WorldWideScience

Sample records for reaction-restriction fragment length

  1. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...... endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes....... Four heterozygotes could not be unequivocally typed with the PCR-RFLP method. The HLA-DPB1 typing results obtained with the PCR-RFLP method were compared with the typing results obtained with PCR allele-specific oligonucleotides (PCR-ASO) in 50 individuals. The results obtained with the two methods...

  2. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  3. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP Analysis

    Directory of Open Access Journals (Sweden)

    Yuny Erwanto

    2014-10-01

    Full Text Available This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp. Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  4. Identification of Pork Contamination in Meatballs of Indonesia Local Market Using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis.

    Science.gov (United States)

    Erwanto, Yuny; Abidin, Mohammad Zainal; Sugiyono, Eko Yasin Prasetyo Muslim; Rohman, Abdul

    2014-10-01

    This research applied and evaluated a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) using cytochrome b gene to detect pork contamination in meatballs from local markets in Surabaya and Yogyakarta regions, Indonesia. To confirm the effectiveness and specificity of this fragment, thirty nine DNA samples from different meatball shops were isolated and amplified, and then the PCR amplicon was digested by BseDI restriction enzyme to detect the presence of pork in meatballs. BseDI restriction enzyme was able to cleave porcine cytochrome b gene into two fragments (131 bp and 228 bp). Testing the meatballs from the local market showed that nine of twenty meatball shops in Yogyakarta region were detected to have pork contamination, but there was no pork contamination in meatball shops in Surabaya region. In conclusion, specific PCR amplification of cytochrome b gen and cleaved by BseDI restriction enzymes seems to be a powerful technique for the identification of pork presence in meatball because of its simplicity, specificity and sensitivity. Furthermore, pork contamination intended for commercial products of sausage, nugget, steak and meat burger can be checked. The procedure is also much cheaper than other methods based on PCR, immunodiffusion and other techniques that need expensive equipment.

  5. Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta Lima

    1998-01-01

    Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

  6. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton

    2013-06-01

    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  7. Simultaneous and rapid differential diagnosis of Mycoplasma genitalium and Ureaplasma urealyticum based on a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    R Mirnejad

    2011-01-01

    Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.

  8. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  9. Distinguishing Heterodera filipjevi and H. avenae using polymerase chain reaction-restriction fragment length polymorphism and cyst morphology.

    Science.gov (United States)

    Yan, Guiping; Smiley, Richard W

    2010-03-01

    The cereal cyst nematodes Heterodera filipjevi and H. avenae impede wheat production in the Pacific Northwest (PNW). Accurate identification of cyst nematode species and awareness of high population density in affected fields are essential for designing effective control measures. Morphological methods for differentiating these species are laborious. These species were differentiated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) of internal transcribed spacer (ITS)-ribosomal (r)DNA with up to six restriction endonucleases (TaqI, HinfI, PstI, HaeIII, RsaI, and AluI). The method was validated by inspecting underbridge structures of cyst vulval cones. Grid soil sampling of an Oregon field infested by both species revealed that H. filipjevi was present at most of the infested grid sites but mixtures of H. avenae and H. filipjevi also occurred. These procedures also detected and differentiated H. filipjevi and H. avenae in soil samples from nearby fields in Oregon and H. avenae in samples from Idaho and Washington. Intraspecific polymorphism was not observed within H. filipjevi or PNW H. avenae populations based on the ITS-rDNA. However, intraspecific variation was observed between H. avenae populations occurring in the PNW and France. Methods described here will improve detection and identification efficiencies for cereal cyst nematodes in wheat fields.

  10. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  11. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  12. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Azzedine Bounamous

    2014-07-01

    Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  13. Restriction fragment length polymorphism of the major histocompatibility complex of the dog.

    Science.gov (United States)

    Sarmiento, U M; Storb, R F

    1988-01-01

    Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D-homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (Bam HI, Eco RI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I, and Bgl II), separated by agarose gel electrophoresis, and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabeled HLA cDNA probes corresponding to DR, DQ, DP, and DO beta genes. The autoradiograms for all nine enzyme digests displayed multiple bands with the DRb, DQb, and DPb probes while the DOb probe hybridized with one to two bands. The RFLP patterns were highly polymorphic but consistent within each DLA-D type. Standard RFLP patterns were established for nine DLA-D types which could be discriminated from each other by using two enzymes (Rsa I and Pst I) and the HLA-DPb probe. Cluster analysis of the polymorphic restriction fragments detected by the DRb probe revealed four closely related supertypic groups or DLA-DR families: Dw3 + Dw4 + D1, Dw8 + D10, D7 + D16 + D9, and Dw1. This study provides the basis for DLA-D genotyping at a population level by RFLP analysis. These results also suggest that the genetic organization of the DLA-D region may closely resemble that of the HLA complex.

  14. Comparison of CHROMagar, polymerase chain reaction-restriction fragment length polymorphism, and polymerase chain reaction-fragment size for the identification of Candida species.

    Science.gov (United States)

    Jafari, Zahra; Motamedi, Marjan; Jalalizand, Nilufar; Shokoohi, Gholam R; Charsizadeh, Arezu; Mirhendi, Hossein

    2017-09-01

    The epidemiological alteration in the distribution of Candida species, as well as the significantly increasing trend of either intrinsic or acquired resistance of some of these fungi highlights the need for a reliable method for the identification of the species. Polymerase chain reaction (PCR) is one of the methods facilitating the quick and precise identification of Candida species. The aim of this study was to compare the efficiency of CHROMagar, PCR-restriction fragment length polymorphism (PCR-RFLP), and PCR-fragment size polymorphism (PCR-FSP) assays in the identification of Candida species to determine the benefits and limitations of these methods. This study was conducted on 107 Candida strains, including 20 standard strains and 87 clinical isolates. The identification of the isolates was accomplished by using CHROMagar as a conventional method. The PCR-RFLP assay was performed on the entire internal transcribed spacer (ITS) region of ribosomal DNA (rDNA), and the consequent enzymatic digestion was compared with PCR-FSP results in which ITS1 and ITS2 regions were separately PCR amplified. In both molecular assays, yeast identification was carried out through the specific electrophoretic profiles of the PCR products. According to the results, the utilization of CHROMagar resulted in the identification of 29 (33.3%) Candida isolates, while the PCR-RFLP and PCR-FSP facilitated the identification of 83 (95.4%) and 80 (91.9%) clinical isolates, respectively. The obtained concordances between CHROMagar and PCR-RFLP, between CHROMagar and PCR-FSP, as well as between PCR-RFLP and PCR-FSP were 0.23, 0.20, and 0.77, respectively. The recognition of the benefits and limitations of PCR methods allows for the selection of the most efficient technique for a fast and correct differentiation. The PCR-RFLP and PCR-FSP assays had satisfactory concordance. The PCR-FSP provides a rapid, technically simple, and cost-effective method for the identification of Candida species

  15. Identification of Echinococcus granulosus strains using polymerase chain reaction-restriction fragment length polymorphism amongst livestock in Moroto district, Uganda.

    Science.gov (United States)

    Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah

    2016-07-29

    A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.

  16. Lyme disease with facial nerve palsy: rapid diagnosis using a nested polymerase chain reaction-restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Hashimoto, Y; Takahashi, H; Kishiyama, K; Sato, Y; Nakao, M; Miyamoto, K; Iizuka, H

    1998-02-01

    A 64-year-old woman with Lyme disease and manifesting facial nerve palsy had been bitten by a tick on the left frontal scalp 4 weeks previously. Erythema migrans appeared on the left forehead, accompanied by left facial paralysis. Nested polymerase chain reaction-restriction fragment length polymorphism analysis (nested PCR-RFLP) was performed on DNA extracted from a skin biopsy of the erythema on the left forehead. Borrelia flagellin gene DNA was detected and its RFLP pattern indicated that the organism was B. garinii, Five weeks later, B. garinii was isolated by conventional culture from the erythematous skin lesion, but not from the cerebrospinal fluid. After treatment with ceftriaxone intravenously for 10 days and oral administration of minocycline for 7 days, both the erythema and facial nerve palsy improved significantly. Nested PCR and culture taken after the lesion subsided, using skin samples obtained from a site adjacent to the original biopsy, were both negative. We suggest that nested PCR-RFLP analysis might be useful for the rapid diagnosis of Lyme disease and for evaluating therapy.

  17. Rapid differentiation of closely related isolates of two plant viruses by polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Barbara, D J; Morton, A; Spence, N J; Miller, A

    1995-09-01

    Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.

  18. Telomere Restriction Fragment (TRF) Analysis.

    Science.gov (United States)

    Mender, Ilgen; Shay, Jerry W

    2015-11-20

    While telomerase is expressed in ~90% of primary human tumors, most somatic tissue cells except transiently proliferating stem-like cells do not have detectable telomerase activity (Shay and Wright, 1996; Shay and Wright, 2001). Telomeres progressively shorten with each cell division in normal cells, including proliferating stem-like cells, due to the end replication (lagging strand synthesis) problem and other causes such as oxidative damage, therefore all somatic cells have limited cell proliferation capacity (Hayflick limit) (Hayflick and Moorhead, 1961; Olovnikov, 1973). The progressive telomere shortening eventually leads to growth arrest in normal cells, which is known as replicative senescence (Shay et al. , 1991). Once telomerase is activated in cancer cells, telomere length is stabilized by the addition of TTAGGG repeats to the end of chromosomes, thus enabling the limitless continuation of cell division (Shay and Wright, 1996; Shay and Wright, 2001). Therefore, the link between aging and cancer can be partially explained by telomere biology. There are many rapid and convenient methods to study telomere biology such as Telomere Restriction Fragment (TRF), Telomere Repeat Amplification Protocol (TRAP) (Mender and Shay, 2015b) and Telomere dysfunction Induced Foci (TIF) analysis (Mender and Shay, 2015a). In this protocol paper we describe Telomere Restriction Fragment (TRF) analysis to determine average telomeric length of cells. Telomeric length can be indirectly measured by a technique called Telomere Restriction Fragment analysis (TRF). This technique is a modified Southern blot, which measures the heterogeneous range of telomere lengths in a cell population using the length distribution of the terminal restriction fragments (Harley et al. , 1990; Ouellette et al. , 2000). This method can be used in eukaryotic cells. The description below focuses on the measurement of human cancer cells telomere length. The principle of this method relies on the lack of

  19. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  20. The prevalence of cryptosporidiosis in Turkish children, and geno typing of isolates by nested polymerase chain reaction-restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.

    2007-01-01

    Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)

  1. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  2. Rapid detection of dihydropteroate polymorphism in AIDS-related Pneumocystis carinii pneumonia by restriction fragment length polymorphism

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Eugen-Olsen, Jesper; Lundgren, B

    2000-01-01

    are associated with failure of sulpha prophylaxis and increased mortality in HIV-1 positive patients with PCP, suggesting that DHPS mutations may cause sulpha resistance. To facilitate detection of DHPS mutations we developed a restriction fragment length polymorphism (RFLP) assay, detecting mutations at codon...

  3. Inheritance of restriction fragment length polymorphisms, random amplified polymorphic DNAs and isozymes in coastal Douglas-fir

    Science.gov (United States)

    K.D. Jermstad; A.M. Reem; J.R. Henifin; N.C. Wheeler; D.B Neale

    1994-01-01

    A total of 225 new genetic loci [151 restriction fragment length polymorphisms (RFLP) and 74 random amplified polymorphic DNAs (RAPD)] in coastal Douglas- fir [Pseudotsuga menziesii (Mirb.) Franco var. menziesii] have been identified using a three-generation outbred pedigree. The Mendelian inheritance of 16 RFLP loci and 29...

  4. Genotyping of major histocompatibility complex Class II DRB gene in Rohilkhandi goats by polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing

    Directory of Open Access Journals (Sweden)

    Kush Shrivastava

    2015-10-01

    Full Text Available Aim: To study the major histocompatibility complex (MHC Class II DRB1 gene polymorphism in Rohilkhandi goat using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP and nucleotide sequencing techniques. Materials and Methods: DNA was isolated from 127 Rohilkhandi goats maintained at sheep and goat farm, Indian Veterinary Research Institute, Izatnagar, Bareilly. A 284 bp fragment of exon 2 of DRB1 gene was amplified and digested using BsaI and TaqI restriction enzymes. Population genetic parameters were calculated using Popgene v 1.32 and SAS 9.0. The genotypes were then sequenced using Sanger dideoxy chain termination method and were compared with related breeds/species using MEGA 6.0 and Megalign (DNASTAR software. Results: TaqI locus showed three and BsaI locus showed two genotypes. Both the loci were found to be in Hardy–Weinberg equilibrium (HWE, however, population genetic parameters suggest that heterozygosity is still maintained in the population at both loci. Percent diversity and divergence matrix, as well as phylogenetic analysis revealed that the MHC Class II DRB1 gene of Rohilkhandi goats was found to be in close cluster with Garole and Scottish blackface sheep breeds as compared to other goat breeds included in the sequence comparison. Conclusion: The PCR-RFLP patterns showed population to be in HWE and absence of one genotype at one locus (BsaI, both the loci showed excess of one or the other homozygote genotype, however, effective number of alleles showed that allelic diversity is present in the population. Sequence comparison of DRB1 gene of Rohilkhandi goat with other sheep and goat breed assigned Rohilkhandi goat in divergence with Jamanupari and Angora goats.

  5. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...

  6. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  7. THE HUMAN FUMARYLACETOACETATE GENE : CHARACTERIZATION OF RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISMS AND IDENTIFICATION OF HAPLOTYPES IN TYROSINEMIA TYPE-1 AND PSEUDODEFICIENCY

    NARCIS (Netherlands)

    ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R

    Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia

  8. Molecular identification of Candida species isolated from cases of neonatal candidemia using polymerase chain reaction-restriction fragment length polymorphism in a tertiary care hospital

    Directory of Open Access Journals (Sweden)

    Akeela Fatima

    2017-01-01

    Full Text Available Context: Candida spp. is an emerging cause of bloodstream infections worldwide. Delay in speciation of Candida isolates by conventional methods and resistance to antifungal drugs in various Candida species are responsible for the increase in morbidity and mortality due to candidemia. Hence, the rapid identification of Candida isolates is very important for the proper management of patients with candidemia. Aims: The aim was to re-evaluate the identification of various Candida spp. by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP and to evaluate the accuracy, speed, and cost of phenotypic methodology versus PCR-RFLP. Settings and Design: Hospital-based cross-sectional study. Materials and Methods: Ninety consecutive clinical isolates of seven Candida species, isolated from blood of neonates and identified by routine phenotypic methods, were re-evaluated using universal primers internal transcribed spacer 1 (ITS1 and ITS4 for PCR amplification and Msp I restriction enzyme for RFLP. Statistical Analysis Used: Kappa test for agreement. Results: The results of PCR-RFLP were 100% in agreement with those obtained using conventional phenotypic methods. Identification could be achieved within 3 work days by both the methods. Our routine methods proved to be cost effective than PCR-RFLP. Conclusions: We can continue with our routine phenotypic methods and PCR-RFLP can be used for periodic quality control or when conventional methods fail to identify a species.

  9. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  10. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  11. ALIS-FLP: Amplified ligation selected fragment-length polymorphism method for microbial genotyping

    DEFF Research Database (Denmark)

    Brillowska-Dabrowska, A.; Wianecka, M.; Dabrowski, Slawomir

    2008-01-01

    A DNA fingerprinting method known as ALIS-FLP (amplified ligation selected fragment-length polymorphism) has been developed for selective and specific amplification of restriction fragments from TspRI restriction endonuclease digested genomic DNA. The method is similar to AFLP, but differs...

  12. Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

    Science.gov (United States)

    Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

    1990-01-01

    The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

  13. Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

    Energy Technology Data Exchange (ETDEWEB)

    Williams, S.D.

    1989-01-01

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P{sup 32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population.

  14. Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

    International Nuclear Information System (INIS)

    Williams, S.D.

    1989-01-01

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P 32 labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population

  15. Restriction Fragment Length Polymorphism Analysis Reveals High Levels of Genetic Divergence Among the Light Organ Symbionts of Flashlight Fish.

    Science.gov (United States)

    Wolfe, C J; Haygood, M G

    1991-08-01

    Restriction fragment length polymorphisms within the lux and 16S ribosomal RNA gene regions were used to compare unculturable bacterial light organ symbionts of several anomalopid fish species. The method of Nei and Li (1979) was used to calculate phylogenetic distance from the patterns of restriction fragment lengths of the luxA and 16S rRNA regions. Phylogenetic trees constructed from each distance matrix (luxA and 16S rDNA data) have similar branching orders. The levels of divergence among the symbionts, relative to other culturable luminous bacteria, suggests that the symbionts differ at the level of species among host fish genera. Symbiont relatedness and host geographic location do not seem to be correlated, and the symbionts do not appear to be strains of common, free-living, luminous bacteria. In addition, the small number of hybridizing fragments within the 16S rRNA region of the symbionts, compared with that of the free-living species, suggests a decrease in copy number of rRNA operons relative to free-living species. At this level of investigation, the symbiont phylogeny is consistent with the proposed phylogeny of the host fish family and suggests that each symbiont strain coevolved with its host fish species.

  16. Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

    Science.gov (United States)

    Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

    2013-09-27

    Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis

    Science.gov (United States)

    Grant T. Kirker; M. Lynn Prewitt; Walter J. Diehl; Susan V. Diehl

    2012-01-01

    The effects of wood preservatives on the bacterial community in southern yellow pine were assessed by the molecular method ‘terminal restriction fragment length polymorphism’ (T-RFLP). Stakes, treated with 0.25 % and 0.37 % ammoniacal copper quat (ACQ-C), 0.1 % and 0.25 % chlorothalonil (CTN), 0.1 % and 0.25 % CTN with 2 % butylated hydroxytoluene (BHT), and 2 % BHT...

  18. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... is comparable to typing of other H. pylori urease genes....

  19. Typing of Human Mycobacterium avium Isolates in Italy by IS1245-Based Restriction Fragment Length Polymorphism Analysis

    Science.gov (United States)

    Lari, Nicoletta; Cavallini, Michela; Rindi, Laura; Iona, Elisabetta; Fattorini, Lanfranco; Garzelli, Carlo

    1998-01-01

    All but 2 of 63 Mycobacterium avium isolates from distinct geographic areas of Italy exhibited markedly polymorphic, multibanded IS1245 restriction fragment length polymorphism (RFLP) patterns; 2 isolates showed the low-number banding pattern typical of bird isolates. By computer analysis, 41 distinct IS1245 patterns and 10 clusters of essentially identical strains were detected; 40% of the 63 isolates showed genetic relatedness, suggesting the existence of a predominant AIDS-associated IS1245 RFLP pattern. PMID:9817900

  20. Allelic sequence variations in the hypervariable region of a T-cell receptor β chain: Correlation with restriction fragment length polymorphism in human families and populations

    International Nuclear Information System (INIS)

    Robinson, M.A.

    1989-01-01

    Direct sequence analysis of the human T-cell antigen receptor (TCR) V β1 variable gene identified a single base-pair allelic variation (C/G) located within the coding region. This change results in substitution of a histidine (CAC) for a glutamine (CAG) at position 48 of the TCR β chain, a position predicted to be in the TCR antigen binding site. The V β1 polymorphism was found by DNA sequence analysis of V β1 genes from seven unrelated individuals; V β1 genes were amplified by the polymerase chain reaction, the amplified fragments were cloned into M13 phage vectors, and sequences were determined. To determined the inheritance patterns of the V β1 substitution and to test correlation with V β1 restriction fragment length polymorphism detected with Pvu II and Taq I, allele-specific oligonucleotides were constructed and used to characterize amplified DNA samples. Seventy unrelated individuals and six families were tested for both restriction fragment length polymorphism and for the V β1 substitution. The correlation was also tested using amplified, size-selected, Pvu II- and Taq I-digested DNA samples from heterozygotes. Pvu II allele 1 (61/70) and Taq I allele 1 (66/70) were found to be correlated with the substitution giving rise to a histidine at position 48. Because there are exceptions to the correlation, the use of specific probes to characterize allelic forms of TCR variable genes will provide important tools for studies of basic TCR genetics and disease associations

  1. Characterization of European Yersinia enterocolitica 1A strains using restriction fragment length polymorphism and multilocus sequence analysis.

    Science.gov (United States)

    Murros, A; Säde, E; Johansson, P; Korkeala, H; Fredriksson-Ahomaa, M; Björkroth, J

    2016-10-01

    Yersinia enterocolitica is currently divided into two subspecies: subsp. enterocolitica including highly pathogenic strains of biotype 1B and subsp. palearctica including nonpathogenic strains of biotype 1A and moderately pathogenic strains of biotypes 2-5. In this work, we characterized 162 Y. enterocolitica strains of biotype 1A and 50 strains of biotypes 2-4 isolated from human, animal and food samples by restriction fragment length polymorphism using the HindIII restriction enzyme. Phylogenetic relatedness of 20 representative Y. enterocolitica strains including 15 biotype 1A strains was further studied by the multilocus sequence analysis of four housekeeping genes (glnA, gyrB, recA and HSP60). In all the analyses, biotype 1A strains formed a separate genomic group, which differed from Y. enterocolitica subsp. enterocolitica and from the strains of biotypes 2-4 of Y. enterocolitica subsp. palearctica. Based on these results, biotype 1A strains considered nonpathogenic should not be included in subspecies palearctica containing pathogenic strains of biotypes 2-5. Yersinia enterocolitica strains are currently divided into six biotypes and two subspecies. Strains of biotype 1A, which are phenotypically and genotypically very heterogeneous, are classified as subspecies palearctica. In this study, European Y. enterocolitica 1A strains isolated from both human and nonhuman sources were characterized using restriction fragment length polymorphism and multilocus sequence analysis. The European biotype 1A strains formed a separate group, which differed from strains belonging to subspecies enterocolitica and palearctica. This may indicate that the current division between the two subspecies is not sufficient considering the strain diversity within Y. enterocolitica. © 2016 The Society for Applied Microbiology.

  2. Restriction Fragment Length Polymorphisms of Virulence Plasmids in Rhodococcus equi

    Science.gov (United States)

    Takai, Shinji; Shoda, Masato; Sasaki, Yukako; Tsubaki, Shiro; Fortier, Guillaume; Pronost, Stephane; Rahal, Karim; Becu, Teotimo; Begg, Angela; Browning, Glenn; Nicholson, Vivian M.; Prescott, John F.

    1999-01-01

    Virulent Rhodococcus equi, which is a well-known cause of pyogranulomatous pneumonia in foals, possesses a large plasmid encoding virulence-associated 15- to 17-kDa antigens. Foal and soil isolates from five countries—Argentina, Australia, Canada, France, and Japan—were investigated for the presence of 15- to 17-kDa antigens by colony blotting, using the monoclonal antibody 10G5, and the gene coding for 15- to 17-kDa antigens by PCR. Plasmid DNAs extracted from positive isolates were digested with restriction endonucleases BamHI, EcoRI, EcoT22I, and HindIII, and the digestion patterns that resulted divided the plasmids of virulent isolates into five closely related types. Three of the five types had already been reported in Canadian and Japanese isolates, and the two new types had been found in French and Japanese isolates. Therefore, we tentatively designated these five types 85-kb type I (pREAT701), 85-kb type II (a new type), 87-kb type I (EcoRI and BamHI type 2 [V. M. Nicholson and J. F. Prescott, J. Clin. Microbiol. 35:738–740, 1997]), 87-kb type II (a new type), and 90-kb (pREL1) plasmids. The 85-kb type I plasmid was found in isolates from Argentina, Australia, Canada, and France. Plasmid 87-kb type I was isolated in specimens from Argentina, Canada, and France. The 85-kb type II plasmid appeared in isolates from France. On the other hand, plasmids 87-kb type II and 90-kb were found only in isolates from Japan. These results revealed geographic differences in the distribution of the virulence plasmids found in the five countries and suggested that the restriction fragment length polymorphism of virulence plasmids might be useful to elucidate the molecular epidemiology of virulent R. equi in the world. PMID:10488224

  3. Restriction fragment length polymorphism of the HLA-DP subregion and correlations to HLA-DP phenotypes

    International Nuclear Information System (INIS)

    Hyldig-Nielsen, J.J.; Morling, N.; Oedum, N.; Ryder, L.P.; Platz, P.; Jakobsen, B.; Svejgaard, A.

    1987-01-01

    The restriction fragment length polymorphism (RFLP) of the class II HLA-DP subregion of the major histocompatibility complex (MHC) of humans has been unraveled by Southern blotting using DP/sub α/ and DP/sub β/ probes in a study of 46 unrelated individuals with known HLA-DP types. Contrary to earlier preliminary findings with a limited number of enzymes, the RFLP appears to be quite extensive both with the DP/sub β/ (14 different DNA markers defined by individual fragments or clusters thereof) and the DP/sub α/ (8 markers) probes, especially when enzyme recognizing only four base pairs were used. A few markers were absolutely or strongly associated with individual DP antigens, whereas most were associated with two or more DP antigens as defined by primed lymphocyte typing. Thus, Southern blotting seems feasible for typing for most DP determinants by specific fragments or subtraction between the various more broadly reactive DNA markers, and the RFLP provides further information on the DP subregion in addition to that provided by primed lymphocyte typing. In two recombinant families, the DP/sub β/ and DP/sub α/ DNA markers segregated with DP antigens, whereas the DR/sub β/, DQ/sub β/, DQ/sub α/, and DX/sub α/ markers followed the DR and DQ antigens

  4. Restriction fragment length polymorphism of two HLA-B-associated transcripts genes in five autoimmune diseases

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1991-01-01

    The restriction fragment length polymorphism of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, identifying polymorphic bands of 12, 8, 2.5, and 1.1 kb, and at 3.3, 2.7, 2.3, and 0.9 kb, respectively, was investigated in patients with primary biliary cirrhosis (PBC......), systemic lupus erythematosus (SLE), pauciarticular juvenile rheumatoid arthritis (P-JRA), rheumatoid arthritis (RA), and primary Sjögren's syndrome (pSS), and in healthy Danes. The BAT2/RsaI 2.7-kb band fragment was more frequent in PBC, pSS, and SLE than in controls, but the p values did not reach...... significance when corrected for multiple comparisons. For pSS and SLE, the associations may be secondary to primary associations with HLA-B8 because the BAT2/RsaI 2.3-kb band, which is allelic to the BAT2/RsaI 2.7-kb band, is strongly negatively associated with HLA-B8 and HLA-DR3. The only significance...

  5. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  6. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  7. Characterization of microbial communities found in the human vagina by analysis of terminal restriction fragment length polymorphisms of 16S rRNA genes

    NARCIS (Netherlands)

    Coolen, MJL; Post, E; Davis, CC; Forney, LJ

    2005-01-01

    To define and monitor the structure of microbial communities found in the human vagina, a cultivation-independent approach based on analyses of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes was developed and validated. Sixteen bacterial strains commonly found in the

  8. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism a...

  9. The isolation and localization of arbitrary restriction fragment length polymorphisms in Southern African populations

    International Nuclear Information System (INIS)

    Conn, V.

    1987-01-01

    The main aim of this study was to contribute to the mapping of the human genome by searching for and characterizing a number of RFLPs (restriction fragment length polymorphisms) in the human genome. The more specific aims of this study were: 1. To isolate single-copy human DNA sequences from a human genomic library. 2. To use these single-copy sequences as DNA probes to search for polymorphic variation among Caucasoid individuals. 3. To show by means of family studies that the RFLPs were inherited in a co-dominant Mendelian fashion. 4. To determine the population frequencies of these RFLPs in Southern African Populations, namely the Bantu-speaking Negroids and the San. 5. To assign these RFLP-detecting DNA sequences to human chromosomes using somatic cell hybrid lines. In this study DNA was labelled with Phosphorus 32

  10. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...... investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...... Danes. Co-dominant segregation and allelic behavior was seen for the BAT1/NcoI 12 kb and 8 kb bands and the BAT2/RsaI 2.7 kb and 2.3 kb bands, respectively. It is possible that the BAT2/RsaI 3.3 kb band represents a rare allele of the BAT2/RsaI system. The BAT2/RsaI 2.3 kb marker was strongly negatively...

  11. PCR-Restriction Fragment Length Polymorphism for Rapid, Low-Cost Identification of Isoniazid-Resistant Mycobacterium tuberculosis▿

    Science.gov (United States)

    Caws, Maxine; Tho, Dau Quang; Duy, Phan Minh; Lan, Nguyen Thi Ngoc; Hoa, Dai Viet; Torok, Mili Estee; Chau, Tran Thi Hong; Van Vinh Chau, Nguyen; Chinh, Nguyen Tran; Farrar, Jeremy

    2007-01-01

    PCR-restriction fragment length poymorphism (PCR-RFLP) is a simple, robust technique for the rapid identification of isoniazid-resistant Mycobacterium tuberculosis. One hundred consecutive isolates from a Vietnamese tuberculosis hospital were tested by MspA1I PCR-RFLP for the detection of isoniazid-resistant katG_315 mutants. The test had a sensitivity of 80% and a specificity of 100% against conventional phenotypic drug susceptibility testing. The positive and negative predictive values were 1 and 0.86, respectively. None of the discrepant isolates had mutant katG_315 codons by sequencing. The test is cheap (less than $1.50 per test), specific, and suitable for the rapid identification of isoniazid resistance in regions with a high prevalence of katG_315 mutants among isoniazid-resistant M. tuberculosis isolates. PMID:17428939

  12. Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

    Science.gov (United States)

    Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

    1999-12-01

    A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

  13. Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

    Science.gov (United States)

    Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

    2015-10-01

    Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

  14. Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats

    DEFF Research Database (Denmark)

    Kastern, W.; Dyrberg, T.; Scholler, J.

    1984-01-01

    DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...

  15. Fragment Length of Circulating Tumor DNA.

    Science.gov (United States)

    Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

    2016-07-01

    Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

  16. Genetic identification of the main opportunistic Mucorales by PCR-restriction fragment length polymorphism.

    Science.gov (United States)

    Machouart, M; Larché, J; Burton, K; Collomb, J; Maurer, P; Cintrat, A; Biava, M F; Greciano, S; Kuijpers, A F A; Contet-Audonneau, N; de Hoog, G S; Gérard, A; Fortier, B

    2006-03-01

    Mucormycosis is a rare and opportunistic infection caused by fungi belonging to the order Mucorales. Recent reports have demonstrated an increasing incidence of mucormycosis, which is frequently lethal, especially in patients suffering from severe underlying conditions such as immunodeficiency. In addition, even though conventional mycology and histopathology assays allow for the identification of Mucorales, they often fail in offering a species-specific diagnosis. Due to the lack of other laboratory tests, a precise identification of these molds is thus notoriously difficult. In this study we aimed to develop a molecular biology tool to identify the main Mucorales involved in human pathology. A PCR strategy selectively amplifies genomic DNA from molds belonging to the genera Absidia, Mucor, Rhizopus, and Rhizomucor, excluding human DNA and DNA from other filamentous fungi and yeasts. A subsequent digestion step identified the Mucorales at genus and species level. This technique was validated using both fungal cultures and retrospective analyses of clinical samples. By enabling a rapid and precise identification of Mucorales strains in infected patients, this PCR-restriction fragment length polymorphism-based method should help clinicians to decide on the appropriate treatment, consequently decreasing the mortality of mucormycosis.

  17. High-sensitivity stable-isotope probing by a quantitative terminal restriction fragment length polymorphism protocol.

    Science.gov (United States)

    Andeer, Peter; Strand, Stuart E; Stahl, David A

    2012-01-01

    Stable-isotope probing (SIP) has proved a valuable cultivation-independent tool for linking specific microbial populations to selected functions in various natural and engineered systems. However, application of SIP to microbial populations with relatively minor buoyant density increases, such as populations that utilize compounds as a nitrogen source, results in reduced resolution of labeled populations. We therefore developed a tandem quantitative PCR (qPCR)-TRFLP (terminal restriction fragment length polymorphism) protocol that improves resolution of detection by quantifying specific taxonomic groups in gradient fractions. This method combines well-controlled amplification with TRFLP analysis to quantify relative taxon abundance in amplicon pools of FAM-labeled PCR products, using the intercalating dye EvaGreen to monitor amplification. Method accuracy was evaluated using mixtures of cloned 16S rRNA genes, DNA extracted from low- and high-G+C bacterial isolates (Escherichia coli, Rhodococcus, Variovorax, and Microbacterium), and DNA from soil microcosms amended with known amounts of genomic DNA from bacterial isolates. Improved resolution of minor shifts in buoyant density relative to TRFLP analysis alone was confirmed using well-controlled SIP analyses.

  18. Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

    Science.gov (United States)

    Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

    2006-01-01

    Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

  19. Towards the molecular characterisation of parasitic nematode assemblages: an evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis.

    Science.gov (United States)

    Lott, M J; Hose, G C; Power, M L

    2014-09-01

    Identifying factors which regulate temporal and regional structuring within parasite assemblages requires the development of non-invasive techniques which facilitate both the rapid discrimination of individual parasites and the capacity to monitor entire parasite communities across time and space. To this end, we have developed and evaluated a rapid fluorescence-based method, terminal restriction fragment length polymorphism (T-RFLP) analysis, for the characterisation of parasitic nematode assemblages in macropodid marsupials. The accuracy with which T-RFLP was capable of distinguishing between the constituent taxa of a parasite community was assessed by comparing sequence data from two loci (the ITS+ region of nuclear ribosomal DNA and the mitochondrial CO1) across ∼20 species of nematodes (suborder Strongylida). Our results demonstrate that with fluorescent labelling of the forward and reverse terminal restriction fragments (T-RFs) of the ITS+ region, the restriction enzyme Hinf1 was capable of generating species specific T-RFLP profiles. A notable exception was within the genus Cloacina, in which closely related species often shared identical T-RFs. This may be a consequence of the group's comparatively recent evolutionary radiation. While the CO1 displayed higher sequence diversity than the ITS+, the subsequent T-RFLP profiles were taxonomically inconsistent and could not be used to further differentiate species within Cloacina. Additionally, several of the ITS+ derived T-RFLP profiles exhibited unexpected secondary peaks, possibly as a consequence of the restriction enzymes inability to cleave partially single stranded amplicons. These data suggest that the question of T-RFLPs utility in monitoring parasite communities cannot be addressed without considering the ecology and unique evolutionary history of the constituent taxa. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  1. Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

    Directory of Open Access Journals (Sweden)

    Fei Cheng

    Full Text Available Abstract Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high purity DNA from soil microbiota, five prewashing agents were compared in terms of their efficiency and effectiveness in removing soil contaminants. Residual contaminants were precipitated by adding 0.6 mL of 0.5 M CaCl2. Four cell lysis methods were applied to test their compatibility with the pretreatment (prewashing + Ca2+ flocculation and to ultimately identify the optimal cell lysis method for analyzing fungal communities in forest soils. The results showed that pretreatment with TNP + Triton X-100 + skim milk (100 mM Tris, 100 mM Na4P2O7, 1% polyvinylpyrrolidone, 100 mM NaCl, 0.05% Triton X-100, 4% skim milk, pH 10.0 removed most soil humic contaminants. When the pretreatment was combined with Ca2+ flocculation, the purity of all soil DNA samples was further improved. DNA samples obtained by the fast glass bead-beating method (MethodFGB had the highest purity. The resulting DNA was successfully used, without further purification steps, as a template for polymerase chain reaction targeting fungal internal transcribed spacer regions. The results obtained by terminal restriction fragment length polymorphism analysis indicated that the MethodFGB revealed greater fungal diversity and more distinctive community structure compared with the other methods tested. Our study provides a protocol for fungal cell lysis in soil, which is fast, convenient, and effective for analyzing fungal communities in forest soils.

  2. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  3. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing.

    NARCIS (Netherlands)

    Huyen, M.N.; Kremer, K.; Lan, N.T.; Buu, T.N.; Cobelens, F.G.; Tiemersma, E.W.; Haas, P. de; Soolingen, D. van

    2013-01-01

    BACKGROUND: In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard

  4. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

    NARCIS (Netherlands)

    Huyen, Mai N. T.; Kremer, Kristin; Lan, Nguyen T. N.; Buu, Tran N.; Cobelens, Frank G. J.; Tiemersma, Edine W.; de Haas, Petra; van Soolingen, Dick

    2013-01-01

    In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of

  5. Molecular analysis of Leptospira spp. isolated from humans by restriction fragment length polymorphism, real-time PCR and pulsed-field gel electrophoresis.

    Science.gov (United States)

    Turk, Nenad; Milas, Zoran; Mojcec, Vesna; Ruzic-Sabljic, Eva; Staresina, Vilim; Stritof, Zrinka; Habus, Josipa; Postic, Daniele

    2009-11-01

    A total of 17 Leptospira clinical strains isolated from humans in Croatia were serologically and genetically analysed. For serovar identification, the microscopic agglutination test (MAT) and pulsed-field gel electrophoresis (PFGE) were used. To identify isolates on genomic species level, PCR-based restriction fragment length polymorphism (RFLP) and real-time PCR were performed. MAT revealed the following serogroup affinities: Grippotyphosa (seven isolates), Icterohaemorrhagiae (eight isolates) and Javanica (two isolates). RFLP of PCR products from a 331-bp-long fragment of rrs (16S rRNA gene) digested with endonucleases MnlI and DdeI and real-time PCR revealed three Leptospira genomic species. Grippotyphosa isolates belonged to Leptospira kirschneri, Icterohaemorrhagiae isolates to Leptospira interrogans and Javanica isolates to Leptospira borgpetersenii. Genomic DNA from 17 leptospiral isolates was digested with NotI and SgrAI restriction enzymes and analysed by PFGE. Results showed that seven isolates have the same binding pattern to serovar Grippotyphosa, eight isolates to serovar Icterohaemorrhagiae and two isolates to serovar Poi. Results demonstrate the diversity of leptospires circulating in Croatia. We point out the usefulness of a combination of PFGE, RFLP and real-time PCR as appropriate molecular methods in molecular analysis of leptospires.

  6. Comparative study of IS6110 restriction fragment length polymorphism and variable-number tandem-repeat typing of Mycobacterium tuberculosis isolates in the Netherlands, based on a 5-year nationwide survey

    NARCIS (Netherlands)

    de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip; van Soolingen, Dick

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

  7. Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

    NARCIS (Netherlands)

    Beer, J.L. de; Ingen, J. van; Vries, G. de; Erkens, C.; Sebek, M.; Mulder, A.; Sloot, R.; Brandt, A.M. van den; Enaimi, M.; Kremer, K.; Supply, P.; Soolingen, D. van

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

  8. Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

    1999-09-01

    Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

  9. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including...... Mycoplasma genitalium (n = 11), Mycoplasma pneumoniae (n = 5), Mycoplasma hominis (n = 5), Mycoplasma hyopneunmoniae (n = 9), Myco plasma flocculare (n = 5), Mycoplasma hyosynoviae (n = 10), and Mycoplasma dispar (n = 5), AFLP templates were prepared by the digestion of mycoplasmal DNA with BglII and Mfe...... to discriminate the analyzed strains at species and intraspecies levels as well, Each of the tested Mycoplasma species developed a banding pattern entirely different from those obtained from other species under analysis, Subtle intraspecies genomic differences were detected among strains of all of the Mycoplasma...

  10. Molecular Characterization of Yeast Strains Isolated from Different Sources by Restriction Fragment Length Polymorphism

    International Nuclear Information System (INIS)

    Ali, M. S.; Latif, Z.

    2016-01-01

    Various molecular techniques like analysis of the amplified rDNA internal transcribed spacers (ITS), intragenic spacers and total ITS region analysis by restriction fragment length polymorphism (RFLP) has been introduced for yeast identification but there are limited databases to identify yeast species on the basis of 5.8S rDNA. In this study, twenty nine yeast strains from various sources including spoiled fruits, vegetables, foodstuffs, and concentrated juices were characterized by PCR-RFLP. PCR-RFLP has been used to characterize yeasts present in different spoiled food samples after isolation of the yeasts. By using this technique, the isolated yeast strains were characterized by direct 5.8S-ITS rDNA region amplification. RFLP analysis was applied to each of the amplification products (varied from 400bp to 800bp) detected, and the corresponding yeast identifications were made according to each specific restriction patterns obtained after treatment with two endonucleases TaqI and HaeIII which yielded a specific banding pattern for each species. For further confirmation amplified products of eleven selected isolates were sequenced and blast on NCBI. Both RFLP and sequence analyses of the strains with accession nos. KF472163, KF472164, KF472165, KF472166, KF472167, KF472168, KF472169, KF472170, KF472171, KF472172, KF472173 gave significantly similar results. The isolates were found to belong five different yeast species including; Candida spp., Pichia spp., Kluyveromyces spp., Clavispora spp. and Hanseniaspora spp. This method provides a fast, easy, reliable and authentic way for determining yeast population present in different type of samples, as compared to traditional characterization technique. (author)

  11. Pst I restriction fragment length polymorphism of the human placental alkaline phosphatase gene in normal placentae and tumors

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.

    1987-01-01

    The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia

  12. Interpreting ecological diversity indices applied to terminal restriction fragment length polymorphism data: insights from simulated microbial communities.

    Science.gov (United States)

    Blackwood, Christopher B; Hudleston, Deborah; Zak, Donald R; Buyer, Jeffrey S

    2007-08-01

    Ecological diversity indices are frequently applied to molecular profiling methods, such as terminal restriction fragment length polymorphism (T-RFLP), in order to compare diversity among microbial communities. We performed simulations to determine whether diversity indices calculated from T-RFLP profiles could reflect the true diversity of the underlying communities despite potential analytical artifacts. These include multiple taxa generating the same terminal restriction fragment (TRF) and rare TRFs being excluded by a relative abundance (fluorescence) threshold. True community diversity was simulated using the lognormal species abundance distribution. Simulated T-RFLP profiles were generated by assigning each species a TRF size based on an empirical or modeled TRF size distribution. With a typical threshold (1%), the only consistently useful relationship was between Smith and Wilson evenness applied to T-RFLP data (TRF-E(var)) and true Shannon diversity (H'), with correlations between 0.71 and 0.81. TRF-H' and true H' were well correlated in the simulations using the lowest number of species, but this correlation declined substantially in simulations using greater numbers of species, to the point where TRF-H' cannot be considered a useful statistic. The relationships between TRF diversity indices and true indices were sensitive to the relative abundance threshold, with greatly improved correlations observed using a 0.1% threshold, which was investigated for comparative purposes but is not possible to consistently achieve with current technology. In general, the use of diversity indices on T-RFLP data provides inaccurate estimates of true diversity in microbial communities (with the possible exception of TRF-E(var)). We suggest that, where significant differences in T-RFLP diversity indices were found in previous work, these should be reinterpreted as a reflection of differences in community composition rather than a true difference in community diversity.

  13. M protein typing of Thai group A streptococcal isolates by PCR-Restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    Good Michael F

    2005-10-01

    Full Text Available Abstract Background Group A streptococcal (GAS infections can lead to the development of severe post-infectious sequelae, such as rheumatic fever (RF and rheumatic heart disease (RHD. RF and RHD are a major health concern in developing countries, and in indigenous populations of developed nations. The majority of GAS isolates are M protein-nontypeable (MNT by standard serotyping. However, GAS typing is a necessary tool in the epidemiologically analysis of GAS and provides useful information for vaccine development. Although DNA sequencing is the most conclusive method for M protein typing, this is not a feasible approach especially in developing countries. To overcome this problem, we have developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP-based assay for molecular typing the M protein gene (emm of GAS. Results Using one pair of primers, 13 known GAS M types showed one to four bands of PCR products and after digestion with Alu I, they gave different RFLP patterns. Of 106 GAS isolates examined from the normal Thai population and from patients with GAS-associated complications including RHD, 95 isolates gave RFLP patterns that corresponded to the 13 known M types. Only 11 isolates gave RFLP patterns that differed from the 13 known M types. These were then analyzed by DNA sequencing and six additional M types were identified. In addition, we found that M93 GAS was the most common M type in the population studied, and is consistent with a previous study of Thai GAS isolates. Conclusion PCR-RFLP analysis has the potential for the rapid screening of different GAS M types and is therefore considerably advantageous as an alternative M typing approach in developing countries in which GAS is endemic.

  14. Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

    Science.gov (United States)

    Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

    2008-01-01

    A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

  15. Genetic Diversity among Rhizobium leguminosarum bv. Trifolii Strains Revealed by Allozyme and Restriction Fragment Length Polymorphism Analyses

    Science.gov (United States)

    Demezas, David H.; Reardon, Terry B.; Watson, John M.; Gibson, Alan H.

    1991-01-01

    Allozyme electrophoresis and restriction fragment length polymorphism (RFLP) analyses were used to examine the genetic diversity of a collection of 18 Rhizobium leguminosarum bv. trifolii, 1 R. leguminosarum bv. viciae, and 2 R. meliloti strains. Allozyme analysis at 28 loci revealed 16 electrophoretic types. The mean genetic distance between electrophoretic types of R. leguminosarum and R. meliloti was 0.83. Within R. leguminosarum, the single strain of bv. viciae differed at an average of 0.65 from strains of bv. trifolii, while electrophoretic types of bv. trifolii differed at a range of 0.23 to 0.62. Analysis of RFLPs around two chromosomal DNA probes also delineated 16 unique RFLP patterns and yielded genetic diversity similar to that revealed by the allozyme data. Analysis of RFLPs around three Sym (symbiotic) plasmid-derived probes demonstrated that the Sym plasmids reflect genetic divergence similar to that of their bacterial hosts. The large genetic distances between many strains precluded reliable estimates of their genetic relationships. PMID:16348600

  16. Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

    International Nuclear Information System (INIS)

    Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

    1990-01-01

    The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

  17. Intestinal microbiota is different in women with preterm birth: results from terminal restriction fragment length polymorphism analysis.

    Directory of Open Access Journals (Sweden)

    Arihiro Shiozaki

    Full Text Available Preterm birth is a leading cause of perinatal morbidity and mortality. Studies using a cultivation method or molecular identification have shown that bacterial vaginosis is one of the risk factors for preterm birth. However, an association between preterm birth and intestinal microbiota has not been reported using molecular techniques, although the vaginal microbiota changes during pregnancy. Our aim here was to clarify the difference in intestinal and vaginal microbiota between women with preterm birth and women without preterm labor. 16S ribosomal ribonucleic acid genes were amplified from fecal and vaginal DNA by polymerase chain reaction. Using terminal restriction fragment length polymorphism (T-RFLP, we compared the levels of operational taxonomic units of both intestinal and vaginal flora among three groups: pregnant women who delivered term babies without preterm labor (non-PTL group (n = 20, those who had preterm labor but delivered term babies (PTL group (n = 11, and those who had preterm birth (PTB group (n = 10. Significantly low levels of Clostridium subcluster XVIII, Clostridium cluster IV, Clostridium subcluster XIVa, and Bacteroides, and a significantly high level of Lactobacillales were observed in the intestinal microbiota in the PTB group compared with those in the non-PTL group. The levels of Clostridium subcluster XVIII and Clostridium subcluster XIVa in the PTB group were significantly lower than those in the PTL group, and these levels in the PTL group were significantly lower than those in non-PTL group. However, there were no significant differences in vaginal microbiota among the three groups. Intestinal microbiota in the PTB group was found to differ from that in the non-PTL group using the T-RFLP method.

  18. Intestinal microbiota is different in women with preterm birth: results from terminal restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Shiozaki, Arihiro; Yoneda, Satoshi; Yoneda, Noriko; Yonezawa, Rika; Matsubayashi, Takamichi; Seo, Genichiro; Saito, Shigeru

    2014-01-01

    Preterm birth is a leading cause of perinatal morbidity and mortality. Studies using a cultivation method or molecular identification have shown that bacterial vaginosis is one of the risk factors for preterm birth. However, an association between preterm birth and intestinal microbiota has not been reported using molecular techniques, although the vaginal microbiota changes during pregnancy. Our aim here was to clarify the difference in intestinal and vaginal microbiota between women with preterm birth and women without preterm labor. 16S ribosomal ribonucleic acid genes were amplified from fecal and vaginal DNA by polymerase chain reaction. Using terminal restriction fragment length polymorphism (T-RFLP), we compared the levels of operational taxonomic units of both intestinal and vaginal flora among three groups: pregnant women who delivered term babies without preterm labor (non-PTL group) (n = 20), those who had preterm labor but delivered term babies (PTL group) (n = 11), and those who had preterm birth (PTB group) (n = 10). Significantly low levels of Clostridium subcluster XVIII, Clostridium cluster IV, Clostridium subcluster XIVa, and Bacteroides, and a significantly high level of Lactobacillales were observed in the intestinal microbiota in the PTB group compared with those in the non-PTL group. The levels of Clostridium subcluster XVIII and Clostridium subcluster XIVa in the PTB group were significantly lower than those in the PTL group, and these levels in the PTL group were significantly lower than those in non-PTL group. However, there were no significant differences in vaginal microbiota among the three groups. Intestinal microbiota in the PTB group was found to differ from that in the non-PTL group using the T-RFLP method.

  19. A Restriction Fragment Length Polymorphism Map and Electrophoretic Karyotype of the Fungal Maize Pathogen Cochliobolus Heterostrophus

    Science.gov (United States)

    Tzeng, T. H.; Lyngholm, L. K.; Ford, C. F.; Bronson, C. R.

    1992-01-01

    A restriction fragment length polymorphism (RFLP) map has been constructed of the nuclear genome of the plant pathogenic ascomycete Cochliobolus heterostrophus. The segregation of 128 RFLP and 4 phenotypic markers was analyzed among 91 random progeny of a single cross; linkages were detected among 126 of the markers. The intact chromosomal DNAs of the parents and certain progeny were separated using pulsed field gel electrophoresis and hybridized with probes used to detect the RFLPs. In this way, 125 markers were assigned to specific chromosomes and linkages among 120 of the markers were confirmed. These linkages totalled 941 centimorgans (cM). Several RFLPs and a reciprocal translocation were identified tightly linked to Tox1, a locus controlling host-specific virulence. Other differences in chromosome arrangement between the parents were also detected. Fourteen gaps of at least 40 cM were identified between linkage groups on the same chromosomes; the total map length was therefore estimated to be, at a minimum, 1501 cM. Fifteen A chromosomes ranging from about 1.3 megabases (Mb) to about 3.7 Mb were identified; one of the strains also has an apparent B chromosome. This chromosome appears to be completely dispensable; in some progeny, all of 15 markers that mapped to this chromosome were absent. The total genome size was estimated to be roughly 35 Mb. Based on these estimates of map length and physical genome size, the average kb/cM ratio in this cross was calculated to be approximately 23. This low ratio of physical to map distance should make this RFLP map a useful tool for cloning genes. PMID:1346261

  20. Genotyping of the fish rhabdovirus, viral haemorrhagic septicaemia virus, by restriction fragment length polymorphisms

    DEFF Research Database (Denmark)

    Einer-Jensen, Katja; Winton, J.; Lorenzen, Niels

    2005-01-01

    The aim of this study was to develop a standardized molecular assay that used limited resources and equipment for routine genotyping of isolates of the fish rhabdovirus, viral haemorrhagic septicaemia virus (VHSV). Computer generated restriction maps, based on 62 unique full-length (1524 nt....... Experimental evaluation of the method consisted of three steps: (i) RT-PCR amplification of the G-gene of VHSV isolates using purified viral RNA as template, (ii) digestion of the PCR products with a panel of restriction endonucleases and (iii) interpretation of the resulting RFLP profiles. The RFLP analysis...

  1. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Legrain, R.

    1984-08-01

    Projectile and nuclear fragmentation are defined and processes referred to are recalled. The two different aspects of fragmentation are considered but the emphasis is also put on heavy ion induced reactions. The preliminary results of an experiment performed at GANIL to study peripheral heavy ions induced reactions at intermediate energy are presented. The results of this experiment will illustrate the characteristics of projectile fragmentation and this will also give the opportunity to study projectile fragmentation in the transition region. Then nuclear fragmentation is considered which is associated with more central collisions in the case of heavy ion induced reactions. This aspect of fragmentation is also ilustrated with two heavy ion experiments in which fragments emitted at large angle have been observed

  2. Single Cystosorus Isolate Production and Restriction Fragment Length Polymorphism Characterization of the Obligate Biotroph Spongospora subterranea f. sp. subterranea.

    Science.gov (United States)

    Qu, Xinshun; Christ, Barbara J

    2006-10-01

    ABSTRACT Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.

  3. Mycobacterium avium restriction fragment lenght polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains

    Directory of Open Access Journals (Sweden)

    Patrícia Carvalho de Sequeira

    2005-11-01

    Full Text Available Simple double repetitive element polymerase chain reaction (MaDRE-PCR and Pvu II-IS1245 restriction fragment length polymorphism (RFLP typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 Aids inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

  4. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  5. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  6. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...

  7. Determination of locust bean gum and guar gum by polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Meyer, K; Rosa, C; Hischenhuber, C; Meyer, R

    2001-01-01

    A polymerase chain reaction (PCR) was developed to differentiate the thickening agents locust bean gum (LBG) and the cheaper guar gum in finished food products. Universal primers for amplification of the intergenic spacer region between trnL 3' (UAA) exon and trnF (GAA) gene in the chloroplast (cp) genome and subsequent restriction analysis were applied to differentiate guar gum and LBG. The presence of guar gum powder added to LBG powder was detectable. Based on data obtained from sequencing this intergenic spacer region, a second PCR method for the specific detection of guar gum DNA was also developed. This assay detected guar gum powder in LBG in amounts as low as 1% (w/w). Both methods successfully detected guar gum and/or LBG in ice cream stabilizers and in foodstuffs, such as dairy products, ice cream, dry seasoning mixes, a finished roasting sauce, and a fruit jelly product, but not in products with highly degraded DNA, such as tomato ketchup and sterilized chocolate cream. Both methods detected guar gum and LBG in ice cream and fresh cheese at levels <0.1%.

  8. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.

    1988-01-01

    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site

  9. Terminal Restriction Fragment Length Polymorphism Analysis of Soil Bacterial Communities under Different Vegetation Types in Subtropical Area.

    Directory of Open Access Journals (Sweden)

    Zeyan Wu

    Full Text Available Soil microbes are active players in energy flow and material exchange of the forest ecosystems, but the research on the relationship between the microbial diversity and the vegetation types is less conducted, especially in the subtropical area of China. In this present study, the rhizosphere soils of evergreen broad-leaf forest (EBF, coniferous forest (CF, subalpine dwarf forest (SDF and alpine meadow (AM were chosen as test sites. Terminal-restriction fragment length polymorphisms (T-RFLP analysis was used to detect the composition and diversity of soil bacterial communities under different vegetation types in the National Natural Reserve of Wuyi Mountains. Our results revealed distinct differences in soil microbial composition under different vegetation types. Total 73 microbes were identified in soil samples of the four vegetation types, and 56, 49, 46 and 36 clones were obtained from the soils of EBF, CF, SDF and AM, respectively, and subsequently sequenced. The Actinobacteria, Fusobacterium, Bacteroidetes and Proteobacteria were the most predominant in all soil samples. The order of Shannon-Wiener index (H of all soil samples was in the order of EBF>CF>SDF>AM, whereas bacterial species richness as estimated by four restriction enzymes indicated no significant difference. Principal component analysis (PCA revealed that the soil bacterial communities' structures of EBF, CF, SDF and AM were clearly separated along the first and second principal components, which explained 62.17% and 31.58% of the total variance, respectively. The soil physical-chemical properties such as total organic carbon (TOC, total nitrogen (TN, total phosphorus (TP and total potassium (TK were positively correlated with the diversity of bacterial communities.

  10. Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

    Science.gov (United States)

    McMeel, O M; Hoey, E M; Ferguson, A

    2001-01-01

    The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

  11. Transmission of tuberculosis in Havana, Cuba: a molecular epidemiological study by IS6110 restriction fragment length polymorphism typing

    Directory of Open Access Journals (Sweden)

    Diaz R

    2001-01-01

    Full Text Available The combination of molecular and conventional epidemiological methods has improved the knowledge about the transmission of tuberculosis in urban populations. To examine transmission of tuberculosis in Havana, Cuba, with DNA fingerprinting, we studied 51 out of 92 Mycobacterium tuberculosis strains isolated from tuberculosis patients who resided in Havana and whose infection was culture-confirmed in the period from September 1997 to March 1998. Isolates from 28 patients (55% had unique IS6110 restriction fragment length polymorphism (RFLP patterns, while isolates from 23 others (45% had identical patterns and belonged to 7 clusters. Three clusters consisting of six, five and two cases were each related to small outbreaks that occurred in a closed setting. Three other clustered cases were linked to a large outbreak that occurred in another institution. Younger patients were more correlated to clustering than older ones. The finding that 45% of the isolates had clustered RFLP patterns suggests that recent transmission is a key factor in the tuberculosis cases in Havana. The IS6110 RFLP typing made it possible to define the occurrence of outbreaks in two closed institutions.

