, R. [Commissariat a l' Energie Atomique, Lab. du Fort de Chatillon, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires

    1951-01-15

    M. Berthelot, to my entrance to the ''Commissariat a l 'Energie Atomique'', proposed me to study the absolute measurement of neutron densities. Very quickly the problem of the absolute activity of {beta} sources became the central object of this work. In a first part, we will develop the methods of absolute determination for {beta} activities. The use of a 4{pi} counter permits to get the absolute activity of all beta radioactive source, susceptible to be put as thin leaf and of period superior than some minutes. The method is independent of the spectra of the measured radioelement. we will describe in the second part some applications which use neutron densities measurement, neutron sources intensities and ratio of cross sections of capture of thermal neutrons. (M.B.) [French] M. Berthelot, a mon entree au ''Commissariat a l 'Energie Atomique'', m'a propose d'etudier la mesure absolue des densites neutroniques. Tres rapidement le probleme de l'activite absolue des sources beta est devenu l'objet central de ce travail. Dans une premiere partie, on abordera les methodes de determination absolue des activites beta. L'utilisation d'un compteur 4{pi} permet d 'obtenir l'activite absolue de toute source radioactive beta, susceptible d'etre mise sous forme de feuille mince et de periode superieure a quelques minutes. La methode est independante du spectre du radioelement mesure. On decrira dans la seconde partie quelques applications a des mesures de densites neutroniques, d'intensites de sources de neutrons et de rapport de sections efficaces de capture de neutrons thermiques. (M.B.)

  10. High speed pulsed magnetic fields measurements, using the Faraday effect; Mesures de champs magnetiques pulses rapides a l'aide de l'effet Faraday

    Energy Technology Data Exchange (ETDEWEB)

    Dillet, A. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1964-12-01

    For these measures, the information used is the light polarization plane rotation induced by the magnetic field in a glass probe. This rotation is detected using a polarizer-analyzer couple. The detector is a photomultiplier used with high-current and pulsed light. In a distributed magnet (gap: 6 x 3 x 3 cm) magnetic fields to measure are 300 gauss, lasting 0.1 {mu}s, with rise times {<=} 35 ns, repetition rate: 1/s. An oscilloscope is used to view the magnetic field from the P.M. plate signal. The value of the field is computed from a previous static calibration. Magnetic fields from 50 to 2000 gauss (with the probe now used) can be measured to about 20 gauss {+-} 5 per cent, with a frequency range of 30 MHz. (author) [French] Pour faire de telles mesures, on utilise comme information la rotation du plan de polarisation de la lumiere provoquee par le champ magnetique dans une sonde en verre. On detecte cette rotation au moyen d'un polariseur et d'un analyseur, qui sont regles a 45 deg. pour conserver un phenomene lineaire. Le detecteur est un photomultiplicateur travaillant en fort courant en lumiere pulsee. Dans un aimant distribue d'entrefer 6 x 3 x 3 cm, on obtient des champs magnetiques a mesurer de 300 gauss, durant 0.1 {mu}s, avec des temps de montee {<=} 35 ns; au taux de 1 fois par seconde. L'observation du champ se fait sur oscilloscope a partir du signal de plaque du P.M. La valeur absolue du champ est obtenue au moyen d'un etalonnage statique prealable. On peut ainsi mesurer a 20 gauss et {+-} 5 pour cent pres environ des champs magnetiques de 50 a 2000 gauss (avec la sonde actuelle) et avec une bande passante de 30 MHz. (auteur)

  11. Effects of N-Glycan Composition on Structure and Dynamics of IgG1 Fc and Their Implications for Antibody Engineering.

    Science.gov (United States)

    Lee, Hui Sun; Im, Wonpil

    2017-10-04

    Immunoglobulin G1 (IgG1), a subclass of human serum antibodies, is the most widely used scaffold for developing monoclonal antibodies to treat human diseases. The composition of asparagine(N)297-linked glycans can modulate the binding affinity of IgG1 Fc to Fc γ receptors, but it is unclear how the structural modifications of N-glycan termini, which are distal from the binding interface, contribute to the affinity. Through atomistic molecular dynamics simulations of a series of sequentially truncated high-mannose IgG1 Fc glycoforms, we found that the C'E loop and the Cγ2-Cγ3 orientation are highly dynamic, and changes in N-glycan composition alter their conformational ensembles. High-mannose glycoform preferentially samples conformations that are more competent to FcγRIIIa binding, compared to the truncated glycoforms, suggesting a role of IgG1 Fc N-glycan in optimizing the interface with the Fc receptor for efficient binding. The trajectory analyses also reveal that the N-glycan has large amplitude motions and the carbohydrate moiety interconverts between Fc-bound and unbound forms, enabling enzymatic modification of the glycan termini.

  12. Nerve growth factor-induced accumulation of PC12 cells expressing cyclin D1: evidence for a G1 phase block.

    Science.gov (United States)

    van Grunsven, L A; Thomas, A; Urdiales, J L; Machenaud, S; Choler, P; Durand, I; Rudkin, B B

    1996-02-15

    The anti-proliferative effect of nerve growth factor (NGF) on the rat pheochromocytoma cell line PC12 has been previously shown to be accompanied by the accumulation of cells in either the G1 phase with a 2c DNA content, or with a 4c DNA content characteristic for G2/M, as evidenced by flow cytometric analysis of DNA distribution using propidium iodide. Herein, these apparently conflicting results are clarified. The present studies indicate that a simple DNA distribution profile obtained by this technique can confound interpretation of the biological effects of NGF on cell-cycle distribution due to the presence of tetraploid cells. Using cyclin D1 and incorporation of bromodeoxyuridine as markers of respectively, G1 and S phase, we show that PC12 cultures can have a considerable amount of tetraploid cells which, when in the G1 phase, have a 4c DNA content and express cyclin D1. During exposure to NGF, this population increases, reflecting the accumulation of cells in the G1 phase of the cell cycle. The data presented, support the possibility that events affecting the expression or action of G1 regulatory proteins may be involved in the molecular mechanism of the anti-mitogenic effect of NGF.