  12. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  13. IS1245 restriction fragment length polymorphism typing of Mycobacterium avium from patients admitted to a reference hospital in Campinas, Brazil

    Directory of Open Access Journals (Sweden)

    A.C. Panunto

    2003-10-01

    Full Text Available Mycobacterium avium is an important pathogen among immunodeficient patients, especially patients with AIDS. The natural history of this disease is unclear. Several environmental sources have been implicated as the origin of this infection. Polyclonal infection with this species is observed, challenging the understanding of its pathogenesis and treatment. In the present study 45 M. avium strains were recovered from 39 patients admitted to a reference hospital between 1996 and 1998. Species identification was performed using a species-specific nucleic acid hybridization test (AccuProbe® from Gen-Probe®. Strains were genotyped using IS1245 restriction fragment length polymorphism typing. Blood was the main source of the organism. In one patient with disseminated disease, M. avium could be recovered more than once from potentially sterile sites. Strains isolated from this patient had different genotypes, indicating that the infection was polyclonal. Four patient clones were characterized in this population, the largest clone being detected in eight patients. This finding points to a common-source transmission of the organism.

  14. An Imaging System for Automated Characteristic Length Measurement of Debrisat Fragments

    Science.gov (United States)

    Moraguez, Mathew; Patankar, Kunal; Fitz-Coy, Norman; Liou, J.-C.; Sorge, Marlon; Cowardin, Heather; Opiela, John; Krisko, Paula H.

    2015-01-01

    The debris fragments generated by DebriSat's hypervelocity impact test are currently being processed and characterized through an effort of NASA and USAF. The debris characteristics will be used to update satellite breakup models. In particular, the physical dimensions of the debris fragments must be measured to provide characteristic lengths for use in these models. Calipers and commercial 3D scanners were considered as measurement options, but an automated imaging system was ultimately developed to measure debris fragments. By automating the entire process, the measurement results are made repeatable and the human factor associated with calipers and 3D scanning is eliminated. Unlike using calipers to measure, the imaging system obtains non-contact measurements to avoid damaging delicate fragments. Furthermore, this fully automated measurement system minimizes fragment handling, which reduces the potential for fragment damage during the characterization process. In addition, the imaging system reduces the time required to determine the characteristic length of the debris fragment. In this way, the imaging system can measure the tens of thousands of DebriSat fragments at a rate of about six minutes per fragment, compared to hours per fragment in NASA's current 3D scanning measurement approach. The imaging system utilizes a space carving algorithm to generate a 3D point cloud of the article being measured and a custom developed algorithm then extracts the characteristic length from the point cloud. This paper describes the measurement process, results, challenges, and future work of the imaging system used for automated characteristic length measurement of DebriSat fragments.

  15. KERAGAMAN GENETIK BENIH IKAN KERAPU SUNU, Plectrophomus leopardus TURUNAN PERTAMA (F1 DENGAN ANALISIS RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP MT-DNA

    Directory of Open Access Journals (Sweden)

    Gusti Ngurah Permana

    2016-11-01

    The variability of differences size was occurred on every culture period of coral trout. The aimed of this study was to know genetics variability and evaluated of which are expressed on large, medium, and small size fry on total of length sizes and different weight. Amplification of single fragment using set primer 16 SrDNA (F5’CGCCTG TTTAACAAAAACAT-3’ and reverse (R: 5’-CCGGTCTGAACTCAGATCATGT-3’. Result showed that PCR amplification of mt-DNA was 625 bp. Restriction digestion processed with Mnl I enzyme showed that polymorphism in large size and monomorphic in both medium and small sizes. Two types of haplotype were found in large size (ABABB and ABAAB while one haplotype observed in medium and small sizes ABABB. The heterozygosities value of large, medium and small sizes from Bali location were 0.480, 0.000, and 0.000 restectively. Heterozygosities value of samples from East Java were 0.211, 0.000, and 0.000 restectively. Samples from Lampung were monomorphic (0.000.

  16. Characterization of Mycoplasma hyosynoviae strains by amplified fragment length polymorphism analysis, pulsed-field gel electrophoresis and 16S ribosomal DNA sequencing

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Ahrens, Peter

    2002-01-01

    , were investigated by analysis of amplified fragment length polymorphisms of the Bgl II and Mfe I restriction sites and by pulsed-field gel electrophoresis of a Bss HII digest of chromosomal DNA. Both methods allowed unambiguous differentiation of the analysed strains and showed similar discriminatory...

  17. A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students

    Science.gov (United States)

    DiBartolomeis, Susan M.

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky73. Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers. PMID:21364104

  18. Discrimination among individuals using terminal restriction fragment length polymorphism profiling of bacteria derived from forensic evidence.

    Science.gov (United States)

    Nishi, Eiji; Tashiro, Yukihiro; Sakai, Kenji

    2015-05-01

    DNA typing from forensic evidence is commonly used to identify individuals. However, when the quantity of the forensic evidence is insufficient, successful identification using DNA typing is impossible. Such evidence may also contain DNA from bacteria that occur naturally on the skin. In this study, we aimed to establish a profiling method using terminal restriction fragment length polymorphisms (T-RFLPs) of the amplified bacterial 16S ribosomal RNA (rRNA) gene. First, the extraction and digestion processes were investigated, and the T-RFLP profiling method using the 16S rRNA gene amplicon was optimized. We then used this method to compare the profiles of bacterial flora from the hands of 12 different individuals. We found that the T-RFLP profiles from one person on different days displayed higher similarity than those between individuals. In a principal component analysis (PCA), T-RFLPs from each individual were closely clustered in 11 out of 12 cases. The clusters could be distinguished from each other, even when the samples were collected from different conditions. No major change of the profile was observed after six months except in two cases. When handprints on glass plates were compared, 11 of 12 individuals were assigned to a few clusters including the cluster corresponding to the correct individual. In conclusion, a method for reproducible T-RFLP profiling of bacteria from trace amounts of handprints was established. The profiles were obtained for particular individuals clustered in PCA and were experimentally separable from other individuals in most cases. This technique could provide useful information for narrowing down a suspect in a criminal investigation.

  19. Monitoring of antibiotic-induced alterations in the human intestinal microflora and detection of probiotic strains by use of terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Jernberg, Cecilia; Sullivan, Asa; Edlund, Charlotta; Jansson, Janet K

    2005-01-01

    Terminal restriction fragment length polymorphism (T-RFLP) was investigated as a tool for monitoring the human intestinal microflora during antibiotic treatment and during ingestion of a probiotic product. Fecal samples from eight healthy volunteers were taken before, during, and after administration of clindamycin. During treatment, four subjects were given a probiotic, and four subjects were given a placebo. Changes in the microbial intestinal community composition and relative abundance of specific microbial populations in each subject were monitored by using viable counts and T-RFLP fingerprints. T-RFLP was also used to monitor specific bacterial populations that were either positively or negatively affected by clindamycin. Some dominant bacterial groups, such as Eubacterium spp., were easily monitored by T-RFLP, while they were hard to recover by cultivation. Furthermore, the two probiotic Lactobacillus strains were easily tracked by T-RFLP and were shown to be the dominant Lactobacillus community members in the intestinal microflora of subjects who received the probiotic.

  20. Molecular characterization of Mycobacterium tuberculosis isolates from Tehran, Iran by restriction fragment length polymorphism analysis and spoligotyping

    Directory of Open Access Journals (Sweden)

    Seifu Gizaw Feyisa

    2016-04-01

    Full Text Available Abstract: INTRODUCTION Characterization of Mycobacterium tuberculosis (MTB isolates by DNA fingerprinting has contributed to tuberculosis (TB control. The aim of this study was to determine the genetic diversity of MTB isolates from Tehran province in Iran. METHODS MTB isolates from 60 Iranian and 10 Afghan TB patients were fingerprinted by standard IS6110-restriction fragment length polymorphism (RFLP analysis and spoligotyping. RESULTS The copy number of IS6110 ranged from 10-24 per isolate. The isolates were classified into 22 clusters showing ≥ 80% similarity by RFLP analysis. Fourteen multidrug-resistant (MDR isolates were grouped into 4 IS6110-RFLP clusters, with 10 isolates [71% (95% CI: 45-89%] in 1 cluster, suggesting a possible epidemiological linkage. Eighteen Iranian isolates showed ≥ 80% similarity with Afghan isolates. There were no strains with identical fingerprints. Spoligotyping of 70 isolates produced 23 distinct patterns. Sixty (85.7% isolates were grouped into 13 clusters, while the remaining 10 isolates (14.2% were not clustered. Ural (formerly Haarlem4 (n = 22, 31.4% was the most common family followed by Central Asian strain (CAS (n = 18, 25.7% and T (n = 9, 12.8% families. Only 1strain was characterized as having the Beijing genotype. Among 60 Iranian and 10 Afghan MTB isolates, 25% (95% CI: 16-37 and 70% (95% CI: 39-89 were categorized as Ural lineage, respectively. CONCLUSIONS A higher prevalence of Ural family MTB isolates among Afghan patients than among Iranian patients suggests the possible transmission of this lineage following the immigration of Afghans to Iran.

  1. Genetic analysis of autoimmune gld mice. I. Identification of a restriction fragment length polymorphism closely linked to the gld mutation within a conserved linkage group

    Science.gov (United States)

    1988-01-01

    A linkage map of distal mouse chromosome 1 was generated using restriction fragment length polymorphism (RFLP) analysis of DNA prepared from 95 [C3H-gld/gld X Mus spretus)F1 X C3H-gld/gld] backcross mice. The gene order was: (centromere) C4bp, Ren-1,2, Ly-5, [At-3/gld], Apoa-2/Ly-17, Spna-1 (telomere). All mice expressing the phenotype of gld homozygotes were homozygous for the At-3 RFLP characteristic of C3H mice and none of the mice heterozygous for At-3 RFLPs had characteristics of gld homozygotes, demonstrating close linkage between these genes. The identification of an RFLP closely linked to the gld gene provides a starting point for the identification of a genetic defect that results in abnormal T cells and autoimmune disease. PMID:2894402

  2. Diversity analysis of bacterial community compositions in sediments of urban lakes by terminal restriction fragment length polymorphism (T-RFLP).

    Science.gov (United States)

    Zhao, Dayong; Huang, Rui; Zeng, Jin; Yan, Wenming; Wang, Jianqun; Ma, Ting; Wang, Meng; Wu, Qinglong L

    2012-11-01

    Bacteria are crucial components in lake sediments and play important role in various environmental processes. Urban lakes in the densely populated cities are often small, shallow, highly artificial and hypereutrophic compared to rural and natural lakes and have been overlooked for a long time. In the present study, bacterial community compositions in surface sediments of three urban lakes (Lake Mochou, Lake Qianhu and Lake Zixia) in Nanjing City, China, were investigated using the terminal restriction fragment length polymorphism (T-RFLP) of PCR-amplified 16S rRNA gene and clone libraries. Remarkable differences in the T-RFLP patterns were observed in different lakes or different sampling stations of the same lake. Canonical correspondence analysis indicated that total nitrogen (TN) had significant effects on bacterial community structure in the lake sediments. Chloroflexi were the most dominant bacterial group in the clone library from Lake Mochou (21.7 % of the total clones) which was partly associated with its higher TN and organic matters concentrations. However, Bacteroidetes appeared to be dominated colonizers in the sediments of Lake Zixia (20.4 % of the total clones). Our study gives a comprehensive insight into the structure of bacterial community of urban lake sediments, indicating that the environmental factors played a key role in influencing the bacterial community composition in the freshwater ecosystems.

  3. Fission fragment yields from heavy-ion-induced reactions measured with a fragment separator

    Science.gov (United States)

    Tarasov, O. B.; Delaune, O.; Farget, F.; Morrissey, D. J.; Amthor, A. M.; Bastin, B.; Bazin, D.; Blank, B.; Cacéres, L.; Chbihi, A.; Fernández-Dominguez, B.; Grévy, S.; Kamalou, O.; Lukyanov, S. M.; Mittig, W.; Pereira, J.; Perrot, L.; Saint-Laurent, M.-G.; Savajols, H.; Sherrill, B. M.; Stodel, C.; Thomas, J. C.; Villari, A. C.

    2018-04-01

    The systematic study of fission fragment yields under different initial conditions has provided valuable experimental data for benchmarking models of fission product yields. Nuclear reactions using inverse kinematics coupled to the use of a high-resolution spectrometer with good fragment identification are shown here to be a powerful tool to measure the inclusive isotopic yields of fission fragments. In-flight fusion-fission was used in this work to produce secondary beams of neutron-rich isotopes in the collisions of a 238U beam at 24 MeV/u with 9Be and 12C targets at GANIL using the LISE3 fragment separator. Unique identification of the A, Z, and atomic charge state, q, of fission products was attained with the Δ E- TKE-B ρ- ToF measurement technique. Mass, and atomic number distributions are reported for the two reactions. The results show the importance of different reaction mechanisms in the two cases. The optimal target material for higher yields of neutron-rich high- Z isotopes produced in fusion-fission reactions as a function of projectile energy is discussed.

  4. Quantitative analysis of Terminal Restriction Fragment Length Polymorphism (T-RFLP microbial community profiles: peak height data showed to be more reproducible than peak area Análise quantitativa de perfis de T-RFLP de comunidades microbianas: dados de altura de picos mostraram-se mais reprodutíveis do que os de área

    Directory of Open Access Journals (Sweden)

    Roberto A. Caffaro-Filho

    2007-12-01

    Full Text Available Terminal Restriction Fragment Length Polymorphism (T-RFLP is a culture-independent fingerprinting method for microbial community analysis. Profiles generated by an automated electrophoresis system can be analysed quantitatively using either peak height or peak area data. Statistical testing demontrated that peak height data showed to be more reproducible than peak area data.Terminal Restriction Fragment Length Polymorphism (T-RFLP é um método molecular, independente de cultivo, para análise de comunidades microbianas. Perfis gerados por um sistema automatizado de eletroforese podem ser analisados quantitativamente usando dados de altura ou área dos picos. Os dados de altura mostraram-se mais reprodutíveis do que os de área.

  5. Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

    Science.gov (United States)

    Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

    2011-01-01

    Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

  6. Terminal Restriction Fragment Length Polymorphism for the Identification of Spirorchiid Ova in Tissues from the Green Sea Turtle, Chelonia mydas.

    Directory of Open Access Journals (Sweden)

    Phoebe A Chapman

    Full Text Available Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to

  7. Mapping of the human APOB gene to chromosome 2p and demonstration of a two-allele restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Huang, L.; Miller, D.A.; Bruns, G.A.P.; Breslow, J.L.

    1986-01-01

    ApoB is a large glycoprotein with an apparent molecular mass of 550 kDa on NaDodSO 4 /PAGE. Recently, apoB cDNA clones have been isolated from an expression library made with mRNA from a human hepatoma cell line. These clones, which were all 1.5-1.6 kilobases (kb) long and corresponded to the 3' end of apoB mRNA, were used to demonstrate that hepatic apoB mRNA is ≅ 22 kb long. In the current report, a probe derived from one of these cDNA clones, pB8, was used for in situ hybridization experiments to map the human gene for apoB, APOB, to the distal half of the short arm of chromosome 2. This probe was also used to analyze somatic cell hybrids and, in agreement with the in situ hybridization studies, concordancy was demonstrated with chromosome 2. In addition, two hybrids with chromosome 2 translocations that contain only the short arm reacted with the pB8 probe. A third hybrid with a complex rearrangement of chromosome 2, which deleted an interstitial region and the tip of the short arm of chromosome 2, did not react. These data indicate that APOB maps to either 2p21-p23 or 2p24-pter. In further studies, DNA from normal individuals, digested with the restriction endonuclease EcoRI and subjected to Southern blot analysis with the pB8 probe, revealed a two-allele restriction fragment length polymorphism (RFLP). The mapping studies provide the means for understanding the relationship of the APOB locus to others in the human genome, whereas the demonstration of an APOB RFLP increases their ability to assess the role of this locus in determining plasma lipoprotein levels

  8. Studies of complex fragment emission in heavy ion reactions

    International Nuclear Information System (INIS)

    Sobotka, L.G.

    1989-01-01

    The production of large fragments, fragments with mass between light particles and fission fragments, in intermediate and high energy nuclear reactions has fostered the proposal of a number of novel reaction mechanisms. These include liquid-vapor equilibrium and nuclear shattering. Temporarily left in the wake of these exciting proposed mechanisms was the old standard, statistical decay of compound nuclei. To be sure, the standard treatment of compound nucleus decay did not deal with large fragment production. However, this omission was not due to any fundamental deficiency of statistical models, but rather an uncertainty concerning exactly how to splice large fragment emission into statistical models. A large portion of our program deals with this problem. Specifically, by studying the yields of large fragments produced in sufficiently low energy reactions we are attempting to deduce the asymmetry and l-wave dependence of large fragment emission from compound nuclear intermediates. This, however, is only half of the problem. Since the novel mechanisms proposed for large fragment emission were spawned by intermediate and high energy reaction data, we must also realize the relevance of the compound nucleus mechanisms at high energies. It is not unreasonable to suspect that compound nucleus-like objects are formed with less than complete momentum transfer and perhaps less than complete mass transfer. Therefore the study of energy, mass, and angular momentum transfer in incomplete fusion and non-compound reactions. This thread joins the apparently divergent subjects covered in this report

  9. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  10. Isoschizomers and amplified fragment length polymorphism for the detection of specific cytosine methylation changes.

    Science.gov (United States)

    Ruiz-García, Leonor; Cabezas, Jose Antonio; de María, Nuria; Cervera, María-Teresa

    2010-01-01

    Different molecular techniques have been developed to study either the global level of methylated cytosines or methylation at specific gene sequences. One of them is a modification of the Amplified Fragment Length Polymorphism (AFLP) technique that has been used to study methylation of anonymous CCGG sequences in different fungi, plant and animal species. The main variation of this technique is based on the use of isoschizomers with different methylation sensitivity (such as HpaII and MspI) as a frequent cutter restriction enzyme. For each sample, AFLP analysis is performed using both EcoRI/HpaII and EcoRI/MspI digested samples. Comparative analysis between EcoRI/HpaII and EcoRI/MspI fragment patterns allows the identification of two types of polymorphisms: (1) "Methylation-insensitive polymorphisms" that show common EcoRI/HpaII and EcoRI/MspI patterns but are detected as polymorphic amplified fragments among samples; and (2) "Methylation-sensitive polymorphisms" that are associated with amplified fragments differing in their presence or absence or in their intensity between EcoRI/HpaII and EcoRI/MspI patterns. This chapter describes a detailed protocol of this technique and discusses modifications that can be applied to adjust the technology to different species of interest.

  11. Testing independence of fragment lengths within VNTR loci

    Energy Technology Data Exchange (ETDEWEB)

    Geisser, S. (Univ. of Minnesota, Minneapolis, MN (United States)); Johnson, W. (Univ. of California, Davis, CA (United States))

    1993-11-01

    Methods that were devised to test independence of the bivariate fragment lengths obtained from VNTR loci are applied to several population databases. It is shown that for many of the probes independence (Hardy-Weinberg equilibrium) cannot be sustained. 3 refs., 3 tabs.

  12. Origin of fragments in multifragmentation reactions

    International Nuclear Information System (INIS)

    Zbiri, K.; Aichelin, J.

    2003-01-01

    Using the quantum molecular dynamics approach we have started analyzing the results of the recent INDRA experiments at GSI facilities. For the first time we could identify a midrapidity source in which fragments are formed from an almost identical fraction of projectile and target nucleons. In smaller systems we have found this source. Nevertheless the fragment spectra at small and large angles is completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (authors)

  13. Origin of fragments in multifragmentation reactions

    International Nuclear Information System (INIS)

    Zbiri, K.; Aichelin, J.

    2005-01-01

    Using the quantum molecular dynamics approach we have started to analyze the results of the recent INDRA experiments at GSI experiments. For the first time we could identify a midrapidity source in which fragments are formed from a almost identical fraction of projectile and target nucleons. In smaller systems we have not found this source. Nevertheless the fragment spectra at small and large angles are completely determined by the dynamics. We discuss how fragments are formed in the different regions of phase space and what they tell us about the reaction mechanism. (author)

  14. Identification of two invasive Cacopsylla chinensis (Hemiptera: Psyllidae) lineages based on two mitochondrial sequences and restriction fragment length polymorphism of cytochrome oxidase I amplicon.

    Science.gov (United States)

    Lee, Hsien-Chung; Yang, Man-Miao; Yeh, Wen-Bin

    2008-08-01

    The occurrence of pear decline, a disease found in some pear (Pyrus spp.) orchards of Taiwan in recent years, is accompanied by an outbreak of Cacopsylla chinensis (Yang & Li). Two major morphological forms (summer and winter forms) with a variety of intermediate body color and two phylogenetic lineages of this psyllid have been described. The work herein used sequences of mitochondrial cytochrome oxidase I (COI) and 16S rDNA regions to delineate the genetic differentiation of this color-variable insect and to elucidate their relationship. Sequence divergence and phylogenetic analysis have shown that C. chinensis individuals could be divided into two lineages with 3.3 and 2.3% divergence of COI and 16S rDNA, respectively. All specimens from China were found to belong to lineage I. Restriction fragment length polymorphism analysis of COI with restriction enzymes AcuI, AseI, BccI, and FokI on 263 specimens of six populations from Taiwan produced two digestion patterns, which are in agreement with the two lineages described above. Both patterns could be found in each population, with most individuals belonging to lineage I and 5-21% of the individuals belonging to lineage II. Because these two lineages included summer as well as winter morphological forms, the lineage differentiation is apparently not related to morphological characters of this psyllid. Because the invasive records are not in favor of a sympatric differentiation, this psyllid is more likely introduced as different populations from countries in temperate regions.

  15. Sex identification and reconstruction of length of humerus from its fragments: An Egyptian study

    Directory of Open Access Journals (Sweden)

    Dalia Mohamed Ali

    2016-06-01

    Full Text Available The aim of this study was to calculate the total length of the humerus and identify the sex from its fragments in Egyptians. One hundred and fifty dry adult right humeri (75 male and 75 female were studied. The humeri were divided into seven fragments according to specific anatomical landmarks. Data obtained was subjected to descriptive statistical analysis. The longest fragmentary portion revealed a good result with closest proximity to the total length of humerus. All fragments showed significant sexual differences (P < 0.001 between males and females except H2. Total length of humerus revealed the highest percentage of accuracy (93.3% followed by H4 (86.7% and H7 (83.3% for sex identification. Finally, from measurements of different humeral fragments in Egyptian population; the length of the humerus can be estimated and the sex can be identified.

  16. Characterization of Biomphalaria orbignyi, Biomphalaria peregrina and Biomphalaria oligoza by polymerase chain reaction and restriction enzyme digestion of the internal transcribed spacer region of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Spatz Linus

    2000-01-01

    Full Text Available The correct identification of Biomphalaria oligoza, B. orbignyi and B. peregrina species is difficult due to the morphological similarities among them. B. peregrina is widely distributed in South America and is considered a potential intermediate host of Schistosoma mansoni. We have reported the use of the polymerase chain reaction and restriction fragment length polymorphism analysis of the internal transcribed spacer region of the ribosomal DNA for the molecular identification of these snails. The snails were obtained from different localities of Argentina, Brazil and Uruguay. The restriction patterns obtained with MvaI enzyme presented the best profile to identify the three species. The profiles obtained with all enzymes were used to estimate genetic similarities among B. oligoza, B. peregrina and B. orbignyi. This is also the first report of B. orbignyi in Uruguay.

  17. Analysis of the bacterial diversity existing on animal hide and wool: development of a preliminary PCR-restriction fragment length polymorphism fingerprint database for identifying isolates.

    Science.gov (United States)

    Chen, Yu; Gao, Hongwei; Zhang, Yanming; Deng, Mingjun; Wu, Zhenxing; Zhu, Laihua; Duan, Qing; Xu, Biao; Liang, Chengzhu; Yue, Zhiqin; Xiao, Xizhi

    2012-01-01

    Twenty-one bacterial strains were isolated from imported cattle hide and rabbit wool using two types of media, nutrient broth, and nutrient broth with serum. The bacteria identified were Brevibacillus laterosporus, Leclercia adecarboxylata, Peptococcus niger, Bacillus circulans, Raoultella ornithinolytica, Bacillus subtilis, Bacillus cereus, Bacillus thermobacillus, Bacillus choshinensis, Bacillus sphaericus, Acinetobacter haemolyticus, Sphingomonas paucimobilis, Bacillus thuringiensis, Staphylococcus intermedius, Mycobacteria, Moraxella, Klebsiella pneumoniae, Ralstonia pickettii, Staphylococcus chromogenes, Comamonas testosteroni, and Cupriavidus pauculus. The 16s rDNA gene of each bacterium was amplified using the universal primers 27f and 1492r. The amplicons were digested with AvaI, BamHI, BgII, DraI, EcoRI, EcoRV, HindIII, HinfI, HpaI, PstI, SmaI, TaqII, XbaI, XmaI, AluI, XhoI, and PvuI individually. A specific fingerprint from the PCR-restriction fragment length polymorphism method based on 16s rDNA was obtained for each bacterium. The results showed that the method developed was useful not only for bacterial identification but also for the etiological investigation of pathogens in imported animal hair and wool.

  18. Evidence of a normal mean telomere fragment length in patients with Ullrich-Turner syndrome

    DEFF Research Database (Denmark)

    Kveiborg, Marie; Gravholt, Claus Højbjerg; Kassem, M

    2001-01-01

    Clinical and epidemiological studies suggest that premature ageing and increased morbidity and mortality is present in Ullrich-Turner syndrome. We studied telomere restriction fragment length (TRFL) in 30 women with Ullrich-Turner syndrome and 30 age-matched control women. All Turner women had...... the 45,X karyotype verified by karyotyping. We found no difference in the mean TRFL in the young age group (TS: 7011+/-521 vs C: 7285+/-917 bp, P = 0.3), or in the older age group (TS: 7357+/-573 vs C: 7221+/-621 bp, P = 0.6). In conclusion, our data suggest that Ullrich-Turner syndrome is not associated...... with excessive telomere loss, at least when studied in peripheral blood leucocytes, and thus quite different from other premature ageing syndromes....

  19. Fragmentation processes in nuclear reactions

    International Nuclear Information System (INIS)

    Baur, G.; Roesel, F.; Trautmann, D.; Shyam, R.

    1983-10-01

    Fragmentation processes in nuclear collisions are reviewed. The main emphasis is put on light ion breakup at nonrelativistic energies. The post- and prior-form DWBA theories are discussed. The post-form DWBA, appropriate for the ''spectator breakup'' describes elastic as well as inelastic breakup modes. This theory can also account for the stripping to unbound states. The theoretical models are compared to typical experimental results to illustrate the various possible mechanisms. It is discussed, how breakup reactions can be used to study high-lying single particle strength in the continuum; how it can yield information about momentum distributions of fragments in the nucleus. (orig.)

  20. High-energy nuclear reaction mechanisms - fission, fragmentation and spallation

    International Nuclear Information System (INIS)

    Kaufman, S.B.

    1987-01-01

    Measurements of the correlations in kinetic energy, mass, charge, and angle of coincident fragments formed in high-energy nuclear reactions have helped to characterize the processes of fission, fragmentation and spallation. For example, fission or fission-like two-body breakup mechanisms result in a strong angular correlation between two heavy fragments; in addition, the momentum transfer in the reaction can be deduced from the correlation. Another example is the multiplicity of light charged particles associated with a given heavy fragment, which is a measure of the violence of the collision, thus distinguishing between central and peripheral collisions. A summary of what has been learned about these processes from such studies will be given, along with some suggestions for further experiments

  1. Generalized hydrodynamic treatment of the interplay between restricted transport and catalytic reactions in nanoporous materials.

    Science.gov (United States)

    Ackerman, David M; Wang, Jing; Evans, James W

    2012-06-01

    Behavior of catalytic reactions in narrow pores is controlled by a delicate interplay between fluctuations in adsorption-desorption at pore openings, restricted diffusion, and reaction. This behavior is captured by a generalized hydrodynamic formulation of appropriate reaction-diffusion equations (RDE). These RDE incorporate an unconventional description of chemical diffusion in mixed-component quasi-single-file systems based on a refined picture of tracer diffusion for finite-length pores. The RDE elucidate the nonexponential decay of the steady-state reactant concentration into the pore and the non-mean-field scaling of the reactant penetration depth.

  2. Aspergillus section Fumigati typing by PCR-restriction fragment polymorphism.

    Science.gov (United States)

    Staab, Janet F; Balajee, S Arunmozhi; Marr, Kieren A

    2009-07-01

    Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding beta-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati.

  3. Aspergillus Section Fumigati Typing by PCR-Restriction Fragment Polymorphism▿

    Science.gov (United States)

    Staab, Janet F.; Balajee, S. Arunmozhi; Marr, Kieren A.

    2009-01-01

    Recent studies have shown that there are multiple clinically important members of the Aspergillus section Fumigati that are difficult to distinguish on the basis of morphological features (e.g., Aspergillus fumigatus, A. lentulus, and Neosartorya udagawae). Identification of these organisms may be clinically important, as some species vary in their susceptibilities to antifungal agents. In a prior study, we utilized multilocus sequence typing to describe A. lentulus as a species distinct from A. fumigatus. The sequence data show that the gene encoding β-tubulin, benA, has high interspecies variability at intronic regions but is conserved among isolates of the same species. These data were used to develop a PCR-restriction fragment length polymorphism (PCR-RFLP) method that rapidly and accurately distinguishes A. fumigatus, A. lentulus, and N. udagawae, three major species within the section Fumigati that have previously been implicated in disease. Digestion of the benA amplicon with BccI generated unique banding patterns; the results were validated by screening a collection of clinical strains and by in silico analysis of the benA sequences of Aspergillus spp. deposited in the GenBank database. PCR-RFLP of benA is a simple method for the identification of clinically important, similar morphotypes of Aspergillus spp. within the section Fumigati. PMID:19403766

  4. Population structure of Salmonella investigated by amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, M.; Ahrens, Peter

    2004-01-01

    Aims: This study was undertaken to investigate the usefulness of amplified fragment length polymorphism (AFLP) in determining the population structure of Salmonella. Methods and Results: A total of 89 strains were subjected to AFLP analysis using the enzymes BglII and BspDI, a combination...... that is novel in Salmonella. Both species S. bongori and S. enterica and all subsp. of S. enterica were represented with emphasis on S. enterica subsp. enterica using a local strain collection and strains from the Salmonella Reference Collection B (SARB). The amplified fragments were used in a band...

  5. Enhanced resolution of DNA restriction fragments: A procedure by two-dimensional electrophoresis and double-labeling

    International Nuclear Information System (INIS)

    Yi, M.; Au, L.C.; Ichikawa, N.; Ts'o, P.O.

    1990-01-01

    A probe-free method was developed to detect DNA rearrangement in bacteria based on the electrophoretic separation of twice-digested restriction fragments of genomic DNA into a two-dimensional (2-D) pattern. The first restriction enzyme digestion was done in solution, followed by electrophoresis of the restriction fragments in one dimension. A second restriction enzyme digestion was carried out in situ in the gel, followed by electrophoresis in a second dimension perpendicular to the first electrophoresis. The 2-D pattern provides for the resolution of 300-400 spots, which are defined and indexed by an x,y coordinate system with size markers. This approach has greatly increased the resolution power over conventional one-dimensional (1-D) electrophoresis. To study DNA rearrangement, a 2-D pattern from a test strain was compared with the 2-D pattern from a reference strain. After the first digestion, genomic DNA fragments from the test strain were labeled with 35S, while those from the reference strain were labeled with 32P. This was done to utilize the difference in the energy emission of 35S and 32P isotopes for autoradiography when two x-ray films were exposed simultaneously on top of the gel after the 2-D electrophoresis. The irradiation from the decay of 35S exposed only the lower film, whereas the irradiation from the decay of 32P exposed both the lower and upper films. Different DNA fragments existed in the test DNA compared with the reference DNA can be identified unambiguously by the differential two 2-D patterns produced on two films upon exposure to the 35S and 32P fragments in the same gel. An appropriate photographic procedure further simplified the process, allowing only the difference in DNA fragments between these two patterns to be shown in the map

  6. Alterations of telomerase activity and terminal restriction fragment in gastric cancer and its premalignant lesions.

    Science.gov (United States)

    Yang, S M; Fang, D C; Luo, Y H; Lu, R; Battle, P D; Liu, W W

    2001-08-01

    In order to explore the role of alterations of telomerase activity and terminal restriction fragment (TRF) length in the development and progression of gastric cancer. Telomerase activity was detected in 176 specimens of gastric mucosa obtained through an operation or endoscopical biopsy by using the telomeric repeat amplification protocol (TRAP) assay. Meanwhile, the mean length of TRF was measured with the use of a Southern blot in part of those samples. Telomerase activity was detected in 14 of 57 (24.6%) chronic atrophy gastritis patients, six of 18 (33.3%) intestinal metaplasia patients, three of eight (37.5%) dysplasia patients and 60 of 65 (92.3%) gastric cancer patients, respectively. Normal gastric mucosa revealed no telomerase activity. No association was found between telomerase activity and any clinicopathological parameters. The mean TRF length was decreased gradually with age in normal mucosa and in gastric cancer tissue. Regression analysis demonstrated that the reduction rate in these tissues was 41 +/- 12 base pairs/year. Among 35 gastric cancers, TRF length was shown to be shorter in 20 cases (57.1%), similar in 12 cases (34.3%) and elongated in three cases (7.6%), compared to the corresponding adjacent tissues. The mean TRF length tended to decrease as the mucosa underwent chronic atrophy gastritis, intestinal metaplasia, dysplasia and into gastric cancer. The mean TRF length in gastric cancer was not statistically correlated with clinicopathological parameters and telomerase activity. Our results suggest that telomerase is expressed during the early stage of gastric carcinogenesis, and that the clinical significance of TRF length appears to be limited in gastric cancer.

  7. RxnFinder: biochemical reaction search engines using molecular structures, molecular fragments and reaction similarity.

    Science.gov (United States)

    Hu, Qian-Nan; Deng, Zhe; Hu, Huanan; Cao, Dong-Sheng; Liang, Yi-Zeng

    2011-09-01

    Biochemical reactions play a key role to help sustain life and allow cells to grow. RxnFinder was developed to search biochemical reactions from KEGG reaction database using three search criteria: molecular structures, molecular fragments and reaction similarity. RxnFinder is helpful to get reference reactions for biosynthesis and xenobiotics metabolism. RxnFinder is freely available via: http://sdd.whu.edu.cn/rxnfinder. qnhu@whu.edu.cn.

  8. Fragment formation in light-ion induced reactions

    International Nuclear Information System (INIS)

    Hirata, Yuichi

    2001-01-01

    The intermediate mass fragment (IMF) formation in the 12 GeV proton induced reaction on Au target is analyzed by the quantum molecular dynamics model combined with the JAM hadronic cascade model and the non-equilibrated percolation model. We show that the sideward peaked angular distribution of IMF occur in the multifragmentation at very short time scale around 20 fm/c where non-equilibrated features of the residual nucleus fluctuates the nucleon density and fragments in the repulsive Coulomb force are pushed for the sideward direction. (author)

  9. Rumen bacterial community evaluated by 454 pyrosequencing and terminal restriction fragment length polymorphism analyses in dairy sheep fed marine algae.

    Science.gov (United States)

    Castro-Carrera, T; Toral, P G; Frutos, P; McEwan, N R; Hervás, G; Abecia, L; Pinloche, E; Girdwood, S E; Belenguer, A

    2014-03-01

    Developing novel strategies to increase the content of bioactive unsaturated fatty acids (FA) in ruminant-derived products requires a deeper understanding of rumen biohydrogenation and bacteria involved in this process. Although high-throughput pyrosequencing may allow for a great coverage of bacterial diversity, it has hardly been used to investigate the microbiology of ruminal FA metabolism. In this experiment, 454 pyrosequencing and a molecular fingerprinting technique (terminal restriction fragment length polymorphism; T-RFLP) were used concurrently to assess the effect of diet supplementation with marine algae (MA) on the rumen bacterial community of dairy sheep. Eleven lactating ewes were divided in 2 lots and offered a total mixed ration based on alfalfa hay and concentrate (40:60), supplemented with 0 (control) or 8 (MA) g of MA/kg of dry matter. After 54 d on treatments, animals were slaughtered and samples of rumen content and fluid were collected separately for microbial analysis. Pyrosequencing yielded a greater coverage of bacterial diversity than T-RFLP and allowed the identification of low abundant populations. Conversely, both molecular approaches pointed to similar conclusions and showed that relevant changes due to MA addition were observed within the major ruminal phyla, namely Bacteroidetes, Firmicutes, and Proteobacteria. Decreases in the abundance of unclassified Bacteroidales, Porphyromonadaceae, and Ruminococcaceae and increases in as-yet uncultured species of the family Succinivibrionaceae, might be related to a potential role of these groups in different pathways of rumen FA metabolism. Diet supplementation with MA, however, had no effect on the relative abundance of Butyrivibrio and Pseudobutyrivibrio genera. In addition, results from both 454 pyrosequencing and T-RFLP indicate that the effect of MA was rather consistent in rumen content or fluid samples, despite inherent differences between these fractions in their bacterial composition

  10. Production of Energetic Light Fragments in Spallation Reactions

    Directory of Open Access Journals (Sweden)

    Mashnik Stepan G.

    2014-03-01

    Full Text Available Different reaction mechanisms contribute to the production of light fragments (LF from nuclear reactions. Available models cannot accurately predict emission of LF from arbitrary reactions. However, the emission of LF is important formany applications, such as cosmic-ray-induced single event upsets, radiation protection, and cancer therapy with proton and heavy-ion beams, to name just a few. The cascade-exciton model (CEM and the Los Alamos version of the quark-gluon string model (LAQGSM, as implemented in the CEM03.03 and LAQGSM03.03 event generators used in the Los Alamos Monte Carlo transport code MCNP6, describe quite well the spectra of fragments with sizes up to 4He across a broad range of target masses and incident energies. However, they do not predict high-energy tails for LF heavier than 4He. The standard versions of CEM and LAQGSM do not account for preequilibrium emission of LF larger than 4He. The aim of our work is to extend the preequilibrium model to include such processes. We do this by including the emission of fragments heavier than 4He at the preequilibrium stage, and using an improved version of the Fermi Break-up model, providing improved agreement with various experimental data.

  11. Detection and RFLP Analysis of Canine Parvovirus (CPV) DNA by Polymerase Chain Reaction (PCR) in a Dog

    OpenAIRE

    ÖZKUL, Aykut

    2002-01-01

    In this study, the detection of canine parvovirus (CPV) in a fecal sample from a dog with enteritis was performed for the first time using the polymerase chain reaction (PCR) in Turkey. The final PCR product was analyzed using the restriction fragment length polymorphysm (RFLP) technique. RFLP analysis using Apa LI and Eco RV restriction endonucleases revealed homology in the nucleotide sequence in at least the VP2 coding region of the virus DNAs detected in the fecal specimen and prepared fr...

  12. Dynamic effects in fragmentation reactions

    International Nuclear Information System (INIS)

    Bertsch, G. F.; Esbensen, H.

    2002-01-01

    Fragmentation reactions offer a useful tool to study the spectroscopy of halo nuclei, but the large extent of the halo wave function makes the reaction theory more difficult. The simple reaction models based on the eikonal approximation for the nuclear interaction or first-order perturbation theory for the Coulomb interaction have systematic errors that they investigate here, comparing to the predictions of complete dynamical calculations. They find that stripping probabilities are underpredicted by the eikonal model, leading to extracted spectroscopy strengths that are two large. In contrast, the Coulomb excitation is overpredicted by the simple theory. They attribute this to a screening effect, as is well known in the Barkas effect on stopping powers. The errors decrease with beam energy as E(sub beam)(sup -1), and are not significant at beam energies above 50 MeV/u. At lower beam energies, the effects should be taken into account when extracting quantitative spectroscopic strengths

  13. Study of fragmentation reactions of light nucleus

    International Nuclear Information System (INIS)

    Toneli, David Arruda; Carlson, Brett Vern

    2011-01-01

    Full text: The decay of the compound nucleus is traditionally calculated using a sequential emission model, such as the Weisskopf-Ewing or Hauser-Feshbach ones, in which the compound nucleus decays through a series of residual nuclei by emitting one particle at a time until there is no longer sufficient energy for further emission. In light compound nucleus, however, the excitation energy necessary to fully disintegrate the system is relatively easy to attain. In such cases, decay by simultaneous emission of two or more particles becomes important. A model which takes into account all these decay is the Fermi fragmentation model. Recently, the equivalence between the Fermi fragmentation model and statistical multifragmentation model used to describe the decay for highly excited fragments for reactions of heavy ions was demonstrated. Due the simplicity of the thermodynamic treatment used in the multifragmentation model, we have adapted it to the calculation of Fermi breakup of light nuclei. The ultimate goal of this study is to calculate the distribution of isotopes produced in proton-induced reactions on light nuclei of biological interest, such as C, O e Ca. Although most of these residual nuclei possess extremely short half-lives and thus represent little long-term danger, they tend to be deficient in neutrons and to decay by positron emission, which allows the monitoring of proton radiotherapy by PET (Positron Emission Tomography). (author)

  14. High-resolution genomic fingerprinting of Campylobacter jejuni and Campylobacter coli by analysis of amplified fragment length polymorphisms

    DEFF Research Database (Denmark)

    Kokotovic, Branko; On, Stephen L.W.

    1999-01-01

    A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... is evaluated with 50 type, reference, and well-characterised field strains. Amplified fragment length polymorphism fingerprints comprised over 60 bands detected in the size range 35-500 bp. Groups of outbreak strains, replicate subcultures, and 'genetically identical' strains from humans, poultry and cattle......, proved indistinguishable by amplified fragment length polymorphism fingerprinting, but were differentiated fi-om unrelated isolates. Previously unknown relationships between three hippurate-negative C. jejuni strains, and two C. coil var, hyoilei strains, were identified. These relationships corresponded...

  15. Genetic diversity of Actinobacillus pleuropneumoniae assessed by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Angen, Øystein

    2007-01-01

    Amplified fragment length polymorphism (AFLP) was evaluated as a method for genotypic characterization and subtyping within the bacterial species Actinobacillus pleuropneumoniae. A total of 155 isolates of A. pleuropneumoniae, representing the serotypic variation described to occur within...

  16. Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

    Energy Technology Data Exchange (ETDEWEB)

    Ogawa, T., E-mail: ogawa.tatsuhiko@jaea.go.jp [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Sato, T.; Hashimoto, S. [Research Group for Radiation Protection, Division of Environment and Radiation Sciences, Nuclear Science and Engineering Directorate, Japan Atomic Energy Agency, Shirakata-Shirane, Tokai, Ibaraki 319-1195 (Japan); Niita, K. [Research Organization for Information Science and Technology, Shirakata-shirane, Tokai, Ibaraki 319-1188 (Japan)

    2013-09-21

    The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections.

  17. Analysis of multi-fragmentation reactions induced by relativistic heavy ions using the statistical multi-fragmentation model

    International Nuclear Information System (INIS)

    Ogawa, T.; Sato, T.; Hashimoto, S.; Niita, K.

    2013-01-01

    The fragmentation cross-sections of relativistic energy nucleus–nucleus collisions were analyzed using the statistical multi-fragmentation model (SMM) incorporated with the Monte-Carlo radiation transport simulation code particle and heavy ion transport code system (PHITS). Comparison with the literature data showed that PHITS-SMM reproduces fragmentation cross-sections of heavy nuclei at relativistic energies better than the original PHITS by up to two orders of magnitude. It was also found that SMM does not degrade the neutron production cross-sections in heavy ion collisions or the fragmentation cross-sections of light nuclei, for which SMM has not been benchmarked. Therefore, SMM is a robust model that can supplement conventional nucleus–nucleus reaction models, enabling more accurate prediction of fragmentation cross-sections

  18. Studies of complex fragment emission in heavy ion reactions

    International Nuclear Information System (INIS)

    Charity, R.J.; Sobotka, L.G.

    1993-01-01

    The study of intermediate-energy heavy-ion nuclear reactions is reported. This work has two foci: the properties of nuclear matter under abnormal conditions, in this energy domain, predominately low densities and the study of the relevant reaction mechanisms. Nuclear matter properties, such as phase transitions, are reflected in the dynamics of the reactions. The process leads to an understanding of the reaction mechanism themselves and therefore to the response characteristics of finite, perhaps non-equilibrium, strongly interacting systems. The program has the following objectives: to study energy, mass, and angular momentum deposition by studying incomplete fusion reactions; to gain confidence in the understanding of how highly excited systems decompose by studying all emissions from the highly excited systems; to push these kinds of studies into the intermediate energy domain (where intermediate mass fragment emission is not improbable) with excitation function studies; and to learn about the dynamics of the decays using particle-particle correlations. The last effort focuses on simple systems, where definitive statements are possible. These avenues of research share a common theme, large complex fragment production. It is this feature, more than any other, which distinguishes the intermediate energy domain

  19. Fragment mass distribution of proton-induced spallation reaction with intermediate energy

    International Nuclear Information System (INIS)

    Fan Sheng; Ye Yanlin; Xu Chuncheng; Chen Tao; Sobolevsky, N.M.

    2000-01-01

    The test of part benchmark of SHIELD code is finished. The fragment cross section and mass distribution and excitation function of the residual nuclei from proton-induced spallation reaction on thin Pb target with intermediate energy have been calculated by SHIELD code. And the results are in good agreement with measured data. The fragment mass distribution of the residual nuclei from proton-induced spallation reaction on thick Pb target with incident energy 1.6 GeV have been simulated

  20. Evolution of fragment-fragment correlations in reactions of 197Au and 107,109Ag with 40Ar from 7A to 34A MeV

    International Nuclear Information System (INIS)

    Ethvignot, T.; Ajitanand, N.N.; Alexander, J.M.; Bauge, E.; Elmaani, A.; Kowalski, L.; Lopez, M.; Magda, M.T.; Desesquelles, P.; Elhage, H.; Giorni, A.; Heuer, D.; Kox, S.; Lleres, A.; Merchez, F.; Morand, C.; Rebreyend, D.; Stassi, P.; Viano, J.B.; Benrachi, F.; Chambon, B.; Cheynis, B.; Drain, D.; Pastor, C.

    1992-01-01

    In-plane and out-of-plane angular correlations have been measured between fragments of Z>3, Li fragments, 3,4 He, and 1,2,3 H. The changing patterns for 40 Ar induced reactions of 7A, 17A, 27A, and 34A MeV give an overview of the decreasing importance of mass-symmetric fissionlike reactions at the expense of a broad range of more mass-asymmetric breakups. Evidence is given that these fragments come from a central collision group of reactions that have similar violence and from which many combinations of fragments and particles are ejected. Very similar azimuthal angular correlations are observed for particles with a Li fragment and for particles with a pair of heavier fragments (Z>3). This similarity suggests comparable strengths of association with the reaction plane for single Li fragments and for fragment pairs of Z>3. Azimuthal angular correlations for Li-Li pairs exhibit distinct asymmetries; their interpretation via trajectory-model calculations indicates mean delay times of ∼5x10 -22 s

  1. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  2. Progress towards construction of a total restriction fragment map of a human chromosome.

    NARCIS (Netherlands)

    H. Vissing; F.G. Grosveld (Frank); E. Solomon; G. Moore; N. Lench; N. Shennan; R. Williamson

    1987-01-01

    textabstractWe present an approach to the construction of an overlapping restriction fragment map of a single human chromosome. A genomic cosmid library genome was constructed from a mouse-human hybrid cell line containing chromosome 17 as its only human genetic component. Cosmids containing human

  3. Seasonal diversity of planktonic protists in Southwestern Alberta rivers over a 1-year period as revealed by terminal restriction fragment length polymorphism and 18S rRNA gene library analyses.

    Science.gov (United States)

    Thomas, Matthew C; Selinger, L Brent; Inglis, G Douglas

    2012-08-01

    The temporal dynamics of planktonic protists in river water have received limited attention despite their ecological significance and recent studies linking phagotrophic protists to the persistence of human-pathogenic bacteria. Using molecular-based techniques targeting the 18S rRNA gene, we studied the seasonal diversity of planktonic protists in Southwestern Alberta rivers (Oldman River Basin) over a 1-year period. Nonmetric multidimensional scaling analysis of terminal restriction fragment length polymorphism (T-RFLP) data revealed distinct shifts in protistan community profiles that corresponded to season rather than geographical location. Community structures were examined by using clone library analysis; HaeIII restriction profiles of 18S rRNA gene amplicons were used to remove prevalent solanaceous plant clones prior to sequencing. Sanger sequencing of the V1-to-V3 region of the 18S rRNA gene libraries from spring, summer, fall, and winter supported the T-RFLP results and showed marked seasonal differences in the protistan community structure. The spring library was dominated by Chloroplastidae (29.8%), Centrohelida (28.1%), and Alveolata (25.5%), while the summer and fall libraries contained primarily fungal clones (83.0% and 88.0%, respectively). Alveolata (35.6%), Euglenozoa (24.4%), Chloroplastida (15.6%), and Fungi (15.6%) dominated the winter library. These data demonstrate that planktonic protists, including protozoa, are abundant in river water in Southwestern Alberta and that conspicuous seasonal shifts occur in the community structure.

  4. Differentiation of Meat Samples from Domestic Horses ( Equus caballus and Asiatic Wild Asses ( Equus hemionus Using a Species-Speci fi c Restriction Site in the Mitochondrial Cytochrome b Region

    Directory of Open Access Journals (Sweden)

    Ralph Kuehn

    2006-12-01

    Full Text Available Recent studies suggest that Asiatic wild asses ( Equus hemionus are being increasingly poached in a commercial fashion. Part of the meat is believed to reach the meat markets in the capital Ulaanbaatar. To test this hypothesis, we collected 500 meat samples between February and May 2006. To differentiate between domestic horse ( Equus caballus and wild ass meat, we developed a restriction fragment length polymorphism (RFLP assay based on the polymerase chain reaction (PCR. We ampli fi ed and sequenced a cytochrome b fragment (335 bp and carried out a multialignment of the generated sequences for the domestic horse, the Asiatic wild ass, the domestic donkey ( Equus asinus and the Przewalski’s horse ( Equus ferus przewalskii . We detected a species-speci fi c restriction site (AatII for the Asiatic wild ass, resulting in a speci fi c restriction fragment length polymorphism (RFLP band pattern. This RFLP assay represents a rapid and cost-effective method to detect wild ass meat. All of the 500 meat samples we collected and analysed within this pilot project proved to be domestic horsemeat as declared by the sales people. Thus, either the assumption that wild ass meat is sold as “cheap horse meat” is wrong, or we picked the wrong markets, products or season.

  5. Characterization of gut microbiota profiles by disease activity in patients with Crohn's disease using data mining analysis of terminal restriction fragment length polymorphisms.

    Science.gov (United States)

    Andoh, Akira; Kobayashi, Toshio; Kuzuoka, Hiroyuki; Tsujikawa, Tomoyuki; Suzuki, Yasuo; Hirai, Fumihito; Matsui, Toshiyuki; Nakamura, Shiro; Matsumoto, Takayuki; Fujiyama, Yoshihide

    2014-05-01

    The gut microbiota plays a significant role in the pathogenesis of Crohn's disease (CD). In this study, we analyzed the disease activity and associated fecal microbiota profiles in 160 CD patients and 121 healthy individuals. Fecal samples from the CD patients were collected during three different clinical phases, the active (n=66), remission-achieved (n=51) and remission-maintained (n=43) phases. Terminal restriction fragment length polymorphism (T-RFLP) and data mining analysis using the Classification and Regression Tree (C&RT) approach were performed. Data mining provided a decision tree that clearly identified the various subject groups (nodes). The majority of the healthy individuals were divided into Node-5 and Node-8. Healthy subjects comprised 99% of Node-5 (91 of 92) and 84% of Node-8 (21 of 25 subjects). Node-3 was characterized by CD (136 of 160 CD subjects) and was divided into Node-6 and Node-7. Node-6 (n=103) was characterized by subjects in the active phase (n=48; 46%) and remission-achieved phase (n=39; 38%) and Node-7 was characterized by the remission-maintained phase (21 of 37 subjects; 57%). Finally, Node-6 was divided into Node-9 and Node-10. Node-9 (n=78) was characterized by subjects in the active phase (n=43; 55%) and Node-10 (n=25) was characterized by subjects in the remission-maintained phase (n=16; 64%). Differences in the gut microbiota associated with disease activity of CD patients were identified. Thus, data mining analysis appears to be an ideal tool for the characterization of the gut microbiota in inflammatory bowel disease.

  6. Dissertation: Precompound Emission of Energetic Light Fragments in Spallation Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Kerby, Leslie Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-08-04

    Emission of light fragments (LF) from nuclear reactions is an open question. Different reaction mechanisms contribute to their production; the relative roles of each, and how they change with incident energy, mass number of the target, and the type and emission energy of the fragments is not completely understood. None of the available models are able to accurately predict emission of LF from arbitrary reactions. However, the ability to describe production of LF (especially at energies ≳ 30 MeV) from many reactions is important for different applications, such as cosmic-ray-induced Single Event Upsets (SEUs), radiation protection, and cancer therapy with proton and heavy-ion beams, to name just a few. The Cascade-Exciton Model (CEM) version 03.03 and the Los Alamos version of the Quark-Gluon String Model (LAQGSM) version 03.03 event generators in Monte Carlo N-Particle Transport Code version 6 (MCNP6) describe quite well the spectra of fragments with sizes up to ⁴He across a broad range of target masses and incident energies (up to ~ 5 GeV for CEM and up to ~ 1 TeV/A for LAQGSM). However, they do not predict the high energy tails of LF spectra heavier than ⁴He well. Most LF with energies above several tens of MeV are emitted during the precompound stage of a reaction. The current versions of the CEM and LAQGSM event generators do not account for precompound emission of LF larger than ⁴He. The aim of our work is to extend the precompound model in them to include such processes, leading to an increase of predictive power of LF-production in MCNP6. This entails upgrading the Modified Exciton Model currently used at the preequilibrium stage in CEM and LAQGSM. It also includes expansion and examination of the coalescence and Fermi break-up models used in the precompound stages of spallation reactions within CEM and LAQGSM. Extending our models to include emission of fragments heavier than ⁴He at the precompound stage has indeed provided results that have much

  7. Fragment emission in reactions of 18.5-GeV 12C ions with complex nuclei

    International Nuclear Information System (INIS)

    Porile, N.T.; Cole, G.D.

    1982-01-01

    The emission of fragments ranging from 24 Na to 52 Mn in reactions of 18.5 GeV 12 C ions with Cu, Ag, Gd, Ta, Au, and U targets has been studied by means of activation techniques. The experiments involved determination of the fragment production cross sections and thick-target recoil properties. The latter were used to obtain mean fragment kinetic energies and values of β/sub parallel to/, the forward velocity component of the struck nucleus (in units of c). The results are compared with similar data for incident protons of the same total kinetic energy. The data may be used to assess the importance of central collisions in fragment production. Such collisions lead to the near total destruction of both interacting nuclei and the resulting fragments are emitted by a system of intermediate rapidity. In such a process, the factorization hypothesis, which has been shown to be valid for target and projectile fragmentation reactions, should not be obeyed. A test for factorization is performed by means of a relation which states that the ratio of the cross sections for producing fragment /sup A/Z in 12 C reactions to that for producing the same fragment in proton reactions with the same target is unity, provided both cross sections are reduced by the values of the corresponding total reaction cross sections sigma/sub R/, and evaluated for the same total kinetic energy of the projectile. The results of this comparison for the targets studied are presented and discussed

  8. DNA polymorphism of butyrophilin gene by PCR-RFLP technique ...

    African Journals Online (AJOL)

    We used the polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) technique to screen for DNA polymorphism in 109 cattle. In all cattle, we amplified an 863 fragment consisting of part of exon 8. The amplified fragment digested with HaeIII restriction endonuclease and subjected to electrophoretic ...

  9. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

    Science.gov (United States)

    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

    2001-01-01

    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

  10. Culture, Polymerase Chain Reaction and Restriction Fragment Length Polymorphism Studies in Bartonella bacilliformis

    Science.gov (United States)

    1998-09-22

    tropical regions. Reports of increasing numbers of clinical cases of bartonellosis in Peru (B. bacilli/ormis), documentation of chronic bacteremia in...negative pleomorphic coccobacillus. The disease, in its endemic fonn, occurs in remote Andean valleys of Peru , Ecuador, and Columbia between elevations of...hemolytic anemia (Oroya Fever) that may be life threatening, and as benign, eruptive, hemangioma-like skin lesions (Verruga Peruana). It is a vector-borne

  11. Validating PHITS for heavy ion fragmentation reactions

    International Nuclear Information System (INIS)

    Ronningen, Reginald M.

    2015-01-01

    The performance of the Monte Carlo code system PHITS is validated for heavy-ion transport capabilities by performing simulations and comparing results against experimental data from heavy-ion reactions of benchmark quality. These data are from measurements of isotope yields produced in the fragmentation of a 140 MeV/u "4"8Ca beam on a beryllium target and on a tantalum target. The results of this study show that PHITS performs reliably. (authors)

  12. Studies of complex fragment emission in heavy ion reactions: Progress report, September 1, 1987--August 31, 1988

    International Nuclear Information System (INIS)

    Sobotka, L.G.