  13. Domain-specific free thiol variant characterization of an IgG1 by reversed-phase high-performance liquid chromatography mass spectrometry.

    Science.gov (United States)

    Cheng, Ying; Chen, Matthew T; Patterson, Lisa C; Yu, X Christopher; Zhang, Yonghua Taylor; Burgess, Braydon L; Chen, Yonghong

    2017-02-15

    Measurement of free thiols in antibody therapeutics is important for product development and assessment of critical quality attributes. Earlier studies demonstrated fast separation of free thiol variants of IgG1 using reversed-phase high performance liquid chromatography (RP-HPLC) with diphenyl resin. Here, we report using N-tert-butylmaleimide (NtBM) alkylation followed by RP-HPLC and online mass spectrometry for rapid total and domain-specific free thiol characterization of IgG1. By increasing hydrophobicity, NtBM alkylation improves separation of free thiol variants from disulfide-linked main peak species. The unique mass shift by NtBM alkylation offers unambiguous characterization of free thiol variants by online mass spectrometry. Variant peaks separated by RP-HPLC were antibody molecules containing two NtBM-alkylated cysteines, corresponding to IgG1 containing two free thiols before alkylation. Further characterization of the collected fractions of variants by peptide mapping revealed that each variant contained unpaired cysteines located in specific IgG1 domains (CH1, CH3, VH and VL domains). Total molecular-level and domain-specific free thiol content measured by this method correlate well with orthogonal differential alkylation peptide mapping analysis, which measures free thiol level at individual cysteine residues. This method provides high throughput quantitation of total and domain-specific free thiol content in IgG1 molecules, facilitating rapid, comprehensive product and manufacturing process characterization. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Overexpression of a glycosyltransferase gene SrUGT74G1 from Stevia improved growth and yield of transgenic Arabidopsis by catechin accumulation.

    Science.gov (United States)

    Guleria, Praveen; Yadav, Sudesh Kumar

    2014-03-01

    Steviol glycoside and gibberellin biosynthetic routes are known as divergent branches of a common origin in Stevia. A UDP-glycosyltransferase encoded by SrUGT74G1 catalyses the conversion of steviolbioside into stevioside in Stevia rebaudiana leaves. In the present study, transgenic Arabidopsis thaliana overexpressing SrUGT74G1 cDNA from Stevia were developed to check the probability of stevioside biosynthesis in them. However, stevioside accumulation was not evident in transgenics. Also, the transgenic Arabidopsis showed no change in GA3 content on SrUGT74G1 overexpression. Surprisingly, significant accumulation of catechin was noticed in transgenics. The transgenics showed a considerable increase in shoot length, root length and rosette area. An increase in free radical scavenging activity of transgenics was noticed. Moreover, the seed yield of transgenics was also increased by 6-15% than control. Additionally, variation in trichome branching pattern on leaf surface of transgenics was observed. The trichome branching pattern was also validated by exogenous catechin exposure (10, 50, 100 ng ml(-1)) to control plants. Hence, present study reports the probable role of SrUGT74G1 from Stevia in catechin accumulation of transgenic Arabidopsis thaliana. Thus, detailed study in present perspective has revealed the role of Stevia SrUGT74G1 gene in trichome branching pattern, improved vegetative growth, scavenging potential and seed yield by catechin accumulation in transgenic Arabidopsis.

  15. ARTD1 regulates cyclin E expression and consequently cell-cycle re-entry and G1/S progression in T24 bladder carcinoma cells

    Science.gov (United States)

    Léger, Karolin; Hopp, Ann-Katrin; Fey, Monika; Hottiger, Michael O.

    2016-01-01

    ABSTRACT ADP-ribosylation is involved in a variety of biological processes, many of which are chromatin-dependent and linked to important functions during the cell cycle. However, any study on ADP-ribosylation and the cell cycle faces the problem that synchronization with chemical agents or by serum starvation and subsequent growth factor addition already activates ADP-ribosylation by itself. Here, we investigated the functional contribution of ARTD1 in cell cycle re-entry and G1/S cell cycle progression using T24 urinary bladder carcinoma cells, which synchronously re-enter the cell cycle after splitting without any additional stimuli. In synchronized cells, ARTD1 knockdown, but not inhibition of its enzymatic activity, caused specific down-regulation of cyclin E during cell cycle re-entry and G1/S progression through alterations of the chromatin composition and histone acetylation, but not of other E2F-1 target genes. Although Cdk2 formed a functional complex with the residual cyclin E, p27Kip1 protein levels increased in G1 upon ARTD1 knockdown most likely due to inappropriate cyclin E-Cdk2-induced phosphorylation-dependent degradation, leading to decelerated G1/S progression. These results provide evidence that ARTD1 regulates cell cycle re-entry and G1/S progression via cyclin E expression and p27Kip1 stability independently of its enzymatic activity, uncovering a novel cell cycle regulatory mechanism. PMID:27295004

  16. The mitotic Clb cyclins are required to alleviate HIR-mediated repression of the yeast histone genes at the G1/S transition.

    Science.gov (United States)

    Amin, Amit Dipak; Dimova, Dessislava K; Ferreira, Monica E; Vishnoi, Nidhi; Hancock, Leandria C; Osley, Mary Ann; Prochasson, Philippe

    2012-01-01

    The histone genes are an important group of cell cycle regulated genes whose transcription is activated during the G1/S transition and repressed in early G1, late S, and G2/M. The HIR complex, comprised of Hir1, Hir2, Hir3 and Hpc2, regulates three of the four histone gene loci. While relief of repression at the G1/S boundary involves the HIR complex, as well as other cofactors, the mechanism by which this derepression occurs remains unknown. To better understand how transcriptional repression contributes to periodic expression in the cell cycle, we sought to identify the cell cycle signals required to alleviate HIR-mediated repression of the histone genes. By measuring histone gene transcription in strains with various combinations of clb mutations, we found that the mitotic Clb1/Clb2 cyclins are required to alleviate Hir-mediated repression during the G1/S transition and that Clb2 physically interacts with the HIR complex. While the HIR complex regulates histone gene transcription in combination with two other histone H3/H4 chaperones, Asf1 and Rtt106, our data demonstrate that the mitotic Clb cyclins are necessary to specifically alleviate the repressive action of the HIR complex itself in order to allow proper expression of the histone genes in late G1/early S phase. Copyright © 2011 Elsevier B.V. All rights reserved.

  17. Rotavirus A genotype G1P[8]: a novel method to distinguish wild-type strains from the Rotarix® vaccine strain

    Directory of Open Access Journals (Sweden)

    Tatiana L Rose

    2010-12-01

    Full Text Available Rotaviruses are important enteric pathogens for humans and animals. Group A rotaviruses (RV-A are the most common agents of severe gastroenteritis in infants and young children and vaccination is the most effective method to reduce RV-A-associated diseases. G1P[8], the most prevalent RV-A genotype worldwide, is included in the RV-A vaccine Rotarix®. The discrimination between wild-type G1P[8] and vaccine G1P[8] strains is an important topic in the study of RV-A epidemiology to manage outbreaks and to define control measures for vaccinated children. In this study, we developed a novel method to segregate the wild-type and vaccine strains using restriction endonucleases. The dsRNA from the Rotarix® vaccine was sequenced and the NSP3 gene was selected as the target gene. The vaccine strain has a restriction pattern that is different than that of wild-type RV-A G1P[8] isolates after digestion with the restriction endonuclease BspHI. This pattern could be used as a marker for the differentiation of wild-type G1P[8] strains from the vaccine strain.

  18. ARTD1 regulates cyclin E expression and consequently cell-cycle re-entry and G1/S progression in T24 bladder carcinoma cells.

    Science.gov (United States)

    Léger, Karolin; Hopp, Ann-Katrin; Fey, Monika; Hottiger, Michael O

    2016-08-02

    ADP-ribosylation is involved in a variety of biological processes, many of which are chromatin-dependent and linked to important functions during the cell cycle. However, any study on ADP-ribosylation and the cell cycle faces the problem that synchronization with chemical agents or by serum starvation and subsequent growth factor addition already activates ADP-ribosylation by itself. Here, we investigated the functional contribution of ARTD1 in cell cycle re-entry and G1/S cell cycle progression using T24 urinary bladder carcinoma cells, which synchronously re-enter the cell cycle after splitting without any additional stimuli. In synchronized cells, ARTD1 knockdown, but not inhibition of its enzymatic activity, caused specific down-regulation of cyclin E during cell cycle re-entry and G1/S progression through alterations of the chromatin composition and histone acetylation, but not of other E2F-1 target genes. Although Cdk2 formed a functional complex with the residual cyclin E, p27(Kip 1) protein levels increased in G1 upon ARTD1 knockdown most likely due to inappropriate cyclin E-Cdk2-induced phosphorylation-dependent degradation, leading to decelerated G1/S progression. These results provide evidence that ARTD1 regulates cell cycle re-entry and G1/S progression via cyclin E expression and p27(Kip 1) stability independently of its enzymatic activity, uncovering a novel cell cycle regulatory mechanism.

  19. Relation entre les caractéristiques des table-bancs et les mesures anthropométriques des écoliers au Benin

    Science.gov (United States)

    Falola, Stève Marjelin; Gouthon, Polycarpe; Falola, Jean-Marie; Fiogbe, Michel Armand; Nigan, Issiako Bio

    2014-01-01

    Introduction Le mobilier scolaire et la posture assise en classe sont souvent impliqués dans l'apparition des douleurs rachidiennes, influant de fait sur la qualité des tâches réalisées par les apprenants. Aucune étude n'a encore vérifié le degré d'adéquation entre les caractéristiques du mobilier et celles des écoliers au Bénin. L'objectif de cette étude transversale est donc de déterminer la relation entre les dimensions des table-bancs utilisées en classe et les mesures anthropométriques des écoliers au Bénin. Methods Elle a été réalisée avec un échantillon probabiliste de 678 écoliers, âgés de 4 à 17 ans. Les mesures anthropométriques des écoliers et les mensurations relatives aux longueurs, largeurs et hauteurs des table-bancs ont été mesurées, puis intégrées aux équations proposées dans la littérature. Les pourcentages des valeurs situées hors des limitesacceptables, dérivées de l'application des équations ont été calculés. Results La largeur et la hauteur des table-bancs utilisées par les écoliers étaient plus élevées (p < 0,05) que les valeurs de référence recommandées par les structures officielles de contrôle et de production des mobiliers scolaires au Bénin. Quel que soit le sexe, il y avait une inadéquation entre la largeur du banc et la longueur fesse-poplité, puis entre la hauteur de la table et la distance coude-bancdes écoliers. Conclusion Les résultats suggèrent de prendre en compte l’évolution des mesures anthropométriques des écoliers dans la confection des table-bancs, afin de promouvoir de bonnes postures assises en classe et de réduire le risque de troubles du rachis. PMID:25317232

  20. Mesures de contraintes in-situ. Méthode de relaxation des carottes Measuring in-Situ Stresses. Relaxation Method with Core Samples

    Directory of Open Access Journals (Sweden)

    Perreau P.