    1988-01-01

    The production of large fragments, fragments with mass between light particles and fission fragments, in intermediate and high energy nuclear reactions has fostered the proposal of a number of novel reaction mechanisms. These include liquid-vapor equilibrium and nuclear shattering. Temporarily left in the wake of these exciting proposed mechanisms was the old standard, statistical decay of compound nuclei. To be sure, the standard treatment of compound nucleus decay did not deal with large fragment production. However, this emission was not due to any fundamental deficiency of statistical models, but rather an uncertainty concerning exactly how to splice large fragment emission into statistical models. A large portion of our program deals with this problem. Specifically, by studying the yields of large fragments produced in sufficiently low energy reactions we are attempting to deduce the asymmetry and l-wave dependence of large fragment emission from compound nuclear intermediates. This, however, is only half of the problem. Since the novel mechanisms proposed for large fragment emission were spawned by intermediate and high energy reaction data, we must also realize the relevance of the compound nucleus mechanisms at high energies. It is not unreasonable to suspect that compound nucleus-like objects are formed with less than complete momentum transfer and perhaps less than complete mass transfer. Therefore the study of large fragment production in low energy reactions should go hand in hand with the study of energy, mass, and angular momentum transfer in incomplete fusion and non-compound reactions. This thread joins the apparently divergent subjects covered in this report

  13. Telomere length in normal and neoplastic canine tissues.

    Science.gov (United States)

    Cadile, Casey D; Kitchell, Barbara E; Newman, Rebecca G; Biller, Barbara J; Hetler, Elizabeth R

    2007-12-01

    To determine the mean telomere restriction fragment (TRF) length in normal and neoplastic canine tissues. 57 solid-tissue tumor specimens collected from client-owned dogs, 40 samples of normal tissue collected from 12 clinically normal dogs, and blood samples collected from 4 healthy blood donor dogs. Tumor specimens were collected from client-owned dogs during diagnostic or therapeutic procedures at the University of Illinois Veterinary Medical Teaching Hospital, whereas 40 normal tissue samples were collected from 12 control dogs. Telomere restriction fragment length was determined by use of an assay kit. A histologic diagnosis was provided for each tumor by personnel at the Veterinary Diagnostic Laboratory at the University of Illinois. Mean of the mean TRF length for 44 normal samples was 19.0 kilobases (kb; range, 15.4 to 21.4 kb), and the mean of the mean TRF length for 57 malignant tumors was 19.0 kb (range, 12.9 to 23.5 kb). Although the mean of the mean TRF length for tumors and normal tissues was identical, tumor samples had more variability in TRF length. Telomerase, which represents the main mechanism by which cancer cells achieve immortality, is an attractive therapeutic target. The ability to measure telomere length is crucial to monitoring the efficacy of telomerase inhibition. In contrast to many other mammalian species, the length of canine telomeres and the rate of telomeric DNA loss are similar to those reported in humans, making dogs a compelling choice for use in the study of human anti-telomerase strategies.

  14. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    presence of the desired DNA segments, and then submitted for fluorescent fragment length analysis (FLA) using capillary electrophoresis. DNA from armadillo passaged bacteria with a known number of repeat copies for each locus is used as a positive control. The FLA chromatograms are then examined using Peak Scanner software and fragment length is converted to number of VNTR copies (allele). Finally, the VNTR haplotypes are analyzed for patterns, and when combined with patient clinical data can be used to track distribution of strain types.

  15. AMPLIFIED FRAGMENT LENGTH POLYMORPHISM ANALYSIS OF MYCOBACTERIUM AVIUM COMPLEX ISOLATES RECOVERED FROM SOUTHERN CALIFORNIA

    Science.gov (United States)

    Fine-scale genotyping methods are necessary in order to identify possible sources of human exposure to opportunistic pathogens belonging to the Mycobacterium avium complex (MAC). In this study, amplified fragment length polymorphism (AFLP) analysis was evaluated for fingerprintin...

  16. Cloning and expression of cell wall acid invertase gene fragment ...

    African Journals Online (AJOL)

    A fragment of invertase gene containing catalytic sites of cysteine was cloned from poinsettia (Euphorbia pulcherrima wild.) by using the polymerase chain reaction (PCR) method. The length of the fragment was 521 bp, encoding 173 amino acids and containing a part of open reading frames, but no intron. It had a high ...

  17. Fission fragment angular distribution in the reaction 28Si+176Yb

    International Nuclear Information System (INIS)

    Tripathi, R.; Sudarshan, K.; Sharma, S.K.; Reddy, A.V.R.; Pujari, P.K.; Dutta, D.; Goswami, A.; Ramachandran, K.

    2009-01-01

    Fission fragment angular distribution has been measured in the reaction 28 Si+ 176 Yb at beam energies of 145 and 155 MeV to investigate the contribution from non-compound nucleus fission. Experiments were carried out at BARC-TIFR Pelletron-LINAC accelerator facility, Mumbai. Experimental angular anisotropies in this reaction were observed to be higher than those calculated using statistical theory, indicating contribution from non-compound nucleus fission in this reaction. (author)

  18. Comparative Analysis of Human and Canine Campylobacter upsaliensis Isolates by Amplified Fragment Length Polymorphism

    DEFF Research Database (Denmark)

    Damborg, Peter; Guardabassi, Luca; Pedersen, Karl

    2008-01-01

    Human (n = 33) and canine (n = 53) Campylobacter upsaliensis isolates from seven countries were genotyped by a new amplified fragment length polymorphism method. We observed 100% typeability and high overall diversity. The majority of human strains (23/33) clustered separately from canine strains...

  19. Genotyping and genetic diversity of Arcobacter butzleri by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    On, Stephen L.W.; Atabay, H.I.; Amisu, K.O.

    2004-01-01

    Aims: To investigate the potential of amplified fragment length polymorphism (AFLP) profiling for genotyping Arcobacter butzleri and to obtain further data on the genetic diversity of this organism. Methods and Results: Seventy-three isolates of Danish, British, Turkish, Swedish, Nigerian and Nor...

  20. Studies of complex fragment emission in heavy ion reactions: Progress report, September 1, 1986 through August 31, 1987

    International Nuclear Information System (INIS)

    Sobotka, L.G.

    1987-01-01

    The production of large fragments, fragments with mass between light particles and fission fragments, in intermediate and high energy nuclear reactions has fostered the proposal of a number of novel reaction mechanisms. These include liquid-vapor equilibrium and nuclear shattering. Temporarily left in the wake of these exciting proposed mechanisms was the old standard, statistical decay of compound nuclei. To be sure, the standard treatment of compound nucleus decay did not deal with large fragment production. However, this omission was not due to any fundamental deficiency of statistical models, but rather an uncertainty concerning exactly how to splice large fragment emission into statistical models. A large portion of our program deals with this problem. Specifically, by studying the yields of large fragments produced in sufficiently low energy reactions we are attempting to deduce the asymmetry and l-wave dependence of large fragment emission from compound nuclear intermediates. This, however, is only half of the problem. Since the novel mechanisms proposed for large fragment emission were spawned by intermediate and high energy reaction data, we must also realize the relevance of the compound nucleus mechanisms at high energies. It is not unreasonable to suspect that compound nucleus-like objects are formed with less than complete momentum transfer and perhaps less than complete mass transfer. Therefore the study of large fragment production in low energy reactions should go hand in hand with the study of energy, mass, and angular momentum transfer in non-compound reactions. This thread joins the apparently divergent subjects covered in this report. 39 refs., 24 figs., 2 tabs

  1. DNA Length Modulates the Affinity of Fragments of Genomic DNA for the Nuclear Matrix In Vitro.

    Science.gov (United States)

    García-Vilchis, David; Aranda-Anzaldo, Armando

    2017-12-01

    Classical observations have shown that during the interphase the chromosomal DNA of metazoans is organized in supercoiled loops attached to a compartment known as the nuclear matrix (NM). Fragments of chromosomal DNA able to bind the isolated NM in vitro are known as matrix associated/attachment/addressed regions or MARs. No specific consensus sequence or motif has been found that may constitute a universal, defining feature of MARs. On the other hand, high-salt resistant DNA-NM interactions in situ define true DNA loop anchorage regions or LARs, that might correspond to a subset of the potential MARs but are not necessarily identical to MARs characterized in vitro, since there are several examples of MARs able to bind the NM in vitro but which are not actually bound to the NM in situ. In the present work we assayed the capacity of two LARs, as well as of shorter fragments within such LARs, for binding to the NM in vitro. Paradoxically the isolated (≈2 kb) LARs cannot bind to the NM in vitro while their shorter (≈300 pb) sub-fragments and other non-related but equally short DNA fragments, bind to the NM in a high-salt resistant fashion. Our results suggest that the ability of a given DNA fragment for binding to the NM in vitro primarily depends on the length of the fragment, suggesting that binding to the NM is modulated by the local topology of the DNA fragment in suspension that it is known to depend on the DNA length. J. Cell. Biochem. 118: 4487-4497, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  2. PCR-restriction fragment length polymorphism analysis of indigenous nitrogen-fixing micro organisms lineages

    International Nuclear Information System (INIS)

    Liew Woan Ying Pauline; Jong Bor Chyan; Khairuddin Abdul Rahim

    2006-01-01

    The use of PCR-RFLP analysis as a useful microbial identification tool has been evaluated for years. This approach was verified effective worldwide, where differential DNA bands and sequence markers distinctive to specific microbes or microbial groups have been identified. In our study, PCR-RFLP technique has been adopted in the identification of our indigenous N 2 -fixing isolates obtained from several local environments. RFLP was carried out with suitable restriction enzymes and the patterns were documented. Representatives of the different patterns were selected and analysed with the 16S ribosomal DNA sequencing method. The results demonstrated correlation between the differential RFLP patterns and the 16S rDNA identities. (Author)

  3. Growth of Fullerene Fragments Using the Diels-Alder Cycloaddition Reaction: First Step towards a C60 Synthesis by Dimerization

    Directory of Open Access Journals (Sweden)

    Julio A. Alonso

    2013-02-01

    Full Text Available Density Functional Theory has been used to model the Diels-Alder reactions of the fullerene fragments triindenetriphenilene and pentacyclopentacorannulene with ethylene and 1,3-butadiene. The purpose is to prove the feasibility of using Diels-Alder cycloaddition reactions to grow fullerene fragments step by step, and to dimerize fullerene fragments, as a way to obtain C60. The dienophile character of the fullerene fragments is dominant, and the reaction of butadiene with pentacyclopentacorannulene is favored.

  4. Chemoattractive capacity of different lengths of nerve fragments bridging regeneration chambers for the repair of sciatic nerve defects

    Institute of Scientific and Technical Information of China (English)

    Jiren Zhang; Yubo Wang; Jincheng Zhang

    2012-01-01

    A preliminary study by our research group showed that 6-mm-long regeneration chamber bridging is equivalent to autologous nerve transplantation for the repair of 12-mm nerve defects.In this study,we compared the efficacy of different lengths (6,8,10 mm) of nerve fragments bridging 6-mm regeneration chambers for the repair of 12-mm-long nerve defects.At 16 weeks after the regeneration chamber was implanted,the number,diameter and myelin sheath thickness of the regenerated nerve fibers,as well as the conduction velocity of the sciatic nerve and gastrocnemius muscle wet weight ratio,were similar to that observed with autologous nerve transplantation.Our results demonstrate that 6-,8-and 10-mm-long nerve fragments bridging 6-mm regeneration chambers effectively repair 12-mm-long nerve defects.Because the chemoattractive capacity is not affected by the length of the nerve fragment,we suggest adopting 6-mm-long nerve fragments for the repair of peripheral nerve defects.

  5. Fragment production in 12-GeV proton-induced reactions

    International Nuclear Information System (INIS)

    Hirata, Yuichi; Ohnishi, Akira; Ohtsuka, Naohiko; Nara, Yasushi; Niida, Koji; Chiba, Satoshi; Takada, Hiroshi

    2000-01-01

    We study mass and angular distribution of Intermediate Mass Fragment (IMF) produced from p(12 GeV)+ 197 Au reaction by using JAM cascade model combined with percolation model. Although the mass distribution of IMF is well reproduced, the experimentally observed sideward peak of IMF angular distribution is not explained within present JAM + percolation model. (author)

  6. Systematics of complex fragment emission from La induced reactions at E/A = 47 MeV

    International Nuclear Information System (INIS)

    Kehoe, W.L.; Mignerey, A.C.; Bradley, S.

    1989-03-01

    Complex fragment (Z > 2) emission was studied in the reverse kinematics reactions of 139 La on 27 Al and /sup nat./Cu at a bombarding energy of E/A = 47 MeV. Experimental results from inclusive and coincidence measurements for two- and three-fold complex fragments events are presented. Measured cross sections and Z 1 -Z 2 correlations show a predominately binary-decay process for the La + Al reaction, while the La + Cu reaction is dominated by multi-body decay. 18 refs., 9 figs., 1 tab

  7. Amplified fragment length polymorphism and pulsed field gel electrophoresis for subspecies differentiation of Serpulina pilosicoli

    DEFF Research Database (Denmark)

    Møller, Kristian; Jensen, Tim Kåre; Boye, Mette

    1999-01-01

    Pulsed field gel electrophoresis (PFGE) and amplified fragment length polymorphism (AFLP) were compared for their ability to differentiate between 50 porcine Serpulina pilosicoli isolates. Both techniques were highly sensitive, dividing the isolates into 36 and 38 groups, respectively. Due...

  8. Genomic Relatedness of Chlamydia Isolates Determined by Amplified Fragment Length Polymorphism Analysis

    OpenAIRE

    Meijer, Adam; Morré, Servaas A.; Van Den Brule, Adriaan J. C.; Savelkoul, Paul H. M.; Ossewaarde, Jacobus M.

    1999-01-01

    The genomic relatedness of 19 Chlamydia pneumoniae isolates (17 from respiratory origin and 2 from atherosclerotic origin), 21 Chlamydia trachomatis isolates (all serovars from the human biovar, an isolate from the mouse biovar, and a porcine isolate), 6 Chlamydia psittaci isolates (5 avian isolates and 1 feline isolate), and 1 Chlamydia pecorum isolate was studied by analyzing genomic amplified fragment length polymorphism (AFLP) fingerprints. The AFLP procedure was adapted from a previously...

  9. Isotopic resolution of fission fragments from 238U + 12C transfer and fusion reactions

    International Nuclear Information System (INIS)

    Caamano, M.; Rejmund, F.; Derkx, X.; Schmidt, K. H.; Andouin, L.; Bacri, C. O.; Barreau, G.; Benlliure, J.; Casarejos, E.; Fernandez-Dominguez, B.; Gaudefroy, L.; Golabek, C.; Jurado, B.; Lemasson, A.; Navin, A.; Rejmund, M.; Roger, T.; Shrivastava, A.; Schmitt, C.; Taieb, J.

    2010-01-01

    Recent results from an experiment at GANIL, performed to investigate the main properties of fission-fragment yields and energy distributions in different fissioning nuclei as a function of the excitation energy, in a neutron-rich region of actinides, are presented. Transfer reactions in inverse kinematics between a 238 U beam and a 12 C target produced different actinides, within a range of excitation energy below 30 MeV. These fissioning nuclei are identified by detecting the target-like recoil, and their kinetic and excitation energy are determined from the reconstruction of the transfer reaction. The large-acceptance spectrometer VAMOS was used to identify the mass, atomic number and charge state of the fission fragments in flight. As a result, the characteristics of the fission-fragment isotopic distributions of a variety of neutron-rich actinides are observed for the first time over the complete range of fission fragments. (authors)

  10. Association of transforming growth factor-ß3 gene polymorphism ...

    African Journals Online (AJOL)

    Genotyping for the TGF-β3 gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method and BslI restriction endonuclease showed a mutation in 294-bp fragment located on the fourth intron of chromosome 5. Polymorphism in TGF-β3 gene was significantly (P < 0.1) associated with ...

  11. Genomic variations of Mycoplasma capricolum subsp capripneumoniae detected by amplified fragment length polymorphism (AFLP) analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Bolske, G.; Ahrens, Peter

    2000-01-01

    The genetic diversity of Mycoplasma capricolum subsp. capripneumoniae strains based on determination of amplified fragment length polymorphisms (AFLP) is described. AFLP fingerprints of 38 strains derived from different countries in Africa and the Middle East consisted of over 100 bands in the size...

  12. Evaluation of genetic diversity in jackfruit (Artocarpus heterophyllus Lam.) based on amplified fragment length polymorphism markers.

    Science.gov (United States)

    Shyamalamma, S; Chandra, S B C; Hegde, M; Naryanswamy, P

    2008-07-22

    Artocarpus heterophyllus Lam., commonly called jackfruit, is a medium-sized evergreen tree that bears high yields of the largest known edible fruit. Yet, it has been little explored commercially due to wide variation in fruit quality. The genetic diversity and genetic relatedness of 50 jackfruit accessions were studied using amplified fragment length polymorphism markers. Of 16 primer pairs evaluated, eight were selected for screening of genotypes based on the number and quality of polymorphic fragments produced. These primer combinations produced 5976 bands, 1267 (22%) of which were polymorphic. Among the jackfruit accessions, the similarity coefficient ranged from 0.137 to 0.978; the accessions also shared a large number of monomorphic fragments (78%). Cluster analysis and principal component analysis grouped all jackfruit genotypes into three major clusters. Cluster I included the genotypes grown in a jackfruit region of Karnataka, called Tamaka, with very dry conditions; cluster II contained the genotypes collected from locations having medium to heavy rainfall in Karnataka; cluster III grouped the genotypes in distant locations with different environmental conditions. Strong coincidence of these amplified fragment length polymorphism-based groupings with geographical localities as well as morphological characters was observed. We found moderate genetic diversity in these jackfruit accessions. This information should be useful for tree breeding programs, as part of our effort to popularize jackfruit as a commercial crop.

  13. Projectile like fragment production in Ar induced reactions around the Fermi energy

    International Nuclear Information System (INIS)

    Borrel, V.; Gatty, B.; Jacquet, D.; Galin, J.

    1986-01-01

    The production of projectile like fragments (PLF) has been studied in Ar induced reactions on various targets. It shows very clearly, that besides the predominance of fragmentation for most of the products, the transfer process is still a very strong component for products nearby the projectile. The influence of the target neutron excess on the PLF production is investigated as well as the evolution with incident energy of the characteristics of the different competing processes

  14. Analysis of DNA restriction fragments greater than 5.7 Mb in size from the centromeric region of human chromosomes.

    Science.gov (United States)

    Arn, P H; Li, X; Smith, C; Hsu, M; Schwartz, D C; Jabs, E W

    1991-01-01

    Pulsed electrophoresis was used to study the organization of the human centromeric region. Genomic DNA was digested with rare-cutting enzymes. DNA fragments from 0.2 to greater than 5.7 Mb were separated by electrophoresis and hybridized with alphoid and simple DNA repeats. Rare-cutting enzymes (Mlu I, Nar I, Not I, Nru I, Sal I, Sfi I, Sst II) demonstrated fewer restriction sites at centromeric regions than elsewhere in the genome. The enzyme Not I had the fewest restriction sites at centromeric regions. As much as 70% of these sequences from the centromeric region are present in Not I DNA fragments greater than 5.7 and estimated to be as large as 10 Mb in size. Other repetitive sequences such as short interspersed repeated segments (SINEs), long interspersed repeated segments (LINEs), ribosomal DNA, and mini-satellite DNA that are not enriched at the centromeric region, are not enriched in Not I fragments of greater than 5.7 Mb in size.

  15. Things fall apart: Fragmentation reactions in the oxidative aging of organic species

    Science.gov (United States)

    Kroll, J. H.; Isaacman-VanWertz, G. A.; Wilson, K. R.; Daumit, K. E.; Kessler, S. H.; Lim, C. Y.; Worsnop, D. R.

    2016-12-01

    The atmospheric oxidation of organic compounds involves a wide array of chemical transformations, including functionalization reactions (addition of polar functional groups to the carbon skeleton), fragmentation reactions (formation of lower carbon-number products via C-C bond scission), and accretion reactions (increases in molecular weight by the combination of two chemical species). Each of these reaction classes can lead to large changes in volatility, and hence can have major implications for atmospheric organic aerosol (OA). For example, the formation of OA is predominantly driven by functionalization and accretion reactions, which generally lead to decreases in volatility. Here we describe a series of laboratory studies of the subsequent organic "aging", the multiday oxidation processes that occur after the initial OA formation and growth. In these studies, the multigenerational oxidation of organic compounds in various phases (the gas phase, the condensed OA phase, and the aqueous phase) is carried out within either an environmental chamber or a flow reactor, and monitored using various high-resolution mass spectrometric techniques. In all cases it is found that fragmentation reactions play a major role in the observed aging chemistry, dominated by the formation of small, volatile oxidation products. These results suggest that multi-day oxidative aging processes do not lead to sustained aerosol growth, but rather may serve as a chemical sink for atmospheric OA.

  16. Nucleon-nucleon scattering length from three-body reactions

    International Nuclear Information System (INIS)

    Bodek, K.

    1989-01-01

    Experiments aimed at the measurement of the singlet scattering lengths 1 a np and 1 a nn of the NN-interaction in the presence of a heavy spectator are described. The values obtained are compared with the results of measurements of other reactions. The very good agreement of the experimental values of 1 a np from all breakup reactions and elastic scattering as well as agreement of the values of 1 a nn from breakup reactions and disagreement with the value from the π - d → nnγ reaction cast doubts on the hypothesis ascribing this discrepancy to a 3N-force. This result also suggests a stronger effect of a violation of the charge independence principle than previously accepted. 101 refs., 18 figs., 3 tabs. (author)

  17. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

    Directory of Open Access Journals (Sweden)

    Huyen Mai NT

    2013-02-01

    Full Text Available Abstract Background In comparison to restriction fragment length polymorphism (RFLP typing, variable number of tandem repeat (VNTR typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of Mycobacterium tuberculosis. However, some reports indicated that VNTR typing may be less suitable for Beijing genotype isolates. We therefore compared the performance of internationally standardized RFLP and 24 loci VNTR typing to discriminate among 100 Beijing genotype isolates from the Southern Vietnam. Methods Hundred Beijing genotype strains defined by spoligotyping were randomly selected and typed by RFLP and VNTR typing. The discriminatory power of VNTR and RFLP typing was compared using the Bionumerics software. Results Among 95 Beijing strains available for analysis, 14 clusters were identified comprising 34 strains and 61 unique profiles in 24 loci VNTR typing ((Hunter Gaston Discrimination Index (HGDI = 0.994. 13 clusters containing 31 strains and 64 unique patterns in RFLP typing (HGDI = 0.994 were found. Nine RFLP clusters were subdivided by VNTR typing and 12 VNTR clusters were split by RFLP. Five isolates (5% revealing double alleles or no signal in two or more loci in VNTR typing could not be analyzed. Conclusions Overall, 24 loci VNTR typing and RFLP typing had similar high-level of discrimination among 95 Beijing strains from Southern Vietnam. However, loci VNTR 154, VNTR 2461 and VNTR 3171 had hardly added any value to the level of discrimination.

  18. Restriction Fragment Pattern (RFP) analysis of genomes from Danish isolates of Suid herpesvirus 1 (Aujeszky's disease virus)

    DEFF Research Database (Denmark)

    Christensen, Laurids Siig; Sørensen, K. J.; Lei, J. C.

    1987-01-01

    Purified DNA from 42 isolates of Suid herpesvirus 1 (SHV-1) collected during 1985 from clinical outbreaks of Aujezsky's disease on Danish farms was compared by restriction fragment pattern (RFP) analysis. The BamHI generated RFPs were found to be distinguishable, thus confirming RFP analysis...

  19. Instantaneous equations for multiphase flow in porous media without length-scale restrictions using a non-local averaging volume

    International Nuclear Information System (INIS)

    Espinosa-Paredes, Gilberto

    2010-01-01

    The aim of this paper is to propose a framework to obtain a new formulation for multiphase flow conservation equations without length-scale restrictions, based on the non-local form of the averaged volume conservation equations. The simplification of the local averaging volume of the conservation equations to obtain practical equations is subject to the following length-scale restrictions: d << l << L, where d is the characteristic length of the dispersed phases, l is the characteristic length of the averaging volume, and L is the characteristic length of the physical system. If the foregoing inequality does not hold, or if the scale of the problem of interest is of the order of l, the averaging technique and therefore, the macroscopic theories of multiphase flow should be modified in order to include appropriate considerations and terms in the corresponding equations. In these cases the local form of the averaged volume conservation equations are not appropriate to describe the multiphase system. As an example of the conservation equations without length-scale restrictions, the natural circulation boiling water reactor was consider to study the non-local effects on the thermal-hydraulic core performance during steady-state and transient behaviors, and the results were compared with the classic local averaging volume conservation equations.

  20. Complex nuclear-structure phenomena revealed from the nuclide production in fragmentation reactions

    International Nuclear Information System (INIS)

    Ricciardi, M.V.; Kelic, A.; Napolitani, P.; Schmidt, K.H.; Yordanov, O.; Ignatyuk, A.V.; Rejmund, F.

    2003-12-01

    Complex structural effects in the nuclide production from the projectile fragmentation of 1 A GeV 238 U nuclei in a titanium target are reported. The structure seems to be insensitive to the excitation energy induced in the reaction. This is in contrast to the prominent structural features found in nuclear fission and in transfer reactions, which gradually disappear with increasing excitation energy. Using the statistical model of nuclear reactions, relations to structural effects in nuclear binding and in the nuclear level density are demonstrated. (orig.)

  1. Fragmentation and direct transfer reactions for 40Ar incident beam on 27Al target at 1760 MeV

    International Nuclear Information System (INIS)

    Cisse, Ousmane

    1985-01-01

    Peripheral collision studies performed with 40 Ar projectiles at 44 MeV/A and 27 Al target show that both fragmentation and transfer reactions can be discerned in this type of interaction. The experimental observation of fragments with masses charges and velocities close to those of the incident beam are the signature of transfer reactions and a detailed analysis of the energy spectra of such fragments has been carried out and interpreted in terms of a direct diffraction transfer model. On the other hand, for large mass transfer reactions, abrasion is the suitable mechanism. Inclusive fragment measurement together with the appropriate residual nuclei-fragment coincidence results then provides experimental data in good agreement with the theoretical predictions obtained from a participant spectator model. These investigations also indicate that the separation energies of the participant from the spectator nucleus, at least within the framework of the above model, can be interpreted in terms of a friction force which becomes more efficient as the projectile energy decreases. (author) [fr

  2. Normal telomere lengths in naive and memory CD4+ T cells in HIV type 1 infection: a mathematical interpretation

    NARCIS (Netherlands)

    Wolthers, K. C.; Noest, A. J.; Otto, S. A.; Miedema, F.; de Boer, R. J.

    1999-01-01

    To study CD4+ T cell productivity during HIV-1 infection, CD4+ T cell telomere lengths were measured. Cross-sectional and longitudinal analysis of HIV-1-infected individuals with CD4+ T cells counts >300 cells/mm3 showed normal average telomeric restriction fragment (TRF) length and normal

  3. Normal telomere lengths in naive and memory CD4 T cells in HIV type 1 infection : a mathematical interpretation

    NARCIS (Netherlands)

    Wolthers, K.C.; Noest, A.J.; Otto, S.A.; Miedema, F.; Boer, R.J. de

    1999-01-01

    To study CD4+ T cell productivity during HIV-1 infection, CD4+ T cell telomere lengths were measured. Cross-sectional and longitudinal analysis of HIV-1-infected individuals with CD4+ T cells counts >300 cells/mm3 showed normal average telomeric restriction fragment (TRF) length and normal

  4. Nuclear fragmentation reactions in extended media studied with Geant4 toolkit

    Energy Technology Data Exchange (ETDEWEB)

    Pshenichnov, Igor, E-mail: pshenich@fias.uni-frankfurt.d [Frankfurt Institute for Advanced Studies, J.-W. Goethe University, 60438 Frankfurt am Main (Germany); Institute for Nuclear Research, Russian Academy of Science, 117312 Moscow (Russian Federation); Botvina, Alexander [Frankfurt Institute for Advanced Studies, J.-W. Goethe University, 60438 Frankfurt am Main (Germany); Institute for Nuclear Research, Russian Academy of Science, 117312 Moscow (Russian Federation); Mishustin, Igor [Frankfurt Institute for Advanced Studies, J.-W. Goethe University, 60438 Frankfurt am Main (Germany); Kurchatov Institute, Russian Research Center, 123182 Moscow (Russian Federation); Greiner, Walter [Frankfurt Institute for Advanced Studies, J.-W. Goethe University, 60438 Frankfurt am Main (Germany)

    2010-03-15

    It is well-known from numerous experiments that nuclear multifragmentation is a dominating mechanism for production of intermediate mass fragments in nucleus-nucleus collisions at energies above 100AMeV. In this paper we investigate the validity and performance of the Fermi break-up model and the statistical multifragmentation model implemented as parts of the Geant4 toolkit. We study the impact of violent nuclear disintegration reactions on the depth-dose profiles and yields of secondary fragments for beams of light and medium-weight nuclei propagating in extended media. Implications for ion-beam cancer therapy and shielding from cosmic radiation are discussed.

  5. Nuclear fragmentation reactions in extended media studied with Geant4 toolkit

    International Nuclear Information System (INIS)

    Pshenichnov, Igor; Botvina, Alexander; Mishustin, Igor; Greiner, Walter

    2010-01-01

    It is well-known from numerous experiments that nuclear multifragmentation is a dominating mechanism for production of intermediate mass fragments in nucleus-nucleus collisions at energies above 100AMeV. In this paper we investigate the validity and performance of the Fermi break-up model and the statistical multifragmentation model implemented as parts of the Geant4 toolkit. We study the impact of violent nuclear disintegration reactions on the depth-dose profiles and yields of secondary fragments for beams of light and medium-weight nuclei propagating in extended media. Implications for ion-beam cancer therapy and shielding from cosmic radiation are discussed.

  6. Restriction site extension PCR: a novel method for high-throughput characterization of tagged DNA fragments and genome walking.

    Directory of Open Access Journals (Sweden)

    Jiabing Ji

    Full Text Available BACKGROUND: Insertion mutant isolation and characterization are extremely valuable for linking genes to physiological function. Once an insertion mutant phenotype is identified, the challenge is to isolate the responsible gene. Multiple strategies have been employed to isolate unknown genomic DNA that flanks mutagenic insertions, however, all these methods suffer from limitations due to inefficient ligation steps, inclusion of restriction sites within the target DNA, and non-specific product generation. These limitations become close to insurmountable when the goal is to identify insertion sites in a high throughput manner. METHODOLOGY/PRINCIPAL FINDINGS: We designed a novel strategy called Restriction Site Extension PCR (RSE-PCR to efficiently conduct large-scale isolation of unknown genomic DNA fragments linked to DNA insertions. The strategy is a modified adaptor-mediated PCR without ligation. An adapter, with complementarity to the 3' overhang of the endonuclease (KpnI, NsiI, PstI, or SacI restricted DNA fragments, extends the 3' end of the DNA fragments in the first cycle of the primary RSE-PCR. During subsequent PCR cycles and a second semi-nested PCR (secondary RSE-PCR, touchdown and two-step PCR are combined to increase the amplification specificity of target fragments. The efficiency and specificity was demonstrated in our characterization of 37 tex mutants of Arabidopsis. All the steps of RSE-PCR can be executed in a 96 well PCR plate. Finally, RSE-PCR serves as a successful alternative to Genome Walker as demonstrated by gene isolation from maize, a plant with a more complex genome than Arabidopsis. CONCLUSIONS/SIGNIFICANCE: RSE-PCR has high potential application in identifying tagged (T-DNA or transposon sequence or walking from known DNA toward unknown regions in large-genome plants, with likely application in other organisms as well.

  7. Ontology aided modeling of organic reaction mechanisms with flexible and fragment based XML markup procedures.

    Science.gov (United States)

    Sankar, Punnaivanam; Aghila, Gnanasekaran

    2007-01-01

    The mechanism models for primary organic reactions encoding the structural fragments undergoing substitution, addition, elimination, and rearrangements are developed. In the proposed models, each and every structural component of mechanistic pathways is represented with flexible and fragment based markup technique in XML syntax. A significant feature of the system is the encoding of the electron movements along with the other components like charges, partial charges, half bonded species, lone pair electrons, free radicals, reaction arrows, etc. needed for a complete representation of reaction mechanism. The rendering of reaction schemes described with the proposed methodology is achieved with a concise XML extension language interoperating with the structure markup. The reaction scheme is visualized as 2D graphics in a browser by converting them into SVG documents enabling the desired layouts normally perceived by the chemists conventionally. An automatic representation of the complex patterns of the reaction mechanism is achieved by reusing the knowledge in chemical ontologies and developing artificial intelligence components in terms of axioms.

  8. The X chromosome shows less genetic variation at restriction sites than the autosomes

    NARCIS (Netherlands)

    Hofker, M. H.; Skraastad, M. I.; Bergen, A. A.; Wapenaar, M. C.; Bakker, E.; Millington-Ward, A.; van Ommen, G. J.; Pearson, P. L.

    1986-01-01

    Using a standard technique, 122 single-copy probes were screened for their ability to detect restriction fragment length polymorphisms (RFLPs) in the human genome. The use of a standardized RFLP screening enables the introduction of statistical methods in the analysis of differences in RFLP content

  9. Cu-Mediated Stille Reactions of Sterically Congested Fragments: Towards the Total Synthesis of Zoanthamine

    DEFF Research Database (Denmark)

    Nielsen, Thomas E.; Le Quement, Sebastian; Juhl, Martin

    2005-01-01

    A study on the Stille reaction of alkenyl iodides and starmanes with structural resemblance to retrosynthetic fragments of a projected total synthesis of the marine alkaloid zoanthamine was carried out. A range of reaction conditions was examined, and a protocol developed by Corey utilizing excess...

  10. Study of projectile fragmentation in the reaction (158 A GeV) Pb + Pb using CR-39

    CERN Document Server

    Qureshi, I E; Javed, M T; Manzoor, S; Sher, G; Aleem, F; Khan, H A

    2005-01-01

    The fragmentation of Pb ions at 158 A GeV energy produced in the interaction with Pb target has been studied using a CR-39 track detector. A stack comprising of 64 detectors was prepared such that a target of 1 cm thickness was sandwiched between the sheets of CR-39. The purpose of this exposure geometry was to calibrate CR-39 with respect to relativistic heavy ions as well as to study the fragmentation of Pb ions at 158 A GeV energy. The exposure was carried out at the SPS beam facility of CERN at normal incidence with a fluence of . Two detectors from the exposed stack have been selected for this study: one before and the other after the target material. After etching, the detectors were scanned using an optical microscope and the etched track lengths and the diameters of the track openings were measured manually. Considering that the lengths of tracks provide the best charge resolution for Z>65, we have measured track lengths for a sufficiently large number of fragments to identify individual charge states...

  11. Populations of excited states and reaction mechanisms in the emission of complex fragments

    International Nuclear Information System (INIS)

    Gomez del Campo, J.

    1990-01-01

    Cross sections for emission of complex fragments (Z>2) in their ground and excited states are presented for several heavy-ion reactions at bombarding energies above 10 MeV/nucleon. Data presented are mostly on the cross sections extracted by γ-ray techniques. It is shown that a simple statistical approach to associate the ratio, of cross sections for excited states and ground states, to the temperature of the emitter fails to give the expected temperatures. However, it is shown that this is mostly due to the fact that the fragments that γ decay are secondary fragments, produced by the particle decay of the primary emitted complex fragments. A Hauser-Feshbach analysis accounts well for the cross sections and extracted temperatures. 22 refs., 6 figs

  12. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

    Science.gov (United States)

    Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

    2017-06-25

    Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

  13. Application of fluorescent amplified fragment length polymorphism for comparison of human and animal isolates of Yersinia enterocolitica

    DEFF Research Database (Denmark)

    Fearnley, C.; On, S.L.W.; Kokotovic, Branko

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y enterocolitica strains according...

  14. Analysis for fragmentation products of proton-induced reactions on Pb with energy up to GeV

    International Nuclear Information System (INIS)

    Fan Sheng; Li Zhuxia; Zhao Zhixiang; Ding Dazhao

    2002-01-01

    The mass and charge distribution of residual products produced in the spallation reaction needs to be studied because it can provide useful information for the disposal of nuclear and the radiation damage in the spallation target. The mass and charge distribution of the spallation products is studied by using quantum molecular dynamic (QMD) models. The simulation results are well agreed with the experimental data of the spallation fragment and empirical formula. However, QMD model does not include the fission process; the calculations can not reproduce the fission fragment. The fission model is introduced into QMD model to investigate the fragment products from proton-induced reactions on Pb. The results are in good agreement with the experimental data

  15. Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

    Science.gov (United States)

    de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a detailed evaluation on discriminatory power and agreement with findings in a cluster investigation was performed on 3,975 tuberculosis cases during the period of 2004 to 2008. The level of discrimination of the two typing methods did not differ substantially: RFLP typing yielded 2,733 distinct patterns compared to 2,607 in VNTR typing. The global concordance, defined as isolates labeled unique or identically distributed in clusters by both methods, amounted to 78.5% (n = 3,123). Of the remaining 855 cases, 12% (n = 479) of the cases were clustered only by VNTR, 7.7% (n = 305) only by RFLP typing, and 1.8% (n = 71) revealed different cluster compositions in the two approaches. A cluster investigation was performed for 87% (n = 1,462) of the cases clustered by RFLP. For the 740 cases with confirmed or presumed epidemiological links, 92% were concordant with VNTR typing. In contrast, only 64% of the 722 cases without an epidemiological link but clustered by RFLP typing were also clustered by VNTR typing. We conclude that VNTR typing has a discriminatory power equal to IS6110 RFLP typing but is in better agreement with findings in a cluster investigation performed on an RFLP-clustering-based cluster investigation. Both aspects make VNTR typing a suitable method for tuberculosis surveillance systems. PMID:23363841

  16. [Recent advances of amplified fragment length polymorphism and its applications in forensic botany].

    Science.gov (United States)

    Li, Cheng-Tao; Li, Li

    2008-10-01

    Amplified fragment length polymorphism (AFLP) is a new molecular marker to detect genomic polymorphism. This new technology has advantages of high resolution, good stability, and reproducibility. Great achievements have been derived in recent years in AFLP related technologies with several AFLP expanded methodologies available. AFLP technology has been widely used in the fields of plant, animal, and microbes. It has become one of the hotspots in Forensic Botany. This review focuses on the recent advances of AFLP and its applications in forensic biology.

  17. Genotypic characterization of Salmonella by multilocus sequence typing, pulsed-field gel electrophoresis and amplified fragment length polymorphism

    DEFF Research Database (Denmark)

    Torpdahl, Mia; Skov, Marianne N.; Sandvang, Dorthe

    2005-01-01

    subspecies enterica isolates. A total of 25 serotypes were investigated that had been isolated from humans or veterinary sources in Denmark between 1995 and 2001. All isolates were genotyped by multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) and amplified fragment length...

  18. T cell telomere length in HIV-1 infection: no evidence for increased CD4+ T cell turnover

    NARCIS (Netherlands)

    Wolthers, K. C.; Bea, G.; Wisman, A.; Otto, S. A.; de Roda Husman, A. M.; Schaft, N.; de Wolf, F.; Goudsmit, J.; Coutinho, R. A.; van der Zee, A. G.; Meyaard, L.; Miedema, F.

    1996-01-01

    Progression to acquired immunodeficiency syndrome (AIDS) has been related to exhaustion of the regenerative capacity of the immune system resulting from high T cell turnover. Analysis of telomeric terminal restriction fragment (TRF) length, a marker for cellular replicative history, showed that

  19. Search for ternary fragmentation in the reaction 856 MeV 98Mo + 51V: Kinematic probing of intermediate-mass-fragment emissions

    International Nuclear Information System (INIS)

    Vardaci, Emanuele; Kaplan, Morton; Parker, Winifred E.; Moses, David J.; Boger, J.T.; Gilfoyle, G.T.; McMahan, M.A.; Montoya, M.

    2000-05-01

    A new technique has been applied to coincidence measurements between fission fragments (FF) and intermediate mass fragments (IMF) emitted from the composite system 149 65 Tb at an excitation energy of 224 MeV. The method permits simultaneous observation of IMF emissions along and normal to the FF separation axes. For the integrated total of 0.10 +-0.02 IMF emitted per fission, we find no significant correlation with FF direction, suggesting that IMFs associated with fission reactions are predominantly emitted from the system prior to fission

  20. Knockout and fragmentation reactions using a broad range of tin isotopes

    Science.gov (United States)

    Rodríguez-Sánchez, J. L.; Benlliure, J.; Bertulani, C. A.; Vargas, J.; Ayyad, Y.; Alvarez-Pol, H.; Atkinson, J.; Aumann, T.; Beceiro-Novo, S.; Boretzky, K.; Caamaño, M.; Casarejos, E.; Cortina-Gil, D.; Díaz-Cortes, J.; Fernández, P. Díaz; Estrade, A.; Geissel, H.; Kelić-Heil, A.; Litvinov, Yu. A.; Mostazo, M.; Paradela, C.; Pérez-Loureiro, D.; Pietri, S.; Prochazka, A.; Takechi, M.; Weick, H.; Winfield, J. S.

    2017-09-01

    Production cross sections of residual nuclei obtained by knockout and fragmentation reactions of different tin isotopes accelerated at 1 A GeV have been measured with the fragment separator (FRS) at GSI, Darmstadt. The new measurements are used to investigate the neutron-excess dependence of the neutron- and proton-knockout cross sections. These cross sections are compared to Glauber model calculations coupled to a nuclear de-excitation code in order to investigate the role of the remnant excitations. This bench marking shows an overestimation of the cross sections for the removal of deeply bound nucleons. A phenomenological increase in the excitation energy induced in the remnants produced in these cases allows us to reproduce the measured cross sections.

  1. Reexamination of fission fragment angular distributions and the fission process: Formalism

    International Nuclear Information System (INIS)

    Bond, P.D.

    1985-01-01

    The theory of fission fragment angular distributions is examined and the universally used expression is found to be valid only under restrictive assumptions. A more general angular distribution formula is derived and applied to recent data of high spin systems. At the same time it is shown that the strong anisotropies observed from such systems can be understood without changing the essential basis of standard fission theory. The effects of reaction mechanisms other than complete fusion on fission fragment angular distributions are discussed and possible angular distribution signatures of noncompound nucleus formation are mentioned

  2. Investigation of the fate and effects of acetyl cedrene on Capitella teleta and sediment bacterial community

    DEFF Research Database (Denmark)

    Ellegaard-Jensen, Lea; Selck, Henriette; Priemé, Anders

    2010-01-01

    /without Capitella teleta (formerly Capitella sp. I)). Furthermore effects of AC on microbial respiration in the system were determined by examining CO(2) flux. T-RFLP (terminal restriction fragment length polymorphism) was used to analyze PCR (polymerase chain reaction) amplified 16S DNA gene fragments from...

  3. Fragment formation in GeV-energy proton and light heavy-ion induced reactions

    International Nuclear Information System (INIS)

    Murakami, T.; Haga, M.; Haseno, M.

    2002-01-01

    We have investigated similarities and differences among the fragment formation processes in GeV-energy light-ion and light heavy-ion induced reactions. We have newly measured inclusive and exclusive energy spectra of intermediate mass fragments (3 ≤ Z ≤ 30; IMFs) for 8-GeV 16 O and 20 Ne and 12-GeV 20 Ne induced target multifragmentations (TMFs) in order to compare them with those previously measured for 8- and 12-GeV proton induced TMFs. We fond noticeable difference in their spectrum shapes and magnitudes but all of them clearly indicate the existence of sideward-peaked components, indicating fragment formations are mainly dictated not by a incident energy per nucleon but by a total energy of the projectile. (author)

  4. Identification of cultured isolates of clinically important yeast species using fluorescent fragment length analysis of the amplified internally transcribed rRNA spacer 2 region

    Directory of Open Access Journals (Sweden)

    Muylaert An

    2002-07-01

    Full Text Available Abstract Background The number of patients with yeast infection has increased during the last years. Also the variety of species of clinical importance has increased. Correct species identification is often important for efficient therapy, but is currently mostly based on phenotypic features and is sometimes time-consuming and depends largely on the expertise of technicians. Therefore, we evaluated the feasibility of PCR-based amplification of the internally transcribed spacer region 2 (ITS2, followed by fragment size analysis on the ABI Prism 310 for the identification of clinically important yeasts. Results A rapid DNA-extraction method, based on simple boiling-freezing was introduced. Of the 26 species tested, 22 could be identified unambiguously by scoring the length of the ITS2-region. No distinction could be made between the species Trichosporon asteroides and T. inkin or between T. mucoides and T. ovoides. The two varieties of Cryptococcus neoformans (var. neoformans and var. gattii could be differentiated from each other due to a one bp length difference of the ITS2 fragment. The three Cryptococcus laurentii isolates were split into two groups according to their ITS2-fragment lengths, in correspondence with the phylogenetic groups described previously. Since the obtained fragment lengths compare well to those described previously and could be exchanged between two laboratories, an internationally usable library of ITS2 fragment lengths can be constructed. Conclusions The existing ITS2 size based library enables identification of most of the clinically important yeast species within 6 hours starting from a single colony and can be easily updated when new species are described. Data can be exchanged between laboratories.

  5. Analysis of production of forward-angle fragments in the 22Ne (40 AMeV + 9Be reaction

    Directory of Open Access Journals (Sweden)

    G. Kaminski

    2008-12-01

    Full Text Available A mechanisms of production of forward-emitted fragments in the 22Ne (40 АMeV + 9Be reaction are investigated. Inclusive velocity and isotopic distributions of products with 3 ≤ Z ≤ 11 were measured on the fragment separator COMBAS. The contribution of direct processes and dissipative ones is presented. Gaussian fitting functions according to Goldhaber formalism has been used to estimate direct components of fragments velocity distributions. Experimental data have been compared to geometric incomplete fusion model predictions. Incomplete fusion model was the first time applied for light nuclei as in the studied reaction system. Overall agreement of simulations with experiment in description of velocity distributions have been achieved for fragments with atomic number close to the projectile mass and for stable isotopes. Discrepancies for other products are the result of transition from incomplete fusion to direct processes with collisions of clusters in the participant zone.

  6. Sources and characteristics of complex fragments in La-induced reactions

    International Nuclear Information System (INIS)

    Roussel-Chomaz, P.; Blumenfeld, Y.; Charity, R.; Colonna, M.; Colonna, N.; Libby, B.; Hanold, K.; Moretto, L.; Peaslee, G.; Wozniak, G.

    1991-01-01

    Complex fragment emission has been studied for a variety of reactions at intermediate energies. Multifragment events are shown to be associated with specific sources characterized by their mass and excitation energy through the incomplete fusion model. Excitation functions for the different multifragment decay channels are found to be almost independent of the system and the incident energy. Preliminary comparisons of the data with dynamical calculations followed by statistical decay calculations are discussed. 11 refs., 7 figs

  7. Nondetectability of restriction fragments and independence of DNA fragment sizes within and between loci in RFLP typing of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Chakraborty, R.; Zhong, Y.; Jin, L. (Univ. of Texas Health Science Center, Houston, TX (United States)); Budowle, B. (FBI Academy, Quantico, VA (United States))

    1994-08-01

    The authors provide experimental evidence showing that, during the restriction-enzyme digestion of DNA samples, some of the HaeIII-digested DNA fragments are small enough to prevent their reliable sizing on a Southern gel. As a result of such nondetectability of DNA fragments, individuals who show a single-band DNA profile at a VNTR locus may not necessarily be true homozygotes. In a population database, when the presence of such nondetectable alleles is ignored, they show that a pseudodependence of alleles within as well as across loci may occur. Using a known statistical method, under the hypothesis of independence of alleles within loci, they derive an efficient estimate of null allele frequency, which may be subsequently used for testing allelic independence within and across loci. The estimates of null allele frequencies, thus derived, are shown to agree with direct experimental data on the frequencies of HaeIII-null alleles. Incorporation of null alleles into the analysis of the forensic VNTR database suggests that the assumptions of allelic independence within and between loci are appropriate. In contrast, a failure to incorporate the occurrence of null alleles would provide a wrong inference regarding the independence of alleles within and between loci. 47 refs., 2 figs., 4 tabs.

  8. Introducing Human Population Biology through an Easy Laboratory Exercise on Mitochondrial DNA

    Science.gov (United States)

    Pardinas, Antonio F.; Dopico, Eduardo; Roca, Agustin; Garcia-Vazquez, Eva; Lopez, Belen

    2010-01-01

    This article describes an easy and cheap laboratory exercise for students to discover their own mitochondrial haplogroup. Students use buccal swabs to obtain mucosa cells as noninvasive tissue samples, extract DNA, and with a simple polymerase chain reaction-restriction fragment length polymorphism analysis they can obtain DNA fragments of…

  9. Pitiríase versicolor circinada: isolamento de Malassezia sympodialis - Relato de caso Pityriasis versicolor circinata: isolation of Malassezia sympodialis - Case report

    Directory of Open Access Journals (Sweden)

    Valéria Maria de Souza Framil

    2010-04-01

    Full Text Available Os autores descrevem caso de pitiríase versicolor circinada, cujo agente etiológico isolado foi Malassezia sympodialis em uma mulher de 34 anos. O isolamento e identificação da Malassezia sympodialis foi em ágar Dixon modificado e o método molecular para confirmação da espécie foi PCR-RFLP (polymerase chain reaction and restriction fragment length polymorphism analysis.The authors report a case of pityriasis versicolor circinata whose isolated etiologic agent was Malassezia sympodialis in a 34-year-old woman. The isolation and identification of Malassezia sympodialis were accomplished with modified Dixon's agar, and the molecular method used to confirm the species was polymerase chain reaction and restriction fragment length polymorphism analysis (PCR-RFLP.

  10. Emission of complex fragments in the reaction Ar+Au at 44 and 77 A.MeV

    International Nuclear Information System (INIS)

    Sokolov, A.; Guerreau, D.; Jiang, D.X.; Cramer, B.; Ingold, G.; Gatty, B.; Lott, B.; Piasecki, E.

    1992-01-01

    Complex fragment emission from the 44 and 77 A.MeV 40 Ar + 197 Au reaction was investigated, and complex fragments have been detected, together with the associated neutron multiplicity distributions, and are seen to be preferentially emitted in violent collisions. Equilibrium and non-equilibrium components were identified which are discussed in terms of statistical emission from the hot target-like fragment and of a possible persistence of a deep-inelastic process. (R.P.) 45 refs.; 16 figs.; 1 tab

  11. Characterization of gut microbiota profiles in coronary artery disease patients using data mining analysis of terminal restriction fragment length polymorphism: gut microbiota could be a diagnostic marker of coronary artery disease.

    Science.gov (United States)

    Emoto, Takuo; Yamashita, Tomoya; Kobayashi, Toshio; Sasaki, Naoto; Hirota, Yushi; Hayashi, Tomohiro; So, Anna; Kasahara, Kazuyuki; Yodoi, Keiko; Matsumoto, Takuya; Mizoguchi, Taiji; Ogawa, Wataru; Hirata, Ken-Ichi

    2017-01-01

    The association between atherosclerosis and gut microbiota has been attracting increased attention. We previously demonstrated a possible link between gut microbiota and coronary artery disease. Our aim of this study was to clarify the gut microbiota profiles in coronary artery disease patients using data mining analysis of terminal restriction fragment length polymorphism (T-RFLP). This study included 39 coronary artery disease (CAD) patients and 30 age- and sex- matched no-CAD controls (Ctrls) with coronary risk factors. Bacterial DNA was extracted from their fecal samples and analyzed by T-RFLP and data mining analysis using the classification and regression algorithm. Five additional CAD patients were newly recruited to confirm the reliability of this analysis. Data mining analysis could divide the composition of gut microbiota into 2 characteristic nodes. The CAD group was classified into 4 CAD pattern nodes (35/39 = 90 %), while the Ctrl group was classified into 3 Ctrl pattern nodes (28/30 = 93 %). Five additional CAD samples were applied to the same dividing model, which could validate the accuracy to predict the risk of CAD by data mining analysis. We could demonstrate that operational taxonomic unit 853 (OTU853), OTU657, and OTU990 were determined important both by the data mining method and by the usual statistical comparison. We classified the gut microbiota profiles in coronary artery disease patients using data mining analysis of T-RFLP data and demonstrated the possibility that gut microbiota is a diagnostic marker of suffering from CAD.

  12. The role of the spectator assumption in models for projectile fragmentation

    International Nuclear Information System (INIS)

    Mc Voy, K.W.

    1984-01-01

    This review is restricted to direct-reaction models for the production of projectile fragments in nuclear collisions, at beam energies of 10 or more MeV/nucleon. Projectile fragments are normally identified as those which have near-beam velocities, and there seem to be two principal mechanisms for the production of these fast particles: 1. Direct breakup, 2. Sequential breakup. Of the two, the authors exclude from their discussion the ''sequential breakup'' process, in which the projectile is excited by the initial collision (either via inelastic scattering or transfer to unbound states) and then subsequently decays, outside the range of interaction

  13. Discrimination of press fit candidate microorganism (Enterobacter cloacae, Bacillus licheniformis) by restriction fragment length polymorphic analysis of the 16SrRNA gene; 16S rRNA idenshi no sengen danpen kchotakei kaiseki niyoru atsunyukoho biseibutsu (Enterobacter cloacae, Bacillus licheni-formis) no shikibetsu

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya; Yonebayashi, Eiji; Enomoto, Heiji

    1999-09-01

    In MeOH viewed as one of the improvement method for recovery of the petroleum with hope, the development of discrimination technique of press fit candidate microorganism and oil reservoir resident microorganism which exists in the test object oil reservoir was tried in order to monitor the survival situation of the microorganism which inserted in the oil reservoir under pressure. 16S rRNA amplified by the PCR using the universal primer The microorganism that it cut off the gene at restriction enzyme HhaI,MspI, AluI and inhabits oil reservoir water and oil reservoir rock in the object oil reservoir by ( necessarily TaqI ) and restriction fragment length polymorphic analysis was classified. As the result, the effectiveness of the this PCR-RFLP method was indicated the microorganism which showed RFLP pattern which is identical with the press fit candidate microorganism in the oil reservoir resident microorganism for the discrimination of the press fit candidate microorganism without existing. And, it was indicated that the this PCR-RFLP method was effective for the investigation of oil reservoir resident microbial community which can positively utilize source of nutrition inserted to oil reservoir with the press fit candidate microorganism under pressure, and it was possible to grasp oil reservoir resident microorganism to be especially considered in MEOR. (translated by NEDO)

  14. Quantum Correlated Multi-Fragment Reaction Imaging

    Energy Technology Data Exchange (ETDEWEB)

    Feagin, James M. [California State Univ., Fullerton, CA (United States)

    2017-06-30

    This grant supported research in basic atomic, molecular and optical physics related to the interactions of atoms with particles and fields. This report will focus on the 12 year period from 2004 to 2017, although the DOE–BES has supported my research every year since 1986. All of the support from the grant was used to pay summer salaries of the PI and students and travel to conferences and meetings. The results were in the form of publications in peer reviewed journals as well as conference invited talks and colloquiums. There were 12 peer reviewed publications in these 12+ years. Innovations in few-body science at molecular and nano levels are a critical component of on- going efforts to establish sustainable environmental and energy resources. The varied research paths taken will require the development of basic science on broad fronts with increasing flexi- bility to crossover technologies. We thus worked to extract understanding and quantum control of few-body microscopic systems based on our long-time experience with more conventional studies of correlated electrons and ions. Given the enormous advances over the past 20 years to our understanding of quantum cor- relations with photon interferometry, AMO collision science generally is ready to move beyond the one-particle, single-port momentum detection that has dominated collision physics since Rutherford. Nevertheless, our familiar theoretical tools for collision theory need to be up- graded to incorporate these more generalized measurement formalisms and ultimately to give incentive for a new generation of experiments. Our interest in these topics remains motivated by the recent surge in and success of exper- iments involving few-body atomic and molecular fragmentation and the detection of all the fragments. The research described here thus involved two parallel efforts with (i) emphasis on reaction imaging while (ii) pursuing longtime work on quantum correlated collective excitations.

  15. An Enumerative Combinatorics Model for Fragmentation Patterns in RNA Sequencing Provides Insights into Nonuniformity of the Expected Fragment Starting-Point and Coverage Profile.

    Science.gov (United States)

    Prakash, Celine; Haeseler, Arndt Von

    2017-03-01

    RNA sequencing (RNA-seq) has emerged as the method of choice for measuring the expression of RNAs in a given cell population. In most RNA-seq technologies, sequencing the full length of RNA molecules requires fragmentation into smaller pieces. Unfortunately, the issue of nonuniform sequencing coverage across a genomic feature has been a concern in RNA-seq and is attributed to biases for certain fragments in RNA-seq library preparation and sequencing. To investigate the expected coverage obtained from fragmentation, we develop a simple fragmentation model that is independent of bias from the experimental method and is not specific to the transcript sequence. Essentially, we enumerate all configurations for maximal placement of a given fragment length, F, on transcript length, T, to represent every possible fragmentation pattern, from which we compute the expected coverage profile across a transcript. We extend this model to incorporate general empirical attributes such as read length, fragment length distribution, and number of molecules of the transcript. We further introduce the fragment starting-point, fragment coverage, and read coverage profiles. We find that the expected profiles are not uniform and that factors such as fragment length to transcript length ratio, read length to fragment length ratio, fragment length distribution, and number of molecules influence the variability of coverage across a transcript. Finally, we explore a potential application of the model where, with simulations, we show that it is possible to correctly estimate the transcript copy number for any transcript in the RNA-seq experiment.