    2006-11-01

    Full Text Available Dans cet article, on se propose de présenter les premiers résultats de l'étude de la méthode d'évaluation des contraintes par mesure de déformations différées d'une carotte après son extraction. Le travail correspondant a été réalisé dans le cadre du projet ARTEP Fracturation hydraulique . Les principes de cette méthode et les quelques éléments d'interprétation récemment publiés dans la littérature sont exposés dans un premier temps. Les résultats de deux campagnes de mesures sur deux puits de la SNEA-P (Soudron, novembre 1985 et Lanot, juillet 1986 sont ensuite présentés. Ces essais ont mis en évidence que les déformations différées d'une carotte dues au relachement des contraintes sont effectivement mesurables. Cependant, une interprétation quantitative de ces mesures nécessite une amélioration des conditions expérimentales (stabilisation thermique, stabilisation de l'état de saturation. This article describes the first results of research on a method of evaluating stresses by measuring the differred deformations of a core sample after it has been extracted. The corresponding research was done within the framework of an ARTEP project on Hydraulic Fracturing . The principles of this method and several interpretation aspects published recently in the literature are described in the first part. Then the results of two measurement campaigns using two SNEA-P wells (Soudron in November 1985 and Lanot in July 1986 are described. These tests revealed that the differed deformations of a core sample due to the relaxing of stresses can effectively be measured. However, a quantitative interpretation of these measurements requires an improvement to be made in the experimental conditions (thermal stabilization, stabilization of the state of saturation.

  1. Etude de la performance des radars hautes-frequences CODAR et WERA pour la mesure des courants marins en presence partielle de glace de mer

    Science.gov (United States)

    Kamli, Emna

    Les radars hautes-frequences (RHF) mesurent les courants marins de surface avec une portee pouvant atteindre 200 kilometres et une resolution de l'ordre du kilometre. Cette etude a pour but de caracteriser la performance des RHF, en terme de couverture spatiale, pour la mesure des courants de surface en presence partielle de glace de mer. Pour ce faire, les mesures des courants de deux radars de type CODAR sur la rive sud de l'estuaire maritime du Saint-Laurent, et d'un radar de type WERA sur la rive nord, prises pendant l'hiver 2013, ont ete utilisees. Dans un premier temps, l'aire moyenne journaliere de la zone ou les courants sont mesures par chaque radar a ete comparee a l'energie des vagues de Bragg calculee a partir des donnees brutes d'acceleration fournies par une bouee mouillee dans la zone couverte par les radars. La couverture des CODARs est dependante de la densite d'energie de Bragg, alors que la couverture du WERA y est pratiquement insensible. Un modele de fetch appele GENER a ete force par la vitesse du vent predite par le modele GEM d'Environnement Canada pour estimer la hauteur significative ainsi que la periode modale des vagues. A partir de ces parametres, la densite d'energie des vagues de Bragg a ete evaluee pendant l'hiver a l'aide du spectre theorique de Bretschneider. Ces resultats permettent d'etablir la couverture normale de chaque radar en absence de glace de mer. La concentration de glace de mer, predite par le systeme canadien operationnel de prevision glace-ocean, a ete moyennee sur les differents fetchs du vent selon la direction moyenne journaliere des vagues predites par GENER. Dans un deuxieme temps, la relation entre le ratio des couvertures journalieres obtenues pendant l'hiver 2013 et des couvertures normales de chaque radar d'une part, et la concentration moyenne journaliere de glace de mer d'autre part, a ete etablie. Le ratio des couvertures decroit avec l'augmentation de la concentration de glace de mer pour les deux types

  2. Mesure d'un effet de lentille de population dans un cristal de Cr3+:LiSAF par la technique du Z-scan

    Science.gov (United States)

    Passilly, N.; Haouas, E.; Ménard, V.; Moncorgé, R.; Aït-Ameur, K.

    2006-10-01

    Nous avons réalisé une expérience permettant de mesurer la variation de la polarisabilité des ions Cr3+ dans le LiSAF lorsqu'ils passent de l'état fondamental 4A{2} à l'état excité 4T{2}. Cette variation de polarisabilité est à l'origine d'un effet de lentille de population non-linéaire dépendant du temps.

  3. Entropy Production in Chemical Reactors

    Science.gov (United States)

    Kingston, Diego; Razzitte, Adrián C.

    2017-06-01

    We have analyzed entropy production in chemically reacting systems and extended previous results to the two limiting cases of ideal reactors, namely continuous stirred tank reactor (CSTR) and plug flow reactor (PFR). We have found upper and lower bounds for the entropy production in isothermal systems and given expressions for non-isothermal operation and analyzed the influence of pressure and temperature in entropy generation minimization in reactors with a fixed volume and production. We also give a graphical picture of entropy production in chemical reactions subject to constant volume, which allows us to easily assess different options. We show that by dividing a reactor into two smaller ones, operating at different temperatures, the entropy production is lowered, going as near as 48 % less in the case of a CSTR and PFR in series, and reaching 58 % with two CSTR. Finally, we study the optimal pressure and temperature for a single isothermal PFR, taking into account the irreversibility introduced by a compressor and a heat exchanger, decreasing the entropy generation by as much as 30 %.

  4. Antineutrino monitoring of thorium reactors

    Science.gov (United States)

    Akindele, Oluwatomi A.; Bernstein, Adam; Norman, Eric B.

    2016-09-01

    Various groups have demonstrated that antineutrino monitoring can be successful in assessing the plutonium content in water-cooled nuclear reactors for nonproliferation applications. New reactor designs and concepts incorporate nontraditional fuel types and chemistry. Understanding how these properties affect the antineutrino emission from a reactor can extend the applicability of antineutrino monitoring. Thorium molten salt reactors breed 233U, that if diverted constitute a direct use material as defined by the International Atomic Energy Agency (IAEA). The antineutrino spectrum from the fission of 233U has been estimated for the first time, and the feasibility of detecting the diversion of 8 kg of 233U, within a 30 day timeliness goal has been evaluated. The antineutrino emission from a thorium reactor operating under normal conditions is compared to a diversion scenario by evaluating the daily antineutrino count rate and the energy spectrum of the detected antineutrinos at a 25 m standoff. It was found that the diversion of a significant quantity of 233U could not be detected within the current IAEA timeliness detection goal using either tests. A rate-time based analysis exceeded the timeliness goal by 23 days, while a spectral based analysis exceeds this goal by 31 days.

  5. Simplifying Microbial Electrosynthesis Reactor Design

    Directory of Open Access Journals (Sweden)

    Cloelle G.S. Giddings

    2015-05-01

    Full Text Available Microbial electrosynthesis, an artificial form of photosynthesis, can efficiently convert carbon dioxide into organic commodities; however, this process has only previously been demonstrated in reactors that have features likely to be a barrier to scale-up. Therefore, the possibility of simplifying reactor design by both eliminating potentiostatic control of the cathode and removing the membrane separating the anode and cathode was investigated with biofilms of Sporomusa ovata, which reduces carbon dioxide to acetate. In traditional ‘H-cell’ reactors, where the anode and cathode chambers were separated with a proton-selective membrane, the rates and columbic efficiencies of microbial electrosynthesis remained high when electron delivery at the cathode was powered with a direct current power source rather than with a poteniostat-poised cathode utilized in previous studies. A membrane-less reactor with a direct-current power source with the cathode and anode positioned to avoid oxygen exposure at the cathode, retained high rates of acetate production as well as high columbic and energetic efficiencies. The finding that microbial electrosynthesis is feasible without a membrane separating the anode from the cathode, coupled with a direct current power source supplying the energy for electron delivery, is expected to greatly simplify future reactor design and lower construction costs.

  6. Rapid starting methanol reactor system

    Science.gov (United States)

    Chludzinski, Paul J.; Dantowitz, Philip; McElroy, James F.

    1984-01-01

    The invention relates to a methanol-to-hydrogen cracking reactor for use with a fuel cell vehicular power plant. The system is particularly designed for rapid start-up of the catalytic methanol cracking reactor after an extended shut-down period, i.e., after the vehicular fuel cell power plant has been inoperative overnight. Rapid system start-up is accomplished by a combination of direct and indirect heating of the cracking catalyst. Initially, liquid methanol is burned with a stoichiometric or slightly lean air mixture in the combustion chamber of the reactor assembly. The hot combustion gas travels down a flue gas chamber in heat exchange relationship with the catalytic cracking chamber transferring heat across the catalyst chamber wall to heat the catalyst indirectly. The combustion gas is then diverted back through the catalyst bed to heat the catalyst pellets directly. When the cracking reactor temperature reaches operating temperature, methanol combustion is stopped and a hot gas valve is switched to route the flue gas overboard, with methanol being fed directly to the catalytic cracking reactor. Thereafter, the burner operates on excess hydrogen from the fuel cells.

  7. IgG1 antiendomysium and IgG antitissue transglutaminase (anti-tTG) antibodies in coeliac patients with selective IgA deficiency

    OpenAIRE

    Cataldo, F; Lio, D.; Marino, V.; Picarelli, A.; Ventura, A.; Corazza, G; a SIGEP,

    2000-01-01

    BACKGROUND—In selective IgA deficiency (IgAD), there is no reliable screening test for coeliac disease (CD).
AIM—To evaluate the usefulness of IgG1 antiendomysium and IgG antitissue transglutaminase tests for CD diagnosis in IgAD.
METHODS—IgA and IgG antigliadin antibodies (IgA- and IgG-AGA), IgA and IgG1 antiendomysium antibodies (IgA- and IgG1-EMA), and IgA and IgG antitissue transglutaminase (IgA- and IgG-anti-tTG) were assayed in: (a) 20 untreated IgAD/CD patients; (b) 34 IgAD/CD patients...

  8. The transcription factor Swi4 is target for PKA regulation of cell size at the G1 to S transition in Saccharomyces cerevisiae.

    Science.gov (United States)

    Amigoni, Loredana; Colombo, Sonia; Belotti, Fiorella; Alberghina, Lilia; Martegani, Enzo

    2015-08-03

    To investigate the specific target of PKA in the regulation of cell cycle progression and cell size we developed a new approach using the yeast strain GG104 bearing a deletion in adenylate cyclase gene and permeable to cAMP ( cyr1Δ, pde2Δ, msn2Δ, msn4Δ). In this strain the PKA activity is absent and can be activated by addition of cAMP in the medium, without any other change of the growth conditions. In the present work we show that the activation of PKA by exogenous cAMP in the GG104 strain exponentially growing in glucose medium caused a marked increase of cell size and perturbation of cell cycle with a transient arrest of cells in G1, followed by an accumulation of cells in G2/M phase with a minimal change in the growth rate. Deletion of CLN1 gene, but not of CLN2, abolished the transient G1 phase arrest. Consistently we found that PKA activation caused a transcriptional repression of CLN1 gene. Transcription of CLN1 is controlled by SBF and MBF dual-regulated promoter. We found that also the deletion of SWI4 gene abolished the transient G1 arrest suggesting that Swi4 is a target responsible for PKA modulation of G1/S phase transition. We generated a SWI4 allele mutated in the consensus site for PKA (Swi4(S159A)) and we found that expression of Swi4(S159A) protein in the GG104-Swi4Δ strain did not restore the transient G1 arrest induced by PKA activation, suggesting that Swi4 phosphorylation by PKA regulates CLN1 gene expression and G1/S phase transition.