  16. HLA DQJ3 restriction fragment length polymorphism and ...

    African Journals Online (AJOL)

    1991-03-16

    Mar 16, 1991 ... We should like to thank Dr Fritz Bach, University of Minnesota, for generously providing the DQf3 probe; Dr R. Martell for his advice and constructive criticism; Chris Martin and Derek Taljaard for technical assistance and Veronique Bruneau for typing the manuscript. This work was supported by grants from ...

  17. Fragmentation cross sections outside the limiting-fragmentation regime

    CERN Document Server

    Sümmerer, K

    2003-01-01

    The empirical parametrization of fragmentation cross sections, EPAX, has been successfully applied to estimate fragment production cross sections in reactions of heavy ions at high incident energies. It is checked whether a similar parametrization can be found for proton-induced spallation around 1 GeV, the range of interest for ISOL-type RIB facilities. The validity of EPAX for medium-energy heavy-ion induced reactions is also checked. Only a few datasets are available, but in general EPAX predicts the cross sections rather well, except for fragments close to the projectile, where the experimental cross sections are found to be larger.

  18. Studies of complex fragment emission in heavy ion reactions

    International Nuclear Information System (INIS)

    Charity, R.J.; Sobotka, L.G.

    1992-01-01

    Our work involves the study of intermediate energy heavy-ion nuclear reactions. This work has two foci. On the one hand, we desire to learn about the properties of nuclear matter under abnormal conditions, in this energy domain, predominately low densities. This purpose runs abreast of the second, which is the study of the relevant reaction mechanisms. The two objectives are inexorably linked because our experimental laboratory for studying nuclear matter properties is a dynamic one. We are forced to ask how nuclear matter properties, such as phase transitions, are reflected in the dynamics of the reactions. It may be that irrefutable information about nuclear matter will not be extracted from the reaction work. Nevertheless, we are compelled to undertake this effort not only because it is the only game in town and as yet we do not know that information cannot be extracted, but also because of our second objective. The process leads to an understanding of the reaction mechanism themselves and therefore to the response characteristics of finite, perhaps non-equilibrium, strongly interacting systems. Our program has been: To study energy, mass, and angular momentum deposition by studying incomplete fusion reactions. To gain confidence that we understand how highly excited systems decompose by studying all emissions from the highly excited systems. To push these kinds of studies into the intermediate energy domain, with excitation function studies. And attempt to learn about the dynamics of the decays using particle-particle correlations. In the last effort, we have decided to focus on simple systems, where we believe, definitive statements are possible. These avenues of research share a common theme, large complex fragment production

  19. Coincidence measurements of intermediate mass fragments produced in /sup 32/S-induced reactions on Ag at E/A = 22.5 MeV

    International Nuclear Information System (INIS)

    Fields, D.J.; Lynch, W.G.; Nayak, T.K.

    1986-01-01

    Single- and two-particle inclusive cross sections for the production of light nuclei and intermediate mass fragments, 3< or =Z< or =24, were measured at angles well beyond the grazing angle for /sup 32/S-induced reactions on Ag at 720 MeV. Information about fragment multiplicities and reaction dynamics was extracted from measurements of light particles, intermediate mass fragments, and targetlike residues in coincidence with intermediate mass fragments. Incomplete linear momentum transfer and non-compound-particle emission are important features of collisions producing intermediate mass fragments. About half of the incident kinetic energy in these collisions is converted into internal excitation. The mean multiplicity of intermediate mass fragments is of the order of 1. Particle correlations are strongly enhanced in the plane which contains the intermediate mass fragment and the beam axis

  20. Sleep restriction may lead to disruption in physiological attention and reaction time

    Directory of Open Access Journals (Sweden)

    Arbind Kumar Choudhary

    2016-07-01

    Full Text Available Sleepiness is the condition where for some reason fails to go into a sleep state and will have difficulty in remaining awake even while carrying out activities. Sleep restriction occurs when an individual fails to get enough sleep due to high work demands. The mechanism between sleep restriction and underlying brain physiology deficits is not well assumed. The objective of the present study was to investigate the mental attention (P300 and reaction time [visual (VRT and auditory (ART] among night watchmen, at subsequent; first (1st day, fourth (4th day and seventh (7th day of restricted sleep period. After exclusion and inclusion criteria, the study was performed among 50 watchmen (age=18–35 years (n=50 after providing written informed consent and divided into two group. Group I-(Normal sleep (n=28 working in day time and used to have normal sleep in night (≥8 h; Group II-(Restricted sleep (n=22 - working in night time and used to have less sleep in night (≤3 h. Statistical significance between the different groups was determined by the independent student ʻtʼ test and the significance level was fixed at p≤0.05. We observed that among all normal and restricted sleep watchmen there was not any significant variation in Karolinska Sleepiness Scale (KSS score, VRT and ART, along with latency and amplitude of P300 on 1st day of restricted sleep. However at subsequent on 4th day and 7th day of restricted sleep, there was significant increase in (KSSscore, and prolongation of VRT and ART as well as alteration in latency and amplitude of P300 wave in restricted sleep watchmen when compare to normal sleep watchmen. The present finding concludes that loss of sleep has major impact in dynamic change in mental attention and reaction time among watchmen employed in night shift. Professional regulations and work schedules should integrate sleep schedules before and during the work period as an essential dimension for their healthy life.

  1. Sleep restriction may lead to disruption in physiological attention and reaction time.

    Science.gov (United States)

    Choudhary, Arbind Kumar; Kishanrao, Sadawarte Sahebrao; Dadarao Dhanvijay, Anup Kumar; Alam, Tanwir

    2016-01-01

    Sleepiness is the condition where for some reason fails to go into a sleep state and will have difficulty in remaining awake even while carrying out activities. Sleep restriction occurs when an individual fails to get enough sleep due to high work demands. The mechanism between sleep restriction and underlying brain physiology deficits is not well assumed. The objective of the present study was to investigate the mental attention (P300) and reaction time [visual (VRT) and auditory (ART)] among night watchmen, at subsequent; first (1st) day, fourth (4th) day and seventh (7th) day of restricted sleep period. After exclusion and inclusion criteria, the study was performed among 50 watchmen (age=18-35 years) (n=50) after providing written informed consent and divided into two group. Group I-(Normal sleep) (n=28) working in day time and used to have normal sleep in night (≥8 h); Group II-(Restricted sleep) (n=22) - working in night time and used to have less sleep in night (≤3 h). Statistical significance between the different groups was determined by the independent student ' t ' test and the significance level was fixed at p≤0.05. We observed that among all normal and restricted sleep watchmen there was not any significant variation in Karolinska Sleepiness Scale (KSS) score, VRT and ART, along with latency and amplitude of P300 on 1st day of restricted sleep. However at subsequent on 4th day and 7th day of restricted sleep, there was significant increase in (KSS)score, and prolongation of VRT and ART as well as alteration in latency and amplitude of P300 wave in restricted sleep watchmen when compare to normal sleep watchmen. The present finding concludes that loss of sleep has major impact in dynamic change in mental attention and reaction time among watchmen employed in night shift. Professional regulations and work schedules should integrate sleep schedules before and during the work period as an essential dimension for their healthy life.

  2. The dual role of fragments in fragment-assembly methods for de novo protein structure prediction

    Science.gov (United States)

    Handl, Julia; Knowles, Joshua; Vernon, Robert; Baker, David; Lovell, Simon C.

    2013-01-01

    In fragment-assembly techniques for protein structure prediction, models of protein structure are assembled from fragments of known protein structures. This process is typically guided by a knowledge-based energy function and uses a heuristic optimization method. The fragments play two important roles in this process: they define the set of structural parameters available, and they also assume the role of the main variation operators that are used by the optimiser. Previous analysis has typically focused on the first of these roles. In particular, the relationship between local amino acid sequence and local protein structure has been studied by a range of authors. The correlation between the two has been shown to vary with the window length considered, and the results of these analyses have informed directly the choice of fragment length in state-of-the-art prediction techniques. Here, we focus on the second role of fragments and aim to determine the effect of fragment length from an optimization perspective. We use theoretical analyses to reveal how the size and structure of the search space changes as a function of insertion length. Furthermore, empirical analyses are used to explore additional ways in which the size of the fragment insertion influences the search both in a simulation model and for the fragment-assembly technique, Rosetta. PMID:22095594

  3. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

    Science.gov (United States)

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

    2017-09-01

    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  4. Effects of G-CSF on telomere lengths in PBMCs from human immunodeficiency virus-infected patients

    DEFF Research Database (Denmark)

    Aladdin, H; Ullum, H; Schjerling, P

    2000-01-01

    , and not in CD4+ T cells. In this double-blind placebo-controlled study, we investigated the effect of granulocyte colony stimulating factor (G-CSF) treatment combined with highly active antiretroviral therapy (HAART) on mean telomere length in peripheral blood mononuclear cells (PBMC). The terminal restriction...... fragment (TRF) length showed no changes during G-CSF treatment although the number of lymphocytes increased significantly. The mean TRF length correlated positively (R = 0.552, P = 0.009) and negatively (R = -0.503, P = 0.02) to the proportion of CD4+ memory and naïve cells, respectively. Our data suggest...

  5. Using Variable-Length Aligned Fragment Pairs and an Improved Transition Function for Flexible Protein Structure Alignment.

    Science.gov (United States)

    Cao, Hu; Lu, Yonggang

    2017-01-01

    With the rapid growth of known protein 3D structures in number, how to efficiently compare protein structures becomes an essential and challenging problem in computational structural biology. At present, many protein structure alignment methods have been developed. Among all these methods, flexible structure alignment methods are shown to be superior to rigid structure alignment methods in identifying structure similarities between proteins, which have gone through conformational changes. It is also found that the methods based on aligned fragment pairs (AFPs) have a special advantage over other approaches in balancing global structure similarities and local structure similarities. Accordingly, we propose a new flexible protein structure alignment method based on variable-length AFPs. Compared with other methods, the proposed method possesses three main advantages. First, it is based on variable-length AFPs. The length of each AFP is separately determined to maximally represent a local similar structure fragment, which reduces the number of AFPs. Second, it uses local coordinate systems, which simplify the computation at each step of the expansion of AFPs during the AFP identification. Third, it decreases the number of twists by rewarding the situation where nonconsecutive AFPs share the same transformation in the alignment, which is realized by dynamic programming with an improved transition function. The experimental data show that compared with FlexProt, FATCAT, and FlexSnap, the proposed method can achieve comparable results by introducing fewer twists. Meanwhile, it can generate results similar to those of the FATCAT method in much less running time due to the reduced number of AFPs.

  6. Research on critical behaviour during fragmentation of the projectile in the Xe+Sn (at 50 MeV/A) reaction; Recherche d`un comportement critique dans la fragmentation du projectile dans la reaction Xe+Sn a 50 MeV/A

    Energy Technology Data Exchange (ETDEWEB)

    Benlliure, J

    1995-03-01

    The study of moments of fragments charge distributions produced in heavy ions collisions can give us evidence of a critical behavior of nuclear matter which could explain the multifragmentation pattern. From an experimental point of view, in order to perform this capabilities of the INDRA detector has made it possible to identify all these particles and to reconstruct the initial projectile-like fragment coming from binary collisions in the reaction Xe+Sn at 50 MeV/A. We have selected events where the initial projectile-like fragments keep their entire charge in a large range of excitation energy. The study of these fragment`s characteristics show clearly a change in the deexcitation pattern. The evolution of moments of the fragment charge distributions has been reproduced within a percolation model, in this sense we can interpreter this change in the deexcitation pattern as a function of the initial projectile-like fragment`s size shows the existence of finite-size effects. However, the signature of a phase transition remains independent on the projectile-like fragment`s size. (author). 74 refs., 58 figs., 9 tabs.

  7. High Efficiency Hydrodynamic DNA Fragmentation in a Bubbling System.

    Science.gov (United States)

    Li, Lanhui; Jin, Mingliang; Sun, Chenglong; Wang, Xiaoxue; Xie, Shuting; Zhou, Guofu; van den Berg, Albert; Eijkel, Jan C T; Shui, Lingling

    2017-01-18

    DNA fragmentation down to a precise fragment size is important for biomedical applications, disease determination, gene therapy and shotgun sequencing. In this work, a cheap, easy to operate and high efficiency DNA fragmentation method is demonstrated based on hydrodynamic shearing in a bubbling system. We expect that hydrodynamic forces generated during the bubbling process shear the DNA molecules, extending and breaking them at the points where shearing forces are larger than the strength of the phosphate backbone. Factors of applied pressure, bubbling time and temperature have been investigated. Genomic DNA could be fragmented down to controllable 1-10 Kbp fragment lengths with a yield of 75.30-91.60%. We demonstrate that the ends of the genomic DNAs generated from hydrodynamic shearing can be ligated by T4 ligase and the fragmented DNAs can be used as templates for polymerase chain reaction. Therefore, in the bubbling system, DNAs could be hydrodynamically sheared to achieve smaller pieces in dsDNAs available for further processes. It could potentially serve as a DNA sample pretreatment technique in the future.

  8. Browse Title Index

    African Journals Online (AJOL)

    Items 5451 - 5500 of 11090 ... Vol 11, No 13 (2012), Genetic diversity of Indonesia milkfish ... reaction-restriction fragment length polymorphism (PCR-RFLP) analysis, Abstract PDF ... Vol 10, No 24 (2011), Genetic diversity of Shaanxi soybean ...

  9. Radical Abstraction Reactions with Concerted Fragmentation in the Chain Decay of Nitroalkanes

    Science.gov (United States)

    Denisov, E. T.; Shestakov, A. F.

    2018-05-01

    Reactions of the type X• + HCR2CH2NO2 → XH + R2C=CH2 + N•O2 are exothermic, due to the breaking of weak C-N bonds and the formation of energy-intensive C=C bonds. Quantum chemistry calculations of the transition state using the reactions of Et• and EtO• with 2-nitrobutane shows that such reactions can be categorized as one-step, due to the extreme instability of the intermediate nitrobutyl radical toward decay with the formation of N•O2. Kinetic parameters that allow us to calculate the energy of activation and rate constant of such a reaction from its enthalpy are estimated using a model of intersecting parabolas. Enthalpies, energies of activation, and rate constants are calculated for a series of reactions with the participation of Et•, EtO•, RO•2, N•O2 radicals on the one hand and a series of nitroalkanes on the other. A new kinetic scheme of the chain decay of nitroalkanes with the participation of abstraction reactions with concerted fragmentation is proposed on the basis of the obtained data.

  10. Coincidence measurement between α-particles and projectile-like fragments in the reaction of 82.7 MeV 16O on 27Al

    International Nuclear Information System (INIS)

    Shen Wenqing; Zhan Wenlong; Zhu Yongtai

    1988-01-01

    In a coincidence measurement between α-particles and projectile-like fragments in the reaction of 82.7 MeV 16 O on 27 Al, the contour plot of Galilean-invariant cross section of the coincidence between C-fragments and α-particles in the velocity plane, and the coincident angular correlation have been obtained. The correlated α-particles measured at positive angles (on the same side of the beam as the projectile-like fragments) were emitted mainly from the projectile-like fragments;the α-particles at large negative angles were emitted from the target-like fragments;the α-particles at small negative angles came from the fragmentation of the 16 O projectile. A possible reaction mechanism in which the residue produced in the fragmentation of the projectile continues the dissipation process during the interaction with the target has been discussed. It is also pointed out that in the large yield of C-fragments observed in the inclusive experiment, the contribution of C-fragments produced by the excited 16 O of DIC product via α-emission is quite small

  11. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  12. Genomic-based restriction enzyme selection for specific detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP

    Directory of Open Access Journals (Sweden)

    Dinka eMandakovic

    2016-05-01

    Full Text Available The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS, a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination and fish samples (coinfection, aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants. Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies.

  13. Percolation-fission model study of the fragment mass distribution for the 1 GeV proton induced reaction

    International Nuclear Information System (INIS)

    Katsuma, Masahiko; Kobayashi, Hiroshi; Sawada, Tetsuo; Sasa, Toshinobu

    2005-01-01

    The 1 GeV proton induced reaction on 208 Pb targets is analyzed by using the percolation model combined with the Atchison fission model. The fragment mass distribution and the isotopic production cross sections obtained from our model are compared with the experimental data. The trends of the fragment mass distribution for the 1 GeV proton induced reaction can be reproduced by our calculation in some degree. The order of magnitude for the calculated isotopic production cross sections at the calculated peak positions is similar to that of the experimental peak values. The calculated peak positions of the isotopic production cross sections are shifted to the heavier region than those of the experimental data. (author)

  14. Universality of projectile fragmentation model

    International Nuclear Information System (INIS)

    Chaudhuri, G.; Mallik, S.; Das Gupta, S.

    2012-01-01

    Presently projectile fragmentation reaction is an important area of research as it is used for the production of radioactive ion beams. In this work, the recently developed projectile fragmentation model with an universal temperature profile is used for studying the charge distributions of different projectile fragmentation reactions with different projectile target combinations at different incident energies. The model for projectile fragmentation consists of three stages: (i) abrasion, (ii) multifragmentation and (iii) evaporation

  15. Production of neutron-rich isotopes by cold fragmentation in the reaction 197Au + Be at 950 A MeV

    International Nuclear Information System (INIS)

    Benlliure, J.; Pereira, J.; Schmidt, K.H.; Cortina-Gil, D.; Enqvist, T.; Heinz, A.; Junghans, A.R.; Farget, F.; Taieb, J.

    1999-09-01

    The production cross sections and longitudinal-momentum distributions of very neutron-rich isotopes have been investigated in the fragmentation of a 950 A MeV 179 Au beam in a beryllium target. Seven new isotopes ( 193 Re, 194 Re, 191 W, 192 W, 189 Ta, 187 Hf and 188 Hf) and the five-proton-removal channel were observed for the first time. The reaction mechanism leading to the formation of these very neutron-rich isotopes is explained in terms of the cold-fragmentation process. An analytical model describing this reaction mechanism is presented. (orig.)

  16. Restriction fragment length polymorphism within the class I gene loci of the equine major histocompatibility complex

    International Nuclear Information System (INIS)

    Alexander, A.J.; Bailey, E.; Woodward, J.G.

    1986-01-01

    Fourteen standard bred horses were serotyped as homozygous for 1 of 6 Equine Leukocyte Antigen (ELA) specificities. DNA was purified from peripheral leukocytes and digested with Hind III or Pvu II. Southern blot hybridization analysis was carried out using a 32 P-labeled mouse cDNA probe (PH2IIa) specific for class I MHC genes. Both enzymes generated blots that contained a large number of bands (23 to 30) per horse. Significant polymorphism existed among most fragment sizes, while a dozen highly conserved band sizes suggested the presence of Qa/tla - like genes. Only 2 animals (both W6's) showed identical band patterns. Polymorphism was greatest between horses of different serotypes and was significantly decreased within serotypes. Unique bands were present on both blots for both W1's and W6's and may account for the serologic specificity seen in ELA W1 and W6 horses. This study is consistent with the findings in other higher vertebrates and implies that the MHC of the horse includes a highly polymorphic class I multigene family

  17. Universal odd-even staggering in isotopic fragmentation and spallation cross sections of neutron-rich fragments

    Science.gov (United States)

    Mei, B.; Tu, X. L.; Wang, M.

    2018-04-01

    An evident odd-even staggering (OES) in fragment cross sections has been experimentally observed in many fragmentation and spallation reactions. However, quantitative comparisons of this OES effect in different reaction systems are still scarce for neutron-rich nuclei near the neutron drip line. By employing a third-order difference formula, the magnitudes of this OES in extensive experimental cross sections are systematically investigated for many neutron-rich nuclei with (N -Z ) from 1 to 23 over a broad range of atomic numbers (Z ≈3 -50 ). A comparison of these magnitude values extracted from fragment cross sections measured in different fragmentation and spallation reactions with a large variety of projectile-target combinations over a wide energy range reveals that the OES magnitude is almost independent of the projectile-target combinations and the projectile energy. The weighted average of these OES magnitudes derived from cross sections accurately measured in different reaction systems is adopted as the evaluation value of the OES magnitude. These evaluated OES magnitudes are recommended to be used in fragmentation and spallation models to improve their predictions for fragment cross sections.

  18. [Methods of measuring telomere length and telomerase activity--practice and problems].

    Science.gov (United States)

    Saito, Y; Suda, T; Hatakeyama, K

    1998-05-01

    The development of a highly sensitive method for detection of telomerase activity, telomeric repeat amplification protocol (TRAP), has provided knowledge on telomerase activity in normal and cancer tissues. Subsequent several modifications have been achieved, including an introduction of the internal standard and hybridization protection technique that leads to simplicity and improvement of reproducibility and linearity of this method, and application of TRAP to in situ analysis to identify the cells responsible for telomerase activity. As for measurement of telomere length, fluorescence in situ hybridization technique appeared to give an information of telomere length on an individual chromosome in contrast to analysis of terminal restriction fragment, a conventional method which can express mean telomere length of all chromosomes. Further methodological improvement in this field is ongoing and showing a new sight on cell mortality and immortality.

  19. Analysis of fission-fragment mass distribution within the quantum-mechanical fragmentation theory

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Pardeep; Kaur, Harjeet [Guru Nanak Dev University, Department of Physics, Amritsar (India)

    2016-11-15

    The fission-fragment mass distribution is analysed for the {sup 208}Pb({sup 18}O, f) reaction within the quantum-mechanical fragmentation theory (QMFT). The reaction potential has been calculated by taking the binding energies, Coulomb potential and proximity potential of all possible decay channels and a stationary Schroedinger equation has been solved numerically to calculate the fission-fragment yield. The overall results for mass distribution are compared with those obtained in experiment. Fine structure dips in yield, corresponding to fragment shell closures at Z = 50 and N=82, which are observed by Bogachev et al., are reproduced successfully in the present calculations. These calculations will help to estimate the formation probabilities of fission fragments and to understand many related phenomena occurring in the fission process. (orig.)

  20. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...... Danes. Co-dominant segregation and allelic behavior was seen for the BAT1/NcoI 12 kb and 8 kb bands and the BAT2/RsaI 2.7 kb and 2.3 kb bands, respectively. It is possible that the BAT2/RsaI 3.3 kb band represents a rare allele of the BAT2/RsaI system. The BAT2/RsaI 2.3 kb marker was strongly negatively...

  1. Application of riboprinting for the identification of isolates of cutaneous Leishmania spp

    NARCIS (Netherlands)

    Nimri, L. F.; Schallig, H. D. F. H.

    2003-01-01

    Riboprinting is one of several molecular methods that can generate comparative data independently of the complexity of the organism's morphology. Restriction fragment length polymorphism (RFLP) profiles derived from digestion of polymerase chain reaction (PCR) products of the ribosomal 18S from

  2. Amplified Fragment Length Polymorphism Diversity in Cephalosporium maydis from Egypt.

    Science.gov (United States)

    Saleh, Amgad A; Zeller, Kurt A; Ismael, Abou-Serie M; Fahmy, Zeinab M; El-Assiuty, Elhamy M; Leslie, John F

    2003-07-01

    ABSTRACT Cephalosporium maydis, the causal agent of late wilt of maize, was first described in Egypt in the 1960s, where it can cause yield losses of up to 40% in susceptible plantings. We characterized 866 isolates of C. maydis collected from 14 governates in Egypt, 7 in the Nile River Delta and 7 in southern (Middle and Upper) Egypt, with amplified fragment length polymorphism (AFLP) markers. The four AFLP primer-pair combinations generated 68 bands, 25 of which were polymorphic, resulting in 52 clonal haplotypes that clustered the 866 isolates into four phylogenetic lineages. Three lineages were found in both the Nile River Delta and southern Egypt. Lineage IV, the most diverse group (20 haplotypes), was recovered only from governates in the Nile River Delta. In some locations, one lineage dominated (up to 98% of the isolates recovered) and, from some fields, only a single haplotype was recovered. Under field conditions in Egypt, there is no evidence that C. maydis reproduces sexually. The nonuniform geographic distribution of the pathogen lineages within the country could be due to differences in climate or in the farming system, because host material differs in susceptibility and C. maydis lineages differ in pathogenicity.

  3. Evidence for Sequence Scrambling and Divergent H/D Exchange Reactions of Doubly-Charged Isobaric b-Type Fragment Ions

    Science.gov (United States)

    Zekavat, Behrooz; Miladi, Mahsan; Al-Fdeilat, Abdullah H.; Somogyi, Arpad; Solouki, Touradj

    2014-02-01

    To date, only a limited number of reports are available on structural variants of multiply-charged b-fragment ions. We report on observed bimodal gas-phase hydrogen/deuterium exchange (HDX) reaction kinetics and patterns for substance P b10 2+ that point to presence of isomeric structures. We also compare HDX reactions, post-ion mobility/collision-induced dissociation (post-IM/CID), and sustained off-resonance irradiation-collision induced dissociation (SORI-CID) of substance P b10 2+ and a cyclic peptide with an identical amino acid (AA) sequence order to substance P b10. The observed HDX patterns and reaction kinetics and SORI-CID pattern for the doubly charged head-to-tail cyclized peptide were different from either of the presumed isomers of substance P b10 2+, suggesting that b10 2+ may not exist exclusively as a head-to-tail cyclized structure. Ultra-high mass measurement accuracy was used to assign identities of the observed SORI-CID fragment ions of substance P b10 2+; over 30 % of the observed SORI-CID fragment ions from substance P b10 2+ had rearranged (scrambled) AA sequences. Moreover, post-IM/CID experiments revealed the presence of two conformer types for substance P b10 2+, whereas only one conformer type was observed for the head-to-tail cyclized peptide. We also show that AA sequence scrambling from CID of doubly-charged b-fragment ions is not unique to substance P b10 2+.

  4. Evidence for sequence scrambling and divergent H/D exchange reactions of doubly-charged isobaric b-type fragment ions.

    Science.gov (United States)

    Zekavat, Behrooz; Miladi, Mahsan; Al-Fdeilat, Abdullah H; Somogyi, Arpad; Solouki, Touradj

    2014-02-01

    To date, only a limited number of reports are available on structural variants of multiply-charged b-fragment ions. We report on observed bimodal gas-phase hydrogen/deuterium exchange (HDX) reaction kinetics and patterns for substance P b10(2+) that point to presence of isomeric structures. We also compare HDX reactions, post-ion mobility/collision-induced dissociation (post-IM/CID), and sustained off-resonance irradiation-collision induced dissociation (SORI-CID) of substance P b10(2+) and a cyclic peptide with an identical amino acid (AA) sequence order to substance P b10. The observed HDX patterns and reaction kinetics and SORI-CID pattern for the doubly charged head-to-tail cyclized peptide were different from either of the presumed isomers of substance P b10(2+), suggesting that b10(2+) may not exist exclusively as a head-to-tail cyclized structure. Ultra-high mass measurement accuracy was used to assign identities of the observed SORI-CID fragment ions of substance P b10(2+); over 30% of the observed SORI-CID fragment ions from substance P b10(2+) had rearranged (scrambled) AA sequences. Moreover, post-IM/CID experiments revealed the presence of two conformer types for substance P b10(2+), whereas only one conformer type was observed for the head-to-tail cyclized peptide. We also show that AA sequence scrambling from CID of doubly-charged b-fragment ions is not unique to substance P b10(2+).

  5. Genotyping of human and porcine Yersinia enterocolitica, Yersinia intertmedia, and Yersinia bercovieri strains from Switzerland by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kuehni-Boghenbor, Kathrin; On, Stephen L.W.; Kokotovic, Branko

    2006-01-01

    In this study, 231 strains of Yersinia enterocolitica, 25 strains of Y. intermedia, and 10 strains of Y. bercovieri from human and porcine sources (including reference strains) were analyzed using amplified fragment length polymorphism (AFLP), a whole-genome fingerprinting method for subtyping...

  6. Association of Leukocyte Telomere Length with Fatigue in Nondisabled Older Adults

    DEFF Research Database (Denmark)

    Bendix, Laila; Thinggaard, Mikael; Kimura, Masayuki

    2014-01-01

    Introduction. Fatigue is often present in older adults with no identified underlying cause. The accruing burden of oxidative stress and inflammation might be underlying factors of fatigue. We therefore hypothesized that leukocyte telomere length (LTL) is relatively short in older adults who...... experience fatigue. Materials and Methods. We assessed 439 older nondisabled Danish twins. LTL was measured using Southern blots of terminal restriction fragments. Fatigue was measured by the Mob-T Scale based on questions on whether the respondents felt fatigued after performing six mobility items. Results...

  7. Copolymers containing meta-pyridylvinylene and para-arylenevinylene fragments: synthesis, quaternization reaction, and photophysical properties

    Science.gov (United States)

    Barashkov, Nikolay N.; Olivos, Hernando J.; Ferraris, John P.

    1997-12-01

    We report the Wittig reaction of the diphosphonium salt of 2,6-bis(chloromethyl)pyridine with terephthaldehyde, 2.5- dioctyloxyterephthaldehyde, or 9,10-anthracenedicarbaldehyde to form conjugated copolymers with fragments of 2,6 - pyridylene and para-arylenevinylene. The protonation reaction of poly(para-arylenevinylene)-co-(meta- pyridylvinylene) with hydrochloric acid and the quaternization reaction of poly(2,5-dioctyloxy-1,4- phenylenevinylene)-co-(2,6-pyridylvinylene) with methyl triflate have been investigated by spectrophotometric and fluorescent methods. The absorption, excitation and fluorescence spectra of these copolymers as well as their corresponding model compounds were studied and compared. The photophysical properties of the investigated polymers suggest that these materials could be good candidates for the fabrication of efficient blue and green light-emitting diodes.

  8. Correlations of fragments and their sequential products from the 3He-induced reaction on 58Ni at 130 MeV

    International Nuclear Information System (INIS)

    Stockhorst, H.

    1986-01-01

    The 3 He breakup on the 58 Ni nucleus was studied with a projectile energy of 130 MeV. The main topic of this studies lies thereby on the absorptive breakup in which a fragment from the 3 He breakup is absorbed by the target nucleus. Beside the single and coincidence measurements on the 3 He breakup on the one hand the reaction 58 Ni(d,pp') was studied at a projectile energy of 80 MeV and on the other hand the inclusive reactions 58 Ni(d,yX) and 58 Ni(p,yX) whereby the light particles y up to A=3 were spectroscoped in a wide angular range. The projectile energies were selected in such a way that they correspond almost to the energies of the primary fragments deuteron and proton from the 3 He breakup (E d =79 MeV and E p =39 MeV). The study of the elastic 3 He breakup resulted that the shapes of the deuteron and proton spectra can be well described by a PWBA model and reproduce the momentum distribution of the fragments before the 3 He breakup. The spectra are therefore determined by properties of the projectiles. However the proton and deuteron spectra from the absorptive breakup show distinct components which cannot be reduced to 3 He properties. Rather they are in their shape comparable with the inclusive spectra of the (d,p) respectively (p,p') reaction. Especially this is valid for spectra from the 3 He breakup in which a fragment was registrated with an energy corresponding to the projectile velocity. This suggests that in the absorptive 3 He breakup a two-stage process is present in which after the 3 He fragmentation in a second stage a (d,p) or (p,p') reaction occurs. The study of the 3 He breakup resulted that such processes yield an essential contribution to the inclusive cross section of the reactions 58 Ni( 3 He,dX) and 58 Ni( 3 He,pX). (HSI) [de

  9. Genomic diversity among Danish field strains of Mycoplasma hyosynoviae assessed by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, Niels F.; Nielsen, Elisabeth O.

    2002-01-01

    Genomic diversity among strains of Mycoplasma hyosynoviae isolated in Denmark was assessed by using amplified fragment length polymorphism (AFLP) analysis. Ninety-six strains, obtained from different specimens and geographical locations during 30 years and the type strain of M. hyosynoviae S16(T......) were concurrently examined for variance in BglII-MfeI and EcoRI-Csp6I-A AFLP markers. A total of 56 different genomic fingerprints having an overall similarity between 77 and 96% were detected. No correlation between AFLP variability and period of isolation or anatomical site of isolation could...

  10. A SIMPLE POLYMERASE CHAIN REACTION/RESTRICTION FRAGMENT LENGTH POLYMORPHISM ASSAY CAPABLE OF IDENTIFYING MEDICALLY RELEVANT FILAMENTOUS FUNGI

    Science.gov (United States)

    The accumulating evidence that suggests that numerous unhealthy conditions in the indoor environment are the result of abnormal growth of the filamentous fungi (mold) in and on buildign surfaces. In order to accurately reflect the organisms responsible for these maladies it is of...

  11. Complex fragment emission in the reaction 197Au → 197Au at an incident energy of 15 MeV/u

    International Nuclear Information System (INIS)

    Schmoll, R.

    1988-07-01

    For the study of the dominant decay processes in the reaction 15 MeV/u 197 Au → 197 Au in one-particle inclusive experiments the emission characteristics of all ejectiles in the mass range 24 ≤ A ≤ 197 were studied. The deflection function of the projectile-like fragments is for all energy losses at the grazing angle Θ cm gr =27.5 degrees peaked and in fact even for scattering events in which the whole available kinetic energy was dissipated in the collisions. The systematic analysis of the velocity spectra shows that the lightest fragments are formed in double-sequential fission of the highly excited gold-like fragments from the first deep inelastic reaction stage before reaching of a global equilibrium. On the other side symmetrical fission products, which are part of the narrow branch of the mass distribution, are emitted in simple-sequential non-equilibrium fission. This simple-sequential breakup is very closely limited to excitation energies of 75 ≤ E * ≤ 275 MeV of the primary, gold-like fragments, while the probability for double-sequential fission above E * ≅ 200 MeV increases very strongly. Contrarily to equilibrated compound-nucleus fission these processes are characterized by a in the source system strongly anisotropic angular distribution with distinct foreward/backward asymmetry and by an extremely asymmetric mass split. The study of the mass distribution shows that non-equilibrium fission at 15 MeV/u is both in view of the reaction cross section and regarding the creation of the complex fragments is the dominant decay process. The integral cross section of the broad four-body distribution corresponds to 60% of the total reaction cross section; the integral cross section of the narrow three-body distribution corresponds to 10%. (orig./HSI) [de

  12. HLA DQβ restriction fragment length polymorphism and rheumatQid ...

    African Journals Online (AJOL)

    Two variants of the HLA-DR4-linked DQw3 allele, namely OQw7 and DQw8, were analysed in patients of mixed ancestry (Cape Coloureds) with rheumatoid arthritis and in healthy individuals from the same population group using a DQ-β specific cDNA probe. The DQw7 allele, identified by 3,4 kb Hind III or 3,7 kb and 6,9 ...

  13. The relation between the PST1 restriction fragment length ...

    African Journals Online (AJOL)

    The elevated apo-AI levels in marathon runners therefore bear no relation to ..... correlation between levels of physical activity and apo-AI levels.15 In the group of ... previously reported for Caucasians in Europe.'9-'3 The higher levels of HDL ...

  14. Projectile-like fragments from 129Xe+natCu reactions at E/A = 40 MeV

    International Nuclear Information System (INIS)

    Russ, D.E.; Mignerey, A.C.; Garcia-Solis, E.J.

    1996-01-01

    The bombarding of heavy nuclei with energetic heavy projectiles has been one of the most important experimental tools for nuclear science. At low beam energies, (E/A) beam 100 MeV, these mean field effects are less important and nucleon-nucleon interactions dominate. Within the intermediate energy region, the situation is less clear because of both the mean field and nucleon-nucleon effects contribute. There is no consensus on the theoretical treatment of nuclear reaction in the intermediate energy regime and statistical, dynamical, and hybrid models have been used with limited success. Previous studies of 136 Xe + 209 Bi at E/A = 28 MeV carried out at Michigan State University (MSU) have been well described by a damped reaction mechanism. On the other hand, 129 Xe + nat Cu at E/A = 50 MeV also at MSU has been compared with a hybrid model with reasonable success. In order to see a transition from a damped reaction mechanism to more fragmentation-like processes, an experiment was carried out at MSU using 129 Xe beams at E/A = 30, 40, 50, and 60 MeV. The targets were Cu, Sc, and Au. The current study only looks at the projectile-like fragments (PLF) detected in the Maryland Forward Array (MFA)

  15. An outbreak of food poisoning due to egg yolk reaction-negative Staphylococcus aureus.

    Science.gov (United States)

    Miwa, N; Kawamura, A; Masuda, T; Akiyama, M

    2001-03-20

    An outbreak of staphylococcal food poisoning due to an egg yolk (EY) reaction-negative strain occurred in Japan. Twenty-one of 53 dam construction workers who ate boxed lunches prepared at their company cafeteria became ill, and eight required hospital treatment. The outbreak showed a typical incubation time (1.5-4 h with a median time of 2.7 h) and symptoms (vomiting and diarrhea) of staphylococcal food poisoning. Staphylococcus aureus, which produces staphylococcal enterotoxin (SE) A, was isolated from four fecal specimens of eight patients tested. Scrambled egg in the boxed lunches contained 20-40 ng/g of SEA, and 3.0 x 10(9)/g of viable S. aureus cells that produced this toxin. All isolates from patients and the food were EY reaction-negative, coagulase type II, and showed the same restriction fragment length polymorphism (RFLP) pattern. We concluded that the outbreak was caused by scrambled egg contaminated with EY reaction-negative S. aureus. In Japan, outbreaks of staphylococcal food poisoning are mainly caused by EY reaction-positive S. aureus, and EY reaction-negative colonies grown on agar plates containing EY are usually not analyzed further for detection of S. aureus. The present outbreak suggested that EY reaction-negative isolates should be subjected to further analysis to detect the causative agents of staphylococcal food poisoning.

  16. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  17. Studies of complex fragment emission in heavy ion reactions. Progress report, January 1, 1993 - September 1, 1995

    International Nuclear Information System (INIS)

    Charity, R.J.; Sobotka, L.G.

    1995-01-01

    This work involves the study of low and intermediate energy heavy-ion nuclear reactions. This work has two foci. First, the authors desired to learn about the properties of both nuclei and nuclear matter under abnormal conditions. Their efforts towards this end run abreast of those for their second focus which is the study of the relevant reaction mechanisms. The two objectives are inexorably linked because their experimental laboratory for studying nuclear properties is a dynamic one. Their task is to answer the questions of how nuclear and nuclear matter properties are reflected in the dynamics of the reactions. The second objective also has great intrinsic value in that they can anticipate improving upon their understanding of the reaction mechanism themselves and therefore to the response characteristics of finite, perhaps non-equilibrium, strongly interacting systems. The program has been: to study the dynamics of fusion reactions, specifically the dynamics of energy, mass, and angular momentum deposition. This work includes reactions near the Coulomb barrier, where fusion dominates the reaction cross section as well as higher energies where incomplete fusion reactions are the primary reactions. This includes the dynamics of fission, still the premier example of collective nuclear motion, as a function of excitation, spin, mass, and mass asymmetry. The authors push these kinds of studies into the intermediate energy domain, and where novel reaction scenarios are predicted. They have studied very central and peripheral collisions between very massive nuclei, and simplified projectile fragmentation reactions utilizing medium to light mass projectiles. The study of central collisions has shown us the importance of collective expansion. The study of peripheral collisions between very heavy nuclei has demonstrated the importance of dynamical production of fragments from the neck region

  18. Precursor Ion Scan Mode-Based Strategy for Fast Screening of Polyether Ionophores by Copper-Induced Gas-Phase Radical Fragmentation Reactions.

    Science.gov (United States)

    Crevelin, Eduardo J; Possato, Bruna; Lopes, João L C; Lopes, Norberto P; Crotti, Antônio E M

    2017-04-04

    The potential of copper(II) to induce gas-phase fragmentation reactions in macrotetrolides, a class of polyether ionophores produced by Streptomyces species, was investigated by accurate-mass electrospray tandem mass spectrometry (ESI-MS/MS). Copper(II)/copper(I) transition directly induced production of diagnostic acylium ions with m/z 199, 185, 181, and 167 from α-cleavages of [macrotetrolides + Cu] 2+ . A UPLC-ESI-MS/MS methodology based on the precursor ion scan of these acylium ions was developed and successfully used to identify isodinactin (1), trinactin (2), and tetranactin (3) in a crude extract of Streptomyces sp. AMC 23 in the precursor ion scan mode. In addition, copper(II) was also used to induce radical fragmentation reactions in the carboxylic acid polyether ionophore nigericin. The resulting product ions with m/z 755 and 585 helped to identify nigericin in a crude extract of Streptomyces sp. Eucal-26 by means of precursor ion scan experiments, demonstrating that copper-induced fragmentation reactions can potentially identify different classes of polyether ionophores rapidly and selectively.

  19. Mass distribution of fission fragments using SSNTDs based image analysis system

    International Nuclear Information System (INIS)

    Kolekar, R.V.; Sharma, D.N.

    2006-01-01

    Lexan polycarbonate track detector was used to obtain mass distribution of fission fragments from 252 Cf planchette source, Normally, if the fission fragments are incident perpendicular to the lexan surface, the diameter of heavy fragment is greater than that of lighter fragment. In practical problems fission fragments are incident on the detector at all angles. So, in the present experiment, lexan detector was exposed to 252 Cf planchette source in 2π geometry. Fission fragments were incident on the detector with various angles. So the projected fission track length for fission fragment of same energy is different because of different angle of incidence. Image analysis software was used to measure the projected track length. But the problem is that for fission fragment having greater angle of incidence the entire track length is not focused on the surface. So reduced track length is measured. This problem is solved by taking two images, one at the surface and one at the tip of track and then overlapping both the images using image analysis software. The projected track length and the depth of the track were used to get the angle of incidence. Fission track lengths were measured for same angle of incidence. In all 500 track lengths were measured and plot for mass distribution for fission fragment was obtained.(author)

  20. Measurement of isotopic cross sections of the fission fragments produced in 500 AMeV {sup 208}Pb + p reaction; Etude de la production des fragments de fission issus de la reaction {sup 208}Pb + p a 500 AMeV

    Energy Technology Data Exchange (ETDEWEB)

    Fernandez-Dominguez, B

    2003-03-01

    The aim of this work is the study of the fission fragments produced in the spallation reaction {sup 208}Pb + p at 500 AMeV. The fission fragments from Z=23 up to Z=59 have been detected and identified by using the inverse kinematics technique with the high-resolution spectrometer FRS. The production cross sections and the recoil velocities of 430 nuclei have been measured. The measured data have been compared with previous data. The isotopic distributions show a high precision. However, the absolute value of the fission cross section is higher than expected. From the experimental data the characteristics of the average fissioning system have been reconstructed (Z{sub fis}, A{sub fis}, E*{sub fis}). In addition, the number of post-fission neutrons emitted from the fission fragments, v{sub post}, has been determined by using a new method. The experimental data have been compared to the two-steps models describing the spallation reaction. The impact of the model parameters on the observables has been analysed and the reasons Leading to the observed differences between the codes are also presented. This analyse shows a good agreement with the INCL4+ABLA code. (author)

  1. Study of the reactions resulting in heavy fragment formation in the collisions {sup 40}Ar + Cu, Ag and Au at 8 to 115 MeV/u; Etude des reactions avec formation d`un fragment lourd dans les collisions {sup 40}Ar + Cu, Ag et Au de 8 a 115 MeV/u

    Energy Technology Data Exchange (ETDEWEB)

    Colin, Eric Yves [Universite Claude Bernard Lyon-1, 69 - Lyon (France)

    1998-11-06

    This work concerns the study of nuclear collisions showing a heavy fragment in {sup 40}Ar + Cu, Ag and Au from 8 A MeV to 115 A MeV. The reactions are classified by centrality or collision violence via the multiplicity of charged particles detected in a 4{pi} array. For the most peripheral reactions (low multiplicities) we always find a projectile-like fragment with velocity near to that of the beam and a heavy target-like fragment with very small velocity. For the more central collisions we find the well-known incomplete fusion reactions at 17 and 27 A MeV. Above 27 A MeV two groups of very dissipative reactions are observed, both with high charged particle multiplicities. The first reaction group forms several fragments with Z {<=} 10 and average longitudinal velocity near to that of c.m. These are very rare, and are found only for the highest 1% of multiplicities. They produce a heavy fragment and a forward spray ({theta}{<=}60 angle) of particles with charge going from 1 to {approx_equal}13. The momentum carried out by the spray is randomly spread over all the particles. In spite of the increase of momentum carried by this spray with increasing beam energy, a heavy emission source is formed with 1 - 2 GeV of excitation energy. After a phase of expansion, especially signaled by Z = 1 particles, this source then evaporates many particles. Finally we observed the remaining heavy residual nucleus. (author) 117 refs., 85 figs., 12 tabs.

  2. Quark fragmentation in e+e- collisions

    International Nuclear Information System (INIS)

    Oddone, P.

    1984-12-01

    This brief review of new results in quark and gluon fragmentation observed in e + e - collisions concentrates mostly on PEP results and, within PEP, mostly on TPC results. The new PETRA results have been reported at this conference by M. Davier. It is restricted to results on light quark fragmentation since the results on heavy quark fragmentation have been reported by J. Chapman

  3. The effects of dorso-lumbar motion restriction on the ground reaction force components during running.

    Science.gov (United States)

    Morley, Joseph J; Traum, Edward

    2016-04-01

    The effects of restricting dorso-lumbar spine mobility on ground reaction forces in runners was measured and assessed. A semi-rigid cast was used to restrict spinal motion during running. Subjects ran across a force platform at 3.6 m/s, planting the right foot on the platform. Data was collected from ten running trials with the cast and ten without the cast and analysed. Casted running showed that the initial vertical heel strike maximum was increased (p running (p running results in measurable and repeatable alterations in ground reaction force components. Alterations in load transfer due to decreased spinal motion may be a factor contributing to selected injuries in runners. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Isotopic production cross-sections and recoil velocities of spallation-fission fragments in the reaction 238U(1A GeV)+e

    CERN Document Server

    Pereira, J; Wlazlo, W; Benlliure, J; Casarejos, E; Armbruster, P; Bernas, M; Enqvist, T; Legrain, R; Leray, S; Rejmund, F; Mustapha, B; Schmidt, K.-H; Stéphan, C; Taïeb, J; Tassan-Got, L; Volant, C; Boudard, A; Czajkowski, S; 10.1103/PhysRevC.75.014602

    2007-01-01

    Fission fragments of 1A GeV 238U nuclei interacting with a deuterium target have been investigatedwith the Fragment Separator (FRS) at GSI (Darmstadt) by measuring their isotopicproduction cross-sections and recoil velocities. The results, along with those obtained recently forspallation-evaporation fragments, provide a comprehensive analysis of the spallation nuclear productionsin the reaction 238U(1A GeV)+d. Details about experiment performance, data reductionand results will be presented.

  5. Association of genetic polymorphism in GH gene with milk ...

    Indian Academy of Sciences (India)

    Associations were analysed between polymorphisms of the growth hormone gene (GH-MspI) (localized in intron 3) and milk production traits of Beijing Holstein cows (a total of 543 cows). Polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method was used for identification of various ...

  6. Authenticating the Origin of Different Shrimp Products on the ...

    African Journals Online (AJOL)

    This study describes a polymerase chain reaction using restriction fragment length polymorphism (PCR-RFLP) assay based on the 16S rRNA mitochondrial gene to identify commercial food products of wide range of Penaeidae and Pandalidae shrimp species commercialised in the Tunisian market. Phylogenetic analyses ...

  7. Effective screening length and quasiuniversality for the restricted primitive model of an electrolyte solution.

    Science.gov (United States)

    Janecek, Jirí; Netz, Roland R

    2009-02-21

    Monte Carlo simulations for the restricted primitive model of an electrolyte solution above the critical temperature are performed at a wide range of concentrations and temperatures. Thermodynamic properties such as internal energy, osmotic coefficient, activity coefficient, as well as spatial correlation functions are determined. These observables are used to investigate whether quasiuniversality in terms of an effective screening length exists, similar to the role played by the effective electron mass in solid-state physics. To that end, an effective screening length is extracted from the asymptotic behavior of the Fourier-transformed charge-correlation function and plugged into the Debye-Huckel limiting expressions for various thermodynamic properties. Comparison with numerical results is favorable, suggesting that correlation and other effects not captured on the Debye-Huckel limiting level can be successfully incorporated by a single effective parameter while keeping the functional form of Debye-Huckel expressions. We also compare different methods to determine mean ionic activity coefficient in molecular simulations and check the internal consistency of the numerical data.

  8. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    Science.gov (United States)

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  9. Comparison by restriction fragment pattern analyses and molecular characterization of some European isolates of Suid herpesvirus 1: A contribution to strain differentiation of European isolates

    DEFF Research Database (Denmark)

    Christensen, Laurids Siig

    1988-01-01

    Eleven European isolates of Suid herpesvirus type 1 (SHV-1) were compared by restriction fragment pattern analyses and Southern blot hybridization using different genomic probes. The presence of strain discriminative 4 major genome types and several subtypes as well as the molecular distinctions...

  10. Transverse energy production in the target fragmentation region in 16O-nucleus reactions at 60 and 200 A GeV

    International Nuclear Information System (INIS)

    Albrecht, R.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Schmidt, H.R.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Plasil, F.; Young, G.R.; Beckmann, P.; Berger, F.; Clewing, G.; Dragon, L.; Glasow, R.; Kampert, K.H.; Peitzmann, T.; Purschke, M.; Santo, R.; Claesson, G.; Eklund, A.; Garpman, S.; Gustafsson, H.A.; Idh, J.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.; Franz, A.; Kristiansson, P.; Loehner, H.; Obenshain, F.E.; Sorensen, S.P.; Poskanzer, A.M.; Ritter, H.G.; Siemiarczuk, T.

    1989-07-01

    Charged pion yields and transverse energies of baryons are measured for the reaction 16 O+Cu, Ag, Au at 60 and 200 AGeV bombarding energy in the target fragmentation region employing the Plastic Ball detector. Only little dependence of the measured quantities on the bombarding energy is found. The data are compared with the Multi-Chain Fragmentation Model of Ranft. As a result it turns out that a leading order formation zone cascade is not sufficient to explain the baryon yield and the transverse energies of baryons in the target fragmentation region. (orig.)

  11. Transverse energy production in the target fragmentation region in 16O-nucleus reactions at 60 and 200 A GeV

    International Nuclear Information System (INIS)

    Albrecht, R.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Schmidt, H.R.; Siemiarczuk, T.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Obenshain, F.E.; Plasil, F.; Saini, S.; Sorensen, S.P.; Tincknell, M.; Young, G.R.; Beckmann, P.; Berger, F.; Clewing, G.; Dragon, L.; Glasow, R.; Kampert, K.H.; Loehner, H.; Peitzmann, T.; Purschke, M.; Santo, R.; Claesson, G.; Eklund, A.; Garpman, S.; Gustafsson, H.A.; Idh, J.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.; Franz, A.; Jacobs, P.; Poskanzer, A.M.; Ritter, H.G.; Kristiansson, P.

    1990-01-01

    Charged pion yields and transverse energies of baryons are measured for the reaction 16 O+Cu, Ag, Au at 60 and 200 A GeV bombarding energy in the target fragmentation region employing the Plastic Ball detector. Only little dependence of the measured quantities on the bombarding energy is found. The data are compared with the multi-chain fragmentation model of Ranft. As a result it turns out that a leading order formation zone cascade is not sufficient to explain the baryon yield and the transverse energies of baryons in the target fragmentation region. (orig.)

  12. Fragmentation and flow in central collisions

    International Nuclear Information System (INIS)

    Jacak, B.V.; Doss, K.G.R.; Gustafsson, H.A.

    1987-01-01

    Investigation of the fragmentation mechanism requires the measurement of complicated observables. To identify what part of the reacting system gives rise to the fragments, it would be useful to tag them as participants or spectators. A large acceptance for all the reaction products and an event-by-event measurement of the fragment multiplicity is required to distinguish fragment formation via sequential emission from a large equilibrated system and multifragmentation. In order to address whether fragments are formed early or late in the collision, information about the dynamical evolution of the reaction is necessary. This can be provided by study of the global properties of the events. This paper discusses experimental techniques applicable to studying fragmentation processes. 25 refs., 8 figs

  13. African Journal of Biotechnology - Vol 11, No 6 (2012)

    African Journals Online (AJOL)

    Genetic diversity of Iranian potato soft rot bacteria based on polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis · EMAIL FREE FULL ... Partial removal of water from red pepper by immersion in an osmotic solution before drying · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

  14. Use of DNA markers in forest tree improvement research

    Science.gov (United States)

    D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

    1992-01-01

    DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

  15. Measurement of isotopic cross sections of the fission fragments produced in 500 AMeV 208Pb + p reaction

    International Nuclear Information System (INIS)

    Fernandez-Dominguez, B.

    2003-03-01

    The aim of this work is the study of the fission fragments produced in the spallation reaction 208 Pb + p at 500 AMeV. The fission fragments from Z=23 up to Z=59 have been detected and identified by using the inverse kinematics technique with the high-resolution spectrometer FRS. The production cross sections and the recoil velocities of 430 nuclei have been measured. The measured data have been compared with previous data. The isotopic distributions show a high precision. However, the absolute value of the fission cross section is higher than expected. From the experimental data the characteristics of the average fissioning system have been reconstructed (Z fis , A fis , E* fis ). In addition, the number of post-fission neutrons emitted from the fission fragments, v post , has been determined by using a new method. The experimental data have been compared to the two-steps models describing the spallation reaction. The impact of the model parameters on the observables has been analysed and the reasons Leading to the observed differences between the codes are also presented. This analyse shows a good agreement with the INCL4+ABLA code. (author)

  16. Global transformation and fate of SOA: Implications of Low Volatility SOA and Gas-Phase Fragmentation Reactions

    Energy Technology Data Exchange (ETDEWEB)

    Shrivastava, ManishKumar B.; Easter, Richard C.; Liu, Xiaohong; Zelenyuk, Alla; Singh, Balwinder; Zhang, Kai; Ma, Po-Lun; Chand, Duli; Ghan, Steven J.; Jiminez, J. L.; Zhang, Qibin; Fast, Jerome D.; Rasch, Philip J.; Tiitta, P.

    2015-05-16

    Secondary organic aerosols (SOA) are large contributors to fine particle loadings and radiative forcing, but are often represented crudely in global models. We have implemented three new detailed SOA treatments within the Community Atmosphere Model version 5 (CAM5) that allow us to compare the semi-volatile versus non-volatile SOA treatments (based on some of the latest experimental findings) and also investigate the effects of gas-phase fragmentation reactions. For semi-volatile SOA treatments, fragmentation reactions decrease simulated SOA burden from 7.5 Tg to 1.8 Tg. For the non-volatile SOA treatment with fragmentation, the burden is 3.1 Tg. Larger differences between non-volatile and semi-volatile SOA (upto a factor of 5) correspond to continental outflow over the oceans. Compared to a global dataset of surface Aerosol Mass Spectrometer measurements and the US IMPROVE network measurements, the non-volatile SOA with fragmentation treatment (FragNVSOA) agrees best at rural locations. Urban SOA is under-predicted but this may be due to the coarse model resolution. All our three revised treatments show much better agreement with aircraft measurements of organic aerosols (OA) over the N. American Arctic and sub-Arctic in spring and summer, compared to the standard CAM5 formulation. This is due to treating SOA precursor gases from biomass burning, and long-range transport of biomass burning OA at elevated levels. The revised model configuration that include fragmentation (both semi-volatile and non-volatile SOA) show much better agreement with MODIS AOD data over regions dominated by biomass burning during the summer, and predict biomass burning as the largest global source of OA followed by biogenic and anthropogenic sources. The non-volatile and semi-volatile configuration predict the direct radiative forcing of SOA as -0.5 W m-2 and -0.26 W m-2 respectively, at top of the atmosphere, which are higher than previously estimated by most models, but in reasonable

  17. Stride length: the impact on propulsion and bracing ground reaction force in overhand throwing.

    Science.gov (United States)

    Ramsey, Dan K; Crotin, Ryan L

    2018-03-26

    Propulsion and bracing ground reaction force (GRF) in overhand throwing are integral in propagating joint reaction kinetics and ball velocity, yet how stride length effects drive (hind) and stride (lead) leg GRF profiles remain unknown. Using a randomised crossover design, 19 pitchers (15 collegiate and 4 high school) were assigned to throw 2 simulated 80-pitch games at ±25% of their desired stride length. An integrated motion capture system with two force plates and radar gun tracked each throw. Vertical and anterior-posterior GRF was normalised then impulse was derived. Paired t-tests identified whether differences between conditions were significant. Late in single leg support, peak propulsion GRF was statistically greater for the drive leg with increased stride. Stride leg peak vertical GRF in braking occurred before acceleration with longer strides, but near ball release with shorter strides. Greater posterior shear GRF involving both legs demonstrated increased braking with longer strides. Conversely, decreased drive leg propulsion reduced both legs' braking effects with shorter strides. Results suggest an interconnection between normalised stride length and GRF application in propulsion and bracing. This work has shown stride length to be an important kinematic factor affecting the magnitude and timing of external forces acting upon the body.