  9. An ultra-clean technique for accurately analysing Pb isotopes and heavy metals at high spatial resolution in ice cores with sub-pg g(-1) Pb concentrations.

    Science.gov (United States)

    Burn, Laurie J; Rosman, Kevin J R; Candelone, Jean-Pierre; Vallelonga, Paul; Burton, Graeme R; Smith, Andrew M; Morgan, Vin I; Barbante, Carlo; Hong, Sungmin; Boutron, Claude F

    2009-02-23

    Measurements of Pb isotope ratios in ice containing sub-pg g(-1) concentrations are easily compromised by contamination, particularly where limited sample is available. Improved techniques are essential if Antarctic ice cores are to be analysed with sufficient spatial resolution to reveal seasonal variations due to climate. This was achieved here by using stainless steel chisels and saws and strict protocols in an ultra-clean cold room to decontaminate and section ice cores. Artificial ice cores, prepared from high purity water were used to develop and refine the procedures and quantify blanks. Ba and In, two other important elements present at pg g(-1) and fg g(-1) concentrations in Polar ice, were also measured. The final blank amounted to 0.2+/-0.2 pg of Pb with (206)Pb/(207)Pb and (208)Pb/(207)Pb ratios of 1.16+/-0.12 and 2.35+/-0.16, respectively, 1.5+/-0.4 pg of Ba and 0.6+/-2.0 fg of In, most of which probably originates from abrasion of the steel saws by the ice. The procedure was demonstrated on a Holocene Antarctic ice core section and was shown to contribute blanks of only approximately 5%, approximately 14% and approximately 0.8% to monthly resolved samples with respective Pb, Ba and In concentrations of 0.12 pg g(-1), 0.3 pg g(-1) and 2.3 fg g(-1). Uncertainties in the Pb isotopic ratio measurements were degraded by only approximately 0.2%.

  10. Sequence variants in eukaryotic translation initiation factor 4-gamma (eIF4G1) are associated with Lewy body dementia.

    Science.gov (United States)

    Fujioka, Shinsuke; Sundal, Christina; Strongosky, Audrey J; Castanedes, Monica Case; Rademakers, Rosa; Ross, Owen A; Vilariño-Güell, Carles; Farrer, Matthew J; Wszolek, Zbigniew K; Dickson, Dennis W

    2013-03-01

    We recently reported a missense mutation and four variants in eukaryotic translation initiation factor 4-gamma (EIF4G1) associated with parkinsonism, dementia or both. In those with a positive family history, the mode of inheritance was autosomal dominant. Detailed neuropathologic descriptions of individuals with EIF4G1 genetic variants have not been reported. Herein, we report neuropathologic findings of three individuals from two American families with EIF4G1 variants. The patients had initial clinical presentations of dementia or parkinsonism and all had dementia at the time of autopsy. One family carried an EIF4G1 double variant, c.2056G>T (p.G686C) and c.3589C>T (p.R1197 W), and one family carried variant c.1505C>T (p.A502V). All three patients also carried at least one ε4 allele of apolipoprotein E. One individual presented with cognitive impairment without significant parkinsonism; one presented with memory problems followed by bradykinesia; and the third presented with cardinal signs of Parkinson's disease, followed more than a year later by cognitive dysfunction. Pathological examination showed diffuse cortical Lewy bodies and Lewy neurites in all patients. A small subset of Lewy bodies and Lewy neurites were immunopositive for eIF4G1. All patients had moderate to frequent non-neuritic, cortical amyloid plaques, mostly medial temporal neurofibrillary pathology (Braak neurofibrillary tangle stages of II to IV), and minimal or no TDP-43 pathology. The results suggest that in some patients variants in EIF4G1 can be associated with pathology that has a high likelihood of association with clinical features of dementia with Lewy bodies.

  11. Cdc48 and cofactors Npl4-Ufd1 are important for G1 progression during heat stress by maintaining cell wall integrity in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Meng-Ti Hsieh

    Full Text Available The ubiquitin-selective chaperone Cdc48, a member of the AAA (ATPase Associated with various cellular Activities ATPase superfamily, is involved in many processes, including endoplasmic reticulum-associated degradation (ERAD, ubiquitin- and proteasome-mediated protein degradation, and mitosis. Although Cdc48 was originally isolated as a cell cycle mutant in the budding yeast Saccharomyces cerevisiae, its cell cycle functions have not been well appreciated. We found that temperature-sensitive cdc48-3 mutant is largely arrested at mitosis at 37°C, whereas the mutant is also delayed in G1 progression at 38.5°C. Reporter assays show that the promoter activity of G1 cyclin CLN1, but not CLN2, is reduced in cdc48-3 at 38.5°C. The cofactor npl4-1 and ufd1-2 mutants also exhibit G1 delay and reduced CLN1 promoter activity at 38.5°C, suggesting that Npl4-Ufd1 complex mediates the function of Cdc48 at G1. The G1 delay of cdc48-3 at 38.5°C is a consequence of cell wall defect that over-activates Mpk1, a MAPK family member important for cell wall integrity in response to stress conditions including heat shock. cdc48-3 is hypersensitive to cell wall perturbing agents and is synthetic-sick with mutations in the cell wall integrity signaling pathway. Our results suggest that the cell wall defect in cdc48-3 is exacerbated by heat shock, which sustains Mpk1 activity to block G1 progression. Thus, Cdc48-Npl4-Ufd1 is important for the maintenance of cell wall integrity in order for normal cell growth and division.