  18. Studies of nontarget-mediated distribution of human full-length IgG1 antibody and its FAb fragment in cardiovascular and metabolic-related tissues.

    Science.gov (United States)

    Davidsson, Pia; Söderling, Ann-Sofi; Svensson, Lena; Ahnmark, Andrea; Flodin, Christine; Wanag, Ewa; Screpanti-Sundqvist, Valentina; Gennemark, Peter

    2015-05-01

    Tissue distribution and pharmacokinetics (PK) of full-length nontargeted antibody and its antigen-binding fragment (FAb) were evaluated for a range of tissues primarily of interest for cardiovascular and metabolic diseases. Mice were intravenously injected with a dose of 10 mg/kg of either human IgG1or its FAb fragment; perfused tissues were collected at a range of time points over 3 weeks for the human IgG1 antibody and 1 week for the human FAb antibody. Tissues were homogenized and antibody concentrations were measured by specific immunoassays on the Gyros system. Exposure in terms of maximum concentration (Cmax ) and area under the curve was assessed for all nine tissues. Tissue exposure of full-length antibody relative to plasma exposure was found to be between 1% and 10%, except for brain (0.2%). Relative concentrations of FAb antibody were the same, except for kidney tissue, where the antibody concentration was found to be ten times higher than in plasma. However, the absolute tissue uptake of full-length IgG was significantly higher than the absolute tissue uptake of the FAb antibody. This study provides a reference PK state for full-length whole and FAb antibodies in tissues related to cardiovascular and metabolic diseases that do not include antigen or antibody binding. © 2015 Wiley Periodicals, Inc. and the American Pharmacists Association.

  19. Study of the reactions resulting in heavy fragment formation in the collisions 40Ar + Cu, Ag and Au at 8 to 115 MeV/u

    International Nuclear Information System (INIS)

    Colin, Eric Yves

    1998-01-01

    This work concerns the study of nuclear collisions showing a heavy fragment in 40 Ar + Cu, Ag and Au from 8 A MeV to 115 A MeV. The reactions are classified by centrality or collision violence via the multiplicity of charged particles detected in a 4π array. For the most peripheral reactions (low multiplicities) we always find a projectile-like fragment with velocity near to that of the beam and a heavy target-like fragment with very small velocity. For the more central collisions we find the well-known incomplete fusion reactions at 17 and 27 A MeV. Above 27 A MeV two groups of very dissipative reactions are observed, both with high charged particle multiplicities. The first reaction group forms several fragments with Z ≤ 10 and average longitudinal velocity near to that of c.m. These are very rare, and are found only for the highest 1% of multiplicities. They produce a heavy fragment and a forward spray (θ≤60 angle) of particles with charge going from 1 to ≅13. The momentum carried out by the spray is randomly spread over all the particles. In spite of the increase of momentum carried by this spray with increasing beam energy, a heavy emission source is formed with 1 - 2 GeV of excitation energy. After a phase of expansion, especially signaled by Z = 1 particles, this source then evaporates many particles. Finally we observed the remaining heavy residual nucleus. (author)

  20. Molecular discrimination of Echinococcus granulosus and Echinococcus multilocularis by sequencing and a new PCR-RFLP method with the potential use for other Echinococcus species

    OpenAIRE

    ŞAKALAR, Çağrı; KUK, Salih; ERENSOY, Ahmet; DAĞLI, Adile Ferda; ÖZERCAN, İbrahim Hanifi

    2015-01-01

    To develop a novel polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) protocol using a new genomic marker sequence and a novel set of restriction enzymes in order to detect and discriminate 2 Echinococcus species, E. granulosus and E. multilocularis, found in formalin-fixed paraffin-embedded (FFPE) human tissues. Materials and methods: DNA was isolated from 11 FFPE human tissue samples positive for cystic echinococcosis or alveolar echinococcosis. A mitochondrial...

  1. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Science.gov (United States)

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  2. Magnetic bead purification of labeled DNA fragments forhigh-throughput capillary electrophoresis sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Elkin, Christopher; Kapur, Hitesh; Smith, Troy; Humphries, David; Pollard, Martin; Hammon, Nancy; Hawkins, Trevor

    2001-09-15

    We have developed an automated purification method for terminator sequencing products based on a magnetic bead technology. This 384-well protocol generates labeled DNA fragments that are essentially free of contaminates for less than $0.005 per reaction. In comparison to laborious ethanol precipitation protocols, this method increases the phred20 read length by forty bases with various DNA templates such as PCR fragments, Plasmids, Cosmids and RCA products. Our method eliminates centrifugation and is compatible with both the MegaBACE 1000 and ABIPrism 3700 capillary instruments. As of September 2001, this method has produced over 1.6 million samples with 93 percent averaging 620 phred20 bases as part of Joint Genome Institutes Production Process.

  3. Differentiation in a geographical mosaic of plants coevolving with ants: phylogeny of the Leonardoxa africana complex (Fabaceae: Caesalpinioideae) using amplified fragment length polymorphism markers.

    Science.gov (United States)

    Brouat, C; McKey, D; Douzery, E J P

    2004-05-01

    Comprising four allopatric subspecies that exhibit various grades of ant-plant interactions, from diffuse to obligate and symbiotic associations, the Leonardoxa africana complex (Fabaceae, Caesalpinioideae) provides a good opportunity to investigate the evolutionary history of ant-plant mutualisms. A previous study of the L. africana complex based on chloroplast DNA noncoding sequences revealed a lack of congruence between clades suggested by morphological and plastid characters. In this study, we analysed phylogenetic relationships within the L. africana complex using a Bayesian probability approach on amplified fragment length polymorphism markers. The results reported permit partial validation of the four subspecies of L. africana previously defined by morphological and ecological markers. Incongruences between phylogenies based on chloroplast DNA and amplified fragment length polymorphism markers are discussed in the light of morphological and ecological data, and confronted with hypotheses of convergence, lineage sorting and introgression.

  4. Identification of Human T-lymphotropic Virus Type I (HTLV-I Subtypes Using Restrited Fragment Length Polymorphism in a Cohort of Asymptomatic Carriers and Patients with HTLV-I-associated Myelopathy/tropical Spastic Paraparesis from São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Segurado Aluisio AC

    2002-01-01

    Full Text Available Although human T-lymphotropic virus type I (HTLV-I exhibits high genetic stability, as compared to other RNA viruses and particularly to human immunodeficiency virus (HIV, genotypic subtypes of this human retrovirus have been characterized in isolates from diverse geographical areas. These are currently believed not to be associated with different pathogenetic outcomes of infection. The present study aimed at characterizing genotypic subtypes of viral isolates from 70 HTLV-I-infected individuals from São Paulo, Brazil, including 42 asymptomatic carriers and 28 patients with HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP, using restricted fragment length polymorphism (RFLP analysis of long terminal repeat (LTR HTLV-I proviral DNA sequences. Peripheral blood mononuclear cell lysates were amplified by nested polymerase chain reaction (PCR and amplicons submitted to enzymatic digestion using a panel of endonucleases. Among HTLV-I asymptomatic carriers, viral cosmopolitan subtypes A, B, C and E were identified in 73.8%, 7.1%, 7.1% and 12% of tested samples, respectively, whereas among HAM/TSP patients, cosmopolitan A (89.3%, cosmopolitan C (7.1% and cosmopolitan E (3.6% subtypes were detected. HTLV-I subtypes were not statistically significant associated with patients' clinical status. We also conclude that RFLP analysis is a suitable tool for descriptive studies on the molecular epidemiology of HTLV-I infections in our environment.

  5. Determination of nn scattering length from data on nn final state interaction in nd-breakup reaction

    International Nuclear Information System (INIS)

    Konobeevski, E.S.; Mordovskoy, M.V.; Sergeev, V.A.; Potashev, S.I.; Zuev, S.V.

    2006-01-01

    Full text: An experiment is proposed for the high-precision determination of the neutron-neutron scattering length investigating the nn final state interaction in the nd breakup reaction. The singlet pp and nn scattering lengths are very sensitive probes of the NN-interaction, and their difference is a direct measure of charge-symmetry breaking (CSB) of the nuclear force. However CSB is a small effect, and accurate values of the scattering lengths are needed for a theoretical analysis. The proton-proton scattering length is well known from pp-scattering data (a pp = -17.3± 0.4 fm), and its uncertainty is mainly due to a model-dependent procedure of removing Coulomb effects. The neutron-neutron scattering length is determined from the following processes n+d→p+n+n, π - + d → γ +n+n, d+d→ 2 He+n+n by investigating the kinematic region of the nn final-state interaction (FSI) where two neutrons fly with low relative energy. The results obtained by now are characterized by a significant uncertainty in values of a nn ; they are grouped near -16 and -19 fm [1,2], so even the sign of the difference a nn - a pp is uncertain. In this experiment neutron-neutron scattering length is determined by measuring the yield of the nd breakup reaction as a function of the relative energy ε nn =(E 1 +E 2 -2(E 1 E 2 ) 1/2 cosθ)/2 of two neutrons in the FSI region (two neutrons fly in a narrow angular cone) where nn-interaction is strongly revealed. The theory of reactions in 3N system predicts the ε nn dependence of the FSI cross section being sensitive to the value of a nn . The measurements will be made using the neutron channel RADEX at Moscow meson factory of the Institute for Nuclear Research. The momenta and angles of the two emitted neutrons and the energy of the proton will be measured for each breakup event. The measured dependence of the reaction yield on the relative energy of the two neutrons will be compared to results of the Monte Carlo simulation that includes

  6. Storage ion trap of an 'In-Flight Capture' type for precise mass measurement of radioactive nuclear reaction products and fission fragments

    International Nuclear Information System (INIS)

    Tarantin, N.I.

    2001-01-01

    Data on nuclear masses provide a basis for creating and testing various nuclear models. A tandem system of FLNR comprised of the U-400M cyclotron, the COMBAS magnetic separator and the mass-spectrometric ion trap of an 'in-flight capture' type is considered as a possible complex for producing of the short-lived nuclei in fragmentation reactions by heavy ions and for precise mass measurement of these nuclei. The plan of scientific and technical FLNR research includes a project DRIBs for producing beams of accelerated radioactive nuclear reaction products and photofission fragments. This project proposes also precise mass measurements of the fission fragment with the help of the ion trap. The in-flight entrance of the ions and their capture in the mass-spectrometric ion trap using the monochromatizing degrader, the static electric and magnetic fields and a new invention, a magnetic unidirectional transporting ventil, is considered

  7. Association of Gln27Glu polymorphism of the β-2- adrenergic ...

    African Journals Online (AJOL)

    A group of 66 patients with preeclampsia and 72 control subjects were analyzed for the Arg16Gly and Gln27Glu polymorphisms of the ADRB2 by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Comparisons of the ADRB2 genotypes or alleles between different groups were performed ...

  8. Temperatures of fragment kinetic energy spectra

    International Nuclear Information System (INIS)

    Bauer, W.

    1995-01-01

    Multifragmentation reactions without large compression in the initial state (proton-induced reactions, reverse kinematics, projectile fragmentation) are examined, and it is verified quantitatively that the high temperatures obtained from fragment kinetic energy spectra and lower temperatures obtained from observables such as level population or isotope ratios can be understood in a common framework

  9. Genetic Variation among Isolates of Sarcocystis neurona, the Agent of Protozoal Myeloencephalitis, as Revealed by Amplified Fragment Length Polymorphism Markers

    OpenAIRE

    Elsheikha, H. M.; Schott, H. C.; Mansfield, L. S.

    2006-01-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelph...

  10. Photo induced multiple fragmentation of atoms and molecules: Dynamics of Coulombic many-particle systems studied with the COLTRIMS reaction microscope

    International Nuclear Information System (INIS)

    Czasch, A.; Schmidt, L.Ph.H.; Jahnke, T.; Weber, Th.; Jagutzki, O.; Schoessler, S.; Schoeffler, M.S.; Doerner, R.; Schmidt-Boecking, H.

    2005-01-01

    Many-particle dynamics in atomic and molecular physics has been investigated by using the COLTRIMS reaction microscope. The COLTRIMS technique visualizes photon and ion induced many-particle fragmentation processes in the eV and milli-eV regime. It reveals the complete momentum pattern in atomic and molecular many-particle reactions comparable to the bubble chamber in nuclear physics

  11. Fission fragments mass distributions of nuclei populated by the multinucleon transfer channels of the 18O+232Th reaction

    Directory of Open Access Journals (Sweden)

    R. Léguillon

    2016-10-01

    Full Text Available It is shown that the multinucleon transfer reactions is a powerful tool to study fission of exotic neutron-rich actinide nuclei, which cannot be accessed by particle-capture or heavy-ion fusion reactions. In this work, multinucleon transfer channels of the 18O+232Th reaction are used to study fission of fourteen nuclei 231,232,233,234Th, 232,233,234,235,236Pa, and 234,235,236,237,238U. Identification of fissioning nuclei and of their excitation energy is performed on an event-by-event basis, through the measurement of outgoing ejectile particle in coincidence with fission fragments. Fission fragment mass distributions are measured for each transfer channel, in selected bins of excitation energy. In particular, the mass distributions of 231,234Th and 234,235,236Pa are measured for the first time. Predominantly asymmetric fission is observed at low excitation energies for all studied cases, with a gradual increase of the symmetric mode towards higher excitation energy. The experimental distributions are found to be in general agreement with predictions of the fluctuation–dissipation model.

  12. Genotyping of Campylobacter jejuni from broiler carcasses and slaughterhouse environment by amplified fragment length polymorphism.

    Science.gov (United States)

    Johnsen, G; Kruse, H; Hofshagen, M

    2006-12-01

    We examined the occurrence and diversity of Campylobacter jejuni on broiler carcasses during slaughter of an infected flock and in the slaughterhouse environment during slaughter and postdisinfection before a new production run. During the slaughter of a known C. jejuni infected broiler flock, samples were taken from broiler carcasses at 7 different stages during the process. Thirty-seven sites in the slaughterhouse environment were sampled both during process and postdisinfection. The samples were analyzed for C. jejuni, and genetic fingerprinting was performed using amplified fragment length polymorphism. All carcass samples were positive. Of the environmental samples collected during slaughter, 89% were positive; 100% of those from the arrival, stunning, scalding, defeathering, and evisceration facilities and 67% of those from the cooling and sorting facilities. Postdisinfection, 41% of the samples were positive; 71% of those from the arrival and stunning area, 60% of those from the scalding and defeathering area, and 20% of those from the evisceration, cooling, and sorting area. The C. jejuni isolates (n = 60) recovered were grouped into 4 different amplified fragment length polymorphism clones with a similarity index of 95% or greater. All isolates obtained from the flock and 94% of the isolates obtained from the environment during slaughtering belonged to clone A, whereas 1 environmental isolate belonged to each of the clones B and C. Isolates from clones A, B, and D were present postdisinfection. Only clone B was detected on flocks slaughtered during the previous week. The high level and continuous presence of Campylobacter in the environment constitutes a risk for transmission to negative carcasses. In Norway, where above 96% of the broiler flocks are Campylobacter-negative, this aspect is of special importance. The ability of Campylobacter to remain in the slaughterhouse environment through washing and disinfection is associated with constructional

  13. A specific PCR-assay for resistance to Biotypes 1 and 2 of the rosy leaf curling aphid in apple based on an RFLP marker closely linked to the Sd1 gene

    NARCIS (Netherlands)

    Roche, P.; Arkel, van G.; Heusden, van A.W.

    1997-01-01

    This report describes the conversion of a restriction fragment length polymorphism (RFLP) marker (the 2B12a locus), linked to the Sd1 aphid resistance gene, to a polymerase chain reaction (PCR) based marker. A section of the 2B12 probe was sequenced and two primers were designed to amplify this

  14. Prolactin-RsaI gene polymorphism in East Anatolian Red cattle in ...

    African Journals Online (AJOL)

    The aim of the study was to determine by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) method the gene and genotype frequencies of PRL gene in native East Anatolian Red (EAR) cattle, which are raised as a genetic resource in Turkey. PCR-RFLP analysis involved the use of the ...

  15. Allele frequency of hyperkalemic periodic paralysis (HYPP) in ...

    African Journals Online (AJOL)

    In some cases, death can occur due to paralysis of the hearth or respiratory muscles. Detection of affected animals can be achieved by a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) test. Based on the fact that the mutation originated in the stallion “Impressive”, whose genetic material is ...

  16. Neutron fragmentation in the reaction pn to pX at 19 GeV/c

    CERN Document Server

    Bakken, V; Lundborg, P; Makela, J; Pimiä, M; Selldén, B; Sundell, E; Tuominiemi, J

    1979-01-01

    Data on the reaction pn to pX are extracted from a pd experiment in the CERN 2 m DBC at 10 GeV/c. The cross-section for neutron fragmentation events with mod t mod <1 (GeV/c)/sup 2/ determined and compared with data at high energies at fixed M/sub x//sup 2//s and t. The cross-section can be described with the triple-Regge formula taking into account only the pion exchange contributions, i.e. the pi pi P and pi pi R terms. A leading-particle effect consistent with the pion exchange model is observed in the longitudinal-momentum distribution of the negative pions in the final state of the reaction pn to pX, when transformed to the rest frame of the recoiling system X. (10 refs).

  17. I. The properties of hot Ca-like fragments from the 40Ca+40Ca reaction at 35 AMeV

    International Nuclear Information System (INIS)

    Planeta, R.; Gawlikowicz, W.; Wieloch, A.

    2001-01-01

    The creation of hot Ca-like fragments was investigated in the 40 Ca + 40 Ca reaction at 35 AMeV. Using the AMPHORA 4π detector system, the primary projectile-like fragment was reconstructed and its properties were determined. Both primary and secondary distributions are compared with the predictions of a Monte Carlo code describing a heavy-ion collision as a two-step process. Some of the nucleons which are identified as participants in the first step are transferred in the second step to these final states, which correspond on the average to the maximum value of entropy (thermodynamic probability). The model allows for competition between mean-field effects and nucleon-nucleon interactions in the overlap zone of the interacting nuclei. The analysis presented here suggests a thermalized source picture of the decay of the projectile-like fragment. The validity of the reconstruction procedure for projectile-like fragments is discussed. (orig.)

  18. Target fragmentation in proton-nucleus and16O-nucleus reactions at 60 and 200 GeV/nucleon

    Science.gov (United States)

    Albrecht, R.; Awes, T. C.; Baktash, C.; Beckmann, P.; Claesson, G.; Berger, F.; Bock, R.; Dragon, L.; Ferguson, R. L.; Franz, A.; Garpman, S.; Glasow, R.; Gustafsson, H. Å.; Gutbrod, H. H.; Kampert, K. H.; Kolb, B. W.; Kristiansson, P.; Lee, I. Y.; Löhner, H.; Lund, I.; Obenshain, F. E.; Oskarsson, A.; Otterlund, I.; Peitzmann, T.; Persson, S.; Plasil, F.; Poskanzer, A. M.; Purschke, M.; Ritter, H. G.; Santo, R.; Schmidt, H. R.; Siemiarczuk, T.; Sorensen, S. P.; Stenlund, E.; Young, G. R.

    1988-03-01

    Target remnants with ZPlastic Ball detector. The excitation energy of the target spectator matter in central oxygen-induced collisions is found to be high enough to allow for complete disintegration of the target nucleus into fragments with Z<3. The average longitudinal momentum transfer per proton to the target in central collisions is considerably higher in the case of16O-induced reactions (≈300 MeV/c) than in proton-induced reactions (≈130 MeV/c). The baryon rapidity distributions are roughly in agreement with one-fluid hydrodynamical calculations at 60 GeV/nucleon16O+Au but are in disagreement at 200 GeV/nucleon, indicating the higher degree of transparency at the higher bombarding energy. Both, the transverse momenta of target spectators and the entropy produced in the target fragmentation region are compared to those attained in head-on collisions of two heavy nuclei at Bevalac energies. They are found to be comparable or do even exceed the values for the participant matter at beam energies of about 1 2 GeV/nucleon.

  19. Fragman: an R package for fragment analysis.

    Science.gov (United States)

    Covarrubias-Pazaran, Giovanny; Diaz-Garcia, Luis; Schlautman, Brandon; Salazar, Walter; Zalapa, Juan

    2016-04-21

    Determination of microsatellite lengths or other DNA fragment types is an important initial component of many genetic studies such as mutation detection, linkage and quantitative trait loci (QTL) mapping, genetic diversity, pedigree analysis, and detection of heterozygosity. A handful of commercial and freely available software programs exist for fragment analysis; however, most of them are platform dependent and lack high-throughput applicability. We present the R package Fragman to serve as a freely available and platform independent resource for automatic scoring of DNA fragment lengths diversity panels and biparental populations. The program analyzes DNA fragment lengths generated in Applied Biosystems® (ABI) either manually or automatically by providing panels or bins. The package contains additional tools for converting the allele calls to GenAlEx, JoinMap® and OneMap software formats mainly used for genetic diversity and generating linkage maps in plant and animal populations. Easy plotting functions and multiplexing friendly capabilities are some of the strengths of this R package. Fragment analysis using a unique set of cranberry (Vaccinium macrocarpon) genotypes based on microsatellite markers is used to highlight the capabilities of Fragman. Fragman is a valuable new tool for genetic analysis. The package produces equivalent results to other popular software for fragment analysis while possessing unique advantages and the possibility of automation for high-throughput experiments by exploiting the power of R.

  20. Studies of projectile-like fragments in the 16O + 238U reaction at 20 MeV/u

    International Nuclear Information System (INIS)

    Dyer, P.; Awes, T.C.; Gelbke, C.K.; Back, B.B.; Mignerey, A.C.; Wolf, K.L.; Breuer, H.; Viola, V.E.; Meyer, W.G.

    1979-01-01

    Projectile residues were studied in coincidence with angle-correlated fission fragments resulting from reactions of 20-MeV/u 16 O ions on 238 U. Distributions of the missing parallel momentum are shown for different projectile residues, and the dependence of the average parallel recoil momentum on the average parallel momentum of the projectile residue is plotted. 2 figures

  1. Detection of Coxiella burnetii in ticks by PCR and by PCR - Restriction Fragment Length Polymorphism (RFLP)

    International Nuclear Information System (INIS)

    2010-01-01

    Coxiella burnetii, as an obligata intracellular bacterium, is the etiologic agent of Q-fever. It is widely distributed in nature and is responsible for infection in various animals (cattle, sheep, goat) and humans. C. burnetii has been isolated from milk, ticks and human patients with acute and chronic Q fever. Ticks are the principal vectors and reservoirs of C. burnetii. Since over 40 species of ticks have been found to be infected with C. burnetii, ticks can serve as indicators of infection in nature. In this study, total of 2472 ticks (1446 female, 1021 male and 5 nymphs) were collected from 38 provinces of Turkey. The ticks were gathered into groups of 1 to 7 ticks as to the provinces, species and gender for DNA extraction. Following DNA extraction, the groups were examined for the presence of C. burtii by using the CB1and CB2. The ticks collected from the province of Denizli (56 in total) were gathered into 13 groups according to the species and gender. From these groups, 6 were positive for C. burnetii. The ticks collected from Ankara province, total of 160 ticks, were grouped into 53 as to their species and gender, only one group was found to be positive for C. burnetii. The specificities of PCR products were evaluated by restriction analysis. The positive PCR products were digested with the enzyme Taq1 and for bands in order of 118, 57, 43 and 39 bp's were appeared such as seen in the positive control DNA (C. burnetii Nine Mile RSA493)

  2. Application of Amplified Fragment Length Polymorphism Fingerprinting for Taxonomy and Identification of the Soft Rot Bacteria Erwinia carotovora and Erwinia chrysanthemi

    OpenAIRE

    Avrova, Anna O.; Hyman, Lizbeth J.; Toth, Rachel L.; Toth, Ian K.

    2002-01-01

    The soft rot bacteria Erwinia carotovora and Erwinia chrysanthemi are important pathogens of potato and other crops. However, the taxonomy of these pathogens, particularly at subspecies level, is unclear. An investigation using amplified fragment length polymorphism (AFLP) fingerprinting was undertaken to determine the taxonomic relationships within this group based on their genetic relatedness. Following cluster analysis on the similarity matrices derived from the AFLP gels, four clusters (c...

  3. An intranuclear cascade-percolation approach for protons and light fragments production in neon-niobium reactions at 400 and 800 MeV per nucleon

    International Nuclear Information System (INIS)

    Montarou, G.; Marroncle, J.; Alard, J.P.; Augerat, J.; Bastid, N.; Charmensat, P.; Dupieux, P.; Fraysse, L.; Parizet, M.J.; Rahmani, A.; Brochard, F.; Gorodetzky, P.; Racca, C.; Cugnon, J.

    1992-01-01

    The results of intranuclear cascade calculations (ideal gas with two body collisions and no mean-field), complemented by a simple percolation procedure, are compared with experimental data on protons and light nuclear fragments (d, t, 3 He and 4 He) measured in 400 and 800 MeV/nucleon Ne+Nb collisions using the large solid angle detector DIOGENE. The model reproduces quite well global experimental observables like nuclear fragment multiplicity distributions or production cross-sections, and nuclear fragment to proton ratios. For rapidity distributions the best agreement occurs for peripheral reactions. Transverse momentum analysis confirms once again that the cascade, although being a microscopic approach, gives too small a collective flow. For heavier nuclear fragments conclusions are not so clear. Since the cross-sections are the main ingredients of the detailed treatment of the first stage of the reaction by the intranuclear cascade, such an approach can be very fruitful in order to infer informations on effective nucleon-nucleon cross-sections. (authors). 31 refs., 23 figs., 6 tabs

  4. Angular distributions of intermediate mass fragments emitted in 30 MeV/u 40Ar induced reactions

    International Nuclear Information System (INIS)

    Gou Quanbu; Zhu Yongtai; Xu Hushan; Wei Zhiyong; Lu Jun; Zhang Yuhu; Wang Qi; Li Songlin; Wu Zhongli

    1999-01-01

    The angular distributions of intermediate mass fragments with charge numbers from 3 to 24 emitted in 30 MeV/u 40 Ar + 58,64 Ni and 115 In reactions over an angular range of 5 degree-140 degree have been measured. In different angular region an exponential distribution function dσ/dΩ = N exp(-θ/α) was used to fit the measured angular distributions. The decay factor α which can be connected with the interaction time τ and the factor N which is related to the intensity of the emission sources have been extracted. The relationship of α(Z) and N(Z) with Z for different reaction systems and different angular regions has been discussed. The different behavior of dσ/dΩ, α(Z), and N(Z) for the three studied reaction systems exists mainly in the middle and backward angular regions. The dependencies of angular distributions on isospin and the size of reaction systems have also been discussed

  5. Linkage map of the fragments of herpesvirus papio DNA.

    Science.gov (United States)

    Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

    1981-01-01

    Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

  6. Target fragmentation in 1 A GeV Au + Pb reaction

    CERN Document Server

    Grabez, B

    1999-01-01

    We investigated the production of target fragments in interaction of 1 A GeV Au projectile with Pb. The behaviour of the atomic numbers of fragments and of the relative velocities has been examined in dependence of the centrality of collision. The results have been compared with the data of other authors obtained for projectile fragmentation.

  7. Essentials of Conservation Biotechnology: A mini review

    Science.gov (United States)

    Merlyn Keziah, S.; Subathra Devi, C.

    2017-11-01

    Equilibrium of biodiversity is essential for the maintenance of the ecosystem as they are interdependent on each other. The decline in biodiversity is a global problem and an inevitable threat to the mankind. Major threats include unsustainable exploitation, habitat destruction, fragmentation, transformation, genetic pollution, invasive exotic species and degradation. This review covers the management strategies of biotechnology which include sin situ, ex situ conservation, computerized taxonomic analysis through construction of phylogenetic trees, calculating genetic distance, prioritizing the group for conservation, digital preservation of biodiversities within the coding and decoding keys, molecular approaches to asses biodiversity like polymerase chain reaction, real time, randomly amplified polymorphic DNA, restriction fragment length polymorphism, amplified fragment length polymorphism, single sequence repeats, DNA finger printing, single nucleotide polymorphism, cryopreservation and vitrification.

  8. Inverse kinematics technique for the study of fission-fragment isotopic yields at GANIL energies

    International Nuclear Information System (INIS)

    Delaune, O.

    2012-01-01

    The characteristics of the fission-products distributions result of dynamical and quantum properties of the deformation process of the fissioning nucleus. These distributions have also an interest for the conception of new nuclear power plants or for the transmutation of the nuclear wastes. Up to now, our understanding of the nuclear fission remains restricted because of experimental limitations. In particular, yields of the heavy fission products are difficult to get with precision. In this work, an innovative experimental technique is presented. It is based on the use of inverse kinematics coupled to the use of a spectrometer, in which a 238 U beam at 6 or 24 A MeV impinges on light targets. Several actinides, from 238 U to 250 Cf, are produced by transfer or fusion reactions, with an excitation energy ranges from ten to few hundreds MeV depending on the reaction and the beam energy. The fission fragments of these actinides are detected by the VAMOS spectrometer or the LISE separator. The isotopic yields of fission products are completely measured for different fissioning systems. The neutron excess of the fragments is used to characterise the isotopic distributions. Its evolution with excitation energy gives important insights on the mechanisms of the compound-nucleus formation and its deexcitation. Neutron excess is also used to determine the multiplicity of neutrons evaporated by the fragments. The role of the proton and neutron shell effects into the formation of fission fragments is also discussed. (author) [fr

  9. Modelling the fragmentation mechanisms

    International Nuclear Information System (INIS)

    Bougault, R.; Durand, D.; Gulminelli, F.

    1998-01-01

    We have investigated the role of high amplitude collective motion in the nuclear fragmentation by using semi-classical macroscopic, as well as, microscopic simulations (BUU). These studies are motivated by the search of instabilities responsible for nuclear fragmentation. Two cases were examined: the bubble formation following the collective expansion of the compressed nucleus in case of very central reactions and, in the case of the semi-central collisions, the fast fission of the two partners issued from a binary reaction, in their corresponding Coulomb field. In the two cases the fragmentation channel is dominated by the inter-relation between the Coulomb and nuclear fields, and it is possible to obtain semi-quantitative predictions as functions of interaction parameters. The transport equations of BUU type predicts for central reactions formation of a high density transient state. Of much interest is the mechanism subsequent to de-excitation. It seems reasonable to conceive that the pressure stocked in the compressional mode manifests itself as a collective expansion of the system. As the pressure is a increasing function of the available energy one can conceive a variety of energy depending exit channels, starting from the fragmentation due the amplification of fluctuations interior to the spinodal zone up to the complete vaporization of the highly excited system. If the reached pressure is sufficiently high the reaction final state may preserve the memory of the entrance channel as a collective radial energy superimposed to the thermal disordered motion. Distributions of particles in the configuration space for both central and semi-central reactions for the Pb+Au system are presented. The rupture time is estimated to the order of 300 fm/c, and is strongly dependent on the initial temperature. The study of dependence of the rupture time on the interaction parameters is under way

  10. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  11. Measurement of Telomere Length in Colorectal Cancers for Improved Molecular Diagnosis

    Directory of Open Access Journals (Sweden)

    Eric Le Balc’h

    2017-08-01

    Full Text Available All tumors have in common to reactivate a telomere maintenance mechanism to allow for unlimited proliferation. On the other hand, genetic instability found in some tumors can result from the loss of telomeres. Here, we measured telomere length in colorectal cancers (CRCs using TRF (Telomere Restriction Fragment analysis. Telomeric DNA content was also quantified as the ratio of total telomeric (TTAGGG sequences over that of the invariable Alu sequences. In most of the 125 CRCs analyzed, there was a significant diminution in telomere length compared with that in control healthy tissue. Only 34 tumors exhibited no telomere erosion and, in some cases, a slight telomere lengthening. Telomere length did not correlate with age, gender, tumor stage, tumor localization or stage of tumor differentiation. In addition, while telomere length did not correlate with the presence of a mutation in BRAF (V-raf murine sarcoma viral oncogene homolog B, PIK3CA (phosphatidylinositol 3-kinase catalytic subunit, or MSI status, it was significantly associated with the occurrence of a mutation in KRAS. Interestingly, we found that the shorter the telomeres in healthy tissue of a patient, the larger an increase in telomere length in the tumor. Our study points to the existence of two types of CRCs based on telomere length and reveals that telomere length in healthy tissue might influence telomere maintenance mechanisms in the tumor.

  12. Dna fingerprinting - review paper

    OpenAIRE

    Blundell, Renald

    2006-01-01

    Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

  13. Mass and velocity of fragments from the reaction 17-115 MeV/u 40Ar + Cu, Ag and Au

    International Nuclear Information System (INIS)

    Colin, E.; Guinet, D.; Stern, M.

    1998-01-01

    Measurements are reported for fragment masses and velocities from the reactions 17-115 MeV/u 40 Ar + Cu, Ag and Au. High momentum and energy deposition are reported for selected events, even for higher incident energy. Further study is needed to understand their origin. (authors)

  14. Coincidence study of alpha particle fragmentation at E/sub alpha/ = 140 MeV

    International Nuclear Information System (INIS)

    Koontz, R.W.

    1980-01-01

    Results of an experimental study of the interaction of 140 MeV alpha particles with 90 Zr nuclei resulting in fragmentation of the alpha particle are reported. The experimental observations of the study are analyzed and are found to show that alpha particle breakup reactions leading to at least 4-body final states, composed of two charged alpha particle fragments, contribute significantly to the singles yield of charged fragments observed at a fixed forward angle. The conclusions are based on coincidence measurements where one charged fragment is detected at a small forward angle which remains fixed, while the second charged fragment is detected at a series of coplanar secondary angles. The largest coincidence charged particle yield for the multiparticle final state events results from 90 Zr(α,pp)X reactions, where both of the measured protons have energy distributions similar to the proton singles energy distributions. The second largest observed coincidence yield involving two charged fragments arises from 90 Zr(α,pd)X reactions, where the p and d fragments, as in the 90 Zr(α,pp)X reactions also have energy distribution similar to the singles energy distributions. Analysis of additional measurements, where alpha particle fragments at the fixed angle are detected in coincidence with evaporation and nonequilibrium particles at many coplanar angles, show that the alpha particle fragmentation reactions are also generally associated with large energy transfer to the target nucleus. A multiple scattering model of the fragmentation reaction is employed, in conjunction with the experimental observations, to estimate the cross sections for alpha particle fragmentation into multi-particle final states resulting in n, 2n, p, pp, d, dn, dp, t and 3 He fragments. The estimated total cross section for all fragmentation reactions is 755 mb or approximately 38% of the total reaction cross section for 140 MeV alpha particle interactions with 90 Zr

  15. Enterocytozoon bieneusi Identification Using Real-Time Polymerase Chain Reaction and Restriction Fragment Length Polymorphism in HIV-Infected Humans from Kinshasa Province of the Democratic Republic of Congo

    Science.gov (United States)

    Wumba, Roger; Jean, Menotti; Benjamin, Longo-Mbenza; Madone, Mandina; Fabien, Kintoki; Josué, Zanga; Jean, Sala; Eric, Kendjo; AC, Guillo-Olczyk; Marc, Thellier

    2012-01-01

    Objective. To determine the prevalence and the genotypes of Enterocytozoon bieneusi in stool specimens from HIV patients. Methods. This cross-sectional study was carried out in Kinshasa hospitals between 2009 and 2012. Detection of microsporidia including E. bieneusi and E. intestinalis was performed in 242 HIV-infected patients. Typing was based on DNA polymorphism of the ribosomal DNA ITS region of E. bieneusi. PCRRFLP generated with two restriction enzymes (Nla III and Fnu 4HI) in PCR-amplified ITS products for classifying strains into different lineages. The diagnosis performance of the indirect immune-fluorescence-monoclonal antibody (IFI-AcM) was defined in comparison with real-time PCR as the gold standard. Results. Out of 242 HIV-infected patients, using the real-time PCR, the prevalence of E. bieneusi was 7.9% (n = 19) among the 19 E. bieneusi, one was coinfected with E. intestinalis. In 19 E. bieneusi persons using PCR-RFLP method, 5 type I strains of E. bieneusi (26.3%) and 5 type IV strains of E. bieneusi (26.3%) were identified. The sensitivity of IFI-AcM was poor as estimated 42.1%. Conclusion. Despite different PCR methods, there is possible association between HIVinfection, geographic location (France, Cameroun, Democratic Republic of Congo), and the concurrence of type I and type IV strains. PMID:22811884

  16. Kinetics of fragmentation-annihilation processes

    OpenAIRE

    Filipe, JAN; Rodgers, GJ

    1996-01-01

    We investigate the kinetics of systems in which particles of one species undergo binary fragmentation and pair annihilation. In the latter, nonlinear process, fragments react at collision to produce an inert species, causing loss of mass. We analyze these systems in the reaction-limited regime by solving a continuous model within the mean-field approximation. The rate of fragmentation for a particle of mass x to break into fragments of masses y and x-y has the form x(lambda-1) (lambda > 0), a...

  17. Study of the peripheral projectile-like fragments from the reaction 129Xe on 27Al, natCu, 139La and 165Ho, at E/A = 50 MeV

    International Nuclear Information System (INIS)

    Garcia-Solis, E.J.; Russ, D.E.; Madani, H.

    1996-01-01

    There are several reaction mechanisms identified for peripheral heavy-ion collisions. For low bombarding energies (E/A ∼ 10 MeV) the predominant reaction channel is the deep-inelastic reaction mechanism. In this process, the projectile and target form a rotating binary system, interchanging nucleons and angular momentum until they separate. At higher bombarding energies (E/A ∼ 50 to 100 MeV) incomplete fusion is thought to be the prevailing reaction channel. In this type of interaction part of the projectile merges with the target during the collision. Finally, for energies greater than 100 MeV/A, the main reaction channel is characterized by the formation of a highly-excited separate fragment (fireball) produced during the overlap between the projectile and the target. The data set studied was from an experiment designed to characterize the projectile-like products of the 27 Al, nat Cu, 139 La, and 165 Ho reactions at E/A = 50 MeV, which was performed at the Michigan State University Super Cyclotron Laboratory (MSU-NSCL). The Maryland Forward Array (MFA), was used to measure projectile-like fragments in coincidence with target-like fragments and light-charge particles in the MSU 4π detector

  18. HETC-3STEP included fragmentation process

    Energy Technology Data Exchange (ETDEWEB)

    Shigyo, Nobuhiro; Iga, Kiminori; Ishibashi, Kenji [Kyushu Univ., Fukuoka (Japan). Faculty of Engineering

    1997-03-01

    High Energy Transport Code (HETC) based on the cascade-evaporation model is modified to calculate the fragmentation cross section. For the cascade process, nucleon-nucleon cross sections are used for collision computation; effective in-medium-corrected cross sections are adopted instead of the original free-nucleon collision. The exciton model is adopted for improvement of backward nucleon-emission cross section for low-energy nucleon-incident events. The fragmentation reaction is incorporated into the original HETC as a subroutine set by the use of the systematics of the reaction. The modified HETC (HETC-3STEP/FRG) reproduces experimental fragment yields to a reasonable degree. (author)

  19. Light fragment formation at intermediate energies

    International Nuclear Information System (INIS)

    Boal, D.H.

    1982-03-01

    This paper concerns itself mainly with the production of energetic protons and light fragments at wide angles. The experiments point to nucleon emission in proton-induced reactions as involving a mechanism in which the observed nucleon is directly knocked out of the nucleus. A similar feature seems to be required to explain (p,F) and (e,F) reactions: an energetic nucleon is produced in one scattering of the projectile, and the struck nucleon subsequently loses some of its energy as it traverses the remaining part of the nucleus, gathering up other nucleons as it goes, to become a fragment. This is what one might call the extreme snowball model, and a more accurate description probably involves multiple scattering of the projectile in addition to the extreme snowball contribution. This will be particularly true for fragments in the mass 6 to 9 region. This scenario also appears to apply to deuteron-induced fragment production. However, for alpha-induced reactions it would appear that the nucleons forming a fragment can originate from collisions involving different incident nucleons in the projectile. For heavy ions, this effect is even stronger, and the snowball contribution is greatly reduced compared to that of the traditional coalescence model

  20. Fragment emission in relativistic heavy-ion reactions

    International Nuclear Information System (INIS)

    Csernai, L.P.; Subramanian, P.R.; Buchwald, G.; Graebner, G.; Rosenhauer, A.; Maruhn, J.A.; Greiner, W.

    1982-05-01

    The authors present a theoretical description of nuclear collisions which consists of a three-dimensional fluid-dynamical model, a chemical equilibrium break-up calculation for local light fragment (i.e. p, n, d, t, 3 He, 4 He) production and a final thermal evaporation of these particles. The light fragment cross section and some properties of the heavy target residues are calculated for the asymmetric systems Ne+U at 400 MeV/N, Ne+Pb at 800 MeV/N and C+Sn at 86 MeV/N. The results of the model calculations are compared with recent experimental data. Several observable signs of the collective hydrodynamical processes are consistent with the present data. An event-by-event analysis of the flow patterns of the various clusters is proposed which can yield deeper insight into collision dynamics. (author)

  1. Multiple heavy-fragment breakup reactions

    International Nuclear Information System (INIS)

    Pelte, D.

    1986-01-01

    Data for heavy ion breakup reactions for projectiles between silicon 28 and argon 40 and targets between carbon 12 and zirconium 90 in the energy range 7 to 15 MeV/n are presented. The experimental method used to cope with the complexity of the exit channels in these reactions is discussed. Data on cross sections, isotopic distribution, charge distribution, energy dependence, Q-value and angular momentum of the target are discussed in relationship to model predictions

  2. Genetic diversity of clinical and environmental isolates of Vibrio cholerae determined by amplified fragment length polymorphism fingerprinting.

    Science.gov (United States)

    Jiang, S C; Matte, M; Matte, G; Huq, A; Colwell, R R

    2000-01-01

    Vibrio cholerae, the causative agent of major epidemics of diarrheal disease in Bangladesh, South America, Southeastern Asia, and Africa, was isolated from clinical samples and from aquatic environments during and between epidemics over the past 20 years. To determine the evolutionary relationships and molecular diversity of these strains, in order to understand sources, origin, and epidemiology, a novel DNA fingerprinting technique, amplified fragment length polymorphism (AFLP), was employed. Two sets of restriction enzyme-primer combinations were tested for fingerprinting of V. cholerae serogroup O1, O139, and non-O1, O139 isolates. Amplification of HindIII- and TaqI-digested genomic DNA produced 30 to 50 bands for each strain. However, this combination, although capable of separating environmental isolates of O1 and non-O1 strains, was unable to distinguish between O1 and O139 clinical strains. This result confirmed that clinical O1 and O139 strains are genetically closely related. On the other hand, AFLP analyses of restriction enzyme ApaI- and TaqI-digested genomic DNA yielded 20 to 30 bands for each strain, but were able to separate O1 from O139 strains. Of the 74 strains examined with the latter combination, 26 serogroup O1 strains showed identical banding patterns and were represented by the O1 El Tor strain of the seventh pandemic. A second group, represented by O139 Bengal, included 12 strains of O139 clinical isolates, with 7 from Thailand, 3 from Bangladesh, and 2 from India. Interestingly, an O1 clinical isolate from Africa also grouped with the O139 clinical isolates. Eight clinical O1 isolates from Mexico grouped separately from the O1 El Tor of the seventh pandemic, suggesting an independent origin of these isolates. Identical fingerprints were observed between an O1 environmental isolate from a river in Chile and an O1 clinical strain from Kenya, both isolated more than 10 years apart. Both strains were distinct from the O1 seventh pandemic strain

  3. Large fragment production calculations in relativistic heavy-ion reactions

    International Nuclear Information System (INIS)

    Seixas de Oliveira, L.F.

    1978-12-01

    The abrasion-ablation model is briefly described and then used to calculate cross sections for production of large fragments resulting from target or projectile fragmentation in high-energy heavy-ion collisions. The number of nucleons removed from the colliding nuclei in the abrasion stage and the excitation energy of the remaining fragments (primary products) are calculated with the geometrical picture of two different models: the fireball and the firestreak models. The charge-to-mass dispersion of the primary products is calculated using either a model which assumes no correlations between proton and neutron positions inside the nucleus (hypergeometric distribution) or a model based upon the zero-point oscillations of the giant dipole resonance (NUC-GDR). Standard Weisskopf--Ewing statistical evaporation calculations are used to calculate final product distributions. Results of the pure abrasion-ablation model are compared with a variety of experimental data. The comparisons show the insufficiency of the extra-surface energy term used in the abrasion calculations. A frictional spectator interaction (FSI) is introduced which increases the average excitation energy of the primary products, and improves the results considerably in most cases. Agreements and discrepancies of the results calculated with the different theoretical assumptions and the experimental data are studied. Of particular relevance is the possibility of observing nuclear ground-state correlations.Results of the recently completed experiment of fragmentation of 213 Mev/A 40 Ar projectiles are studied and shown not to be capable of answering that question unambiguously. But predictions for the upcoming 48 Ca fragmentation experiment clearly show the possibility of observing correlation effects. 78 references

  4. Atypical myxomatosis--virus isolation, experimental infection of rabbits and restriction endonuclease analysis of the isolate.

    Science.gov (United States)

    Psikal, I; Smíd, B; Rodák, L; Valícek, L; Bendová, J

    2003-08-01

    Atypical form of myxomatosis, which caused non-lethal and clinically mild disease in domestic rabbits 1 month after immunization with a commercially available vaccine MXT, is described. The isolated myxoma virus designated as Litovel 2 (Li-2) did not induce systemic disease following subcutaneous and intradermal applications in susceptible experimental rabbits but led to the immune response demonstrated by ELISA. No severe disease was induced in those Li-2 inoculated rabbits by challenge with the virulent strains Lausanne (Lu) or Sanar (SA), while the control animals showed nodular form of myxomatosis with lethal course of the illness. Restriction fragment length polymorphism (RFLP) of genomic DNA with KpnI and BamHI endonucleases was used for genetic characterization of the Li-2 isolate, the vaccine strain MXT and both virulent strains Lu and SA, respectively. In general, RFLP analysis has shown to be informative for inferring genetic relatedness between myxoma viruses. Based on restriction endonuclease DNA fragment size distribution, it was evident that the pathogenic strain SA is genetically related to the reference strain Lu and the isolate Li-2 is more related, but not identical, to the vaccination strain MXT.

  5. Fragmentation of SIV-gag vaccine induces broader T cell responses.

    Directory of Open Access Journals (Sweden)

    Adel Benlahrech

    Full Text Available High mutation rates of human immunodeficiency virus (HIV allows escape from T cell recognition preventing development of effective T cell vaccines. Vaccines that induce diverse T cell immune responses would help overcome this problem. Using SIV gag as a model vaccine, we investigated two approaches to increase the breadth of the CD8 T cell response. Namely, fusion of vaccine genes to ubiquitin to target the proteasome and increase levels of MHC class I peptide complexes and gene fragmentation to overcome competition between epitopes for presentation and recognition.three vaccines were compared: full-length unmodified SIV-mac239 gag, full-length gag fused at the N-terminus to ubiquitin and 7 gag fragments of equal size spanning the whole of gag with ubiquitin-fused to the N-terminus of each fragment. Genes were cloned into a replication defective adenovirus vector and immunogenicity assessed in an in vitro human priming system. The breadth of the CD8 T cell response, defined by the number of distinct epitopes, was assessed by IFN-γ-ELISPOT and memory phenotype and cytokine production evaluated by flow cytometry. We observed an increase of two- to six-fold in the number of epitopes recognised in the ubiquitin-fused fragments compared to the ubiquitin-fused full-length gag. In contrast, although proteasomal targeting was achieved, there was a marked reduction in the number of epitopes recognised in the ubiquitin-fused full-length gag compared to the full-length unmodified gene, but there were no differences in the number of epitope responses induced by non-ubiquitinated full-length gag and the ubiquitin-fused mini genes. Fragmentation and ubiquitination did not affect T cell memory differentiation and polyfunctionality, though most responses were directed against the Ad5 vector.Fragmentation but not fusion with ubiquitin increases the breadth of the CD8 T vaccine response against SIV-mac239 gag. Thus gene fragmentation of HIV vaccines may maximise

  6. Dynamics of {sup 58}Ni + {sup 54}Fe → {sup 112}Xe* reaction across the Coulomb barrier

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Manpreet; Sharma, Manoj K. [Thapar University, School of Physics and Materials Science, Patiala (India)

    2014-03-15

    The dynamical cluster-decay model (DCM) has been applied to study the decay of the {sup 112}Xe* compound nucleus formed in the massive heavy-ion reaction {sup 58}Ni + {sup 54}Fe at energies across the Coulomb barrier with E{sub c.m.} ∼ 85-110 MeV. The calculations are done for spherical fragmentation as well as by including deformation and orientation degrees of freedom of the decaying fragments. DCM-based cross sections give a nice description of the experimental fusion excitation function σ{sub ER}, within one parameter fitting, the neck length parameter (ΔR), whose value remains within the range of nuclear proximity interaction. The barrier height corresponding to the neck length parameter brings into the picture the barrier modification which enables us to address the data particularly at below barrier energies. The role of excitation energy (or temperature), deformations, orientations, angular momentum and diffuseness parameter is investigated to understand the dynamics of the {sup 58}Ni + {sup 54}Fe reaction. Finally the N/Z dependence of the fragmentation structure of different compound systems formed via {sup 58}Ni beam (projectile) is explored. (orig.)

  7. Restricted fragmentation of poliovirus type 1, 2, and 3 RNAs by ribonuclease III

    Energy Technology Data Exchange (ETDEWEB)

    Nomoto, A. (State Univ. of New York, Stony Brook); Lee, Y.F.; Babich, A.; Jacobson, A.; Dunn, J.J.; Wimmer, E.

    1979-01-01

    Cleavage of the genome RNAs of poliovirus type 1, 2, and 3 with the ribonuclease III of Escherichia coli has been investigated with the following results: (1) at or above physiological salt concentration, the RNAs are completely resistant to the action of the enzyme, an observation suggesting that the RNAs lack primary cleavage sites; (2) lowering the salt concentration to 0.1 M or below allows RNase III to cleave the RNAs at secondary sites. Both large and small fragments can be obtained in a reproducible manner depending on salt conditions chosen for cleavage. Fingerprints of three large fragments of poliovirus type 2 RNA show that they originate from unique segments and represent most if not all sequences of the genome. Based upon binding to poly(U) filters of poly(A)-linked fragments, a physical map of the large fragments of poliovirus type 2 RNA was constructed. The data suggest that RNase III cleavage of single-stranded RNA provides a useful method to fragment the RNA for further studies.

  8. The Distribution Of Bovine Leukemia Virus Genotypes In Cattle From ...

    African Journals Online (AJOL)

    reaction (PCR), to detect BLV provirus, from peripheral blood lymphocytes (PBL) were performed. To identify genotypes, restriction fragment length polymorphism ... On a effectué le test AGID sur des prélèvements de sérum et le test PCR pour détecter le provirus VLB à partir des lymphocytes du sang périphérique. En vue ...

  9. Fragment molecular orbital study on electron tunneling mechanisms in bacterial photosynthetic reaction center.

    Science.gov (United States)

    Kitoh-Nishioka, Hirotaka; Ando, Koji

    2012-11-01

    The tunneling mechanisms of electron transfers (ETs) in photosynthetic reaction center of Blastochloris viridis are studied by the ab initio fragment molecular orbital (FMO) method combined with the generalized Mulliken-Hush (GMH) and the bridge Green function (GF) calculations of the electronic coupling T(DA) and the tunneling current method for the ET pathway analysis at the fragment-based resolution. For the ET from batctriopheophytin (H(L)) to menaquinone (MQ), a major tunneling current through Trp M250 and a minor back flow via Ala M215, Ala M216, and His M217 are quantified. For the ET from MQ to ubiquinone, the major tunneling pathway via the nonheme Fe(2+) and His L190 is identified as well as minor pathway via His M217 and small back flows involving His L230, Glu M232, and His M264. At the given molecular structure from X-ray experiment, the spin state of the Fe(2+) ion, its replacement by Zn(2+), or its removal are found to affect the T(DA) value by factors within 2.2. The calculated T(DA) values, together with experimentally estimated values of the driving force and the reorganization energy, give the ET rates in reasonable agreement with experiments.

  10. Peripheral Ar induced reactions at 44MeV/u. Similarities and deviations with respect to a high energy fragmentation process

    International Nuclear Information System (INIS)

    Borrel, V.; Guerreau, D.; Galin, J.; Gatty, B.; Jacquet, D.; Tarrago, X.

    1983-01-01

    Peripheral Ar reactions induced on 58 Ni at GANIL at 44 MeV/u have been analyzed in the framework of the high energy fragmentation model. Several deviations from this model have been interpreted as due to the persistence of some collective effects at this intermediate energy

  11. Restriction enzyme body doubles and PCR cloning: on the general use of type IIs restriction enzymes for cloning.

    Science.gov (United States)

    Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

    2014-01-01

    The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.

  12. Study of the multi-fragment production in asymmetric heavy ion reactions at E/A = 600 MeV

    International Nuclear Information System (INIS)

    Hubele, J.C.

    1992-03-01

    In this thesis the fragmentation of Au projectiles in collisions with light target nuclei ( 12 C, 27 Al, 64 Cu) is studied at a projectile energy of 600 MeV per nucleon. For the description of an event three observables are used: the multiplicity M lp of the light particles, the largest observed charge Z max of the projectile fragments, as well as a newly introduced obsevable Z bound , which is defined as the sum of all charge contained in complex projectile fragments (Z ≥ 2). By means of this observable different exit channels can be identified: the formation of a heavy residual nucleus by evaporation of light particles, the binary fission, the decay into IMF's (3 ≤ Z ≤ 30) and the complete decay into light particles. At the applied incident energy in the case of Au+Cu reactions each of these decay channels can be realized. The observables Z bound and M lpp are proved as suited quantities for the reconstruction of the impact parameter. Furthermore independently on the target a universal relation between Z bound and the multiplicity distribution of medium-heavy fragments is found. By simple model assumptions it is made plausible that Z bound is correlated both with the size of the projectile residue and in the mean with its excitation energy. For the characterization of the decay into IMF's the multiplicity M imf of these fragments is applied. For all three targets with increasing centrality first an increasing of the mean fragment multiplicities to maximal values of 3-4 is observed. In the case of the Cu target and suggestively also at the Al target in the most central collisions again a decreasing of the multiplicity is found. The universal Z bound behaviour is a hint to a - at least partial - equilibration of the primary projectile residue before the decay. (HSI) [de

  13. Flying between sky islands: the effect of naturally fragmented habitat on butterfly population structure.

    Science.gov (United States)

    Sekar, Sandhya; Karanth, Praveen

    2013-01-01

    High elevation montane areas are called "sky islands" when they occur as a series of high mountains separated by lowland valleys. Different climatic conditions at high elevations makes sky islands a specialized type of habitat, rendering them naturally fragmented compared to more continuous habitat at lower elevations. Species in sky islands face unsuitable climate in the intervening valleys when moving from one montane area to another. The high elevation shola-grassland mosaic in the Western Ghats of southern India form one such sky island complex. The fragmented patches make this area ideal to study the effect of the spatial orientation of suitable habitat patches on population genetic structure of species found in these areas. Past studies have suggested that sky islands tend to have genetically structured populations, possibly due to reduced gene flow between montane areas. To test this hypothesis, we adopted the comparative approach. Using Amplified Fragment Length Polymorphisms, we compared population genetic structures of two closely related, similar sized butterfly species: Heteropsis oculus, a high elevation shola-grassland specialist restricted to the southern Western Ghats, and Mycalesis patnia, found more continuously distributed in lower elevations. In all analyses, as per expectation the sky island specialist H. oculus exhibited a greater degree of population genetic structure than M. patnia, implying a difference in geneflow. This difference in geneflow in turn appears to be due to the natural fragmentation of the sky island complexes. Detailed analysis of a subset of H. oculus samples from one sky island complex (the Anamalais) showed a surprising genetic break. A possible reason for this break could be unsuitable conditions of higher temperature and lower rainfall in the intervening valley region. Thus, sky island species are not only restricted by lack of habitat continuity between montane areas, but also by the nature of the intervening habitat.

  14. Determination of the shapes and sizes of the regions in which in hadron-nucleus collisions reactions leading to the nucleon emission, particle production, and fragment evaporation occur

    International Nuclear Information System (INIS)

    Strugalski, Z.

    1985-01-01

    Shapes and sizes of the regions in target-nuclei in which reactions leading to the nucleon emission, particle production and fragment evaporation occur are determined. The region of nucleon emission is of cylindrical shape, with the diameter as large as two nucleon diameters, centered on the incident hadron course. The reactions leading to the particle production happen predominantly along the incident hadron course in nuclear matter. The fragment evaporation goes from the surface layer of the part of the target-nucleus damaged in nucleon emission process

  15. Genome-wide macrosynteny among Fusarium species in the Gibberella fujikuroi complex revealed by amplified fragment length polymorphisms.

    Directory of Open Access Journals (Sweden)

    Lieschen De Vos

    Full Text Available The Gibberella fujikuroi complex includes many Fusarium species that cause significant losses in yield and quality of agricultural and forestry crops. Due to their economic importance, whole-genome sequence information has rapidly become available for species including Fusarium circinatum, Fusarium fujikuroi and Fusarium verticillioides, each of which represent one of the three main clades known in this complex. However, no previous studies have explored the genomic commonalities and differences among these fungi. In this study, a previously completed genetic linkage map for an interspecific cross between Fusarium temperatum and F. circinatum, together with genomic sequence data, was utilized to consider the level of synteny between the three Fusarium genomes. Regions that are homologous amongst the Fusarium genomes examined were identified using in silico and pyrosequenced amplified fragment length polymorphism (AFLP fragment analyses. Homology was determined using BLAST analysis of the sequences, with 777 homologous regions aligned to F. fujikuroi and F. verticillioides. This also made it possible to assign the linkage groups from the interspecific cross to their corresponding chromosomes in F. verticillioides and F. fujikuroi, as well as to assign two previously unmapped supercontigs of F. verticillioides to probable chromosomal locations. We further found evidence of a reciprocal translocation between the distal ends of chromosome 8 and 11, which apparently originated before the divergence of F. circinatum and F. temperatum. Overall, a remarkable level of macrosynteny was observed among the three Fusarium genomes, when comparing AFLP fragments. This study not only demonstrates how in silico AFLPs can aid in the integration of a genetic linkage map to the physical genome, but it also highlights the benefits of using this tool to study genomic synteny and architecture.

  16. Saturating representation of loop conformational fragments in structure databanks

    Directory of Open Access Journals (Sweden)

    Fiser András

    2006-07-01

    Full Text Available Abstract Background Short fragments of proteins are fundamental starting points in various structure prediction applications, such as in fragment based loop modeling methods but also in various full structure build-up procedures. The applicability and performance of these approaches depend on the availability of short fragments in structure databanks. Results We studied the representation of protein loop fragments up to 14 residues in length. All possible query fragments found in sequence databases (Sequence Space were clustered and cross referenced with available structural fragments in Protein Data Bank (Structure Space. We found that the expansion of PDB in the last few years resulted in a dense coverage of loop conformational fragments. For each loops of length 8 in the current Sequence Space there is at least one loop in Structure Space with 50% or higher sequence identity. By correlating sequence and structure clusters of loops we found that a 50% sequence identity generally guarantees structural similarity. These percentages of coverage at 50% sequence cutoff drop to 96, 94, 68, 53, 33 and 13% for loops of length 9, 10, 11, 12, 13, and 14, respectively. There is not a single loop in the current Sequence Space at any length up to 14 residues that is not matched with a conformational segment that shares at least 20% sequence identity. This minimum observed identity is 40% for loops of 12 residues or shorter and is as high as 50% for 10 residue or shorter loops. We also assessed the impact of rapidly growing sequence databanks on the estimated number of new loop conformations and found that while the number of sequentially unique sequence segments increased about six folds during the last five years there are almost no unique conformational segments among these up to 12 residues long fragments. Conclusion The results suggest that fragment based prediction approaches are not limited any more by the completeness of fragments in databanks but

  17. Looking for bimodal distributions in multi-fragmentation reactions

    International Nuclear Information System (INIS)

    Gulminelli, F.

    2007-01-01

    The presence of a phase transition in a finite system can be deduced, together with its order, from the form of the distribution of the order parameter. This issue has been extensively studied in multifragmentation experiments, with results that do not appear fully consistent. In this paper we discuss the effect of the statistical ensemble or sorting conditions on the form of fragment distributions, and propose a new method, which can be easily implemented experimentally, to discriminate between different fragmentation scenarios. This method, based on a re-weighting of the measured distribution to account for the experimental constraints linked to the energy deposit, is tested on different simple models, and appears to provide a powerful discrimination. (author)

  18. Fragmentation in central collisions of heavy systems

    International Nuclear Information System (INIS)

    Claesson, G.; Doss, K.G.R.; Ferguson, R.

    1987-01-01

    One of the goals of heavy ion reaction studies is to understand the fragmentation of hot nuclei. The LBL/GSI Plastic Ball detector system has been used to achieve a very high solid angle for detection of light and medium-heavy fragments emitted in 200 Mev/A Au + Au and Au + Fe reactions. The simultaneous measurement of almost all of the nucleons and nuclei resulting from each collision allows an estimation of the total charged particle multiplicity and hence the impact parameter. By choosing subsets of the data corresponding to a peripheral or central collision, the assumptions inherent in various models of nuclear fragmentation can be tested. 3 refs., 3 figs

  19. Target fragmentation in proton-nucleus and 16O-nucleus reactions at 60 and 200 GeV/nucleon

    International Nuclear Information System (INIS)

    Schmidt, H.R.; Albrecht, R.; Claesson, G.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Siemiarczuk, T.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Obenshain, F.E.; Plasil, F.; Sorensen, S.P.; Young, G.R.; Beckmann, P.; Berger, F.; Dragon, L.; Glasow, R.; Kampert, K.H.; Loehner, H.; Peitzmann, T.; Purschke, M.; Santo, R.; Franz, A.; Kristiansson, P.; Poskanzer, A.M.; Ritter, H.G.; Garpman, S.; Gustafsson, H.A.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.

    1988-01-01

    Target remnants with Z 16 O-nucleus reactions at 60 and 200 GeV/nucleon were measured in the angular range from 30 0 to 160 0 (-1.7 16 O-induced reactions (≅ 300 MeV/c) than in proton-induced reactions (≅ 130 MeV/c). The baryon rapidity distributions are roughly in agreement with one-fluid hydrodynamical calculations at 60 GeV/nucleon 16 O+Au but are in disagreement at 200 GeV/nucleon, indicating the higher degree of transparency at the higher bombarding energy. Both, the transverse momenta of target spectators and the entropy produced in the target fragmentation region are compared to those attained in head-on collisions of two heavy nuclei at Bevalac energies. They are found to be comparable or do even exceed the values for the participant matter at beam energies of about 1-2 GeV/nucleon. (orig.)

  20. Target fragmentation in proton-nucleus and 16O-nucleus reactions at 60 and 200 GeV/nucleon

    International Nuclear Information System (INIS)

    Schmidt, H.R.; Albrecht, R.; Claesson, G.; Bock, R.; Gutbrod, H.H.; Kolb, B.W.; Lund, I.; Siemiarczuk, T.; Awes, T.C.; Baktash, C.; Ferguson, R.L.; Lee, I.Y.; Obenshain, F.E.; Plasil, F.; Sorensen, S.P.; Young, G.R.; Beckmann, P.; Berger, F.; Dragon, L.; Glasow, R.; Kampert, K.H.; Loehner, H.; Peitzmann, T.; Purschke, M.; Santo, R.; Franz, A.; Kristiansson, P.; Poskanzer, A.M.; Ritter, H.G.; Garpman, S.; Gustafsson, H.A.; Oskarsson, A.; Otterlund, I.; Persson, S.; Stenlund, E.

    1988-01-01

    Target remnants with Z 16 O-nucleus reactions at 60 and 200 GeV/nucleon were measured in the angular range from 30 0 to 160 0 (-1.7 16 O-induced reactions (= 300 MeV/c) than in proton-induced reactions (= 130 MeV/c). The baryon rapidity distributions are roughly in agreement with one-fluid hydrodynamical calculations at 60 GeV/nucleon 16 O+Au but are in disagreement at 200 GeV/nucleon, indicating the higher degree of transparency at the higher bombarding energy. Both, the transverse momenta of target spectators and the entropy produced in the target fragmentation region are compared to those attained in head-on collisions of two heavy nuclei at Bevalac energies. They are found to be comparable or do even exceed the values for the participant matter at beam energies of about 1-2 GeV/nucleon. (orig.)

  1. Complex fragment emission at low and high excitation energy

    International Nuclear Information System (INIS)

    Moretto, L.G.

    1986-08-01

    Complex fragment emission has been certified as a compound nucleus process at low energies. An extension of the measurements to heavy ion reactions up to 50 MeV/u shows that most complex fragments are emitted by highly excited compound nuclei formed in incomplete fusion reactions. 12 refs., 26 figs

  2. Model for how type I restriction enzymes select cleavage sites in DNA

    International Nuclear Information System (INIS)

    Studier, F.W.; Bandyopadhyay, P.K.

    1988-01-01

    Under appropriate conditions, digestion of phage T7 DNA by the type I restriction enzyme EcoK produces an orderly progression of discrete DNA fragments. All details of the fragmentation pattern can be explained on the basis of the known properties of type I enzymes, together with two further assumptions: (i) in the ATP-stimulated translocation reaction, the enzyme bound at the recognition sequence translocates DNA toward itself from both directions simultaneously; and (ii) when translocation causes neighboring enzymes to meet, they cut the DNA between them. The kinetics of digestion at 37 degree C indicates that the rate of translocation of DNA from each side of a bound enzyme is about 200 base pairs per second, and the cuts are completed within 15-25 sec of the time neighboring enzymes meet. The resulting DNA fragments each contain a single recognition site with an enzyme (or subunit) remaining bound to it. At high enzyme concentrations, such fragments can bu further degraded, apparently by cooperation between the specifically bound and excess enzymes. This model is consistent with a substantial body of previous work on the nuclease activity of EcoB and EcoK, and it explains in a simple way how cleavage sites are selected

  3. Fragmentation under the Scaling Symmetry and Turbulent Cascade with Intermittency

    Science.gov (United States)

    Gorokhovski, M.

    2003-01-01

    Fragmentation plays an important role in a variety of physical, chemical, and geological processes. Examples include atomization in sprays, crushing of rocks, explosion and impact of solids, polymer degradation, etc. Although each individual action of fragmentation is a complex process, the number of these elementary actions is large. It is natural to abstract a simple 'effective' scenario of fragmentation and to represent its essential features. One of the models is the fragmentation under the scaling symmetry: each breakup action reduces the typical length of fragments, r (right arrow) alpha r, by an independent random multiplier alpha (0 Saveliev, the fragmentation under the scaling symmetry has been reviewed as a continuous evolution process with new features established. The objective of this paper is twofold. First, the paper synthesizes and completes theoretical part of Gorokhovski & Saveliev. Second, the paper shows a new application of the fragmentation theory under the scale invariance. This application concerns the turbulent cascade with intermittency. We formulate here a model describing the evolution of the velocity increment distribution along the progressively decreasing length scale. The model shows that when the turbulent length scale gets smaller, the velocity increment distribution has central growing peak and develops stretched tails. The intermittency in turbulence is manifested in the same way: large fluctuations of velocity provoke highest strain in narrow (dissipative) regions of flow.

  4. Asymmetry effects in fragment production

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Manpreet [Sri Guru Granth Sahib World University, Fatehgarh Sahib-140406, Punjab (India); Kaur, Varinderjit, E-mail: drvarinderjit@gmail.com [Mata Gujri College, Fatehgarh Sahib-140406, Punjab (India)

    2016-05-06

    The production of different fragments has been studied by taking into account the mass asymmetry of the reaction and employing the momentum dependent interactions. Two different set of asymmetric reactions have been analyzed while keeping At{sub otal} fixed using soft momentum dependent equation of state. Our results indicate that the impact of momentum dependent interactions is different in lighter projectile systems as compared to heavier ones. The comparative analysis of IQMD simulations with the experimental data in case of heavier projectile and lighter target system for the reaction of {sup 197}Au+{sup 27}Al (η = 0.7) at E = 600 MeV/nucleon shows that with the inclusion of MDI we are able, upto some extent, to reproduce the experimental universality of rise and fall of intermediate mass fragments (IMFs).

  5. Fission fragment spins and spectroscopy

    International Nuclear Information System (INIS)

    Durell, J.L.

    1988-01-01

    Prompt γ-ray coincidence experiments have been carried out on γ-rays emitted from post-neutron emission fission fragments produced by the aup 19F + 197 Au and 18 O + 232 Th reactions. Decay schemes have been established for even-even nuclei ranging from 78 Se to 148 Nd. Many new states with spin up to ∼ 12h have been observed. Apart from providing a wealth of new information on the spectroscopy of neutron-rich nuclei, the data have been analyzed to determine the average spin of primary fission fragments as a function of fragment mass. The results suggest that the fragment spins are determined by the temperature and shape of the primary fragments at or near to scission

  6. High-Resolution Amplified Fragment Length Polymorphism Typing of Lactococcus lactis Strains Enables Identification of Genetic Markers for Subspecies-Related Phenotypes▿

    Science.gov (United States)

    Kütahya, Oylum Erkus; Starrenburg, Marjo J. C.; Rademaker, Jan L. W.; Klaassen, Corné H. W.; van Hylckama Vlieg, Johan E. T.; Smid, Eddy J.; Kleerebezem, Michiel

    2011-01-01

    A high-resolution amplified fragment length polymorphism (AFLP) methodology was developed to achieve the delineation of closely related Lactococcus lactis strains. The differentiation depth of 24 enzyme-primer-nucleotide combinations was experimentally evaluated to maximize the number of polymorphisms. The resolution depth was confirmed by performing diversity analysis on 82 L. lactis strains, including both closely and distantly related strains with dairy and nondairy origins. Strains clustered into two main genomic lineages of L. lactis subsp. lactis and L. lactis subsp. cremoris type-strain-like genotypes and a third novel genomic lineage rooted from the L. lactis subsp. lactis genomic lineage. Cluster differentiation was highly correlated with small-subunit rRNA homology and multilocus sequence analysis (MLSA) studies. Additionally, the selected enzyme-primer combination generated L. lactis subsp. cremoris phenotype-specific fragments irrespective of the genotype. These phenotype-specific markers allowed the differentiation of L. lactis subsp. lactis phenotype from L. lactis subsp. cremoris phenotype strains within the same L. lactis subsp. cremoris type-strain-like genomic lineage, illustrating the potential of AFLP for the generation of phenotype-linked genetic markers. PMID:21666014

  7. Study of fission fragments produced by 14N + 235U reaction

    International Nuclear Information System (INIS)

    Yalcinkaya, M.; Erduran, M.N.; Ganioglu, E.; Akkus, B.; Bostan, M.; Gurdal, G.; Erturk, S.; Balabanski, D.; Minkova, A.; Danchev, M.

    2005-01-01

    This work was performed to understand the structure of neutron rich fission fragments around ∼ 130 region. A thin metallic 235 U target was bombarded by 14 N beam with 10 MeV/A from the Separated Sector Cyclotron at the National Accelerator Centre, Cape Town, South Africa. The main goal to detect and identify fission fragments and to obtain their mass distribution was achieved by using Solar Cell detectors in the AFRODITE (African Omnipurpose Detector for Innovative Techniques and Experiments) spectrometer. The X-rays emitted from fission fragments were detected by LEP detectors and γ rays emitted from excited states of the fission fragments were detected by CLOVER detectors in the spectrometer. (author)

  8. Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

    Science.gov (United States)

    Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

    2012-01-01

    A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

  9. Fragment emission from modestly excited nuclear systems

    Energy Technology Data Exchange (ETDEWEB)

    Lou, Y. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Souza, R.T. de [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Chen, S.L. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Cornell, E.W. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Davin, B. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Fox, D. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Hamilton, T.M. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Mcdonald, K. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility; Tsang, M.B. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Glasmacher, T. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Dinius, J. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Gelbke, C.K. [Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Handzy, D.O. [Indiana Univ., Bloomington, IN (United States). Dept. of Chemistry]|[Indiana Univ., Bloomington, IN (United States). Cyclotron Facility]|[Michigan State Univ., East Lansing, MI (United States). National Superconducting Cyclotron Lab.; Hsi, W.C.

    1996-07-08

    Fragment emission patterns occurring in nuclear systems of modest excitation are studied. Exclusive measurement of fragment emission in {sup 14}N+{sup 197}Au reactions at E/A=100, 130 and 156 MeV allows selection of central collisions where a single source dominates the decay. Low threshold measurement of IMF emission for these events allows investigation of the influence of detector threshold effects. The time scale of fragment emission is deduced using fragment-fragment velocity correlations. Comparisons are made to the predictions of a statistical decay model. (orig.).

  10. Mycobacterium intracellulare Pleurisy Identified on Liquid Cultures of the Pleural Fluid and Pleural Biopsy

    OpenAIRE

    Lim, Jong Gu; O, Sei Won; Lee, Ki Dong; Suk, Dong Keun; Jung, Tae Young; Shim, Tae Sun; Chon, Gyu Rak

    2013-01-01

    Pleural effusion is a rare complication in non-tuberculous mycobacterial infection. We report a case of Mycobacterium intracellulare pleuritis with idiopathic pulmonary fibrosis in a 69-year-old man presenting with dyspnea. Pleural effusion revealed lymphocyte dominant exudate. M. intracellulare was identified using a polymerase chain reaction-restriction fragment length polymorphism method and liquid cultures of pleural effusion and pleural biopsy. After combination therapy for M. intracellu...

  11. Design of combinatorial libraries for the exploration of virtual hits from fragment space searches with LoFT.

    Science.gov (United States)

    Lessel, Uta; Wellenzohn, Bernd; Fischer, J Robert; Rarey, Matthias

    2012-02-27

    A case study is presented illustrating the design of a focused CDK2 library. The scaffold of the library was detected by a feature trees search in a fragment space based on reactions from combinatorial chemistry. For the design the software LoFT (Library optimizer using Feature Trees) was used. The special feature called FTMatch was applied to restrict the parts of the queries where the reagents are permitted to match. This way a 3D scoring function could be simulated. Results were compared with alternative designs by GOLD docking and ROCS 3D alignments.

  12. Construction of a 3D-shaped, natural product like fragment library by fragmentation and diversification of natural products.

    Science.gov (United States)

    Prescher, Horst; Koch, Guido; Schuhmann, Tim; Ertl, Peter; Bussenault, Alex; Glick, Meir; Dix, Ina; Petersen, Frank; Lizos, Dimitrios E

    2017-02-01

    A fragment library consisting of 3D-shaped, natural product-like fragments was assembled. Library construction was mainly performed by natural product degradation and natural product diversification reactions and was complemented by the identification of 3D-shaped, natural product like fragments available from commercial sources. In addition, during the course of these studies, novel rearrangements were discovered for Massarigenin C and Cytochalasin E. The obtained fragment library has an excellent 3D-shape and natural product likeness, covering a novel, unexplored and underrepresented chemical space in fragment based drug discovery (FBDD). Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Fragmentation mechanism reflecting the cluster structure of {sup 19}B

    Energy Technology Data Exchange (ETDEWEB)

    Takemoto, H.; Horiuchi, H. [Kyoto Univ., Dept. of Physics, Kyoto (Japan); Ono, A.

    1999-08-01

    Clustering structure of neutron dripline nucleus {sup 19}B which was predicted theoritically is investigated by studying the fragmentation reaction of {sup 19}B. We compare {sup 19}B fragmentation with {sup 13}B fragmentation in {sup 19}B + {sup 14}N and {sup 13}B + {sup 14}N reactions by using antisymmetrized molecular dynamics, where {sup 13}B has no clustering feature in its structure. We find that the cluster structure of the {sup 19}B nucleus is reflected in its fragmentation as the simultaneous production of He and Li isotopes. Furthermore we investigate the dependence of the cluster decay of {sup 19}B on the incident energy, and find that the cluster structure of {sup 19}B in its ground state is more reflected in lower incident-energy reactions. (author)

  14. Photodegradable, Photoadaptable Hydrogels via Radical-Mediated Disulfide Fragmentation Reaction.

    Science.gov (United States)

    Fairbanks, Benjamin D; Singh, Samir P; Bowman, Christopher N; Anseth, Kristi S

    2011-04-26

    Various techniques have been adopted to impart a biological responsiveness to synthetic hydrogels for the delivery of therapeutic agents as well as the study and manipulation of biological processes and tissue development. Such techniques and materials include polyelectrolyte gels that swell and deswell with changes in pH, thermosensitive gels that contract at physiological temperatures, and peptide cross-linked hydrogels that degrade upon peptidolysis by cell-secreted enzymes. Herein we report a unique approach to photochemically deform and degrade disulfide cross-linked hydrogels, mitigating the challenges of light attenuation and low quantum yield, permitting the degradation of hydrogels up to 2 mm thick within 120 s at low light intensities (10 mW/cm(2) at 365 nm). Hydrogels were formed by the oxidation of thiol-functionalized 4-armed poly(ethylene glycol) macromolecules. These disulfide cross-linked hydrogels were then swollen in a lithium acylphosphinate photoinitiator solution. Upon exposure to light, photogenerated radicals initiate multiple fragmentation and disulfide exchange reactions, permitting and promoting photodeformation, photowelding, and photodegradation. This novel, but simple, approach to generate photoadaptable hydrogels portends the study of cellular response to mechanically and topographically dynamic substrates as well as novel encapsulations by the welding of solid substrates. The principles and techniques described herein hold implications for more than hydrogel materials but also for photoadaptable polymers more generally.

  15. Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

    DEFF Research Database (Denmark)

    Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

    1988-01-01

    Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI.......Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

  16. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes.

    Directory of Open Access Journals (Sweden)

    Kotoka Masuyama

    Full Text Available Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted "bidirectional analysis," which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples.

  17. Effect of angular-momentum dissipation and fluctuation on energy coherence lengths and time evolution in the dissipative collision 28Si+48Ti

    International Nuclear Information System (INIS)

    Kun, S.Yu.; WITS Univ., Johannesburg; Noerenberg, W.; TH Darmstadt; Papa, M.

    1992-09-01

    We analyze the energy autocorrelation functions and the energy coherence lengths in the strongly dissipative collision 28 Si(E lab = 130 MeV) + 4 8Ti for Z=11 and 12 reaction fragments. It is found that in order to obtain a good fit of both the energy averaged angular distributions and the angular dependence of the energy coherence lengths one has to take into account (i) the dissipation and fluctuation of the relative angular momentum of the dinucleus and (ii) the contribution from direct (fast) reactions in addition to the statistical (relatively slow) interaction processes. The established angular dependence is a direct consequence of the angular-momentum dissipation-fluctuation effects on the time-space evolution of the intermediate dinucleus. (orig.)

  18. Analyzing powers and isotope ratios for the natAg(rvec p, intermediate-mass fragment) reaction at 200 MeV

    International Nuclear Information System (INIS)

    Renshaw, E.; Yennello, S.J.; Kwiatkowski, K.; Planeta, R.; Woo, L.W.; Viola, V.E.

    1991-01-01

    Analyzing powers and isotope ratios have been measured for ejectiles with Z≤7 emitted at forward angles in the 200-MeV rvec p+ nat Ag reaction. The observed analyzing powers are consistent with zero, and thus do not provide evidence for a significant contribution from cluster knockout, or similar direct formation mechanisms. Fragment kinetic-energy spectra above the Coulomb peak are compared with a coalescence calculation. The isotopic composition of the elemental kinetic-energy spectra is found to favor N/Z≥1 nuclei for fragment energies near the exit-channel Coulomb energy, whereas species with N/Z≤1 are more abundant in the high-energy spectral tails. This behavior is consistent with the predictions of an accreting source calculation

  19. Production of 149Tb in deep inelastic transfer reactions: an approach to the angular momentum of fragments

    International Nuclear Information System (INIS)

    Rivet, M.F.; Bimbot, R.; Gardes, D.; Fleury, A.; Hubert, F.; Llabador, Y.

    1978-01-01

    The excitation functions for deep inelastic reactions in which two to six charges are transferred from 40 Ar and 63 Cu ions to rare earth targets have been measured using activation techniques, the observed radionuclides being 150 Dy, 151 Dy and 149 gTb. From the comparison of the curves relative to 149 gTb and those relative to 150 Dy, 151 Dy, it was deduced that the low spin isomer 149 gTb was produced with significant probability for low incident energies. Using data from (heavy ions, xn) reactions, it was possible to attribute this production to the deexcitation of Tb fragments formed in deep inelastic transfers with angular momenta lower than 9n. This result is in good agreement with the angular momentum calculations performed under the hypothesis that the initial angular momentum window leading to deep inelastic reactions is situated between the critical angular momentum for fusion and that corresponding to grazing collisions. As far as Cu induced reactions are concerned, both hypothesis of rolling and sticking are consistent with the experimental data. For Ar induced reactions, the results indicate that the stage of sticking is not reached when the incident energy is lower than 200 MeV

  20. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  1. Effect of alcohol dehydrogenase 1C (ADH1C genotype on vitamin A restriction and marbling in Korean native steers

    Directory of Open Access Journals (Sweden)

    Dong Qiao Peng

    2017-08-01

    Full Text Available Objective This work was to find the correlation of alcohol dehydrogenase 1C (ADH1C genotype with vitamin A reduction and carcass traits during the vitamin A restriction period. Methods In study 1, 60 Korean native steers were fed a diet (890 IU/kg with 8,000 IU and 0 IU of supplemental premix vitamin A/kg of dry matter (DM for control and treatment group, respectively. The levels of serum vitamin A were analyzed through high preparative performance liquid chromatography, and the ADH1C genotype was analyzed based on polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP; 78.1% TT type, 21.9% TC type; however, CC type was not found. Then, the interaction between ADH1C and carcass traits on the vitamin A restriction was investigated in study 2. A total of 136 Korean native steers were fed a diet that included 930 IU/kg vitamin A of DM. Results Serum vitamin A in treatment was reduced to 112.4 IU/dL in steers with TT type of ADH1C, while for steers with TC type the concentration of serum vitamin A was dropped to 79.5 IU/dL (p<0.1 in study 1. This showed that TC type had the potential to lower serum vitamin A concentration during vitamin A restriction compared to TT type. In study 2 we found that eye muscle area, marbling and carcass weight in Korean native steers with TC type were higher than in steers with TT type (p<0.05. Conclusion The interaction between vitamin A restriction and TC type of ADH1C gene could have the potential of increasing the marbling in Korean native steers. These results indicated that steers with TC type of the ADH1C gene were more sensitive to the change of serum vitamin A than TT types. Furthermore, this finding has the potential to enable a higher marbling score under the condition of vitamin A restriction in Korean native steers.

  2. Photoluminescence and self-assembly of cesium lead halide perovskite nanocrystals: Effects of chain length of organic amines and reaction temperature

    International Nuclear Information System (INIS)

    Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei

    2017-01-01

    Highlights: • CsPbBr_3 perovskite nanocrystals have been synthesized in the presence of organic amines with different hydrocarbon length. • The photoluminescence of the CsPbBr_3 nanocrystals is affected by the varying the carbon length of the organic amines. • The lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr_3 nanocrystals. - Abstract: All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr_3 nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr_3 NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr_3 NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55–80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr_3 NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr_3 NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the product synthesized in the presence of

  3. Photoluminescence and self-assembly of cesium lead halide perovskite nanocrystals: Effects of chain length of organic amines and reaction temperature

    Energy Technology Data Exchange (ETDEWEB)

    Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei, E-mail: awtang@bjtu.edu.cn

    2017-05-31

    Highlights: • CsPbBr{sub 3} perovskite nanocrystals have been synthesized in the presence of organic amines with different hydrocarbon length. • The photoluminescence of the CsPbBr{sub 3} nanocrystals is affected by the varying the carbon length of the organic amines. • The lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr{sub 3} nanocrystals. - Abstract: All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr{sub 3} nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr{sub 3} NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr{sub 3} NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55–80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr{sub 3} NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr{sub 3} NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the

  4. Reaction 40Ca+natCu at 35 MeV/nucleon measured with the AMPHORA multidetector. Study of the excitation energy and angular momentum of the reconstructed projectile-like fragment

    International Nuclear Information System (INIS)

    Elhage, H.

    1992-10-01

    We have studied the reaction of 40 Ca with nat Cu at 35 MeV/nucleon with the AMPHORA multidetector. Three different reaction models were developed and we have shown that a simulation of the AMPHORA response is necessary to interpret the experimental results. Only two-body events were analyzed. Kinematic selection criterions, based on relative velocity, were used in order to isolate particles and residues coming from the de-excitation of the projectile-like fragment. The reconstitution of such a nucleus allowed to define the reaction plane and to calculate the energy balance event-by-event. We have proposed a method to determine the angular momentum based on the emission asymmetry of the light particles with respect to the normal to the reaction plane. The estimated angular momenta are in good agreement with the theoretical predictions. The projectile-like fragment temperature was estimated from the energy spectra of the light particles. The independent determination of the excitation energy, temperature and angular momentum allowed to calculate the level density parameter. This quantity does not evolve with the excitation energy and is equal to A/8. The projectile-like fragment de-excitation mode is mainly evaporation

  5. Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

    Science.gov (United States)

    Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

    2017-05-17

    Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

  6. MCNP6 fragmentation of light nuclei at intermediate energies

    Energy Technology Data Exchange (ETDEWEB)

    Mashnik, Stepan G., E-mail: mashnik@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); Kerby, Leslie M. [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States); University of Idaho, Moscow, ID 83844 (United States)

    2014-11-11

    Fragmentation reactions induced on light target nuclei by protons and light nuclei of energies around 1 GeV/nucleon and below are studied with the latest Los Alamos Monte Carlo transport code MCNP6 and with its cascade-exciton model (CEM) and Los Alamos version of the quark-gluon string model (LAQGSM) event generators, version 03.03, used as stand-alone codes. Such reactions are involved in different applications, like cosmic-ray-induced single event upsets (SEU's), radiation protection, and cancer therapy with proton and ion beams, among others; therefore, it is important that MCNP6 simulates them as well as possible. CEM and LAQGSM assume that intermediate-energy fragmentation reactions on light nuclei occur generally in two stages. The first stage is the intranuclear cascade (INC), followed by the second, Fermi breakup disintegration of light excited residual nuclei produced after the INC. Both CEM and LAQGSM account also for coalescence of light fragments (complex particles) up to {sup 4}He from energetic nucleons emitted during INC. We investigate the validity and performance of MCNP6, CEM, and LAQGSM in simulating fragmentation reactions at intermediate energies and discuss possible ways of further improving these codes.

  7. Heavy fragment radioactivity

    International Nuclear Information System (INIS)

    Silisteanu, I.

    1991-06-01

    The effect of collective mode excitation in heavy fragment radioactivity (HFR) is explored and discussed in the light of current experimental data. It is found that the coupling and resonance effects in fragment interaction and also the proper angular momentum effects may lead to an important enhancing of the emission process. New useful procedures are proposed for the study of nuclear decay properties. The relations between different decay processes are investigated in detail. We are also trying to understand and explain in a unified way the reaction mechanisms in decay phenomena. (author). 17 refs, 4 figs, 3 tabs

  8. A model for projectile fragmentation

    International Nuclear Information System (INIS)

    Chaudhuri, G; Mallik, S; Gupta, S Das

    2013-01-01

    A model for projectile fragmentation is developed whose origin can be traced back to the Bevalac era. The model positions itself between the phenomenological EPAX parametrization and transport models like 'Heavy Ion Phase Space Exploration' (HIPSE) model and antisymmetrised molecular dynamics (AMD) model. A very simple impact parameter dependence of input temperature is incorporated in the model which helps to analyze the more peripheral collisions. The model is applied to calculate the charge, isotopic distributions, average number of intermediate mass fragments and the average size of largest cluster at different Z bound of different projectile fragmentation reactions at different energies.

  9. Coincidence measurement between. cap alpha. -particles and projectile-like fragments in reaction of 82. 7 MeV /sup 16/O on /sup 27/Al

    Energy Technology Data Exchange (ETDEWEB)

    Wen-Qing, Shen; Wen-long, Zhan; Yong-tai, Zhu; Shu-zhi, Yin; Zhong-yan, Guo; Wei-min, Qiao; Guo-ying, Fan; Gen-ming, Jin; Song-ling, Li; Zhen, Zhang; others, and

    1987-01-01

    In the coincidence measurement between ..cap alpha..-particles and projectile-like fragments in the reaction of 82.7 MeV /sup 16/O on /sup 27/Al, the contour plot of the C-..cap alpha.. coincidence in the velocity plane and the coincident angular correlation are obtained. Different mechanisms of ..cap alpha..-particle emission are analysed. A possible reaction mechanism of incomplete DIC is discussed.

  10. Comparison of Direct Sequencing, Real-Time PCR-High Resolution Melt (PCR-HRM) and PCR-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis for Genotyping of Common Thiopurine Intolerant Variant Alleles NUDT15 c.415C>T and TPMT c.719A>G (TPMT*3C).

    Science.gov (United States)

    Fong, Wai-Ying; Ho, Chi-Chun; Poon, Wing-Tat

    2017-05-12

    Thiopurine intolerance and treatment-related toxicity, such as fatal myelosuppression, is related to non-function genetic variants encoding thiopurine S-methyltransferase (TPMT) and Nudix hydrolase 15 (NUDT15). Genetic testing of the common variants NUDT15:NM_018283.2:c.415C>T (Arg139Cys, dbSNP rs116855232 T allele) and TPMT: NM_000367.4:c.719A>G (TPMT*3C, dbSNP rs1142345 G allele) in East Asians including Chinese can potentially prevent treatment-related complications. Two complementary genotyping approaches, real-time PCR-high resolution melt (PCR-HRM) and PCR-restriction fragment length morphism (PCR-RFLP) analysis were evaluated using conventional PCR and Sanger sequencing genotyping as the gold standard. Sixty patient samples were tested, revealing seven patients (11.7%) heterozygous for NUDT15 c.415C>T, one patient homozygous for the variant and one patient heterozygous for the TPMT*3C non-function allele. No patient was found to harbor both variants. In total, nine out of 60 (15%) patients tested had genotypic evidence of thiopurine intolerance, which may require dosage adjustment or alternative medication should they be started on azathioprine, mercaptopurine or thioguanine. The two newly developed assays were more efficient and showed complete concordance (60/60, 100%) compared to the Sanger sequencing results. Accurate and cost-effective genotyping assays by real-time PCR-HRM and PCR-RFLP for NUDT15 c.415C>T and TPMT*3C were successfully developed. Further studies may establish their roles in genotype-informed clinical decision-making in the prevention of morbidity and mortality due to thiopurine intolerance.

  11. Fragmentation and reactivity of energy-selected ferrocenium ions

    International Nuclear Information System (INIS)

    Mestdagh, H.; Dutuit, O.; Heninger, M.; Thissen, R.; Alcaraz, C.

    2002-01-01

    In this study, results concerning the discussion of state-selected ferrocenium ions (c-C 5 H 5 ) 2 Fe + commonly called Cp 2 Fe + , as well as their reactions with methanol and ethanol are presented. Parent ions Cp 2 Fe + were produced by vacuumultraviolett (VUV) photoionization of neutral ferrocene using synchrotron radiation, and selected in internal energy by threshold photoelectron-photoion coincidences. The apparatus is divided into three differentially pumped regions: the source, the reaction and the detection zones. In source, state-selected parent ions are formed and can be selected in mass by a first quadrupole filter. State-selected ions are then injected in the second zone which is a RF octopole ion guide where reaction product ions are mass analyzed by a second quadrupole filter and detected by microchannelplates. In addition, the long flight time in the octopoles (several hundreds of microseconds) allows studying long-lived metastable ions. Total mass spectra were recorded at different photon energies, in addition to the main CpFe + and Fe + fragments, several minor fragments were detected such as C 10 H 10 + which reflects the formation of a C-C bond between the two Cp ligands. Losses of CH 3 , C 2 H 2 and C-4H 4 also indicate that important structure rearrangements take place before cleavage. The appearance energies of each mass-selected fragment ion were measured by recording fragment ion yields as a function of photon energy. Surprisingly, all fragments were found to have the same energy onset, i.e. 13.2 eV photon energy, except for C 3 H 3 Fe + (m/z 95). For Fe + ions, a sharp increase was observed at 17 eV, above the thermochemical onset of Fe + + 2 Cp. The 13.2 eV appearance energy of Fe + is thus assigned to the formation of Fe - + C 10 H 10 . The reactivity of ferrocenium ion with methanol and ethanol was investigated as a function of photon energy. While no reaction occurs at lower photon energies, several reaction products appear at 13.0 e

  12. T-cell mean telomere lengths changes in treatment naïve HIV-infected patients randomized to G-CSF or placebo simultaneously with initiation of HAART

    DEFF Research Database (Denmark)

    Aladdin, H; Von Essen, M; Schjerling, P

    2001-01-01

    The effect of highly active antiretroviral therapy (HAART) and granulocyte colony stimulating factor (G-CSF) on mean telomere restriction fragment (TRF) length of peripheral blood mononuclear cells (PBMC) was examined in 11 treatment naïve human immunodeficiency virus (HIV)-infected individuals...... with a CD4+ T-cell count CSF thrice weekly for 12 weeks (n = 6) or placebo (n = 5). An increase in the mean TRF lengths was observed in PBMC of patients on HAART after 24 weeks of treatment mainly owing to increased mean CD8+ T-cell TRF...... lengths. However, in the group of patients on HAART combined with G-CSF no changes of PBMC mean TRF length was observed during treatment or during 12 weeks of follow-up. The mean CD4+ T-cell TRF length did not change in any of the two groups. These results confirm that HAART induces mainly the lengthening...

  13. Comparison among three methods for mycobacteria identification Comparación entre tres métodos para identificar micobacterias

    OpenAIRE

    Misael Mondragón-Barreto; Carlos A. Vázquez-Chacón; Candelaria Barrón-Rivero; Patricia Acosta-Blanco; Kenneth C. Jost Jr; Susana Balandrano; Hiram Olivera-Díaz

    2000-01-01

    OBJECTIVE: To compare three methods: Biochemical tests, high-performance liquid chromatography (HPLC) and polymerase chain reaction-restriction fragments length polymorphism (PCR-RFLP), for the identification of mycobacteria, and to perform a cost-benefit analysis to define an optimum identification algorithm. MATERIAL AND METHODS: One-hundred-and-seven mycobacteria isolates were identified by the three methods at Instituto de Diagnóstico y Referencia Epidemiológicos, between February of 1999...

  14. Optimal decision procedures for satisfiability in fragments of alternating-time temporal logics

    DEFF Research Database (Denmark)

    Goranko, Valentin; Vester, Steen

    2014-01-01

    We consider several natural fragments of the alternating-time temporal logics ATL*and ATL with restrictions on the nesting between temporal operators and strate-gicquantifiers. We develop optimal decision procedures for satisfiability in these fragments, showing that they have much lower complexi...

  15. Sex Determination from Fragmented and Degenerated DNA by Amplified Product-Length Polymorphism Bidirectional SNP Analysis of Amelogenin and SRY Genes

    Science.gov (United States)

    Masuyama, Kotoka; Shojo, Hideki; Nakanishi, Hiroaki; Inokuchi, Shota; Adachi, Noboru

    2017-01-01

    Sex determination is important in archeology and anthropology for the study of past societies, cultures, and human activities. Sex determination is also one of the most important components of individual identification in criminal investigations. We developed a new method of sex determination by detecting a single-nucleotide polymorphism in the amelogenin gene using amplified product-length polymorphisms in combination with sex-determining region Y analysis. We particularly focused on the most common types of postmortem DNA damage in ancient and forensic samples: fragmentation and nucleotide modification resulting from deamination. Amplicon size was designed to be less than 60 bp to make the method more useful for analyzing degraded DNA samples. All DNA samples collected from eight Japanese individuals (four male, four female) were evaluated correctly using our method. The detection limit for accurate sex determination was determined to be 20 pg of DNA. We compared our new method with commercial short tandem repeat analysis kits using DNA samples artificially fragmented by ultraviolet irradiation. Our novel method was the most robust for highly fragmented DNA samples. To deal with allelic dropout resulting from deamination, we adopted “bidirectional analysis,” which analyzed samples from both sense and antisense strands. This new method was applied to 14 Jomon individuals (3500-year-old bone samples) whose sex had been identified morphologically. We could correctly identify the sex of 11 out of 14 individuals. These results show that our method is reliable for the sex determination of highly degenerated samples. PMID:28052096

  16. Genetic variation among isolates of Sarcocystis neurona, the agent of protozoal myeloencephalitis, as revealed by amplified fragment length polymorphism markers.

    Science.gov (United States)

    Elsheikha, H M; Schott, H C; Mansfield, L S

    2006-06-01

    Sarcocystis neurona causes serious neurological disease in horses and other vertebrates in the Americas. Based on epidemiological data, this parasite has recently emerged. Here, the genetic diversity of Sarcocystis neurona was evaluated using the amplified fragment length polymorphism (AFLP) method. Fifteen S. neurona taxa from different regions collected over the last 10 years were used; six isolates were from clinically diseased horses, eight isolates were from wild-caught opossums (Didelphis virginiana), and one isolate was from a cowbird (Molothrus ater). Additionally, four outgroup taxa were also fingerprinted. Nine primer pairs were used to generate AFLP patterns, with a total number of amplified fragments ranging from 30 to 60, depending on the isolate and primers tested. Based on the presence/absence of amplified AFLP fragments and pairwise similarity values, all the S. neurona isolates tested were clustered in one monophyletic group. No significant correlation could be found between genomic similarity and host origin of the S. neurona isolates. AFLP revealed significant intraspecific genetic variations, and S. neurona appeared as a highly variable species. Furthermore, linkage disequilibrium analysis suggested that S. neurona populations within Michigan have an intermediate type of population structure that includes characteristics of both clonal and panamictic population structures. AFLP is a reliable molecular technique that has provided one of the most informative approaches to ascertain phylogenetic relationships in S. neurona and its closest relatives, allowing them to be clustered by relative similarity using band matching and unweighted pair group method with arithmetic mean analysis, which may be applicable to other related protozoal species.

  17. Restriction map of the single-stranded DNA genome of Kilham rat virus strain 171, a nondefective parvovirus

    International Nuclear Information System (INIS)

    Banerjee, P.T.; Rathrock, R.; Mitra, S.

    1981-01-01

    A physical map of Kilham rat virus strain 171 DNA was constructed by analyzing the sizes and locations of restriction endonuclease-generated fragments of the replicative-form viral DNA synthesized in vitro. BglI, KpnI, BamHI, SmaI, XhoI, and XorII did not appear to have any cleavage sites, whereas 11 other enzymes cleaved the genome at one to eight sites, and AluI generated more than 12 distinct fragments. The 30 restriction sites that were mapped were distributed randomly in the viral genome. A comparison of the restriction fragments of in vivo- and in vitro-replicated replicative-form DNAs showed that these DNAs were identical except in the size or configuration of the terminal fragments

  18. Quantifying Interfacial pH Variation at Molecular Length Scales Using a Concurrent Non-Faradaic Reaction.

    Science.gov (United States)

    Ryu, Jaeyune; Wuttig, Anna; Surendranath, Yogesh

    2018-05-15

    We quantify changes in the interfacial pH local to the electrochemical double layer during electrocatalysis, using a concurrent non-faradaic probe reaction. In the absence of electrocatalysis, nanostructured Pt/C surfaces mediate the reaction of H2 with cis-2-butene-1,4-diol to form a mixture of 1,4-butanediol and n-butanol with a selectivity that is linearly dependent on the bulk solution pH. We show that kinetic branching occurs from a common surface-bound intermediate, ensuring that this probe reaction is uniquely sensitive to the interfacial pH within molecular length scales of the surface. We use the pH-dependent selectivity of this reaction to track changes in interfacial pH during concurrent hydrogen oxidation electrocatalysis and find that the local pH can vary dramatically, > 3 units, relative to the bulk value even at modest current densities in well-buffered electrolytes. This work highlights the key role that interfacial pH variation plays in modulating inner-sphere electrocatalysis. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Physics of projectile fragments

    International Nuclear Information System (INIS)

    Minamisono, Tadanori

    1982-01-01

    This is a study report on the polarization phenomena of the projectile fragments produced by heavy ion reactions, and the beta decay of fragments. The experimental project by using heavy ions with the energy from 50 MeV/amu to 250 MeV/amu was designed. Construction of an angle-dispersion spectrograph for projectile fragments was proposed. This is a two-stage spectrograph. The first stage is a QQDQQ type separator, and the second stage is QDQD type. Estimation shows that Co-66 may be separated from the nuclei with mass of 65 and 67. The orientation of fragments can be measured by detecting beta-ray. The apparatus consists of a uniform field magnet, an energy absorber, a stopper, a RF coil and a beta-ray hodoscope. This system can be used for not only this purpose but also for the measurement of hyperfine structure. (Kato, T.)

  20. Protein-Templated Fragment Ligations-From Molecular Recognition to Drug Discovery.

    Science.gov (United States)

    Jaegle, Mike; Wong, Ee Lin; Tauber, Carolin; Nawrotzky, Eric; Arkona, Christoph; Rademann, Jörg

    2017-06-19

    Protein-templated fragment ligation is a novel concept to support drug discovery and can help to improve the efficacy of protein ligands. Protein-templated fragment ligations are chemical reactions between small molecules ("fragments") utilizing a protein's surface as a reaction vessel to catalyze the formation of a protein ligand with increased binding affinity. The approach exploits the molecular recognition of reactive small-molecule fragments by proteins both for ligand assembly and for the identification of bioactive fragment combinations. In this way, chemical synthesis and bioassay are integrated in one single step. This Review discusses the biophysical basis of reversible and irreversible fragment ligations and gives an overview of the available methods to detect protein-templated ligation products. The chemical scope and recent applications as well as future potential of the concept in drug discovery are reviewed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Polymerase chain reaction-based method for the identification of Leishmania (Viannia) braziliensis and Leishmania (Viannia) guyanensis in mucosal tissues conserved in paraffin.

    Science.gov (United States)

    Prestes, Suzane Ribeiro; Guerra, Jorge Augusto de Oliveira; Romero, Gustavo Adolfo Sierra; Magalhaes, Laylah Kelre Costa; Santana, Rosa Amelia Gonçalves; Maciel, Marcel Gonçalves; Custódio, Ana; Barbosa, Maria das Graças Vale; Silveira, Henrique

    2015-01-01

    In the Americas, mucosal leishmaniasis is primarily associated with infection by Leishmania (Viannia) braziliensis. However, Leishmania (Viannia) guyanensis is another important cause of this disease in the Brazilian Amazon. In this study, we aimed at detecting Leishmaniadeoxyribonucleic acid (DNA) within paraffin-embedded fragments of mucosal tissues, and characterizing the infecting parasite species. We evaluated samples collected from 114 patients treated at a reference center in the Brazilian Amazon by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analyses. Direct examination of biopsy imprints detected parasites in 10 of the 114 samples, while evaluation of hematoxylin and eosin-stained slides detected amastigotes in an additional 17 samples. Meanwhile, 31/114 samples (27.2%) were positive for Leishmania spp. kinetoplast deoxyribonucleic acid (kDNA) by PCR analysis. Of these, 17 (54.8%) yielded amplification of the mini-exon PCR target, thereby allowing for PCR-RFLP-based identification. Six of the samples were identified as L. (V.) braziliensis, while the remaining 11 were identified as L. (V.) guyanensis. The results of this study demonstrate the feasibility of applying molecular techniques for the diagnosis of human parasites within paraffin-embedded tissues. Moreover, our findings confirm that L. (V.) guyanensisis a relevant causative agent of mucosal leishmaniasis in the Brazilian Amazon.

  2. Accommodating error analysis in comparison and clustering of molecular fingerprints.

    OpenAIRE

    Salamon, H.; Segal, M. R.; Ponce de Leon, A.; Small, P. M.

    1998-01-01

    Molecular epidemiologic studies of infectious diseases rely on pathogen genotype comparisons, which usually yield patterns comprising sets of DNA fragments (DNA fingerprints). We use a highly developed genotyping system, IS6110-based restriction fragment length polymorphism analysis of Mycobacterium tuberculosis, to develop a computational method that automates comparison of large numbers of fingerprints. Because error in fragment length measurements is proportional to fragment length and is ...

  3. Chemical Production using Fission Fragments

    International Nuclear Information System (INIS)

    Dawson, J. K.; Moseley, F.

    1960-01-01

    Some reactor design considerations of the use of fission recoil fragment energy for the production of chemicals of industrial importance have been discussed previously in a paper given at the Second United Nations International Conference on the Peaceful Uses of Atomic Energy [A/Conf. 15/P.76]. The present paper summarizes more recent progress made on this topic at AERE, Harwell. The range-energy relationship for fission fragments is discussed in the context of the choice of fuel system for a chemical production reactor, and the experimental observation of a variation of chemical effect along the length of a fission fragment track is described for the irradiation of nitrogen-oxygen mixtures. Recent results are given on the effect of fission fragments on carbon monoxide-hydrogen gas mixtures and on water vapour. No system investigated to date shows any outstanding promise for large-scale chemical production. (author) [fr

  4. Tumour necrosis factor-α polymorphism as one of the complex inherited factors in pemphigus

    Directory of Open Access Journals (Sweden)

    Jolanta Dorota Torzecka

    2003-01-01

    Full Text Available The aim of our study was to analyse a significance of tumour necrosis factor (TNF-α promoter gene polymorphisms in relation to the HLA-DR locus in genetic predisposition to pemphigus. TNF-α gene polymorphisms in position -238 and -308 were identified using a modified polymerase chain reaction-restriction fragment length polymorphism method in 53 patients with pemphigus (38 with pemphigus vulgaris, 15 with pemphigus foliaceus and 87 healthy controls. The HLA-DRB1 locus was typed using the polymerase chain reaction SSO method in all the patients and 152 population controls.

  5. Nuclear fragmentation and the number of particle tracks in tissue

    International Nuclear Information System (INIS)

    Ponomarev, A. L.; Cucinotta, F. A.

    2006-01-01

    For high energy nuclei, the number of particle tracks per cell is modified by local nuclear reactions that occur, with large fluctuations expected for heavy ion tracks. Cells near the interaction site of a reaction will experience a much higher number of tracks than estimated by the average fluence. Two types of reaction products are possible and occur in coincidence; projectile fragments, which generally have smaller charge and similar velocity to that of the projectile, and target fragments, which are produced from the fragmentation of the nuclei of water atoms or other cellular constituents with low velocity. In order to understand the role of fragmentation in biological damage a new model of human tissue irradiated by heavy ions was developed. A box of the tissue is modelled with periodic boundary conditions imposed, which extrapolates the technique to macroscopic volumes of tissue. The cross sections for projectile and target fragmentation products are taken from the quantum multiple scattering fragmentation code previously developed at NASA Johnson Space Center. Statistics of fragmentation pathways occurring in a cell monolayer, as well as in a small volume of 10 x 10 x 10 cells are given. A discussion on approaches to extend the model to describe spatial distributions of inactivated or other cell damage types, as well as highly organised tissues of multiple cell types, is presented. (authors)

  6. Random Tagging Genotyping by Sequencing (rtGBS, an Unbiased Approach to Locate Restriction Enzyme Sites across the Target Genome.

    Directory of Open Access Journals (Sweden)

    Elena Hilario

    Full Text Available Genotyping by sequencing (GBS is a restriction enzyme based targeted approach developed to reduce the genome complexity and discover genetic markers when a priori sequence information is unavailable. Sufficient coverage at each locus is essential to distinguish heterozygous from homozygous sites accurately. The number of GBS samples able to be pooled in one sequencing lane is limited by the number of restriction sites present in the genome and the read depth required at each site per sample for accurate calling of single-nucleotide polymorphisms. Loci bias was observed using a slight modification of the Elshire et al.some restriction enzyme sites were represented in higher proportions while others were poorly represented or absent. This bias could be due to the quality of genomic DNA, the endonuclease and ligase reaction efficiency, the distance between restriction sites, the preferential amplification of small library restriction fragments, or bias towards cluster formation of small amplicons during the sequencing process. To overcome these issues, we have developed a GBS method based on randomly tagging genomic DNA (rtGBS. By randomly landing on the genome, we can, with less bias, find restriction sites that are far apart, and undetected by the standard GBS (stdGBS method. The study comprises two types of biological replicates: six different kiwifruit plants and two independent DNA extractions per plant; and three types of technical replicates: four samples of each DNA extraction, stdGBS vs. rtGBS methods, and two independent library amplifications, each sequenced in separate lanes. A statistically significant unbiased distribution of restriction fragment size by rtGBS showed that this method targeted 49% (39,145 of BamH I sites shared with the reference genome, compared to only 14% (11,513 by stdGBS.

  7. Observation of high seasonal variation in community structure of denitrifying bacteria in arable soil receiving artificial fertilizer and cattle manure by determining T-RFLP of nir gene fragments

    DEFF Research Database (Denmark)

    Priemé, Anders; Wolsing, Martin

    2004-01-01

    Temporal and spatial variation of communities of soil denitrifying bacteria at sites receiving mineral fertilizer (60 and 120 kg N ha-1 year-1) and cattle manure (75 and 150 kg N ha-1 year-1) were explored using terminal restriction fragment length polymorphism (T-RFLP) analyses of PCR amplified...... nitrite reductase (nirK and nirS) gene fragments. The analyses were done three times during the year: in March, July and October. nirK gene fragments could be amplified in all three months, whereas nirS gene fragments could be amplified only in March. Analysis of similarities in T-RFLP patterns revealed...... a significant seasonal shift in the community structure of nirK-containing bacteria. Also, sites treated with mineral fertilizer or cattle manure showed different communities of nirK-containing denitrifying bacteria, since the T-RFLP patterns of soils treated with these fertilizers were significantly different...

  8. Fragmentation of Ceramics in Rapid Expansion Mode

    Science.gov (United States)

    Maiti, Spandan; Geubelle, Philippe H.; Rangaswamy, Krishnan

    The study of the fragmentation process goes back to more than a century, motivated primarily by problems related to mining and ore handling (Grady and Kipp, 1985). Various theories have been proposed to predict the fragmentation stress and the fragment size and distribution. But the investigations are generally case specific and relate to only a narrow set of fragmentation processes. A number of theoretical studies of dynamic fragmentation in a rapidly expanding body can be found in the literature. For example, the study summarized in (Grady, 1982) presents a model based on a simple energy balance concept between the surface energy released due to fracture and the kinetic energy of the fragments. Subsequent refinements of the energy balance model have been proposed by (Glenn and Chudnovsky, 1986), which take into account the strain energy of the fragments and specify a threshold stress below which no fragmentation occurs. These models assume that the fracture events are instantaneous and occur simultaneously. Evidently, these assumptions are quite restrictive and these models can not take into account the transient nature of the fragmentation process after the onset of fracture in the material. A more recent model proposed by (Miller et al., 1999) however takes into account this time-dependent nature of the fragmentation event and the distribution of flaws of various strengths in the original material.

  9. Amplified Fragment Length Polymorphism Fingerprinting for Identification of a Core Group of Neisseria gonorrhoeae Transmitters in the Population Attending a Clinic for Treatment of Sexually Transmitted Diseases in Amsterdam, The Netherlands

    OpenAIRE

    Spaargaren, Joke; Stoof, Jeroen; Fennema, Han; Coutinho, Roel; Savelkoul, Paul

    2001-01-01

    Amplified fragment length polymorphism analysis seems well suited for studying the epidemiology of isolates of Neisseria gonorrhoeae obtained from patients attending the Sexually Transmitted Disease Outpatient Clinic in Amsterdam, The Netherlands. It shows potential to identify the core group of transmitters.

  10. Effect of fragmentation on the Costa Rican dry forest avifauna

    OpenAIRE

    Barrantes, Gilbert; Ocampo, Diego; Ram?rez-Fern?ndez, Jos? D.; Fuchs, Eric J.

    2016-01-01

    Deforestation and changes in land use have reduced the tropical dry forest to isolated forest patches in northwestern Costa Rica. We examined the effect of patch area and length of the dry season on nestedness of the entire avian community, forest fragment assemblages, and species occupancy across fragments for the entire native avifauna, and for a subset of forest dependent species. Species richness was independent of both fragment area and distance between fragments. Similarity in bird comm...

  11. Two mutant alleles of the human cytochrome P-450dbl gene (P450C2D1) associated with genetically deficient metabolism of debrisoquine and other drugs

    International Nuclear Information System (INIS)

    Skoda, R.C.; Gonzalez, F.L.; Demierre, A.; Meyer, R.A.

    1988-01-01

    The debrisoquine polymorphism is a clinically important genetic defect of drug metabolism affecting 5-10% of individuals in Caucasian populations. It is inherited as an autosomal recessive trait. A full-length cDNA for human cytochrome P-450db1, the deficient enzyme (also designated P450IID1 for P450 family II subfamily D isozyme 1), has recently been cloned. Leukocyte DNA from extensive metabolizers (EMs) or poor metabolizers (PMs) of debrisoquine was examined by Southern analysis. Two polymorphic restriction fragments were associated with the PM phenotype when DNAs from 24 unrelated PM and 29 unrelated EM individuals were probed with P-450db1 cDNA after digestion with Xba I restriction endonuclease and Southern blotting. Seventy-five percent of PMs had either the 44-kb or the 11.5-kb fragment or both. Segregation of these restriction fragment length polymorphisms in the families of six PM probands demonstrated that each of the two fragments is allelic with the 29-kb fragment present in all EM individuals and suggests that they identify two independent mutated alleles of the P-450db1 gene (designated P450C2D1). The Xba I 44-kb fragment and 11.5-kb fragment were in linkage disequilibrium with restriction fragment length polymorphisms generated by four and five additional restriction endonucleases, respectively, which can be used to identify the same mutant alleles for the P-450db1 gene

  12. PCR-based diagnosis, molecular characterization and detection of atypical strains of avian Chlamydia psittaci in companion and wild birds.