  12. Purification and characterization of two phospho-β-galactosidases, LacG1 and LacG2, from Lactobacillus gasseri ATCC33323(T).

    Science.gov (United States)

    Honda, Hiroyuki; Nagaoka, Seiji; Kawai, Yasushi; Kemperman, Robèr; Kok, Jan; Yamazaki, Yukiko; Tateno, Yoshio; Kitazawa, Haruki; Saito, Tadao

    2012-01-01

    Lactobacillus gasseri ATCC33323(T) expresses four enzymes showing phospho-β-galactosidase activity (LacG1, LacG2, Pbg1 and Pbg2). We previously reported the purification and characterization of two phospho-β-galactosidases (Pbg1 and Pbg2) from Lactobacillus gasseri JCM1031 cultured in lactose medium. Here we aimed to characterize LacG1 and LacG2, and classify the four enzymes into 'phospho-β-galactosidase' or 'phospho-β-glucosidase.' LacG1 and recombinant LacG2 (rLacG2), from Lb. gasseri ATCC33323(T), were purified to homogeneity using column chromatography. Kinetic experiments were performed using sugar substrates, o-nitrophenyl-β-D-galactopyranoside 6-phosphate (ONPGal-6P) and o-nitrophenyl-β-D-glucopyranoside 6-phosphate (ONPGlc-6P), synthesized in our laboratory. LacG1 and rLacG2 exhibited high k(cat)/K(m) values for ONPGal-6P as compared with Pbg1 and Pbg2. The V(max) values for ONPGal-6P were higher than phospho-β-galactosidases previously purified and characterized from several lactic acid bacteria. A phylogenetic tree analysis showed that LacG1 and LacG2 belong to the phospho-β-galactosidase cluster and Pbg1 and Pbg2 belong to the phospho-β-glucosidase cluster. Our data suggest two phospho-β-galactosidase, LacG1 and LacG2, are the primary enzymes for lactose utilization in Lb. gasseri ATCC33323(T). We propose a reclassification of Pbg1 and Pbg2 as phospho-β-glucosidase.

  13. Induction of interleukin-10 in the T helper type 17 effector population by the G protein coupled estrogen receptor (GPER) agonist G-1

    Science.gov (United States)

    Brunsing, Ryan L; Prossnitz, Eric R

    2011-01-01

    Interleukin-10 (IL-10) is a potent suppressor of the immune system, commonly produced by CD4+ T cells to limit ongoing inflammatory responses minimizing host damage. Many autoimmune diseases are marked by large populations of activated CD4+ T cells within the setting of chronic inflammation; therefore, drugs capable of inducing IL-10 production in CD4+ T cells would be of great therapeutic value. Previous reports have shown that the small molecule G-1, an agonist of the membrane-bound G-protein-coupled estrogen receptor GPER, attenuates disease in an animal model of autoimmune encephalomyelitis. However, the direct effects of G-1 on CD4+ T-cell populations remain unknown. Using ex vivo cultures of purified CD4+ T cells, we show that G-1 elicits IL-10 expression in T helper type 17 (Th17) -polarized cells, increasing the number of IL-10+ and IL-10+ IL-17A+ cells via de novo induction of IL-10. T-cell cultures differentiated in the presence of G-1 secreted threefold more IL-10, with no change in IL-17A, tumour necrosis factor-α, or interferon-γ. Moreover, inhibition of extracellular signal-regulated kinase (but not p38 or Jun N-terminal kinase) signalling blocked the response, while analysis of Foxp3 and RORγt expression demonstrated increased numbers of IL-10+ cells in both the Th17 (RORγt+) and Foxp3+ RORγt+ hybrid T-cell compartments. Our findings translated in vivo as systemic treatment of male mice with G-1 led to increased IL-10 secretion from splenocytes following T-cell receptor cross-linking. These results demonstrate that G-1 acts directly on CD4+ T cells, and to our knowledge provide the first example of a synthetic small molecule capable of eliciting IL-10 expression in Th17 or hybrid T-cell populations. PMID:21722102

  14. Estimation des incertitudes de mesure pour l'analyse chimique des adjuvants et des produits de cure destinés aux constructions de béton hydraulique

    OpenAIRE

    UGER, Aurore; BRIQUET, Philippe; LABORATOIRE CENTRAL DES PONTS ET CHAUSSEES - LCPC; UNIVERSITE DE CERGY-PONTOISE

    2005-01-01

    Ce stage de DESS, effectué au LCPC / PCM, fait suite à celui de Nathalie Hamon en 2004. Il a consisté à déterminer les incertitudes de mesure pour certaines caractéristiques des adjuvants du béton (Extrait Sec conventionnel, Teneur en Chlorures, Teneur en Alcalins équivalents) et des produits de cure (Teneur en cendres, Temps d'Ecoulement), produits soumis, dans le cadre du programme n°3 du COFRAC, à essais de certification NF dans nos laboratoires. La valeur de l'incertitude de mesure, affec...

  15. Gaseous fuel nuclear reactor research

    Science.gov (United States)

    Schwenk, F. C.; Thom, K.

    1975-01-01

    Gaseous-fuel nuclear reactors are described; their distinguishing feature is the use of fissile fuels in a gaseous or plasma state, thereby breaking the barrier of temperature imposed by solid-fuel elements. This property creates a reactor heat source that may be able to heat the propellant of a rocket engine to 10,000 or 20,000 K. At this temperature level, gas-core reactors would provide the breakthrough in propulsion needed to open the entire solar system to manned and unmanned spacecraft. The possibility of fuel recycling makes possible efficiencies of up to 65% and nuclear safety at reduced cost, as well as high-thrust propulsion capabilities with specific impulse up to 5000 sec.