    Science.gov (United States)

    Madani, S A; Peighambari, S M

    2013-02-01

    Chlamydiosis is one of the most important infectious diseases of birds. In this study, 253 clinical samples were taken from 27 bird species belonging to seven orders. Thirty-two (12.6%) samples were positive for Chlamydia psittaci major outer membrane gene (ompA) DNA by a nested polymerase chain reaction (PCR). Twelve nested PCR-positive specimens were typed by ompA gene-based PCR-restricted fragment length polymorphism, using CTU/CTL primers and AluI restriction enzyme. Four restriction patterns were identified, including genotype A (two specimens from an African grey parrot [Psittacus erithacus] and a lorikeet [Trichoglossus haematodus]), genotype B (two specimens from a rock dove [Columbia livia] and a canary [Serinus canaria]), a third new restriction pattern (six specimens from African grey parrots), and a fourth new restriction pattern (two specimens from a ring-necked parakeet [Psittacula krameri] and an Alexandrine parakeet [Psittacula eupatria]). The third and the fourth restriction patterns are suggested to be provisional genotypes I and J, respectively. Partial sequencing of the ompA gene of seven specimens completely correlated with the results of PCR-restricted fragment length polymorphism and confirmed the presence of genotypes A and B and the two new provisional genotypes I and J. The two new genotypes have the closest identity with C. psittaci genotype F and Chlamydia abortus, respectively. From an evolutionary perspective, both new genotypes, particularly genotype J, are intermediate between the two species, C. psittaci and C. abortus.

  13. Current fragmentation in deep inelastic scattering

    International Nuclear Information System (INIS)

    Hamer, C.J.

    1975-04-01

    It is argued that the current fragmentation products in deep inelastic electron scattering will not be distributed in a 'one-dimensional' rapidity plateau as in the parton model picture of Feynman and Bjorken. A reaction mechanism with a multiperipheral topology, but which the above configuration might have been achieved, does not in fact populate the current fragmentation plateau; and unless partons are actually observed in the final state, it cannot lead to Bjorken scaling. The basic reason for this failure is shown to be the fact that when a particle is produced in the current fragmentation plateau, the adjacent momentum transfer in the multiperipheral chain becomes large and negative: such processes are inevitably suppressed. Instead, the current fragmentation products are likely to be generated by a fragmentation, or sequential decay process. (author)

  14. Genetic relationship among nine Rhododendron species in Qinling mountains, China using amplified fragment length polymorphism markers

    International Nuclear Information System (INIS)

    Zhao, B.; Zheng, X.Z.

    2015-01-01

    Genetic relationships of nine species of Rhododendron in the Qinling Mountains were evaluated using amplified fragment length polymorphism (AFLP) markers. A total of 440 amplification products were obtained using nine selected AFLP markers, of which 421 (95.40%) showed polymorphism. With these polymorphic products, a dendrogram was constructed using the unweighted pair-group method with arithmetic mean (UPGMA). R. calophytum, R. hypoglaucum and R. clementinae, belonging to Subgen Hymenanthes, gathered together, and the species derived from Subgen Rhododendron and Subgen Tsutsusi formed another two groups. R. tsinlingense, R. purdomii, R. Taibaiense and R. capitatum (Subsect. Lapponica), and R. concinnum (Subsect. Triflora) were clustered as one group, but they belong to difference subsect. and R. purdomii and R. Taibaiense showed the closest genetic distance, but both species differed greatly in morphological characteristics.These results showed that the genetic relationships among nine Rhododendron species, determined by AFLP markers, were partially related to their taxonomic position, geography distribution and morphological classification. The present study will benefit the identification and conservation of Rhododendron, and the development of new Rhododendron cultivar. (author)

  15. Development of a PCR-RFLP assay for the detection and differentiation of canine parvovirus and mink enteritis virus.

    Science.gov (United States)

    Zhang, Chuanmei; Yu, Yongle; Yang, Haiyan; Li, Guimei; Yu, Zekun; Zhang, Hongliang; Shan, Hu

    2014-12-15

    A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay has been developed to detect and differentiate between canine parvovirus (CPV) and mink enteritis virus (MEV). Eight CPV and three MEV epidemic strains isolated from 28 pathological samples from dogs and minks suspected of being infected with parvovirus were amplified by PCR using a pair of specific primers designed based on the CPV-N strain (M19296). PCR amplified a fragment of 1016bp from the genomic DNA of both MEV and CPV. The MEV-derived fragment could be digested with the restriction enzyme BSP1407I into three fragments of 102bp, 312bp and 602bp, while the fragment amplified from the CPV genomic DNA was digested into only two fragments of 414bp and 602bp. The lowest DNA concentration of CPV and MEV that could be detected using this assay was 0.004μg/ml and 0.03μg/ml, respectively. The PCR-RFLP assay developed in the present study can, therefore, be used to detect and differentiate MEV from CPV with high specificity and sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Gluon fragmentation in T(1S) decays

    International Nuclear Information System (INIS)

    Bienlein, J.K.

    1983-05-01

    In T(1S) decays most observables (sphericity, charged multiplicity, photonic energy fraction, inclusive spectra) can be understood assuming that gluons fragment like quarks. New results from LENA use the (axis-independent) Fox-Wolfram moments for the photonic energy deposition. Continuum reactions show 'standard' Field-Feynman fragmentation. T(1S) decays show a significant difference in the photonic energy topology. It is more isotropic than with the Field-Feynman fragmentation scheme. Gluon fragmentation into isoscalar mesons (a la Peterson and Walsh) is excluded. But if one forces the leading particle to be isoscalar, one gets good agreement with the data. (orig.)

  17. The angular momentum dependence of complex fragment emission

    International Nuclear Information System (INIS)

    Sobtka, L.G.; Sarantites, D.G.; Li, Z.

    1987-01-01

    Large fragment (A > 4) production at high angular momentum is studied via the reaction, 200 MeV 45 Sc + 65 Cu. Comparisons of the fragment yields from this reaction (high angular momentum) to those from 93 Nb + Be (low angular momentum) are used to verify the strong angular momentum dependence of large fragment production predicted by equilibrium models. Details of the coincident γ-ray distributions not only confirm a rigidly rotating intermediate but also indicate that the widths of the primary L-wave distributions decrease with increasing symmetry in the decay channel. These data are used to test the asymmetry and L-wave dependence of emission barriers calculated from a rotating, finite range corrected, liquid drop model. 21 refs., 10 figs

  18. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  19. Fragger: a protein fragment picker for structural queries.

    Science.gov (United States)

    Berenger, Francois; Simoncini, David; Voet, Arnout; Shrestha, Rojan; Zhang, Kam Y J

    2017-01-01

    Protein modeling and design activities often require querying the Protein Data Bank (PDB) with a structural fragment, possibly containing gaps. For some applications, it is preferable to work on a specific subset of the PDB or with unpublished structures. These requirements, along with specific user needs, motivated the creation of a new software to manage and query 3D protein fragments. Fragger is a protein fragment picker that allows protein fragment databases to be created and queried. All fragment lengths are supported and any set of PDB files can be used to create a database. Fragger can efficiently search a fragment database with a query fragment and a distance threshold. Matching fragments are ranked by distance to the query. The query fragment can have structural gaps and the allowed amino acid sequences matching a query can be constrained via a regular expression of one-letter amino acid codes. Fragger also incorporates a tool to compute the backbone RMSD of one versus many fragments in high throughput. Fragger should be useful for protein design, loop grafting and related structural bioinformatics tasks.

  20. Observation for really cold fragmentation of heavy nucleus

    International Nuclear Information System (INIS)

    Goverdovskij, A.A.; Ketlerov, V.V.; Mitrofanov, V.F.; Ostapenko, Yu.B.; Khryachkov, V.A.

    1998-01-01

    The results of the detailed study on mass-energy charged correlations of the thorium-232 fission fragments, produced by the 5 MeV neutrons are presented. The event of the thorium nucleus really cold fragmentation into tellurium-134 and strontium-99 at the basic quantum states is identified. It is shown that the whole reaction energy is exhausted by the motion kinetic energy of the fragments in the mutual field

  1. Treatment of PCR products with exonuclease I and heat-labile alkaline phosphatase improves the visibility of combined bisulfite restriction analysis

    International Nuclear Information System (INIS)

    Watanabe, Kousuke; Emoto, Noriko; Sunohara, Mitsuhiro; Kawakami, Masanori; Kage, Hidenori; Nagase, Takahide; Ohishi, Nobuya; Takai, Daiya

    2010-01-01

    Research highlights: → Incubating PCR products at a high temperature causes smears in gel electrophoresis. → Smears interfere with the interpretation of methylation analysis using COBRA. → Treatment with exonuclease I and heat-labile alkaline phosphatase eliminates smears. → The elimination of smears improves the visibility of COBRA. -- Abstract: DNA methylation plays a vital role in the regulation of gene expression. Abnormal promoter hypermethylation is an important mechanism of inactivating tumor suppressor genes in human cancers. Combined bisulfite restriction analysis (COBRA) is a widely used method for identifying the DNA methylation of specific CpG sites. Here, we report that exonuclease I and heat-labile alkaline phosphatase can be used for PCR purification for COBRA, improving the visibility of gel electrophoresis after restriction digestion. This improvement is observed when restriction digestion is performed at a high temperature, such as 60 o C or 65 o C, with BstUI and TaqI, respectively. This simple method can be applied instead of DNA purification using spin columns or phenol/chloroform extraction. It can also be applied to other situations when PCR products are digested by thermophile-derived restriction enzymes, such as PCR restriction fragment length polymorphism (RFLP) analysis.

  2. Feasibility of Traveling Wave Direct Energy Conversion of Fission Reaction Fragments

    Science.gov (United States)

    Tarditi, A. G.; George, J. A.; Miley, G. H.; Scott, J. H.

    2013-01-01

    Fission fragment direct energy conversion has been considered in the past for the purpose of increasing nuclear power plant efficiency and for advanced space propulsion. Since the fragments carry electric charge (typically in the order of 20 e) and have 100 MeV-range kinetic energy, techniques utilizing very high-voltage DC electrodes have been considered. This study is focused on a different approach: the kinetic energy of the charged fission fragments is converted into alternating current by means of a traveling wave coupling scheme (Traveling Wave Direct Energy Converter, TWDEC), thereby not requiring the utilization of high voltage technology. A preliminary feasibility analysis of the concept is introduced based on a conceptual level study and on a particle simulation model of the beam dynamics.

  3. Identification and characterization of some aromatic rice mutants using amplified fragment length polymorphism (AFLP) technique

    International Nuclear Information System (INIS)

    Fahmy, E.M.; Sobieh, S. E. S.; Ayaad, M. H.; El-Gohary, A. A.; Rownak, A.

    2012-12-01

    Accurate identifying of the genotypes is considered one of the most important mechanisms used in the recording or the protection of plant varieties. The investigation was conducted at the experimental form belonging to the egyptian Atomic Energy Authority, Inshas. The aim was to evaluate grain quality characteristics and molecular genetic variation using Amplified Fragment Length Polymorphism (AFLP) technique among six rice genotypes, Egyptian Jasmine aromatic rice cultivar and five aromatic rice mutants in (M3 mutagenic generation). Two mutation (Egy22 and Egy24) were selected from irradiated Sakha 102 population with 200 and 400Gy of gamma rays in the M2 generation, respectively, and three mutations ( Egy32, Egy33, and Egy34) were selected from irradiated Sakha 103 population with 200, 300, 400Gy of gamma rays in the M2 generation, respectively. The obtained results showed that the strong aroma was obtained for mutant Egy22 as compared with Egyptian Jasmine rice cultivar (moderate aroma). Seven primer combinations were used through six rice genotypes on the molecular level using AFLP marker. The size of AFLP Fragments Were Ranged from 51- 494bp. The total number of amplified bands was 997 band among them 919 polymorphic bans representing 92.2%. The highest similarity index (89%) was observed between Egyptian Jasmine and Egy32 followed by (82%) observed between Egyptian Jasmine and Egy34. On the other hand, the lowest similarity index was (48%) between Egyptian Jasmine and Egy24. In six rice genotypes, Egy24 produced the highest number of the AFLP makers giving 49 unique markers (23 positive and 26 negative), then Egy22 showed 23 unique markers (27 positive and 6 negative) while Egy33 was characterized by 17 unique markers (12 positive and 5 negative). At last Egyptian Jasmine was discriminated by the lowest number of markets, 10 (6 positive and 4 negative). The study further confirmed that AFLP technique was able to differentiate rice genotypes by a higher number

  4. Estimation of the reaction efficiency in polymerase chain reaction

    NARCIS (Netherlands)

    Lalam, N.

    2006-01-01

    Polymerase chain reaction (PCR) is largely used in molecular biology for increasing the copy number of a specific DNA fragment. The succession of 20 replication cycles makes it possible to multiply the quantity of the fragment of interest by a factor of 1 million. The PCR technique has

  5. Fragmentation of the projectile near the Fermi energy

    International Nuclear Information System (INIS)

    Dayras, R.

    1986-05-01

    The experimental data about projectile fragmentation around the Fermi energy are reviewed. Comparisons with low and high energy data suggest that this energy domain is indeed a transition region. Reaction mechanisms dominated by the mean field at low energy progressively give way to individual n-n collisions. In the present case, this transition manifests itself by a rapid decrease of transfer reactions for the benefit of fragmentation processes. A coherent description of the observed results requires to take into account mean field effects as well as individual n-n collisions

  6. Attosecond-recollision-controlled selective fragmentation of polyatomic molecules.

    Science.gov (United States)

    Xie, Xinhua; Doblhoff-Dier, Katharina; Roither, Stefan; Schöffler, Markus S; Kartashov, Daniil; Xu, Huailiang; Rathje, Tim; Paulus, Gerhard G; Baltuška, Andrius; Gräfe, Stefanie; Kitzler, Markus

    2012-12-14

    Control over various fragmentation reactions of a series of polyatomic molecules (acetylene, ethylene, 1,3-butadiene) by the optical waveform of intense few-cycle laser pulses is demonstrated experimentally. We show both experimentally and theoretically that the responsible mechanism is inelastic ionization from inner-valence molecular orbitals by recolliding electron wave packets, whose recollision energy in few-cycle ionizing laser pulses strongly depends on the optical waveform. Our work demonstrates an efficient and selective way of predetermining fragmentation and isomerization reactions in polyatomic molecules on subfemtosecond time scales.

  7. (PCR) for direct cloning of blunt-end DNA fragments

    African Journals Online (AJOL)

    Administrator

    2011-09-19

    Sep 19, 2011 ... Key words: Blunt-end cloning, phosphorylated DNA fragment, dephosphorylated blunt-end vector. INTRODUCTION ... With this method, a lot of steps are saved, which includes restriction .... pBSK-blunt (data not shown).

  8. Fragmentation of a 500 MeV/nucleon 86Kr beam, investigated at the GSI projectile fragment separator

    International Nuclear Information System (INIS)

    Weber, M.; Donzaud, C.; Geissel, H.; Grewe, A.; Lewitowicz, M.; Magel, A.; Mueller, A.C.; Nickel, F.; Pfuetzner, M.; Piechaczek, A.; Pravikoff, M.; Roeckl, E.; Rykaczewski, K.; Saint-Laurent, M.G.; Schall, I.; Stephan, C.; Tassan-Got, L.; Voss, B.

    1993-10-01

    Production cross-sections and longitudinal momentum distributions have been investigated for reactions between a 500 MeV/nucleon 86 Kr beam and beryllium, copper and tantalum targets. Fragments in a wide A/Z range were studied at the projectile-fragment separator FRS at GSI. The experimental production cross-sections have been used for testing the predictions obtained from a semi-empirical parameterization, a statistical abrasion model and an intranuclear-cascade model. The present study allows to extrapolate the production cross-sections towards very neutron-rich isotopes such as the doubly magic nucleus 78 Ni. For fragments close to the projectile the measured longitudinal momentum distributions agrees qualitatively with a semi-empirical parameterization, which is based on the two-step picture of the fragmentation process. The momentum widths of lighter fragments, however, show deviations from this simple picture. (orig.)

  9. Inclusive projectile fragmentation in the spectator model

    International Nuclear Information System (INIS)

    Hussein, M.S.; McVoy, K.W.

    1985-01-01

    Crazing-angle single spectra for projectile fragments from nuclear collisions exhibit a broad peak centered near the beam velocity, suggesting that these observed fragments play only a 'spectator' role in the reaction. Using only this spectator assumption (but not DWBA), it is found that a 'prior form' formulation of the reaction leads, via closure, to a -type estimate of the inclusive spectator spectrum, thus relating it to the reaction cross section for the 'participant' with the target. It is shown explicitly that this expression includes an improved multi-channel version of the Udagawa-Tamura formula for the 'breakup-fusion' or incomplete fusion cross section, and identifies it as the fluctuation part of the participant-target reaction cross section. A Glauber-type estimate of the distorted wave functions which enter clearly shows how the width of the peak in the spectator spectrum arises from the 'Fermi motion' within the projectile, as in the simple Serber model, but is modified by the 'overlap geometry' of the collision. (Author) [pt

  10. Projectile fragmentation processes in 35-MeV/amu (α,xy) reactions

    International Nuclear Information System (INIS)

    Koontz, R.W.; Chang, C.C.; Holmgren, H.D.; Wu, J.R.

    1979-01-01

    Coincidence measurements with 35-MeV/amu α particles show that at least three projectile-fragmentation processes occur. The dominant process is ''absorptive'' breakup, where one component of the projectile interacts strongly with the target resulting in the emission of evaporation or nonstatistical particles while the other component behaves as a spectator. The other fragmentation processes which are observed account for only a few percent of the breakup cross section

  11. Study of fragmentation cross-sections for 12C+12C reaction at 95 MeV/u and 400 MeV/u for hadron-therapy

    International Nuclear Information System (INIS)

    Juliani, Didier

    2013-01-01

    The hadron-therapy is a radiotherapy method using ions (carbon ions here) instead of the more conventional X-rays for cancer treatment. Deep radioresistant tumour areas, as brain carcinoma for example, can be treated thanks to the specific dose deposition at the end of the ion path. This is an additional method to older classic ones (surgery, X-rays, chemotherapy). Two hadron-therapy centres for treatment and research are planned in France from 2018 (ARCHADE) in order to benefit from the newest progress and to keep improving this method. Carbon ions energy loss in the matter follows the Bethe-Bloch law. The maximum of energy depth is located in a limited area called 'Bragg peak'. By adjusting the beam position and energy, the whole volume of the tumor can be irradiated. Nevertheless, nuclear reactions of carbon ion in tissues generate the production of lighter fragments (H, He, Li etc.) that deposit their energy beyond the Bragg peak. Models implemented in hadron-therapy simulation codes (FLUKA, GEANT4 etc.) cannot reproduce angular distributions of the lighter fragments and energy distributions at the same time. These poor estimations affect the treatment planning systems accuracy that are clinically used. Indeed, a bad estimation of fragmentation process induces a bias in the dose calculation concerning healthy cells beyond the Bragg peak. In order to better constraint models, two experiments based on fragmentation cross-sections measurements have been performed. The first one in may 2011 with a beam at 95 MeV/u (GANIL) in collaboration with the LPC Caen and the second one in august 2011 with a beam at 400 MeV/u (GSI) with the FIRST collaboration. E600 experiment is devoted to the study of carbon ions fragmentation at 95 MeV/u in several thin targets (Au, C, , Ti etc.) corresponding to the basic building blocks of human body. Five telescopes are designed for the fragments detection. Each one is a three-stage detector (2 silicon detectors and one CsI scintillator

  12. MCNP6 Simulation of Light and Medium Nuclei Fragmentation at Intermediate Energies

    Energy Technology Data Exchange (ETDEWEB)

    Mashnik, Stepan Georgievich [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kerby, Leslie Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Univ. of Idaho, Moscow, ID (United States)

    2015-08-24

    Fragmentation reactions induced on light and medium nuclei by protons and light nuclei of energies around 1 GeV/nucleon and below are studied with the Los Alamos transport code MCNP6 and with its CEM03.03 and LAQGSM03.03 event generators. CEM and LAQGSM assume that intermediate-energy fragmentation reactions on light nuclei occur generally in two stages. The first stage is the intranuclear cascade (INC), followed by the second, Fermi breakup disintegration of light excited residual nuclei produced after the INC. CEM and LAQGSM account also for coalescence of light fragments (complex particles) up to sup>4He from energetic nucleons emitted during INC. We investigate the validity and performance of MCNP6, CEM, and LAQGSM in simulating fragmentation reactions at intermediate energies and discuss possible ways of further improving these codes.

  13. Fluorescence-labeled methylation-sensitive amplified fragment length polymorphism (FL-MS-AFLP) analysis for quantitative determination of DNA methylation and demethylation status.

    Science.gov (United States)

    Kageyama, Shinji; Shinmura, Kazuya; Yamamoto, Hiroko; Goto, Masanori; Suzuki, Koichi; Tanioka, Fumihiko; Tsuneyoshi, Toshihiro; Sugimura, Haruhiko

    2008-04-01

    The PCR-based DNA fingerprinting method called the methylation-sensitive amplified fragment length polymorphism (MS-AFLP) analysis is used for genome-wide scanning of methylation status. In this study, we developed a method of fluorescence-labeled MS-AFLP (FL-MS-AFLP) analysis by applying a fluorescence-labeled primer and fluorescence-detecting electrophoresis apparatus to the existing method of MS-AFLP analysis. The FL-MS-AFLP analysis enables quantitative evaluation of more than 350 random CpG loci per run. It was shown to allow evaluation of the differences in methylation level of blood DNA of gastric cancer patients and evaluation of hypermethylation and hypomethylation in DNA from gastric cancer tissue in comparison with adjacent non-cancerous tissue.

  14. The extended sum-rule model view of light and intermediate mass fragment emission in nuclear reactions at intermediate energies

    International Nuclear Information System (INIS)

    Brancus, I.M.; Rebel, H.; Wentz, J.; Corcalciuc, V.

    1989-11-01

    The original sum-rule model worked out by Wilczynski et al. and successfully used for a global description of complete and incomplete fusion reactions has been extended by a term accounting for dissipative processes of the dinuclear system on its way to fusion. When applying to light and heavy ion collisions with various targets at energies in the transitional region, the new term proves to be rather essential for reproducing the element distributions of the fragments emitted from rather asymmetric systems. (orig.) [de

  15. FRAGSION: ultra-fast protein fragment library generation by IOHMM sampling.

    Science.gov (United States)

    Bhattacharya, Debswapna; Adhikari, Badri; Li, Jilong; Cheng, Jianlin

    2016-07-01

    Speed, accuracy and robustness of building protein fragment library have important implications in de novo protein structure prediction since fragment-based methods are one of the most successful approaches in template-free modeling (FM). Majority of the existing fragment detection methods rely on database-driven search strategies to identify candidate fragments, which are inherently time-consuming and often hinder the possibility to locate longer fragments due to the limited sizes of databases. Also, it is difficult to alleviate the effect of noisy sequence-based predicted features such as secondary structures on the quality of fragment. Here, we present FRAGSION, a database-free method to efficiently generate protein fragment library by sampling from an Input-Output Hidden Markov Model. FRAGSION offers some unique features compared to existing approaches in that it (i) is lightning-fast, consuming only few seconds of CPU time to generate fragment library for a protein of typical length (300 residues); (ii) can generate dynamic-size fragments of any length (even for the whole protein sequence) and (iii) offers ways to handle noise in predicted secondary structure during fragment sampling. On a FM dataset from the most recent Critical Assessment of Structure Prediction, we demonstrate that FGRAGSION provides advantages over the state-of-the-art fragment picking protocol of ROSETTA suite by speeding up computation by several orders of magnitude while achieving comparable performance in fragment quality. Source code and executable versions of FRAGSION for Linux and MacOS is freely available to non-commercial users at http://sysbio.rnet.missouri.edu/FRAGSION/ It is bundled with a manual and example data. chengji@missouri.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. Amplified fragment length polymorphism fingerprinting of Pseudomonas strains from a poultry processing plant.

    Science.gov (United States)

    Geornaras, I; Kunene, N F; von Holy, A; Hastings, J W

    1999-09-01

    Molecular typing has been used previously to identify and trace dissemination of pathogenic and spoilage bacteria associated with food processing. Amplified fragment length polymorphism (AFLP) is a novel DNA fingerprinting technique which is considered highly reproducible and has high discriminatory power. This technique was used to fingerprint 88 Pseudomonas fluorescens and Pseudomonas putida strains that were previously isolated from plate counts of carcasses at six processing stages and various equipment surfaces and environmental sources of a poultry abattoir. Clustering of the AFLP patterns revealed a high level of diversity among the strains. Six clusters (clusters I through VI) were delineated at an arbitrary Dice coefficient level of 0.65; clusters III (31 strains) and IV (28 strains) were the largest clusters. More than one-half (52.3%) of the strains obtained from carcass samples, which may have represented the resident carcass population, grouped together in cluster III. By contrast, 43.2% of the strains from most of the equipment surfaces and environmental sources grouped together in cluster IV. In most cases, the clusters in which carcass strains from processing stages grouped corresponded to the clusters in which strains from the associated equipment surfaces and/or environmental sources were found. This provided evidence that there was cross-contamination between carcasses and the abattoir environment at the DNA level. The AFLP data also showed that strains were being disseminated from the beginning to the end of the poultry processing operation, since many strains associated with carcasses at the packaging stage were members of the same clusters as strains obtained from carcasses after the defeathering stage.

  17. Quantum mechanical fragment methods based on partitioning atoms or partitioning coordinates.

    Science.gov (United States)

    Wang, Bo; Yang, Ke R; Xu, Xuefei; Isegawa, Miho; Leverentz, Hannah R; Truhlar, Donald G

    2014-09-16

    Conspectus The development of more efficient and more accurate ways to represent reactive potential energy surfaces is a requirement for extending the simulation of large systems to more complex systems, longer-time dynamical processes, and more complete statistical mechanical sampling. One way to treat large systems is by direct dynamics fragment methods. Another way is by fitting system-specific analytic potential energy functions with methods adapted to large systems. Here we consider both approaches. First we consider three fragment methods that allow a given monomer to appear in more than one fragment. The first two approaches are the electrostatically embedded many-body (EE-MB) expansion and the electrostatically embedded many-body expansion of the correlation energy (EE-MB-CE), which we have shown to yield quite accurate results even when one restricts the calculations to include only electrostatically embedded dimers. The third fragment method is the electrostatically embedded molecular tailoring approach (EE-MTA), which is more flexible than EE-MB and EE-MB-CE. We show that electrostatic embedding greatly improves the accuracy of these approaches compared with the original unembedded approaches. Quantum mechanical fragment methods share with combined quantum mechanical/molecular mechanical (QM/MM) methods the need to treat a quantum mechanical fragment in the presence of the rest of the system, which is especially challenging for those parts of the rest of the system that are close to the boundary of the quantum mechanical fragment. This is a delicate matter even for fragments that are not covalently bonded to the rest of the system, but it becomes even more difficult when the boundary of the quantum mechanical fragment cuts a bond. We have developed a suite of methods for more realistically treating interactions across such boundaries. These methods include redistributing and balancing the external partial atomic charges and the use of tuned fluorine

  18. Molecular identification of dermatophytosis by polymerase chain reaction (PCR and detection of source of infection by restricted fragment length polymorphism (RFLP

    Directory of Open Access Journals (Sweden)

    BK Jha

    2013-09-01

    Full Text Available Introduction Dermatophytes are responsible for most superficial fungal infections and the estimated lifetime risk of acquiring a dermatophyte infection is between 10-20%. These fungi are mainly classified in three major genera Microsporum, Trichophyton and Epidermophyton. Materials and Methods Clinically suspected 200 cases of dermatophyte infected patients from K. R. Hospital Mysore and Mission Hospital Mysore were included in this descriptive study from January 2011 to June 2012. All the culture positive smear- 10% Potassium Hydroxide (KOH and culture in different dermatophytic medium patients were confirmed by PCR and source of infection was detected (n=10 from PCR positive patients and (n=10 from their domestic animals by PCR-RFLP methods targeting 18S rDNA regions of fungi. Results Out of 200 clinically suspected cases KOH mount was positive in 143 (71.5% cases and culture was positive in 132(66% cases. The isolates belonged to three genera and eight species as T.mentagrophytes 52(39.4%, T.rubrum 30(22.7%, T.violacium 18(13.6%, T.verrucosum 11(8.3%, E.floccosum 10(7.6%, M.canis 6(4.5%, T.tonsurans 03(2.3% and T.schollenii 2(1.5%. To identify the source of infection 10 animals ,one each from the houses of 10 patients who were PCR positive were also subjected to PCR and RFLP. The animals and the patients were found to be infected by same organisms T.verrucosum .This indicates that T.verrucosum infection is from animal source. Conclusion Dermatophytic infections are more common infectious disease. Preliminary diagnosis of dermatophytosis can be done by KOH mount and culture, which takes longer time to report and cannot differentiate at the genus and species level. Results indicate that PCR-RFLP may be considered as gold standard for the diagnosis and confirmation of source of infection of dermatophytosis and can aid the clinician in initiating prompt and appropriate antifungal therapy. Journal of College of Medical Sciences-Nepal, 2012, Vol-8, No-4, 7-15 DOI: http://dx.doi.org/10.3126/jcmsn.v8i4.8694

  19. Hard processes and fragmentation in a unified model for interactions at ultra-relativistic energies; Les processus durs et la fragmentation dans un modele unifie pour les interactions aux energies ultra-relativistes

    Energy Technology Data Exchange (ETDEWEB)

    Drescher, H.J

    1999-06-11

    In this work we have developed hard processes and string fragmentation in the framework of interactions at relativistic energies. The hypothesis of the universality of high energy interactions means that many elements of heavy ion collisions can be studied and simulated in simpler nuclear reactions. In particular this hypothesis implies that the fragmentation observed in the reaction e{sup +}e{sup -} follows the same rules as in the collision of 2 lead ions. This work deals with 2 nuclear processes: the e{sup +}e{sup -} annihilation reaction and the deep inelastic diffusion. For the first process the string model has been developed to simulate fragmentation by adding an artificial breaking of string due to relativistic effects. A monte-Carlo method has been used to determine the points in a Minkowski space where this breaking occurs. For the second reaction, the theory of semi-hard pomerons is introduced in order to define elementary hadron-hadron interactions. The model of fragmentation proposed in this work can be applied to more complicated reactions such as proton-proton or ion-ion collisions.

  20. Fission Fragment Angular Distributions in the $^{234}$U(n,f) and $^{236}$U(n,f) reactions

    CERN Multimedia

    We propose to measure the fission fragment angular distribution (FFAD) of the $^{234}$U(n,f) and $^{236}$U (n,f) reactions with the PPAC detection setup used in previous n_TOF-14 experiment. This experiment would take advantage of the high resolution of the n_TOF facility to investigate the FFAD behaviour in the pronounced vibrational resonances that have been observed between 0.1 and 2 MeV for the thorium cycle isotopes. In addition, the angular distribution of these isotopes will be measured for the first time beyond 14 MeV. Furthermore, the experiment will also provide the fission cross section with reduced statistical uncertainty, extending the $^{236}$U(n,f) data up to 1 GeV

  1. The dynamics of fragment formation

    International Nuclear Information System (INIS)

    Keane, D.

    1994-09-01

    We demonstrate that in the Quantum Molecular Dynamics model, dynamical correlations can result in the production rate for final state nucleon clusters (and hence composite fragments) being higher than would be expected if statistics and the available phase space were dominant in determining composite formation. An intranuclear cascade or a Boltzmann-Uehling-Uhlenbeck model, combined with a statistical approach in the late stage of the collision to determine composites, provides an equivalent description only under limited conditions of centrality and beam energy. We use data on participant fragment production in Au + Au collisions in the Bevalac's BOS time projection chamber to map out the parameter space where statistical clustering provides a good description. In particular, we investigate momentum-space densities of fragments up to 4 He as a function of fragment transverse momentum, azimuth relative to the reaction plane, rapidity, multiplicity and beam energy

  2. Assessment of intercentre reproducibility and epidemiological concordance of Legionella pneumophila serogroup 1 genotyping by amplified fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Fry, N K; Bangsborg, Jette Marie; Bernander, S

    2000-01-01

    The aims of this work were to assess (i) the intercentre reproducibility and epidemiological concordance of amplified fragment length polymorphism analysis for epidemiological typing of Legionella pneumophila serogroup 1, and (ii) the suitability of the method for standardisation and implementation...... by members of the European Working Group on Legionella Infections. Fifty coded isolates comprising two panels of well-characterised strains, a "reproducibility" panel (n=20) and an "epidemiologically related" panel (n=30), were sent to 13 centres in 12 European countries. Analysis was undertaken in each...... using gel analysis software yielded R=1.00 and E=1.00, with 12, 13 or 14 types. This method can be used as a simple, rapid screening tool for epidemiological typing of isolates of Legionella pneumophila serogroup 1. Results demonstrate that the method can be highly reproducible (R=1...

  3. Use of Full-Length Recombinant Calflagin and Its C Fragment for Improvement of Diagnosis of Trypanosoma cruzi Infection†

    Science.gov (United States)

    Marcipar, Iván S.; Roodveldt, Cintia; Corradi, Gerardo; Cabeza, María L.; Brito, Maria Edileuza F.; Winter, Lucile M. Floeter; Marcipar, Alberto J.; Silber, Ariel M.

    2005-01-01

    Serological diagnosis of Trypanosoma cruzi infection is hampered by issues related to test specificity due to the cross-reactivity of most antigens with proteins of related parasites such as Leishmania spp. The recombinant calflagins are considered relevant antigens for the diagnosis of infection by Trypanosoma cruzi. In the present work, we describe two genes coding for putative calflagins in Leishmania major with the N-terminal moieties presenting high similarity with T. cruzi genes. This fact raised questions about their role in some cross-recognition of this antigen by sera from Leishmania spp.-infected individuals. The complete T. cruzi calflagin and two fragments of the protein, consisting of 146 amino acids of the N-terminal and 65 amino acids of the C-terminal regions, were expressed and evaluated against a panel of sera, which included well-characterized samples from T. cruzi, and Leishmania-infected patients. We were able to show that sera from Leishmania (Viannia) braziliensis-infected individuals recognized the recombinant full-length calflagin. Both the N-terminal and the complete protein presented the same high sensitivity (98.5% of sera from T. cruzi-infected patients was detected) but different specificities (94% and 98%, respectively, when evaluated against sera from people not infected by T. cruzi, including 15 sera from people infected with L. braziliensis). The C-terminal fragment presented low sensitivity (70%) but 100% specificity. We propose the use of these antigens in two sequential assays to optimize the serological diagnosis of T. cruzi infection in humans in geographic areas where Leishmania spp. infection is coendemic. PMID:16272476

  4. Elaboration of a model of the nuclear fragmentation and application to the method of isotopic separation of projectile fragments

    International Nuclear Information System (INIS)

    Gaimard, J.J.

    1990-10-01

    In this thesis the experimental results on the cross sections for the production of 36 P in the fragmentation of 403 MeV/u 40 Ar on a carbon target are presented. Furthermore some models of the nuclear fragmentation are elaborated and compared by means of experimental data for the production of gold and cerium isotopes in the reaction 12 C+ 209 Bi at 400 MeV/u, of chlorine, sulfur, aluminium, magnesium, and oxygen isotopes in the reactions 40 Ar+ 12 C at 600 MeV/u and 48 Ca+ 9 Be at 212 MeV/u, and of cobalt, manganese, vanadium, and scandium isotopes together with the charge distributions for A=43 and A=44 in the reactions 40 Ar+ 64 Cu at 2 GeV/u and 56 Fe+ 12 C at 600 MeV/u. (HSI)

  5. Oncogenic transformation of rat lung epithelioid cells by SV40 DNA and restriction enzyme fragments

    International Nuclear Information System (INIS)

    Daya-Grosjean, L.; Lasne, C.; Nardeux, P.; Chouroulinkov, I.; Monier, R.

    1979-01-01

    Rat epithelioid lung cells were transformed with various preparations of SV40 DNA using the Ca 2+ -precipitation technique. The amount of SV40 genetic information integrated into transformed clones was evaluated by DNA-DNA renaturation kinetics. The growth properties on plastic and in soft-agar were examined, as well as the ability to induce tumors in syngeneic newborn animals or in adult nude mice. One particular transformed line, which had received the HpaII/BamHIA (59 per cent) fragment, was found to contain about 3 integrated copies of this fragment per cell and no significant amount of the HpaII/BamHIB (41 per cent fragment). This line which grew to high saturatio densities and efficiently formed clones in low serum on plastic, produced tumors in both syngeneic rats and nude mice. Thus the HpaII/BamHIA fragment, which mainly includes early viral information, was sufficient to impart these properties to rat epithelioid lung cells. (author)

  6. Gene Prediction in Metagenomic Fragments with Deep Learning

    Directory of Open Access Journals (Sweden)

    Shao-Wu Zhang

    2017-01-01

    Full Text Available Next generation sequencing technologies used in metagenomics yield numerous sequencing fragments which come from thousands of different species. Accurately identifying genes from metagenomics fragments is one of the most fundamental issues in metagenomics. In this article, by fusing multifeatures (i.e., monocodon usage, monoamino acid usage, ORF length coverage, and Z-curve features and using deep stacking networks learning model, we present a novel method (called Meta-MFDL to predict the metagenomic genes. The results with 10 CV and independent tests show that Meta-MFDL is a powerful tool for identifying genes from metagenomic fragments.

  7. Authentication of beef, carabeef, chevon, mutton and pork by a PCR-RFLP assay of mitochondrial cytb gene

    OpenAIRE

    Kumar, Deepak; Singh, S. P.; Karabasanavar, Nagappa S.; Singh, Rashmi; Umapathi, V.

    2012-01-01

    Authentication of meat assumes significance in view of religious, quality assurance, food safety, public health, conservation and legal concerns. Here, we describe a PCR-RFLP (Polymerase Chain Reaction- Restriction Fragment Length Polymorphism) assay targeting mitochondrial cytochrome-b gene for the identification of meats of five most common food animals namely cattle, buffalo, goat, sheep and pig. A pair of forward and reverse primers (VPH-F & VPH-R) amplifying a conserved region (168–776 b...

  8. Association between apolipoprotein E genotype, serum lipids, and colorectal cancer in Brazilian individuals

    OpenAIRE

    Souza, D.R.S.; Nakazone, M.A.; Pinhel, M.A.S.; Alvares, R.M.; Monaco, A.C.; Pinheiro, A.; Barros, C.F.D.C.; Cury, P.M.; Cunrath, G.S.; Netinho, J.G.

    2009-01-01

    We evaluated genetic variants of apolipoprotein E (APOE HhaI) and their association with serum lipids in colorectal cancer (CRC), together with eating habits and personal history. Eight-seven adults with CRC and 73 controls were studied. APOE*2 (rs7412) and APOE*4 (rs429358) were identified by polymerase chain reaction-restriction fragment length polymorphism. APOE gene polymorphisms were similar in both groups, but the ε4/ε4 genotype (6%) was present only in controls. The patients ...

  9. Dual Fragment Impact of PBX Charges

    Science.gov (United States)

    Haskins, Peter; Briggs, Richard; Leeming, David; White, Nathan; Cheese, Philip; DE&S MoD UK Team; Ordnance Test Solutions Ltd Team

    2017-06-01

    Fragment impact can pose a significant hazard to many systems containing explosives or propellants. Testing for this threat is most commonly carried out using a single fragment. However, it can be argued that an initial fragment strike (or strikes) could sensitise the energetic material to subsequent impacts, which may then lead to a more violent reaction than would have been predicted based upon single fragment studies. To explore this potential hazard we have developed the capability to launch 2 fragments from the same gun at a range of velocities, and achieve impacts on an acceptor charge with good control over the spatial and temporal separation of the strikes. In this paper we will describe in detail the experimental techniques we have used, both to achieve the dual fragment launch and observe the acceptor charge response. In addition, we will describe the results obtained against PBX filled explosive targets; discuss the mechanisms controlling the target response and their significance for vulnerability assessment. Results of these tests have clearly indicated the potential for detonation upon the second strike, at velocities well below those needed for shock initiation by a single fragment.

  10. Photoluminescence and self-assembly of cesium lead halide perovskite nanocrystals: Effects of chain length of organic amines and reaction temperature

    Science.gov (United States)

    Yuan, Yi; Liu, Zheming; Liu, Zhenyang; Peng, Lan; Li, Yongjie; Tang, Aiwei

    2017-05-01

    All-inorganic halide perovskites have become one of the most prospective materials for lightening and display technology due to their color-tunable and narrow-band emission. Herein, we have systematically studied the effects of organic amines with different hydrocarbon chain length on the optical properties and morphology as well as the crystal structure of colloidal CsPbBr3 nanocrystals (NCs), which were synthesized in the presence of oleic acid (OA) and organic amines by using a simple hot-injection approach. The hydrocarbon chain length has shown an independent correlation to the morphology and crystal structure of the as-obtained CsPbBr3 NCs at 160 °C, but their optical properties can be affected to some extent. The photoluminescence quantum yields (PLQYs) of the CsPbBr3 NCs synthesized in the presence of organic amines with long carbon chain length are generally in the range of 55-80% for different reaction time, but the PLQYs of less than 20% are obtained for the products synthesized in the presence of octylamine (OTAm) with short carbon chain length. The effects of the reaction temperature on the optical properties, size and crystal structure of the CsPbBr3 NCs synthesized in the presence of cetylamine (CTAm) are studied. Interestingly, some nanoplates also appear in these CsPbBr3 NCs obtained at relatively low temperatures (120 and 140 °C), which have a strong tendency to self-assemble into face-to-face nanostructures. Such a similar self-assembly behavior is also observed in the product synthesized in the presence of oleylamine (OLAm), but only flat nanoplates are observed in the products in the presence of OTAm at 120 °C. The results indicate that the lower reaction temperature and hydrocarbon chain length of the organic ligands play a significant role in the self-assembly of CsPbBr3 NCs. This work opens up an alternative approach to controllable-synthesis of perovskite NCs through varying the carbon chain length of organic surfactants, and enlightens

  11. Collectivity in composite fragment emission from relativistic heavy ion collisions

    International Nuclear Information System (INIS)

    Bock, R.; Claesson, G.; Gutbrod, H.H.; Kolb, B.; Schmidt, H.R.; Doss, K.G.R.; Harris, J.W.; Kristiansson, P.; Lefebres, F.; Poskanzer, A.M.; Ritter, H.G.; Teitelbaum, L.; Tincknell, M.; Weiss, S.; Ferguson, R.L.; Gavron, I.; Jacak, B.V.; Wilhelmy, J.; Gustafsson, H.A.; Kampert, K.H.; Siemiarczuk, T.; Wieman, H.

    1987-05-01

    Composite fragments of 2< Z<10 have been measured in the Plastic Ball Spectrometer in 200 MeV/nucleon Au+Au and Au+Fe collisions. Strong azimuthal alignment of the fragments reveal the collective behaviour of the reaction. (orig.)

  12. Restriction fragment polymorphism (RFLP) of a "new" HLA-DP specificity, CDP-HEI

    DEFF Research Database (Denmark)

    Hyldig-Nielsen, J J; Ødum, Niels; Morling, Niels

    1988-01-01

    Southern blotting with a DP beta cDNA probe of MspI digested DNA from 83 healthy unrelated individuals revealed a 1.8 kb fragment present in all four individuals (and no others) possessing the newly determined DP specificity, CDP-HEI....

  13. HIERARCHICAL FRAGMENTATION OF THE ORION MOLECULAR FILAMENTS

    International Nuclear Information System (INIS)

    Takahashi, Satoko; Ho, Paul T. P.; Su, Yu-Nung; Teixeira, Paula S.; Zapata, Luis A.

    2013-01-01

    We present a high angular resolution map of the 850 μm continuum emission of the Orion Molecular Cloud-3 (OMC 3) obtained with the Submillimeter Array (SMA); the map is a mosaic of 85 pointings covering an approximate area of 6.'5 × 2.'0 (0.88 × 0.27 pc). We detect 12 spatially resolved continuum sources, each with an H 2 mass between 0.3-5.7 M ☉ and a projected source size between 1400-8200 AU. All the detected sources are on the filamentary main ridge (n H 2 ≥10 6 cm –3 ), and analysis based on the Jeans theorem suggests that they are most likely gravitationally unstable. Comparison of multi-wavelength data sets indicates that of the continuum sources, 6/12 (50%) are associated with molecular outflows, 8/12 (67%) are associated with infrared sources, and 3/12 (25%) are associated with ionized jets. The evolutionary status of these sources ranges from prestellar cores to protostar phase, confirming that OMC-3 is an active region with ongoing embedded star formation. We detect quasi-periodical separations between the OMC-3 sources of ≈17''/0.035 pc. This spatial distribution is part of a large hierarchical structure that also includes fragmentation scales of giant molecular cloud (≈35 pc), large-scale clumps (≈1.3 pc), and small-scale clumps (≈0.3 pc), suggesting that hierarchical fragmentation operates within the Orion A molecular cloud. The fragmentation spacings are roughly consistent with the thermal fragmentation length in large-scale clumps, while for small-scale cores it is smaller than the local fragmentation length. These smaller spacings observed with the SMA can be explained by either a helical magnetic field, cloud rotation, or/and global filament collapse. Finally, possible evidence for sequential fragmentation is suggested in the northern part of the OMC-3 filament.

  14. Molecular detection and PCR-RFLP analysis using Pst1 and Alu1 of multidrug resistant Klebsiella pneumoniae causing urinary tract infection in women in the eastern part of Bangladesh

    Directory of Open Access Journals (Sweden)

    Golam Mahmudunnabi

    2018-06-01

    Full Text Available Klebsiella pneumoniae is the second leading causative agent of UTI. In this study, a rapid combined polymerase chain reaction and restriction fragment length polymorphism analysis was developed to identify K. pneumoniae in women, infected with urinary tract infection in the Sylhet city of Bangladesh. Analysis of 11 isolates from women at the age range of 20–55 from three different hospitals were done firstly by amplification with K. pneumoniae specific ITS primers. All of the 11 collected isolates were amplified in PCR and showed the expected 136 bp products. Then, restriction fragment length polymorphism analysis of 11 isolates were conducted after PCR amplification by 16s rRNA universal primers, followed by subsequent digestion and incubation with two restriction enzymes, Pst1 and Alu1. Seven out of 11 isolates were digested by Pst1 restriction enzymes, six isolates digested by Alu1, and while others were negative for both enzymes. Data results reveal that, women at age between 25 and 50 were digested by both enzymes. A woman aged over than 50 was negative while bellow 20 was digested by only Pst1. The results could pave the tactic for further research in the detection of K. pneumoniae from UTI infected women. Keywords: Klebsiella pneumoniae, ITS-primer, MDR isolates, PCR-RFLP analysis

  15. Synthesis of the C(18)-C(34) fragment of amphidinolide C and the C(18)-C(29) fragment of amphidinolide F.

    Science.gov (United States)

    Roy, Sudeshna; Spilling, Christopher D

    2010-11-19

    A convergent synthesis of the C(18)-C(34) fragment of amphidinolide C and the C(18)-C(29) fragment of amphidinolide F is reported. The approach involves the synthesis of the common intermediate tetrahydrofuranyl-β-ketophosphonate via cross metathesis, Pd(0)-catalyzed cyclization, and hydroboration-oxidation. The β-ketophosphonate was coupled to three side chain aldehydes using a Horner-Wadsworth-Emmons (HWE) olefination reaction to give dienones, which were reduced with l-selectride to give the fragments of amphidinolide C and F.

  16. Effect of Stemming to Burden Ratio and Powder Factor on Blast Induced Rock Fragmentation- A Case Study

    Science.gov (United States)

    Prasad, Sandeep; Choudhary, B. S.; Mishra, A. K.

    2017-08-01

    Rock fragmentation size is very important parameters for economical point of view in any surface mining. Rock fragment size direct effects on the costs of drilling, blasting, loading, secondary blasting and crushing. The main purpose of this study is to investigate effect of blast design parameters such as burden, blast hole length, stemming length, and powder factor on rock fragmentation. The fragment sizes (MFS, K50, m), and maximum fragment size (K95, m) of rock were determined by using the computer software. For every blast, after blasting operation, the images of whole muck pile are captured and there images were used for fragmentation analysis by using the Fragalyst software. It was observed that the optimal fragment size (MFS, K50, m and maximum fragment size, K95, m) of rock depends strongly on the blast design parameters and explosive parameters.

  17. Differentiation between Aspergillus flavus and Aspergillus parasiticus from Pure Culture and Aflatoxin-Contaminated Grapes Using PCR-RFLP Analysis of aflR-aflJ Intergenic Spacer

    International Nuclear Information System (INIS)

    El Khoury, A.; Atoui, A.; Lebrihi, A.; Rizk, T.; Lteif, R.; Kallassy, M.

    2011-01-01

    Aflatoxins (AFs) represent the most important single mycotoxin-related food safety problem in developed and developing countries as they have adverse effects on human and animal health. They are produced mainly by Aspergillus flavus and A. parasiticus. Both species have different aflatoxinogenic profile. In order to distinguish between A. flavus and A. parasiticus, gene-specific primers were designed to target the intergenic spacer (IGS) for the AF biosynthesis genes, aflJ and aflR. Polymerase chain reaction (PCR) products were subjected to restriction endonuclease analysis using BglII to look for restriction fragment length polymorphisms (RFLPs). Our result showed that both species displayed different PCR-based RFLP (PCR-RFLP) profile. PCR products from A. flavus cleaved into 3 fragments of 362, 210, and 102 bp. However, there is only one restriction site for this enzyme in the sequence of A. parasiticus that produced only 2 fragments of 363 and 311 bp. The method was successfully applied to contaminated grapes samples. This approach of differentiating these 2 species would be simpler, less costly, and quicker than conventional sequencing of PCR products and/or morphological identification. (author)

  18. Target fragmentation in proton-nucleus and /sup 16/O-nucleus reactions at 60 and 200 GeVnucleon

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, H R; Albrecht, R; Awes, T C; Baktash, C; Beckmann, P; Claesson, G; Berger, F; Bock, R; Dragon, L; Ferguson, R L; Franz, A; Garpman, S; Glasow, R; Gustafsson, H A; Gutbrod, H H; Kampert, K H; Kolb, B W; Kristiansson, P; Lee, I Y; Loehner, H; Lund, I; Obenshain, F E; Oskarsson, A; Otterlund, I; Peitzmann, T; Persson, S; Plasil, F; Poskanzer, A M; Purschke, M; Ritter, H G; Santo, R; Siemiarczuk, T; Sorensen, S P; Stenlund, E; Young, G R

    1987-01-01

    Target remnants with Z<3 from proton-nucleus and /sup 16/O-nulceus reactions at 60 and 200 GeVnucleon were measured in the angular range from 30)degree) to 160)degree) (-1.7<)eta)1.3) employing the Plastic Ball detector. The excitation energy of the target spectator matter in central oxygen-induced collisions is found to be high enough to allow for complete disintegration of the target nucelus into fragments with Z<3. The average longtitudinal momentum transfer per proton to the target in central collisions is considerably higher in the case of /sup 16/O-induced reactions (approx.300 MeVc) than in proton-induced reactions (approx.130 MeVc). The baryon rapidity distributions are roughly in agreement with one-fluid hydrodynamical calcualtions at 60 GeVnucleon /sup 16/O)plus)Au but are in disagreement at 200 GeVnucleon, indicating the higher degree of transparency at the higher bombarding energy. Both, the transverse moments of target spectators and the entropy produced in the target gfragmentation region are compared to those attained in head-on collisions of two heavy nuclei at Bevalac energies. They are found to be comparable or do even exceed the values for the participant matter at beam energies of about 1-2 GeVnucleon. 18 refs., 112 figs

  19. Total reaction cross sections and neutron-removal cross sections of neutron-rich light nuclei measured by the COMBAS fragment-separator

    Science.gov (United States)

    Hue, B. M.; Isataev, T.; Erdemchimeg, B.; Artukh, A. G.; Aznabaev, D.; Davaa, S.; Klygin, S. A.; Kononenko, G. A.; Khuukhenkhuu, G.; Kuterbekov, K.; Lukyanov, S. M.; Mikhailova, T. I.; Maslov, V. A.; Mendibaev, K.; Sereda, Yu M.; Penionzhkevich, Yu E.; Vorontsov, A. N.

    2017-12-01

    Preliminary results of measurements of the total reaction cross sections σR and neutron removal cross section σ-xn for weakly bound 6He, 8Li, 9Be and 10Be nuclei at energy range (20-35) A MeV with 28Si target is presented. The secondary beams of light nuclei were produced by bombardment of the 22Ne (35 A MeV) primary beam on Be target and separated by COMBAS fragment-separator. In dispersive focal plane a horizontal slit defined the momentum acceptance as 1% and a wedge degrader of 200 μm Al was installed. The Bρ of the second section of the fragment-separator was adjusted for measurements in energy range (20-35) A MeV. Two-neutron removal cross sections for 6He and 10Be and one -neutron removal cross sections 8Li and 9Be were measured.

  20. Rapid establishment of polymerase chain reaction-restriction ...

    African Journals Online (AJOL)

    RFLP) optimization reaction system for cpDNA in tea [Camellia sinensis (L.) O. Kuntze] was rapidly established. Results show that the optimal PCR reaction system was 100 ng template DNA, 200 μmolL-1 dNTPs, 1.5 mmolL-1 MgCl2, 50 ng primer, ...

  1. Unimolecular and collisionally induced ion reactions

    International Nuclear Information System (INIS)

    Beynon, J.H.; Boyd, R.K.

    1978-01-01

    The subject is reviewed under the following headings: introduction (mass spectroscopy and the study of fragmentation reactions of gaseous positive ions); techniques and methods (ion sources, detection systems, analysis of ions, data reduction); collision-induced reactions of ions and unimolecular fragmentations of metastable ions; applications (ion structure, energetic measurements, analytical applications, other applications). 305 references. (U.K.)

  2. Projectile rapidity dependence in target fragmentation

    International Nuclear Information System (INIS)

    Haustein, P.E.; Cumming, J.B.; Hseuh, H.C.

    1979-01-01

    The thick-target, thick-catcher technique was used to determine mean kinetic properties of selected products of the fragmentation of Cu by 1 H, 4 He, and 12 C ions (180 to 28,000 MeV/amu). Momentum transfer, as inferred from F/B ratios, is ovserved to occur most efficiently for the lower velocity projectiles. Recoil properties of target fragments vary strongly with product mass, but show only a weak dependence on projectile type. The projectile's rapidity is shown to be a useful variable for quantitative intercomparison of different reactions. These results indicate that E/sub proj//A/sub proj/ is the dominant parameter which governs the mean recoil behavior of target fragments. 20 references

  3. Fragmentation in rotating isothermal protostellar clouds

    International Nuclear Information System (INIS)

    Bodenheimer, P.; Black, D.C.

    1980-01-01

    In this paper we report briefly the results of an extensive set of 3-D hydrodynamic calculations that have been performed during the past two and one-half years to investigate the susceptibility of rotating clouds to gravitational fragmentation. Because of the immensity of parameter space and the expense of computations, we have chosen to restrict this investigation to strictly isothermal collapse sequences. (orig./WL)

  4. Fragmentation and thermal risks from climate change interact to affect persistence of native trout in the Colorado River basin.

    Science.gov (United States)

    Roberts, James J; Fausch, Kurt D; Peterson, Douglas P; Hooten, Mevin B

    2013-05-01

    Impending changes in climate will interact with other stressors to threaten aquatic ecosystems and their biota. Native Colorado River cutthroat trout (CRCT; Oncorhynchus clarkii pleuriticus) are now relegated to 309 isolated high-elevation (>1700 m) headwater stream fragments in the Upper Colorado River Basin, owing to past nonnative trout invasions and habitat loss. Predicted changes in climate (i.e., temperature and precipitation) and resulting changes in stochastic physical disturbances (i.e., wildfire, debris flow, and channel drying and freezing) could further threaten the remaining CRCT populations. We developed an empirical model to predict stream temperatures at the fragment scale from downscaled climate projections along with geomorphic and landscape variables. We coupled these spatially explicit predictions of stream temperature with a Bayesian Network (BN) model that integrates stochastic risks from fragmentation to project persistence of CRCT populations across the upper Colorado River basin to 2040 and 2080. Overall, none of the populations are at risk from acute mortality resulting from high temperatures during the warmest summer period. In contrast, only 37% of populations have a ≥90% chance of persistence for 70 years (similar to the typical benchmark for conservation), primarily owing to fragmentation. Populations in short stream fragments <7 km long, and those at the lowest elevations, are at the highest risk of extirpation. Therefore, interactions of stochastic disturbances with fragmentation are projected to be greater threats than warming for CRCT populations. The reason for this paradox is that past nonnative trout invasions and habitat loss have restricted most CRCT populations to high-elevation stream fragments that are buffered from the potential consequences of warming, but at risk of extirpation from stochastic events. The greatest conservation need is for management to increase fragment lengths to forestall these risks. © 2013

  5. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  6. TERRA Expression Levels Do Not Correlate With Telomere Length and Radiation Sensitivity in Human Cancer Cell Lines

    Directory of Open Access Journals (Sweden)

    Alexandra eSmirnova

    2013-05-01

    Full Text Available Mammalian telomeres are transcribed into long non-coding telomeric RNA molecules (TERRA that seem to play a role in the maintenance of telomere stability. In human cells, CpG island promoters drive TERRA transcription and are regulated by methylation. It was suggested that the amount of TERRA may be related to telomere length. To test this hypothesis we measured telomere length and TERRA levels in single clones isolated from five human cell lines: HeLa (cervical carcinoma, BRC-230 (breast cancer, AKG and GK2 (gastric cancers and GM847 (SV40 immortalized skin fibroblasts. We observed great clonal heterogeneity both in TRF (Terminal Restriction Fragment length and in TERRA levels. However, these two parameters did not correlate with each other. Moreover, cell survival to γ-rays did not show a significant variation among the clones, suggesting that, in this cellular system, the intra-population variability in telomere length and TERRA levels does not influence sensitivity to ionizing radiation. This conclusion was supported by the observation that in a cell line in which telomeres were greatly elongated by the ectopic expression of telomerase, TERRA expression levels and radiation sensitivity were similar to the parental HeLa cell line.