  16. Investigation of KW reactor incident

    Energy Technology Data Exchange (ETDEWEB)

    Sturges, D G [USAEC Hanford Operations Office, Richland, WA (United States); Hauff, T W; Greager, O H [General Electric Co., Richland, WA (United States). Hanford Atomic Products Operation

    1955-02-11

    The new KW reactor was placed in operation on January 4, 1955, and had been running at relatively low power levels for only 17 hours when it was shut down because of a process tube water leak which appeared to be associated with a slug rupture. After several days of unrewarding effort to remove the slugs and tube by customary methods, it developed that considerable melting of the tube and slugs had taken place. It was then evident that removal of the stuck mass and repairs to the damaged tube channel would require unusual measures that were certain to extend the reactor outage for several weeks. This report documents the work and findings of the Committee which investigated the KW reactor incident. Its content represents unanimous agreement among the three Committee members.

  17. Effects of plant water-soluble polysaccharides on the production of immunoglobulins E and G1 by lymphocytes of mice sensitized with ovalbumin.

    Science.gov (United States)

    Danilets, M G; Belska, N V; Bel'sky, Y P; Uchasova, E G; Trophimova, E S; Ligatcheva, A A; Guriev, A M; Belousov, M V; Ahmedganov, R R; Usubov, M S; Agaphonov, V I

    2008-11-01

    Were studied the effects of water-soluble plant polysaccharides isolated from pharmacopoeic raw material on anaphylactic shock and production of IgE and IgG1 by lymphocytes from mice immunized with ovalbumin. Course treatment with polysaccharides from coltsfoot, sweet flag, clover, Artemisia, marigold, and elecampane reduced animal mortality after induction of anaphylactic shock. In addition, injection of these substances reduced serum concentrations of IgE and IgG1. These substances can be regarded as promising agents for the treatment of IgE-dependent diseases (atopic dermatitis, asthma, atopic rhinitis, urticaria, food allergies, etc.).

  18. Synergistic Inhibition of R5 HIV-1 by the Fusion Protein (FLSC) IgG1 Fc and Maraviroc in Primary Cells: Implications for Prevention and Treatment.

    Science.gov (United States)

    Latinovic, Olga S; Zhang, Jian; Tagaya, Yutaka; DeVico, Anthony L; Fouts, Timothy R; Schneider, K; Lakowicz, Joseph R; Heredia, Alonso; Redfield, Robert R

    2016-01-01

    Antiretroviral (ARV) drugs targeting retroviral enzymes have been extensively employed to treat HIV-1 infection. Drawbacks of this approach include cost, toxicity, and the eventual emergence of resistant strains that threaten prophylactic and/or therapeutic efficacy. Accordingly, efforts to develop next-generation ARV approaches are warranted, particularly if they can offer a higher threshold of resistance. We have previously shown that FLSC, a fusion protein containing gp120(BAL) and the D1 and D2 domains of human CD4, specifically binds CCR5, an important cellular co-receptor, and inhibits the entry of R5 HIV isolates. (FLSC) IgG1, a fusion of FLSC and the hinge-C(H)2-C(H)3 region of human IgG1, has an increased antiviral activity, likely due to the resultant bivalency. In this study, we show CCR5 reduction upon (FLSC) IgG1 treatment both by standard flow cytometry and visualized using a novel nanoparticle method. A β-lactamase virus-cell fusion assay was used to quantify (FLSC) IgG1 inhibition of HIV-1 entry into both cell lines and primary cells. Synergistic anti-viral activities of (FLSC) IgG1 and MVC in primary cells were evaluated by measuring supernatant p24 levels via ELISA and calculated using the MacSynergy™ II program. We previously reported that treatment with the CCR5 small molecule antagonist Maraviroc (MVC) increased the apparent exposure of the (FLSC) IgG1 binding sites on CCR5, leading us to wonder if the two compounds used in combination might synergize in their anti-viral activity. Here we show that this is indeed the case. We demonstrate that fusion protein (FLSC) IgG1, strongly synergizes with the CCR5 antagonist Maraviroc to successfully inhibit both MVC-sensitive and MVC-resistant R5 HIV-1. Observed synergy between (FLSC) IgG1 and MVC was high in both, cell lines and primary PBMCs. This has relevance for future in vivo studies. In addition, synergy occurred both with MVC-sensitive viruses and MVC-resistant viruses, partially restoring the

  19. Draft genome sequences of two Kocuria isolates, K. salsicia G1 and K. rhizophila G2, isolated from a slaughterhouse in Denmark

    DEFF Research Database (Denmark)

    Herschend, Jakob; Raghupathi, Prem Krishnan; Røder, Henriette Lyng

    2016-01-01

    We report here the draft genome sequences ofKocuria salsiciaG1 andKocuria rhizophilaG2, which were isolated from a meat chopper at a small slaughterhouse in Denmark. The two annotated genomes are 2.99 Mb and 2.88 Mb in size, respectively.......We report here the draft genome sequences ofKocuria salsiciaG1 andKocuria rhizophilaG2, which were isolated from a meat chopper at a small slaughterhouse in Denmark. The two annotated genomes are 2.99 Mb and 2.88 Mb in size, respectively....

  20. STARFIRE: a commercial tokamak reactor

    Energy Technology Data Exchange (ETDEWEB)

    1979-12-01

    The purpose of this document is to provide an interim status report on the STARFIRE project for the period of May to September 1979. The basic objective of the STARFIRE project is to develop a design concept for a commercial tokamak fusion electric power plant based on the deuterium/tritium/lithium fuel cycle. The key technical objective is to develop the best embodiment of the tokamak as a power reactor consistent with credible engineering solutions to design problems. Another key goal of the project is to give careful attention to the safety and environmental features of a commercial fusion reactor.