  7. Papain cleavage of the 38,000-dalton fragment inhibits the binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate to lys-539 on the 60,000-dalton fragment in human band 3.

    Science.gov (United States)

    Yamaguchi, Takeo; Kojima, Hideaki; Kawaguchi, Shiori; Shimada, Maiko; Aso, Haruka

    2017-08-01

    Human band 3 is a 98-kDa transmembrane (TM) protein comprising 14 TM segments. Papain cleavages band 3 into 38- and 60-kDa fragments. Under vigorous conditions, the cleavage of the loop region between the TM 7 of gate domain and the TM 8 of core domain in the 38-kDa fragment produces 7- and 31-kDa fragments. Conformational changes of the TM 5 segment containing Lys-539 by cleavage of the 38-kDa fragment remain unclear. Pressure-induced haemolysis of erythrocytes was suppressed by binding of 4, 4'-diisothiocyanostilbene-2, 2'-disulfonate (DIDS) to Lys-539. Such effect of DIDS was not observed upon cleavage of the 38-kDa fragment, because of inhibition of DIDS binding to Lys-539. Using fluorescence of DIDS labelled to Lys-539, conformational changes of band 3 were examined. Fluorescence spectra demonstrated that the molecular motion of DIDS is more restricted upon digestion of the 38-kDa fragment. Interestingly, the quenching of DIDS fluorescence showed that Hg2+ is less accessible to DIDS upon digestion of the 38-kDa fragment. Taken together, we propose that the conformational changes of the TM 5 segment characterized by the sequestration and restricted motion of Lys-539 are induced by the cleavage of the loop region between the TM 7 and the TM 8. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  8. Fission-fragment mass distribution and estimation of the cluster emission probability in the γ + 232Th and 181Ta reactions

    International Nuclear Information System (INIS)

    Karamyan, S.A.; Adam, J.; Belov, A.G.; Chaloun, P.; Norseev, Yu.V.; Stegajlov, V.I.

    1997-01-01

    Fission-fragment mass distribution has been measured by the cumulative yields of radionuclides detected in the 232 Th(γ,f)-reaction at the Bremsstrahlung endpoint energies of 12 and 24 MeV. The yield upper limits have been estimated for the light nuclei 24 Na, 28 Mg, 38 S etc. at the Th and Ta targets exposure to the 24 MeV Bremsstrahlung. The results are discussed in terms of the multimodal fission phenomena and cluster emission >from a deformed fissioning system or from a compound nucleus

  9. Mycobacterium intracellulare Pleurisy Identified on Liquid Cultures of the Pleural Fluid and Pleural Biopsy.

    Science.gov (United States)

    Lim, Jong Gu; O, Sei Won; Lee, Ki Dong; Suk, Dong Keun; Jung, Tae Young; Shim, Tae Sun; Chon, Gyu Rak

    2013-03-01

    Pleural effusion is a rare complication in non-tuberculous mycobacterial infection. We report a case of Mycobacterium intracellulare pleuritis with idiopathic pulmonary fibrosis in a 69-year-old man presenting with dyspnea. Pleural effusion revealed lymphocyte dominant exudate. M. intracellulare was identified using a polymerase chain reaction-restriction fragment length polymorphism method and liquid cultures of pleural effusion and pleural biopsy. After combination therapy for M. intracellulare pulmonary disease, the patient was clinically well at a 1-month follow-up.

  10. Nuclear fission and reactions

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    The nuclear fission research programs are designed to elucidate basic features of the fission process. Specifically, (1) factors determining how nucleons of a fissioning nucleus are distributed between two fission fragments, (2) factors determining kinetic energy and excitation energies of fragments, and (3) factors controlling fission lifetimes. To these ends, fission studies are reported for several heavy elements and include investigations of spontaneous and neutron-induced fission, heavy ion reactions, and high energy proton reactions. The status of theoretical research is also discussed. (U.S.)

  11. In-beam γ-ray spectroscopy of two-step fragmentation reactions at relativistic energies. The case of 36Ca

    International Nuclear Information System (INIS)

    Doornenbal, P.

    2007-01-01

    A two-step fragmentation experiment has been performed at GSI with the RISING setup. It combines the fragment separator FRS, which allows for the production of radioactive heavy ions at relativistic energies, with a high resolution γ-spectrometer. This combination offers unique possibilities for nuclear structure investigations like the test of shell model predictions far from stability. Within the present work the question if the N=14(16) shell stabilisation in Z=8 oxygen isotopes and the N=20 shell quenching in 32 Mg are symmetric with respect to the isospin projection quantum number Tz has been addressed. New γ-ray decays were found in the neutron deficient 36 Ca and 36 K by impinging a radioactive ion beam of 37 Ca on a secondary 9 Be target. The fragmentation products were selected with the calorimeter telescope CATE and the emitted γ-rays were measured with Ge Cluster, MINIBALL, and BaF 2 HECTOR detectors. For 36 Ca the 2 1 + →0 g.s. + transition energy was determined to be 3015(16) keV, which is the heaviest T=2 nucleus from which γ-spectroscopic information has been obtained so far. A comparison between the experimental 2 1 + energies of 36 Ca and its mirror nucleus 36 S yielded a mirror energy difference of ΔE M =-276(16) keV. In order to understand the large ΔE M value, the experimental single-particle energies from the A=17, T=1/2 mirror nuclei were taken and applied onto modified isospin symmetric USD interactions in shell model calculations. These calculations were in agreement with the experimental result and showed that the experimental single-particle energies may account empirically for the one body part of Thomas-Ehrman and/or Coulomb effects. A method to extract the lifetime of excited states in fragmentation reactions was investigated. Therefore, the dependence between the lifetime of an excited state and the average de-excitation velocity and trajectory of the nuclei in relativistic fragmentation experiments has been studied. Known

  12. Gene flow and effective population sizes of the butterfly Maculinea alcon in a highly fragmented, anthropogenic landscape

    DEFF Research Database (Denmark)

    Vanden Broeck, An; Maes, Dirk; Kelager, Andreas

    2017-01-01

    fragmentation as they occupy narrow niches or restricted habitat ranges. Here, we assess contemporary interpopulation connectedness of the threatened, myrmecophilous butterfly,Maculinea alcon, in a highly fragmented landscape.Weinferred dispersal, effective population sizes, genetic diversity and structure...

  13. Measurement of Fragment Production Cross Sections in the $^{12}$C+$^{12}$C and $^{12}$C+$^{197}$Au Reactions at 62 $A$ MeV for Hadrontherapy and Space Radiation Protection

    CERN Document Server

    Tropea, S; Agodi, C; Blancato, A A; Bondì, M; Cappuzzello, F; Carbone, D; Cavallaro, M; Cirrone, G A P; Cuttone, G; Giacoppo, F; Nicolosi, D; Pandola, L; Raciti, G; Rapisarda, E; Romano, F; Sardina, D; Scuderi, V; Sfienti, C

    2014-01-01

    Over the last twenty years, there has been a renewed interest in nuclear fragmentation studies for both hadrontherapy applications and space radiation protection. In both fields, fragmentation cross sections are needed to predict the effects of the ions nuclear interactions within the patient’s and the astronaut’s body. Indeed, the Monte Carlo codes used in planning tumor treatments and space missions must be tuned and validated by experimental data. However, only a limited set of fragmentation cross sections are available in literature, especially at Fermi energies. Therefore, we have studied the production of secondary fragments in the 12 C+ 12 C and 12 C+ 197 Au reactions at 62 A MeV. In this work, the measured 4 He cross sections angular distributions at four selected angles are presented and compared.

  14. Application of Fluorescent Amplified Fragment Length Polymorphism for Comparison of Human and Animal Isolates of Yersinia enterocolitica

    Science.gov (United States)

    Fearnley, Catherine; On, Stephen L. W.; Kokotovic, Branko; Manning, Georgina; Cheasty, Tom; Newell, Diane G.

    2005-01-01

    An amplified fragment length polymorphism (AFLP) method, developed to genotype Yersinia enterocolitica, has been used to investigate 70 representative strains isolated from humans, pigs, sheep, and cattle in the United Kingdom. AFLP primarily distinguished Y. enterocolitica strains according to their biotype, with strains dividing into two distinct clusters: cluster A, comprising largely the putatively pathogenic biotypes (BT2 to -4), and cluster B, comprising the putatively nonpathogenic biotype 1A strains and a single BT1B isolate. Within these two clusters, subclusters formed largely on the basis of serotype. However, AFLP profiles also allowed differentiation of strains within these serotype-related subclusters, indicating the high discriminatory power of the technique for Y. enterocolitica. Investigation of the relationship between strain AFLP profile and host confirmed that pigs are, and provides further proof that sheep may be, potential sources of human infection with putatively pathogenic strains. However, the results suggest that some strains causing human disease do not come from veterinary sources identifiable at this time. The distribution of some BT1A isolates within cluster A raises questions about the relationship between virulence potential and biotype. PMID:16151073

  15. Curves of restricted type in euclidean spaces

    Directory of Open Access Journals (Sweden)

    Bengü Kılıç Bayram

    2014-01-01

    Full Text Available Submanifolds of restricted type were introduced in [7]. In the present study we consider restricted type of curves in Em. We give some special examples. We also show that spherical curve in S2(r C E3 is of restricted type if and only if either ƒ(s is constant or a linear function of s of the form ƒ(s = ±s + b and every closed W - curve of rank k and of length 2(r in E2k is of restricted type.

  16. Angular evolution of peripheral heavy ion reactions at intermediate energies

    International Nuclear Information System (INIS)

    Blumenfeld, Y.; Chomaz, P.; Frascaria, N.; Garron, J.P.; Jacmart, J.C; Roynette, J.C

    1985-01-01

    Energy spectra and angular distributions of projectile-like fragments have been measured in the vicinity of the grazing angle for the 40 Ar+ 40 Ca and 40 Ar+ 208 Pb reactions at 44MeV/nucleon. Measurements of the 40 Ar+ 40 Ca system at 27MeV/nucleon and 20 Ne+ 208 Pb reaction at 44MeV/nucleon at one angle have also been performed. For fragments with charge and mass close to the projectile numerous deviations from the standard fragmentation model have been observed including rapidly changing shapes of the angular distributions with the fragment mass. Moreover the isotopic distributions and mean fragment velocities are strongly dependent on detection angle. A surface transfer reaction component dominant at the grazing angle can be separated from a second component which cannot be entirely accounted for by a simple fragmentation mechanism

  17. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  18. Fragment charge and energy distributions in the 1.8-4.8 GeV 3He + natAg, 197Au reactions

    International Nuclear Information System (INIS)

    Bracken, D.S.; Foxford, E.R.; Kwiatkowski, K.

    1995-01-01

    Moving source fits have been performed for IMFs as a function of observables related to collision violence in the 1.8-4.8 GeV 3 He + nat Ag, l97 Au reactions. The systematic behavior of the source properties and fragment charge distributions will be reviewed. The evolution of the spectral Coulomb parameters provides evidence for nuclear expansion prior to multifragmentation, suggesting a breakup density of p/p o ∼ 1/3. The charge distributions will be examined in terms of power-law fits and moment analyses

  19. Intermittency in 197Au fragmentation

    International Nuclear Information System (INIS)

    Dabrowska, A.; Holynski, R.; Olszewski, A.; Szarska, M.; Wilczynska, B.; Wolter, W.; Wosiek, B.; Cherry, M.L.; Deines-Jones, P.; Jones, W.V.; Sengupta, K.; Wefel, B.

    1995-07-01

    The concept of factorial moments was applied to an analysis of the dynamical fluctuations in the charge distributions of the fragments emitted from gold nuclei with energies 10.6 and < 1.0 GeV/n interacting with emulsion nuclei. Clear evidence for intermittent fluctuations has been found in an analysis using all the particles released from the gold projectile, with a stronger effect observed below 1 GeV/n than at 10.6 GeV/n. For the full data sets, however, the intermittency effect was found to be very sensitive to the singly charged particles, and neglecting these particles strongly reduces the intermittency signal. When the analysis is restricted to the multiply charged fragments, an intermittency effect is revealed only for multifragmentation events, although one that is enhanced as compared to the analysis of all, singly and multiply charged, particles. The properties of the anomalous fractal dimensions suggest a sequential decay mechanism, rather than the existence of possible critical behaviour in the process of nuclear fragmentation. The likely influence of the charge conservation effects and the finite size of decaying systems on the observed intermittency signals was pointed out. (author). 37 refs, 9 figs, 5 tabs

  20. The multi-step prompt particle emission from fission fragments

    International Nuclear Information System (INIS)

    Zhivopistsev, A.; Oprea, C.; Oprea, I.

    2003-01-01

    The purpose of this work is the study of non-equilibrium high-energy gamma emission from 252 Cf. In the framework of the formalism of statistical multi-step compound processes in nuclear reactions. A relation was found between the shape of the high-energy part of the gamma spectrum and different mechanisms of excitation of the fission fragments. Agreement with experimental data for different groups of fission fragments was obtained. The analysis of the experimental high-energy part of gamma spectra yields information about the mechanism of excitation of fission fragments. The influence of dissipation of the deformation excess on intrinsic excitation of fission fragments was studied. (authors)

  1. Coherent control of indirect photofragmentation in the weak-field limit: Control of transient fragment distributions

    DEFF Research Database (Denmark)

    Shu, Chuan-Cun; Henriksen, Niels Engholm

    2011-01-01

    I molecule, where it is shown that the probability of observing atomic fragments as well as the distribution of their relative momenta can be changed by a phase modulated pulse with a fixed bandwidth. This type of control is restricted to finite times during the indirect fragmentation. (C) 2011 American...

  2. Energy loss, range and fluence distributions, total reaction and projectile fragment production cross sections for proton-nucleus and nucleus-nucleus interactions

    International Nuclear Information System (INIS)

    Sihver, L.; Kanai, T.

    1992-07-01

    We have developed a computer code for calculations of energy loss (dE/dx) and range distributions for heavy ions in any media. The results from our calculations are in very good agreement with previous calculations. We have developed semiempirical total reaction cross section formulae for proton-nucleus (with Z p ≤26) and nucleus-nucleus (with Z p and Z t ≤26) reactions. These formulae apply for incident energies above 15 MeV and 100 MeV/nucleon respectively. From the total reaction cross sections, we can calculate the mean free paths and the fluence distributions of protons and heavy ions in any media. We have compared all the calculated reaction cross sections and the mean free paths with experimental data, and the agreement is good. We have also constructed a procedure for calculating projectile fragment production cross sections, by scaling semiempirical proton-nucleus partial cross section systematics. The scaling is performed using a scaling parameter deduced from our reaction cross sections formulae, and additional enhancements factors. All products with atomic number ranging from that of the projectile (Z p ) down to Z=2 can be calculated. The agreement between the calculated cross sections and the experimental data is better than earlier published results. (author)

  3. Synthesis of the C(18)–C(34) Fragment of Amphidinolide C and the C(18)–C(29) Fragment of Amphidinolide F

    Science.gov (United States)

    Roy, Sudeshna; Spilling, Christopher D.

    2010-01-01

    A convergent synthesis of the C(18)–C(34) fragment of amphidinolide C and the C(18)–C(29) fragment of amphidinolide F is reported. The approach involves the synthesis of the common intermediate tetrahydrofuranyl-β-ketophosphonate via cross metathesis, Pd(0)-catalyzed cyclization and hydroboration-oxidation. The β-ketophosphonate was coupled to three side chain aldehydes using a Horner-Wadsworth-Emmons (HWE) olefination reaction to give dienones, which were reduced with L-selectride to give the fragments of amphidinolide C and F. PMID:21028791

  4. Molecular epidemiology of Blastocystis

    Directory of Open Access Journals (Sweden)

    Fadime Eroğlu

    2015-12-01

    Full Text Available Blastocystis pathogenicity and classification was newly illuminated with molecular genetic studies and recently the parasite was found in the focus of many researchers. Several molecular methods such as; polymerase chain reaction (PCR, PCR-restriction fragment length polymorphism, random amplified polymorphic DNA, real-time polymerase chain reaction and DNA sequencing analyses can be used in genotyping of Blastocystis. Blastocystis parasites may cause diarrhea, abdominal pain, bloating, gas, irritability, anorexia, cramps, vomiting, dehydration, insomnia, nausea, loss of appetite, weight loss, fatigue symptoms and also could be asymptomatic cases. In this review, it was aimed to summarize the associations between Blastocystis subtypes and pathogenicity.

  5. Improving computer security for authentication of users: influence of proactive password restrictions.

    Science.gov (United States)

    Proctor, Robert W; Lien, Mei-Ching; Vu, Kim-Phuong L; Schultz, E Eugene; Salvendy, Gavriel

    2002-05-01

    Entering a username-password combination is a widely used procedure for identification and authentication in computer systems. However, it is a notoriously weak method, in that the passwords adopted by many users are easy to crack. In an attempt to improve security, proactive password checking may be used, in which passwords must meet several criteria to be more resistant to cracking. In two experiments, we examined the influence of proactive password restrictions on the time that it took to generate an acceptable password and to use it subsequently to long in. The required length was a minimum of five characters in Experiment 1 and eight characters in Experiment 2. In both experiments, one condition had only the length restriction, and the other had additional restrictions. The additional restrictions greatly increased the time it took to generate the password but had only a small effect on the time it took to use it subsequently to long in. For the five-character passwords, 75% were cracked when no other restrictions were imposed, and this was reduced to 33% with the additional restrictions. For the eight-character passwords, 17% were cracked with no other restrictions, and 12.5% with restrictions. The results indicate that increasing the minimum character length reduces crackability and increases security, regardless of whether additional restrictions are imposed.

  6. Investigation of the fission fragment properties of the reaction 238U(N,F) at incident neutron energies up to 5.8 MeV

    International Nuclear Information System (INIS)

    Vives, F.

    1998-01-01

    The 238 U(n,f) reaction has been studied at various incident neutrons energies from 1,2 at 5,8 MeV. The author shows that the vibrational resonances presence in the cross section threshold area and the protons parity effect, lead to variations in the fission fragments properties. The mass, the total kinetic energy (TKE) and the fragments angular distribution have been obtained thanks a ionisation double chamber use. Mass function changes in the mass and kinetic energy distributions and their respectively contributions to the TKE variations, have also been studied. The two-dimension distributions adjustments mass-TKE have been compared to the theoretical calculus, compiled with the multi-modal random neck-rupture model: two solutions are possible. Meanwhile, only one leads to significant physical interpretation in terms of layers effects. (A.L.B.)

  7. Bacterial discrimination by means of a universal array approach mediated by LDR (ligase detection reaction

    Directory of Open Access Journals (Sweden)

    Consolandi Clarissa

    2002-09-01

    Full Text Available Abstract Background PCR amplification of bacterial 16S rRNA genes provides the most comprehensive and flexible means of sampling bacterial communities. Sequence analysis of these cloned fragments can provide a qualitative and quantitative insight of the microbial population under scrutiny although this approach is not suited to large-scale screenings. Other methods, such as denaturing gradient gel electrophoresis, heteroduplex or terminal restriction fragment analysis are rapid and therefore amenable to field-scale experiments. A very recent addition to these analytical tools is represented by microarray technology. Results Here we present our results using a Universal DNA Microarray approach as an analytical tool for bacterial discrimination. The proposed procedure is based on the properties of the DNA ligation reaction and requires the design of two probes specific for each target sequence. One oligo carries a fluorescent label and the other a unique sequence (cZipCode or complementary ZipCode which identifies a ligation product. Ligated fragments, obtained in presence of a proper template (a PCR amplified fragment of the 16s rRNA gene contain either the fluorescent label or the unique sequence and therefore are addressed to the location on the microarray where the ZipCode sequence has been spotted. Such an array is therefore "Universal" being unrelated to a specific molecular analysis. Here we present the design of probes specific for some groups of bacteria and their application to bacterial diagnostics. Conclusions The combined use of selective probes, ligation reaction and the Universal Array approach yielded an analytical procedure with a good power of discrimination among bacteria.

  8. Multiparticle production in heavy-ion reactions

    International Nuclear Information System (INIS)

    Pelte, D.

    1980-01-01

    This lecture is concerned with the question how many particles and what kind of them are produced in heavy-ion collisions at energies about 10 MeV/n. We tend to assume that heavy-ion reactions at this energy are binary reactions. The experimental set consisting of two large ionization chambers serving to detection, in coincidence, the reaction fragments is described. With this set-up a number of reactions induced on 27 Al, 28 Si and 40 Ca by the 32 S beam of 135 and 190 MeV energy has been studied. Two-fragments inclusive and exclusive reactions were investigated. The assumption of a sequential statistical decay gives the best agreement with the data for all analyzed cases. (H.M.)

  9. Fission fragment driven neutron source

    Science.gov (United States)

    Miller, Lowell G.; Young, Robert C.; Brugger, Robert M.

    1976-01-01

    Fissionable uranium formed into a foil is bombarded with thermal neutrons in the presence of deuterium-tritium gas. The resulting fission fragments impart energy to accelerate deuterium and tritium particles which in turn provide approximately 14 MeV neutrons by the reactions t(d,n).sup.4 He and d(t,n).sup.4 He.

  10. Roads leading to roam. Role of triple fragmentation and of conical intersections in photochemical reactions: experiments and theory on methyl formate.

    Science.gov (United States)

    Tsai, Po-Yu; Chao, Meng-Hsuan; Kasai, Toshio; Lin, King-Chuen; Lombardi, Andrea; Palazzetti, Federico; Aquilanti, Vincenzo

    2014-02-21

    The exploration of alternative roads that open to molecules with sufficient energy to yield different products permits prediction and eventually control of the outcomes of chemical reactions. Advanced imaging techniques for monitoring laser-induced photodissociation are here combined with dynamical simulations, involving ample sets of classical trajectories generated on a quantum chemical potential energy surface. Methyl formate, HCOOCH3, is photodissociated at energies near the triple fragmentation threshold into H, CO and OCH3. Images of velocity and rotational distributions of CO exhibit signatures of alternative routes, such as those recently designated as transition-state vs. roaming-mediated. Furthermore, a demonstration of the triple fragmentation route is given, and also confirmed by H-atom product imaging and FTIR time-resolved spectra of the intermediate HCO radical. In addition, the relevance of nonadiabatic transitions promoted by a conical intersection is clarified by simulations as the privileged "reactivity funnel" of organic photochemistry, whereby the outcomes of molecular photoexcitation are delivered to electronic ground states.

  11. The effects of social status on biological aging as measured by white-blood-cell telomere length.

    Science.gov (United States)

    Cherkas, L F; Aviv, A; Valdes, A M; Hunkin, J L; Gardner, J P; Surdulescu, G L; Kimura, M; Spector, T D

    2006-10-01

    Low socio-economic status (SES) is associated with a shortened life expectancy, but its effect on aging is unknown. The rate of white-blood-cell (WBC) telomere attrition may be a biological indicator of human aging. We tested the hypothesis that SES is associated with telomere attrition independent of known risk factors influencing the aging process. We studied 1552 female twins. A venous blood sample was taken from each twin and isolated WBCs used for extraction of DNA. Terminal restriction fragment length (TRFL) was measured. Questionnaire data were collected on occupation, education, income, smoking, exercise, height and weight. Standard multiple linear regression and multivariate analyses of variance tested for associations between SES and TRFL, adjusting for covariates. A discordant twin analysis was conducted on a subset to verify findings. WBC telomere length was highly variable but significantly shorter in lower SES groups. The mean difference in TRFL between nonmanual and manual SES groups was 163.2 base pairs (bp) of which 22.9 bp (approximately 14%) was accounted for by body mass index, smoking and exercise. Comparison of TRFL in the 17 most discordant SES twin pairs confirmed this difference. Low SES, in addition to the harmful effects of smoking, obesity and lack of exercise, appears to have an impact on telomere length.

  12. T-cell receptor V sub. alpha. and C sub. alpha. alleles associated with multiple sclerosis and myasthenia gravis

    Energy Technology Data Exchange (ETDEWEB)

    Oksenberg, J.R.; Cavalli-Sforza, L.L.; Steinman, L. (Stanford Univ., CA (USA)); Sherritt, M.; Bernard, C.C. (LaTrobe Univ., Victoria (Australia)); Begovich, A.B.; Erlich, H.A. (Cetus Corporation, Emeryville, CA (USA))

    1989-02-01

    Polymorphic markers in genes encoding the {alpha} chain of the human T-cell receptor (TcR) have been detected by Southern blot analysis in Pss I digests. Polymorphic bands were observed at 6.3 and 2.0 kilobases (kb) with frequencies of 0.30 and 0.44, respectively, in the general population. Using the polymerase chain reaction (PCR) method, the authors amplified selected sequences derived from the full-length TcR {alpha} cDNA probe. These PcR products were used as specific probes to demonstrate that the 6.3-kb polymorphic fragment hybridizes to the variable (V)-region probe and the 2.0-kb fragment hybridizes to the constant (C)-region probe. Segregation of the polymorphic bands was analyzed in family studies. To look for associations between these markers and autoimmune diseases, the authors have studied the restriction fragment length polymorphism distribution of the Pss I markers in patients with multiple sclerosis, myasthenia gravis, and Graves disease. Significant differences in the frequency of the polymorphic V{sub {alpha}} and C{sub {alpha}} markers were identified between patients and healthy individuals.

  13. T-cell receptor Vα and Cα alleles associated with multiple sclerosis and myasthenia gravis

    International Nuclear Information System (INIS)

    Oksenberg, J.R.; Cavalli-Sforza, L.L.; Steinman, L.; Sherritt, M.; Bernard, C.C.; Begovich, A.B.; Erlich, H.A.

    1989-01-01

    Polymorphic markers in genes encoding the α chain of the human T-cell receptor (TcR) have been detected by Southern blot analysis in Pss I digests. Polymorphic bands were observed at 6.3 and 2.0 kilobases (kb) with frequencies of 0.30 and 0.44, respectively, in the general population. Using the polymerase chain reaction (PCR) method, the authors amplified selected sequences derived from the full-length TcR α cDNA probe. These PcR products were used as specific probes to demonstrate that the 6.3-kb polymorphic fragment hybridizes to the variable (V)-region probe and the 2.0-kb fragment hybridizes to the constant (C)-region probe. Segregation of the polymorphic bands was analyzed in family studies. To look for associations between these markers and autoimmune diseases, the authors have studied the restriction fragment length polymorphism distribution of the Pss I markers in patients with multiple sclerosis, myasthenia gravis, and Graves disease. Significant differences in the frequency of the polymorphic V α and C α markers were identified between patients and healthy individuals

  14. Gene Flow of a Forest-Dependent Bird across a Fragmented Landscape.

    Directory of Open Access Journals (Sweden)

    Rachael V Adams

    Full Text Available Habitat loss and fragmentation can affect the persistence of populations by reducing connectivity and restricting the ability of individuals to disperse across landscapes. Dispersal corridors promote population connectivity and therefore play important roles in maintaining gene flow in natural populations inhabiting fragmented landscapes. In the prairies, forests are restricted to riparian areas along river systems which act as important dispersal corridors for forest dependent species across large expanses of unsuitable grassland habitat. However, natural and anthropogenic barriers within riparian systems have fragmented these forested habitats. In this study, we used microsatellite markers to assess the fine-scale genetic structure of a forest-dependent species, the black-capped chickadee (Poecile atricapillus, along 10 different river systems in Southern Alberta. Using a landscape genetic approach, landscape features (e.g., land cover were found to have a significant effect on patterns of genetic differentiation. Populations are genetically structured as a result of natural breaks in continuous habitat at small spatial scales, but the artificial barriers we tested do not appear to restrict gene flow. Dispersal between rivers is impeded by grasslands, evident from isolation of nearby populations (~ 50 km apart, but also within river systems by large treeless canyons (>100 km. Significant population genetic differentiation within some rivers corresponded with zones of different cottonwood (riparian poplar tree species and their hybrids. This study illustrates the importance of considering the impacts of habitat fragmentation at small spatial scales as well as other ecological processes to gain a better understanding of how organisms respond to their environmental connectivity. Here, even in a common and widespread songbird with high dispersal potential, small breaks in continuous habitats strongly influenced the spatial patterns of genetic

  15. CYP3A4*18: it is not rare allele in Japanese population.

    Science.gov (United States)

    Yamamoto, Takehito; Nagafuchi, Nobue; Ozeki, Takeshi; Kubota, Takahiro; Ishikawa, Hiroshi; Ogawa, Seishi; Yamada, Yasuhiko; Hirai, Hisamaru; Iga, Tatsuji

    2003-01-01

    We sequenced all 13 exons of the CYP3A4 gene derived from 48 Japanese subjects. One subject possess the 20070 T>C mutation in the exon 10 (result in leu293Pro substitution, namely CYP3A4(*)18), as heterozygote. Thus, we investigated the frequency of CYP3A4(*)18 in 118 Japanese population using polymerase chain reaction-restriction fragment length polymorphism with Msp I and determined that the frequency of the CYP3A4(*)18 allele was 1.3%.

  16. Statistical emission of complex fragments from highly excited compound nucleus

    International Nuclear Information System (INIS)

    Matsuse, T.

    1991-01-01

    A full statistical analysis has been given in terms of the Extended Hauser-Feshbach method. The charge and kinetic energy distributions of 35 Cl+ 12 C reaction at E lab = 180, 200 MeV and 23 Na+ 24 Mg reaction at E lab = 89 MeV which form the 47 V compound nucleus are investigated as a prototype of the light mass system. The measured kinetic energy distributions of the complex fragments are shown to be well reproduced by the Extended Hauser-Feshbach method, so the observed complex fragment production is understood as the statistical binary decay from the compound nucleus induced by heavy-ion reaction. Next, this method is applied to the study of the complex production from the 111 In compound nucleus which is formed by the 84 Kr+ 27 Al reaction at E lab = 890 MeV. (K.A.) 18 refs., 10 figs

  17. Sleep restriction and degraded reaction-time performance in Figaro solo sailing races.

    Science.gov (United States)

    Hurdiel, Rémy; Van Dongen, Hans P A; Aron, Christophe; McCauley, Peter; Jacolot, Laure; Theunynck, Denis

    2014-01-01

    In solo offshore sailing races like those of the Solitaire du Figaro, sleep must be obtained in multiple short bouts to maintain competitive performance and safety. Little is known about the amount of sleep restriction experienced at sea and the effects that fatigue from sleep loss have on sailors' performance. Therefore, we assessed sleep in sailors of yachts in the Figaro 2 Beneteau class during races and compared response times on a serial simple reaction-time test before and after races. Twelve men (professional sailors) recorded their sleep and measured their response times during one of the three single-handed races of 150, 300 and 350 nautical miles (nominally 24-50 h in duration). Total estimated sleep duration at sea indicated considerable sleep insufficiency. Response times were slower after races than before. The results suggest that professional sailors incur severe sleep loss and demonstrate marked performance impairment when competing in one- to two-day solo sailing races. Competitive performance could be improved by actively managing sleep during solo offshore sailing races.

  18. In-beam {gamma}-ray spectroscopy of two-step fragmentation reactions at relativistic energies. The case of {sup 36}Ca

    Energy Technology Data Exchange (ETDEWEB)

    Doornenbal, P.

    2007-10-23

    A two-step fragmentation experiment has been performed at GSI with the RISING setup. It combines the fragment separator FRS, which allows for the production of radioactive heavy ions at relativistic energies, with a high resolution {gamma}-spectrometer. This combination offers unique possibilities for nuclear structure investigations like the test of shell model predictions far from stability. Within the present work the question if the N=14(16) shell stabilisation in Z=8 oxygen isotopes and the N=20 shell quenching in {sup 32}Mg are symmetric with respect to the isospin projection quantum number Tz has been addressed. New {gamma}-ray decays were found in the neutron deficient {sup 36}Ca and {sup 36}K by impinging a radioactive ion beam of {sup 37}Ca on a secondary {sup 9}Be target. The fragmentation products were selected with the calorimeter telescope CATE and the emitted {gamma}-rays were measured with Ge Cluster, MINIBALL, and BaF{sub 2} HECTOR detectors. For {sup 36}Ca the 2{sub 1}{sup +}{yields}0{sub g.s.}{sup +} transition energy was determined to be 3015(16) keV, which is the heaviest T=2 nucleus from which {gamma}-spectroscopic information has been obtained so far. A comparison between the experimental 2{sub 1}{sup +} energies of {sup 36}Ca and its mirror nucleus {sup 36}S yielded a mirror energy difference of {delta}E{sub M}=-276(16) keV. In order to understand the large {delta}E{sub M} value, the experimental single-particle energies from the A=17, T=1/2 mirror nuclei were taken and applied onto modified isospin symmetric USD interactions in shell model calculations. These calculations were in agreement with the experimental result and showed that the experimental single-particle energies may account empirically for the one body part of Thomas-Ehrman and/or Coulomb effects. A method to extract the lifetime of excited states in fragmentation reactions was investigated. Therefore, the dependence between the lifetime of an excited state and the average de

  19. Possible influence of the Kuramoto length in a photo-catalytic water splitting reaction revealed by Poisson-Nernst-Planck equations involving ionization in a weak electrolyte

    Science.gov (United States)

    Suzuki, Yohichi; Seki, Kazuhiko

    2018-03-01

    We studied ion concentration profiles and the charge density gradient caused by electrode reactions in weak electrolytes by using the Poisson-Nernst-Planck equations without assuming charge neutrality. In weak electrolytes, only a small fraction of molecules is ionized in bulk. Ion concentration profiles depend on not only ion transport but also the ionization of molecules. We considered the ionization of molecules and ion association in weak electrolytes and obtained analytical expressions for ion densities, electrostatic potential profiles, and ion currents. We found the case that the total ion density gradient was given by the Kuramoto length which characterized the distance over which an ion diffuses before association. The charge density gradient is characterized by the Debye length for 1:1 weak electrolytes. We discuss the role of these length scales for efficient water splitting reactions using photo-electrocatalytic electrodes.

  20. Apparent genetic difference between hypothyroid patients with blocking-type thyrotropin receptor antibody and those without, as shown by restriction fragement length polymorphism analyses of HLA-DP loci

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, Daisuke; Sugawa, Hideo; Akamizu, Takashi; Mori, Toru (Kyoto Univ. School of Medicine, Kyoto (Japan)); Sato, Kaoru; Inoko, Hidetoshi; Tsuji, Kimiyoshi (Tokai Univ. School of Medicine, Kanagawa (Japan)); Maeda, Masahiro (Nichirei Corp., Tokyo (Japan))

    1993-09-01

    HLA types in Japanese patients with primary hypothyroidism were analyzed to see whether those with blocking-type TSH receptor antibody (TSH-R BAb M) differed genetically from those with idiopathic myxedema (IM). HLA typings of -A, -B, -C, -DR, and -DQ (73 antigens) were performed serologically, and those of -D and -DP (29 antigens) were analyzed by the restriction fragment length polymorphism method. Thirty patients were studied with TSH-R BAb M, and 28 with IM. The data were analyzed and compared with previous results from 88 Graves' patients, 46 Hashimoto patients, and 186 control subjects. Overall, 192 patients with 4 autoimmune thyroid disorders showed a decrease in -Aw19 and an increase in -DQw4 (corrected P < 0.05) and significant associations of -Aw33, -Bw46, -Cw3, -DRw8, -DR9, and -DQw3. In TSH-R BAb M patients, increases in -B35, -Bw60, and -Dw8 and decreases in -DR4 and -DPw2 were seen, whereas IM patients showed increased -DPw2, -Bw61, and -Dw23. In comparisons between TSH-R-BAb M and IM, the difference in -DPw2 was highly significant. HLA-B35 differed significantly in these 2 types of hypothyroidism. In conclusion, TSH-R BAb M patients have decreased frequency of -DPw2 and are genetically similar to Graves' disease, whereas IM patients are characterized by high frequency of -DPw2 and are genetically similar to Hashimoto's thyroiditis. 39 refs., 2 figs., 3 tabs.

  1. De novo analysis of electron impact mass spectra using fragmentation trees

    International Nuclear Information System (INIS)

    Hufsky, Franziska; Rempt, Martin; Rasche, Florian; Pohnert, Georg; Böcker, Sebastian

    2012-01-01

    Highlights: ► We present a method for de novo analysis of accurate mass EI mass spectra of small molecules. ► This method identifies the molecular ion and thus the molecular formula where the molecular ion is present in the spectrum. ► Fragmentation trees are constructed by automated signal extraction and evaluation. ► These trees explain relevant fragmentation reactions. ► This method will be very helpful in the automated analysis of unknown metabolites. - Abstract: The automated fragmentation analysis of high resolution EI mass spectra based on a fragmentation tree algorithm is introduced. Fragmentation trees are constructed from EI spectra by automated signal extraction and evaluation. These trees explain relevant fragmentation reactions and assign molecular formulas to fragments. The method enables the identification of the molecular ion and the molecular formula of a metabolite if the molecular ion is present in the spectrum. These identifications are independent of existing library knowledge and, thus, support assignment and structural elucidation of unknown compounds. The method works even if the molecular ion is of very low abundance or hidden under contaminants with higher masses. We apply the algorithm to a selection of 50 derivatized and underivatized metabolites and demonstrate that in 78% of cases the molecular ion can be correctly assigned. The automatically constructed fragmentation trees correspond very well to published mechanisms and allow the assignment of specific relevant fragments and fragmentation pathways even in the most complex EI-spectra in our dataset. This method will be very helpful in the automated analysis of metabolites that are not included in common libraries and it thus has the potential to support the explorative character of metabolomics studies.

  2. Calpastatin ( CAST ) gene polymorphism in Kajli, Lohi and Thalli ...

    African Journals Online (AJOL)

    Restriction fragment length polymorphisms (RFLPs) in the amplified fragments were studied using Msp1 restriction enzyme. Frequencies of MM, MN and NN genotypes were found to be 77, 20 and 3% in Lohi breed and 68, 26 and 6% in Kajli breed respectively. In Thalli sheep, only the MM (80%) and MN (20%) genotypes ...

  3. Direct Reactions for Nuclear Structure and Nuclear Astrophysics

    Energy Technology Data Exchange (ETDEWEB)

    Jones, Katherine Louise [Univ. of Tennessee, Knoxville, TN (United States). Experimental Low-Energy Nuclear Physics Group

    2014-12-18

    Direct reactions are powerful probes for studying the atomic nucleus. Modern direct reaction studies are illuminating both the fundamental nature of the nucleus and its role in nucleosynthetic processes occurring in the cosmos. This report covers experiments using knockout reactions on neutron-deficient fragmentation beams, transfer reactions on fission fragment beams, and theoretical sensitivity studies relating to the astrophysical r-process. Results from experiments on 108,106Sn at the NSCL, and on 131Sn at HRIBF are presented as well as the results from the nucleosynthesis study.

  4. Direct reactions for nuclear structure and nuclear astrophysics

    International Nuclear Information System (INIS)

    Jones, Katherine Louise

    2014-01-01

    Direct reactions are powerful probes for studying the atomic nucleus. Modern direct reaction studies are illuminating both the fundamental nature of the nucleus and its role in nucleosynthetic processes occurring in the cosmos. This report covers experiments using knockout reactions on neutron-deficient fragmentation beams, transfer reactions on fission fragment beams, and theoretical sensitivity studies relating to the astrophysical r-process. Results from experiments on 108,106 Sn at the NSCL, and on 131 Sn at HRIBF are presented as well as the results from the nucleosynthesis study.

  5. Domino reactions initiated by intramolecular hydride transfers from tri(di)arylmethane fragments to ketenimine and carbodiimide functions.

    Science.gov (United States)

    Alajarin, Mateo; Bonillo, Baltasar; Ortin, Maria-Mar; Sanchez-Andrada, Pilar; Vidal, Angel; Orenes, Raul-Angel

    2010-10-21

    The ability of triarylmethane and diarylmethane fragments to behave as hydride donors participating in thermal [1,5]-H shift/6π-ERC tandem processes involving ketenimine and carbodiimide functions is disclosed. C-Alkyl-C-phenyl ketenimines N-substituted by a triarylmethane substructure convert into a variety of 3,3,4,4-tetrasubstituted-3,4-dihydroquinolines, as structurally related carbodiimides transform into 3,4,4-trisubstituted-3,4-dihydroquinazolines via transient ortho-azaxylylenes. The first step of these one-pot conversions, the [1,5]-H shift, is considered to be a hydride migration on the basis of the known hydricity of the tri(di)arylmethane fragment and the electrophilicity of the central heterocumulenic carbon atom, whereas the final electrocyclization involves the formation of a sterically congested C-C or C-N bond. In the cases of C,C-diphenyl substituted triarylmethane-ketenimines the usual 6π-ERC becomes prohibited by the presence of two phenyl rings at each end of the azatrienic system. This situation opens new reaction channels: (a) following the initial hydride shift, the tandem sequence continues with an alternative electrocyclization mode to give 9,10-dihydroacridines, (b) the full sequence is initiated by a rare 1,5 migration of an electron-rich aryl group, followed by a 6π-ERC which leads to 2-aryl-3,4-dihydroquinolines, or (c) a different [1,5]-H shift/6π-ERC sequence involving the initial migration of a hydrogen atom from a methyl group at the ortho position to the nitrogen atom of the ketenimine function. Diarylmethane-ketenimines bearing a methyl group at the benzylic carbon atom experience a tandem double [1,5]-H shift, the first one being the usual benzylic hydride transfer whereas the second one involves the methyl group at the initial benzylic carbon atom, the reaction products being 2-aminostyrenes. Diarylmethane-ketenimines lacking such a methyl group convert into 3,4-dihydroquinolines by the habitual tandem [1,5]-H shift/6

  6. Experimental studies on the heavy quark fragmentation functions

    International Nuclear Information System (INIS)

    Bethke, S.

    1985-07-01

    The influence of perturbative QCD gluon radiation and initial state photon radiation on the experimental determination of the heavy quark fragmentation functions is studied in order to extract , the mean of the charm fragmentation function, from the recent measurements of inclusive Dsup(*) production in e + e - annihilation processes. The result is =0.71+-0.014+-0.03, which is scale invariant in the c.m. energy range of 10 GeV to 34 GeV. This result is interpreted in terms of kinematical calculations on heavy quark fragmentation and also compared with results from ν-N-reactions and from investigations of inclusive lepton production in e + e - annihilation. Results of a QCD shower model are in good agreement with the data and offer an alternative description of phenomenological fragmentation functions. (orig.)

  7. Changes in bacterial community structure in the colon of pigs fed different experimental diets and after infection with Brachyspira hyodysenteriae

    DEFF Research Database (Denmark)

    Leser, Thomas D.; Lindecrona, Rikke Hvid; Jensen, Tim Kåre

    2000-01-01

    Bacterial communities in the large intestines of pigs were compared using terminal restriction fragment length polymorphism (T-RFLP) analysis targeting the 16S ribosomal DNA. The pigs were fed different experimental diets based on either modified standard feed or cooked rice supplemented with die......Bacterial communities in the large intestines of pigs were compared using terminal restriction fragment length polymorphism (T-RFLP) analysis targeting the 16S ribosomal DNA. The pigs were fed different experimental diets based on either modified standard feed or cooked rice supplemented...

  8. Overexpression of stress-related genes in Cuscuta campestris in response to host defense reactions

    Directory of Open Access Journals (Sweden)

    Hamed Rezaei

    2017-07-01

    Full Text Available Herb dodder ( Cuscuta spp. is one of the most important parasitic plants that can severely affect crop yields in the world. So far, interactions of this parasitic plant with hosts were not investigated adequately. Here, we conducted a differential expression analyzes and identified a number of genes that were differentially expressed in haustorium tissue compared with the stem of Cuscuta campestris growing on Alfalfa. We obtained 439 cDNA fragments from haustoria (parasite-host connection zone and stems (25 cm away from connections zones using the cDNA-AFLP (Amplified Fragment Length Polymorphism method with eight different primer combinations. Of 439 transcript-derived fragments (TDFs that were detected, 145 fragments were identified as differentially expressed genes. Five TDF sequences were similar to known functional genes involved in signal transduction, metabolism, respiration, and stress responses. Genes encoding DEAD-box ATP-dependent RNA helicase, potential heme-binding protein, lysine-specific demethylase 5A were selected for qRT-PCR. The qRT-PCR analyzes confirmed the results obtained using cDNA-AFLP. Our findings shed light on the elicitation of dodder defense responses in the connection zone to overcome plant defense reactions.

  9. Does the range of IMF affect rise and fall trend in fragmentation?

    Science.gov (United States)

    Sharma, Sakshi; Kumar, Rohit; Puri, Rajeev K.

    2018-05-01

    We study the rise and fall behavior in the multiplicity of intermediate mass fragments produced in the asymmetric reactions of 36S+ 198Pt using isospin-dependent quantum molecular dynamics model. We use different definitions of intermediate mass fragments according to various experimental studies. We find that the use of one or the other definition of intermediate mass fragments does not alter results significantly.

  10. Kinematics of current region fragmentation in semi-inclusive deeply inelastic scattering

    Energy Technology Data Exchange (ETDEWEB)

    Boglione, M., E-mail: elena.boglione@to.infn.it [Dipartimento di Fisica, Università di Torino, INFN - Sezione Torino, Via P. Giuria 1, 10125 Torino (Italy); Collins, J., E-mail: jcc8@psu.edu [Department of Physics, Penn State University, University Park, PA 16802 (United States); Gamberg, L., E-mail: lpg10@psu.edu [Science Division, Penn State University Berks, Reading, PA 19610 (United States); Gonzalez-Hernandez, J.O., E-mail: jogh@jlab.org [Department of Physics, Old Dominion University, Norfolk, VA 23529 (United States); Theory Center, Jefferson Lab, 12000 Jefferson Avenue, Newport News, VA 23606 (United States); Rogers, T.C., E-mail: trogers@odu.edu [Department of Physics, Old Dominion University, Norfolk, VA 23529 (United States); Theory Center, Jefferson Lab, 12000 Jefferson Avenue, Newport News, VA 23606 (United States); Sato, N., E-mail: nsato@jlab.org [Theory Center, Jefferson Lab, 12000 Jefferson Avenue, Newport News, VA 23606 (United States)

    2017-03-10

    Different kinematical regions of semi-inclusive deeply inelastic scattering (SIDIS) processes correspond to different underlying partonic pictures, and it is important to understand the transition between them. We find criteria in semi-inclusive deeply inelastic scattering (SIDIS) for identifying the current fragmentation region — the kinematical region where a factorization picture with fragmentation functions is appropriate, especially for studies of transverse-momentum-dependent (TMD) functions. This region is distinguished from the central (soft) and target fragmentation regions. The basis of our argument is in the errors in approximations used in deriving factorization. As compared with previous work, we show that it is essential to take account of the transverse momentum of the detected hadron, and we find a much more restricted range for genuine current fragmentation. We show that it is important to develop an extended factorization formulation to treat hadronization in the central region, as well as the current and target fragmentation regions, and to obtain a unified formalism spanning all rapidities for the detected hadron.

  11. Inclusive breakup of three-fragment weakly bound nuclei

    International Nuclear Information System (INIS)

    Carlson, B.V.; Frederico, T.; Hussein, M.S.

    2017-01-01

    The inclusive breakup of three-fragment projectiles is discussed within a four-body spectator model. Both the elastic breakup and the non-elastic breakup are obtained in a unified framework. Originally developed in the 80's for two-fragment projectiles such as the deuteron, in this paper the theory is successfully generalized to three-fragment projectiles. The expression obtained for the inclusive cross section allows the extraction of the incomplete fusion cross section, and accordingly generalizes the surrogate method to cases such as (t, p) and (t, n) reactions. It is found that two-fragment correlations inside the projectile affect in a conspicuous way the elastic breakup cross section. The inclusive non-elastic breakup cross section is calculated and is found to contain the contribution of a three-body absorption term that is also strongly influenced by the two-fragment correlations. This latter cross section contains the so-called incomplete fusion where more than one compound nuclei are formed. Our theory describes both stable weakly bound three-fragment projectiles and unstable ones such as the Borromean nuclei.

  12. Inclusive breakup of three-fragment weakly bound nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Carlson, B.V.; Frederico, T. [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Hussein, M.S., E-mail: hussein@if.usp.br [Instituto Tecnológico de Aeronáutica, DCTA, 12.228-900 São José dos Campos, SP (Brazil); Instituto de Estudos Avançados, Universidade de São Paulo, C.P. 72012, 05508-970 São Paulo, SP (Brazil); Instituto de Física, Universidade de São Paulo, C.P. 66318, 05314-970 São Paulo, SP (Brazil)

    2017-04-10

    The inclusive breakup of three-fragment projectiles is discussed within a four-body spectator model. Both the elastic breakup and the non-elastic breakup are obtained in a unified framework. Originally developed in the 80's for two-fragment projectiles such as the deuteron, in this paper the theory is successfully generalized to three-fragment projectiles. The expression obtained for the inclusive cross section allows the extraction of the incomplete fusion cross section, and accordingly generalizes the surrogate method to cases such as (t, p) and (t, n) reactions. It is found that two-fragment correlations inside the projectile affect in a conspicuous way the elastic breakup cross section. The inclusive non-elastic breakup cross section is calculated and is found to contain the contribution of a three-body absorption term that is also strongly influenced by the two-fragment correlations. This latter cross section contains the so-called incomplete fusion where more than one compound nuclei are formed. Our theory describes both stable weakly bound three-fragment projectiles and unstable ones such as the Borromean nuclei.

  13. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  14. Interplay between inhibited transport and reaction in nanoporous materials

    Energy Technology Data Exchange (ETDEWEB)

    Ackerman, David Michael [Iowa State Univ., Ames, IA (United States)

    2013-01-01

    This work presents a detailed formulation of reaction and diffusion dynamics of molecules in confined pores such as mesoporous silica and zeolites. A general reaction-diffusion model and discrete Monte Carlo simulations are presented. Both transient and steady state behavior is covered. Failure of previous mean-field models for these systems is explained and discussed. A coarse-grained, generalized hydrodynamic model is developed that accurately captures the interplay between reaction and restricted transport in these systems. This method incorporates the non-uniform chemical diffusion behavior present in finite pores with multi-component diffusion. Two methods of calculating these diffusion values are developed: a random walk based approach and a driven diffusion model based on an extension of Fick's law. The effects of reaction, diffusion, pore length, and catalytic site distribution are investigated. In addition to strictly single file motion, quasi-single file diffusion is incorporated into the model to match a range of experimental systems. The connection between these experimental systems and model parameters is made through Langevin dynamics modeling of particles in confined pores.

  15. Global patterns of fragmentation and connectivity of mammalian carnivore habitat.

    Science.gov (United States)

    Crooks, Kevin R; Burdett, Christopher L; Theobald, David M; Rondinini, Carlo; Boitani, Luigi

    2011-09-27

    Although mammalian carnivores are vulnerable to habitat fragmentation and require landscape connectivity, their global patterns of fragmentation and connectivity have not been examined. We use recently developed high-resolution habitat suitability models to conduct comparative analyses and to identify global hotspots of fragmentation and connectivity for the world's terrestrial carnivores. Species with less fragmentation (i.e. more interior high-quality habitat) had larger geographical ranges, a greater proportion of habitat within their range, greater habitat connectivity and a lower risk of extinction. Species with higher connectivity (i.e. less habitat isolation) also had a greater proportion of high-quality habitat, but had smaller, not larger, ranges, probably reflecting shorter distances between habitat patches for species with restricted distributions; such species were also more threatened, as would be expected given the negative relationship between range size and extinction risk. Fragmentation and connectivity did not differ among Carnivora families, and body mass was associated with connectivity but not fragmentation. On average, only 54.3 per cent of a species' geographical range comprised high-quality habitat, and more troubling, only 5.2 per cent of the range comprised such habitat within protected areas. Identification of global hotspots of fragmentation and connectivity will help guide strategic priorities for carnivore conservation.

  16. Nucleus fragmentation induced by a high-energy hadron

    International Nuclear Information System (INIS)

    Zielinski, P.

    1982-10-01

    The author presents a review about the spallation in hadron reactions. Especially he considers proton-proton correlations at low relative momentum, angular distributions of 30-100 MeV protons, emission of fast deuterons, the vanishing of the Coulomb barrier, fission-like processes, the rise of the heavy fragment yield with energy transfer, proton-deuteron breakup reactions, and the backward emission of fast protons. (HSI)

  17. Critical Features of Fragment Libraries for Protein Structure Prediction.

    Science.gov (United States)

    Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel

    2017-01-01

    The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.

  18. Analysis of the first and second internal transcribed spacer sequences of the ribosomal DNA in Biomphalaria tenagophila complex (Mollusca: Planorbidae

    Directory of Open Access Journals (Sweden)

    Teofânia HDA Vidigal

    2004-03-01

    Full Text Available The first and second internal transcribed spacer regions (ITS1 and ITS2 of the ribosomal DNA of Biomphalaria tenagophila complex (B. tenagophila, B. occidentalis, and B. t. guaibensis were sequenced and compared. The alignment lengths of these regions were about 655 bp and 481 bp, respectively. Phylogenetic relationships among the Biomphalaria species were inferred by Maximum Parsimony and Neighbor-joining methods. The phylogenetic trees produced, in most of the cases, were in accordance with morphological systematics and other molecular data previously obtained by polymerase chain reaction and restriction fragment length polymorphism analysis. The present results provide support for the proposal that B. tenagophila represents a complex comprising B. tenagophila, B. occidentalis and B. t. guaibensis.

  19. Intermittency in {sup 197}Au fragmentation

    Energy Technology Data Exchange (ETDEWEB)

    Dabrowska, A; Holynski, R; Olszewski, A; Szarska, M; Wilczynska, B; Wolter, W; Wosiek, B [Institute of Nuclear Physics, Cracow (Poland); Cherry, M L; Deines-Jones, P; Jones, W V; Sengupta, K; Wefel, B [Louisiana State Univ., Baton Rouge, LA (United States). Dept. of Physics and Astronomy; Waddington, C J [Minnesota Univ., Minneapolis, MN (United States). School of Physics and Astronomy; Pozharova, E A; Skorodko, T Yu [Inst. of Theoretical and Experimental Physics, Moscow (Russian Federation); KLMM Collaboration

    1995-07-01

    The concept of factorial moments was applied to an analysis of the dynamical fluctuations in the charge distributions of the fragments emitted from gold nuclei with energies 10.6 and < 1.0 GeV/n interacting with emulsion nuclei. Clear evidence for intermittent fluctuations has been found in an analysis using all the particles released from the gold projectile, with a stronger effect observed below 1 GeV/n than at 10.6 GeV/n. For the full data sets, however, the intermittency effect was found to be very sensitive to the singly charged particles, and neglecting these particles strongly reduces the intermittency signal. When the analysis is restricted to the multiply charged fragments, an intermittency effect is revealed only for multifragmentation events, although one that is enhanced as compared to the analysis of all, singly and multiply charged, particles. The properties of the anomalous fractal dimensions suggest a sequential decay mechanism, rather than the existence of possible critical behaviour in the process of nuclear fragmentation. The likely influence of the charge conservation effects and the finite size of decaying systems on the observed intermittency signals was pointed out. (author). 37 refs, 9 figs, 5 tabs.

  20. Cloning, sequencing and variability analysis of the gap gene from Mycoplasma hominis

    DEFF Research Database (Denmark)

    Mygind, Tina; Jacobsen, Iben Søgaard; Melkova, Renata

    2000-01-01

    The gap gene encodes the glycolytic enzyme glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The gene was cloned and sequenced from the Mycoplasma hominis type strain PG21(T). The intraspecies variability was investigated by inspection of restriction fragment length polymorphism (RFLP) patterns...... after polymerase chain reaction (PCR) amplification of the gap gene from 15 strains and furthermore by sequencing of part of the gene in eight strains. The M. hominis gap gene was found to vary more than the Escherichia coli counterpart, but the variation at nucleotide level gave rise to only a few...